1460

Regular Article

Biol. Pharm. Bull. 36(9) 14601465 (2013)

Vol. 36, No. 9

Highlighted Paper selected by Editor-in-Chief

Selective Androgen Receptor Modulator, YK11, Regulates Myogenic

Differentiation of C2C12 Myoblasts by Follistatin Expression
Yuichiro Kanno,* Rumi Ota, Kousuke Someya, Taichi Kusakabe, Keisuke Kato, and
Yoshio Inouye
Faculty of Pharmaceutical Sciences, Toho University; 221 Miyama, Funabashi, Chiba 2748510, Japan.
Received March 20, 2013; accepted June 19, 2013
The myogenic differentiation of C2C12 myoblast cells is induced by the novel androgen receptor (AR)
partial agonist, (17,20E)-17,20-[(1-methoxyethylidene)bis-(oxy)]-3-oxo-19-norpregna-4,20-diene-21-carboxylic acid methyl ester (YK11), as well as by dihydrotestosterone (DHT). YK11 is a selective androgen receptor modulator (SARM), which activates AR without the N/C interaction. In this study, we further investigated the mechanism by which YK11 induces myogenic differentiation of C2C12 cells. The induction
of key myogenic regulatory factors (MRFs), such as myogenic differentiation factor (MyoD), myogenic factor
5 (Myf5) and myogenin, was more signicant in the presence of YK11 than in the presence of DHT. YK11
treatment of C2C12 cells, but not DHT, induced the expression of follistatin (Fst), and the YK11-mediated
myogenic differentiation was reversed by anti-Fst antibody. These results suggest that the induction of Fst is
important for the anabolic effect of YK11.
Key words

androgen receptor; selective androgen receptor modulator; C2C12 cell; follistatin

Androgens such as testosterone and 5--dihydrotestosterone

(DHT) act as agonists of androgen receptor (AR), which is a
member of the nuclear receptor (NR) superfamily of liganddependent transactivation factors. Because androgens show
anabolic effects on skeletal muscles, androgen declining with
age contributes to age-related bone and muscle loss and increase in fat mass.13) Thus, the androgen anabolic effect is
attractive for the maintenance of health. However, besides
anabolic effects, various biological effects, such as development of male reproductive tissues, sexual development and
spermatogenesis (androgenic effects), are mediated by AR.47)
Separation of anabolic effects from androgenic effects is critical for clinical usage of selective androgen receptor modulators (SARMs) in diseases such as sarcopenia, cancer cachexia
and osteoporosis.8,9) However, the detailed mechanism of
selective anabolic action by SARMs in skeletal muscle still
remains unclear.
Structurally characterized by an amino-terminal transactivation domain [NTD/activation function 1 (AF1)], a DNA
binding domain (DBD), and a ligand binding domain (LBD)
including a carboxy-terminal transactivation domain [activation function 2 (AF2)],10,11) AR mediates the expression of
androgen-regulated genes, such as prostate specic antigen
(PSA)1214) and FK506-binding protein 51 (FKBP51).1517)
AR is localized in the cytoplasm, where it forms a complex
with chaperones. Upon ligand binding, AR translocates into
the nucleus. Following nuclear translocation, AR binds as a
homodimer to androgen responsive elements (ARE) in the
promoter regions of its target genes. Full activation of AR
requires physical interaction between the NTD/AF1 and LBD/
AF2 (known as the N/C interaction).1821)
Follistatin (Fst) is essential for muscle ber formation and
growth. It is an extracellular protein that acts as an inhibitory
binding partner of activins and selected transforming growth
factor (TGF-) family members. As the TGF- signaling
cascade inhibits myogenic differentiation, inhibition of TGF-

signaling accelerates myogenic differentiation.

Previously, we have reported the AR partial agonistic
nature of the novel steroidal compound, (17,20E)-17,20[(1-methoxyethylidene) bis-(oxy)]-3-oxo-19-norpregna-4,20diene-21-carboxylic acid methyl ester (YK11), using the
ARE-luciferase assay.22) YK11 did not induce the N/C interaction required for the AR full agonist function and was geneselective in MDA-MB 453 cells. In the present study, we show
the induction of myogenic differentiation of myoblast C2C12
cells by YK11 in comparison with DHT.

MATERIALS AND METHODS

Chemicals YK11 was prepared as previously reported.22)
DHT and hydroxyflutamide (FLU) were obtained from Wako
Pure Chemical Industries, Ltd. (Osaka, Japan) and Toronto
Research Chemicals (Toronto, Canada), respectively. Antifollistatin (Fst) antibody was purchased from GeneTex (San
Antonio, TX, U.S.A.).
Cell Culture Mouse myoblast C2C12 cells were cultured in Dulbeccos modied Eagles medium (DMEM)
supplemented with 10% fetal bovine serum (FBS) at 37C
in a humidied atmosphere with 5% CO2. C2C12 cells were
Table 1.

Primers for the Target Genes (53)

Myogenin
MyoD
Myf5
Follistatin
AR
-Actin

The authors declare no conflict of interest.

 To whom correspondence should be addressed. e-mail: ykanno@phar.toho-u.ac.jp
*

FW
Rev
FW
Rev
FW
Rev
FW
Rev
FW
Rev
FW
Rev

AGCTGTATGAGACATCCCCC
TTCTTGAGCCTGCGCTTCTC
ACTACAGCGGCGACTCCGACGCGTCCAG
GGTGGAGATGCGCTCCACGATGCTGGACAG
AGCATTGTGGATCGGATCACGTCT
CTGGAGGGTCCCGGGGTAGC
AGAGGAAATGTCTGCTTCCG
CACCTCTCTTCAGTCTCCTG
TACCAGCTCACCAAGCTCCT
GATGGGCTTGACTTTCCCAG
TCCTCCTGAGCGCAAGTACTC
CTGCTTGCTGATCCACATCTG
2013 The Pharmaceutical Society of Japan

September 20131461

Fig. 1.

Induction of Myogenic Differentiation by YK11 and DHT

(A) C2C12 cells were treated with YK11 (500 n M), DHT (500 n M) or solvent control (EtOH) in differentiation medium for 2 d. Whole-cell lysates were resolved by SDSPAGE, and proteins were detected by immunoblotting using antibodies against androgen receptor and tubulin as a loading control. (B) C2C12 cells were treated with
YK11 (500 n M), DHT (500 n M) or solvent control (EtOH) in differentiation medium for 7 d. Whole-cell lysates were resolved by SDS-PAGE, and proteins were detected by
immunoblotting using antibodies against myosin heavy chain (MyHC) and tubulin as a loading control. (CH) C2C12 cells were treated with YK11 (CE: 500 n M, FH:
1500 n M), DHT (CE: 500 n M, FH: 1500 n M) or solvent control (EtOH) in differentiation medium for 2 or 4 d. The mRNA expression of Myf5 (C, F), MyoD (D, G) and
myogenin (E, H) was measured by qRT-PCR. The results were normalized against -actin and are expressed as meanS.D. (#, p<0.05 compared with DHT-treated cells;
*, p<0.05 and **, p<0.01 compared with the solvent control; n=3).

seeded on plates and maintained in culture medium for 24 h.

To induce myogenic differentiation, YK11 or DHT in DMEM
supplemented with 2% horse serum (differentiation medium)
was added to the cells on day 0. For the neutralization assay
of Fst (also known as activin-binding protein), C2C12 cells
were maintained in differentiation medium in the presence of
anti-Fst antibody.
Immunoblotting Cells were harvested and lysed in

sodium dodecyl sulfate (SDS) sample buffer containing

125 m M TrisHCI, pH 6.8, 4% SDS, 10% sucrose, 10 m M dithiothreitol and 0.01% bromophenol blue. Whole-cell lysates
were resolved by SDS-polyachylamide gel electrophoresis
(PAGE) and immunoblotting was performed using anti-myosin
heavy chain (MyHC, eBioscience, San Diego, CA, U.S.A.),
anti-androgen receptor (Epitomics, Burlingame, CA, U.S.A.)
and anti-tubulin antibodies (MBL, Nagoya, Japan) as primary

1462

Fig. 2.

Vol. 36, No. 9

Effect of the AR Antagonist, FLU, on the YK11-Induced Upregulation of MRFs (AC)

C2C12 cells were treated with YK11 (500 n M) or solvent control (EtOH) in the presence or absence of FLU (10 M) in differentiation medium for 4 d. The mRNA expression of Myf5 (A), MyoD (B) and myogenin (C) was measured by qRT-PCR. The results were normalized against -actin and are expressed as meanS.D. (*, p<0.05
compared with solvent control or FLU alone; n=3).

antibodies. Horseradish peroxidase-conjugated anti-mouse

or rabbit immunoglobulin G (IgG) antibody (Cell Signaling
Technology, Danvers, MA, U.S.A.) was used as secondary
antibody.
Knockdown Experiments Cells were transfected with
AR small interfering RNA (SASI_Mm01_00027673; SigmaAldrich, St. Louis, MO, U.S.A.) or control siRNA using Lipofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA,
U.S.A.) according to the manufacturers instructions.
Real-Time Quantitative Reverse Transcription-Polymerase Chain Rection (qRT-PCR) Total RNA was isolated
using ISOGEN II (Nippon Gene Co., Ltd., Toyama, Japan).
cDNA was synthesized using the ReverTra Ace qPCR RT
Kit (TOYOBO, Osaka, Japan). qRT-PCR was conducted using
THUNDERBIRD SYBR qPCR Mix (TOYOBO) in a nal
volume of 25 L according to the manufacturers protocol, and
analyzed with the Applied Biosystems 7500 Fast System SDS
software. The primer pairs used are described in Table 1.
Statistical Analysis Statistically signicant differences
were determined using the Students t-test, and differences
were considered statistically signicant at p<0.05.

RESULTS
YK11 and DHT Induce Myogenic Differentiation of
C2C12 Cells Firstly, we examined whether AR is expressed
in C2C12 myoblast cells. AR expression was detected in
C2C12 cells during cell differentiation by immunoblot assay
(Fig. 1A). To investigate the effect of YK11 on C2C12 cells,
the expression of the differentiation marker, myosin heavy
chain (MyHC), was examined. C2C12 cells were cultured with
YK11, DHT or solvent in differentiation medium. The MyHC
protein level on Day 7 was enhanced by both YK11 and DHT
treatments (Fig. 1B), suggesting that like DHT, YK11 can induce myogenic differentiation of C2C12 cells.
YK11 and DHT Upregulate the mRNA Expression of
MRFs Next, we analyzed the mRNA expression of the
MRFs, Myf5, MyoD and myogenin. Cells were treated with
YK11, DHT or solvent, and the expression of Myf5, MyoD
and myogenin was analyzed by qRT-PCR on Day 2 and 4.

Myf5 and myogenin mRNA expression on Day 4 was more

signicantly enhanced by YK11 treatment than by DHT treatment (Figs. 1C, E). Interestingly, upregulation of Myf5 and
myogenin mRNA on Day 4 by YK11 treatment required high
YK11 concentrations (100 n M or 500 n M; Figs. 1FH), whereas
DHT increased the expression of these genes at lower concentrations.
Co-treatment with the AR antagonist, FLU, suppressed this
upregulation, suggesting that YK11-induced MRFs expression
may be mediated by AR (Figs. 2AC).
YK11 Induces Myf5 mRNA Expression via Fst mRNA
Upregulation by AR It has been reported that androgeninduced myogenic differentiation is regulated by Fst, which
stimulates Myf5 expression.23,24) Fst modulates the function of
a number of TGF- family members, such as myostatin, which
is a negative regulator of myogenic differentiation, by directly
binding to them. We speculated that the AR-dependent Fst
induction may be responsible for the functional difference
between YK11 and DHT. To verify this hypothesis, Fst expression was measured on Day 2 and Day 4 after the addition
of YK11 or DHT. Fst mRNA expression was signicantly
induced by YK11 treatment, whereas it was not affected by
DHT treatment (Fig. 3A). The YK11-induced upregulation of
Fst mRNA was signicantly reduced by co-treatment with
FLU, supporting the AR-dependence of the YK11-mediated
upregulation of Fst expression (Fig. 3B). Furthermore, we carried out an AR knockdown experiment. Similarly to the FLU
treatment, the YK11-induced upregulation of Fst mRNA was
signicantly reduced by knockdown of AR (Fig. 3C).
To see whether the YK11-induced Fst upregulation is responsible for the induction of Myf5 mRNA expression, C2C12
cells were treated with YK11 in the presence of neutralizing
anti-Fst antibody for 2 d in differentiation medium. The increase in Myf5 mRNA level induced by YK11 treatment was
abolished when cells were treated with the antibody against
Fst (Fig. 4).

DISCUSSION
In this study, we showed that the AR partial agonist, YK11,

September 20131463

Fig. 3.

YK11-Induced Myogenic Differentiation Is Mediated by Induction of Fst Expression via AR in C2C12 Cells

(A) C2C12 cells were cultured with YK11, DHT (500 n M each) or solvent control (EtOH) in differentiation medium for 2 or 4 d. (**, p<0.01 compared with each solvent
control on Day 2. (B) C2C12 cells were cultured in differentiation medium for 24 h. After 30 min of pretreatment with FLU (10 M), cells were treated with YK11, DHT
(500 n M each) or solvent control (EtOH) for 6 h. (*, p<0.05). (C) C2C12 cells were treated with siRNA against AR or negative control siRNA. After 24 h the medium was
changed to differentiation medium. After another 24 h, cells were treated with YK11 or solvent for an additional 6 h. (**, p<0.01). The mRNA expression of Fst was measured by qRT-PCR. The results were normalized against -actin and are expressed as meanS.D. (n=3).

Fig. 4. Neutralization of Fst Inhibits YK11-Induced Myogenic Differentiation of C2C12 Cells

C2C12 cells were treated with YK11 (500 n M) or solvent control (EtOH) in differentiation medium for 4 d in the presence or absence of anti-Fst antibody. The
mRNA expression of Myf5 was measured by qRT-PCR. The results were normalized against -actin and are expressed as meanS.D. (*, p<0.05; n=3).

induced myogenic differentiation of C2C12 myoblast cells.

Key MRFs such as MyoD, Myf5 and myogenin are known
to be required for myogenic differentiation. MyoD and Myf5
are important for myogenic determination, whereas myogenin
is important for terminal differentiation and lineage maintenance.25) Here, we demonstrated that YK11 signicantly increased the mRNA levels of these MRFs compared with DHT,
an AR full agonist. Based on these ndings, YK11 may be
more potent in inducing myogenic differentiation than DHT.
Recent reports have shown that testosterone treatment upregulates Fst expression and promotes myogenic differentiation in mesenchymal multipotent C3H 10T1/2 cells24) and in
isolated satellite cells.26) We found that the Fst mRNA level
was enhanced by YK11 treatment in C2C12 cells in an ARdependent manner, as this effect was signicantly reduced by

co-treatment with an AR antagonist. The differentiation state

may be involved in the agonist-specic Fst mRNA regulation, as unlike C3H 10T1/2 and isolated satellite cells, which
are poorly differentiated compared with C2C12 cells, we did
not observe a DHT induction of Fst mRNA in C2C12 cells.
Recent reports have suggested that testosterone induces Fst
expression via the non-canonical Wnt signaling.24,26) Testosterone promotes nuclear translocation of the AR/-catenin
complex, which interacts with the Wnt pathway downstream
factor, T-cell factor 4 (TCF-4). The Fst promoter has a TCF
binding site and Fst mRNA is induced by Wnt.27) These reports have shown crosstalk between AR and Wnt signaling,
however the molecular mechanism is not clear. In contrast,
the Wnt3a-induced canonical Wnt signal decreases myogenic
differentiation 28) and promotes osteoblastic differentiation
through upregulation of inhibitor of differentiation-3 (Id3)
in C2C12 cells.29) Using various N/C interaction decient
mutants, it has been shown that the N/C interaction of AR
is important for AR-dependent gene regulation. The N/C interaction contributes to selective gene activation by cofactor
recruitment and chromatin binding.19,30) Previously, we have
shown by ARE-luciferase reporter assay that YK11 acts as a
partial AR agonist without inducing N/C interaction, whereas
DHT strongly induced N/C interaction. In fact, a different
regulation of AR target genes has been observed between
YK11 and DHT treatment in MDA-MB453 cells.22) Furthermore, mutations of AR, which impair the N/C interaction,
were found in incompletely virilized patients with partial
androgen insensitivity.3133) In Fig. 2, a slight upregulation
of MRFs mRNA was observed by treatment of FLU alone.
Since FLU inhibits N/C interaction of AR, FLU may increase
MRFs expression. A recent report has demonstrated that the
SARM, S-101479, which shows low N/C interaction, induced
recruitment of fewer cofactors than DHT.34) This observation
suggests that the difference in Fst mRNA regulation between
YK11 and DHT stems from cofactor recruitment differences.
In conclusion, YK11 induces myogenic differentiation via
AR-dependent induction of Fst expression. Although DHT
did not increase Fst mRNA, both YK11 and DHT elevated
the expression of MyHC protein and MRFs mRNA, implying that DHT enhances myogenic differentiation through an

1464

Fst-independent pathway. In addition to the Fst pathway, YK11

may share this Fst-independent pathway with DHT.
In this report, YK11 was shown to be an appropriate
anabolic SARM. However, further investigation is required to
elucidate the mechanisms of the differential activation of the
Fst pathway by YK11 and DHT.
Acknowledgments This study was partially supported by
the Ministry of Education, Culture, Sports, Science and Technology of Japan, a Grant-in-Aid for Young Scientists (B), and
the Open Research Center Project.

Vol. 36, No. 9

17)

18)

19)

REFERENCES
1) Bhasin S, Tenover JS. Age-associated sarcopeniaissues in the use
of testosterone as an anabolic agent in older men. J. Clin. Endocrinol. Metab., 82, 16591660 (1997).
2) Bhasin S, Storer TW, Berman N, Yarasheski KE, Clevenger B, Phillips J, Lee WP, Bunnell TJ, Casaburi R. Testosterone replacement
increases fat-free mass and muscle size in hypogonadal men. J.
Clin. Endocrinol. Metab., 82, 407413 (1997).
3) Sattler FR, Castaneda-Sceppa C, Binder EF, Schroeder ET, Wang Y,
Bhasin S, Kawakubo M, Stewart Y, Yarasheski KE, Ulloor J, Colletti P, Roubenoff R, Azen SP. Testosterone and growth hormone
improve body composition and muscle performance in older men. J.
Clin. Endocrinol. Metab., 94, 19912001 (2009).
4) Matsumoto T, Takeyama K, Sato T, Kato S. Study of androgen
receptor functions by genetic models. J. Biochem., 138, 105110
(2005).
5) Matsumoto T, Shiina H, Kawano H, Sato T, Kato S. Androgen receptor functions in male and female physiology. J. Steroid Biochem.
Mol. Biol., 109, 236241 (2008).
6) Matsumoto T, Takeyama K, Sato T, Kato S. Androgen receptor
functions from reverse genetic models. J. Steroid Biochem. Mol.
Biol., 85, 9599 (2003).
7) Lee DK, Chang C. Endocrine mechanisms of disease: Expression
and degradation of androgen receptor: mechanism and clinical implication. J. Clin. Endocrinol. Metab., 88, 40434054 (2003).
8) Narayanan R, Mohler ML, Bohl CE, Miller DD, Dalton JT. Selective androgen receptor modulators in preclinical and clinical development. Nucl. Recept. Signal., 6, e010 (2008).
9) Bhasin S, Jasuja R. Selective androgen receptor modulators as function promoting therapies. Curr. Opin. Clin. Nutr. Metab. Care, 12,
232240 (2009).
10) Robinson Rechavi M, Escriva Garcia H, Laudet V. The nuclear receptor superfamily. J. Cell Sci., 116, 585586 (2003).
11) Simental JA, Sar M, Lane MV, French FS, Wilson EM. Transcriptional activation and nuclear targeting signals of the human androgen receptor. J. Biol. Chem., 266, 510518 (1991).
12) Cleutjens KB, van Eekelen CC, van der Korput HA, Brinkmann
AO, Trapman J. Two androgen response regions cooperate in steroid
hormone regulated activity of the prostate-specic antigen promoter. J. Biol. Chem., 271, 63796388 (1996).
13) Henttu P, Liao SS, Vihko P. Androgens up-regulate the human
prostate-specic antigen messenger ribonucleic acid (mRNA), but
down-regulate the prostatic acid phosphatase mRNA in the LNCaP
cell line. Endocrinology, 130, 766772 (1992).
14) Wolf DA, Schulz P, Fittler F. Transcriptional regulation of prostate
kallikrein-like genes by androgen. Mol. Endocrinol., 6, 753762
(1992).
15) Magee JA, Chang LW, Stormo GD, Milbrandt J. Direct, androgen
receptor-mediated regulation of the FKBP5 gene via a distal enhancer element. Endocrinology, 147, 590598 (2006).
16) Makkonen H, Kauhanen M, Paakinaho V, Jaaskelainen T, Palvimo
JJ. Long-range activation of FKBP51 transcription by the andro-

20)

21)

22)

23)

24)

25)

26)

27)

28)

29)

30)

31)

32)

gen receptor via distal intronic enhancers. Nucleic Acids Res., 37,
41354148 (2009).
Febbo PG, Lowenberg M, Thorner AR, Brown M, Loda M, Golub
TR. Androgen mediated regulation and functional implications
of fkbp51 expression in prostate cancer. J. Urol., 173, 17721777
(2005).
Doesburg P, Kuil CW, Berrevoets CA, Steketee K, Faber PW,
Mulder E, Brinkmann AO, Trapman J. Functional in vivo interaction between the amino-terminal, transactivation domain and the
ligand binding domain of the androgen receptor. Biochemistry, 36,
10521064 (1997).
Li J, Fu J, Toumazou C, Yoon HG, Wong J. A role of the aminoterminal (N) and carboxyl-terminal (C) interaction in binding of
androgen receptor to chromatin. Mol. Endocrinol., 20, 776785
(2006).
Schaufele F, Carbonell X, Guerbadot M, Borngraeber S, Chapman MS, Ma AA, Miner JN, Diamond MI. The structural basis
of androgen receptor activation: intramolecular and intermolecular
amino-carboxy interactions. Proc. Natl. Acad. Sci. U.S.A., 102,
98029807 (2005).
He B, Lee LW, Minges JT, Wilson EM. Dependence of selective
gene activation on the androgen receptor NH2- and COOH-terminal
interaction. J. Biol. Chem., 277, 2563125639 (2002).
Kanno Y, Hikosaka R, Zhang SY, Inoue Y, Nakahama T, Kato
K, Yamaguchi A, Tominaga N, Kohra S, Arizono K, Inouye Y.
(17alpha,20E)-17,20-[(1-Methoxyethylidene)bis(oxy)]-3-oxo-19-norpregna-4,20-diene-21-carboxylic acid methyl ester (YK11) is a
partial agonist of the androgen receptor. Biol. Pharm. Bull., 34,
318323 (2011).
Zhu J, Li Y, Lu A, Gharaibeh B, Ma J, Kobayashi T, Quintero AJ,
Huard J. Follistatin improves skeletal muscle healing after injury
and disease through an interaction with muscle regeneration, angiogenesis, and brosis. Am. J. Pathol., 179, 915930 (2011).
Singh R, Bhasin S, Braga M, Artaza JN, Pervin S, Taylor WE,
Krishnan V, Sinha SK, Rajavashisth TB, Jasuja R. Regulation of
myogenic differentiation by androgens: cross talk between androgen
receptor/beta-catenin and follistatin/transforming growth factorbeta signaling pathways. Endocrinology, 150, 12591268 (2009).
Perry RL, Rudnick MA. Molecular mechanisms regulating myogenic determination and differentiation. Front. Biosci., 5, D750D767
(2000).
Braga M, Bhasin S, Jasuja R, Pervin S, Singh R. Testosterone inhibits transforming growth factor-beta signaling during myogenic
differentiation and proliferation of mouse satellite cells: potential
role of follistatin in mediating testosterone action. Mol. Cell. Endocrinol., 350, 3952 (2012).
Willert J, Epping M, Pollack JR, Brown PO, Nusse R. A transcriptional response to Wnt protein in human embryonic carcinoma cells.
BMC Dev. Biol., 2, 8 (2002).
Tanaka S, Terada K, Nohno T. Canonical Wnt signaling is involved
in switching from cell proliferation to myogenic differentiation of
mouse myoblast cells. J. Mol. Signal., 6, 12 (2011).
Zhang L, Shi S, Zhang J, Zhou F, ten Dijke P. Wnt/beta-catenin
signaling changes C2C12 myoblast proliferation and differentiation
by inducing Id3 expression. Biochem. Biophys. Res. Commun., 419,
8388 (2012).
He B, Minges JT, Lee LW, Wilson EM. The FXXLF motif mediates
androgen receptor-specic interactions with coregulators. J. Biol.
Chem., 277, 1022610235 (2002).
Quigley CA, Tan JA, He B, Zhou ZX, Mebarki F, Morel Y, Forest MG, Chatelain P, Ritzen EM, French FS, Wilson EM. Partial
androgen insensitivity with phenotypic variation caused by androgen receptor mutations that disrupt activation function 2 and the
NH(2)- and carboxyl-terminal interaction. Mech. Ageing Dev., 125,
683695 (2004).
Langley E, Kemppainen JA, Wilson EM. Intermolecular NH2-/

September 20131465
carboxyl-terminal interactions in androgen receptor dimerization
revealed by mutations that cause androgen insensitivity. J. Biol.
Chem., 273, 92101 (1998).
33) Thompson J, Saatcioglu F, Janne OA, Palvimo JJ. Disrupted aminoand carboxyl-terminal interactions of the androgen receptor are
linked to androgen insensitivity. Mol. Endocrinol., 15, 923935

(2001).
34) Furuya K, Yamamoto N, Ohyabu Y, Morikyu T, Ishige H, Albers
M, Endo Y. Mechanism of the tissue-specic action of the selective androgen receptor modulator S-101479. Biol. Pharm. Bull., 36,
442451 (2013).