Proceedings of BUU Conference 2012

PROCEEDINGS OF THE BURAPHA
UNIVERSITY INTERNATIONAL
CONFERENCE 2012
GLOBAL CHANGE
OPPORTUNITY&RISK
9-11 JULY 2012
JOMTIEN PALM BEACH

HOTEL & RESORT, PATTAYA,
THAILAND
Content
ID
HSO41-1
HSO58-2
HSO65-3
HSO133-4
HSO61-5
HSO85-6
HSO179-7
HSO215-8
HSO216-9
HSO197-10
HSP24-1
HSP28-2
HSP30-3
HSP45-4
HSP46-5
The Effect of Music Therapeutic and Exercise on the Quality of Life in

Cancer Patient
Awikunprasert C, Vongjaturapat N, Li F, Sittiprapaporn W
Barefoot Running: Systemic Review
Onwaree Ingkatecha
Factors Predicting the Physical Activity Participation in Older Americans
Kittiwan Junrith, James Swan
Motivations of Students to Participate in Karatedo Club at Dong Thap
University
Tri Thien Huynh, Kim Ngan Huynh Nguyen
Tai Lue Food: Nutritive Dimension
Saowapa Sakkayaphan
The Chronic Illness Resources Survey in Thais with Type 2 Diabetes
Ananya Manit
Risk Factors for Onset Disability in Community
Siranee Srihapak, Piyathida Kuhiranyarat
Eating Habits and Physical Activity among Vietnamese School Children
Tran Thi Xuan Hanh, Nujjaree Chaimongkol, Yunee Pongjaturawit
Family Factors Affecting Unintentional Home Injuries among Young
Children in Wenzhou
Qiu Xian Yun, Chintana Wacharasin, Wannee Deoisre
Improving health promotion for people in Faculty of Public Health
Burapha University, Thailand
Yuvadee Rodjarkpai
Characteristics of Toxic Epidermal Necrolysis and Stevens-Johnson
Syndrome: A 5- Year Retrospective Study
Jiranuch Thammakumpee, Somchai Yongsiri
The Dispended of Polypharmacy with Steroids for Asthma Symptom:
Study on the Bang Phlat District, Bangkok
Pimporn Thongmuang, Yuttana Sudjaroen
Physical Performance and Quality of Life among Over Body Mass Index
Elderly in Lablae District, Uttaradit Province, Thailand
Thanakorn Thanawat, Jongruk Duangthong, Sasithon Sukjit, Kittiwan
Junrith
Thermal Alteration of the Hand in Healthy and Scleroderma Patients
Kunavut Vannajak, Yodchai Boonprakob, Wichai Eungpinichpong,
Ratanavadee Nanagara
Clinical assessment of the craniovertebral angle and the forward shoulder
posture in the dental students with and without neck pain : A preliminary
study
Pimonpan Taweekarn, Yodchai Boonprakob, Daraporn Sae-lee,
Teekayu P. Jorns, Supunnee Ungpansattawong, Somsak Ruammahasab
Page I
Page
1
10
25
37
45
51
53
77
86
94
95
96
101
102
103
ID
HSP57-6
HSP62-7
HSP67-8
HSP83-9
HSP101-10
HSP103-11
HSP186-12
HSP187-13
HUO120-1
HUO56-2
HUO77-5
HUO27-7
HUO167-8
HUO52-10
HUO31-12
HUO108-13
Use of Fast Music during Speed Acceleration Training: Effects on 100metre Sprint
Prachaya Chomsahai
Association of Musculoskeletal Injuries between Prior and During the Training
Camp of Thai Rowing Athletes
Seekaow Churproong, Buratin Khampirat, Likit Matrakool, Preecha
Phuangphairote, Suriya Intra
Effects of Germinated Soybean on Serum Lipids in Rats
Wanpen Mesomya, Yaovadee Cuptapun, Duangchan Hengsawadi, Saruda
Lohana, Sompoch Yaieiam
The Immediate Effects of Manual Therapy on Pain Perception, Pressure
Pain Threshold, and Maximum Mouth Opening in Patients with
Temporomandibular Disorders: A Pilot Randomized Controlled Study
Thanchanok Niyomsirisap, Yodchai Boonprakob, Daraporn Sae-lee,
Teekayu P. Jorns
New record of Rickenella cf. fibula, mycenoid fungi from Thailand
(Agaricales, Basidiomycota)
Thitiya Boonpratuang and Rattaket Choeyklin
Simple Isolation of Human CD4+Lymphocytes using Monoclonal
Antibody-based Magnetic Particle
Surachai Suttawat, Panatda Sanrit, Sanita Singsanan, Niramon
Thamwiriyasati, Suticha Chunta
Pain Relief of Chili Roll-on in Chronic Musculoskeletal Pain
Sunantha Osiri, Supaporn Pitiporn, Somboon Vanichayobol, Pagakrong
Kwankhao, Natdanai Musigavong, Pinit Chinsoi, Lakkana Somprasong
The Effect of Eye-hand Coordination Training on Response Time in Table
Tennis Players
Surapon Chamroon, Sukit Pitakcharoen, Monton Thongroj
The effectiveness of the three common types of written corrective
feedback in improving grammatical accuracy
Arlan Parreo
Insider Trading Behavior and News Announcement:Evidence from the
Stock Exchange of Thailand
Weerawan Laoniramai
Motivations in Motorcycle Theft
Somboon Phongphu, Panya Srichandr
Globalization, Governance and The Role of The State
Syaifudin Zakir
Problem of Quality Management in Small and Medium Enterprises
Anil Kumar
Preparing Thai University Library Facilities and Services for ASEAN
Students from Neighboring Countries Qualitative Research of Cambodian
Students Perception
Kimcheang Hong, Samonya Thawinyarti, Suphapipat Wannasiri, Rana
Pongruengphant and Hermann Gruenwald
Investigation of Thai University Students' Attitudes towards Native/Nonnative Speakers of English
Watthana Suksiripakonchai
Security Resources Managements Perspective on Global Change
Suphanee Navakul
Page II
Page
104
105
106
107
108
112
113
119
121
133
140
147
156
162
168
177
ID
HUO105-15
HUO39-16
HUO84-19
HUO170-20
HUO98-21
HUO143-23
HUO192-26
HUO109-28
HUP64-1
HUP110-2
HUP112-3
HUP131-4
HUP149-5
HUP10-6
STO172-1
The Effect of Language Handbook Guideline for Developing English and

Arabic Speaking Proficiency of Nursing Staff in a Private Hospital
Readiness for ASEAN Community
Siriporn Poonruksa
The Study of Creative Thinking Level of Primary Students in
Watsaweatachat School
Wandee Srikongchan, Sittichai Kaewkuekool and Sopon Mejaleurn
Visitor Perception in Architectural Monument:Case Study of The Historic
City of Ayutthaya
Patiphol Yodsurang
Implementation of Student-centered Methods and Approaches in
Engineering Education
Slavko Kocijancic and Anuparp Boonsongsrikul
The Synthesis of Self Assessment Reports and Analysis of The
Audience Satisfaction of The Thai Teacher TV Project for Two
Years
Pongthep Jiraro
Views of Tourism Impacts From The Cultural Margins of Thai Society
Kanokkarn Kaewnuch, Chokechai Suveatwatanakul
Knowledge Management Model for Local Occupation Development: A
Case Study of Nonthaburi Province, Thailand
Chinawong Sringam
SNSCombiner: A Module for Combining Social Networking Services to
Identify Users Interests in Tourism Domain
Komkid Chatcharaporn, Jitimon Angskun, and Thara Angskun
The Marketing Value Model in using Spa Service of the Foreign Tourists
in Chiangmai Province
Parasee Anek
Students Satisfaction with Learning Program, Lecturers and Teaching
Methods within Studying in Physical Education Subject at University of
Sciences-Ho Chi Minh City National University.
Nguyen Tra Giang, Ngo Tuan Anh, Lam Quang Thanh
Foreign Students Motivation in Vietnamese Language Course at Faculty
of Vietnamese Studies, University of Social Science and Humanities-Ho
Chi Minh City National University.
Nguyen Thu Lan, Nguyen Tra Giang, Nguyen Van Chanh
Factors supporting the Establishment of Learning Organization for
Governance Officers and Employees at Local Administrative
Organizations in Singburi province
Chavalit Supasaktumrong and Chirawan Somwang
Volatility of International Tourist Arrivals to Thailand
Tanattrin Bunnag
Predictors of Effective Quality Assurance of the Eastern University of
Management and Technology
Suneerat Srisopa
Screening, Isolation and Identification of Extracellular Polysaccharide
Producing Bacteria from Sugar Cane Field
Patcharapa Klahan, Unchalee Singyoovong, Atsuo Kimura, Yasuyuki
Hashidoko, and Jintanart Wongchawalit
Page III
Page
185
196
200
207
217
223
234
243
253
259
266
272
278
299
305
ID
STO208-2
STO209-3
STO214-5
STO166-11
STO35-12
STO42-13
STO135-15
STO53-16
STO122-17
STO70-18
STO183-19
STO79-20
STO88-21
STO75-22
STO157-23
STO191-24
Isolation of the cellulose degrading microorganisms from three earthworm

species and the biodegradation of waste paper sludge
Supphasin Thaweesak, Anantachai Chaysang, Anuchida Pobpimay,
Parichart Yamsri, Witawat Jangiam
Isolation of the High Powerful Nitrate Degrading Bacteria from Effective
Microorganisms (EM)
Jutarut Kalaya, Bussaba Phonyotin, Arin Ngophuthong, Witawat Jangiam
Improving of Bradyrhizobial inoculant for soybean cultivation under
environmental stress conditions (Fulltext)
Jenjira Wongdee, Nantakorn Boonkerd, Neung Teaumroong, and Panlada
Tittabutr
Antibacterial, Antioxidant and Toxicity Activities of Methanol Extract of
Xylocarpus granatum Fruit
Asep Awaludin Prihanto, Muhamad Firdaus, Rahmi Nurdiani
Controlled releasing of urea fertilizer by biodegradable polymer with
conventional encapsulation
Sirima Pinpeangchan, Chokchai Wanapu
Preparation and evaluation of nanoparticles for sustained delivery of
ampicillin
Dr.S.Ramesh,M.Pharm.,Ph.D.,ARPS(London)
Luminescence of Beryllium heat treated corundum
Bhuwadol Wanthanachaisaeng, Nantharat Bunnag, Chakkaphan Sutthirat,
Wilawan Atichat, Papawarin Ounorn, Tasnara Sripoonjan
Dispersion of CuO/SiO2 Nanocomposites by Microwave and
Conventional Drying Processes
Saisamorn Niyomsoan, Sanya Prangsri-aroon, Pinsuda Viravathana
The connection between the quadratic nonlinear Schrdinger and the
Schamel equation via the Madelungs fluid
Sarun Phibanchon and Michael Allen
Increasing the heating value of tar by using catalytic
Borisut Chantrawongphaisal, Arunee Chaisawat, Apichat Junsod, Satta
Watanatham, Pichai Wongharn, Pravit Thapnui, Phongsak
Hongcharoensri
Characterization and Transformation of the Polymorphs of DLMethionine Crystals
Lek Wantha
Study of Flow Behavior in High-Density Riser and Downer Reactors
Parinya Khongprom, Sunun Limtrakul, Terdthai Vatanatham
Application of PSCAD/EMTDC Program in High Voltage Engineering
Education
Preecha Sakarung
Push and Pull System Simulation Based for Flow Shop
Tuspol Khaimarn
Rapid Wall Building Construction and Conventional Building
Construction-A Case Study
Prakash Rao B., Nitin Antony Francis
Improvement of Aerodynamics Characteristic of Heavy Trucks
Dr. Imad Shukri Ali, Aws Akram Mahmood
Page IV
Page
314
321
327
338
345
351
358
363
369
376
383
391
401
409
418
427
ID
STP6-2
STP29-5
STP49-9
STP51-10
STP55-12
STP60-13
STP68-14
STP74-15
STP78-17
STP81-18
STP86-20
STP95-22
STP111-28
STP116-29
Using Scanning Electron Microscope to study the effects of different

photoperiods on panicle initiation of KDML 105 rice during and off
cropping season
Nuntiya Kumboonreang, Hatsachai Boonjung, Sodchol Wonprasaid And
Yuvadee Manakasem
Spore forming of Bacillus cereus in pasteurized school milk of small diary
plant (Northeast of Thailand)
Jindawan Wibuloutai, Thidarat Somdee, Prachumporn Lauprasert and
Jirapa Phetsom
Laccase production by Lentinus polychrous from agricultural wastes
Jirapa Phetsom and Karnika Ratanapongleka
COMPARATIVE GLOBAL PROTEOMIC PROFILE OF ERYTHOID
PROGENITOR CELL IN -THALASSEMIA/HEMOGLOBIN E
LALIDA UMBUA, SARUNYOO PONNIKORN, TASSANEE
PANICHAKUL, SUMALEE TUNGPRADUBKUL
Determination of Volatile Organic Compounds (VOCs) in Water by Purge
and Trap-Gas Chromatography-Mass Spectrometry (PT-GC-MS)
Apinya Navakhun, Chartchai Malaphong
Synthesis of Micrometer-Sized Gold Nanoplate for Jewelry Application
Pimthong Thongnopkun, Aumaparn Phlayrahan
Potential of Golden Shower )Leguminosae Mimosoideae( extracts using as
bio-insecticide in paddy field
Khobkul Nongnutch, Jakkaphun Nanuam, Pichet Tebumroong
PROLINE CONTENT OF RICE SEEDLINGS: DIFFERING
RESPONSES OF TWO CULTIVARS TO SALT STRESS
Wichuda Jankangram and Piyada Theerakulpisut
Habitat partitioning of genetically distinct zooxanthellae inhabiting soft
corals in the genus Sinularia
Thadsin Panithanarak
Gene identification and structural modeling of a novel organic solvent
stable and thermophilic lipase from Acinetobacter baylyi
Phraewphan Sawasdee and Jittima Charoenpanic
Gene identification and structural modeling of an amidase from a novel
acrylamide-degrading bacterium Enterobacter aerogenes
Sureeporn Suktanara, Oratai Mangkalad, and Jittima Charoenpanich
The in vitro effect of Andrographis paniculata extracts on the innate
immune response of hybrid catfish (Clarias macrocephalus x Clarias
garipienus) and Nile tilapia (Oreochromis niloticus)
Budianto, Praparsiri Kachanopas-Barnette, Rungnapha Saeeng, and
Sukanda Tubmeca
Responses of physic nut seed and oil to storage temperature and duration
Phornphimon Janchai, Rungsarid Kaveeta, Sukuntaros Tadakittisarn and
Chalermpol Phumichai
Preliminary screening of lignin-degrading enzymes from selected
Corticiaceae
Amornsri Singnam, Thitiya Boonpratuang, Rattaket Choeyklin, Torpong
Kreetachat, Sawitri Chuntranuluck and Pilanee Vaithanomsat
Page V
Page
450
455
461
470
478
487
493
499
512
524
533
543
552
561
ID
STP119-31
STP123-32
STP124-33
STP127-35
STP128-36
STP136-38
STP144-40
STP150-41
STP159-45
STP184-50
STP189-52
STP204-58
STP217-62
STP218-63
Influence of TiO2/PLA Biocomposite Supporter on Photocatalytic

Oxidation Activity of the TiO2
Nantavat Tangchantra, Waranya Pompan, Kasinee Nacmool, Kanisorn
Jai-eau, Pannawit Amornpanpokin, Jittiporn Kruenate, Kowit
Suwannahong
The effect of modified TiO2 embedded in the biopolymer matrix on the
efficacy of Dichloromethane degradation
Praewpan Katrun, Suchart Supattanapalapol, Nantavat Tangchantra,
Kasinee Nacmool, Jittiporn Kruenate, Kowit Suwannahong
The Adsorption of Direct Dyes by Zeolite
Pannawit Amornpanpokin, Suchart Supattanapalapol, Praewpan Katrun,
Tammarak Sooksomsong, Kanisorn Jai-eau, Jittiporn Kruenate, Kowit
Suwannahong
Lead Contaminations in the Chanthaburi River and Vicinity Area
Kamolthip Mahavong, Sopa Chinwetkitvanich, Poranee Pataranawat
Photocatalytic oxidation activity of carbon supported TiO2/HDPE
nanocomposite film
Waranya Phompan, Thammarak Sooksomsong, Pannawit Amornpanpokin,
Jittiporn Kruenate, Nantavat Tangchantra, Kanisorn Jai-eau, Kowit
Suwannahong
Paraquat Contaminations in the Chanthaburi River and Vicinity Area
Kankanit Suppaudom, Duangta Kitkaew, Poranee Pataranawat
Effect of activators solution on frozen sperm quality of striped catfish,
Pangasianodon hypophthalmus
Samorn Ponchunchoovong, Augkana Jaikud, Tunyaluk Ratsuwan, Sunai
Plime
Hydrogen Production from Food Waste by Dark Fermentation
in Anaerobic Semi Complete Mixed Reactor
Patthanant Natpinit, Rewadee Anuwattana and Sarunpit Supanit
The mosquito NADPH-Cytochrome P450 Oxidoreductase (CYPOR):
Structure and implement for safety insecticidal synergistic application.
Songklod Sarapusit and Sarinya Thongjam
Competitive Sorption of Phenol in the presence of Lead by Organoclays
Thitirat Ditkaew, Sutha Khaodhiar
Sound-field Distribute and Measuring in Electrical-Acoustics Designing
for Multi-media room and Conference Hall in University
Xu Wen Yi, Xu Guang Ze, Shi Yi Jin
Removal of Mohom Dye from Wastewater Using zeolite from Slag
Rewadee Anuwattana, Tawee Sappinant, Pawanee Tantuan and
Worapong Pattayawan
L-Alanine production from glycerol by Escherichia coli alanine racemasedeficient mutant expressing alanine dehydrogenase gene
Chanapa Onpan, Rujirut Hatrongjit, Kanoktip Packdibamrung
High Selenium-Enriched Yeast Production
Prakaidoy Ditsayabut, Pakanit Kupittayanant, Chokchai Wanapu
Page VI
Page
568
577
587
595
605
615
624
631
641
651
657
663
671
679
Burapha University International Conference 2012

July 9-11, 2012
HSO41-1
The Effect of Music Therapeutic and Exercise on the

Quality of Life in Cancer Patient
Awikunprasert C1, Vongjaturapat N1, Li F2 Sittiprapaporn W3
1 Faculty of Sport Science, Burapha University
2 Oregon Research Institute, USA
3 Faculty of Medicine, Mahasarakham University
Email: chayanona@yahoo.com
Abstract
Background: Music therapy and exercise provide inner peace and physical wellbeing to the
cancer patients. Music therapy and exercise have been included in the program of alternative
medicine which resulted in great outcomes. Uncompetitive to medical treatments, music and
exercise bring more family and social involvement, and contribute with more encouragement and
positive attitude to fight for cancer.
Objective: The present study was to identify the association to examine the efficacy of music
and exercise on the quality of life in cancer patients.
Material and Method: This is an experimental research using music and exercise program to
establish quality of life in cancer patients. The 21 cancer patients were divided into four different
groups; the control group who followed their routine schedules; the music group who received
additional music therapy with a music leader; the exercise group who had an additional exercise
program with a professional trainer; the music and exercise group, who combined both
treatments, music and exercise, on the same day. Thai- Hospice Quality of Life Index was used
for the purpose of the study and collected every 4th, 8th and 12th week during the experiment to
observe the efficiency of the alternative therapies.
Results: According to the statistical analysis, the music and exercise group showed the most
significant improvement compared to the other three groups, suggesting the combination of
music and exercise has the most potential to increase the self-confidence and interaction with
surroundings for the cancer patients.
Conclusion: Music and exercise treatment are good models to improve self-confidence of cancer
patients and social interaction with their family and friends of cancer patients. In conclusion, this
treatment can also be used in general clinics or hospitals as an alternative treatment for cancer
patients.
Keywords: Music, Exercise, Quality of life, Cancer patient
INTRODUCTION
Cancer is a disease associated with mental health. Spiritual discipline and

proactive positive thinking may aid in surviving the battle with cancer. Body tension,
derived through anger, bitterness, worry and stress which are indicators, in the early
stages of cancer, of non-acceptance of the disease, may in fact heighten and compound
the problems. These initial concerns may be mitigated through acceptance, which may
allow for some remission (Onnchomjun, 2009). Cancer cells cannot grow in an
environment that the organism has enough oxygen. Routine exercise and deep breaths
help the body get oxygen up into the chest and into the cellular level.
Page 1

July 9-11, 2012
Cancer is a chronic disease and is a major public health problem that threatens
human life, mainly due to the long-term treatment with associated serious side effects.
The treatments and their side effects have caused significant economic impact on human
resources and social development of countries (Cancer Research UK, 2007). The World
Health Organization (WHO) in 2006 has estimated, by the year of 2020, there will be
more than 11 million deaths from cancer throughout the world (World Health
Organization [WHO], 2007).
Cancer is the second cause of death after cardiovascular disease in the United
States. Cancer affects people at all ages with the risk for most types increasing with age
(Cancer Research UK, 2007). Cancer has caused about 13% of all human deaths in 2007
(World Health Organization, 2007; American Cancer Society, 2008). Each year 10.9
million people worldwide are diagnosed with cancer and there are 6.7 million deaths
from the disease. It is estimated that there are 24.6 million people alive who have
received a diagnosis of cancer in the last five years (Cancer Research UK, 2007; World
Health Organization, 2007).
In Thailand, the trend of cancer is increasing in line with other countries around
the world. According to statistics for 2007 from the Bureau of Policy and Strategies,
Ministry of Health found that the mortality rate of patients with cancer is growing every
year and the number one cause of death in Thailand since 2003. The National Cancer
Institute in 2008 also estimates that Thailand will have 120,000 new cancer patients and
will increase by another 50 percent in the next 10 years (National Cancer Institute, 2008).
The changes of physical symptoms that accompany cancer may cause the patients
to become weak in mind and body. This weakness and associated hopelessness of selfawareness might separate or isolate patients from the social environment. Both physical
and mental conditions are the factors that trigger mental illness; therefore it is important
to help patients, especially in terms of mental stimulation in order to fight the disease and
for pain management. For example, body massage and music therapy can be methods of
mental stimulation which help patients confront their illness and gain motivation
(Delbrck, 2007).
Many cancer patients use therapies promoted as literal alternatives to
conventional medical care. However, the alternative therapies are unproven or were
studied and found to be worthless, and even, in some circumstances, can be harmful
(Delbrck, 2007, Barrie & Deny, 2004). In addition, a greater proportion of cancer
patients use complementary therapies along with mainstream cancer treatments7. Most
are helpful adjunctive approaches that control phenomenon and magnify the quality of
life (Delbrck, 2007; Barrie & Deny, 2004).
Music therapy is an easy, inexpensive way to help cancer patients cope with the
emotional upset often caused by high-dose chemotherapy and autologous stem cell
transplantation8. Patients who were visited by a trained music therapist reported less
anxiety and better overall mood than patients who did not receive music therapy (Barrie
& Deny, 2004). According to Cassileth and his colleagues in 2003, 28% reduced anxiety
and 37% reduced disturbance 69 of cancer patients, when p value is equaled to 0.01
(Cassileth, Vickers, & Magill, 2003).
Physical exercise is important for maintaining physical fitness and can contribute
positively in maintaining a healthy weight, building bone density, muscle strength, joint
mobility, promoting physiological well-being, reducing surgical risks (Cohen &
Williamson, 1991).
Page 2

July 9-11, 2012
The quality of life is used to evaluate the general well-being of individuals,

societies and healthcare, but also the built environment, physical and mental health,
education, recreation and leisure time, and social (McMillan, & Weitzner, 2001).
Purpose of the study
The aim of this study is to examine the use of music and exercise programs to enhance
the quality of life in cancer patients.
MATERIALS AND METHODS
Participants were classified as stage 3 to 4 of cancer patients who were receiving hospice
care. The participants were 3 to 4 stage cancer patients (N = 21), treated at the Arokhayasala
Foundation, Sakonnakhon Province, Thailand. The cancer patients were randomly assigned into
4 groups, control group (n = 6); music group (n = 5); exercise group (n = 5); music and exercise
group (n = 5). The patients were treated with drug chemotherapy, radiation therapy or surgery
before being administrated at the Arokhayasala Foundation.
Upon admitted into the hospice program, the participants for the study were evaluated by
the nurses and medical doctors for qualification. The participants need to sign an agreement and
were assigned to one of the four groups the control/music therapy and/or exercise therapy. The
right of participant protection of this study has been approved by Burapha University, Thailand.
The nurses would collect to survey by using the Thai- Hospice Quality of Life Index (THQOLI). The participants were divided into two groups, the control and experimental group. For
the experimental group, the participants were asked to collect the questionnaires (T-HQOLI) at
the 4th week, 8th week, and 12th week similar to control group. Meanwhile, the participants in
the control group continue their routine therapies at the Arokhayasala Foundation, with no
additional music therapy or exercise. After being assigned into different experimental groups,
the music or exercise were introduced and provided at each routine visit. The participants
received doctor permission to get involved in the exercise group, since those in the 3rd or 4th
stages of the cancer might be vulnerable in terms of mobility.
Statistical analyses
All of the data collected, including the results from both questionnaires and cortisol
analysis were analyzed by using the Software Package of Social Statistic / Personal Computer.
Non-parametric scale was measured with Kruskal Wallis Test and Friedman Test. The statistical
significance of this study was set p value to less than .05.
RESULTS
The main study examines the music and exercise program effects on the quality of life in
21 cancer patients. The mean age of participants was 52.76 (range 40-72 years of age). There
were a majority of stage 3 patients (61.9%) with the rest at stage 4 (38.1%) as shown in Table 1
Page 3

July 9-11, 2012
Table 1 The characteristics of cancer patients for data collection and analysis (N = 21)
Comparison of level quality of life

The table represents the comparison between control (a) and experimental groups (b) on
their results in the final week of the experiment. At the same time, the table also represents the
comparison between pre-test and results at 4th, 8th and 12th weeks. According to this table,
when the exercise group with music, exercise group and the control group are compared, the
exercise group shows statistical significant (mean = 8.670.61) at p value less than .05; the music
and exercise groups also shows a significant difference (mean = 9.140.50) at p value of less
than .05 (Table 2). During 4th and 8th week, there was no real improvement in quality of life,
however, the significant improvement was observed at the 12th week, although the effects only
show in the exercise and music and exercise group.
The post-test of QOL at week 4, 8 and 12 after treatment shows significant differences
when compared with pre-test of QOL (p value < .05). For the music group, the pre-test of the
quality of life present significant difference when compared to the post-test at 4th week
(mean=5.810.38), 8th week (mean = 7.290.58) and 12th week (mean = 7.620.48) after
treatment. For the exercise group, the pre-tests of the quality of life present significant
differences when compared to post-test mean at 4th week (mean = 7.471.12), 8th week (mean =
7.950.82) and 12th week (mean = 8.670.61) after treatment. For both music and exercise
groups, the pre-test of the quality of life shows significant differences when compared to the
post-test at 4th week (mean = 6.760.77), 8th week (mean = 7.961.01) and 12th week (mean =
9.140.50) after treatment (Table 2).
Page 4

July 9-11, 2012
Table 2 Means and SD of QOL between pre-test, 4th, 8th and 12th weeks
* p value < .05 (Ranging from .02 to .04) (between pre- and post-test using Mann-Whitney U
test)
p values A from Friedman test
p value B from Kruskal Wallis test (a, b Results with the same letter are not statistically different
(between groups))
In the 12th week, while compared all the treatments in pairs, we can observe that there is
no significantly different between control and music groups either as the music and music and
exercise groups (Table 3).
Table 3 Test of paired QOL differences of treatment after Kruskal Wallis test using
at week 12
Week 12
Pair of treatments
U
Z
p value
Control - music
8.00
1.28
.199
Control - exercise
2.50
2.29*
.022
Control M and E
1.00
2.35*
.019
Music - exercise
2.00
2.20*
.028
Music - M and E
0.50
2.34*
.019
Exercise - M and E
4.00
1.47
.142
U- test
* p value < .05

If compare between each week, we can observe that, in the control group, 8th week and
12th weeks showed no significantly different; in the music group, 8th and 12th week had no
significantly difference; for the exercise group, there is no significantly difference in the 4th and
8th groups; and the music and exercise group, there is significantly difference in all weeks (Table
4).
Page 5

July 9-11, 2012
Table 4 Test of comparison QOL differences by pairs of week after Friedman test at
4th, 8th and 12 weeks
Control
Music
pre-test,
Exercise
M and E
Pair of week
(Comparison)
Pre-test week 4
2.20* .027
2.02* .043
2.02* .043
2.02*
.043
Pre-test week 8
2.20* .028
2.02* .043
2.02* .043
2.02*
.043
Pre-test week 12
2.20* .027
2.02* .043
2.02* .043
1.82*
.048
week 4 - week 8
2.03* .029
2.07* .048
1.34
.067
2.01*
.045
week 4 - week 12
2.05* .025
2.09* .042
2.04* .042
2.09*
.038
week 8 - week 12
1.23
1.34
2.05* .040
2.10*
.035
p value
.068
p value
.067
p value
p value
* p value < .05
For the comparison of the study groups, the groups were divided into 4, which were the
control group, the music group, the exercise group and both the music and exercise group. The
results show the increase levels of the quality of life in 12 weeks. For the pre-test, each group
found the value of the quality of life in the range of 4.35 - 5.28. At week 8, the control group and
the music group present the mean value of the quality of life whereas the exercise group and both
music and exercise group also show the similar quality of life. At week 12, all sample groups
show, the mean the quality of life ranged from 7.62 - 9.14 (Figure 1). As mentioned above,
although the improvement was not observed in the first 8 weeks, the patients were more likely to
become accustomed to the treatments at the later weeks. These results show that the patients
appreciated more a positive attitude from their families and in their social life.
Figure 1 Level of the quality of life of each group at pre-test, 4, 8 and 12 week
Score
Time
Page 6

July 9-11, 2012
From Table 5 shows means and standard division of the quality of life in cancer patients
at the pre-test, 4th, 8th and 12th week in subscales. The quality of life is divided into 3 subscales:
Psycho physiological, Functional and Social/spiritual. Each subscale is divided into 4 groups:
control, music, exercise and, music and exercise. In the Psycho physiological subscale, the
development of quality of life in every group and in every time of collecting data gradually
increases. In the Functional and Social/spiritual subscale, the quality of life is gradually
developed in every group and in every time except the quality of life in the music & exercise
group in the 12th week is slightly decreased.
Table 5 Means and SD of QOL at the pre-test, 4th, 8th and 12th week in subscales
Subscales
(Group)
Psycho physiological
Control
Music
Exercise
Music & Exercise
Functional
Control
Music
Exercise
Music & Exercise
Social/ Spiritual
Control
Music
Exercise
Music & Exercise
Pre-test
Week 4
Week 8
Week 12
M (SD)
M (SD)
M (SD)
M (SD)
4.44 (0.58)
3.65 (0.53)
4.47 (0.57)
4.93 (1.67)
6.11 (1.26)
5.75 (0.94)
7.68 (1.53)
6.48 (0.92)
7.50 (0.79)
7.43 (0.86)
8.18 (0.95)
7.98 (1.35)
7.97 (0.47)
7.82 (0.67)
8.87 (0.75)
9.33 (0.41)
3.93 (0.76)
3.89 (0.91)
4.17 (0.62)
4.34 (0.68)
5.48 (1.28)
5.31 (0.35)
7.17 (1.53)
6.60 (0.61)
6.76 (1.36)
6.91 (0.97)
7.14 (1.23)
7.54 (1.40)
7.21 (1.02)
7.29 (0.92)
8.34 (0.62)
7.29 (1.42)
5.65 (0.57)
5.80 (0.45)
6.25 (0.70)
6.63 (0.80)
6.44 (0.14)
6.35 (0.72)
7.40 (0.27)
7.33 (0.82)
7.23 (0.62)
7.40 (0.18)
8.30 (0.94)
8.30 (0.42)
8.04 (0.38)
7.63 (0.35)
8.65 (0.75)
7.10 (4.03)
The results of this study indicate that music and exercise had a positive effect on the
quality of life and showed some encouraging trends with respect to health in cancer patients.
Because quality of life (psycho physiological, functional and social/ spiritual) are ultimate goals
in the rehabilitation and recovery of cancer patients, the practice of music and exercise program
could provide an effective means for approaching these goals.
DISCUSSION
The scale and results of the T-HQOLI would reflect and document the efficiency of the
traditional medication and well-being of the patients. In addition, the results also would reflect
the patients response to the treatment during each visit and if there was any need for
improvement upon patients request and suggestions. The results of the T-HQOLI were collected
for reference to compare with the later survey and the participants in the experimental group
divided into music or exercise groups based on the first T-HQOLI results.
An effect of music on QOL
We can observe that the participants in this study had a better quality of life, since the
score was improved significantly. Recent studies indicated that the quality of life of the patients
receiving music therapy was higher and the quality of life was improved compared from the
Page 7

July 9-11, 2012
onset to the end of the experiment (Hilliard, 2003). Listening to music can help patients score
lower in anxiety, stress and pain. In addition, the music can help to slow heart rate and ease
intense nerves (Pittman, 2011). Recent announcement from Stanford Hospital and Clinics offers
music in the patient room, especially for end-of-life situations. The doctors believe that bedside
music can provide healing value and comfort to both the patients and the visitors (Stanford
Hospital and Clinics, 2011).
An effect of exercise on QOL
The participants had a better quality of life, respectively, after getting used to the
exercise program provided, including walking exercise and Tai chi chuan exercise. The exercise
program is not too complicated for cancer patients at stage 3 and 4. Tai Chi has been able to
improve the self-esteem and quality of life also in breast cancer survivors (Mustian et al., 2004).
By practicing Tai Chi, breast cancer survivors increased their functional capacity significantly
more than the control group that did not participate in Tai Chi (Mustian, Katula, & Zhao, 2006).
Exercise is gradually becoming recognized as an important treatment for the recovery and
rehabilitation of cancer survivors. The findings from previous reviews and meta-analyses suggest
that exercise reduced a range of physical and psychological complaints after cancer treatment.
The benefits are thought to include reductions in fatigue and improvements in immune function,
physical functioning, body composition (Galvao & Newton, 2005; Kirshbaum, 2007).
An effect of music and exercise on QOL
The participants had a better quality of life, respectively. During music and exercise, the
participants would clap their hands and sing and also, pray along with music, followed by the
easy exercise program. Recent studies also indicated that music therapy and rhythmic exercise
have positive effects on quality of life, especially on vitality, general health and mental health
(Jeon et al, 2009). Physical exercise after cancer diagnosis consistently has been found to have a
positive effect on quality of life including physical, functional, psychological, and emotional
well-being (Schwartz et al., 2001).
CONCLUSION
This study aimed to determine the effectiveness of a music and exercise program on
quality of life in cancer patients. The results of this study showed that the music and physical
activity program was simple and effective to undertaken by the cancer patients. This program
provided the patients exercise with walking and Tai Chi Chuan. The music therapy helped the
patients cope with the emotional issues surrounding cancer. Music therapy and exercise,
including aerobic, provide inner peace and physical well-being to the cancer patients. Music and
exercise were activities that required breathing control, thus adding to the overall effectiveness of
the program. As mentioned above, music therapy and exercise have been included in the program
of alternative medicine that resulted in significant outcomes, and bring more family and social
involvement, encouragement and positive attitude to fight with cancer. The alternative treatment
was performed in this study can also create an opportunity to bring more positive views and
perspectives of life, especially in the late stages of cancer patients.
ACKNOWLEDGEMENTS
This work was fully funded through the Strategic Scholarship Fellowship Frontier
Research Network, Thailand.
Page 8

July 9-11, 2012
REFERENCES
American Cancer Society. Cancer Facts and Figure. 2008. [cited 2008 April 18];
Available from: http://www.cancer.org/downloads/STT/2008CAFFfinalsecured.pdf
Barrie, R. and Deny, G. 2004. Complementary and alternative therapies for cancer. The
Oncologist, 9, 80-89.
Cancer Research UK. 2007. [cited 2009 May 8]; Available from:
http://info.cancerresearchuk.org/cancerstats/world/index.htm
Cassileth, B. R. Vickers, A. J. and Magill, L. A. 2003. Music therapy for mood disturbance
during hospitalization for autologous stem cell transplantation. Cancer, 98(12), 27232729.
Cohen, S. and Williamson, G. M. 1991. Stress and infectious disease in humans. \Psychological
Bulletin, 109, 524.
Delbrck, H. 2007. Psychological support and self-help groups in cancer rehabilitation and
palliation. Rehabilitation and Palliation of Cancer Patients, 7, 27-49.
Galvao, D. A. and Newton, R. U. 2005. Review of exercise intervention studies in cancer
patients. Journal of Clinical Oncology, 23(4), 899-909.
Hilliard, R. E. 2003. The effects of music therapy on the quality and length of life of people
diagnosed with terminal cancer. Journal of Music Therapy, 40(2), 113-137.
Jeon, E. Y., Kim, S. Y., and Yoo, H. S. 2009. Effects of music therapy and rhythmic exercise on
quality of life, blood pressure and upper extremity muscle strength in institution-dwelling
elderly women. Journal Korean Academic Nursing, 39, (6), 829-39.
Kirshbaum, M. N. 2007. A review of the benefits of whole body exercise during and after
treatment for breast cancer. Journal of Clinical Nursing, 16(1), 104-121.
McMillan, S. C. and Weitzner, M. Quality of life in cancer patients use if a revised .2001.
288-282 ,(5)6 ,Cancer Practice .hospice index
Mustian, K. M., Katula, J. A., Gill, D. L., Roscoe, J. A., Lang, D., and Murphy, K. 2004.
Tai Chi Chuan, health-related quality of life and self-esteem: A randomized trial with
breast cancer survivors. Support Care Cancer, 12(12), 871-876.
Mustian, K. M., Katula, J. A., and Zhao, H. 2006. A pilot study to assess the influence of tai chi
chuan on functional capacity among breast cancer survivors. Journal of Support
Oncology, 4, 139-145.
National Cancer Institute. Cancer Statistics. 2008. [cited 2010 June 30]; Available from:
http://www.nci.go.th
Onnchomjun, D. Body, Mental, Music and Concentration Therapy for Patients Cancer.
2009. [cited 2009 Feb 4]; Available from:
http://www.mfu.ac.th/school/health_sci/cirrent_topic02.html.
Pittman, G. Music Therapy may Ease Anxiety in Cancer Patients. 2011. [cited 2011 Aug
11]; Available from: http://www.reuters.com/article/2011/08/15/us-music-therapy-
cancer-idUSTRE77E5OT20110815
Schwartz, A. L., Mori, M., and Gao, R. 2001. Exercise reduces daily fatigue in women with
breast cancer receiving chemotherapy. Medicine & Science in Sports & Exercise, 33,
718-723.
Stanford Hospital and Clinics. Music in Patient Rooms. 2011. [cited 2010 May 15];
Available from:
http://stanfordhospital.org/forPatients/patientServices/musicprogram/patientrooms.html
World Health Organization Cancer News Report. 2007. [cited 2009 April 18]; Available
from: http://www.who.int/mediacentre/news/releases/2006/pr06/en/index.html
Page 9

July 9-11, 2012
HSO58-2
Barefoot Running: Systemic Review

Onwaree Ingkatecha
Faculty of Sport Science, Burapha University, Chonburi, 20131, Thailand
Email: onwaree@buu.ac.th
Abstract
Running is one of the most popular sport activities which millions of people have
engaged in. It is convenient, inexpensive and offers numerous health benefits. With a pair of
shoes, people can start running. The modern running shoes have been thought of a protective
device from different surfaces and environment. Shock attenuation has been one of the primary
roles for running shoes to provide shock absorption. The various materials have been added to
improve the wearers performance and impact force reduction but some researchers concluded
that expensive running shoes were no better at reducing impact forces than were low-cost shoes
as well as other studies which postulated that barefoot running could reduce impact force. In
addition, the incidences of running and overload injuries which occur as a result of repetitive
microtrauma from chronic loading of skeleton, especially lower extremities, had risen as well.
With the release of the book about Tamahumara Indians in Mexico, Born to Run, barefoot
running has seen a rise in popularity over the last half a decade. There still are the controversial
issues if barefoot running is helpful or harmful. Some studies showed the impact reduction which
leads to injury prevention while some studies argued that it could stimulate more injuries and
long-term effects on feet. There are still a lot of debates over barefoot running about benefits and
safety. However, this trend has spread to the footwear manufacturers. The minimalist shoes
which offer little protection on the heel have been launched to the market.
Keywords: barefoot, minimalist, running injuries, footwear, biomechanics of running
Introduction
Millions of people are involved in recreational running all over the world. Running is one
of the most popular forms of aerobic exercises which requires no membership, inexpensive and
offers numerous health benefits. The health benefits of running are similar to the benefits
achieved by all forms of moderate intensity cardiorespiratory exercise. It helps improve the
efficiency of cardiorespiratory system, decrease cholesterol, prevent heart diseases and
hypertension, improve immune system, control body weight. Aside from health benefits, there
are several psychological benefits such as stress reduction, confidence and attitude improvement.
Running can be performed anywhere with a pair of shoes and comfortable clothes.
Page 10

July 9-11, 2012
Biomechanics of Running
Running is a complex task involving the coordination of all the bodys segments. It is a
modification of walking but different in significant aspects. The running cycle consists of a
stance phase, where one foot is in contact with the ground while the other leg is swinging,
followed by a float phase where both legs are off the ground or no double support. The stance
phase is divided into two sub-phases: early stance and late stance, and the swing phase is divided
into three sub-phases: early swing, mid-swing and late swing (Fig. 1) (Hunter et al., 2008).
Fig. 1. Phases of running cycles, based on event of a single lower-limb (Hunter et al.,
2008).
The stance phase serves to absorb impact forces and maintain forward momentum and to
support the bodys weight. The late stance functions to accelerate the body forward and upward
by an increase in the limb length. The swing is the enhancement of the forward and upward
ground reaction thrust. This phase begins as the foot moves forwards.
Kinematics of Running
Kinematics is the study of the motion of object. The variables describes as a function of
the percentage of the total running cycle. The trunk and pelvis are tilted forward in order to keep
the forward acceleration. The hip is flexed between 25 and 30 at foot strike. The hip extends
maximally just before toe-off. During the early stance, the knee and ankle joints flex. A further
2030 of knee flexion occurs early in the stance period which is a natural mechanism that
cushions some of the impact force. Most runners initially contact the running surface with their
rearfoot. In the late stance, the knee extension and ankle plantarflxion are followed. The ankle
plantarflexes up to 30 before toe off (Novacheck, 1998; Lafortune et al, 2000). The heel contacts
the ground with the foot in a slightly supinated position (Mann et al., 1981). After that, the foot
progresses into pronation accompanied by hindfoot eversion and tibial internal roation which
increases mobility of subtalar joint and forefoot. After maximal foot pronation, the subtalar
supination begins at heel-off and remainder of the stance phase for propulsion (Dugan & Bhat,
2005). After take-off, the hip starts to flex and continue through the midswing. The knee and
ankle undergo flexion for toe clearance. The hip and knee joint start to extend in preparation for
touchdown at late swing phase (Hunter et al., 20
Page 11

July 9-11, 2012
Fig. 2. Knee flexion angle as a function of (a) the thigh angle and (b) the ankle angle
(Lafortune et al., 2000)
Kinetics of Running
According to the 3rd law of Newton, Foot contact generates a reaction force from the
ground which is divided into three components; vertical ground reaction force, anteroposterior
ground reaction force, and mediolateral ground reaction force. The vertical component is the
largest component which effects the human skeleton. The previous studies provided the
information concerning the magnitude, direction and point of application. Its magnitude is 1.3 to
1.5 times body weight during walking while the magnitude of vertical ground reaction force in
running is able to approach 3 to 4 times body weight. In addition, the peak impact force relates to
running speed. As the running velocity increases, the amplitude of ground reaction forces
increases (Cavanagh & Lafortune, 1980).
Fig. 3. Vertical ground reaction forces compare between rearfoot striker and midfoot
striker (Blazevich, 2007)
The vertical impact force presented in Fig. 3 showed the characteristics of a rearfoot
runner and midfoot runner. Running style is classified according to which part of the foot makes
Page 12

July 9-11, 2012
first contact with the ground. Runners with a mid- or forefoot impact will tend to experience a
lower impact force as the loading is cushioned by the active contraction of the calf muscles
(Grimshaw et al., 2006)
Human Foot and Functions
In order to provide support for standing and a lever for propulsion, the stability of foot
during weight bearing derives from articulations and ligaments from the heel to the central
metatarsal heads. As well as being the firm supporting base, it needs to be flexible for propulsion
and moving on the irregular surfaces. The human foot is a complex structure with 26 bones,
several joints, ligaments and soft tissues. It is divided into 3 parts; forefoot, midfoot and rearfoot.
The forefoot, the most flexible part, includes five metatarsal bones and fourteen phalanges. The
midfoot includes five tarsal bones arranged in two rows. The rearfoot includes talus, which forms
the pivot of ankle joint, and calcaneus which forms the heel (Fig. 4a).
There are three arches from the structural formation (Fig. 4b); the medial and lateral
longitudinal arches, and transverse arch. The medial longitudinal arch is the highest and most
important, is composed of the calcaneum, talus, navicular, cuneiforms and the first three
metatarsals. The lateral longitudinal arch is lower and flatter than the medial arch. It is composed
of the calcaneus, cuboid, and the fourth and fifth metatarsals. The transverse arch is composed of
the cuneiforms, the cuboid, and the five metatarsal bases. These arches are strengthened by
ligaments and tendons (McKinley & OLoughlin, 2008).
Page 13

July 9-11, 2012
Fig. 4 a) Anatomical structure of right foot (superior view) b) Longitudinal arches of foot
(McKinley & OLoughlin, 2008)
The arch of the foot is an important design feature for the stability and function of the
foot. It is capable of supporting itself by the foot natural arch support mechanism known as the
windlass mechanism (Hicks, 1954), that the medial longitudinal arch is raised on dorsiflexing the
first metatarsophalangeal joint.
Running Injuries
Many injuries are related to running because of the high impact forces. Since recreational
running becomes dramatically popular among people, the incidence of running injuries has risen.
Several literatures indicated that the etiology of running-related injuries was multifactorial
characteristics (Keller et al., 1996; Satterthwaite et al., 1999; Taunton et al., 2002; van
Middelkoop et al., 2008; Buist, et al, 2010; Buist, et al, 2010; Harrast & Colonno, 2010; Lynch &
Hoch, 2010; Chang et al., 2011). The factors that causing running injuries could be categorized
into three factors: training, anatomical, and biomechanical factors. The training factors have been
routine excessive mileage, increased intensity, duration and frequency of running, irregular
surface running, running experiences, orthotic use, the type of shoe insoles, the racing group,
training duration and terrain, incorrect footwear, training errors. The anatomical factors have
been identified as the abnormalities or malalignment of the body, especially lower extremities
such as tibia varum, rearfoot varus, and leg length discrepancies. The biomechanical factors have
been the magnitude of impact forces (Cavanagh & Lafortune, 1980), the rate of impact loading
(Nigg, 1986), and the magnitude of push off forces (Winter, 1983).
Most of the running injuries are overuse injuries which occur as a result of repetitive
microtrauma from chronic loading of tendons, muscles, or bones. Lun et al. (2004) studied
musculoskeletal injuries of 87 recreational runners who had no history of injury at the start of the
study and found the incidence was 79%, which was the same for both sexes. van Gent, et al
(2007) summarized that running injuries occurred 7%-50% at knee, followed by the lower leg
(9%-32.2%), the foot (5.7%-39.3%) and upper leg (3.4%-38.1%). van Mechelen (1992) stated
that 50-75% of injuries are due to overuse from running.
Page 14

July 9-11, 2012
Table 1 study characteristics (van Gent et al., 2007)
Page 15

July 9-11, 2012
The modern running shoes have been thought of a protective device from rough and
uneven surfaces, excessive ground impact forces, and cold - wet environments. Running shoes
were first designed in the 1970s. Footwear characteristics found to influence injury rates include
shock absorbing properties (Finestone et al., 1992; Milgrom et al., 1992; McKay, Goldie &
Oakes, 2001; Torkki et al., 2002), arch support system, outsole and midsole materials (Chiu &
Wang, 2007), shoe flexibility, toe box room (Miller, 2000), pressure over the plantar surface area
(Jordan, Payton & Bartlett, 1997). Shock attenuation has been a major concern for footwear
designers and manufacturers, as one of the primary roles for running injuries reduction by
providing shock absorption (Cavanagh, 1980; Nigg, 1986). In addition, the deformity of the foot
such as overpronation has also been identified as a key factor related to running injuries (Hart
and Smith, 2009).
The three primary categories of running footwear in the market are motion control,
cushion trainers, and stability shoes. Motion control shoes are developed to control excessive
rearfoot motion (Williams et al., 2001). Motion control running shoes are rigid, durable, stable
control-oriented running shoes that limit pronation. These shoes are designed to provide
significant support for flat-footed or severe overpronators. Cushion trainer shoes are developed to
attenuate lower extremity loading (Williams et al., 2001). The investigations have been focused
on midsole cushioning in order to reduce the impact force and running injuries (Andreasson &
Peterson, 1986). The midsole will provide the extra shock absorption and is best for runners with
a high arch. Stability shoes are designed for the runners with a normal arch. It is believed that
assigning running shoes matched to arch type, injury risk could be reduced (Knapik et al., 2010).
Page 16

July 9-11, 2012
Footwear manufacturers have tended to pay more attention to shock absorption and cushioning
than to motion control in designing running shoes with much attention to midsole hardness.
Barefoot Running
Basically a minimalist lifestyle is a lifestyle that is free of complications, clutter,
confusion and distraction to change their lives from turmoil, materialism, and a poor work life
balance, to something more holistic. People still believes that if something is more complex and
complicated then it must be better, but the minimalists prefer to look for elegant simplicity as the
deciding factor of quality.
The human foot is designed that the toes are spread and extended. In well-developed
societies, the foots natural shape has been changed by long wearing footwear which the heel is
elevated above the forefoot, the toes become elevated and pinched together over time. This
deforms the foot, and leads to the foot problems, gait abnormalities, musculoskeletal pathologies.
Several researches supported the claims that going barefoot was healthy and natural (Robbins &
Hanna, 1987; Cook, et al, 1990; van Mechelen, 1992). Barefoot running, minimalist running and
natural running are all terms that describe running in a manner that allows the foot to function the
way it is designed. With the release of the book about Tamahumara Indians in Mexico, Born to
Run: A Hidden Tribe, Super Athletes, and the Greatest Race the World Has Never Seen, the
interest of barefoot running has popularly risen.
In order for effectiveness and safe, persons need to organize physiologic and
neuromuscular responses to the environment. There are significant alterations to running pattern.
Several studies have found consistent changes in barefoot running, for example, decreased stride
length, increased stride rate, decreased range of motion at the ankle, knee, and hip, and more
ankle plantarflexion at foot strike which allowed weight bearing at the metatarsal heads instead
of the heel (Lieberman, 2010). Divert et al. (2005) concluded that these changes in foot strike
pattern were largely designed to reduce the impact forces.
The potential benefits of barefoot running
1. Reduction of ground reaction forces; Barefoot running reduced impact force when
performed on a sufficient number of steps (Divert, et al., 2005, 2008; Squadrone & Gallozzi,
2009; Leiberman, et al., 2010). In addition, there is adaptation of the intrinsic musculature with
resulting increased strength and, therefore, a medial longitudinal arch that is higher and better
able to deform with impact and provide improved shock attenuation (Robbins & Hanna, 1987).
De Wit et al (2000) found that runners adopted a flatter foot placement to attempt to limit local
impact on the heel when running barefoot, whereas there was a tendency to land heavily on the
heel due to the extra cushioning in running footwear.
2. Increased running economy; Burkett et al. (1985) found that oxygen consumption
during running increased as the amount of mass they added to the foot increased; shoes and
orthotics representing 1% of body mass increased oxygen consumption by 3.1%. Flaherty (1994)
found that oxygen consumption during running at 12 km/h was 4.7% higher in shoes of mass
weighing 700 g than in barefoot but there were some research stated that the difference in
running economy between shod and barefoot is not significantly different (Squadrone &
Gallozzi, 2009; Franz, Wierzbinski & Kram, 2012)
Page 17

July 9-11, 2012
3. Increased proprioceptive input; It has been suggested that footwear material densities
affected periphearal sensory information (Ganevia & Gurke, 1992; Kurz & Stergiou, 2003). The
barrier between the plantar and supporting surfaces would hinder foot position awareness
provided by feedback from plantar cutaneous mechanoreceptors in direct contact with the ground
(Robbins, et al, 1995). The continuous use of modern footwear limited sensory feedback to the
brain, which reduced the brains ability to process sensations and adapt to the motor responses
appropriately (Shakoor & Block, 2006; Doidge, 2007). The improved proprioceptive ability led
to a reduction in foot position errors and fewer lateral ankle sprains which caused by impaired
proprioception (Robbins, et al, 1995).
4. Increased muscle strength; Rao and Joseph (1992) evaluated 2,300 Indian children
between the ages of 4 and 13 and found that the incidence of flat feet was more than three times
greater in shod than in unshod leading them to conclude that shoe-wearing in early childhood
was detrimental to the development of a normal arch. Robbins and Hanna (1987) stated that
barefoot training increased adaptation of the intrinsic muscles of the foot. A recent study suggests
that minimally supported shoes might actually improve rehabilitation outcomes as compared to
conventional running shoes (Ryan, Fraser, McDonald, & Taunton, 2009).
5. Decreased risk of foot deformities; There were several studies concerned with the
increasing of hallux valgus and flatfoot in modern societies based on the assumption of
inadequate footwears consequences. Sachithanandamm & Joseph (1995) surveyed 1,846
adolescents and found that the prevalence of flat feet had increased in those who wore shoes
before the first 6 years of age which supported by the study of Staheli (1991). The stiff and tight
footwear might lead to deformities of foot structures during growing up, Wolf et al. (2008)
concluded that optimum foot development could only occur in barefoot conditions.
The potential harms of barefoot running
1. Injuries from running surfaces; The skin of the foot is exposed to debris such as glass,
nails, rocks and thorns and have a chance to injure. (Squadrone & Gallozzi, 2009).
2. Exposure to microorganisms/infectious agents; Cracks, blisters, or scrapes on the feet
will have a higher risk of infection.
3. Lack of support; Less cushioning and a thinner heel shoes should be used with caution
and awareness of the possible increased injury risks (Denton, 2005).
4. Poor running pattern; causes muscle strains.
Minimalist running shoes
The evolution of running footwear has been changed. Minimalist running shoes have
been believed that it does not only improve the efficiency of a runners stride, but also
dramatically reduce running-related injuries. By forcing a runner to land on midfoot or forefoot
instead of heel, minimalist footwear reduces the amount of impact absorbed by the ankles, hips
and knees while still protecting the feet with shoes.
The characteristics of minimalist running shoes (Richards & Hollowell, 2011; Kaselj, 2012);
1. Anatomical correctness: Minimalist shoes have little padding or arch support. It
requires a runner to rely more on their own feet and legs to take care cushioning and stability.
2. Close to the ground: The sole is made of a material is to allow proper communication
between the sensory organs of the foot and the ground. The thinner and firmer the shoe, the more
ground feel (proprioception). The increased ground feel allows the body to adjust to the forces of
running in a more efficient way and is optimal for learning natural running pattern and
Page 18

July 9-11, 2012
technique. Without a firm message to the nervous system, the body does not know which
muscles to use, how hard to turn them on, and how long to keep them on for. To get a clear
message in thick/soft shoes, people are forced to strike the ground harder and drive the foot onto
a firm surface to give the feedback that requires.
3. Neutral/lack of drop: This means the difference in height, as measured from the heel
to the ground, and the forefoot to the ground. Regular running shoes have a 12 mm to 24 mm
heel-to-toe drop, while more minimalist shoes have at least less than 9mm. It was postulated that
wearing a greater heel height provided less stability in the elderly population (Robbins et al,
1997; Tencer et al, 2004). The arches of foot are designed to be supported at the ends, and that
means heel, ball, and toes in level and balanced contact. This facilitates stability and balance in
midstance. While it will protect the foot from hazards on the ground, it will also prevent the
natural inclination of the arch to flatten over time. This will prevent the ligaments and muscles in
the foot from developing and functioning for optimum strength and health.
4. Light weight: The shoe doesnt add much to the weight of the lower leg, and allows
the foot to swing back to the ground with a natural motion.
5. Wide toe box: The toes are spread and extended. This allows for optimal balance and
stride. When the big toe is compressed to be out of alignment, the front end of the arch does not
work. The big toe is not allowed to aid in balance, stability, and propulsion.
6. Rotational and Longitudinal flexibility: Rotational flexibility is the ability to roll the
shoe up from toe to heel and the longitudinal flexibility is the ability to roll the toe box in one
direction and the heel in the other and. The foot naturally bends in all directions. Most shoes are
stiff in the middle and stiff where the toes bend at the ball of the foot or MTP joint.
7. Slipper-like: Shoes should fit well enough that they can be tied loosely enough to take
off without untying, but not come off mid-run. Minimalist shoes have little structure for the top
of the foot.
Fig. 4. The comparison between modern running shoes and minimalist running shoes
New Direction in Running Footwear
From the 1960s to present, the running footwears have been developed from brown
rubber to the super cushioning heel by many research which conducted to develop for functions
and styles. The several features; raised heel and arch support, are believed that these parts of the
shoe will help prevent common running injuries. Why are the super cushioning footwear not able
to reduce the incidences of injuries? This big question is discussed among investigators, doctors,
runners and footwear manufacturers. Consumers are looking for more comfortable, safe and
satisfied. Therefore, the studies are directly geared to the back to basics or minimalist lifestyle
to improve the functioning of footwear and let the feet move in their natural way, hold the feet in
the right places and support the body weight at the right locations.
Page 19

July 9-11, 2012
Since the human lower extremity is not a delicate, rigid, passive structure but is a
flexible, active, well designed structure which is capable of handling the impacts during
running. Dr. Froncioni (2006), the orthopaedic doctor, predicted from the medical
establishments point of view that the changes would come about in footwear design. However,
this trend has spread to the footwear manufacturers. The minimalist shoes, the better shoes with
thinner heel and less midsole which offer little protection on the heel have been launched into the
market.
Conclusion
The blogosphere and popular magazines are full of debate about barefoot running, with
testimonials to it as a more 'natural' and less injury. It seems that footwear design returns back to
a minimalistic state as the natural design of the feet and how the feet function when running. As
running shoe trends change towards minimalist shoes and shoe manufactures scramble to bring
their new products to the market. Currently there is only evidence that forefoot or midfoot
striking patterns may help prevent repetitive stress injuries. To date, there is no scientific
evidence directly examining the efficiency of minimally supported or barefoot on running
injuries.
Page 20

July 9-11, 2012
References
Andreasson, G., & Peterson, L. (1986). Effects of shoe and surface characteristics on lower limb
injuries in sports. International Journal of Sports Biomechanics, 2; 202-209.
Blazevich, A. (2007). Sports Biomechanics The Basics: Optimising human performance.London:
A & C Black Publishers
Buist, I., Bredeweg, S.W., Bessem, B., van Mechelen, W., Lemmink, K.A., & Diercks, R.L.
(2010). Incidence and risk factors of running-related injuries during preparation for a 4mile recreational running event. British Journal of Sports Medicine, 44: 598-604.
Buist, I., Bredeweg, S.W., Lemmink, K.A., van Mechelen, W., & Diercks, R.L. (2010).Predictors
of running-related injuries in novice runners enrolled in a systematic training program: A
prospective cohort study. American Journal of Sports Medicine, 38: 273-280.
Burkett, L.N., Kohrt, W.M., & Buchbinder, R. (1985). Effects of shoes and foot orthotics on VO2
and selected frontal plane knee kinematics. Medicine & Science in Sport and Exercise,
17(1): 158-163.
Cavanagh, P.R., Lafortune, M. A. (1980). Ground reaction forces in distance running. Journal of
Biomechanics, 13; 397406.
Chang, W.L., Shih, Y.F., & Chen, W.Y. (2011). Running injuries and associated factors in
participants of ING Taipei Marathon. Physical Therapy in Sport,
doi:10.1016/j.ptsp.2011.08.001.
Chiu, M.C., & Wang, M.J. (2007). Professional footwear evaluation for clinical nurses. Applied
Ergonomics, 38:133141.
Cook, S.D., Brinker, M.R., & Mahlon, P. (1990). Running shoes: their relation to running
injuries. Sports Medicine, 10: 1-8.
Denton, J.D. (2005) Light does not make right. Running Times, retrieve from
http://runningtimes.com/Article.aspx?ArticleID=5462
De Wit, B., De Clercq, D., & Aerts, P. (2000). Biomechanical analysis of the stance phase during
barefoot and shod running. Journal of Biomechanics, 33; 269-278.
Divert, C., Mornieux, G., Baur, H., Mayer, F., & Belli, A. (2005). Mechanical Comparison of
Barefoot and Shod Running. International Journal of Sports Medicine, 26(7); 593-598.
Divert, C., Mornieux, G., Freychat, P, Baly, L., Mayer, F., & Belli, A. (2008). Barefoot-shod
running differences: shoe or mass effect? International Journal of Sports Medicine,
29(6): 512-518
Dugan, S.A., & Bhat, K.P. (2005). Biomechanics and analysis of running gait. Physical Medicine
and Rehabilitation Clinics of North America, 16: 603-621.
Finestone, A., Shlamkovitch, N., Eldad, A., Karp, A., & Milgrom, C. (1992). A prospective study
of the effect of the appropriateness of a footshoe fit and raining shoe type on incidence
of overuse injuries among infantry recruits. Military Medicine, 157:489-490.
Flaherty RF (1994). Running economy and kinematic differences among running with the foot
shod, with the foot bare, and with the bare foot equated for weight. Microform
Publications, International Institute for Sport and Human Performance, University of
Oregon, Eugene, Oregon
Franz, J.R., Wierzbinski, C.M., & Kram, R. (2012). Metabolic Cost of Running Barefoot versus
Shod: Is Lighter Better? Medicine & Science in Sports & Exercise, articles
in press, doi: 10.1249/MSS.0b013e3182514a88
Page 21

July 9-11, 2012
Froncioni, J. (2006). Athletic footwear and running injuries. Retrieve from
http://www.quickswood.com/my_weblog/2006/08/athletic_footwe.html
Ganevia, S.C., & Gurke, D. (1992). Does the nervous system depend on kinesthetic nformation
to control natural limb movements. Behavioral and Brain Sciences, 15: 614-632.
Grimshaw, P., Lees, A., Fowler, N., & Burden, A. (2006). Sport and Exercise Biomechanics.
NY: Taylor & Francis.
Harrast, M. A., & Colonno, D. (2010). Stress fractures in runners. Clinical Sports Medicine, 29:
399-416.
Hart, P. M., & Smith, D. R. (2009). Preventing running injuries through barefoot activity:
sometimes dressing out means not putting on your shoes. Journal of Physical
Education, Recreation & Dance, 79(4), 50-54.
Hicks, J.H., (1954). The Mechanics of the Foot II: The plantar aponeurosis and the arch.
Journal of Anatomy, 88:25-31
Hunter, J. P., Marshall, R.N., & McNair, P.J. (2008). External and internal forces in sprint
running. In Y. Hong, & R. Bartlett (Eds.), Routledge Handbook of Biomechanics and
Human Movement Science (pp. 354-366). NY: Routledge.
Jordan, C., Payton, C.J., & Bartlett, R.M. (1997). Perceived comfort and pressure distribution in
casual footwear. Clinical Biomechanic, 12(3): S5.
Kaselj, R. (2012). Traditional shoes vs. Minimalist shoes. Retrieved from
http://exercisesforinjuries.com/traditional-shoes-vs-minimalist-shoes/
Keller, T. S., Weisberger, A. M., Ray, J. L., Hasan, S. S., Shiavi, R. G., & Spengler, D. M.
(1996). Relationship between vertical ground reaction force and speed during walking,
slow jogging, and running. Clinical Biomechanics, 11(5): 253-259.
Knapik, J. J., Brosch, L. C., Venuto, M., Swedler, D. I., Bullock, S. H., Gaines, L. S., et al.
(2010). Effect on injuries of assigning shoes based on foot shape in air force basic
training. American Journal of Preventive Medicine, 38(1 Suppl.): S197-S211
Kurz, M.J., & Stergiou, N. (2003). The spanning set indicates that variability during the stance
period of running is affected by footwear. Gait and Posture, 17: 132-135.
Lafortune, M.A., Valiant, G.A., & McLean, B. (2000). Biomechanics of Running. In J.A.Hawley
(Ed.), Handbook of Sports Medicine and Science; Running (pp. 28-43). UK: Blackwell
Science
Lieberman, D.E., Venkadesan, M., Werbel, W.A., Daoud, A.I., Andrea, S.D., & Davis, I.S, et al.
(2010). Foot strike patterns and collision forces in habitually barefoot versus shod
runners. Nature, 463; 531-535.
Lun V., Meeuwisse W.H., Stergiou P, & Stefanyshyn D. (2004). Relation between running injury
and static lower limb alignment in recreational runners. British Journal of Sports
Medicine, 38(5), 576-580.
Lynch, S.L., & Hoch, A.Z. (2010). The female runner: gender specifics [review]. Clinical Sports
Medicine, 29: 477-498.
Mann, R.A., Baxter, D.E., & Lutter, L.D. (1981). Running symposium. Foot Ankle, 1:190224.
McKay, G.D., Goldie, P.A., & Oakes, B.W. (2001). Ankle injuries in basketball: injury rate and
risk factors. British Journal of Sports Medicine, 35: 103-108.
McKinley, M., & OLoughlin, V. (2007). Human anatomy, 2nd ed. NY: McGraw-Hill.
Page 22

July 9-11, 2012
Milgrom, C., Finestone, A., Shlamkovitch, N., Wosk, J., Laor, A., Voloshin, A., et al. (1992).
Prevention of overuse injuries of the foot by improved shoe shock attenuation. Clinical
Orthopedics, 281: 189-192.
Miller, J.E., Nigg, B.M., Liu, W., Stefanyshyn, D.J., & Nurse, M.A. (2000). Influence of foot, leg
and shoe characteristics on subjective comfort. Foot and Ankle International, 21:759-767
Nigg, B.M. (1986). Biomechanics of Running Shoes. Champaign, IL: Human Kinetics.
Novacheck, T.F. (1998). The biomechanics of running. Gait and Posture, 7: 77-95.Rao, U. B., &
Joseph, B. (1992). The influence of footwear on the prevalence of flat foot, A survey of
2300 children. Journal of Bone Joint Surgery, 74(4): 525-527.
Richards, C., & Hollowell, T. (2011). The complete idiots guide to barefoot running. NY:
Penguin group.
Robbins, S.E., & Hanna, A.M. (1987). Running-related injury prevention through barefoot
adaptations. Medicine & Science in Sports and Exercise, 19(2): 148-156.
Robbins, S., Waked, E., & McClaran, J. (1995). Proprioception and stability: foot position
awareness as a function of age and footwear. Age Ageing, 24(1): 67-72.
Robbins, S.E., Waked, E., & Rappel, R. (1995). Ankle taping improves proprioception before
and after exercise in young men. British Journal of Sports Medicine, 29: 242-247.
Robbins, S., Waked, E., & McClaran J. (1997). The effect of footwear midsole hardness and
thickness on proprioception and stability in older men. Journal of Test and Evaluation,
25(1):143148.
Ryan, M., Fraser, S., McDonald, K., & Taunton, J. (2009). Examining the degree of pain
reduction using a multielement exercise model with a conventional training shoe
versus an ultraflexible training shoe for treating plantar fasciitis. Physician and
Sportsmedicine, 37(4), 68-74.
Sachithanandam, V., & Joseph, B. (1995). The influence of footwear on the prevalence of flat
foot, A survey of 1846 skeletally mature persons. Journal of Bone Joint Surgery, 77(2):
254-257.
Satterthwaite, P., Norton, R., Larmer, P., & Robinson, E. (1999). Risk factors for injuries and
other health problems sustained in a marathon. British Journal of Sports Medicine, 33:
22-26.
Shakoor, N., & Block, J. A. (2006). Walking barefoot decreases loading on the lower extremity
joints in knee osteoarthritis. Arthritis Rheumatism. 54(9): 2923-2927.
Squadrone, R., & Gallozzi, C. (2009). Biomechanical and physiological comparison of barefoot
and two shod conditions in experienced barefoot runners. Journal of Sports Medicine and
Physical Fitness, 49: 6-13.
Staheli LT. (1991). Shoes for children: a review. Pediatrics, 88(2): 371375.
Tencer, A.F., Koepsell, T.D., & Wolf, M.E. (2004).Biomechanical properties of shoes and risk of
falls in older adults. Journal of American Geriatrics Society, 52(11):1840-1846.
Taunton, J. E., Ryan, M. B., Clement, D. B., McKenzie, D. C., Lloyd-Smith, D. R., & Zumbo, B.
D. (2002). A retrospective case-control analysis of 2002 running injuries. British Journal
of Sports Medicine, 36: 95-101
Torkki, M., Malmivaara, A., Reivovnen, N., Seitsalo, S., Laippalo, P., & Hoikka, V. (2002).
Individually fitted sports shoes for overuse injuries among newspaper carriers.
Scandinavian Journal of Work, Environment and Health, 28:176-83.
Page 23

July 9-11, 2012
van Gent, R.N., Siem, D., van Middelkoop, M., van Os, A.G., Bierma-Zeinstra, S.M., & Koes,
B.W. (2007). Incidence and determinants of lower extremity running injuries in long
distance runners: a systematic review. British Journal of Sports Medicine, 41(8): 469-480.
van Mechelen,W., Hlobil, H., & Kemper, H.C. (1992). Incidence, severity, aetiology and
prevention of sports Injuries: A review of concepts. Sports Medicine,14(2):8299.
van Mechelen, W. (1992). Running injuries: a review of the epidemiological literature. Sports
Medicine, 14(5): 320-335.
van Middelkoop, M., Kolkman, J., Van Ochten, J., Bierma-Zeinstra, S. M., & Koes, B.W.(2008).
Risk factors for lower extremity injuries among male marathon runners. Scandinavian
Journal of Medicine & Science in Sports, 18: 691-697.
Williams, D.S., McClay, I.S., Hamill, J., & Buchanan, T.S. (2001). Lower extremity kinematic
and kinetic differences in runners with high and low arches. Journal of Applied
Biomechanics, 17: 153163.
Winter, D. A. (1983). Moments of force and mechanical power in jogging. Journal of
Biomechanics, 16: 9197.
Wolf, S., Simon, J., Patikas, D., Schuster, W., Armbrust, P., & Doderlein, L. (2008). Foot motion
in children: a comparison of barefoot walking with shod walking in conventional and
flexible shoes. Gait and Posture 27(1): 51-59.
Page 24

July 9-11, 2012
HSO65-3
Factors Predicting the Physical Activity Participation

in Older Americans
Kittiwan Junrith1 and James H. Swan2.
1Department of Public Health, Faculty of Sciences and Technology, Uttaradit Rajabhat
University, Uttaradit 53000, Thailand.
2Department of Applied Gerontology, University of North Texas, USA.
E-mail: kittiwanjunrith@yahoo.com
Abstract
Physical activity is one aspect of healthy lifestyles that is associated with overall health
outcomes and health care expenditure among older adults. With an increasing older population in
the U.S., there is limited information on physical activity in this group and even less for those
experiencing difficulties in physical functioning and chronic illnesses. The objective of the study
was to determine how demographic factors, physical factors, psychological issues, chronic
illnesses, pain symptoms, and perceived health status influence physical activity participation in
older respondents aged 50 or over in the U.S. The study is based on the National Health
Interview Survey (NHIS) from 2002 to 2009. Ordinal logistic regression analysis was used to
predict and explain the physical activity participation in older respondents. Factors associated
with more physical activity participation included a higher level of education, more positively
perceived health status, and having at least one chronic illness or pain symptoms. Respondents
with difficulties in physical functioning reported less physical activity participation. This study
provides the most recent evidence to health care providers to develop and implement policies and
strategies to facilitate physical programs that will be beneficial to older adults living in the U.S.
Keywords: physical activity participation, older adults, difficulties in physical functioning,
chronic illnesses, perceived health stat
INTRODUCTION
Older populations in the United States have steadily increased in the past two decades.
Between 2010 and 2050, the United States is projected to experience rapid growth in its older
population. In 2050, the number of Americans aged 65 and older is projected to be 42%, up from
20% in 2010 (U.S. Census Bureau, 2010b).
As individuals live longer, health promotion behaviors become even more important,
particularly with regard to maintaining function and independence and improving quality of life.
The U.S. Department of Health and Human Services focuses on health promotion and aging
through regular exercise, smoking cessation, nutrition, avoiding excessive alcohol use, and having
age-appropriate immunizations (Lang, Moore, Harris, and Anderson, 2005). These behaviors are
encouraged to reduce the potential years of life lost to premature mortality and ensure better
quality of remaining life (McAuley et al., 2006).
Page 25

July 9-11, 2012
Physical activity is the component of lifestyle that has been associated with health
outcomes. Regular physical activity in older adults is associated with an overall improvement in
health, functional capacity, quality of life, and independence (Brach, Kriska, Glynn, and Newman,
2008). Exercise increases functional capacity and plays a role in both primary and secondary
prevention of coronary heart disease (CHD) risk factors. Physical activity is also associated with
improvements in various indexes of psychological functioning, such as depression, and may
enhance cognitive functioning in patients with impairments (Klieman et al., 2007; Prohaska et al.,
2006; Ton et al., 2010). However, approximately one-third of those older than 65 years of age
report no leisure-time physical activity. Older adults often face multiple barriers to initiating and
maintaining a regular exercise program (Klieman et al., 2007).
The likelihood of having one or more co-morbidities increases with age. Among people
aged 65 and older, 43% have three or more chronic conditions, and 24% have four or more chronic
conditions. Having more than one chronic condition complicates maintaining an active lifestyle,
including the ability to exercise regularly (Klieman et al., 2007). Older people face other common
functional impairments. Community-dwelling citizens in the U.S. aged 65 and older reported
having difficulty with simple activities like walking, stooping, lifting, and getting in and out of a
bed or chair. These limitations certainly influence the older persons desire and willingness to
engage in regular safe physical activity (Klieman et al., 2007). However, it is important to consider
the elderly adults have unique perspectives when creating health promotion strategies. It is clear
that older people need forms of exercise that are compatible with their capabilities (both physical
and mental) (Nakasato and Carnes, 2006). One of the most effective strategies for enhancing
independence is to prolong active or functional life styles by the detection and prevention of ageassociated functional deterioration (Lubben and Damron-Rodriguez, 2003; McPhee, Johnson, and
Dietrich, 2004; Myers and Degges-White, 2007).
Elderly adults have a different approach for engaging in health-promotion activities.
Increasing age seems to lead to less participation in healthy activities (Klieman et al., 2007;
Orsega-Smith, Payne, Mowen, Ho, and Godbey, 2007). Therefore, it is useful to use an individual
approach to predict participation in healthy activities among older adults.
The purpose of this study is to identify factors influencing physical activity in the older
population in the U.S. This section presented background information on the problem and its
significance for older adults. The information justified efforts to determine the factors influencing
physical activity in the foreign born. Having a strong knowledge base of the factors influencing
physical activity participation among the older population will provide the foundation for
developing effective interventions and programs that would increase physical activity participation
in this group.
Sources of the data are the 2002-2009 National Health Interview Survey (NHIS). The
sample focuses on the older population aged 50 years and older. Because Americans aged 50-64
are the pre-retirement group that will be transferred to the retirement group in the future and older
adults at the age over 50 are in the Baby Boomers generation that will be increased in the future.
To increase sample sizes, the data was pooled from eight years of the Adult Sample, 2002-2009,
resulting in 93,846 older populations.
Page 26

July 9-11, 2012
Physical activity status is defined as frequency and duration of vigorous and moderate
physical activity during leisure time.
- Adults classified as inactive reported no sessions per week of moderate or vigorous
leisure time or strengthen activity of at least 10 minutes in duration.
- Adults classified as having some leisure time physical activity reported at least one
session per week of moderate or vigorous physical activity or strengthen activity of at least 10
minutes in duration but did not meet the definition of regular leisure time physical activity.
- Adults classified as having regular leisure time physical activity reported three or more
sessions per week of vigorous activity lasting 20 minutes or five or more sessions per week of
moderate activity lasting at least 30 minutes or three or more sessions per week of strengthen
activity of at least 10 minutes in duration.
Difficulties in physical functioning: These refer to the degree of difficulty respondents
experienced performing eight physical activities without the assistance of another person and
without using special equipment. The items were added to give scores ranging from 0 to 5, with
higher scores indicating greater difficulties in physical functioning. This subscale has
demonstrated reliability among older adults with internal consistencies at Cronbachs alpha was
0.917.
Psychological issues: These refer to six types of mental characteristics. Respondents could
choose from five response categories. The items were added to give scores ranging from 1 to 5,
with higher scores indicating less psychological issues. This subscale has demonstrated reliability
with internal consistencies at Cronbachs alpha was 0.870.
Chronic illnesses: Respondents were asked if a doctor or other health professional had
ever told them that they had heart disease, hypertension, stroke, asthma, chronic bronchitis, cancer,
diabetes, and arthritis.
Pain symptoms: Respondents were asked if they had specific pain symptoms in the past 3
months (chronic joint symptoms, migraines or severe headache, pain in the neck, pain in the lower
back, or pain in the face and jaw.
Perceived health status: This is the subjectively perceived health of an individual in
general is excellent, very good, good, fair or poor.
A multivariate analysis was used to describe the attribute of physical activity and also
some aspects of the socio-demographic factors. A multivariate logistic regression analysis
(RLOGIST in SAS-Callable SUDAAN) was used to examine the association between the
dependent variable and the independent variables by controlling for the other variables.
RESULTS
Table 1 shows an overview of the respondents general demographic characteristics by
age, gender, education levels, and marital status. About 58% of older respondents were male with
an average age of 63.7 (standard deviation is 10.6). The majority of older respondents reported as
at least high school level of graduation (30.8%). Around two-thirds of older population reported
being married.
Page 27

July 9-11, 2012
Table 1 Demographic Characteristic of Respondents Aged 50 and Over
Table 2 shows the frequency and percent distribution of physical factors (difficulties in
physical functioning) in older respondents. Only 3.4% of the older population responded very
difficult to do or cant do at all to use fingers to grasp or handle small object without special
equipment; by comparison, 16.9% responded very difficult to do or cant do at all to stand for 2
hours without special equipment and 16.6% reported very difficult to do or cant do at all to
stoop/bend/kneel without special equipment. The highest percentage of difficulties in physical
functioning for which the older respondents report cant do at all are standing, walking, and
pushing or pulling large objects without special equipment (10.9%, 8.9%, and 8.2%, respectively).
The average score on difficulties in physical functioning is 0.7 with a standard deviation of 34.4.
The minimum score is 0 and the maximum score is 5.
Page 28

July 9-11, 2012
Table 2 Frequency and Percent Distribution of Difficulties in Physical Functioning in
Respondents
Difficulties in Physical Functioning
Physical Factors
Not at all
difficult
Only a little
difficult
Somewhat
difficult
Very
difficult
Cant do at
all
n(%)
n (%)
n(%)
n(%)
n(%)
Do not do
this
activity
n(%)
Walking mile without

special equipment
62,174(69.1)
6,782(6.9)
6,308(6.5)
5,268(5.2)
9,056(8.9)
3,379(3.5)
Climb 10 steps without

special equipment
67,763(75.5)
6,420(6.4)
5,503(5.4)
4,932(4.6)
6,369(6.0)
2,349(2.1)
Stand 2 hours without

special equipment
59,058(65.7)
71,06(7.5)
6,490(6.7)
6,965(6.0)
11,046(10.9)
3,448(3.2)
Stoop/Bend/kneel
without special
equipment
55,179(60.6)
10,319(11.2)
9,647(10.1)
8,456(8.6)
8,228(8.0)
1,519(1.5)
Reach over head

without special
equipment
77,938(84.6)
5,100(5.2)
4,778(4.7)
2,934(2.9)
2,067(2.0)
653(0.6)
Use fingers to grasp

small objects without
special equipment
78,569(85.2)
6,128(6.2)
4,783(4.9)
2,719(2.6)
863(0.8)
301(0.3)
Lift or carry 10 pounds

without special
equipment
72,315(80.0)
5,222(5.1)
4,686(4.6)
3,398(3.1)
5,426(5.1)
2293(2.1)
Push or pull large

objects without special
equipment
64,993(72.1)
5,682(5.9)
4,963(5.1)
3,894(3.7)
85,18(8.2)
5,269(5.0)
Page 29

July 9-11, 2012
Table 3 Frequency and Percent Distribution of Psychological Issues in Respondents
Categories of Mental Characteristics
Psychological
Issues
All of the
time
Most of the
time
Some of the
time
A little of the
time
None of the
time
n(%)
n (%)
n(%)
n(%)
n(%)
Sadness
1,145(1.1)
2,539(2.4)
8,985(8.9)
12,068(12.5)
67,432(75.1)
Hopelessness
852(0.8)
1,439(1.4)
4,247(4.2)
4,918(5.0)
80,661(88.6)
Worthlessness
917(0.9)
1,234(1.2)
3,309(3.4)
3,719(3.8)
82,911(90.7)
Everything is an
Effort
2,209(2.2)
3,053(3.1)
7,701(8.1)
8,503(9.1)
70,604(77.5)
Feeling of
Nervousness
1,588(1.6)
2,638(2.6)
9,811(10.4)
14,655(16.1)
63,475(69.3)
Feeling of
Restlessness
1,848(2.0)
2,876(3.0)
10,310(11.1)
12,869(14.1)
64,237(69.8)
Table 3 presents the frequency and percent distribution of psychological issues in

respondents reported over the past 30 days. Overall, 12.4% of the older respondents experienced
feelings of sadness all of the time, most of the time, and some of the time. About 6.4% felt
hopeless; 3.5% felt worthless; 13.4% felt like everything was an effort; 14.6% felt nervous; and
about 16.1% felt restless all, most, or some of the time during the same period.
The average score on psychological issues in older respondents is 4.7 with a standard
deviation of 18.6. The minimum score is 1 and the maximum score is 5.
Page 30

July 9-11, 2012
Table 4 Frequency and Percent Distribution of Chronic Illnesses and Pain Symptoms in
Respondents
From the Table 4, the respondents reported the highest percentage of hypertension, arthritis,
and diabetes (47.6%, 40.1%, and 16.2%, respectively). In terms of pain symptoms, respondents
reported the high percentage of chronic joint symptoms, pain in lower back, and pain in face and jaw
(44.8%, 31.2%, and 16.3%, respectively). The findings also reported that about 73% of older
respondents had at least one chronic illness, and about 60% reported at least one pain symptom. About
80% of respondents reported their health status as excellent, very good and good, while only 20%
reported their health status as fair or poor. About 44% of older adults reported inactive in physical
activity, 24.5% reported participation in some physical activity, and 32% reported regular physical
activity.
Page 31

July 9-11, 2012
Table 5 Ordinal Logistic Regression Results Predicting Physical Activity Participation in Older
Respondents
Table 5 presents the ordinal logistic regression predicting the physical activity participation in
older adults. Respondents aged 65 and over are more likely to participate in physical activity than
those who are younger (OR=1.15). Married older respondents reported more physical activity
participation (OR=1.06). The odds ratio of difficulties in physical functioning equal to 0.64 means that
with each score increase in difficulties in physical functioning, the predicted likelihood of participation
in physical activity in respondents decreases by about 36%. Older adults who reported more positively
health status reported more physical activity participation. Respondents having chronic illnesses or
pain symptoms reported more physical activity participation (OR=1.18. and OR=1.27, respectively).
DISCUSSION
Changes in body system are highly prevalent in older adults and it affects the physical activity
participation in older adults. This result of the study is consistent with the previous research that
reported that older adults had some difficulty in daily living (Cigolle et al., 2007; Henchoz et al., 2008;
Klieman et al., 2007). Ferrini and Ferrini (2008) also demonstrated that older persons experienced a
decrease in muscular strength and flexibility in joints thataffected limited movement. In addition, a
recent study demonstrated that about 80% of seniors had at least one chronic health condition (U.S.
Census Bureau, 2005). This is consistent with the previous research that older adults participate in less
physical activity because they experience barriers to maintain physical activity (Klieman et al., 2007).
Drewnoski et al. (2003) also pointed out that the most common reported barriers to physical activity in
Page 32

July 9-11, 2012
older adults were age-related conditions that limit physical mobility and inhibit participation in
physical activity. Older adults with better physical functioning reported more adequate physical
activity than those with poor physical functioning (Lim and Taylor, 2005). The motivating factor that
influenced healthy behaviors in older adults was perceived health limitation. The older adults with
perceived health limitations were less likely to participate in exercise and physical recreation (Holahan
and Suzuki, 2005). In addition, this result supports the ideas established by earlier research that when
older adults need help with daily activity, they are more likely to reduce their participation in physical
activity (Elkjaer, Poulsen, and Avlind, 2006).
The results indicated that older respondents who had at least one chronic illness or at least one
pain symptom were more likely to participate in physical activity. Lim and Taylor (2005) argued that
were barriers to physical activity in older adults. Older women reported that health problems were
associated with more physical activity barriers (Kowal and Fortier, 2007). Older adults aged 65 and
over with no chronic illness met the guidelines for leisure time physical activity more often than those
with one or more chronic illnesses. In addition, pain and the presence of mobility and dexterity
problems were factors that impede respondents in achieving the recommended level of physical
activity (Ashe et al., 2009). The data analysis from the 2007 Behavioral Risk Factors Surveillance
System (BRFSS) survey of older adults with diabetes mellitus (DM) revealed that respondents with
coronary heart disease were associated with a lower rate of meeting physical activity
recommendations, and older adults with DM were significantly less likely than older adults without
DM to engage in physical activity at the recommended levels (Zhao et al., 2011).
One possible explanation for this outcome is the awareness about benefit of physical activity
in older adults. Wojtek et al. (2009) mentioned that older adults engaged at least some daily physical
activity and refusing sedentary lifestyle may reduce the risk of developing chronic diseases, lower risk
of developing functional limitations, and lower risk of mortality. Klieman et al (2007) also pointed out
that physical activity help control the pain that is associated with arthritis in older adults. In addition,
the earlier research by Turner et al. (2007) also revealed that the strongest effects on reported increase
in physical activity in older adults were physician recommendation (Turner et al., 2007). Ashe et al.
(2009) also stated that walking was the activity most used for older adults with chronic diseases and
physicians are more likely to recommend walking as physical activity in older adults.
The results indicated that older respondents who reported their health status as excellent or
very good are more likely to participate in physical activity than those who reported their health status
as good. The results from this study corroborate earlier research that found that older adults who
reported their health status as very good or excellent reported more participation in walking than those
who reported their health as poor (Friis et al., 2003). In addition, poor perceived health status was one
of the personal barriers to physical activity in older adults (Belza et al., 2004; Orsega-Smith et al.,
2007).
The size of the older population in the U.S. has been increasing rapidly and now represents a
large portion of the population (U.S. Census Bureau, 2004; U.S. Census Bureau, 2010a; U.S. Census
Bureau, 2010b). Healthy behaviors in older adults should address various issues to discover how
physical activity benefits or threatens older adults health. Specifically, an investigation is needed to
Page 33

July 9-11, 2012
analyze the relationships and dynamics between individual characteristics, social circumstances, and
physical activities in this population. A better understanding of these associations provides the basis
for and opportunity to design physical activity intervention for community-dwelling older populations
who have difficulties in physical functioning, chronic illnesses, or pain symptoms. The results of the
study also provide health care professionals who care about older adults with potentially useful
information on the patterns of physical activity participation. Health professionals and researchers
should pay attention to physical activity intervention for specific needs of this group or should be
provided with technical consultants with the appropriate type of physical activity for individuals with
physical problems.
The results of this study suggest direction for future study about potentially important
variables, namely social support and social networks, were excluded from this analysis due to the
limitation of the data set. Future studies should consider the inclusion of social support to develop a
better understanding of the social circumstances that affect physical activity participation in older
population.
Additionally, to promote and facilitate the physical activity of older adults, it is necessary to
understand the factors that affect their decisions to engage in physical activity. Information regarding
physical activity and factors describing the physical activity can be useful for health-care professionals
to develop and implement appropriate health promotion interventions for older immigrants. As a
result, quality of life and successful aging of older population will be increased.
Page 34

July 9-11, 2012
REFERENCES
Ashe, M.C., Miller, W.C., Eng, J.J., & Noreau, L. 2009. Older adults, chronic diseases and leisuretime physical activity. Gerontology 55: 64-72.
Belza, B., Walwick, J., Shiu-Thornton, S., Schwartz, S., Taylor, M., & LoGerfo, J. 2004. Older adult
perspectives on physical activity and exercise: Voices from multiple cultures. Preventing
Chronic Disease 1(4): 1-11.
Brach, J.S., Kriska, A.M., Glynn, N.W., & Newman, A.B. 2008. Physical activity and the older adults:
Measurement, benefits, and risks. Current Cardiovascular Risk Reports 2: 305-310.
Cigolle, C.T., Langa, K.M., Kabeto, M.U., Tian, Z, & Blaum, C.S. 2007. Geriatric conditions and
disability: The health and retirement study. Annals of Internal Medicine 147(3): 156-164.
Elkjaer, E., Poulsen, T., & Avlind, K. 2006. Stability and change in physical
activity in old age: the role of changes in disability. European Journal of Ageing 3: 89-97.
Ferrini, A.F., & Ferrini, R.L. 2008. Health in the later years. New York: McGraw-Hill Companies.
Friis, R.H., Nomura, W. L., Ma, C.X., & Swan, J.H. 2003.Socioepidemiologic and health-related
correlates of walking for exercise among the elderly: Results from the longitudinal study of
aging. Journal of the Aging and Physical Activity 11(1): 54-65.
Henchoz, K., Cavalli, S., & Girardin, M. 2008. Health perception and health status in advanced old
age: A paradox of association. Journal of Aging Studies 22: 282-290.
Holahan, C.K., & Suzuki, R. 2005. Motivational factors in health promoting behavior in later aging.
Activities, Adaptation & Aging 30(1): 47-60.
Klieman, L., Hyde, S., Berra, K., & Haskell, W. 2007. Exercise and older adults. Current
Cardiovascular Risk Reports 1: 335-339.
Lang, J., Moore, M.J., Harris, A.C., & Anderson, L.A. 2005. Healthy aging:
Priorities and programs of the Centers for Disease Control and Prevention. Generations: 24-29.
Lim, K., & Taylor. L. 2005. Factors associated with physical activity among older people-a
population-based study. Preventive Medicine 40(1): 33-40.
Lubben, J.E., & Damron-Rodriguez, J. 2003. An international approach to community health care for
older adults. Family & Community Health 26(4): 338-349.
McAuley, E., Kanopack, J.F., Motl, R.W., Morris, K.S., Doerksen, S.E. & Rosengren,
K.R. 2006. Physical activity and quality of life in older adults: Influence of health status and
self-efficacy. Annals of Behavioral Medicine 31(1): 99-103.
McPhee, S.D., Johnson, T.R., & Dietrich, M.S. 2004. Comparing health status
with healthy habits in elderly assisted-living residents. Family & Community Health 27(2):
158-169.
Myers, J.E., & Degges-White, S. 2007. Aging well in an upscale retirement community: The
relationships among perceived stress, mattering, and wellness. Adultspan Journal 6(2): 96110.
Nakasato, Y.R., & Carnes, B.A. 2006. Health promotion in older adults promoting successful aging in
primary care settings. Geriatrics 61(4): 27-31.
Orsega-Smith, E.M., Payne, L.L., Mowen, A.J., Ho, C.-H., & Godbey, G.C.
2007. The role of special support and self-efficacy in shaping the leisure time physical activity
of older adults. Journal of Leisure Research 39(4): 705-727.
Prohaska, T., Belansky, E., Belza, B., Buchner, D., Marshall, V., McTigue, K., Wilcox, S. 2006.
Physical activity, public health, and aging: Critical issues and research priorities. Journal of
Gerontology 61B: S267-S273.
Page 35

July 9-11, 2012
Ton, T.G.N., Steinman, L., Yip, M.-P., Ly, K.A., Sin, M.-K., Fitzpatrick, A.L., & Tu, S.-P. (2010).
Knowledge of cardiovascular health among Chinese, Korean and Vietnamese immigrants to
the US. Journal of Immigrant Minority Health 13(1): 127.
Turner, K., Swan, J.H., & McClung, M. 2007. Increased physical activity and senior center
participation. Speech presented at American Public Health Association conference annual
convention, Washington, DC.
U.S. Census Bureau. 2004. The foreign-born population in the United States: 2003, P20-551.
Washington D.C: U.S Department of Commerce, Bureau of the Census.
U.S. Census Bureau 2005. 65+ in the United States: 2005, P23-209.Washington D.C: U.S Department
of Commerce, Bureau of the Census.
U.S. Census Bureau 2010a. Nativity status and citizenship in the United States: 2009, ACSBR/09-16.
U.S. Census Bureau. 2010b. Place of birth of the foreign-born population: 2009, ACSBR/09-15.
Wojtek, J.C., David, N.P., Maria, A.F., Christopher, T.M., Claudio, R.N., George, J.S., & James, S.S.
2009. Exercise and physical activity for older adults. Medicine & Science in Sport & Exercise
41(7): 1510-1530.
Zhao, G., Ford, E.S., Li, C., & Balluz, L.S. 2011. Physical activity in U.S. older adults with diabetes
mellitus: Prevalence and correlates of meeting physical activity recommendations. Journal of
the American Geriatrics Society 59(1): 132-137.
Page 36

July 9-11, 2012
HSO133-4
MOTIVATIONS OF STUDENTS TO PARTICIPATE IN

KARATE-DO CLUB AT DONG THAP UNIVERSITY
Tri Thien Huynh1 and Kim Ngan Huynh Nguyen2

1 Ton Duc Thang university, Ho Chi Minh city, Viet Nam
2 Dong Thap university, Dong Thap city, Viet Nam
E-mail: huynhtrithien@hotmail.com
Abstract
Purposes. This study aimed to measure the motivations affecting students when they participate in the
activities at the martial arts club of sport center at Dong Thap university and to perceive the limitations
in the training at the center.
Methods. This study adopted non-probability sampling method over one month in October, 2011,
with strategic and subjective questionnaires. A total 800 survey questionnaires were distributed at
Karate-do club. Finally, 604 questionnaires were collected as useable (ratio = 75.5%), and other
questionnaires were useless. The Likerts Scale was employed in the questionnaire for each question;
(5 excellent, 4 good, 3 average, 2 fair and 1 poor). The descriptive statistics, t-test, one-way
ANOVA are used as the tools to analysis the data collection by using the SPSS for Windows version
16.0.
Results. The results of this study were
(1) As regards demographics, the most participants was female and freshmen. In term of living
place, most of respondents stayed at near by school and in Dormitory. Regards level of participation,
most of respondents participated around 3 4 times/week at Karate-do club (43.5%) and this was the
largest group.
(2) Turning to the students motivations, the highest level of agreement from students was the
factor of Health demand (with the average mean = 3.94). Conversely, the lowest level of average mean
of Students motivation was Psychological demand (with the average mean = 2.94).
In conclusion, this research has several implications for researchers and other college health
professionals with an interest in promoting physical activity. This research provides a better
understanding of behaviors of college students with respect to the motivation constructs. Therefore,
practitioners could benefit from tailoring promo-tional materials to address differences in their efforts
to increase participation in these clubs among college students.
Keywords: karate-do clubs and motivations.
INTRODUCTION
Karate-do was introduced from Japan to Vietnam more than four decades ago. The military
has long established a special battle tactic training team that utilizes karate-do, and the police force has
also practiced it in regular training. In addition, most schools have karate-do clubs on campus, and
hundreds of private establishments are scattered throughout the country.Today, there are thousands of
karate-do training halls in Vietnam and there have been over hundreds of athletes participating in
Page 37

July 9-11, 2012
Vietnamese karate-do championship each year. And, the athletes of this style of martial art also got
many high results in the international tournament.
Dong Thap University has set for targets in its educational strategy to form and train a group
of professional trainers in martial arts who, after graduation, will be able to teach both normal school
subjects and martial arts, and in their special field, will be able to set up martial arts clubs good
enough to reach their goals in exercising the body and enhancing the mind and virtue, to train you
athletes for different competitions in the province, and to promote the development of the sports.
Although Dong Thap university is not a big university in Vietnam however, the movement of physical
education in this university is interested in many kind of sports, especially karate-do.
There are hundreds of students who are participating karate-do at physical education class as
well as extra-curriculum programs. However, there are not only karate-do in Dong Thap university,
but also are other sports such as football, volleyball, badminton, or tennis, especially there are the
highly competitive between martial art items including taekwondo, wushu, judo, and so on. As
competition among the karate-do classes and programs with other sports is intensive, students
behaviors become an integral part in this kind of teaching. If karate-do programs understand either
fulfill students motivations and contraints, it will be difficult for the karate-do programs to be
successful in the customer-oriented market. Therefore, managers, operators and teachers of karate-do
classes and programs get to provide the best understand to students in order to gain more students at
these classes.
This study attempted to explore students behaviors including there motivations of programs
in karate-do classes system because it was advantageous to expand and improve the karate-do
movement at Dong Thap university. The researcher works as a teacher of karate-do department of
physical education at Dong Thap university. Her main responsibility was to manage the class system,
ensure the service quality in order to increase the students satisfaction level as well as quantity of
participating student. Hence, the researcher was inspired to conduct research on this topic since
students behaviors in order to clearly understand what students want and need in this kind of sport
activities at Dong Thap university.
METHODS
Procedures of the study. After the formation of draft questionnaire, the questionnaire was sent
to eight leading experts who specialize in teaching and training in the field of sports and physical
education from different areas for the content validity. There were two experts from National Taiwan
Sport University, two experts from Ho Chi Minh city University of Sport, two experts from Dong
Thap university. After the feedbacks from the experts data were analysed and synthetised, the
questionnaire was rewritten and redesigned.
Once the content validity had completed, a pilot study was arranged to test the convergent
validity and internal consistent reliability. This study was implemented with 100 students in Thu Dau
Mot university in Binh Duong Province for a final check of its validity. With the qualified
questionnaire, the formal survey was conducted.
Page 38

July 9-11, 2012
After that, the final questionnaire was sent to eight students who were participating in karatedo club at Dong Thap university in order to examine their motivations.
Subjects of the study. In this study, 800 subjects were randomly selected from a total of 1,000
students participating in the Karate-do club at Dong Thap university. The subjects was asked to
complete the questionnaire during July 2011.
Data analysis. Depending on the research objects, the resercher used both the descriptive
analysis and the inferential statistic to satisfy the demand of this study. The data will collect, code by
using SPSS program for Windows version 16.0. 800 copies of the questionnaire were analyzed in
three sections: demographic profile of members, level of members motivation. In addition,
percentage and mean score were calculated by using the SPSS for Windows version 16.0. The
descriptive statistics, t-test, one-way ANOVA are used as the tools to analysis the data collection.
RESULTS
The current situation of students participating in Karatedo club.
This study adopted non-probability sampling method over one month which began from 1st
Aug, and finished at 30th Oct, 2011, with strategic and subjective questionnaires. A total 800 survey
questionnaires were distributed at Karate-do club. Finally, 604 questionnaires were collected as
useable (ratio = 75.5%), and other questionnaires were useless.
The basic attributes of respondents, including six major variables in this study were (1)
gender, (2) academic year, and (3) living place because of the students situation. After running
statistical analysis, the results were come out as Table 4.3 following
Page 39

July 9-11, 2012
In term of participants gender, most of respondents were female (52.3%, n = 316), while
males occupied less than (47.7%, n = 288). As regards academic groups of participants, four groups
were categorized in this study: 36.3% (n = 219) of the participants were Freshmen and this was the
largest group; 23.8% (n = 144) of the participants were Junior student and this was the second largest
group; 23.3% (n = 141) of the participants were Sophomore. The smallest group, composed of 16.6%
(n = 100) of the sample, was composed of respondents that were Senior student.
In term of living place, most of respondents stayed at near by school (53.1%, n = 321) and this
was the largest group; 29.3% (n = 177) of the participants stayed in Dormitory and this was the second
largest group. The smallest group, composed of 17.5% (n = 106) of the sample, was composed of
respondents that stayed at home.
Moreovers, regards level of participation, most of respondents participated around 3 4
times/week at Karate-do club (43.5%, n = 263) and this was the largest group; 34.3% (n = 207) of the
participants participated around 1 2 times/week and this was the second largest group; 8.8% (n = 53)
of the participants enjoyed 2 3 times/month; and 7% (n = 42) of the participants took part in almost
everyday. The smallest group, composed of 6.5% (n = 39) of the sample, was composed of
respondents that participated in Karate-do club at once a month.
Students motivation.
In the second part of research question, researchers examined the opinions of students on their
motivations when participated in Karate-do club at Dong Thap university. There are four main items
involved students motivations including health demand, achievement demand, psychological demand
and leisure demand in order to measure these behaviors of students.
In addition, matching with these four items, there are twenty sub-items which were included in
the questionnaire. The Likert 5 points scale with five levels from (1) strongly disagreed to (5) strongly
agreed. The descriptive statistic was used to analyze the most frequency of participants. The four items
and twenty sub-items were evaluated and ranked individually using the following scale: (a) strongly
agreed, from 4.50 to 5.00; (b) agreed, from 3.50 to 4.49; (c) neutral, from 2.50 to 3.49; (d) disagreed,
from 1.50 to 2.49; and (e) strongly disagreed, from 1.00 to 1.49.
Health demand. With Health demand item, all four sub-items were evaluated and ranked as
agreed (i.e. mean score of this from 3.50 to 4.49) including You participate in sports and physical
exercises to improve health (mean = 4.33), and You participate in sports and physical exercises to
free up energy (mean = 3.58)
Page 40

July 9-11, 2012
Achievement demand. With Achievement demand item, there were four sub-items were
evaluated and ranked as agreed (i.e. mean score of this from 3.50 to 4.49) including You participate
in sports and physical exercises to be able to defend yourself (mean = 4.27), You participate in
sports and physical exercises to protect yourself and your family (mean = 4.06), and You participate
in sports and physical exercises to master fighting techniques (mean = 3.79).
Other three of the rest sub-items were evaluated and ranked as neutral (i.e. mean score of
this from 2.50 to 3.49) including You participate in sports and physical exercises to obtain the black
belt (mean = 3.14), You participate in sports and physical exercises to take part in contests (mean =
3.10), and You participate in sports and physical exercises to become an instructor (mean = 2.96).
Psychological demand. With Psychological demand item, there were just one sub-item were
evaluated and ranked as agreed (i.e. mean score of this from 3.50 to 4.49) including You participate
in sports and physical exercises because you feel more confident (mean = 3.52).
Other six of the rest sub-items were evaluated and ranked as neutral (i.e. mean score of this
from 2.50 to 3.49) including You participate in sports and physical exercises because you want to be
relieved from stress (mean = 3.45), You participate in sports and physical exercises because your
parents encourage you to (mean = 2.83), and You participate in sports and physical exercises
because your friends encourage you to (mean = 2.79).
The other results on Psychological demand were described on Table 4.6 following
Leisure demand. With Leisure demand item, there were just one sub-item were evaluated and
ranked as agreed (i.e. mean score of this from 3.50 to 4.49) including You participate in sports and
physical exercises because you like to be with friends (mean = 3.58).
Page 41

July 9-11, 2012
Other two of the rest sub-items were evaluated and ranked as neutral (i.e. mean score of this
from 2.50 to 3.49) including You participate in sports and physical exercises to encourage your
friends to take part (mean = 3.36), and You participate in sports and physical exercises because you
like to travel and to be outdoors (as provided by competitions) (mean = 2.97).
According to Figure 4.2, the highest level of agreement from students was the factor of Health
demand (with the average mean = 3.94). Conversely, the lowest level of average mean of Students
motivation was Psychological demand (with the average mean = 2.94). The other average mean of the
Students motivation were described in Figure 4.2, following
Page 42

July 9-11, 2012
CONCLUSION
The following conclusions were showed as a result of the research findings regarding karatedo clubs at Dong Thap university.
1. As regards demographics, the most participants was female and freshmen. In term of living
place, most of respondents stayed at near by school and in Dormitory. Regards level of participation,
most of respondents participated around 3 4 times/week at Karate-do club (43.5%) and this was the
largest group; 34.3% of the participants participated around 1 2 times/week and this was the second
largest group; 8.8% of the participants enjoyed 2 3 times/month; and 7% of the participants took part
in almost everyday. The smallest group, composed of 6.5% of the sample, was composed of
respondents that participated in Karate-do club at once a month.
2. Turning to the students motivations, the highest level of agreement from students was the
factor of Health demand (with the average mean = 3.94). Conversely, the lowest level of average mean
of Students motivation was Psychological demand (with the average mean = 2.94).
This research has several implications for researchers and other college health professionals
with an interest in promoting physical activity. This research provides a better understanding of
behaviors of college students with respect to their motivation. This examination of physical activity
among college students at karate-do club should be of interest to those fostering programs, services
and facilities to support this behavior, and particularly campus recreation professionals. The task of
improving system of karate-do clubs becomes more concrete with this newly extracted
multidimensional scale, which might be termed fitness and sport service quality. This is because sports
and fitness service providers can obtain valuable information regarding the components of the quality
service expectations, and they can take action to gauge the extent to which these expectations are
satisfied by the services offered.
Page 43

July 9-11, 2012
Finally, the target market for the karate-do training halls were students. The priority of
participation motivation among karate-do members was exercising to become healthier. It also pointed
out that the first participation motivation was the factor of body needs, then knowledge needs and
achievement needs. Therefore, the karate-do programs need to enhance their related fitness activities,
and try to promote the health of their students.
Page 44

July 9-11, 2012
HSO61-5
Tai Lue Food: Nutritive Dimension

Saowapa Sakkayaphan
Chiang Mai Rajabhat University, Chiang Mai ,50300,Thailand
E-mail:saosakka@yahoo.com
Abstract
This study aims at investigating nutritive values of the ethnic food, Tai Lue food, in
Xishuangbanna and Lanna. The data and types of foods were collected through interviewing 40
key informants known to be highly specialized in this kind of ethnic food. Ten dishes commonly
consumed by Tai lue people in each region were analyzed for nutritive values in a chemical
laboratory. It is found the food with higher energy are crab paste, crab curry , hor-nung, grilled
fish and pickling pak-kum curry. In each 100 grams of the foods, they are shown 207.16
kilocalories, 146.80 kilocalories,125.68 kilocalories, 115.70 kilocalories and 111.62 kilocalories,
respectively. The foods with higher carbohydrate are Aeng Thae, crab paste and pickling pakkum curry. They are shown 21.83 grams,14.16 grams and 9.42 grams, respectively. The foods
with higher protein are crab paste, hor-nung, grilled fish and pikling pak-kum curry. They are
shown 24.94 grams,17.37 grams , 14.24 grams, and 11.00 grams respectively. The food with
higher fat is crab curry with 10.51grams of fat. The foods with higher vitamin A are Aeng Thae,
pickling pak-kum curry and pak-van(water fern )soup.They are shown 855.50 RE, 492.19 RE and
755.70 RE respectively. The foods with higher calcium are crab paste ,crab paste with green chili
and crab curry. They are shown 1,183.00 milligrams ,484.14 milligrams and 333.33 milligrams
respectively.
Keywords: Lue ethnic food, nutritive value, nutrients, Lanna, Xishuangbanna
Introduction
Tai Lue is an ethnic group residing in the Mekong Region, particularly in the southern
part of Yunnan Province or the Xishuangbanna Autonomous Region. During 1700 B.C to 1976
B.C . This ethnic group migrated southwardly from their origin to Burma , Vietnam, Laos and
Lanna. The reasons for their migration were as prisoners of war, as free citizens in search of a
better life, as traders, and as relatives of those who had settled there previously( Social Research
Institute of Chiang Mai University, 2008:39). There were four migration routes as follows.
The first route was through Burma to Muang Yong, Muang Yu, Muang Luay, Muang Chiang Lap,
Muang Rai, Muang Pyak, Muang Ko, Muang Ton, Muang Len and Ken Tung.
The second route was through Vietnam. There are Lue communities in Binh Lu, Muang
Thaen and along the western bank of the Black River bordering China.
The third route was through Laos. There are Lue communities in Luang Namtha, Phong
Saly, Udomsai, Chayaburi, Bor Kaew, and Luang Prabang Regions
The fourth route was through the Lanna region in Chiang Rai, Chiang Mai, Lamphun,
Lampang, Phayao, Nan and Phrae Provinces. Migration of each batch of the Lue from
Xishuangbanna to the Lanna region was driven by various reasons. This is in line with a study
finding of the Social Research Institute, Chiang Mai University (2008: 30), revealing that the main
reason was as prisoners of war in the reign of King Kawila during the period called City
Reconstruction after the fall of Chiang Mai and Lamphun.
Despite having settled in Lanna for several centuries, their lifestyles have rarely changed.
Other aspects of the ethnic lifestyles have widely been investigated, such as dress, settlement or
beliefs and rituals. However, food of the ethnic group has attracted little attention among
Page 45

July 9-11, 2012
academics. It is evident that people are now paying more attention on good, nutritious and healthy
foods. Therefore, Tai Lue food is an alternative for those who wish to consume healthy and
nutritious food, because the ethnic food is mostly vegetable-based. Additionally, the vegetables
are home-grown and organic, which can be eaten raw as condiments or cooked. The food is also
herbal with medicinal properties that keep consumers healthy. This investigation focused on
historical and nutritive values of the food in order to raise awareness of the Lue and other ethnic
groups on the benefits and nutritive values of the food. Furthermore, this investigation would
motivate the local and concerned agencies to promote and publicize the ethnic food, so that people
would implement the sufficiency economy philosophy of HM the King to their eating habits.
Once the ethnic food has been promoted, more people would be more health-conscious, eating
nutritious dishes with spiritual values. This effort would also reduce the consumption of
fashionable but less nutritious foods which are detrimental to health.
Objectives of the study
This study aims
at
investigating nutritive values of
the Tai Lue ethnic food.
Methodology
The data used are of both qualitative and quantitative types. They were gathered by
interviewing 20 Lue ethnic informants in Pannamuangluang and Muang Ham (Kalanpao),
Xishuangbanna Region, and 20 Lue ethnic informants in Phayao and Chiang Mai provinces for
the Lanna Region. The key informants were local scholars, village heads, teachers, and specialists
in food, traditions and rituals. For examining nutritive values, ten types of most frequently eaten
food on a daily basis were selected. The dishes were then analyzed in a chemical laboratory for
the quantity of essential nutrients, including carbohydrate, fat, protein, moisture, ashes, vitamin A
and calcium. They were analyzed by Proximate analysis and nutritional composition. Vitamin A
and calcium were analyzed by HPLC and AOAC methods.
The research findings
Interviewing with the key informants reveals that, in most cases, food preparation and
types of Tai Lue food in Lanna remains the same or similar to that in Xishuangbanna, despite
having migrated from their origin for several centuries. However, minor changes can be seen in
both regions due to the influences of the environment in which the Lue live.
It is found that 10 types of most frequently eaten food on a daily basis were Crab paste ), Crab
paste with green chili, Crab curry, Pak-van (water fern) soup, Cucumber salad, Aeng Thae, Hornung, Mangos leaves salad, Grilled fish and Pickling pak - kum curry. (See Table 1 and Figure
1- 4).
From analyzing nutritive values of the ethnic food, it is found that the foods with higher
energy are crab paste, crab curry , hor-nung, grilled fish and pickling pak-kum curry. In each 100
grams of the foods, they are shown 207.16 kilocalories, 146.80 kilocalories,125.68 kilocalories,
115.70 kilocalories and 111.62 kilocalories, respectively. The foods with higher carbohydrate are
Aeng Thae, crab paste and pickling pak-kum curry. They are shown 21.83 grams,14.16 grams and
9.42 grams, respectively. The foods with higher protein are crab paste, hor-nung, grilled fish and
pikling pak-kum curry. They are shown 24.94 grams,17.37 grams , 14.24 grams, and 11.00 grams
respectively. The food with higher fat is crab curry with 10.51grams of fat. The foods with
higher vitamin A are Aeng Thae, pickling pak-kum curry and pak-van(water fern )soup.They are
shown 855.50 RE, 492.19 RE and 755.70 RE respectively. The foods with higher calcium are
crab paste ,crab paste with green chili and crab curry. They are shown 1,183 milligrams ,484.14
milligrams and 333.33 milligrams respectively.
Discussion
Regarding food preparation and types of food, the ethnic food in Lanna remains the same
or similar to that in Xishuangbanna, despite having migrated from their origin for several hundred
years. Food culture has left traces for investigation and comparison in each ethnic group, which is
Page 46

July 9-11, 2012
indicative of cultural background of people in a particular region. In the old days, there were no
clear-cut geo-political or cultural boundaries. Consequently, the ethnic culture of the Lue in the
two regions is closely similar. Nevertheless, change and assimilation is inevitable in order to
survive and co-exist peacefully in a new region. There has been cultural borrowing in an
environmental context from various periods. To survive in a new environment, different strategies
must be implemented, e.g. maintaining food identity or adopting certain aspects of local food
culture to create new dishes. However, the identity of Tai Lue food and some types of their food
reflect their ways of lives and culture such as history, tradition and ritual. This observation is in
agreement with that of Padolsky (Padolsky,2005:3).
As for nutritive values, there have been campaigns to eat more nutritious food, particularly
organic food and food with antioxidant properties, e.g. vitamins A, C and E. From analyzing
nutritive values of the ethnic food, it was found that the food is abundant with essential nutrients.
For example; when you eat crab paste you get more vitamin A and calcium. In addition, when
you eat the paste you eat it with many fresh vegetables. For this reason you will get many kinds of
vitamin and more dietary fiber from fresh vegetables. Moreover, most of Tai lue food have a low
cost aspect as they are vegetable-based and most vegetables are home-grown. Also, most Tai
Lue food is easy to find and easy to prepare . Eating Thai Lue food is an aspect of sufficiency life
,which is in line with the sufficiency economy philosophy of HM the King..It is strongly
recommended that Tai Lue food be publicized and promoted in order to raise awareness of the
public to eat this ethnic food which is free from chemicals, toxins and other contaminant.
Table 1 Nutritive value of the Tai Lues food ( in 100 grams)
Foods name
Crab paste
Crab pastewith green chili
Crab curry
Pak-van (water fern)soup
Cucumber salad
Aeng Thae
Hor-nung
Mango leaf salad
Grilled fish
Pickling pak-kum curry
Energy
(cal)
207.16
74.87
146.8
55.54
43.24
46.22
125.68
69.52
115.7
111.62
CHO
(grams)
14.16
6.39
7.02
3.43
4.51
21.83
4.78
4.3
6.97
9.42
Pro
(grams)
24.94
7.1
5.61
6.11
2.98
3.37
17.37
7.26
14.24
11
Page 47
Fat
(grams)
5.64
2.3
10.51
1.98
1.48
2.38
4.35
2.57
3.43
3.33
Vit. A
(RE)
172.56
87.72
333.13
755.7
65.49
855.5
213.87
259.98
317.48
492.19
Ca
(mg)
1,183
484.14
158.54
79.26
68.94
120.34
26.39
50.86
60.12
101.65

July 9-11, 2012
111.62
Grilled fish
115.7
69.52
Mangos leaves salad
125.68
Hor-nung
Food's name
46.22
Aeng Thae
Cucumber salad
43.24
55.54
Crab curry
146.8
74.87
Crab paste
207.16
0
50
100
150
200
250
cal
Figure 1 Energy value of the Tai Lues food ( in 100 grams)

3.33
11
9.42
3.43
Grilled fish
14.24
6.97
2.57
Mangos leaves salad
7.26
4.3
4.35
Hor-nung
17.37
4.78
2.38
3.37
Aeng Thae
Fat
21.83
Pro
Food's name
1.48
Cucumber salad
CHO
2.98
4.51
1.98
6.11
3.43
10.51
Crab curry
5.61
7.02
2.3
7.1
6.39
5.64
24.94
Crab paste
14.16
0
10
15
20
25
30
grams
Figure 2 Fat, carbohydrate and protein value of the Tai Lues food ( in 100 grams)
Page - 48 -

July 9-11, 2012
492.19
317.48
Grilled fish
Mangos leaves salad
259.98
Hor-nung
213.87
Aeng Thae
855.5
Food's name
Cucumber salad
65.49
755.7

Crab curry
333.13
87.72
Crab paste
172.56
0
100
200
300
400
500
600
700
800
900
RE
Figure 3 Vitamin A value of the Tai Lues food ( in 100 grams)
101.65

Grilled fish
60.12
Mangos leaves salad
50.86
26.39
Hor-nung
120.34
Aeng Thae
Food's name
Cucumber salad
68.94
79.26
158.54
Crab curry
484.14
1,183
Crab paste
0
200
400
600
800
mg
Figure 4 Calcium value of the Tai Lues food ( in 100 grams)
Page - 49 -
1,000
1,200
1,400

July 9-11, 2012
References
Fabre, S.& Boonkreab,V.2007. Some commentation about Xishaungbanna(Sipsong ban- na) in the
present time.Proceeding in Tai Cultural in Xishaungbanna(Sipsong ban-na). Chiang Rai :
MaephaLung University.
Jeera-nakorn,Y. & Settakul,R.,2008. History of Xishaun banna (Sipsong ban-na). second edit.
Bangkok : Srang-Son Compny.
Natchumnong T.1989. Settled area of Tai Lue in Xishaungbanna. Meaung- Boran (Old city )
Journal 16,8(July-September) : 50-65.
Nuchniyom, S. 2007.Tai Lue in Xishaungbanna(Sipsong ban-na) and Tai Lue in Thailand.
Proceeding in Tai Cultural in Xishaungbanna(Sipsong banna). Chiang Rai : MaephaLung
University.
Padolsky,E.2005.You are where you eat: ethnicity,food and cross-cultural.Canadian Ethnic
Studies Journal,Summer : 25- 30.
Rakpong P.1994. Study about Tai Lue Village in Lumpang Province. Lumpang : Lumpang
Teacher Collage.
Rujaya, A,M.R.1998.Tai Lue. Bangkok:Vision Master.
Saiwichain, P.2004.Food Culture and Healthy.Chiang Mai : Nop- buree Printed.
Sobal, J.1998.Cultural Comparison Research Designs in Food eating and Nutrition. Journal of
Food Quality and Preference.Volume 9,Issue 6: 385-392.
Social Research Institute of Chiang Mai University.2008.Tai Lue.Chiang-Mai: Chiang Mai
University.Srisawat, B. 2008. 30 nations in Chiang Rai. Bangkok : Sayam Press.
Page - 50 -

July 9-11, 2012.
HSO85-6
The Chronic Illness Resources Survey In Thais With Type 2

Diabetes: Instrument Development
Ananya Manit
King Narai Hospital, Lop Buri, 15000, Thailand
Email: ya_manit@yahoo.com
Abstract
Background: The Chronic Illness Resources Survey (CIRS) evaluates support for healthful
lifestyle behaviours and chronic illness self-management (i.e. diabetes) from multiple sources (i.e.
physician and health care team, personnel, family and friends, neighbourhood, etc.) (1) Valid and
reliable instrument is therefore requisite for the identification of patient characteristics and the
provision of individually matched self-management interventions. Therefore, it should be
individualized to each patient at the extent possible.(2).
Purpose of the study were 1) to develop the Thai comprehensive and short CIRS instruments in
Thais with type 2 diabetes, and 2) to determine psychometric properties (face validity, content
validity, internal consistency, test-retest reliability and construct validity).
Research methodology: Cross-sectional study was be used. The Thai short CIRS instruments (34
items) was administered from Thai comprehensive CIRS (60 items) and the original English
version of CIRS (64 items). A sample were 320 type 2 diabetic patients from Chulalongkorn
Memmorial Hospital, Bangkok, and King Narai Hospital, Lop Buri. Psychometric analyses were
performed, including internal consistency, test-retest reliability at 2 weeks, and 2 months, and
construct validity.
Results: Test-retest reliability of Thai comprehensive and short CIRS instrument was a moderate
positive significant correlation (r = 0.25, 0.21, and 0.25, 0.19 at 2 weeks, and 2 months,
respectively). Reliability of Thai comprehensive and short CIRS instrument were good
(Chronbach alpha = 0.93, and 0.89, respectively). Divergent validity of Thai comprehensive and
short CIRS instrument were supported (there was a moderate positive significant correlation with
Perceived self-efficacy of dietary control, physical exercise, medicine taking and feet care
questionnaire(3), and Diabetes Empowerment Scale-Short Form (DES-SF)(4) (r = 0.12, and 0.15 of
Thai comprehensive CIRS, and r = 0.12, 0.17 of short CIRS at p < 0.05, respectively).
Conclusion: The Thai short CIRS instruments showed good psychometric properties and result
was consistent with the Thai comprehensive CIRS.
Key words: Chronic Illness Resources Survey, Type 2 diabetes
Page 51

July 9-11, 2012.
REFERENCES
Baker DW, Williams MV, Parker RM, Gazmararian JA, Nurss J. Development of a brief test to
measure functional health literacy. Patient Educ Couns. [Sep]. 1999;38(1):33-42.
Funnell MM, Anderson RM, Austin A, Gillespie SJ. AADE Position Statement: Individualization
of Diabetes Self-management Education. The Diabetes Educator 2007
January/February;33(1 ):45-9.
George D, Mallery P. SPSS for Windows step by step: A simple guide and reference. 11.0 update.
4th ed. Boston: Allyn & Bacon; 2003.
Glasgow RE, A.Strycker L, J.Toobert D, Eakin E. A Social-Ecologic Approach to Assessing
Support for Disease Self-Management: The Chronic Illness Resources Survey. Journal of
Behavioral Medicine 2000 November;23(6):559-83.
Hongrapipat R. The Comparison of the Effectiveness between Self-Efficacy Theory and Social
support as applied to Health Education program on Behavioral modification among type 2
Diabetes Mellitus patients attending services at Sikhoraphum
Hospital of Surin province. Mueang Nakorn Pathum: Mahidol University; 1998.Anderson RM,
Fitzgerald JT, Gruppen LD, Funnell MM, Oh MS. The Diabetes Empowerment ScaleShort Form (DES-SF). Diabetes care. 2003;26(5):1641-2.
Johnjumsut C. Individualized Empowerment Approach in Dietary Self-Management to improve
metabolic control in patients with type 2 diabetes Mueang Nakhon Prathom: Mahidol;
2007.
Raine R, Sanderson C, Black N. Developing clinical guidelines: a challenge to current methods.
BMJ 2005 17 September;331:631-3.
Sanjaithum K. Factors Influencing Nutritional Self-Management among older adults with Diabetes
Mellitus. Mueang Nakorn Pathom: Mahidol University; 2006.
Page 52

July 9-11, 2012.
HSO179-7
Risk Factors for Onset Disability in Community Dwelling

elderly : A systematic review
Siranee Sihapark1st Piyathida Kuhirunyaratn2nd
1stBorommarajanani college of nursing Khon Kaen, 40000, Thailand
2ndKhon Kaen University, 40000, Thailand
Email: daosiam@gmail.com
Abstract
A systematic review aimed to explain the risk of disability among community dwelling
elderly. the articles were identified risk factors for the study including, a cohort study, case control,
and cross - sectional analysis, which had been published ten years ago (2000 2009). The
database was selected from database of Google scholar, Pubmed, Biomed central, and Cochran
review by disability term, activities daily living (ADL), and instrumental activities daily living
(IADL). This inclusion criteria was determined by key word on title and abstract, and exclusion
criteria were detected on the articles, such as, participants, objective, outcome measurement,
research design, and during 2000 2009. We found 19 quality articles: 2 systematic reviews, 16
cohort studies, and a case control study
The result found that the high strength of association of risk factors for the occurrence of
the disability, which the dimension was composed of three dimensions such as, chronic diseases,
psycho impairment, and age. Also, it was found all five factors that was profile of risk factors:
stroke, arthritis/osteoarthritis, co mobility, cognitive impairment/dementia, and age. Therefore, risk
factors of disability is obvious to use in making decisions about management, prevention, and
reduction disability in older people, that a disability prevention for the elderly should been
appropriate to track the factors of caused the disability.
Key word: Elderly, Disability, activities daily living, instrumental activities daily living
Introduction
The current world population structure is changed, that the proportion of people aged 65
years or more increased from 5.9 percent in 1975 to 6.9 percent in 2000 and is estimated in 2025 to
2050 the proportion of elderly population will increase to 10.4 per cent and 15.6, respectively. In
addition, life expectancy at birth of the world population increased from 59.6 years in 1975
1980, 66 years in 2000 to 2005, and was expected to increase to 72.4 years in 2025 to 2030
(United Nations,2002).The tendency of the elderly population is increasing rapidly, that many
countries in the world are being into a state of aging society. This is a signal indicative of the
burden from the elderly increased.
The burden of care for the elderly was problem of disability. Disability was refer to
difficulty in performing activities for self-care (Verbrugge and Jette,1994; Rejeski and Focht,
2002), that it was likely to increase the number of elderly people. For instance, in Belgium, the
prevalence of disability was increase 18.9 percent in 1997 to 22.9 percent in 2001 and 23.8 percent
Page 53

July 9-11, 2012.
in 2004 (Lafortune and Balestat, 2004), in Thailand, prevalence of disability in 2010 were 15.5
percent (Akpalakorn, 2010). Besides, follow-up of older people in England aged 65 years for a
period of two years, who showed severe disability 6.59 percent (Yi Li Chung, et al. 2002).
Disability has become a major problem that effect to family, community, and nation.
However, the disability process is complex and a variety of causes. Furthermore, disability
related to the interaction between people with social and environmental, that induce to increase or
decrease of disability in the elderly (Verbrugge and Jette,1994; Rejeski and Focht, 2002).
Understanding the process of disability and relevant factors are necessary and important for
preventing the risk of disability. It will also help to prevent and delay the occurrence of disability
in the elderly. A systematic review aimed to explain risk factors of disability among elderly people
living in community between 2000 to 2009, that was prevention of disability in the elderly.
Selection of the articles
Study selection process was starting from the question of a systematic review. "What were
the factors that caused disability in the elderly, and were different of risk factors? ", then, searched
of the database on the occurrence of disability in the elderly. Although, it had been a systematic
review on risk factors for disability in the elderly, but a review of the past, mainly focused on
health conditions. In this study were selected on difference the previous database, that population
was more comprehensive and the period of modern people by published in the official and
unofficial data. Inclusion criteria were the key word (ageing OR elderly OR senior citizen OR
older adult) AND (disability OR disabled OR activities daily living) AND (risk factors OR risk
associated OR risk determinate) for the selection of titles and abstracts , which reported the initial
study of 177 articles, then including population based study of the elderly in community and
during in 2000 to 2009 were included 70 articles.
Exclusion criteria were: 1) the purpose of study was to determine risk factors of disability
in the elderly, 2) outcome measurement was activities daily living (ADL), or instrumental
activities daily living(IADL), and 3) type of research was the longitudinal study such as,
randomized control trail, cohort study, case control, and cross section analysis. The remaining
reports were 19 reports, which were 2 a systematic reviews, 16 cohort studies, and a case control
study (Figure 1).
Page 54

July 9-11, 2012.
Figure 1 Study selection process

Outcome Measurement
Disability is a concept that refers the ability or the difficulty in performing activities daily
living (Verbrugge and Jette,1994; Rejeski and Focht, 2002). The assessment disability tool was
classified into two main categories: first, to evaluate the ability to perform activities of daily living
(ADL) as measured on their ability to care for the basic activities of life. Second, to evaluate the
ability to perform instrumental activities of daily living (IADL) as measured of the degree of
independence or dependence in activities, which was necessary to live according to the context of
a community. The measurement in this study was divided three type, ADLs only, IADLs only, and
both ADLs and IADLs.
Methodology Assessment.
Report of the 19 articles was to assess the quality of research methodology by the concept
of agency for healthcare research and quality (West,et al, 2002), that was represented sample,
exposure or intervention, outcome measurement, criteria for selection, lack of follow-up samples,
and results. The articles with the quality of the research methodology were high level 5 articles
(Gregg,et al, 2002; Gill,et al, 2004; Spiers, et al,2005; Tas, et al, 2007; Tas, et al, 2007), such as, a
systematic review of diseases and conditions in the United Kingdom, the present data showed
access a database of 35 articles, comparison of sample group, and analysis clearly by the
Page 55

July 9-11, 2012.
statistical significance(Spiers,et al,2005). A cohort study in the hospital, it was restrictions on the
activities, that was follow up onset of disability in older people with long term (60 months) and
presented results to clear (Gill, et al,2004) (Table 1 in Appendix).
Strength of a body evidence
Risks factors of all 19 articles were grouped into two groups: a risk factor for ADLs
disability and IADLs disability, then, grouped according to similarities based on the dimensions of
risk. Next, analyzed the strength of the incidence of each risk factor by dimension of the strength
of the occurrence from the agency for healthcare research this was divided quality by three main
elements, such as, consistency, quantity, and quality (West,et al,2002) (Table 1).
Table 1 the dimension of the strength of the incident
Domain
Definition
Quality
The quality of all relevant studies for a given topic, where quality
is defined as the extent to which a studys design, conduct, and
analysis has minimized selection, measurement, and confounding
biases
Quantity
The magnitude of treatment effect

The number of studies that have evaluated the given topic
The overall sample size across all included studies
Consistency
For any given topic, the extent to which similar findings are
reported from work using similar and different study designs
Results
Researches were more than half the students in the United States, 7 articles in Europe's, 7
studies in the Middle East, and a subject to study in Asia. A report of more than half of the study
of long-term follow-up form project database, such as, the study of such long-term women's health
and aging study I, the second longitudinal study of aging (LSOA), the MRC cognitive function and
ageing study, the HALE project, the Rotterdam study, the Kungsholmen project the established
populations for epidemiologic studies of the elderly (EPESE), health and retirement study (HRS),
and the Jerusalem longitudinal study. The sample size was a minimized of 559 people (McGuire,
Ford, and Ajani, 2006.), and maximized of the 9,093 people (Gray,et al.2006), that was subject of
the 66.71 females. The duration of follow-up averaged 45.94 months period to the shortest 18
months (Gill1 and Kurland, 2003.), length 147 months (Gregg,et al, 2002) (table 2 in Appendix).
Analysis of risk factors.
This was a component of the risk factors from 19 the research report, that were 27 factors
identified and separated into 8 dimensions, such as, chronic disease, psycho impairment, fall, risk
behavior, sensory impairment, age, restrict activity, and socioeconomic. Moreover, analyzing the
strength of the relationship of risk factors for the occurrence of the disability, a critical component
of the disability dimension, was composed of three dimensions such as, chronic diseases, psycho
Page 56

July 9-11, 2012.
impairment, and age. Also, it was found that all five factors, such as, stroke, arthritis/osteoarthritis,
co mobility, cognitive impairment/dementia and age (Figure 2 and Table 2)
Gill,et al,
2004
OR 2.5 Spiers, et al,
(95%1.8-3.6)
2005
OR 4.6 Tas, et al,
(95%CI1.6-13.5)
2007
OR1.56 Dunlop,et al
(95%CI1.06-2.30)
2005
HR 1.94
(95%CI1.45-2.60)
Co morbidity
Stroke
Risk factors of
high strenght
Gill,et al,
2004
Gill and Kurland,
OR 1.4
(95%0.9-2.1)
2003
Tas, et al
OR 2.6
(95%CI1.3-5.0)
2007
Dunlop,et al,
OR2.86
(95%CI1.71-4.78)
2005
Arthritis/
Osteoarthitis
HR 2.10
(95%CI1.63-2.71)
Cognitive impairment/
Dementia
Tas, et al
OR 2.1
(95%CI3.6-27.3)
2007
Gill and Kurland,
OR 1.3
(95%CI1.2-1.4)
2003
Marengoni,et al,
OR 3.3
(95%CI1.5-7.4)
2008
Age
Jogger,et al,
OR 1.46
(95%CI1.18-1.82)
2007
Spiers, et al,
OR 1.3
(95%1.0-1.6)
2005
Tas, et al,
OR 1.6
(95%CI1.2-2.3)
2007
Gill,et al
HR 1.44
(95%1.32-1.57)
2004
Dunlop,et al
OR3.10
(95%CI2.29-4.19)
2005
Table 2 Level of evidence risk factors for disability.
Discussion
The strength of the analysis of risk factors was explained the occurrence of disability,
which was determined by the constancy of the results to the disability of various risk factors
(Consistent), the statistically was significant P value <0.05 or association RR/OR/HR (95% CI)
range from 1.0 up to a value (Quality), and quantitative research (Quantity). It found that the risk
of disability, that was seven high strong factors and two moderate factors. In addition, other factors
had found a limited.
Page 57

July 9-11, 2012.
Chronic disease was risk factors of physical disease, that was high strength of associated
with disability, such as, stroke, arthritis/osteoarthritis, co morbidity, psychological disease was
cognitive impairment or dementia. Chronic disease was causes pathology, loss of function of
organ, and led to the loss of the ability to perform daily activities (Verbrugge and Jette,1994;
Rejeski and Focht, 2002). Also, age was showed a strong correlation with the occurrence of
disability among elderly, that as a result aging process. It was caused sensory and nervous system
to decrease, when was the old age the more chance of disability(Gill,et al. 2004; Tas, et al.
2007;WHO,2003).
The findings of this a systematic review are consistent with the World Health Organization
that summarize the main risk factors for disability are three kinds: chronic disease, accidents, and
age(older)(WHO,2003). Therefore, risk factors for disability that is obvious to use in making
decisions about management, prevention, and reduction disability in older people, that a disability
prevention for the elderly should been appropriate to track the factors of caused the disability.
However, disability process is complex, that is concerned various factors, such as, health factors,
socioeconomic factors. This study did not appear socioeconomic factors, that is gap between the
knowledge of the risk of disability in the elderly and need to seek.
Strengths and limitations
The advantage of this study was investigation of risk disability, which factors selected for
the study of high quality. However, the disability process is complex and difficult to compare, that
the differences in measurement and participants. Therefore, in order to acquire more accurate
understanding of the risk factors of disability and the knowledge of the risk of disability is
required.
Acknowledgements.
This research was funded from Faculty of Medicine Khon Kaen University, and Research
Group on Well-being and Sustainable Development(WeSD), Faculty of Humanities and Social
Sciences Khon Kaen University.
Page 58

July 9-11, 2012.
REFERENCES
Aekplakorn W, Porapakkham Y, Taneepanichskul S, Thaikla K (2009) The report of Thailand
population health examination survey IV. Bangkok.
Brenes G.A, et al, 2005. The Influence of Anxiety on the Progression of Disability. J Am Geriatr Soc.
53(1): 3439.
Cronin-Stubbs D, et al, 2000. Six-Year Effect of Depressive Symptoms on the Course of Physical
Disability in Community-Living Older Adults. ARCH INTERN MED. 160(13)3074 3080.
Dunlop D.D,et al.2005.Incidence of Disability Among Preretirement Adults:The Impact of Depression.
American Journal of Public Health. 95(11):2003-2008.
Dunlop D.D., 2005. Risk Factors for Functional Decline in Older Adults with Arthritis.ArthritisRheum.
April ; 52(4): 12741282.
Freedman V. A, Martin L. G, Schoeni R. F.2002. Recent Trends in Disability and Functioning Among
Older Adults in the United States: A Sysyematic reviews. JAMA. 288(24):3137-3146.
Gill1 T.M. and Kurland B.F. 2003. Prognostic Effect of Prior Disability Episodes among Nondisabled
Community-living Older Persons. Am J Epidemiol. 158:10901096.
Gill T.M,et al. 2004. Older Persons Hospitalization, Restricted Activity, and the Development of
Disability Among Older Persons. JAMA. 292(17):2115-2124.
Gray S.L.,et al.2006. Benzodiazepine Use and Physical Disability in Community-Dwelling Older
Adults. J Am Geriatr Soc. February ; 54(2): 224230.
Gregg E. W.,et al. 2002. Diabetes and Incidence of Functional Disability in Older Women. Diabetes
care. 25(1) : 61 67.
Jagger C,et al.2001. Patterns of Onset of Disability in Activities of DailyLiving with Age. JAGS.
49:404409.
Jagger C,et al.2007. Cohort differences in disease and disability in the young-old: findings
from the MRC Cognitive Function and Ageing Study (MRC-CFAS). BMC Public
Health.7:156.
Lafortune G, Balestat G. 2004. Trends in Severe Disability Among Elderly People: Assessing the
evidence in 12 OECD countries and the future implications. : OECD Employment,
Marengoni A.,et al. 2008.The impact of chronic multimorbidity and disability on functional decline and
survival in elderly persons. A community-based, longitudinal study. Journal of Internal
Medicine.265; 288295.
McGuire L.C, Ford E.S. and Ajani U.A. 2006. The impact of cognitive functioning on mortality and
the development of functional disability in older adults with diabetes: the second longitudinal
study on aging. BMC Geriatrics. 6:8.
Rejeski W.J, Focht BC. 2002. Aging and physical disability: on integrating group and individual
counseling with the promotion of physical activity. Exerc Sport Sci Rev. Oct;.70-166:(4)30
Spiers N.A, et al.2005. Diseases and Impairments as Risk Factors for Onset of Disability in the Older
Population in England and Wales: Findings From the Medical Research Council. Journal of
Gerontology. 60A, (2), 248254.
Stessman J, et all.2002. Effect of Exercise on Ease in Performing Activities of Daily Living and
Instrumental Activities of Daily Living From Age 70 to 77: The Jerusalem Longitudinal
Study. JAGS. December. 50(12) :.1938 - 1934
Tas U, et al. 2007. Incidence and risk factors of disability in the elderly: the Rotterdam Study.
Prev Med. Mar;-272:(3)4427.8
Tas U, et al. 2007.Prognostic factors of disability in older people: a systematic review. British Journal
of General Practice. April (57): 319323.
United Nations.2002. World Population Ageing .2050 - 1950New York: United Nation.
Verbrugge L.M, Jette AM. 1994, The disablement process. Soc Sci Med. Jan;.14-1:(1)38
Vopato S, et al.2002 Progression of Lower-Extremity Disability in Older Women With Diabetes and
Incidence of Functional Disability in Older Women. Diabetes care. 26(1): 70 75.
West S.,et al, 2002. Systems to Rate the Strength Of Scientific Evidence .North Carolina: Agency for
Healthcare Research and Quality U.S. Department of Health and HumanServices
Page 59

July 9-11, 2012.
WHO. 2003. What are the main risk factors for disability in old age and how can disability be
prevented? Denmark: WHO .1-17.
Yi Li Chung, et al. 2002. Longest held occupation in a lifetime and risk of disability in activities of
daily living. Occup Environ Med.57:550554.
Page 60

July 9-11, 2012.
Appendix
Table 1 Evaluation of Scales and Checklists for Systematic Reviews, by Specific Instrument and
11 Domains
Instrument
Domain
Search
Study
question
Strateg
y
Quality
Inclusion/ Interve
ntion
Exclusion
Outcom
e
Study
Study
data
extraction quality/
validity
Synthesis result
and
analysis
Discussio
n
Funding
1. Freedman
Vicki A., Martin
Linda G.and
Schoeni Robert
F, 2002
2. Umit Ta s, et
al ,2007
High
Table 1 Evaluation of Scales and Checklists for Observational Studies, by Specific Instrument and
9 Domains*
Domain
Instrument
Study Search
question
popula
tion
3. Cronin-Stubbs
Diane,et al, 2000
4. Gregg Edward
W., et al,2002
5. Volpato Stefano,
et al, 2002
6. Gill Thomas M.
and Kurland Brenda
F. , 2003
Compar Expos
bility ure/
Statistic result
Outcome
0f Interven measure
subjects ion ment
Analysi
s
Discuss
ion
Fundin
g
Page 61
Quality
High

July 9-11, 2012.
9 Domains*
Domain
Instrument
Study Search Compara Expos Outcome Statistic result

ility
ure/
questio
measuremAnalysis
populati
n
0f subjec Interven ent
on
ion
Discus
sion
Fundi
ng
Quality
High
7.Thomas M.
Gill, et
l.,2004
8. Brenes
Gretchen A.,
et al,2005
9. McGuire
Lisa C , Ford
Earl S and
Ajani Umed
A,2006
10. Carol
Jagger, et
al,2001
11. Spiers A
Nicola, 2005
12. Carol
Jagger, et al
,2007
13. Umit Ta
s, et al ,2007
14.Marengon
i A., et al,
2008
15.Chung-Yi
Li, Shwu
Chong Wu,
Shi Wu Wen
Page 62
High
High

July 9-11, 2012.
9 Domains*
Domain
Instrument
16.Shelly L.
Gray,
Study Search ComparabExposu Outcom Statistic result

lity
re/
question
measurem Analysi
popula
s
tion 0f subjectInterventient
on
Discuss
ion
Fundi
ng
Quality
Et al ,2006,
pubmed
17.Dorothy
D. Dunlop,
Pamela
Semanik,
,et al,2005
18.Dorothy
D. Dunlop,
et al, 2005
19.Jochanan
Stessman,et
al, 2002
Pubmed
Page 63
High

July 9-11, 2012.
Table 2 reports the research on risk factors for disability in the elderly (Systematic Reviews)
NO./ Database/
Country
Sources
Search
Strategy
Inclusion/
Exposure or
Intervention
Outcome
Data Extraction
Study Quality /
Validity
Data Synthesis and

Analysis
Result
Limitation
Quality
score
self-reports of
either needing
help or having
difficulty with
activities of
daily living
(ADLs) and
instrumental
activities of
daily living
(IADLs)
1) no explicitly the
reliability of
outcome measure
including intra rater
reliability
Base on a
national research
council report and
follow up
evaluated survey
quality according to 10
criteria, ranked the
Evidence on trends in
disparities by age, sex,
race, and education
was limited and mixed
,with no consensus yet
emerging
Outcome had
difference 4 type,
no report loss
follow up 5 article
High
Experiencing
difficulty in
ADLs or
IADLs
1) consistency
process
1) strong evidence that

higher; age and
cognitive impairment
are prognostic factors
of disability.
1)ADL and IADL

give a common
High
Exclusion
1.A Systematic
Review(USA)
Freedman Vicki
A., Martin
Linda G.and
Schoeni Robert
F, 2002
2 database;
MEDLINE,
AGEING,
Jan1990May2002
2.Systematic
review(UK,
Tas Umit,et al,

2007
3 database;
Pubmed
Dutch, German,
French, Danish,
Norwegian,
Swedish, and
Turkis)
(19662006),
EMBASE
(19802006),
PsycINFO
(1975-2006
Inclusion;
65 or 70
years or
over, in
USA,16
articles
1)physical
disability
2)functional,
cognitive, and
sensory
limitations
Exclusion;
institutional
or health
care
utilization
3) age, sex
19 articles,
Inclusion;
outcome,
longitudinal
study,age 50
years, in
UK, Dutch,
German,
French,
Danish,
Norwegian,
1)demographic
and
socioeconomic
factors,lifestyle
factors, and
medical
conditions
surveys as good, fair,

or poor, and calculated
for each outcome the
average annual percent
change.
2) 3 reviewers
3) no report blinding
of reviewrs
based on 15
criteria of internal
and
2) 5 reviewers
3) no report blinding
of reviewrs
2)functional
status
external validity.
the assessment
resulted with a
score of 70% of
the maximum
obtainable
points or higher
were rated as
high-quality
studies.
Swedish,
and Turkis
Page 64
It was possible to
pool the data if terms
of homogeneity were
met. In the case of
heterogeneity, a
synthesis of the best
evidence was
performed.
The strength of
evidence was rated as
follows: strong
evidence; moderate
evidence; limited
evidence; conflicting
2) strong evidence that

moderate; vision
impairment,and poor
self-rated health are
prognostic factors of
disability.
basis for many

investigators,
heterogeneity in
the way
2)standardisation
of assessment and
analysis
of disability

July 9-11, 2012.
Table 2 reports the research on risk factors for disability in the elderly (Cohort Study)
NO./ Database/
Country
Sources
Age
Number
Loss
follow up
Comparability
Exposure or
Intervention
Length of
follow up
Outcome
Result
Limitation
1) disabled increased with

symptom of depression : OR= 1.16,
95% CI, 1.13-1.19 (the Katz) and
OR = 1.14; 95% CI, 1.11-1.16 (the
Rosow-Breslau)
1) our measure of
chronic health
conditions was
imperfect, as it relied
on self-reports of
previously diagnosed
conditions and lacked
detail on the severity
of disease.
Study/Control
3.East Boston,
Massachusetts,
(USA)
Cronin-Stubbs
Diane,et al,
2000
65 years or
older
3,434
NR
Mild
depression
Depression
72
(19991994)
/ NR
1)ADLs(6 items; bathing,

dressing, eating, toileting,
walking across a room, and
transferring from a bed to a
chair)
2) It is unlikely that
non response
bias limits the
interpretation of the
studys results.
Page 65
Quality
score

July 9-11, 2012.
NO./ Database/
Country
Sources
Age
Number
Loss
follow up
Comparability
Exposure or
Intervention
Length of
follow up
Outcome
147
1)ADLs(5 items; walking two

to three blocks on level
ground, walking up or down
10
steps,
and
doing
housework, shopping, and
cooking meals)
Result
Limitation
Quality
score
Study/Control
4.Baltimore,
Monongahela
Valley, Portland,
and Minneapolis
(USA)
Gregg Edward
W., et al,2002
65 years
or older
8,344
18
Diabetes /
Non
Diabetes
Diabetes
Insulin
treatment
(19892001)
BMI
Stroke
1) associated with diabetes ranged

from 2.12 (1.822.48) for doing
housework to 2.50 (2.053.04)
1) The study
population was
limited to white,
2) Insulin-treated women with

diabetes had a higher risk of
disability HRR=2.70,1.903.83
than those not on insulin 1.96,1.68
2.30
noninstitutionalized
women who were
probably healthier
than those in the
typical
3) BMI > 30 was HRR 2.57 (1.82

3.63)
same-aged
population.
4) Stroke was HRR 1.46 (0.94 2.27)
2) collected diabetes
status
by self-report, our
findings may not be
generalizable to
women with
undiagnosed
diabetes
3)lacked information
about glycemic
control and specific
diabetes
medications
Page 66
High

July 9-11, 2012.
NO./ Database/
Country
Sources
Age
Number
Loss
follow up
Comparability
Exposure or
Intervention
Length of
follow up
Outcome
36(19992002)
1) ADLs(5 items; bathing,

transferring from bed to chair,
using the toilet, and dressing)
Result
Limitation
Study/Control
5.Baltimore,
Maryland
Volpato
Stefano, et al,
2002
65 years
or older
729
NR
With
diabetes /
without
diabetes
Diabetes
(USA)
1) adjustment for age and

compared with women without
diabetes, with diabetes had an RR
1.57 (1.152.14) P<0.01 for
incident activity of daily living
disability.
1) this study
was that the
algorithm used for
diabetes
ascertainment did not
include a fasting
glucose level.
6.New Haven
(USA)
Gill Thomas M.
and Kurland
Brenda F. ,
2003
70 years or
older
580
22.8
Physical
frailty / no
Physical
frailty
Chronic
condition(no)
18(1998
2002)
Cognitive
impairment
1)ADLs(4
items;bathing,
dressing, walking inside the
house, and transferring from a
chair)
1) HR found significantly associated;

a prior history of disability HR* 2.0,
95% CI 1.4- 2.7; cognitive
impairment
1.4 , 95% CI 0.9- 2.1, p<0.002;
chronic condition(No.) 1.3, 95% CI
1.2- 1.4 p<0.001; physical frailty
1.5, 95% CI 1.1 2.1 p<0.001
Physical frailty
Prior history of
disability
1) Although our
disability assessment
had excellent
reliability, it is
possible that some of
the disability
transitions
represented
measurement error
rather than a true
change
2)eating, toileting
and grooming were
omitted from
assessment.
3)oversampled
persons who were
physically frail.
Page 67
Quality
score

July 9-11, 2012.
NO./ Database/
Country
Sources
Age
Number
Loss
follow up
Comparability
Exposure or
Intervention
Length of
follow up
Outcome
Result
Prior
Hospitalization
60 (March
1998 to
March 2003)

dressing, walking inside the
house, and transferring from a
chair)
1) The HR for the development of

disability were 1.35,95% CI (1.211.51) p<0.001 within prior of
hospitalization and 5.54 (4.27-7.19)
within a month of restricted
activity. 2) Age per each 5 year
associated with disability HR
1.44(1.32-1.57)
Limitation
Quality
score
Study/Control
7.New Haven,
Conn, (USA)
Thomas M.
Gill; Heather G.
Allore;
Theodore R.
Holford; et
al.,2004
70 years or
older
754
21.9
Physical
frailty / no
Physical
frailty
restricted
activity
Physical frailty
disease
Age
3) Physical frailty was development

of Any Disability; HR 3.19 ( 2.623.89) p<0.001
1)analyses were
limited to the first
episodes
of any disability,
persistent disability,
and disability with
nursing
home admission,
4) disease was development of any

disability: Congestive heart failure
2.33 (1.71-3.17) p<0.001, cognitive
impairment 2.10 (1.63-2.71)
p<0.001, Stroke 1.94 (1.45-2.60)
p<0.001
8.Womens
Health and Aging
Study I (USA)
Brenes
Gretchen A., et
al,2005
65 years or
older
1,002
NR
Anxiety / No
Anxiety
Anxiety
36(2003
2000)

dressing, eating,transferring
from bed to chair, and using
the toilet)
2) IADLs(3 item; walking
across a room, lifting ten
pounds, and performing light
housework)
Page 68
1)Unadjusted models indicate that

anxiety was associated with a
greater risk of worsening disability:
ADL disability HR 1.40, 95% CI
1.101.79 and mobility disability
HR = 1.41, 95% CI 1.061.86
1)that the sample

consists of disabled
women
2)this study is that
anxiety symptoms,
rather than anxiety
disorders, are assessed.
High

July 9-11, 2012.
NO./ Database/
Country
Sources
Age
Number
Loss
follow up
Comparability
Exposure or
Intervention
Length of
follow up
Outcome
26 (1997 May, and the

second followup between
June 1999 August2000)

dressing, eating, transferring,
walking, and toileting)
Result
Limitation
Study/Control
9.The Second
Longitudinal
Study of Aging
(LSOA II).
McGuire Lisa C
, Ford Earl S
and Ajani Umed
A,2006
70 years or
older
559
NR
Disabled /
Non-disabled
Cognitive
functioning
Diabetes
(USA)
2)IADL(6 items; preparing

meals, grocery shopping,
managing money, using the
telephone, doing light/heavy
housework, managing
medications)
1)Participant had cognitive

functioning becoming disabled ;
AOR = 0.87, 95% CI 0.780.97
compared to those people who
were disability free.
1) functional
disability outcomes
were assessed using
respondent-reported,
they
may not reflect
adaptations a person
makes to successfully
complete a task
2) unfortunately,
medication adherence
and depression were
not assessed on the
LSOA II, which can
potentially impair
cognition
10.Melton
Mowbray,
Leicestershire,
(UK)
Carol Jagger,
Antony J.
Arthur, Nicola
A. Spiers,
Michael
Clarke,2001
75 years or
older.
1,345
NR
Men /
Women
Sex
72(1991
1997)
Age
1)ADLs(7 items; mobility

around the home,getting to
and from the toilet, transfer
from chair, transfer from bed,
feeding, dressing, and
bathing)
1)Women had a higher risk of

disability in bathing; RR=51.6,
95% CI 1.31.9, p<.001 and
Toileting; RR= 1.7, 95% CI 1.2
2.5, p<.003
2) for all ADLs there was a
significant increase in the risk of
disability with increasing age.
Page 69
1)the data from

routine health
assessments,
the substantial
variability in time
between observation
points
Quality
score

July 9-11, 2012.
NO./ Database/
Country
Sources
Age
Number
Loss
follow up
Comparability
Exposure or
Intervention
Length of
follow up
Outcome
Result
Limitation
Quality
score
1)IADLs(5 items : transfer to

and from a chair, put on shoes
and socks, prepare a hot meal,
get around outside, and have
1) disabled by disease: Parkinsons

disease OR 3.7,95%CI 1.5-11.3
p<0.01; Stroke OR 2.5,1.8 3.6
p<0.001; Treated diabetes OR 1.7,
1.2-2.5 p<0.01; chronic airway
obstruction OR 1.5,1.2-2.0
p<0.001;coronary hearth
disease(angina and hearth attack)
OR1.4,1.1-1.8 p<0.01; Arthritis
OR1.3,1.0-1.6 p<0.01
1)There is evidence
for self-report data on
some diseases and
conditions, but the
uncertain validity of
other self-reported
diagnostic data
suggests caution in
interpretation. 2)The
lack of an association
between prevalent
depression and onset
of disability could be
due to the
High
Study/Control
11.England and
Spiers A Nicola,
2005
65 years or
older
35
article,
27.2
Disabled /
not Disabled
Disease
36(1998
2001)
Impairment
Wales(UK)
7,913
a bath or an all-over wash)
2) disabled by impairment: MMSE

score(0-21) OR 3.6,2.6-5.1
p<0.001; hearing problem OR 1.2,
0.9-1.5 ; eyesight problem OR 1.3,
1.0-1.7 p<0.05
Measure
3) disabled by current smoker OR

1.5, 1.2-1.9 p<0.01
12.The MRC
Cognitive
Function and
Ageing
Study;MRCCFAS (UK)
Carol Jagger, et
al ,2007
6569
years old
689
3.0
New cohort /
Old cohort
Arthritis
Chronic
airways
obstruction
24 (between
1991 1992
and 1996
1997)
Age
Page 70
1) ADLs(5 items; transfer to

and from a chair, put on shoes
and socks, prepare a hot meal,
get around outside, and have
a bath)
1) Risk factor of chronic

conditions; arthritis OR : 1.46<
95% CI, 1.18 1.82 p<0.001 and
chronic airways obstruction OR
1.36,1.04 - 1.78 p=0.02
2) IADLs(3 items; shopping ,

carrying heavy bags and
heavy housework)
2) Risk disability of physical

limitation OR 1.34, 0.98 1.83,
p=0.06
1) the majority of
information
on chronic conditions
was self-report and
therefore
our findings,

July 9-11, 2012.
NO./ Database/
Country
Sources
Age
Number
Loss
follow up
Comparability
Exposure or
Intervention
Length of
follow up
Outcome
72 (first
wave 1990 1993; second
wave 1994 1996; third
wave 1997 1999)
1)ADLs(8 items; dressing and

grooming, rising, reach,
hygiene, eating, walking, grip
and activity)
Result
Limitation
Quality
score
Study/Control
13.The Rotterdam
Study, Rotterdam
(Germany)
Umit Ta s, et al
,2007
55 years or
older
4,258
27.5
Men /
Women
Health
conditions
Age
1) Risk factors of mild* and severe**

disability for men by; self rated health
(worse) OR 3.6,95%CI 1.5-8.7
p<0.01** ; BMI(30 or higher) 2.0, 1.1
3.4 p<0.05*; depression 2.4, 1.4-4.1
p<0.01**; stroke 4.6, 1.6-13.5
p<0.01**; ,Joint complaints 1.6, 1.2-2
p<0.01*; fall 1.7,1.0-2.9 p<0.05*;
comorbidities 2.2,1.4-3.5 p<0.05**; a
medication use 1.8,1.1-3.2 p<0.05**
2)For women by : self rated health
(worse) 2.7, 1.2-5.8 p<0.05*;
cognitive impairment 2.6, 1.3-5.0
p<0.01**; BMI(30 or higher) 2.8,
1.7-4.4 p<0.01**; osteoarthritis 1.6,
1.2-2.3p<0.01* and 1.5, 1.0-2.2
p<0.01**; Joint complaints 1.8,
1.2-2.6 p<0.01*; fall 1.7,1.0-2.9
p<0.05*; and medication use
2.2,1.3-2.9 p<0.01** and 1.6,1.22.1p<0.01*
3) Age associated with mild* and
severe** disability in men and
women
Page 71
1) this study data on

chronic conditions
were based on self reports.
2)A drawback of our
study is the
proportion of noncompleters
probably due to a
longer follow-up
period.
High

July 9-11, 2012.
NO./ Database/
Country
Sources
Age
Number
Loss
follow up
Comparability
Exposure or
Intervention
Length of
follow up
Outcome
Result
Limitation
Study/Control
14.The
Kungsholmen
project,
Stockholm,
(Sweden)
15.in northern
Taiwan.
Marengoni A.,
Strauss von E.,
Rizzuto D.,
Winblad B.,
and Fratiglioni
L.,2008
Chung-Yi Li,
Shwu Chong
Wu, Shi Wu
Wen
75 years or
older
680
38.13
Disability /
Without
Disability
Chronic multi
morbidity
32(1987
2000)
Functional
decline
65 years or
older
2,198
NR
Disability /
free
Disability
1)longest held
occupation in a
lifetime
60
(1993-1997)
2) social class
indicated

dressing, going to the toilet,
transferring, continence and
feeding)
1) ADLs (6 items: bathing;

dressing;moving between bed
and chair; using the
toilet; eating; and walking
inside the house)
1)The HR for functional decline

increased from 1.5, 95% CI 0.6
3.7) in persons affected by one
disease to 6.2 ,95% CI 2.515.2 in
those with 4+ conditions.
1)a potential
2) having chronic multi morbidity

and no disability showed risk of
functional decline HR 3.3; 95% CI
1.57.4 and chronic multi
morbidity and with disability risk
HR 9.9; 95%CI 3.6 27.3
without taking into

account severity.
1) had increased risks

of subsequent ADL disability;
workers in agriculture, animal
husbandry, forestry, or fishing OR
1.9, 95% CI (1.1 to 3.5) p=0.04 and
workers in craft and related trades
OR 1.9, (1.1 to 3.4) p=0.04
2) social class in unskilled blue
collar worker had increased risks
of subsequent ADL disability OR
1.8 (1.1-2.8) p=0.01
Page 72
limit of using the

sum of diseases as
ordinal scale
2)the diagnoses
included definition of
multimorbidity to
those conditions with
potential of severity
Quality
score

July 9-11, 2012.
NO./ Database/
Country
Sources
Age
Number
Loss
follow up
Comparability
Exposure or
Intervention
Length of
follow up
Outcome
Result
Limitation
Study/Control
16.the Established
Populations for
Epidemiologic
Studies of the
Elderly, EPESE,
(USA)
Shelly L. Gray,
65 years or
older
9,093
2.94%
Et al ,2006,
pubmed
Benzodiazep
ine user /
nonusers
Benzodiazepine
72 (NA)
1) ADLs (6 items; bathing,

eating, dressing, transferring
from a bed to a chair, using
the toilet, or walking across a
small room).
1) benzodiazepine users were 1.23

times to develop ADL
disability OR 1.28 (95% CI = 1.09
1.52).
2) Risk for ADL disability was
greater with short- (HR = 1.58,
95% CI = 1.252.01) but not longacting (HR =
1.11, 95% CI = 0.891.39) agents
than for no use.
17.Health and
Retirement Study
(HRS)
Dorothy D.
Dunlop, Pamela
Semanik,
,et al,2005
(USA)
65 years or
older
5,715
NR
Functional
Limitation /
Functional
Limitation with
arthritis
24(19982000)
Non
Functional
Limitation
1) IADLs (5 items; preparing

hot meals, shopping for
groceries, making telephone
calls, taking medications, and
managing money)
2) ADL(6 items; walking
across a room, dressing,
bathing, eating, using the
toilet, and transferring from a
bed)
Page 73
1)Function declined
Significantly; in women than men
OR1.4 (CI=1.2,1.7); cognitive
impairment OR 2.86 (1.71-4.78);
depressive symptoms OR
1.27(1.05-1.55); DM OR
1.55(1.21-1.99); stroke
OR1.56(1.06-2.30); vision poor OR
1.63 (1.20-2.20); lack of regular
physical activity OR 1.94(1.542.44) age 85 or over OR 3.10(2.294.19)
1) misclassification
of benzodiazepine
exposure may have
occurred, these
analyses may have
underestimated the
true risk , because
long-term exposure
included those who
tolerated
benzodiazepines
1) secondary databases
may affect the
findings, it is unknown
which may be
consequences or
causes of baseline
functional problems
2) the physical
activity assessment
does not provide
information on the
types or levels of
activities in which
people engaged
Quality
score

July 9-11, 2012.
NO./
Database/
Country
Sources
Age
Number
Comparability Exposure
Loss
or
follow up
Intervention
Study/Control
Length
of
follow up
Outcome
Result
Limitation
18.Health and
Retirement Study
(HRS)
Dorothy D.
Dunlop,
54 65
6,871
7.19
24(19961998)
1)ADLs (6 items; dress,

toilet,
1)ADLs disability were 4.3 times

greater for depressed adults than
their non-depressed peers (95%
confidence interval=3.07 - 6.0).
1)limitations
Depression /
not
Depression
Depression
bathe, eat, walk across a

room, and transfer in and out
of bed)
et al, 2005
(USA)
common to
secondary databases
may affect
the present findings.
2)Self-reported
measurement of
limitations
in function and IADL
disability may not be
as
sensitive as objective
measures
19.The Jerusalem
Longitudinal
Study, Jerusalem
(Israel)
Jochanan
Stessman,et al,
2002
pubmed
70 77
605
32
Exercise /
No exercise
Exercise
62 (1991
1998)
1021

dressing, toileting, and rise
from chair)
2)IADL(4 items; cook, shop,
clean home, laundry)
1)ADL tasks was independently

related to exercise at age 70 for
women OR 8.5, 95%CI (2.036.2)
p=.0037 and for men OR 4.3, (1.1
17.1) p=.36
2) IADL tasks also correlated to
exercise for men in this regression
OR 3.7, (1.112.2) p=.0334 but not
for women OR 2.0, (0.66.3)
p=.229
Page 74
1) Loss follow up in
first stage
Quality
score
High

July 9-11, 2012.
Table 3 Risk factors analysis of onset disability in elderly peoples
Page 75

July 9-11, 2012.
Table 3 Risk factors analysis of onset disability in elderly peoples
Page 76

July 9-11, 2012
HSO215-8
Eating Habits, Physical Activity, and Their Associated Factors

Among Vietnamese School Children
a
Tran Thi Xuan Hanh , Nujjaree Chaimongkolb, Yunee Pongjaturawitc

a
Master of Nursing Science Student, bAssociate Professor, cAssistant Professor
Faculty of Nursing, Burapha University, Chon Buri, 20131, THAILAND
E-Mail: hanhtranthixuan@yahoo.com.vn
Abstract
The purposes of this study were to examine eating habits and physical activity and determine
relationships and differences between eating habits and physical activity, and their associated factors,
including age, gender, weight, BMI, years of study, mothers education and family income among
Vietnamese school children. Sample included 227 children currently studying in grade 3-7 in primary
and secondary schools in Ho Chi Minh city, Vietnam. Stratified random sampling was used to recruit
the sample. Data were collected from February-April 2012. Research instruments contained the
demographic recording form, the eating habits and the physical activity questionnaires, which their
internal consistency reliability of .80 and .82, respectively. Data were analyzed by using descriptive
statistics, Pearson correlation, t-test and one-way ANOVA. Results revealed that mean total score of
eating habits was 31.18 (S.D.=5.08), and of physical activity was 10.31 (S.D.=2.82), which could be
implied that the sample had high healthy eating habits while it had moderate healthy physical activity.
There were significant correlations between eating habits and child age (r=-.22, p=< .01), physical
activity and child age (r=-19, p<.01), and physical activity and weight (r=-.15, p<.05). Significant
differences of eating habits and physical activity were found between the children with different family
incomes (<5,000,000/>5,000.000) (t=- 4.05, p<.001 and t=2.87, p<.01). The results also showed
significant differences of eating habits and physical activity over the differences of the childs years of
study (F=4.97, p<.01 and F=2.67, p<.05). In addition, eating habits of the sample with different
mothers education was significantly difference (F=28.86, p<.001). These findings suggest that nurse
should promote and encourage older and heavier school children as well as children with different
family income, years of study and mothers education to have better and more appropriate eating habits
and physical activity. Furthermore, nurse and related health care personnel could apply these findings to
effectively plan an intervention program to reduce and prevent overweight and obesity among
Vietnamese school children.
Keywords: eating habits, physical activity, school children, Vietnam
INTRODUCTION
Unhealthy diets and inadequate physical activity are the key risk factors for noncommunicable diseases. The goal of the World Health Organization (WHO) is to recognize the
opportunity for reducing deaths and diseases worldwide by improving diets and increasing levels of
physical activity. This is also applied to the children as there is an increased number of overweight
and obesity in developed and developing countries (WHO, 2004). Overweight and obesity among
children is becoming a global epidemic which resulted in increased morbidity and mortality. At
present, it has been estimated that there were 21.2% of young children with 2-5 years old, and
35.5% of 6-11 years old were considered overweight or obese (Ogden, Carroll, Curtin, Lamb, &
Flegal, 2010).
Page 77

July 9-11, 2012.
Ho Chi Minh City, is the largest city in Vietnam, is growing rapidly in urbanization and
changes in peoples life style and behavioral patterns over recent decades. It has obese children
more than any other cities with 16% of overweight children, and obesity was 22.5% (National
Institute of Nutrition, 2003). Children in school age group were in the period of transition from
toddler to childhood and, they gained weight rapidly because of physical development and fat
accumulates to prepare for puberty (Burns, 2004). Studies indicated that consuming large
proportions of unhealthy foods, lack of participation in physical activities, too much sedentary
behavior at home, in school and community environments could influence the childrens health
behaviors (U.S. Preventive Services Task Force [USPSTF], 2004).
Eating habits and physical activity levels varied according to age and gender. A study
reported that children in Grade 3-8, eating breakfast, vegetable, fruit, and milk consumption
decreased with increased age while the consumption of soft drinks increased. At an older age,
children were more likely to eat foods of their own choice. However, girls preferred healthier food
than boys (Robinson & Thomas, 2004). Major differences of unhealthy eating were found in
relation to eating breakfast, and gender differences became more pronounced with age. Breakfast
consumption decreased to 9% among boys, and 17% among girls between the ages of 1115 years.
Studies also showed that less physical activity has been seen among young students as they are less
likely to walk to school since their parent dropped them in the school, and Girls were less likely
than boys to participate in physical activities (WHO, 2004).
Overweight children spent on
average 20 fewer minutes per day in moderate vigorous physical activity compared to normal
weight children. The lack of physical exercise and time spent inactive form, especially watching
TV/videos or playing video-games were found to have strong correlations with overweight status
(Trost et al., 2002). In most families, parents have worked outside their home. Thus, the families
increasingly relied on convenience foods which less nutritious. In addition, higher parental
education has been associated with health consciousness in food choices (Patrick, & Nicklas,
2005).
Currently in Vietnam, information related to health behaviors, including eating habits and
physical activity, and their associated factors among Vietnamese school children has not wellunderstood. Therefore, factors associated with eating habits and physical activities in school
children will be examined in order to gain better knowledge and understanding. Moreover, it could
be applied as fundamental information to effectively plan program and intervention to reduce and
prevent overweight and obesity among Vietnamese school children.
Objectives of the study
1. To examine eating habits and physical activity among Vietnamese school children.
2. To determine relationships and differences between eating habits and physical
activity, and their associated factors, including age, gender, weight, BMI, years of study, mothers
education and family income among Vietnamese school children.

A cross-sectional study design was used. Stratified random sampling was applied for sample
recruitment. Sample included 227 children currently studying in grade 3-7, in which the sample size
calculated based on recommendation for survey study by Bartlett, Kotrlik, and Higgins (2001).
Data were collected from 3 primary and 2 secondary schools in the District 5, Ho Chi Minh city,
Vietnam from February-April 2012.
Research instruments
1. The demographic questionnaire was developed by the researcher. Its items asked
Page 78

July 9-11, 2012.
about the childrens characteristics including, age, gender, years of study, weight, height, and the
familys characteristics, including mothers and fathers age and education, and family income.
This questionnaire was completed from the school record by the reseacher.
2. The eating habits questionnaire was developed by Turconi et al, (2008). It consisted
of 14 questions designed to investigate the food habits of the school children The score assigned to
each response ranged from always =3 to never =0, with the maximum score assigned to the
healthiest habits of eating, and the minimum score to the least healthy eating habits. The total score
ranged from 0-42. In this study, its internal consistency reliability was .80.
3. The physical activity questionnaire was developed by Turconi et al, (2008).
It consisted of 6 questions used to explore physical activity levels of the school children. Each item
score ranged from 0-3, with the maximum score assigned to the healthiest physical activity, and the
minimum score to the least healthy physical activity. The total score ranged from 0-18. In this
study, its internal consistency reliability was .82.
Translation Process
The process of back translation was used as validity testing for the measures before
administration to the sample. The eating habits and the physical activity questionnaires were
translated from English into Vietnamese language. The process of translation was followed by
back-translation technique as recommend by Douglas and Craig (2007), Cha et al. (2007), and
Sousa and Rojjanasrirat (2011).
Protection of Human Subjects
The study proposal was submitted for approval from the ethical committee of Faculty of
Nursing, Burapha University Institutional Review Board (IRB). The data collection and result
representation was done with thoughtful concern for the dignity, value, and consequence to a child
and the family.
Data Collection Procedure
The procedure of data collection was as follows:
1. After the proposal has been approved by the IRB committee of Faculty of Nursing,
Burapha University. The permission for conducting the study was obtained from the Director of
Pham Ngoc Thach Medical University, heads of Educational and Director of primary, secondary
schools of district 5 in Ho Chi Minh City, Vietnam.
2. Visited the chosen schools to inform them about the study purposes.
3. Then, obtained permission from the in-charge teacher to allow the students to participate
in the study. Subsequently, the demographic questionnaire was completed by the reseacher using
data from the students school record.
4. Initially the researcher provided briefing information related to study objectives and right
to participate to the students and explained how to answer all iterms in the questionnaires.
Page 79

July 9-11, 2012.
5. The two questionnaires of the eating habits and the physical activity for the students selfreport were filled in classroom by the students. They were taken approximately 10 - 15 minutes to
complete the two questionnaires.
6. Completed questionnaires were sealed in envelops by the participants and immediately
kept in a secure box accessible only by the researcher.
7. The researcher entered the data into a software computer program for later data analyses.
Data Analysis
Data were analyzed by using a computer software program. The level of significance was set
as .05. Descriptive data analysis in terms of frequency, percent, mean, and standard deviation was
calculated to describe demographic information, eating habits and physical activity. Pearson
correlation coefficient was used to examine association between childrens age, weight, BMI with
eating habits and physical activity among the sample. Independent t-test and one-way ANOVA
were calculated to determine the differences between genders, years of study, family income and
mothers education with eating habits and physical activity among the sample.
RESULTS
1. Demographic characteristic of the sample and family
The sample included 227 Vietnamese school children. Their mean age was 11.2 years old
(S.D. = 1.44, range = 9 -13), with their mean weight and height of 41.59 kilograms (kg; S.D. =
9.60, range = 22 69), and 143.31 centimetres (cm; S.D. = 10.45, range = 119-170, respectively).
Their average Body Mass Index (BMI; kg/m2) was 19.93 (S.D. = 3.48, range = 13-31).
Approximately, 91% of the sample had BMI less than 25 and about 9% had BMI of 25 or more.
There were 50.2% for boys, and 49.8% for girls. Their years of study were 5 levels of grade 3, 4, 5,
6 and 7. There were 21.1% of the sample in grade 3, 18.5% in grade 4, 18.5% in grade 5, 21.1% in
grade 6, and 20.7% in grade 7.
The mean mothers age was 40.51 years (S.D. = 4.74) with range from 35 years to 53
years. About one half the families (52.9%) earned more than 5.000.000 VND/month (~ 7,142 Thai
Baht). Most of their mothers completed general education. There were 33.5% of high school,
26.0% of secondary school or lower, 24.7% of university or above, and 15.9% of diploma/college.
2. Descriptive statistics of eating habits and physical activity
Mean total score of eating habits was 31.18 (S.D. = 5.08, range = 17 - 41). Mean total score
of physical activity was 10.31 (S.D. = 2.82, range = 4-18). It could be implied that the sample had
high health eating habits while it had moderate healthy physical activity.
3. Association between eating habits ofthesample and child age,gender,weight,BMI,

yearsofstudy, mothers education and family income of the sample
The results showed that there was a negatively significant correlation between eating habits
and child age (r = -.22, p < .01). However, the findings showed no significant relationship between
eating habits and weight, and eating habits and BMI (p > .05).
Page 80

July 9-11, 2012.
The results showed no significant difference of eating habits between boy and girl, and the
difference of BMI (<25/>25) (p >.05). However, there was a significant difference of eating habits
between the children with different family income in VND (<5,000,000 / >5,000.000) (M = 29.79
and M = 32.43, respectively; t = - 4.05, p < .001).
The results showed significant differences of eating habits over the difference of the childs
years of study (F = 4.97, p < .01). LSD Pos Hoc multiple comparisons revealed that the sample in
grade 3 had eating habits significantly different from those in grade 6 (M = 32.69 and M = 30.40,
respectively; p < .05) and grade 7 (M = 32.69 and M = 29.11, respectively; p < .001). The sample
in grade 5 had eating habits significantly different from those in grade 6 (M = 32.98 and M = 30.40,
respectively; p < .05) and grade 7 (M = 32.98 and M = 29.11, respectively p < .001). However,
significant differences were not found for all other pairs of the childs year of study (p > .05).
Eating habits of the sample with different mothers education was significantly difference
(F = 28.86, p < .001). LSD Pos Hoc multiple comparisons revealed that the sample with mothers
education at secondary school or lower had eating habits significantly different from those with
mothers education at high school (M = 27.00 and M = 31.40, respectively; p < .001),
diploma/college (M = 27.00 and M = 33.17, respectively; p < .001) and university (M = 27.00 and
M = 34.04, respectively; p < .001). The sample with mothers education at high school had eating
habits significantly different from those with mothers education at diploma/college (M = 31.40
and M = 33.17, respectively; p < .05) and university (M = 31.40 and M = 34.04, respectively; p <
.01). However, significant differences were not found between the sample with mothers education
at diploma/college and university level (p > .05).
4. Association between physical activity of the sample and child age, gender, weight, BMI,
years of study, mothers education and family income
The results showed that there were negatively significant correlations between physical
activity and child age (r = -.19, p < .01), and weight (r = -.15, p < .05). However, the findings
showed no significant relationship between physical activity and BMI (p > .05).
The results showed no significant difference of having physical activity between boy and
girl, and the difference of BMI (<25/>25) (p >.05). However, there was a significant difference of
physical activity between the children with different family income in VND (<5,000,000 /
>5,000.000) (M = 10.88 and M = 9.83, respectively; t = 2.87, p < .01).
The results showed significant differences of physical activity over the difference of the
childs years of study (F = 2.67, p < .05). LSD Pos Hoc multiple comparisons revealed that the
sample in grade 3 had physical activity significantly different from those in grade 6 (M = 11.08 and
M = 9.42, respectively; p < .01) and grade 7 (M = 11.08 and M = 9.94, respectively; p <.05). The
sample in grade 4 had physical activity significantly different from those in grade 6 (M = 10.76 and
M = 9.42, respectively; p < .05). However, significant differences were not found for all other pairs
of the childs year of study (p > .05). Moreover, physical activity of the sample with different
mothers education was not significantly difference (p>.05).
DISCUSSION
From the finding, the Vietnamese school children had high healthy eating habits (M =
31.18). This finding was inconsistent with other studies which found moderate level of eating
Page 81

July 9-11, 2012.
habits (Turconi et al., 2008). Although this result showed high level, but its score was in low-high
of the high eating habit level (30.01-42.00). Moreover, consuming more on vegetables and fruits
and less on fat and calories was the norms of Vietnamese people. The result also reveled that the
Vietnamese school children had moderate physical activity (M = 10.31). This was consistent with
other studies which have found that moderate level of physical activity (Turconi et al., 2008). The
reasons were similar to many studies that the children had increasing television viewing, using
internet, and playing sedimentary games, etc. (Coon, Goldberg, & Rogers, 2001; Francis et al.,
2003).
The findings showed that the older the children, the less the healthy eating habits. This
finding was consistent with previous study (Temple, Steyn, Myburgh, & Nel, 2006). The
explanation is that children younger than 12 years old in Vietnam were served for lunch at school
as the national policy whereas children 12 years or older had to purchased food at school, mainly at
the school store. Moreover they usually ate outside the school with high-fat snacks and fast food
with their own preference choices.
In addition, the child with family income more than 5,000,000 VND/month had healthier
eating habit than those with family income 5,000,000 VND/month or less. Eating habits of the
children was significant difference when they had different years of study and mothers education.
There was inconsistent with a previous study reported that 62% in the highest income family
consumed fewer than the recommended minimum of three daily servings (Community, & Survey,
2006). Moreover, it could be explained with similar reason above that age was negatively
correlated to eating habits. For mother education, the finding was consistent with Xie et al. (2003)
and Craig et al. (2010). They reported that the likelihood of eating a healthy diet increased with
parental high education levels.
The results also showed that the older and heavier the children the less physical activity.
This finding was consistent with many studies (OLoughlin et al., 1999; National Institute of
Nutrition, 2003). The explanation is that, in urban area, especially in Ho Chi Minh City, most
children spend their leisure time for indoor activities like watching TV, playing games and reading.
But there were very few children with physical activities. In addition, they indicated that children
with higher weight status played moderate amounts of electronic games, while children with lower
weight status spent very little time engaged in playing electronic games.
In addition, the child with family income 5,000,000 VND/month or less had more physical
activity than those with family income more than 5,000,000 VND/month. Physical activity of the
children was significant difference when they had different years of study. This finding of family
income was consistent with previous study showed that children aged 12 to 20 years from low
income families were more physically inactive than those from high income families. Moreover,
the finding of year of study was consistent with previous research (Trost et al., 2002; The Kaiser
Family Foundation, 2005; Rew, Horner, & Fouladi, 2010). They found that grades 4 and 5 were
statistically significantly different from the mean for health behavior at grade 6, and girls engaged
in more health behaviors than boys. This could be explained was consistent with children aged
above findings. Children with low grade of study were physical activity better than children with
high grade of study.
Page 82

July 9-11, 2012.
Recommendations
1. Nurse should promote and encourage older and heavier school children as well as
children with different family income, years of study and mothers education to have better and
proper eating habits and physical activity. For example, nurse could facilitate to initiate a project to
provide lunch box and/or fresh milk with standard quality of food at primary and secondary school.
In addition, policy related to school food provision and routine physical activity program at school
could be driven by nurse action.
2. Nurse and related health care personnel who work with school children should apply
these findings to effectively plan an intervention program at school level, such as the weightwatcher project and the daily morning aerobic project, to reduce and prevent overweight and
obesity among Vietnamese school children.
ACKNOWLEDGEMENTS
The researcher would like to deeply thanks to major and co-advisor for their help, thanks to
Burapha University, Thailand, for partly research funding, many thanks to Pham Ngoc Thach
University, Vietnam, to support my studying in Thailand, a lot of thanks to all participants and
contributors to make this study possible and completed, and the last but not least thanks to all my
family for financial and emotional supports.
Page 83

July 9-11, 2012.
REFERENCES
Bartlett, J. E., Kotrlik, J. W., & Higgins, C. C. (2001). Organizational research: Determining appropriate
sample size in survey research. Spring, 19(1), 4350. Retrieved from
http://www.citeulike.org/group/2682/article/1349629
Burn,C.E., Dunn., A. M.,Brady, M. A., Starr, N. B., & Blosser, C .G. (2004). Pediatric primary care: A
handbook for nurse practitioner. (3 rd ed.). St. Louis: Saunders.Cha, E.S., Kim, K. H., & Erlen, J.
A. (2007). Translation of scales in cross-cultural research: issues and techniques. Journal of
Advanced Nursing, 58(4), 386-395.
Community, C., & Survey, H. (2006). Canadian Community Health Survey: Overview of Canadians
eating habits. Community Health, (May), 1-9.
Coon, K. A., Goldberg, J., Rogers, B. L., & Tucker, K. L. (2001). Relationships between use of
television during meals and childrens food consumption patterns. Pediatrics, 107(1), E7.
Retrieved from http://pediatrics.aappublications.org/cgi/doi/10.1542/peds.107.1.e7
Craig, L. C. A., McNeill, G., MacDiarmid, J. I., Masson, L. F., & Holmes, B. A.(2010).Dietary patterns
of school-age children in Scotland: association with socio-economic indicators, physical
activity and obesity. The British journal of nutrition, 103(3), 319-334.
Douglas, S., & Craig, C.S. (2007). Collaborative and iterative translation: An alternative approach to
back translation. Journal of International Marketing, 15(1), 30-43.
Francis, L. A., Lee, Y., & Birch, L. L. (2003). Parental weight status and girls television viewing,
snacking, and body mass indexes. Obesity Research, 11(1), 143-151.
National Institute of Nutrition. (2003). The National General survey on overweight and obesity.
Retrieved from http://www.tinmoi.vn/Ty-le-hoc-sinh-beo-phi-nhieu truong-hoc-tren
0969899.html
Ogden, C. L., Carroll, M. D., Curtin, L. R., Lamb, M. M., & Flegal, K. M. (2010). Prevalence of high
body mass index in US children and adolescents. Journal of American Medical Association,
303, 242-249.
OLoughlin, J., Paradis, G., Kishchuk, N., Barnett, T., & Renaud, L. (1999). Prevalence and
correlates of physical activity behaviors among elementary school children in multiethnic, low
income, inner-city neighborhoods in Montreal, Canada. Annals of Epidemiology, 9(7), 397407.
Patrick, H., & Nicklas, T. A. (2005). A review of family and social determinants of childrens eating
patterns and diet quality. Journal of the American College of Nutrition, 24(2), 83-92.
Rew, L., Horner, S. D., & Fouladi, R. T. (2010). Factors associated with health behaviors in middle
childhood. Journal of Pediatric Nursing, 25(3), 157-166.
Robinson, C.H., & Thomas, S.P. (2004). The interaction model of client health behavior as a conceptual
guide in the explanation of childrens health behaviors. Public Health Nursing, 21(1), 73-84.
Sousa, V. D., & Rojjanasrirat, W. (2011). Translation, adaptation and validation of instruments or scales
for use in cross- cultural health care research: a clear and user- friendly guideline. Journal of
Evaluation in Clinical Practice, 17(2), 268-274.
Temple, N. J., Steyn, N. P., Myburgh, N. G., & Nel, J. H. (2006). Food items consumed by students
attending schools in different socioeconomic areas in Cape Town, South Africa. Nutrition
Burbank Los Angeles County Calif, 22(3), 252-258.
The Kaiser Family Foundation (2005). Generation M: Media in the lives of eight to eighteen year olds.
Washington, DC: Author. Retrieved from
http://www.kff.org/entmedia/entmedia030905pkg.cfm
Trost, S. G., Kerr, L.M.,Ward, D. S., & Pate,R. R. (2002). Physical activity and determinants Of
physical activity in obese and non-obese children. International Journal of Obesity, 25, 822-829.
Turconi, G., Guarcello, M., Maccarini, L., Cignoli, F., Setti, S., Bazzano, R., & Roggi, C. (2008). Eating
habits and behaviors, physical activity, nutritional and food safety knowledge and beliefs in an
adolescent Italian population. Journal of the American College of Nutrition, 27(1), 31-43.
U.S. Preventive Services Task Force (USPSTF). (2004). Screening for obesity in adults:
Recommendations and rationale. Annals of Internal Medicine, 69(5), 930-932.
Page 84

July 9-11, 2012.
Word Health Organization (2004). Global strategy on diet, physical activity and health. (S. W. H.
Organization, Ed.) Scandinavian Journal of Nutrition, 2002(May), 57-57. World Health
Organization. Retrieved from http://www.informaworld.com/openurl?genre=article&doi=
10.1080/11026480410034349 &magic=crossref
Xie, B., Gilliland, F. D., Li, Y. F., & Rockett, H. R. H. (2003). Effects of ethnicity, family income, and
education on dietary intake among adolescents. Preventive Medicine, 36, 30-40.
Page 85

July 9-11, 2012.
HSO216-9
Family factors affecting unintentional home injuries among young

children in Wenzhou, China
Xian Yun Qiu, Chintana Wacharasin, Wannee Deoisres
Faculty of Nursing, Burapha University
E-mail: qiuxianyun1001@163.com
Abstract
Unintentional injuries are the leading cause of morbidity and mortality among children
under five years globally. Around 1/2 of injuries are composed of Unintentional Home Injuries
(UHI). They result in not only physical and psychological problems for children but economic
losses and stress for their family. Family as childrens immediate surroundings provides
psychological and physical environment affecting UHI. Few researchers pay attention to predictors
of UHI among toddlers from perspective of family system. The objective of the study was to
determine how family income, family type, home hazards, family functioning, parents education,
parenting style and parents awareness on UHI affect UHI among toddlers. The random sampling
was performed to select 280 parents with toddlers attending kindergarten in Wenzhou, China.
Research instruments used to collect data were questionnaires. Descriptive statistics showed that
the incidence rate of UHI among young children was 40.4% and the leading types of UHI were fall
(42%), struck by/against (28%). Multivariate logistic regression revealed that the predictor of UHI
was home hazards. Children in the families having high home hazards received UHI at 1.89 times
more than those having low home hazards did. This result suggested that heath care providers
should reduce home hazards in order to prevent UHI among toddlers in China. Further study is
needed to highlight determinants and intervention regarding home hazards among toddlers in
China.
Keywords: unintentional home injuries, young children, parents awareness, family functioning,
home hazards
INTRODUCTION
UHI are unintentional injuries taking place at home (Alptekina et al., 2008). Unintentional
injury is the leading cause of morbidity and mortality among children under five years globally
(World Health Organization [WHO], 2004; 2008). In China, the incidence of accidents aged 0-3 or
0-4 years was 11.5%-19.1% and 1/3 to over 1/2 of the previous cases occurred at home (Hui and
Xia, 2004; Xin et al., 2005). The age group of 2-3 years old was more affected by household
injuries (Jiang et al., 2008), since the imbalance between motor skills and cognitive development
makes them vulnerable to accidents (Ball and Bindler, 2006). They also spend most of time at
home. Therefore, toddlers are prone to UHI.
UHI among young children would bring about a wide range of impacts on themselves and
their families. It was reported that 76% of pediatric burns occurred at home and resulted in
dramatically acute and lifetime physical and psychological problems such as excruciating pain,
anticipatory anxiety and overt distress (Tarnowski et al., 1991). Childrens mothers also experience
post-traumatic stress disorder after their children have suffered a large burn (Kent et al., 2000).
Likewise, UHI produces considerable costs. In Canada, it was estimated that 630 million dollars a
Page 86

July 9-11, 2012.
year are spent with childhood falls alone (Angus et al, 1998). UHI is harmful to children, their
family or society.
Family serves as a childs immediate surroundings. Integrated interactions of children with
family system have the greatest impact on UHI. Low income, overcrowding or divorced family was
risk factors for UHI (Akhtar, et al., 2006; Alptekina et al., 2008). Home hazards also possibly
increase the incidence rate of accidents requiring medical attention (Keall et al., 2008). Likewise,
family functioning affecting UHI is also worth concerning. Zhao (2009) emphasized that weaker
family cohesion while stronger family conflict resulted in higher rate of accidents to school-aged
students. Lastly, parents factors are also essential with respect to parents education and interaction
of parent-children such as parents awareness on UHI and parenting styles. Lack of education for
parents was risk factor for UHI (Akhtar et al., 2006). Parents with low awareness to UHI
experienced more potential injury events and parenting style with permissive elevated young
childrens risk for UHI (Qin, 2010a; Morrongielllo et al.,2006).
In China, few researchers pay attention to home accidents. Moreover, fewer study focus on
toddlers about UHI (Pang, 2010a; 2010b; Xing et al, 2011). It is estimated that 115,000 children
aged 1-3 years live in Wenzhou of Zhejiang province. In the province, the prevalence of accidents
to school-aged students was 41.9% in 2008 and the deaths dying from accidents accounted for 44%
of total deaths in 2004 (Zhu 2008; Han et al., 2007). However, it is little known what factors
determine home accidents among young children in Wenzhou. The purpose of the study is to
identify family factors affecting UHI among children with 2 - 3 years old in Wenzhou, China. This
would guide family nurses to identify vulnerable families and adopt tailored intervention with risk
factors to prevent UHI.
This is a predictive design research. The populations were parents having young children aged
2 to 3 years old residing in Wenzhou city.
Sample size and sampling: Given logistic regression adopted to analyze data, 40 to 1 of
cases-to-independent variables is reasonable (Tabachnick and Fidell, 2007). Because of 7
independent variables, two hundred eighty of samples are needed. It was cluster sampling. Samples
were recruited from kindergartens in three communities of Lucheng district enrolling children
younger than 4 years old. Two communities were randomly chosen from 12 urban communities of
Wenzhou. All eligible kindergartens were drawn from the two communities except for one
kindergarten which leader did not permit. Following permission from all kindergartens, each class
which contained children aged 2-3 was chosen to collect data.
Research instruments: There were six instruments as the below:
Demographic questionnaire was used to assess characteristics of children (e.g., age, gender),
family (i.e., family income, family type), and parents (e.g., education, occupation).
UHI had to meet the following criteria: injuries was diagnosed by the international
Classification of Diseases-10th (ICD-10), the injuries occurred at home within the past six months
and the injuries required first aid, health professionals care, or rest for at least half of day (Wang
1998).
Page 87

July 9-11, 2012.
The Family Adaptability and Cohesion Evaluation Scale, the second edition-Chinese version
(FACESII-CV) was used to measure family functioning (Fei et al., 1999). There were 28 items
with 5-likert type of scale. The Cronbachs alpha was .80.
The Assessment Tool of Domestic Hazards (ATDH) was used to evaluate number of home
hazards (Pang et al., 2010b). It includes 37 items. The total score is 37 points. Internal consistency
was .85 and test- retest reliability is .69.
Situation Awareness of Toddlers Parents to Domestic Injuries (SATPDI) was used to assess
parent awareness on UHI (Pang, 2010a). It contains 24 questions to ask parents to identify home
hazards, choose the consequence of the hazard and actions their child do on the hazard for their
own child in a simulative home. Crobachs alpha was .88 and test-retest reliability was .79.
Parenting Style Questionnaire (PSQ) was used to evaluate parenting style for young children
under 6 years old (Zhu & Qin, 1998). The 20-item questionnaire was five- point likert type scale. It
comprised permissive, authoritative and authoritarian. Cronbachs alphas were from .5 to .8.
The above instruments comprised the total questionnaire named investigation on relevant
factors and occurrence of unintentional home injuries among toddlers in Wenzhou.
Data collection: Six research assistants were trained to collect data. Research group collected
data when parents go to school to pick their children up. The group explained eligible parents
research objectives, advantage and disadvantage for them and their rights to withdraw at any time.
After informed consent was obtained, questionnaires were handed to them and taken back home.
After 1 or 2 days, participants had to bring the questionnaire back to class. Each questionnaire was
put in one envelope where there was a slip of paper about instruction how to write the questionnaire
and double faced adhesive tape to seal it. Plastic turtle as a gift was given to every participant as
acknowledgement. The questionnaires were locked in safe area and will be destroyed after the
study is published.
Samples: There were 280 completing questionnaire from 372 eligible subjects. The response
rate was 75.7%. All target children were 24 to 47 months years old. The majority of them (67.9%)
fell into age group within 36-47 months. Seventy-five percents of participants were mothers.
Parents graduating from four various levels of education took account for the same percentage
(25% respectively). Half of them have been living in nuclear family, half in extended family.
Three-fourths families did not reach average line by family income (Statistics department of
Wenzhou government, 2012).
RESULTS
The incidence rate of UHI with the target children was 40.4% within half of a year in
Wenzhou. The leading types of UHI were fall (42%), struck by/against (28%), cutting (6.8%) and
burn (6.7%). Likewise, fifty-nine percents of children with UHI have sustained injuries one time
while 41% children for two times or more (see table1).
Page 88

July 9-11, 2012.
Table 1 Characteristic of UHI among toddlers
The result showed that only home hazards was significant correlated with UHI (2 = 6, p
=.01) (table 2). Therefore, only home hazards could be entered the multiple logistic regression.
Table4 showed that home hazards could significantly affect UHI (P= .002, OR = 2.31) (see table
3). The possibility to get UHI among children living in the home with high hazards was 2.31 times
as many as that among children with lower home hazards.
DISCUSSION
The incidence rate of UHI among toddlers in this study (40.4%) was one time higher than the
rates in other areas of China (Hui and Xia, 2004; Xin, Nan and Ling, 2005). Moreover, the
occurrence rate of UHI requiring health care was 17.14% in Wenzhou, higher than that in the U.S.
(0.64%), but near the rate in Turkey (12%) (Runyan, et al., 2005; Alptekina et al., 2008). Likewise, 41% of children sustained UHI in the study have suffered injuries more than one time in the
past 6 months. The leading types of UHI in this study were fall, struck by/against, and cutting,
similar to those in the U. S and Turkey (Runyan, et al., 2005; Alptekina et al., 2008). Toddlers were
vulnerable to accidents which might be due to their curiosity to explore unknown world while
unawareness of dangerous environment.
The finding indicated that only high home hazard was risk factors causing UHI. Strong
curiosity of toddlers on new objects and development of motor skill induce them to access to home
hazards, meanwhile, they fail to identify the dangerous of hazards due to insufficient cognition
ability (Ball & Binder, 2006). The imbalance causes young children easy to touch injury hazards
and results in UHI. For example, children tend to fall when they climb up on the table through short
chair. Children could undergo burn if they access to hot food warmer and turn over it and sustain
cutting if they play knife.
The result also revealed that family income, family type, and family functioning failed to
predict UHI among young children. Given that most of family in China have only child, parents are
willing to spend money and time to focus on childrens safety behavior whether they are rich or
Page 89

July 9-11, 2012.
poor. Actually, it did not cost family substantial money to create safety home environment and
nearly all families could afford it. Additionally, extended family is also more likely to produce
sufficient support to take care of children in order to prevent them from accidents, whereas this
family is more likely to produce more home hazards. Therefore, on balance, family type had no
significant relationship with UHI. Likewise, Herring et al. (2006) emphasized that poor family
functioning resulted in parents mental disorder and toddlers psychological problems.
Nevertheless, a few study (Ram say et al., 2003; Rhodes and Washyna, 2007) found that parents
mental well-being, young childrens emotional illness and behavioral problem were not statistically
significantly predictors of home accidents.
Table 2 Relationship between UHI and family factors (N = 280)
Table 3 Multiple logistic regression results predicting UHI (N=280)
Page 90

July 9-11, 2012.
Surprisingly, parents awareness did not affect UHI. This is possibly because parents with
high awareness often overestimate the young childrens ability to identify injury hazards and highrisk situations although they have higher ability to identify home hazard and understand the
relationship between hazards and injuries (Morrongiello et al., 2001). Besides, parents awareness
might be increased after their children had fallen UHI before investigation. Parents with
authoritative teach their children with high rules and explanation for rules about home safety while
authoritarian are accustomed to high rules but low explanation (Morrongiello et al., 2006). The two
kinds of parenting trend to use rules for home safety. Morrongiello et al (2000) also asserted that
the Children with 4-6 years old spontaneously recalled only about half of their parents' home safety
rules and the child's injury history was not significantly related to the number of rules for home
safety. Furthermore, toddlers would recall less rules compared with the children aged 4-6 years.
Thus, parenting style was not predictor of UHI. Interestingly, the present study indicated that
children whose parents had both the highest and the lowest level of education experienced higher
occurrence rates of UHI (48% and 41% respectively). The possible interpretation was that the two
kinds of parents in Wenzhou had to spend more time to work and less time to take care of their
children.
Implications for nursing science
The study suggested nurses or other health care professional who work with the family
having toddlers should concern UHI prevention. They should target every family during
childbearing period or with young children regardless of the parents education level, the family
income, and family type. It is worthwhile for the nurses to help target parents to be aware of the
importance of home hazards for childrens home injuries and evaluate home environment
especially home hazards during assessing family health. Furthermore, nurses should put more
efforts on creating safety home environment. It is also necessary for healthcare providers to teach
parents how to cope with common types of UHI among toddlers in first aid such as fall, cutting,
burn and chocking.
Further study is needed to identify risk or protective factors affecting home hazards. Based
on these factors, focus of nursing research is on making tailored intervention how to decrease home
hazards in order to reduce UHI. Moreover, cost-efficiency intervention with modification home
environment could be taken into account. This will guide health professionals to take most effective
measures for creation safety home by the minor cost.
Page 91

July 9-11, 2012.
REFRENCES
Angus, D. E., et al.1998. The economic burden of unintentional injury in Canada. Toronto: Smartrisk.
Retrieved April 14, 2004, from http: //www. Phac -aspc.gc.ca/ injury-bles/ebuic-feb nc/indexeng.php.
Akhtar, S., Rani, G. R., and Anezi, F. A. 2006. Risk factors in acute poisoning in children - a
retrospective study. Kuwait Medical Journal 38 (1): 33-36.
Alptekina, F., Uskunb, E., Kisioglub, A. N. and Ozturk, M. 2008. Unintentional non-fatal home-related
injuries in Central Anatolia, Turkey: Frequencies, characteristics, and outcomes. Injury
International journal Care injured 39: 535-546.
Ball, J.W., and Bindler, R. C. 2006. Concepts of growth and development, pp.141-154. In Pearson
Education. In Cowen, J.K (ed.). Child health nursing: partnering with children and families,
Upper Saddle River, New Jersey.
Fei, L. P., Zheng, Y. P. and Zhou, D. H. 1998. FACESII-CV. Chinese Psychological health journal 102
109 (Supplement).
Fu, w. 2003. A study on incidence of unintentional injuries and its affecting factors in kindergarten
children in Gongbei community of Zhuhai City. Masters thesis. Department of public health,
Jinan University, Zhejiang, China.
Gaines, J., and Schwebel, D. C. 2009. Recognition on home injury risks by novice parents of toddlers.
Accident Analysis and Prevention 41: 10701074.
Han, X. L., Liang, J. F. and Chen, C. X. 2007. Analysis on deaths among children under 5 years old in
Zhejiang province. Journal of Zhe Jiang prevention medicine 19: 31-32.
Herring, S. et al. 2006. Behavioral and emotional problems in toddlers with pervasive development
disorders and developmental delay: associations with parental mental health and family
functioning. Journal of Intellectual Disability Research 50: 874-882.
Hu, Q. G. et al. 2011. An epidemiological survey on the incidence of non-fatal injury and influencing
factors among children under 5 years old in china. Chinese Journal of Epidemiology. 32: 773776.
Hui, H. Z., and Xia, C. Z. 2004. An epidemiological analysis on injuries among children in Tianhe
district of Guangzhou. South China Journal of Prevention Medicine 30(4): 6.
Jiang, Y. H., Zhong, Y., Liu, K. X., Kang, R. T., and You, C. 2008. The analysis of causes of
unintentional injuries among 2543 children. Journal of China pediatric health 16: 231-232.
Jin, H.Q., Li, C. Y., and Yu, W. S. 2007. Analysis on familial aggregation in unintentional injury and
accident-proneness. Chinese Women and Childrens Health 22: 1907-1908.
Keall, M. D., Baker, M., Philipp, H. C., and Malcolm, C. 2008. Association between the number of
home injury hazards and home injury. Accident Analysis and Prevention 40: 887893.
Morrongiello, B. A., Midgett, C. and Roslyn Shields, R. 2001. Don't Run With Scissors:
Young Children's Knowledge of Home Safety Rules. Journal of Pediatric Psychology 26: 105115.
Morrongiello, B. A., et al. 2006. Factors influencing young children's risk of unintentional injury:
Parenting style and strategies for teaching about home safety, Journal of Applied
Developmental Psychology 27: 560570.
Pang, S. Q. 2010a. A study on the reliability and validity of a tool to measure the situation awareness of
toddlers' parents towards domestic injuries. Chinese Journal of Nursing 45(6): 505-508.
Pang, S. Q. 2010b. Effects of using visual material for the education of toddlers parents to promote the
situation awareness towards domestic injuries. Chinese Journal of Nursing 45(12): 1065-1068.
Ramsay, L.J., et al. 2003. UHI in preschool-aged children: looking for the key-an exploration of the
interrelationship and relative importance of potential risk factors. Public Health 117: 404411.
Rhodes V. K. and Washyna, J. T. 2007. Child injury risks are close to home: parent psychosocial factors
associated with child safety. Matern Child Health Journal 11: 69-275.
Runyan, C.W. et al. 2005. Unintentional injuries in the home in the United States part II: morbidity.
American Journal of Preventive Medicine 28: 80-87.
Page 92

July 9-11, 2012.
Statistics department of Wenzhou government 2012. Average income of residents in Wenzhou
rural within the first quarter of 2012. China: Wenzhou. Retrieved April 13, 2012, from
http://www. wzstats.gov. cn/ infoshow.asp?id =10 006.
Tabachnick, B. G., and Fidell, L. S. 2007. Using multivariate statistics (5th ed.). Pearson Education,
United States of America.
Tarnowski, K. J., Rasnake, L. K., Gavaghan-Jones, M. P., and Smith, L. 1991. Psychosocial sequelae of
pediatric burn injuries; A review. Clinical Psychology review 11: 371-398.
Wang, P. S. 1998. Content and methods of study on injuries epidemiology. Journal literature and
information of prevention medicine 4: 299-303.
World Health Organization [WHO] 2004. Annual incidence (000s) for selected causes, in WHO
Regions (a), estimates for 2004. Retrieved October, 2008, from http://www.who.int/ health
info/ global_ burden _ disease/INC6%20 2004.
WHO 2008. Causes of death 2008 summary tables. Retrieved May, 2011, from http://www. who.int
/gho/ mor- tality_burden_disease/global_burden_ disease_ DTH6_2008.xls.
Xin, C., Nan, L. X., and Ling, S.Y. 2005. Epidemiology study on unintentional injury among children
0-14 years in Xuzhou city. Chinese Journal of School Doctor 19: 3.
Xing, H. Z., Chen, X., Wang, Z. N., Qiu, L. J. and Xiao, M. 2011. A survey on the temperament of children
who have suffered from foreign body airway obstruction and their parents parenting styles.
Journal of Nursing Administration 11: 248-249
Zhao, K. F. 2009. A study on unintentional injury and mental health status of stay-at-home children in
rural area of Anhui province. Masters thesis, Public Health Department of Anhui Medical
university, Anhui, China.
Zhu, X. X. (2008). An Cross-Sectional Study on Injuries of School Aged Children of Migrant Workers
in Hang zhou. Masters thesis, Department of Epidemiology and Statistics, Zhejiang university,
Zhejiang, China.
Zhu, Y, L., and Qin, Y. C. 1998. Young childrens temperament influencing parenting style.
Psychological science 21: 43-48.
Page 93

July 9-11, 2012.
HSO197-10
Improving health promotion for people in Faculty of Public

Health Burapha University, Thailand
Yuvadee Rodjarkpai
Dr.PH,.Assistant Professor, Department of Health Education

Faculty of Public Health, Burapha University, Chon Buri, Thailand
Abstract
Objective: To improve the health promotion for people in Faculty of Public Health Burapha
University .
Methods: Operations research was carried out in five phases: self-assessment, training, planning of
the health promotion projects, implementation of an action plan and evaluation of the health
promotion projects based on the action plan. Data were gathered throughout the research in the
five- year period of the study. Four instruments were used to collect data: 1) Guidelines for focus
groups 2) Self- assessment 3) Questionnaires 4) Stress test. Content validity of the questionnaires
was determined by consulting with and expert to make some grammatical correction and suitability
in language usage adjustment before trial application. The sample population from the people in
Faculty of Public Health included students officers and lecturers about 540.Data were analyzed by
using percentage, mean value, standard deviation.
Results: After it was implemented, the health promotion was evaluated, along with changes in
health promotion behaviors, Good dietary habits, Good security habits no stress, good environment
and health promotion curriculum.
Conclusion: Given administrator support and teamwork among people, the health promotion
process can be an important tool in development of faculty-based health promotion projects.
Key words: Improving,Health promotion, faculty of public health
Page 94

July 9-11, 2012.
HSP24-1
Characteristics of toxic epidermal necrolysis and StevensJohnson syndrome: A 5- year retrospective study
Jiranuch Thammakumpee MD *, Somchai Yongsiri MD**
* Internal medicine department Chonburi hospital,Thailand
**Faculty of Medicine,Burapha university Thailand
Abstract
Background:Toxic epidermal necrolysis (TEN) and Stevens-Johnson syndrome (SJS) are rare,
unpredictable, life-threatening drug reaction with high mortality and acute emergencies condition.
There was no data about these patients in community base practice in Thailand.
Objective: To study the demography, causative drugs, laboratory features, treatments,
complications, and mortality of TEN/SJS in Chonburi hospital and compare factors associated with
mortality between groups.
Material and Method: The medical records of TEN/SJS patients during 2005-2009 were
retrospectively reviewed. Characteristic of the patients and factors associated with mortality were
analyzed by SPSS version 19 for windows.
Results: There were 15 SJS and 9 TEN patients. The average age was 40.13+/-22 years. Male to
female ratio was 1.4:1. The mean SCORTEN on day 1 was 1.54+/-1.1 and 1.79+/-1.59 on day 3.
The overall mortality was 20.83%. Antibiotics were the commonest group of drugs causing
TEN(55.6%) and SJS(66.7%) . Septicemia and pulmonary infections were associated with higher
mortality (p<0.001 and 0.004 respectively). Steroid treatment was associated with lower mortality
13.33 % vs. 33.33 %.
Conclusion: Antibiotics is the most common causative agents in SJS/TEN. Sepsis and pulmonary
infections are associated with higher mortality. Steroid treatment may have some survival benefit.
Keywords: Stevens-Johnson syndrome, toxic epidermal necrolysis

Correspondance to: Jiranuch Thammakumpee. Internal medicine department, Chonburi hospital,
Chonburi 20000, Thailand. Phone & Fax: 0-3893-1101.E-mail: jiranuchth@gmail.com
Page 95

July 9-11, 2012.
HSP28-2
The dispended of polypharmacy with steroids for asthma

symptom: Study on the Bang Phlat district, Bangkok
Pimporn Thongmuang.1 and Yuttana Sudjaroen.2
1Department of Aesthetic Health Science, Faculty of Science and Technology, Suan Sunandha
Rajabhat University 1 U Thong Nok Dusit 10300, Bangkok, Thailand
2Department of Health Science, Faculty of Science and Technology, Suan Sunandha Rajabhat
University 1 U Thong Nok Dusit 10300, Bangkok, Thailand
Email: phamaice@hotmail.com
Abstract
The purpose of this study is 1) to survey the number of drugstores that unlawful dispended
of asthma prescription drugs, in form of a polypharmacy (drug set), in district of Bangkok, Bang
Phlat, 2) to inspect the steroid contained in that polypharmacy, 3) to find means for informing
general public about the danger of the drugs and for conduct a campaign for stop using them.
Researcher collected polypharmacies from 69 drugstores in Bang Plat from Feb 1, 2012 to
Mar 1, 2012. The survey found 18 drug stores, or 26.08 %, sold asthma polypharmacy drug to
customers without proper prescription.
The collected samples were tested for steroid
contamination by using Immunochromatography kits. Five samples, or 27.78%, were found
contaminated with steroids. To improve the knowledge of self health maintenance and drug usage
among public, Thai Department of Public Health should educate people about the side effects of
using polypharmacy and steroids. It should also tightly control and closely inspect the practices of
drugstores in the distribution of steroid medications.
Keywords: steroids, dispend, polypharmacy, asthma relief, Bang Phlat
INTRODUCTION
Steroid is a controlled substance according to Notification of Public Health, Subject:
Special Controlled Drug. This means steroid distribution is restricted under Drug Act. B.E. 2510,
section 4 which states that steroid can only be prescribed by licensed medical practitioner,
veterinarian, or a drugstore that has a licensed pharmacist on duty at all time. Thailands legal
principle pertaining to the dispensing of polypharmacy (drug set) under Drug Act. B.E. 2510
section 75 bi amended by Drug Act. B.E. 2530 prohibits any person from dispensing a mixing of
medications as one prescription intending to cure, to treat or to prevent one particular condition.
The prohibition does not apply to licensed pharmacist, medical profession or licensed dentist who
prescribes only to their patients or veterinarian who dispenses only for their patients (Drug Act.
B.E. 2510, 2010). However, the problem of using polypharmacy still persists in both Bangkok and
other provinces. In provincial area, polypharmacy can be purchased from any drugstore, grocery or
even coffee shop. Most of polypharmacies obtained from sampling were intended to cure flu, to
relieve body aches and pain or to lower weight. Each of them made up of painkillers, linking to
mental side effects, anti inflammatory drugs, vitamins and acid reducing medicines. And almost
Page 96

July 9-11, 2012.
every polypharmacy includes some form of steroid drug because polypharmacists believe that
steroid is potent to treat a wide range of medical conditions (Charoenphol, 1996).
Survey of drugstores distribution of polypharmacy for body aches and pain dispended in
Ratchathewi district founded that 6 out of 95 samples contained steroid. Ratchathewi district is
located in the heart of Bangkok, there should be no case of illegal distribution of steroid
(Thongmuang and Sudjaroen, 2010). The similar survey was conducted in Dusit district and
founded 12 out of 38 drugstores illegally dispended ace and pain polypharmacy containing steroid.
These results are unexpected because both Ratchathewi and Dusit districts are located in the center
of Bangkok where there should be no case of illegal steroid distribution left (Thongmuang and
Sudjaroen, 2011).
The effects of glucocorticoids in human can cause give risk to diabetes mellitus, immune
reaction suppression, perforation of the ulcer occurs, reduce bone production and may develop
cataract or glaucoma (Greenstein, 2004; Clayton, Stock and Harroum, 2007; Karch, 2008) This
objective of this research were to surveillance of steroids in asthma polypharmacy dispended for
asthma relief from drugstores in the Bang Phlat district, and evaluate situation of polypharmacy
with steroid drug usage.
There are several methods to determined for the quantity of steroid (Dexamethasone and
Prednisolone) such as; High Performance Liquid Chromatography or Thin Layer Chromatography
(Thongyindee, 2004) in the form of Dexamethasone or Prednisolone tablet following
pharmacopoeia (The United States Pharmacopoeia, 2009), or analyzing using Fourier transform
infrared spectrophotometer and UV-visible spectrophotometer (Ruaysup, 2004) and this research
was qualitative determined dexamethasone and prednisolone by immunochromatographic test kit
from Bureau of Drug and Narcotic, Department of Medical Science, Ministry of Public Health,
Thailand which was rapid and simply to perform with no prerequisite regarding laboratory
equipments or laboratory skills (Matapatara and Likitthanaset, 2008)
Sample collection: The polypharmacies were collected by 30 volunteers who studied in
Department of Aesthetic Health Science and Department of Applied Thai Traditional Medicine,
Faculty of Science and Technology, Suan Sunandha Rajabhat University from 69 drugstores in the
Bang Phlat district, Bangkok on February to March 2012. Name and location of 69 drugsstores in
the Bang Phlat district were provided from Food and Drug Administration, Ministry of Public
Health. All volunteers were trained explained asthma symptom, and common data of drug stores
including pharmacist duty.
The polypharmacies were brought and collected by students whom study in Department of
Aesthetic Health Science and Department of Applied Thai Traditional Medicine, Faculty of
Science and Technology, Suan Suandha Rajabhat University.
The conversation for polypharmacy dispended was asking for prescribed were photo and
labeled as individual data (Fig. 1).
Page 97

July 9-11, 2012.
Figure 1. Polypharmacy collected from drugstores in the Bang Phlat district, Bangkok.
Sample preparation and determination: Each tablets of polypharmacy were gridded and
filled until met the blue line of the test tube. Reagent was dropped into tube with sample contained
until met the red line of the test tube. The suspending were mixed at list 3 minutes by vortex mixer
homogeneously and standing for precipitated. The supernatant was dropped (4 drops) into the test
well of Immunochrographic test kit (DMSc Steroid Test Kit, Thailand) and read the result rapidly
and not longer than 10 minutes. The positive result was presented as one band at C region and
negative result was presented as two bands at T and C region. Dexamethasone and
prednisolone were used as positive control (Fig.2).
Figure 2A. Positive result
Figure 2B. Negative result
RESULTS AND DISCUSSION

The sampling was conducted between February and March 2012 by role played, a research
staff member acted as a customer who wanted to buy five asthma polypharmacies, without
prescription, for a friend who had asthma symptoms; chest pressure, coughing up sputum, and
wheezing waiting for her at the dormitory. Their friends reported that they previously experienced
asthma polypharmacy, from nearby drugstore, and it was fast and effective.
The findings were presented 30 drugstores (43.48%) denied to dispended polypharmacies.
Therefore, 18 drug stores (26.08%) were dispended polypharmacies to our volunteers (Table 1) and
5 samples (27.78%), were contained with steroids. And the positive results were present as only
one band (Fig.3).This results were corresponded with previous study (Thongmuang and Sudjaroen,
2012), which showed steroid contained in polypharmacy and dispended for relief asthma. It may
implied that steroids were still used for other symptom, i.e. asthma rather than pain relief.
Table 1. Situation of polypharmacy dispended from drugstores
Dispending of polypharmacy
Denied to dispended polypharmacy
Dispended drug sets
Not reject to dispended drug sets but dispended 1 tablet
Out of Service
Drug company
69
Total
Number of drugstores
30
18
4
3
14
Page 98

July 9-11, 2012.
Figure 3. Positive results
The number of tablets for each dispended from drugstores in Bang Phlat distric were
various number (Table 2). Two and Three tablets were most dispended from 7 drugstores and only
one was dispended 5 tablets as maximum number.
Table 2. Number of tablets dispended from drugstores

Number of tablets
2
3
4
5
Total
Number of drugstores
7
7
3
1
18
CONCLUSION
The study found 18 drugstores in Bang Phlat district dispended polypharmacy to customer
on demand without asking for a prescription. However, 30 drugstores denied selling polypharmacy.
Some pharmacists informed the staff about the danger of polypharmacy which should not be used
to relief asthma. They recommended using over the counter tablet or nasal spray instead. Some
pharmacists even further informed the staff about steroid content and its side effect in
polypharmacy.This indicated that most of drugstores awared of an inappropriateness of
polypharmacy dispensing and concerned about the safety of public in drug consumption.
This study showed that even though the drugstores were located in Bangkok which is the
capital and the most civilized city of the country, there still exist a number of cases of asthma
polypharmacy dispensing as evidenced by drugstores in Bang Phlat. The focal point is the finding
of the distribution of polypharmacy containing steroid, a controlled substance, without prescription.
It is an inappropriate usage of steroid drug; unnecessary use and for wrong purpose of treatment.
For this reason, the Department of Public Health should be more tightly enforcing the steroid
regulation, especially, to prevent a case of polypharmacy dispending from a drugstore operating
without a pharmacist on duty and a case of steroid dispensing without prescription. To improve the
safety of drug usage among public and also to increase the public awareness of risk and harm form
steroid in polypharmacy, the Department of Public Health should publish and advertise to educate
public about the side effects of steroids. And also at university undergraduate level, a health related
class should be required for graduation in order to strengthen the knowledge in this field for young
people who are the future of our country.
ACKNOWLEDGEMENTS
The author sincerely thanks Research and Development Institute, Suan Sunandha Rajabhat
University, Bangkok, Thailand for partially financial support. We thanks to students whom study in
Department of Aesthetic Health Science and Department of Applied Thai Traditional Medicine,
Faculty of Science and Technology, Suan Sunandha Rajabhat University for help us as good
volunteers to collecting samples and useful data.
Page 99

July 9-11, 2012.
REFFERENCES
Charoenphol, V. 1996. Factor affecting the decision-making on the selling of Yachud at grocery
stores in rural area Muang distric Loei province. Master of Public Health thesis. Chiang
Mai University, Chiang Mai, Thailand (in Thai).
Clayton, B.D., Stock, Y.N. and Harroum, R.D. 2007. Basic Pharmacology for Nurses. 14th ed. pp.
662. Mosby Elsevier, St. Louis.
Drug Act. B.E. 2510. Available at URL: http://www.moph.go.th/osp/minister_06/drug1.pdf on
November 2010.
Greenstein, B. 2004. Trounce s Clinical Pharmacology for Nurses. 7th ed. pp. 205. Churchill
Livingstone, Edinburgh.
Karch, A.M. 2008. Focus on Nursing Pharmacology. 4th ed. pp. 567. Walter Kluwer/ Lippincott
William & Wilkins, Philadelphia.
Matapatara, W. and Likitthanaset, M. 2010. Immunochromatography test kit for detection of
dexamethazone and prednisolone Journal of Health Science 19:59-70 (in Thai).
Ruaysup, M. 2004. Determination of dexamethasone and prednisolone in pills by using FT-IR and
UV-visible spectrophotometer. Research report. Suan Sunandha Rajabhat University,
Bangkok, Thailand (in Thai).
The United States Pharmacopeial Convention. The United States Pharmacopoeia. 2009. Volume 3.
27th ed. pp. 2087, 3370. United Book Press, Maryland, USA.
Thongmuang P. and Sudjaroen Y. 2011. Drugstores and dispending of analgesic drugsets
contained with steroids: Study in the Ratchathewi district, Bangkok. In: poster
presentation. Thailand Research Expo 2011; Bangkok, Thailand, 2011 August 26-30.
Thongmuang, P. and Sudjaroen, Y. 2012. The dispended drugsets with steroids for relief
asthma symptom: Study in the Dusit district, Bangkok. In: Abstract of the 7th
Indochina Conference on Pharmaceutical Sciences; Bangkok, Thailand; 2011 December
14-16.
Thongyindee, A. 2004. Quantitative analysis of steroid in Yachud in Amphor Muang Nakhon
Pathom by TLC and HPLC. Bachelors Degree thesis. Nakhon Pathom Rajabhat
University, Nakhon Pathom, Thailand (in Thai).
Page 100

July 9-11, 2012.
HSP30-3
Physical Performance and Quality of Life among Over Body

Mass Index Elderly in Lablae District,
Uttaradit Province, Thailand
Thanakorn Thanawat, Jongruk Duangthong, Sasithon Sukjit, Kittiwan Junrith
Department of Health Sciences, Faculty of Science and Technology,
Uttaradit Rajabhat University, 53000, Thailand
Email: thanawat_uru@hotmail.com (corresponding e-mail address)
Abstract
Over body mass index (BMI) in older adults has both short term and long term effects on
their health status. The physical performance is one of the essential factors for life style. Especially,
it could indicate the ability to perform optimal of activities daily living in the elderly people. The
purpose of this descriptive study was to describe the physical performance and quality of life
among over body mass index (BMI) older adults in Lublae District, Uttaradit Province,
Thailand. Data were selected through 82 over BMI elderly (52 female and 30 male), aged between
60-74 years (Mean=65.5, SD=7.2). This study based on purposive sampling and selected subjects
following inclusion and exclusion criterions. For physical performance assessment, six aspects
(strength of upper and lower extremities, maximal oxygen consumption related physical activity,
agility and body balance, and flexibility of upper and lower extremities) were designed to measure
the physical performance assessment. For quality of life evaluation, the collected data assessed by
World Health Organization Quality of Life Thai version (WHOQOL-BREF-THAI). This
questionnaire consisted of 4 aspects (26 items) including; physical, psychological, social
relationships and environmental perspectives. Data were analyzed by using descriptive statistics
and interpretation following standard value.
The results indicated that overall, female elderly reported their physical performance as
low, while men elderly aged 65 to 69 reported their physical performance as moderate.
Overall, about 50% of the elderly reported their quality of life as moderate. When considered in
each aspect of quality of life, about 68.3% of participants reported their psychological aspect level
as good. In addition, the elderly reported their quality of life in terms of physical, social
relationships and environmental aspects level as moderate (68.3%, 61.0%. and 51.2%,
respectively).
Key words: physical performance, quality of life, over body mass index
Page 101

July 9-11, 2012.
HSP45-4
Thermal alteration of the hand in healthy and

scleroderma patients
Kunavut Vannajak1*, Yodchai Boonprakob2, Wichai Eungpinichpong2, Ratanavadee
Nanagara3
1 Department of exercise and sport sciences, Graduate school,
Khon Kean University, Khon Kean, 40002, Thailand
2 Department of Physical Therapy, Faculty of Associated Medical Sciences,
Khon Kean University
3 Department of Medicine, Faculty of Medicine, Khon Kean University
*Corresponding author (e-mail: kvs_28@hotmail.com)
Abstract
Heat modality is very important for patients with scleroderma because it can prevent hand
disability. Can heat applied to one hand affect the temperature of the other hand? Purpose: to
determine if there is an immediate cross side effect of hand temperature when heat is applied to
only one side. Also to determine if there is a statistically measurable difference between healthy
skin and scleroderma. Method: Ten participants were divided into 2 groups: healthy group (n=5)
and scleroderma group (n=5). Both groups received the same treatment. First, temperatures of both
right and left hands were measured by thermography (FLK-TIR1). Next, the left hand was
immersed in a paraffin bath at 40 degrees Celsius and rested for 20 minutes. Then the post
treatment temperatures of both right and left hands were measured immediately. Result: Left hand
skin temperature of both groups showed a significant difference between pre and post heating
(p<0.05) while the right hand did not show any measurable difference. Conclusion: heat applied to
one side of the upper extremity does not affect the hand temperature of the other side.
Key words: Thermoregulatory system, Thermography, and Scleroderma
Page 102

July 9-11, 2012.
HSP46-5
Clinical assessment of the craniovertebral angle and the

forward shoulder posture in the dental students with and
without neck pain : A preliminary study
Pimonpan Taweekarnab*, Yodchai Boonprakobb,c, Daraporn Sae-lee b,d,
Teekayu P. Jornsb,d, Supunnee Ungpansattawonge, Somsak Ruammahasabf
a Sport and Exercise Science Program, Graduate School, Khon Kean University
b Neuroscience Research and Development Group, Khon Kaen University
c Faculty of Associated Medical Sciences, Khon Kean University
d Faculty of Dentistry, Khon Kean University
e Faculty of Science, Khon Kean University
f Engineer
*Corresponding author: E-mail: vina_pin@hotmail.com
Abstract
Neck pain is one of the most common musculoskeletal problems among dentists and this
condition can occur as early as undergraduate practice years among dental students. Neck pain can
be a consequence of poor posture especially forward head posture during clinical practice such as a
slump sitting and awkward head position. The objective of this study was to compare the
craniovertebral angle (CV angle) and the forward shoulder posture angle (FSP angle) between
dental students with neck pain and pain-free controls. Ten participants in each group were
recruited in this study (mean age 22.90.74, 22.4 0.52, respectively). The assessment of the
degree of CV and FSP angles were measured by three-point marker detection software (ICC>0.99).
Data were analyzed by an independent sample t-test. For the neck pain group, the average CV
angle were 42.992.48 (95% CI: 41.46-44.52) and the average FSP angle were 58.895.36 (95%
CI: 55.56-62.22). For the non-neck pain group, the average CV angle were 51.38 2.21 (95% CI:
50.01-52.75) and the average FSP angle were 65.207.74 (95% CI: 60.40-70.00). The results show
CV and FSP angles in participants with neck pain were significantly smaller than the control group
(p< 0.05). A small CV angle indicated the forward head posture and a narrow FSP angle indicated
the round shoulder posture which represented a poor posture and can finally cause neck pain. These
preliminary results indicate that dental students with neck pain have poor posture and therefore, it
is crucial to implement specific interventions that can improve or correct poor postures in order to
prevent future neck pain problem.
Key words: craniovertebral angle (CV angle), forward shoulder posture angle (FSP angle), neck
pain
Page 103

July 9-11, 2012.
HSP57-6
Use of Fast Music during Speed Acceleration Training: Effects

on 100-metre sprint
Prachaya Chomsahai
Institute of Physical Education-Chiangmai Campus, 50200, Thailand
Email: assassin_pong@hotmail.com
Abstract
The aim of this quasi-experiment is to study the effects of fast-rhythm music when used
during train accelerated speed running for 4 weeks. One group of 9 young male athletics (age range
from 9 12 years) perform 100 metres in the pre and post test condition. Two fast music are used
as the tool, one is selected by researcher and the participants select the other. Fusion (Smart speed
version) is used as an speed test instrument. Analyses of t-tests on time records, for each distance of
40m., 50m., 60m., 70m., and 100m., reveal not significant improvement for all, including speed
time, speed acceleration and the average of speed acceleration through 100 metres sprint. This note
that the fast-rhythm music alone may cannot improve athletic sprint record. However, followings
the interviewed after speed test (2 days) results that most of participants feel that they heard the
music while performing speed during the post-test. This results suggest that audio can be images
during performing run as previous findings (Ladda, Nilobon, & Somchai, 2010).
Keywords: fast music, speed training, speed acceleration, 100 sprint, audio imagery
Page 104

July 9-11, 2012.
HSP62-7
Association of Musculoskeletal Injuries between Prior and During

the Training Camp of Thai Rowing Athletes
Seekaow Churproong1, Buratin Khampirat2, Likit Matrakool3, Preecha Phuangphairote4 ,
Suriya Intra5
Suranaree University of Technology, Nakhonratchasima, 30000, Thailand
Email: seekaow@sut.ac.th
Abstract
This survey research studied the areas of musculoskeletal injuries prior and during the training
camp of Thai Rowing Athletes of 109, during April-October 2011 at Suranaree University of
Technology, in order to prepare for the 26th SEA Games, Indonesia. The ratio of the samples in this
study were 60.55% males, 39.45% females, with the age ranges of 19-23 (21.425.54). And the
period of practice prior camping was within 4 months. The questionnaires were used to screen
musculoskeletal injuries. Chi-square and Odds ratio were used to analyze the data.
The results revealed that prevalence of musculoskeletal injuries were 40.36% prior to
camping, 54.12% during camping and 62.38% prior and during camping, respectively. 33.03% of
these injuries disturbed practice and area of injuries 27.16% at shoulder 19.75% at back. 29.03% of
these athletes were rehabilitated by stretching average 15-18 minutes. Correlation of injuries
between prior and during camping was found significant (p <0.01) i.e. overall chance of injuries
increased 6.64 times (OR = 6.64, 95% CI = 2.73 16.16). When focusing on specific anatomical
sites of injuries, chance for repeating back injuries increased by 63 times (OR = .63, 95% CI = 5.75
690.37) and repeating shoulder injuries increased by 34 times (OR = .34, 95% CI = 4.91
235.61)
This study benefits the Rowing-Canoeing Association of Thailand (RCAT) for planning
and applying several strengthening and stretching programs to treat and rehabilitate injured
athletes, and to promote general athletes performance and injury prevention.
Keyword: Musculoskeletal injuries, Suranaree University of Technology, Thailand Rowing
Athletes , Rowing-Canoeing Association of Thailand(RCAT), Integrated care
Page 105

July 9-11, 2012.
HSP67-8
Effects Of Germinated Soybean On Serum Lipids In Rats

Wanpen Mesomya1* ,Yaovadee Cuptapun1,Duangchan Hengsawadi1,
Saruda Lohana2 And Sompoch Yaieiam2
1Department of nutrition and Health, Institute of Food Research and Product Development ,
Kasetsart University. 50 Pahonyothin Road, IFRPD, Kasetsart University, Chatuchak ,Bangkok
10900.
2Department of Food Processing and Preservation , Institute of Food Research and Product
Development, Kasetsart University. 50 Pahonyothin Road ,IFRPD ,Kasetsart University
,Chatuchak ,Bangkok 10900.
*Corresponding e-mail address : ifrwpm@ku.ac.th
Abstract
The purpose of this research is to evaluate the effects of germinated soybean on serum
lipids by feeding male Sprague-Dawley rats with 6 diets containing casein , soy protein isolate
(SPI), non germinated soybean (NGS), 10% protein germinated soybean (10% GS), 20% protein
germinated soybean (20% GS) and 28% protein germinated soybean (28% GS). Five experimental
diets and control diet (casein) were prepared from 5 formulas by AOAC, contained 10 0.30%,
20%, 28% test protein, 8% oil, 5% water, 5% AIN mineral , 1% AIN vitamin, 1% cellulose,
35% sucrose and 35% corn starch. The results of this study showed that serum cholesterol,
triglyceride, HDL c , LDL c levels were not significantly different among the rats fed with NGS
diet and 10% GS diet. But serum cholesterol, triglyceride and LDL c level in rats fed with 20%
GS diet and 28% GS diet were significantly lower than rats fed with NGS diet and 10% GS diet.
And serum cholesterol, triglyceride and LDL c levels in rats fed with 28% GS diet (57.40 6.25
, 30.30 5.25 , 11.80 2.69 mg/dl) were significantly lower than rats fed with SPI diet (73.10
13.32 , 58.20 13.13 , 23.40 5.01 mg/dl). The data indicates that experimental diet from 28%
protein germinated soybean reduced serum cholesterol , triglyceride and LDL c in the
experimental rats.
Keywords : germinated soybean , lipid, serum, experimental rat
Page 106

July 9-11, 2012.
HSP83-9
The Immediate effects of manual therapy on pain perception,

pressure pain threshold, and maximum mouth opening in
patients with temporomandibular disorders:
a pilot randomized controlled study
Thanchanok Niyomsirisapab*, Yodchai Boonprakobb,c,d, Daraporn Sae-leec,e,
Teekayu P. Jornsc,e
a Physical Therapy Program, Graduate School, Khon Kaen University
b Back, Neck and other Joint Pain Research Group, Faculty of Associated Medical Sciences,
KhonKaen University
c Neuroscience Research and Development Group, Khon Kaen University
d Faculty of Associated Medical Sciences, Khon Kean University
e Orofacial Pain Clinic, Faculty of Dentistry, Khon Kean University
*Corresponding author: E-mail: Shaylin_zhe@hotmail.com
Abstract
Temporomandibular Disorders (TMD) are a group of disorder associated with the
masticatory muscles, temporomandibular joint (TMJ) and associated structure, or both. The signs
associated TMD are pain in masticatory muscles or TMJ and limitation in mandibular range of
motion. Physical therapy is one of the suggested managements for TMD patients. The purpose of
this randomized controlled study was to determine the immediate effects of manual therapy on pain
intensity, pressure pain threshold (PPT), and maximum mouth opening. Ten participants (2 males
and 8 females with a mean age of 29.3 10.11 years) were randomly assigned into manual therapy
group or sham manual therapy group (control). Participants received manual therapy which consist
of the myofascial release technique on masticatory muscles for either 10 minutes and mobilization
on TMJ three times (5 minutes each) or sham manual therapy. Data were analyzed by paired t-test.
The results showed the significant decrease of visual analog scale (VAS) (p=.001) and maximum
mouth opening showed significant increase (p=.003) in manual therapy group. However, PPT in
massester muscle had a not significantly difference after the treatment, whereas the result of control
group showed not significant different in VAS, PPT and maximum mouth opening. These results
indicate that manual therapy in patients with temporomandibular disorders may be used as the
alternative therapy for TMD patients.
Keywords: Temporomandibular Disorders (TMD), manual therapy, mobilization, myofascial
release, maximum mouth opening
Page 107

July 9-11, 2012.
HSP101-10
New record of Rickenella cf. fibula, mycenoid fungi from

Thailand (Hymenochaetales, Basidiomycota)
Thitiya Boonpratuang1* and Rattaket Choeyklin2
1Mycology Laboratory, Bioresources Technology Unit, National Center for Genetic Engineering
and Biotechnology, Thailand Science Park, Pathumthani, 10210 Thailand
2Nanotechnology and Biotechnology Division, Kasetsart Agricultural and Agro-Industrial Product
Improvement Institute (KAPI), Kasetsart University, Bangkok, 10900 Thailand
E-mail: thitiya.boon@biotec.or.th
Abstract
Mycenoid is a group of fungi that share a few morphological characters such as type of
basidiome, colour or even some microscopic characters such as hymenium system and
dermatocystidia. Mycenoid fungi are including the genus Mycena, Poromycena and Filoboletus
which are accepted in the Mycenaceae but Rickenella are accepted in its own family,
Rickenellaceae. Many of them are saprobic but a few species are mutualism with moss such as
Mycena erubescens and Rickenella fibula. The genus Rickenella has never been recovered and
reported from Thailand. This study was proposed a new record of Rickenella cf. fibula from
Thailand. The specimen was found on moss in evergreen mountain of Khao Kaew at Khao Yai
National Park in 2010.
Keywords: Taxonomy, Rickenella, Khao Yai National Park, Mycenoid fungi, Basidiomycota,
Mushroom
INTRODUCTION
Rickenella and Mycena are very similar genera by sharing the same macroscopic
characters, only microscopic characteristics are able to separate these two genera. Pileus trama of
Rickenella is not reaction with Melzers reagent (giving an inamyloid reaction) while Mycena is
reaction with Melzers reagent (giving a dextrinoid reaction) by turning from yellowish to reddish
brown color at pileus trama or lamellae trama. Basidiospore of Rickenella is inamyloid while
dextrinoid in Mycena. Rickenella fibula is well-known from Europe, Canada, USA and Japan
(Antonin and Noordeloos, 2004: Bougher and Syme, 1998: Smith, 1947) but it has never been
reported from tropical or Southeast Asia. This study was proposed a new record of Rickenella cf.
fibula from Thailand and Southeast Asia. The specimen was found on moss in evergreen mountain
of Khao Kaew at Khao Yai National Park in 2010.
Raw Material
Mushroom was collected on leaves litter from dicotyledonous tree in evergreen mountain
of Khao Kaew at Khao Yai National Park in 2010 by T. Boonpratuang, T.W. Flegel, A.
Wiriyageerapipat and P. Promkiam-on. Mushroom and it substrate was slowly dried at 40-50C by
food dehydrator for 8 hours then was stored in plastic box with label, and was sealed by plastic bag.
The specimen was protected them from pest damaged by frozen specimen in box into freezer -20C
Page 108

July 9-11, 2012.
for 24 hours, then was took it out from freezer to store in room temperature for 24 hours. Fungal
herbarium was documented and cataloged by MIMSmy program, then it was deposited into
BIOTEC Bangkok Herbarium (BBH) followed the standardized of ISO9001:2000 system. This
herbarium borrowed for identification by the author under the authorization of curator of BBH with
the accession code of 1684. (Bridson & Forman, 1998)
Sample Preparation
Macromorphological features were recorded from fresh material, documenting all aspects
of basidiome (mushroom) size, shape, colour, surface, texture and odor (Hemmes and Desjardin,
2002). Colour of basidiomes were described in daylight by using the colour guide by Kornerup &
Wanscher (Kornerup and Wanscher, 1963). Basidiomes was illustrated with pencil, and digital
photographs when possible. Dried specimen was used for analyses of micromorphological features,
wherein all cell types and tissue types were described in detail. Head, stipe and base were dissected
by using a razor blade. The dissecting portion was rehydrated in 95% ethanol followed by distilled
water, 3% KOH or Melzers reagent (Largent and Watling, 1977). Microscopic structures were
measured with ocular micrometer and illustrated with aid of a drawing tube attached to an Olympus
BX51 compound microscope. The size, shape, location, organization, and chemical reaction of
each cell type and tissue were documented (Desjardin et al., 2000).
RESULTS
The identification of this species was indicated into a new record of Rickenella cf. fibula of
Thailand and Southeast Asia.
Macroscopic morphology
Pileus: 5-7 mm diam., convex to campanulate, mostly umbonate but rarely umbilicate disc,
pulvinate, dry, sulcate, pileus beyond lamellae, orange disc and creamish orange over all, paler
color when age. Pileus-context: 0.5 mm, orange color. Lamellae: deeply decurrent, 14-16
lamellulae, series, cream color both edge and face, thick, distant. Stipe: 0.5 0.7 mm. wide 10
25 mm. central, cylindrical, fistulose, cream to pale yellow, translucent, smooth, dry, enlarge base.
Substrate: soil. Habitat: living among living moss. Habit: Scattered to caespitose.
Microscopic morphology
Basidiospores: 6 7 (9) 3 4 m, subglobose to ellipsoid, hyaline, smooth, thin-walled,
inamyloid. Basidia: 15 28 5 7 m, 24spores, clavate, hyaline, smooth, thin-walled,
inamyloid. Basidioles: 10 18 4 5 m, clavate, hyaline, smooth, thin-walled, inamyloid.
Pileipellis consisting with cutis of repent hyphae, monometic hyphal system, hyaline, smooth thinwalled, inamyloid, clamp connection presented. Pleurocystidium: 8 32 m, clavate to ventricoserosetate, hyaline, smooth, thin-walled, inamyloid. Cheilocystidia: absent. Lamellulae trama:
divergent, consisting with generative slim hyphae and inflated hyphae, hyaline, smooth thin-walled,
inamyloid, clamp connection presented.
Stipitipellis: consisting with parallel layer of repent hyphae 4 5 m, hyaline, smooth,
thin-walled, inamyloid and giving arise numerous of Caulocystidia. Caulocystidia: 35 55 7 12
m, clavate, Stipe trama consisting with inflated hyphae 8 15 m, clavate to cylindrical, hyaline,
smooth, thin-walled, inamyloid.
DISCUSSION
This species was described close to Rikenella cf. fibula because most of macromorphology
and micromorphology were similar but only one microscopic feature was different (Antonin and
Noordeloos, 2004: Bougher and Syme, 1998: Smith, 1947). Type species consisted of scattered
pileocystidia while absented in Thai species. This species might be described a new species of
Rikenella because the point of pileocystidia is an important taxonomic character. This study need to
confirm with loaning type specimen from oversea and molecular information will be included for
future analysis.
Page 109

July 9-11, 2012.
Photo and illustration of Rikenella cf. fibula 1) Basidiomes with moss, 2) Basidiospores,
3) Basidia and basidium with basidioles, 4) Basidioles with clamp connection, 5) Pleurocystidium,
6) Stipe trama and Caulocystidia, stipe hyphae with clamp connection. Bar 1 = 10 mm, 2 6 = 10
m. Original code: TBP1252 = BBH1684. Photoed and illustrated by Thitiya Boonpratuang.
ACKNOWLEDGEMENTS
Dr. Scott Readhead was acknowledged for his value suggestions on the concept of genus
Rikenella. The Center for Genetic Engineering and Biotechnology (BIOTEC) were thanked for
financial support under BRN program and RI program (P-11-00490). BIOTEC Bangkok
Herbarium (BBH) was thanked for herbarium examination. Khao Yai National Park and
Department of National Parks, Wildlife and Plant Conservation were thanked for permission of
surveying and collecting fungi in Khao Yai National Park.
Page 110

July 9-11, 2012.
REFERENCES
Antonin, V. and Noordeloos, M. E. 2004. A monograph of the genera Hemimycena, Delicatula,
Fayodia, Gamundia, Myxomphalia, Resinomycena, Rickenella, and Xeromphalina in
Europe. IHW Verlag, Eching, Germany.
BougherN. L. and Syme, K. 1998. Fungi of southern Australia. University of Western Australia
Press, Nedlands, Australia. Bridson, D. and Forman, L. 1998. The herbarium handbook
(third edition). The Board of Trustees of The Royal Botanic Gardens, Kew, UK.
Desjardin, D. E., Boonpratuang, T., Ruksawong, P. and Hywel-Jones, N. L. 2000. A new species of
Incrustocalyptella from Thailand. Fungal Diversity 4: 75-79.
Hemmes, D. E. and Desjardin, D. E. 2002. Mushroom of Hawai'i (an identification guide). Ten
Speed Press, Toronto, Canada.
Kornerup, A. and Wanscher, J. H. 1963. Methuen handbook of colour, Methuen and Co. Ltd., Germany.
Largent, D. J. and Watling, R. 1977. How to identify mushrooms to genus III: microscopic
features. Mad River Press, Inc., London, UK.
Smith, A. H. 1947. North American species of Mycena. University of Michigan Press, Ann Arbor,
Michigan, USA.
Page 111

July 9-11, 2012.
HSP103-11
Simple Isolation of Human CD4+ Lymphocytes Using

Monoclonal Antibody-based Magnetic Particle
Surachai Suttawat, Panatda Sanrit, Sanita Singsanan,
Niramon Thamwiriyasati, Suticha Chunta
Department of Medical Technology, Faculty of Allied Health Sciences,
Burapha University, Chonburi, Thailand
Email: suticha_c@hotmail.com
Abstract
Human CD4+ lymphocytes are largely used in immunological research especially for the
study of HIV infection. CD4+ lymphocyte isolation method based on monoclonal antibody-based
magnetic particle is attractive alternative because it is convenient, simple and cheap. In this study,
the optimal concentration of purified anti-human CD4+ lymphocyte antibodies (0.05 mg/mL) were
immobilized on the magnetic particle surface via protein A. All particles showed positive reactivity
with DyLight 550-conjugated anti-mouse immunoglobulin antibody, indicating that all particles
were coated with antibody. The binding ability between antibody and CD4+ lymphocyte could be
observed under microscopy. Immunomagnetic particles were applied to separate the CD4+
lymphocyte in the peripheral blood mononuclear cells (PBMC) which were prepared by a FicollHypaque gradient solution (density = 1.070 g/mL). The surface markers of CD4+ lymphocytes
were determined by CD3/CD4/CD45 staining and analysis using flow cytometry. CD4+
lymphocytes (3.48 104 cells/L) were isolated from the PBMC suspension (containing 6 104
cells/L).
Keywords: Human CD4+ lymphocyte, magnetic particle, monoclonal antibody, peripheral blood
mononuclear cell
Page 112

July 9-11, 2012.
HSP186-12
Pain Relief of Chili Roll-on in Chronic Musculoskeletal Pain

Sunantha Osiri a, Supaporn Pitiporn b, Somboon Vanichayobol b, Pagakrong Kwankhao
b
,Natdanai Musigavong b , Pinit Chinsoi c, Lakkana Somprasong d
a
Faculty of Abhaibhubejhr Thai Traditional Medicine, Burapha University, Thailand.
b
Chao Phya Abhaibhubejhr Hospital, Prachinburi Province, Thailand.
c
Wangnamyen Hospital, Sakeao Province, Thailand.
d
Kutchum Hospital, Yasothon Province, Thailand.
a
Email : sosiri@buu.ac.th
ABSTRACT
The efficacy and safety of capsaicin roll-on were evaluated when it was used as
symptomatic therapy in the patients with chronic musculoskeletal pain. In this single-blind
randomized vehicle-controlled trial, 132 patients received capsaicin or placebo for four weeks. The
69 patients were instructed to apply 0.025% capsaicin roll-on and 63 patients were instructed to
apply vehicle to painful area four times daily. At baseline, no significant difference between two
groups exists for sex ratio, mean age, BMI, diagnosis, frequency of pain, and pain disruption. Pain
relief was assessed using visual analog scales (VAS), patient global assessments (PGA), and patient
satisfaction. Capsaicin was superior to vehicle in providing pain relief. Capsaicin-treated patients
reported greater reduction on the VAS pain scores at week 3 (p=0.019) and week 4 (p=0.024). The
overall improvement on PGA scores were higher at week 1 (p=0.008), week 2 (p<0.001) and week
3 (p=0.031). The mean patient satisfaction scores in the capsaicin-treated patients was significantly
more than in the vehicle-treated patients (p=0.039). Transient burning was felt at the sites of drug
application by 15 capsaicin-treated patients (27.1%). These results support the beneficial effects of
0.025% capsaicin roll-on for chronic musculoskeletal pain after two weeks of treatment. However,
the formula might be improved to reduce side effects.
Keywords: capsaicin, chili roll-on, chronic musculoskeletal pain

INTRODUCTION
Chronic musculoskeletal pain is the
long-lasting pain that affects the muscles,

ligaments and tendons, along with the
bones. Musculoskeletal pain is the
complaint most frequently reported in
health interview surveys (Woolf, 2008). It
is most often caused by an injury or
overuse, such as associated with sports or
occupation. Pain from overuse affects 33%
of adults and accounts for 29% of lost
workdays due to illness (IASP, 2009). The
suffering and discomfort associated with
musculoskeletal pain diminished quality
and productivity in patients work and
personal lives. Capsaicin, the active
compound present in chili peppers

(Capsicum frutescens L.), binds to
nociceptors in the skin, reduces pain by
depleting substance P in local sensory
nerve endings and type C fibers (Brandt,
2001). The efficacy of capsaicin was
shown in the systematic review, the topical
capsaicin (0.025% cream or plaster) was
significantly better than placebo for the
treatment of chronic musculoskeletal pain
(Mason et al., 2004). The mean treatment
response at four weeks was 38%, while the
response to placebo was 25%. In general
therefore topical capsaicin is best
employed as an adjunct to other modes of
therapy. It should be used for 3 to 4 weeks
(applied 4 times daily) to achieve maximal
Page 113

July 9-11, 2012.
benefit (Patel and Mackworth-Young,

2012). Adverse events from capsaicin are
mainly at the application site (burning,
stinging, erythema), and systemic events
are rare (Derry, 2009).
Results from the clinical trials,
capsaicin 0.025% was approved for
musculoskeletal pain relief in the List of
Herbal Medicinal Products of the National
List of Essential Drugs A.D.2011.
Capsaicin most commonly found in painrelieving creams and gels, but also can be
applied with roll-ons or sprays. Topical
capsaicin should not be applied to broken
skin or allowed to come in contact with the
eyes or mucous membranes. To avoid
burning sensation when applied by hand,
the capsaicin roll-on formula of Chao Phya
Abhaibhubejhr
Hospital
has
been
developed. The objectives of this study
were to evaluate the efficacy of 0.025%
capsaicin roll-on (Chili roll-on) for relief
of chronic musculoskeletal pain and side
effect.
The randomized single blind controlled
trial was carried out at Chao Phya

Abhaibhubejhr Hospital, Wangnamyen
Hospital, and Kutchum Hospital, in
Thailand from April 2008 to September
2011. The outpatients with chronic pain
lasting more than 6 months under the
diagnosis of musculoskeletal pain by the
physicians were randomized into two
groups. All patients received usual
medical care from their physicians and
received either 0.025% capsaicin roll-on or
placebo (the vehicle roll-on) for four
weeks. The roll-ons were identical in
appearance, packaging, and labeling. The
patients did not know whether they
received capsaicin or placebo. They were
instructed to apply roll-on to painful area
four times daily after they enrolled in the

study and were followed up in the period
of four weeks. Patient's status and history
of musculoskeletal pain were taken. The
pain severity visual analog scale score
(VAS) from 0 to 10 were used for
comparing the pain relief between the two
groups. The Patient Global Assessment
(PGA) were completed by the patient to
rate on a scale how they feel overall. The
patients perception of treatment outcome
were obtained by the five point satisfaction
scale. Side effect were reported. This study
was approved by the Ministry of Public
Health Ethic Committee. Informed
consents were obtained from all of the
participating patients. All data were
analyzed for frequencies, means and SD.,
Chi-Square and t-test were used and
p<0.05 was maintained as significant.
Baseline characteristics
The 132 patients with chronic
musculoskeletal pain were randomized
into two groups to receive capsaicin or
placebo for four weeks. The 69 patients
were instructed to apply 0.025% capsaicin
roll-on and 63 patients were instructed to
apply placebo to painful area four times
daily. Both groups were similar at the
beginning of the study. No significant
difference between two groups exists for
sex ratio, mean age, body mass index, and
diagnosis (p=0.227, 0.523, 0.739, and
0.095 respectively). The symptoms of
chronic musculoskeletal pain of both
groups were compared. The frequency of
pain, the pain disrupt sleep, of both groups
were not different. (p=0.08, 0.113
respectively). Exercise and analgesic
taking for pain relief were not different
(p=0.679, 0.611 respectively). [Table 1]
Page 114

July 9-11, 2012.
respectively). So, the results of pain relief
had not been interfered from exercise and
analgesic taking in both groups.
RESULTS
Table 1 Baseline characteristics
Characteristics
Patients Receiving
Treatment (N=132)
p-value
Capsaicin
(n=69)
Placebo
(n=63)
Sex (male/female)
23/46
15/48
0.227
Age (Mean) year
49.5
47.9
0.523
BMI (Mean) kg/m2
24.6
24.3
0.739
Comparison of pain relief

Pain relief was assessed using VAS,
PGA, and patient satisfaction. The baseline
VAS score of both groups were not different
(p=0.630).
Capsaicin-treated
patients
reported significantly greater reduction on the
VAS pain score at week 3 (p=0.019) and
week 4 (p=0.024). [Table 2] [Figure 1]
Table 2 Comparison of VAS pain score
Diagnosis
VAS score (0-10)
- joint pain (%)
11(20.4)
4(8.0)
- muscle pain (%)
37(68.5)
43(86.0)
Capsaicin
- others (%)
6(11.1)
3(6.0)
(n=69)
Placebo
(n=63)
Before
5.54 + 2.19
5.67 + 2.01
0.630
week 1
4.32 + 2.11
4.72 + 1.53
0.261
week 2
4.08 + 1.95
4.14 + 1.53
0.878
Frequency of pain
- sometime (%)
0.095
0.080
19(27.9)
26(41.9)
-pain while having

35(51.5)
20(32.3)
week 3
3.36 + 1.74
4.25 + 1.62
0.019*
14(20.6)
16(25.8)
week 4
2.94 + 1.66
3.83 + 1.74
0.024*
Pain while sleep(%) 41(59.4)
45(72.6)
0.113
Exercise for pain

relief (%)
32(46.4)
31(49.2)
0.679
Analgesic taking
(%)
8(13.8)
9(17.3)
0.611
activity (%)
- all the time (%)
After 4 weeks of treatment the pain

symptoms and action for pain relief of
both groups were compared. The
frequency of pain, the pain disrupt sleep,
in both groups were not different
(p=0.293, 0.48 respectively). These might
explain that the chronic symptoms were
persisted after 4 weeks. Exercise and
analgesic taking for pain relief in both
groups were not different (p=0.196, 0.45
p-value
* Sig.(p<.05)
Figure 1 Comparison of VAS score

The baseline PGA score of both
groups were not different (p=0.378). The
PGA score of capsaicin-treated patients
showed significant improvement at week 1
Page 115

July 9-11, 2012.
(p=0.008), week 2 (p<0.001) and week 3
(p=0.031).[Table 3] [Figure 2]
sensation was also found in one of the

vehicle-treated patients.
Table 3 Comparison of PGA score for pain

relief
DISCUSSIONS
Capsaicin was superior to vehicle
only in providing pain relief on the VAS
scores at week 3 and week 4. The PGA
scores showed that they felt better at week 1,
week 2, and week 3. The satisfaction of
treatment outcome in capsaicin-treated
patients was significantly more than the
vehicle-treated patients. These results imply
that there are beneficial effects of 0.025%
capsaicin roll-on for chronic musculoskeletal pain. These findings also pertain to
topical capsaicin cream or plaster, as per a
systematic review by Mason et al. (2004).
Even though the pain symptoms were
relieved, the PGA scores at week 4 were not
different. There may be external conditions
unrelated to the capsaicin therapy which
contribute to PGA scores.
The local adverse events, burning
sensation occurred in the 15 patients (27.1%)
of capsaicin treated patients. Since the
adverse event rated high, about one third of
patients, Bandolier (2005) commented that
topical capsaicin was an unlikely first or even
second
choice
for
treatment.
The
contamination of the patient's environment
(clothing, bedding, contact lenses, etc.) might
be associated with burning sensation. Poor
patient compliance with these products has
also been cited as a likely contributor to
limited efficacy (Altman and Barkin, 2009).
The formula could possibly be improved to
reduce side effects. There are also lowconcentration
capsaicin
formulations
(0.0125% capsaicin) (Kosuwon et al., 2010).
In other dosage form, a high-concentration
single-administration capsaicin 8% patch
which was recently approved in the EU and
USA, was designed to rapidly deliver
capsaicin into the skin while minimizing
unwanted systemic or environmental
exposure of capsaicin to patients (Anand and
Bley, 2011). The modified capsaicin
structures should be developed for improving
the analgesic effectiveness with minimal
unwanted side effects (Rusterholz, 2006).
PGA score (0-5)

Capsaicin
p-value
(n=69)
Placebo
(n=63)
Before
3.18 + 0.73
3.03 + 0.73
0.378
week 1
3.57 + 0.57
3.19 + 0.48
0.008*
week 2
3.83 + 0.53
3.18 + 0.68
<.001*
week 3
3.62 + 0.70
3.21 + 0.59
0.031*
week 4
3.83 + 0.75
4.00 + 0.75
0.690
* Sig.(p <.05)
Figure 2 Comparison of PGA score

The mean patient satisfaction of
capsaicin-treated patients was significantly
higher than that of patients treated with
vehicle only (3.58 0.88 and 3.20 0.86)
(p=0.039).
Side effect
The local adverse event reported
during the 4-week treatment with
capsaicin, 15 patients (21.7%) had
transient burning sensation, one patient
had skin rash, and one patient had itching at
the sites of drug application but none
withdrew for these reasons. Burning
Page 116

July 9-11, 2012.
CONCLUSIONS
The efficacy of 0.025% capsaicin
roll-on for chronic musculoskeletal pain
relief were presented by the changes in VAS
scores, PGA scores, and patient satisfaction
compared to the vehicle. However, the
formula should be improved to reduce side
effect. Further clinical studies of other
capsaicin dosage forms and other innovative
topical capsaicin formulations should be
undertaken.
ACKNOWLEDGEMENT
This study was supported by Faculty
of Abhaibhubejhr Thai Traditional Medicine,
Burapha University, Thailand. Thank you Dr.
Ronald Markwardt for sparing his valuable
time in editing this report.
Page 117

July 9-11, 2012.
REFERENCES
Altman R, Barkin RL, 2009. Topical therapy For osteoarthritis: clinical and
pharmacologicperspectives. Postgraduate Medical Journal 21:13947.doi:10.3810/pgm.2009.03.1986.
Anand P. and Bley K. 2011. Topical capsaicin for pain management: therapeutic potential andmechanisms
of action of the new high-concentration capsaicin 8% patch. British Journal of
Anaesthesia 107(4): 490-502.
Bandolier, 2005. Topical analgesics: A Review of reviews and a bit of perspective. Bandolier extra.
Evidence-based health care. March 2005: 1-22.
Brandt K.D. 2001.Osteoarthritis. In: Braunwald E., Fauci A.S., Kasper D.L., et al, (eds.) Harrisons
Principles of Internal Medicine, 15th ed. New York, NY: McGraw-Hill Inc: 198794.
Derry S., Lloyd R., Moore R.A., McQuayH.J. 2009. Topical capsaicin for chronic neuropathic pain in
adults. Cochrane Database of Systematic Reviews, Issue 4.Art.No.:CD007393.
doi:10.1002/14651858.CD007393.pub2.
IASP. 2009. Musculoskeletal pain. Global YearAgainst Musculoskeletal Pain. October 2009-2010.
Kosuwon W., Sirichatiwapee W, WisanuyotinT.Jeeravipoolvarn P., Laupattarakasem W. 2010.
Efficacy of symptomatic control of knee osteoarthritis with 0.0125% of capsaicin versus
placebo. Journal of The Medical Association of Thailand 93(10): 1188-95.
Mason L., Moore R.A., Derry S., Edwards J.E.,McQuay H.J. 2004. Systematic review of topical
capsaicin for the treatment of chronic pain. British Medical Journal 328:991-994.
National Essential Drug List Committee, National Drug Committee. The National List of Essential
Drugs A.D. 2011 (List of Herbal Medicinal Products), Bangkok: War Veterans
Administration Printing; 2011.
Patel L. and Mackworth-Young C. 2012. Topical and regional treatment for osteoarthritis.
Osteoarthritis-Diagnosis, Treatment and Surgery. In Qian C. (ed): InTech, March; 47-64
Rusterholz, D. 2006. Capsaicin, from Hot to Not; Can new pain-relieving drugs be derived from
this substance known to cause pain? Journal of Chemical Education. 83.12:1809-1811.
Woolf A.D. 2008. Musculoskeletal conditions.Major and chronic diseases Report 2007. European
Commission, 236-266.
Page 118

July 9-11, 2012.
HSP187-13
THE EFFECT OF EYE-HAND COORDINATION

TRAINING IN TABLE TENNIS PLAYERS
Surapon Chamroon, Sukit Pitakcharoen, Monton Thongroj
Sports Science Center, Sports Authority of Thailand
Email:sukit.p@sat.or.th
Abstract
Introduction
Table tennis is a sport that contests in the Olympic Games and World Championship.
One factor that leads athletes to be achieved at a competition is quick eye-hand coordination,
therefore table tennis players need to improve their skills by training eye-hand
coordination.Therefore, the aim of this research was to study the effect of eye-hand coordination
training on response time in table tennis players.
Medthods
The sample of this research were 11 youth table tennis players (6 females and 5 males),
through purposive sampling. The instrument for collecting data was the eye-hand response time
test. After they were pre-test for eye and hand response time, the subjects were trained by eye-hand
coordination program for 6 weeks. Then, they were post-test after week 6. The data were analysed
in terms of Mean, Standard Deviation and Paired Samples T-test (for comparison between pre-test
and post-test). The level of significance was set at .05
Results
The results of means and standard deviation of the eye and hand response time pre-test
were ( x =0.41) and (SD=0.03); post-test were ( x =0.37) and (SD=0.02) for female, while pre-test
were ( x =0.43) and (SD=0.04); post-test were ( x =0.39) and (SD=0.02) for male, respectively.
Discussion
It was found that there were differences of response time means between pre-test and posttest for female table tennis players, significantly at .05 level of confidence. The same results were
also found between pre-test and post-test for male table tennis players, significantly at .05 level of
confidence.
Key Word: Eye-hand coordination training, Table tennis players
Page 119

July 9-11, 2012.
References
Clarke, Harrison H. (1968). Approach to Measurement to Health and Physical Education. 3rd ed.
New Jersey: Englewood Cliffs, Prentice Hall, Inc.
Erickson, G.B. (2007). Sports Vision: Vision Care for the Enhancement of Sports Performance.
UK: Butterworth-Heinemann.
Regan, D. (1992). Visual judgments and misjudgments in cricket, and the art of flight. Perception
21, 91115.
Strzeszewski, K. (2003). Hand Eye Coordination Exercises. Retrieved July, 2011. from
http://www.livestrong.com/article/90555-hand-eye-coordination-exercises.
Scott , M.Glay; & Esthes French. (1960). Purpose of Evaluation and Measurement, Measurement
and Evaluation in Physical Education. Lowa: W.M.C. Brown Company.
Page 120

July 9-11, 2012.
HUO120-1
The effectiveness of the three common types of written

corrective feedback in improving grammatical accuracy
Arlan Parreo
Assumption University
Ramkamheng Road Soi 24, Huamark, Bangkapi
Bangkok 10240, Thailand
E-mail: aparreno@au.edu
ABSTRACT
The study was conducted to determine the effectiveness of written corrective feedback and
the differences between the three common types of written corrective feedback on grammatical
accuracy among learners of English as a second language in a Thai university context. A pre-testimmediate-post-test-delayed-post-test design was used to compare the effects of direct corrective
feedback, indirect corrective feedback, coded corrective feedback, and no correction approach
(control group) on accuracy in subject-verb agreement, verb tense, verb form, and word form in a
paragraph writing task. Sixty-eight Thai students enrolled in an English foundation course
participated in the 15-week experiment. Analyses of data revealed that, in general, grammatical
accuracy was significantly influenced by the type of written corrective feedback. Moreover,
analyses showed that written corrective feedback had positive revision effects on the four grammar
areas. However, only the students who received coded written corrective feedback gained
significantly in the delayed post-test. Furthermore, the coded corrective feedback group
consistently outperformed the other two experimental groups and the control group in both posttests. Results, therefore, support the role of written corrective feedback, specifically coded
corrective feedback, in grammatical accuracy, at least in subject-verb agreement, verb tense, verb
form, and word form.
Keywords: error correction, corrective feedback, grammar, L2 learning
INTRODUCTION
Giving feedback is widely believed
as a major part of the teaching profession.
Nunan (1998) noted that, together with
instructing, giving feedback is considered as
one of the most significant responsibilities of
teachers. Giving corrective feedback is even
considered as a teachers traditional right
(Ellis, 2000). Because of such beliefs,
teachers are expected to give feedback on
whether students answers or productions are
correct or appropriate, or what and how
students should improve. It is therefore not
surprising to see teachers spending
significant amounts of time and effort in
performing the task, particularly writing
teachers. As pointed out by Ferris (2007),

giving written feedback to learners is the
most time consuming and challenging part
(p. 165) of teaching writing.
Leki (1990) observed that one of the
most common written feedback given by
writing instructors was on language use. She
noted that writing instructors were compelled
to focus on how ideas were presented or
structured in sentences instead of on the ideas
because the label writing teacher entailed
the expected responsibility of teaching how
to write in a particular language.
Language experts theorized that
corrective feedback helps in language
learning and acquisition as it assists learners
notice the difference between their own
Page 121

July 9-11, 2012.
production and the target structure, raising
their consciousness about the structures they
are learning (Schmidt & Frota, 1986).
Chaudron (1995) and Shin (2008) believed
that grammatical corrective feedback is
necessary for students to verify the
hypotheses they have made in structuring
their ideas.
Studies have confirmed language
teachers beliefs and practices supporting
corrective feedback in terms of grammar as
well
as
mechanics
(Schulz,
2001;
Montgomery & Baker, 2007; Lee, 2009).
Students as well have a strong belief
about the importance of grammar feedback in
learning a language and, understandably,
have great expectations as well on receiving
such feedback (Leki, 1990; Nunan, 1998;
Schulz, 2001; Ur, 1998).
Due to these beliefs and expectations, giving
written grammar corrective feedback has
become a pervasive practice among language
teachers (Ferris, 2010). So pervasive that
even
though
teachers
suspect
its
effectiveness, they still continue giving it
(Lee, 2009).
Conflicting views and research results
about written corrective feedback
However, despite the positive
perception of the value of corrective
feedback, language academics have not
found a consensus on the effectiveness of
different kinds of corrective feedback, and
even on its usefulness in general (Ellis, 2000,
2009; Ur, 1998). Furthermore, research
results have not been helpful in settling these
issues (Macaro, 2005; Guenette, 2007).
Since the 80s up to mid-2000,
language researchers and experts have
offered conflicting findings and theories
about the benefits of corrective feedback. For
example, Lalande (1982), Schmidt and Frota
(1986), Fathman and Whaley (1990),
Matsumura et al (2002), Ferris (2006), and
Ellis et al. (2006) favored the use of
corrective feedback. On the other hand,
Semke (1984), Brock et al (1986), Krashen
(1987), Leki (1990), and Truscott (1996,
2007) questioned its usefulness.
Common types of written corrective

feedback and their effectiveness
The three most common types of
written corrective feedback are direct
corrective feedback, indirect corrective
feedback, and metalinguistic corrective
feedback, of which use of codes is the most
common approach (Ellis, 2009). However,
the question as to which type is the most
effective way in dealing with language errors
in student compositions has not yet been
given a satisfactory answer.
Some research findings have shown the
benefits of the direct approach (Ellis et al.,
2008; Bitchener & Knoch, 2009; Sheen,
2010). Others, like Fathman and Whaley
(1990) and Lee (1997), have favored the
indirect method, while there are also others
preferring the use of codes, such as Lalande
(1982) and Kubota (2001). However, these
three approaches have not yet been put
together in an experimental study designed to
determine their long-term impacts.
Research questions
Considering the significant amounts
of time and effort invested by language
teachers in providing corrective feedback on
students compositions, together with all
these questions about the role of corrective
feedback in second language acquisition, an
investigation into the effectiveness of written
corrective feedback is therefore imperative.
The following research questions
guided the design of the study.
1) Does written corrective feedback
improve
students
English
grammatical accuracy
in subject-verb agreement, verb tense, verb
form, and word form?
2) Are there significant differences in
the effects of the three common types of
written corrective feedback, namely direct
corrective feedback, indirect corrective
feedback, and coded corrective feedback, on
students English grammatical accuracy in
subject-verb agreement, verb tense, verb
form, and word form?
Page 122

July 9-11, 2012
Table 1. Descriptive statistics for pre-test mean
ratings of errors in paragraph
METHODOLOGY
Research Design
To answer the research questions, a
pre-test-post-test experimental study was
conducted. It involved three experimental
groups based on the three types of written
corrective feedback treatment, which were
direct corrective feedback (DCF), indirect
corrective feedback (ICF), and coded
corrective feedback (CCF), and a control group
that received no written corrective feedback.
All groups were given a pre-test (at the
beginning of the semester) , an immediate
post-test (right after the first treatment was
given) and a delayed post-test (at the end of the
15-week semester) to determine the effects of
the treatment.
Participants
The study was done at Assumption
University in academic semester 1/2011. Four
sections of academic English I students were
randomly assigned for the study. Originally,
there were 112 students divided among the
four sections. However, due to exemptions,
withdrawals, and student nationality, only 68
Thai students were used for the analyses of
data. The four sections were randomly
assigned to the four groups.
The average age of the participants
was 18.93 years. Of the 68, 40 (57.4%) were
females and 28 (41.2%) were males. They
were all first year students coming from the
faculty of Business Administration (26.5%),
Arts (38.2%), and Communication Arts
(35.3%). They had an average of 12 years of
learning English prior to university. The first
language of all study subjects is Thai.
One-way
analysis
of
variance
(ANOVA) of the pre-test scores showed that
there were no significant differences between
the groups in terms of accuracy in the four
grammar areas under study: subject-verb
agreement (F (3,64) = 0.619, p = 0.605); verb
tense (F (3,64) = 0.237, p = 0.80); verb form (
F (3, 64) = 0.330, p = 0.804), and word form
(F (3,64) = 0.780, p = 0.51). Thus, it was
assumed that all groups were comparable.
ICF
Mean
(SD)
SVA 2.79
(2.12)
VT
2.07
(1.60)
VF
1.07
(0.71)
WF 1.36
(0.60)
DCF
CCF
Control
Mean
(SD)
3.26
(1.25)
2.10
(1.66)
1.30
(0.48)
1.40
(0.39)
Mean
(SD)
3.40
(2.19)
2.15
(1.11)
1.24
(0.54)
1.22
(0.43)
Mean
(SD)
2.72
(1.11)
2.45
(1.57)
1.18
(0.91)
1.53
(0.90)
Target language features

The suggestions of Holt (1997) and
Lane and Lange (1999) about global and
frequent errors and the findings of Bennui
(2008), Lush (2002), Pongsiriwet (2001), and
Thep-Ackrapong (2005) about the common
language problems among Thai students
guided the selection of the target structures.
Two global errors, i.e errors in verb tense and
verb form, and two local errors, i.e. subjectverb agreement and word form, were chosen as
they were the most frequent errors committed
by Thai students.
Treatment
The direct corrective feedback group
received explicit corrections through any of the
following ways: a) drawing a line through the
error and writing the correct word or words
above it; b) crossing out a word or words that
make the structure incorrect; c) inserting a
letter, a word or words to make a structure
correct.
For the indirect corrective feedback
group, grammatical errors in students writings
were simply underlined or circled without
giving the correction or explaining the error.
The treatment for the coded corrective
feedback group
involved underlining or
circling the errors and identifying the type of
errors by using codes, i.e. SVA for incorrect
subject-verb agreement, VT for incorrect verb
tense, VF for incorrect verb form, and WF for
Page 123

July 9-11, 2012
incorrect word form. Also, upon the return of
the first practice writing with the treatment,
participants in this group received a copy of a
correction guide about the use of the codes
with explanations as to what they mean with
sample errors and corrections. They were
allowed to use this guide whenever they
revised their practice writings.
The control group received no
grammatical corrective feedback, but they
received content and organization feedback.
Focused or selective grammar
corrective feedback was used, which means
only the four target areas were dealt with
disregarding other grammar errors.
All groups received general as well as
text-specific written feedback on content and
organization. Post-writing conferences were
also held to discuss common major problems
in terms of ideas and language use.
A total of seven treatments were given
in the whole study at an interval of
approximately two weeks beginning on week
2.Corrected compositions were returned to
students in the class following the practice
writing, or in the case of quiz and exam papers,
as soon as grading and treatment were finished.
Students were asked to go through their
writings, and they were encouraged to ask
Tests
on the topic The Person I Admire

Most. The same topic was given in the pretest and in the two post-tests to avoid problems
in the reliability and validity of the data due to
the influence of varying instruments and
writing conditions.
questions regarding the feedback if they had
any. Rewriting was also required for practice
writings, not for exams. Revised compositions
were only impressionistically checked in terms
of content and returned to the students in the
following meeting.
As mentioned earlier, a pre-test and
two post-tests were administered to all groups.
The tests consisted of a descriptive paragraph
writing
task which was to be completed in

approximately 40 minutes. The students were
asked to write a paragraph of about 150 words
Scoring
Three expert raters identified, marked,
and tallied the target grammar errors. After all
papers were examined, grammatical accuracy
scores were calculated. In quantifying
grammatical accuracy, the number of errors for
every particular grammar area was divided by
the number of words in a student composition
(Polio, 1997). The score was then normalized
by multiplying the result by 100 and was
expressed in percent (Biber et al., 1998). For
example, (3 SVA errors /150 words) x 100 =
2% or 2 SVA errors per 100 words. Thus, the
lower the score, the higher the accuracy.
The ratings of the three teachers in all four
grammar areas in all three testing periods were
highly and significantly correlated (ranging
from 0.90 to 0.953, p < 0.000), indicating high
inter-rater reliability. Hence, the ratings of the
three teachers for each subject in each
grammar area in every test were averaged, and
these averages were used in the statistical
analyses.
Data Analysis
The data were processed and analyzed
using SPSS. Exploration of data revealed that
there were no extreme values and that the data
were normally distributed. For descriptive
purposes of the samples and pre- and post-test
scores, means, standard deviations, and
percentages were obtained. Analysis of
variance (ANOVA) was used to determine the
comparability of groups at the beginning of the
study. To answer the research questions, preand post-test data were compared using
General Linear Model (GLM) Repeated
Measures Test: Two-factor Mixed Design (one
between-groups variable treatment groups,
and one within-subjects variable test scores).
Page 124

July 9-11, 2012
RESULTS
Sample sizes: ICF = 18, DCF = 13, CCF = 20,
Control = 17
Subject-verb agreement (SVA)
Table 2 presents the means and
standard deviations (SD) of the subject-verb
agreement errors made by the four different
groups in the three tests. Figure 1 shows the
pattern of the changes in the mean scores.
Table 2. Descriptive statistics for subject-verb

agreement
Group
ICF
DCF
CCF
Control
Pre-test
Mean (SD)
Post-test1
Mean
(SD)
1.24
(1.07)
1.34
(1.02)
Post-test2
Mean
(SD)
1.83
(1.77)
3.33
(1.58)
1.59
.88 (.56)
(1.10)
2.49
2.16(1.28)
(1.51)
2.79 (2.12)
3.26 (1.25)
3.40(2.19)
2.72(1.11)
4
3.5
3
2.5
1.5
1
0.5
0
Pre-test
Post-test 1
Post-test 2
Indirect CF
Direct CF
Coded CF
Control
Fig. 1. Means for three testing periods of each

group in subject-verb agreement
General Linear Model (GLM) repeated

measures tests of within-subjects effects
revealed that the differences in the number of
SVA errors made across the three tests were
significant (F (2, 128) = 35.40, p = 0.000),
with the most number of errors in the pre-test,
less in post-test 2, and the least in post-test 1.
The time-group interaction was also
statistically significant (F (6, 128) = 4.20, p =
0.001), which suggests that the number of
SVA errors committed across the three testing
periods depends on the type of the treatment
group. Figure 1 illustrates that, although there
was a general decrease in the number of SVA
errors made in post-test 1 and in post-test 2
compared to the pre-test for all groups, the rate
of decrease was greater for the coded CF group
than for the other three groups. Tests of withinsubjects contrasts for time and group
interaction showed significant results for both
post-test 1 vs. pre-test (F (3,64) = 4.489, p =
0.006) and post-test 2 vs. pre-test (F (3,64) =
4.595, p = 0.006). These contrast results
indicate that the mean differences between the
pre-test and post-test 1 varied significantly
across the four groups, with the coded CF
group making the greatest improvement,
followed by the direct CF, indirect CF, and
control groups respectively. The results also
mean that the differences between the pre-test
and post-test 2 were significant across the
groups, again with the coded CF group
making the most improvement, followed by
the indirect CF and control groups, while the
direct CF group made more errors in post-test
2 than in the pre-test.
Verb tense
Table 3 shows the results of the three
tests among the groups in terms of verb tense
accuracy. The patterns are somewhat similar to
that of the SVA results.
Page 125

July 9-11, 2012
Table 3. Descriptive statistics for verb tense
Group Pre-test
Post-test1
Post-test2
Mean (SD) Mean (SD)
Mean (SD)
ICF
2.07 (1.60) 0.75 (0.87)
2.01 (1.98)
DCF
2.10 (1.66) 0.36 (0.47)
1.40 (0.95)
CCF
2.15 (1.11) 0.53 (0.60)
.52 (0.36)
Control 2.45 (1.57) 1.64 (1.23)
2.45(1.72)
3
2.5
2
1.5
1
0.5
0
Pre-test
Post-test 1
Post-test 2
Indirect CF
Direct CF
Coded CF
Control

group in verb tense
Results of GLM repeated measures

tests showed that there were significant
differences in the number of verb tense errors
across the three tests (F (2, 128) = 37.40, p =
0.000). The most number of errors was made
in the pre-test, whereas the least was in posttest 1. Moreover, the interaction between time
and group was significant (F (6, 128) = 3.86, p
= 0.001). This indicates that the four groups
developed their verb tense accuracy
differentially over time. Figure 2 clearly
presents the trend in which the three
experimental groups outperformed the control
group in the immediate post-test. The figure
also shows that the coded CF group continued
its improvement from pre-test to post-test 2
compared to the other groups. Results of tests
within-subjects contrast for time and group
interaction revealed that the contrast between
the pre-test and post-test 1 was not significant
(F (3,64) = 1.715, p = 0.173), which indicates
that the mean differences between these two
tests did not vary across the groups. However,
the contrast for the pre-test vs. post-test 2 was
found to be significant (F (3, 64) = 5.919, p =

0.001). This indicates that the four groups
developed differentially in terms of verb tense
accuracy from pre-test to delayed post-test, in
which the coded CF group made the most
improvement followed by the direct CF group,
while the indirect CF group had a negligible
change and the control group exhibited no
improvement at all.
Verb form (VF)
Means and standard deviations for the
number of verb form errors made by the four
groups in the three testing periods are given in
Table 4. All groups made the least number of
errors in the immediate post-test and produced
the most number of errors in the pre-test,
except for the control group that committed the
most number of errors in the delayed post-test.
Table 4. Descriptive statistics for verb form
Group
Pre-test
Mean
(SD)
ICF
1.07(0.71)
DCF
1.30(0.48)
CCF
1.24(0.54)
Control 1.18(0.91)
Post-test1
Mean(SD)
Post-test2
Mean(SD)
0.56 (0.53)
0.34(0.46)
0.34(0.39)
0.80(0.94)
1.03(0.50)
1.15(0.68)
0.47(0.38)
1.65(1.01)
1.8
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0
Pre-test
Post-test 1
Post-test 2
Indirect CF
Direct CF
Coded CF
Control

group in verb form
Page 126

July 9-11, 2012
In terms of verb form errors, GLM
repeated measures tests (using the Huynh-Feldt
corrected tests because the assumption of
sphericity was not met (Mauchlys Test of
Sphericity p = 0.019)) showed that the scores
of all four groups differed significantly across
the three tests (F (1.923, 123. 074) = 27.032, p
= 0.000). The time and group interaction was
also found to be significant (F (5.769, 123.074)
= 4.206, p = 0.001). This significant interaction
indicates that the number of verb form errors
made in the three tests depends on the kind of
written corrective feedback given to the
different groups. Figure 3 shows the pattern in
which the experimental groups scored better
than the control group from the pre-test to the
immediate post-test. However, the mean
differences between the pre-test and post-test 1
for time and group interaction were not
significant (F (3, 64) = 1.893, p = 0.140),
which means that the revision improvement in
verb form accuracy did not vary significantly
across the groups. The pre-test vs. post-test 2
contrast for time*group interaction was
significant (F (3, 64) = 11.127, p = 0.000),
which indicates that the rate of improvement
from the pre-test to the delayed post-test was
not similar across the four groups. As
illustrated in Figure 3 the coded CF group
outperformed the other two experimental
groups, which barely made any improvement,
when the pre-test and post-test 2 were
contrasted. The control group, on the other
hand, produced more errors in the delayed
post-test than in the pre-test.
results involving errors in word forms are

generally similar to that of the other grammar
areas under study. Immediate post-test results
were lower than the pre-test results, with the
indirect CF group showing the most
improvement followed by coded CF, direct
CF, and control groups respectively. Delayed
post-test results were
higher than the
immediate post-test results, but lower than the
pre-test results, with the coded CF group
showing greater improvement than the other
three groups.
Table 5. Descriptive statistics for word form
Group
Pre-test
Mean(SD)
ICF
1.36(0.60)
DCF
1.40(0.39)
CCF
1.22(0.43)
Control 1.530(.90)
Post-test2
Mean(SD)
0.91(0.62)
0.94(0.61)
0.51(0.60)
1.41(0.65)
1.8
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0
Pre-test
Post-test 1
Post-test 2
Indirect CF
Direct CF
Coded CF
Control

group in word form
Word form (WF)

Descriptive statistics for word form
errors made in the paragraph writing task by
the four groups in the three tests are
summarized in table 5. The patterns of the
Post-test1
Mean(SD)
0.38(0.32)
0.50(0.51)
0.30(0.31)
0.91(1.08)
Page 127

July 9-11, 2012
Tests of within-subjects effects of
GLM repeated measures indicated that the
differences in the number of word form errors
made by all groups across the three tests were
significant (F (2, 128) = 46.638, p = 0.000).
Although Figure 4 illustrates that the three
experimental groups performed better than the
control group from the pre-test to post-tests 1
and 2 , the interaction between time and group
was found to be not statistically significant (F
(6, 128) = 1.234, p = 0.293). This means that
the number of word form errors committed
across the three tests was not dependent on the
type of written corrective feedback.
DISCUSSION
The first research question asked
whether providing written corrective feedback
helped improve the grammatical accuracy of
learners of English as a second language. To
answer this question, we have to look at the
immediate or revision effect and the delayed or
long-term effect.
With regard to the immediate effect,
results have shown that all three groups that
received different kinds of written corrective
feedback performed better than the control or
no correction group in all grammar areas, i.e.
subject-verb agreement, verb tense, verb form,
and word form. This result is expected for the
direct corrective feedback group since the
students simply copied the corrections
provided by the teacher. The improvement
among students who received indirect
corrections can be related to two factors. The
first factor is that the students probably had the
so-called declarative or explicit knowledge
about the four grammar areas which helped
them correct their mistakes when located by
the teacher. This suggests that students may be
capable of correcting their own mistakes in the
editing or revision stage of the writing process
as long as they are guided as to where their
mistakes are. Another factor that may explain
their improved accuracy is that they might
have asked knowledgeable others in the

classroom, such as the teacher or their
classmates, as to why they were wrong and
how to correct their mistakes. The increased
accuracy among students who received coded
corrective feedback indicates that they
understood the correction codes with the help
of the correction guide which contains the
codes, their meaning with sample sentences
and corrections. It also suggests that the
students possessed declarative knowledge
regarding the target structures which helped in
implementing the corrective feedback.
Students who did not get any written corrective
feedback on the four grammar areas also
showed some improvement, but at a lower rate
than those who received corrective feedback.
As this group was also asked to revise their
work, they might have made changes in
content and organization which in turn might
have lessened their use of such grammatical
structures. They might have also benefitted
from the post-writing conference in which
common problems in ideas and language were
discussed.
However, when it came to the delayed
or long-term effect of written corrective
feedback, it can be noted that only the coded
corrective feedback consistently worked in all
four grammar areas. In subject-verb
agreement, coded corrective feedback and
indirect corrective feedback groups performed
better than the control group, while the direct
corrective feedback group performed worse
than the control group and even performed
worse than in the pre-test. In verb tense, coded
corrective feedback and direct corrective
feedback groups did better than the indirect
corrective feedback group, which made
negligible improvement, and than the control
group that did not make any improvement. In
verb form, the direct and indirect corrective
feedback
groups
made
very
slight
improvement, while the control group
performed worse than in the pre-test. Only the
coded corrective feedback group showed
marked improvement in verb form. In word
form, although all groups showed some
Page 128

July 9-11, 2012
improvement, the coded corrective feedback
group showed the greatest improvement.
Research question 2 asked whether
there were significant differences in the effects
of the three common types of written
corrective feedback on grammatical accuracy.
Statistical analyses have shown that there
were. Students who received different
corrective feedback approaches developed
their grammatical accuracy in subject-verb
agreement, verb tense, and verb form
differentially across the testing periods,
especially in the long term, but not in the area
of word form. As discussed above, while all
three corrective feedback approaches benefited
students in the revision stage, only those who
received
coded
corrective
feedback
consistently improved their grammatical
accuracy in subject-verb agreement, verb
tense, and verb form. The superiority of coded
corrective feedback over the direct and indirect
approaches when it comes to long-term
language learning can be attributed to the
active mental involvement of students when
they are dealing with the codes to correct their
written work. Lalande (1982), Jordan (1997),
and Broughton et al. (1994) noted that the use
of codes engages students in guided learning
and problem solving as students analyze their
mistakes and do their correction with the help
of the codes. The codes do not simply help
students in noticing their mistakes, but they
also supply some clues as to the kind of
mistakes students make, helping students
understand the target structure (Sheen, 2010).
This understanding is essential in retaining
grammatical knowledge for future activation
when needed. According to Storch and
Wigglesworth (2010), using codes makes
students more engaged in their language tasks
which then leads to increased uptake in
revision. This high uptake results in better
comprehension that benefits students in the
long-term because of higher retention. The
same cannot be said of the direct and indirect
corrective feedback. The direct approach
obviously does not engage students in active
cognition as students simply follow what
teachers supply them. Students may notice the
difference between their own construction and

the proper way of writing or saying it, but they
may not be able to understand why it is so or
they may simply forget later on. Indirect
approach may involve students in problem
solving, but without guidance or explanations,
they may not be able to fully understand
certain
language
structures.
Asking
knowledgeable others may not always be an
option or available to all students since they
may be shy to ask or those they want to ask
may be busy too. Limited understanding of
mistakes may lead to limited retention or
worse, retention of incorrect information.
There should be one important thing to
note here. As observed, only subject-verb
agreement, verb tense, and verb form were
significantly influenced by written corrective
feedback. Although the corrective feedback
groups, especially the coded group,
outperformed the control group in word form
accuracy, results have shown that the
improvement did not depend on the treatment
and may be linked to practice effect. This
finding can be explained by what Ferris (2006)
called treatable and untreatable errors.
Treatable errors are those that are rule-based
and thus can be corrected by following the
rules. Untreatable errors, on the other hand, are
those that are not governed by rules, but rather
by convention or vocabulary, which can be
acquired through practice. Subject-verb
agreement, verb tense, and verb form are all
considered treatable as there are grammar rules
that govern their proper usage, while word
form is considered as untreatable because it is
based on vocabulary knowledge. Even if
students know that they have to use a noun,
verb, adjective, or adverb in a certain structure
but they are not familiar with the different
forms of a particular word, they will not be
able to write the appropriate word. This finding
suggests that written corrective feedback, i.e.
coded corrective feedback, can impact only
treatable errors.
Page 129

July 9-11, 2012
CONCLUSIONS
The investigation was conducted to
help answer some lingering questions about
the role of written corrective feedback in
developing the language accuracy of learners
of English as a second language. This study
has provided evidence that a common type of
corrective feedback improves grammatical
accuracy in the areas of subject-verb
agreement, verb tense, and verb form. That
type is the coded corrective feedback, which
involves underlining the mistakes and giving
clues as to the kind of mistakes by using codes
or signs. The results of this investigation have
shown that using codes in dealing with
grammar errors is more effective than simply
locating the mistakes (indirect approach) or
supplying the corrections (direct approach) as
it involves active mental participation of
students in correcting their mistakes, which is
essential in learning a language. The use of
codes does not simply help students notice the
gap between their own production and the
correct way of using a particular language
structure, but more importantly, it affords
students better engagement with and
understanding of target language structures,
both of which are vital in retaining knowledge
for future use.
However, it should be noted that coded
corrective feedback in this study seems to have
worked in the following context. First, the
students involved were of low intermediate to
intermediate levels of English proficiency.
Second, writing paragraphs was one of the
main foci of the course. Third, the corrective
feedback was focused on selected grammatical
structures. Fourth, only rule-based structures or
treatable errors were influenced by coded
corrective feedback. Fifth, students were given
a correction guide that clearly explains the
meaning of the codes, with sample mistakes
and corrections. Finally, rewriting of
compositions with corrective feedback was a
part of the process. It is therefore safe to
suggest that in order to reap the benefits of
coded written corrective feedback, all six
factors should be carefully considered.
Finally, as this study has limitations,

further research should be focused on the
following questions.
- Are there significant differences in
the effects of the different types of written
corrective feedback on grammatical accuracy
in other contexts such as different English
courses, different student proficiency levels,
longer writing tasks, other errors, unfocused
correction, and no rewriting tasks?
- Is coded corrective feedback
effective in the contexts mentioned above?
Answers to these and other relevant
questions will aid in better understanding
about the role of written corrective feedback in
second language learning.
Page 130

July 9-11, 2012
REFERENCES
Bennui, P. 2008. A study of L1 interference in the writing of Thai EFL students. Malaysian
Journal of ELT Research, 4, 72-102.
Biber, D., Conrad, S. & Reppen, R. 1998. Corpus Linguistics: Investigating language use structure
and use. Cambridge: Cambridge University Press.
Bitchener, J. & Knoch, U. 2009. The contribution of written corrective feedback to language
development: A ten-month investigation. Applied Linguistics, 31 (2), 193-214.
Brock, C., Crookes, G., Day, R. & Long, M. 1986. Differential effects of corrective feedback in
native-speaker-nonnative speaker conversation. In R. Day (ed.) Talking to learn:
Conversation in Second Language Acquisition (pp. 229-236). Massachusetts: Newbury
House Publishers, Inc.
Broughton, G., Brumfit C., Flavell, R., Hill, P., & Pincas, A. 1994. Teaching English as a Foreign
Language (2nd ed.). New York: Routledge.
Chaudron, C. 1995. Second Language Classrooms: Research on teaching and learning.
Cambridge: Cambridge University Press.
Ellis, R. 2000. Instructed Second Language Acquisition: Learning in the classroom. Oxford: Basil
Blackwell.
Ellis, R. 2009. A typology of written corrective feedback types. ELT Journal, 63 (2), 97-107.
Ellis, R., Loewen, S. & Erlam, R. 2006. Implicit and explicit corrective feedback and the
acquisition of second language grammar. Studies in Second Language Acquisition, 28, 339368.
Ellis, R., Sheen, Y., Murakami, M. & Takashima, H. 2008. The effects of focused and unfocused
written corrective feedback in an English as a foreign language context. System, 36 (3),
353-371.
Fathman, A. K. & Whalley, E. 1990. Teacher response to student writing: Focus on form versus
content. In B. Kroll (Ed.) Second Language Writing: Insights for the classroom (pp. 178190). Cambridge: Cambridge University Press.
Ferris, D. 2006. Does error feedback help student writers? New evidence on the short- and longterm effects of written error correction. In K. Hyland and F. Hyland (Eds.) Feedback in
second Language Writing: Contexts and issues (pp. 81-104). Cambridge: Cambridge
University Press. 81-104.
Ferris, D. 2007. Preparing teachers to respond to student writing. Journal of Second Language
Writing, 16 (3), 165-193.
Ferris, D. 2010. Second language writing research and written corrective feedback in Second
Language acquisition: Intersections and practical applications. Studies in Second Language
Acquisition, 32, 181-201.
Guenette, D. 2007. Is feedback pedagogically correct? Research design issues in studies of
feedback on writing. Journal of Second Language Writing, 16 (1), 40-53.
Holt, S. 1997. Responding to grammar errors. New Directions for Teaching and Learning, 70, 69-76.
Jordan, R. R. 1997. English for Academic Purposes: A guide and resource book for teachers.
Cambridge: Cambridge University Press.
Kubota, M. 2001. Error correction strategies used by learners of Japanese when revising a writing
task. System, 29 (4), 467-480.
Krashen, S. 1987. Principles and Practice in Second Language Acquisition. London: Prentice Hall.
Lalande, J.F. 1982. Reducing composition errors: an experiment. Modern Language
Journal, 66, 140-149.
Lane, J. & Lange, E. 1999. Writing clearly: An editing guide. Boston: Heinle & Heinle.
Lee, I. 1997. ESL learners performance in error correction in writing: Some implications for
teaching. System: International Journal of Educational Technology & Applied Linguistics,
25 (4), 465-477.
Page 131

July 9-11, 2012
Lee, I. 2009. Ten mismatches between teachers beliefs and written feedback practice. ELT
Journal, 63 (1), 13-22.
Leki, I. 1990. Coaching from the margins: Issues in written response. In B. Kroll (ed.) Second
Language Writing: Insights for the classroom (pp. 57-68). Cambridge: Cambridge
University Press.
Lush, B. 2002. Writing errors: A study of Thai students writing errors. Thai TESOL Bulletin, 15 (1),
75-82.
Macaro, E. 2005. Teaching and Learning a Second Language: a guide to recent research and its
application. London: Continuum.
Matsumura, L.C., Patthey-Chavez, G.G., Valdes, R. & Garnier, H. 2002. Teacher feedback, writing
assignment quality, and third grade students revision in lower- and higher-achieving urban
schools. The Elementary School Journal, 103 (1), 3-25.
Montgomery, J. & Baker, W. 2007. Teacher-written feedback: Student perceptions, teacher selfassessment, and actual teacher performance. Journal of Second Language Writing, 16 (2),
82-99.
Nunan, D. 1998. Language Teaching Methodology: A textbook for teachers. London: Prentice Hall.
Polio, C.G. 1997. Measures of linguistic accuracy in second language writing research. Language
Learning, 47 (1), 101-143.
Pongsiriwet, C. 2001. Relationships among grammatical accuracy, discourse features, and the
quality of second language writing: The case of Thai EFL learners. Ed.D. Dissertation,
West Virginia University, United States -- West Virginia. Retrieved October 10, 2010, from
Dissertations & Theses: A&I. (Publication No. AAT 3022059).
Schmidt, R.W. & Frota, S.N. 1986. Developing basic conversational ability in a second language: A
case study of an adult learner of Portuguese. In R. Day (Ed.) Talking to learn:
Conversation in Second Language Acquisition (pp.237-326). Massachusetts: Newbury
House Publishers, Inc.
Schulz, R.A. 2001. Cultural differences in student and teacher perceptions concerning the role of
grammar instruction and corrective feedback: USA-Colombia. The Modern Language
Journal, 85 (2), 244-258.
Semke, H.D. 1984. Effects of the red pen. Foreign Language Annals, 17, 195-202.
Sheen, Y. 2010. The role of oral and written corrective feedback in second language acquisition.
Studies in second Language Acquisition, 32, 169-179.
Shin, S.K. 2008. Fire your proofreader! Grammar correction in the writing classroom. ELT Journal, 62
(4), 358-365.
Thep-Ackrapong, T. 2005. Teaching English in Thailand: An Uphill Battle. Manutsart Paritat:
Journal of Humanities (Srinakarinwirote University), 27 (1), 51-62.
Truscott, J. 1996. The case against grammar correction in L2 writing classes. Language Learning, 46
(2), 327-369.
Truscott, J. 2007. The effect of error correction on learners ability to write accurately. Journal of
Second Language Writing, 16 (4), 255-272.
Ur, P. 1998. A Course in Language Teaching: Practice & Theory. Cambridge: Cambridge
University Press.
Storch, N. & Wigglesworth, G. 2010. Learners processing, uptake, and retention of corrective
feedback on writing. Studies in Second Language Acquisition, 32 (02), 303-334.
Page 132

July 9-11, 2012
HUO56-2
Insider Trading Behavior and News Announcement:

Evidence from the Stock Exchange of Thailand
Weerawan Laoniramai
College of Management, Mahidol University, Bangkok, Thailand
weerawanja@gmail.com
ABSTRACT
The purpose of this paper is to examine insider trading behavior reaction to news
announcement by using firms listed on the Stock Exchange of Thailand during 2000 to 2008. By
employing event study approach, the results show that the information contents are significant to
insider buying but not to insider selling. In other words, only insider buying can create abnormal
returns. Moreover, trading before good news announcement shows significant abnormal return for
both selling and buying, in particular, insider buying followed by good news greatly impact on
prices.
Keywords: insider trading, news, Thailand

INTRODUCTION
The topic of insider trading has
attracted tremendous attention from various
market participants, such as academic
researchers, policy-makers, and investors. It is
due to most insiders would have an ability to
time the market. They usually trade their own
securities in favorable time and earn abnormal
returns. Moreover, insiders who possess nonpublic information about their firms may be
motivated to take advantage of it through their
trading, but such action is illegal.
Previous studies have documented that
insiders are able to outperform the market. In
other words, they can gain abnormal returns
through trading stocks of their own firms [7]
[13] [11]. We choose to examine insider trading
in Thailand because most studies about insider
trading based in the U.S. market, and these
results may not be robust in Asian or emerging
markets.
To provide fairness and transparency
to all investors, the Securities and Exchange
Commission (SEC) issues regulations which
enforce firms to disclose all related and
necessary information to the public. Despite
SECs regulations in Thailand prohibited on

trading with private information, there is
evidence which exhibits abnormal changes in
stock prices of firm on the day of news
announcement. For example the case of
THCOM (Thaicom Pcl.), when Thailands
government announced plans to buy stocks
back from Singapore state-owned investment
company, THCOM increased by 30 percent
and exceeds a 30-percent-thresholds circuit
breaker. On the same day, the benchmark of the
Security and Exchange of Thailand (SET)
Index
increased
only
1.5
percent
(www.businessweek.com, June 14, 2010).
Here, there are two objectives of the study: 1)
to investigate insiders trading activities and
market reaction; 2) to examine the relationship
between insiders trading activities and
subsequent corporate news announcement.
The rest of the paper is organized as
follows. We first briefly describe relevant
studies in the next section. Then we present
materials and methods. In the following part,
we discuss empirical results. At last, the study
is concluded.
Page 133

July 9-11, 2012
LITERATURE REVIEW
Earliest research about corporate
insiders focused its study on the performance of
insider trading. Most studies measured
abnormal returns during a period of insider
trading. References [7] [13] assert that insider
trades are profitable. There are significant
abnormal returns to insider ranging from 6 to
12 months after the transaction. More recent
researches report a similar result. Insiders gain
more than average profits from their
transactions [11] [2]. These imply that insider
trading contains information.
The disclosure news provides
information to market participants. Having
obtained information before news release, an
insider may take this opportunity to trade in a
favorable way. Such transactions may impact
the price of the security. Many previous
researches have studied insider trading toward
certain public events. To illustrate, [9] [8] find
information leakage before merger and
acquisition announcements. Reference [6]
report that insider trades are larger after
earnings disclosures and become a profitable
manner; selling (buying) stocks after good
(bad) announcements. Reference [5] find no
significant relationship between timing of
insider trading and subsequent announcements.
However, the findings of [12] [4] show that
insider transactions can gain benefits from
voluntary disclosures.
MATERIALS AND METHODOS
Raw Material
The source of insider trading data is
the SECs Form 59-2 (corporate insider) and
Form 246-2 (large shareholder). Both reports
contain all transactions by insiders which are
daily provided through the SECs website. The
study period covers from January 2000 to
December 2008. The news reports and the data
of securities market are obtained from
SETSMART. This database is a main source of
financial data provided by the SET.
We investigate buying and selling of
common shares in listed firms. Our sample
includes complete and valid transactions.
Following these adjustments, the numbers of
observations remain 29,752 transactions from
490 firms. The transactions of corporate

insiders are 27,179 trades and the transactions
of large shareholders are 2,573 trades.
News Classification
This study uses all significant events of
companies
which
are
reported
in
SETSMARTs
database.
The
broad
classification of news into good or bad is
following the markets reaction to the news
[10]. We find the different value of stock price
from the closing price on the day before the
publish news to the opening price on the day
after the news. We define good news if the
price change of stock is positive and bad news
if it is negative. Neutral news is expected to
produce no price change reaction.
To examine the relationship of insider
trading activities and subsequent corporate
news, we consider only the first news
publication following insider transactions [5]. If
the news motivates insiders to trade, they
would trade in such a way that benefits their
position. Therefore, we expect a positive
correlation between the trade direction and the
content of the first news.
Event Study Method
We use a standard event study method
market-adjusted returns [3] to measure
abnormal returns. The stock return is daily
returns of each security adjusted dividend. The
benchmark return is SET index return.
Abnormal returns equation is following.
ARit = Rit Rmt
(1)
Where ARit is the abnormal return of

stock i on day t. Rit and Rmt are return of
stock i and SET index on day t.
Then we calculate the average
abnormal return (AAR) and the cumulative
average abnormal return (CAAR).
AARt =
1
N
ARit
i =1
(2)
t2
CAAR (t1, t 2) = AARt

t =t1
(3)
N is the number of firms with insider

trading on day t.
Page 134

July 9-11, 2012
The null hypothesis is to test
whether the CAAR is equal to zero. We
use the test statistic of [1].
tCAAR =
CAAR(t1, t 2)
(CAR(t1, t 2) ) n
(4)
(CAR (t1, t2))
is the crosssectional sample standard deviation of the

cumulative abnormal returns for the sample
of n firms between t1 and t2 period.
We separate event study for insider buying
and selling. The number of net insider
transactions for each firm in a day uses to
classify the direction of insider. If the number
of insider buying is higher than the number of
insider selling, we classify as a buying firm.
The convert situation becomes a selling firm.
We exclude the day that the number of insider
buying equals selling. We choose the event
window period 30 days after insider trading day
because it reflects the complete market
reaction.
RESULTS
This section reports three main results
according to our hypotheses. We show three
groups of insiders which are all types of insider,
corporate insider, and large shareholder. The
buying and selling activities are separately
presented.
H1: The relation of cumulative
average abnormal return (CAAR) to the
insiders buying is positive.
The result in Table 1 supports our

hypothesis
H1. The relation of CAAR to insiders
buying is positive. For example, when all types
of insider buying, the CAAR1,30 is increasing
to 2.86%. Similar results are in corporate
insider and large shareholder that the CAAR
amounts to 2.77% and 3.66%, respectively.
These values are significance at 1% level.
H2: The relation of cumulative
average abnormal return (CAAR) to the
insiders selling is negative.
Results of insider selling are also
reported in Table1. The relation of CAAR to
insiders selling is not negative. Even though
most post-event CAARs are significantly
different from zero, they are all positive. The
CAAR1,30 for each group of insider is 1.81%
for all types of insider, 1.87% for corporate
insider, and 1.36% for large shareholder.
Therefore, we reject the hypothesis H2.
Our result is consistent with earlier
research only to insider buying. Most studies
state that insider trades are profitable [7] [13]
[11] [2]. In this paper, the evidence shows that
insiders can time their buying and get abnormal
returns, while they cannot time their selling and
fail to get abnormal returns. The possible
explanation is that the main reason for insider
buying is to make profits, but there are many
reasons for insider selling, such as liquidity
needs or portfolio diversification.
H3: The cumulative average abnormal
return (CAAR) is associated with the news
contents. Insiders buying (selling) shares
before good (bad) news announcement gain
large CAAR.
Page 135

July 9-11, 2012
Table 1 Percentage CAAR for insider trading events
In each row, the first number shows the CAAR and the second in parentheses shows test statistic (p-value). +,
++ and +++ denote statistical significance at the 10%, 5% and 1% level, respectively.
Event window
(+1, +5)
(+1, +10)
(+1, +20)
(+1, +30)
Sample size
All types of insider
Buy
Corporate insider
Sell
Buy
Sell
Sell
-0.0840
0.8177
0.1766
0.7474
0.2339
1.9779
( 0.0000) +++
( 0.0195) ++
( 0.0000) +++
( 0.0021) +++
( 0.0000) +++
( 0.7563 )
1.2680
0.5407
1.1919
0.5707
2.4913
0.5317
( 0.0000) +++
( 0.0000) +++
( 0.0000) +++
( 0.0000) +++
( 0.0000) +++
( 0.1324 )
2.2100
1.2583
2.1252
1.2875
3.0707
1.1713
( 0.0000) +++
( 0.0000) +++
( 0.0000) +++
( 0.0000) +++
( 0.0000) +++
( 0.0168) ++
2.8610
1.8112
2.7769
1.8787
3.6640
1.3607
( 0.0000) +++
( 0.0000) +++
( 0.0000) +++
( 0.0000) +++
( 0.0001) +++
( 0.0191) ++
14,866
14,886
14,035
We test news contents in detail along

with insider transactions in hypothesis H3.
Three groups of news direction include the
right direction, the wrong direction, and the
neutral direction. The right direction means
insider trades by predicting the news contents.
For example, they buy shares before good news
and sell shares before bad news. The wrong
direction defines as the contrary prediction. The
neutral direction means insider trades before
neutral news.
Table 2 shows the result. The
CAAR1,30 of three insider groups trading are
significant differences among news directions
at 1% level (the p-value does not show in the
table). For insider buying, the CAAR1,30 of the
right direction is the highest to 5.87%, 5.66%
and 8.81% at significance level 1% for all types
of insider, corporate insider and
large
shareholder, respectively. Regards insider
selling, the CAAR1,30 of the wrong direction
is the largest to 4.88%, 4.69% and 6.06% at
significance level 1% for all types of insider,
13,144
831
1,742
corporate insider and

large shareholder,
respectively. Surprisingly, all CAARs of the
right direction and the neutral direction are
negative considered the right sign of selling. It
implies that insider selling before bad news and
neutral news are likely to sell shares at the high
CONCLUSION
This paper investigates insider trading

behavior reaction to news announcement in
Thai listed firms. We analyze the sample of 490
firms with 29,752 insider transactions during
2000 to 2008. By using event study
methodology, several important results emerge.
First, the result of market reaction to
insiders buying is consistent with earlier
studies. There are significantly positive
abnormal returns after insider buying. Second,
the result of market reaction to insiders selling
is not negative which is inconsistent with
previous researches. These conclude that
insiders have timing ability only for buying but
not for selling. Third,
price. Only insider buying result is consistent

with our hypothesis H3. Insider buying prior to
good news (the right direction) greatly impacts
on prices. However, insider selling prior to
good news (the wrong direction) also has large
impact on prices. The possible explanation is
that insider may sell shares under various
reasons not only for profits but also for liquidity
needs or portfolio diversification. Reference
[12] [4] find that managers can time their stock
purchases around voluntary revelations for their
personal gains.
Large shareholder
Buy
Page 136

July 9-11, 2012
Table 2 Percentage CAAR for insider trading by news contents
We use news during 30 trading days after insider transactions to group the trade direction. Three groups
include the right, the wrong and the neutral direction. The right direction means insider buy (sell) shares
before good (bad) news announcement, whereas the wrong direction gives the opposite performance. The
neutral direction means insider trades before neutral news. In each row, the first number shows the CAAR
and the second in parentheses shows test statistic (p-value). +, ++, and +++ denote statistical significance at
the 10%, 5%, and 1% level, respectively.
Panel A: All types of insider

Event
window
(+1, +5)
(+1, +10)
(+1, +20)
(+1, +30)
Sample size

(news in the right direction)
Buy
Sell

(news in the wrong direction)
Buy
Sell

(news in the neutral direction)
Buy
Sell
-0.5099
1.6831
-0.7337
0.0118
1.1189
0.6895
( 0.0000) +++
( 0.0000) +++
( 0.9191 )
( 0.0000) +++
( 0.0000) +++
( 0.0023) +++
2.9065
-0.7760
-0.2121
2.0895
0.8062
-0.5127
( 0.0000) +++
( 0.0000) +++
( 0.1772 )
( 0.0000) +++
( 0.0004) +++
( 0.0175) ++
4.4588
-0.5515
0.2158
3.7820
1.1564
-1.2371
( 0.0000) +++
( 0.0250) ++
( 0.3117 )
( 0.0000) +++
( 0.0021) +++
( 0.0007) +++
5.8769
-0.0805
0.0776
4.8808
1.4897
-1.8034
( 0.0000) +++
( 0.7859 )
( 0.7837 )
( 0.0000) +++
( 0.0012) +++
( 0.0001) +++
5,516
5,148
4,792
6,250
1,973
2,004
Panel B: Corporate insider

Event
window
(+1, +5)
(+1, +10)
(+1, +20)
(+1, +30)
Sample size
Corporate insider
Corporate insider
Corporate insider
Buy
Sell
Buy
Sell
Buy
Sell
1.5593
-0.5444
0.0189
1.0704
0.5643
-0.4946
( 0.0000) +++
( 0.0001) +++
( 0.8707 )
( 0.0000) +++
( 0.0002) +++
( 0.0027) +++
2.7364
-0.5690
-0.1590
1.9267
0.6256
-0.5879
( 0.0000) +++
( 0.0024) +++
( 0.3097 )
( 0.0000) +++
( 0.0058) +++
( 0.0077) +++
4.3004
-0.2960
0.3084
3.5749
0.9420
-1.1928
( 0.0000) +++
( 0.2399 )
( 0.1513 )
( 0.0000) +++
( 0.0142) ++
( 0.0011) +++
5.6663
0.3495
0.2045
4.6935
1.3045
-1.7136
( 0.0000) +++
( 0.2565 )
( 0.4759 )
( 0.0000) +++
( 0.0056) +++
( 0.0001) +++
5,173
4,517
4,500
5,531
1,859
1,778
Panel C: Large shareholder

Event
window
(+1, +5)
(+1, +10)
(+1, +20)
(+1, +30)
Sample size
Large shareholder
Buy
Sell
Large shareholder
Buy
Sell
Large shareholder
Buy
Sell
-0.6141
3.4099
-1.8277
-0.0909
1.4248
2.6486
( 0.0000) +++
( 0.0001) +++
( 0.8827 )
( 0.0011) +++
( 0.0079) +++
( 0.3587 )
5.2808
-1.9719
-0.9741
3.1159
3.5933
-0.0037
( 0.0000) +++
( 0.0006) +++
( 0.2690 )
( 0.0000) +++
( 0.0041) +++
( 0.9962 )
6.6700
-2.0275
-1.1140
5.0871
4.4643
-1.5373
( 0.0000) +++
( 0.0127) ++
( 0.3118 )
( 0.0000) +++
( 0.0081) +++
( 0.2747 )
8.8166
-2.5649
-1.7446
6.0611
4.3417
-2.4118
( 0.0000) +++
( 0.0057) +++
( 0.2067 )
( 0.0000) +++
( 0.0394) ++
( 0.1520 )
343
631
292
719
114
226
Page 137

July 9-11, 2012
both insiders buying and selling prior to good
news announcement have significant impact on
abnormal returns. Particularly, insider buying
before good news (the right direction) greatly
impacts on prices. This implies that insider
trades exploit news contents only for buying
but not for selling.
This study provides two empirical
implications. Investors may consider the
relation between insider trading activities and
abnormal returns as one reason for their
investment decision. In addition, policymakers should focus on the effect of corporate
news disclosures on insider trading activities,
so that they can develop rules and regulations
to prevent someone from using inside
information for personal gain. The limitation of
this research is thatthe sample study is legal
insider trading. The future research may extend
to study on illegal insider cases and compare
the different performances with the legal one.
Another limitation is that we should control
other confounding events, such as other news
besides insider trading news, which may affect
to stock price reaction.
Page 138

July 9-11, 2012
REFERENCES
Barber, B. M., and Lyon, J. D., 1997. Detecting long-run abnormal stock returns: the empirical
power and specification of test statistics, Journal of Financial Economics, 43, 341-371.
Betzer, A., and Theissen, E., 2009. Insider trading and corporate governance: the case of Germany,
European Financial Management, 61, 402-429.
Brown, S. J., and Warner, J. B., 1985. Using daily stock returns: the case of event studies, Journal
of Financial Economics, 14, 3-32.
Cheng, Q., and Lo, K., 2006. Insider trading and voluntary disclosures, Journal of Accounting
Research, 44, 815-848.
Givoly, D., and Palmon, D., 1985. Insider trading and the exploitation of inside information: some
empirical evidence, Journal of Business, 58, 69-87.
Huddart, S., Ke, B., and Shi, C., 2007. Jeopardy, non-public information, and insider trading around
SEC 10-K and 10-Q filings, Journal of Accounting and Economics, 43, 3-36.
Jaffe, J. F., 1974. Special information and insider trading, Journal of Business, 47, 410-428.
Jabbour, A. R., Jalilvand, A., and Switzer, J. A., 2000. Pre-bid price run-ups and insider trading
activity: evidence from Canadian acquisitions, International Review of Financial Analysis,
9, 21-43.
Keown, A. J., and Pinkerton, J. M., 1981. Merger announcements and insider trading activity: an
empirical investigation, Journal of Finance, 36, 855-867.
Koppel, M., and Shtrimberg. I., 2004. Good news or bad news? let the market decide, In AAAI
Spring Symposium on Exploring Attitude and Affect in Text: Theories and Applications.
Lakonishok, J., and Lee, I., 2001. Are insider trades informative?, Review of Financial Studies, 14,
79-111.
Noe, C. F., 1999. Voluntary disclosures and insider transactions, Journal of Accounting and
Economics, 27, 305-326.
Seyhun, H. N., 1986. Insiders profits, cost of trading, and market efficiency, Journal of Financial
Economics, 16, 189-212.
Page 139

July 9-11, 2012
HUO77-5
Motivations in Motorcycle Theft

Somboon Phongphu, Panya Srichandr
Integrated Product Design and Manufacturing Program
School of Energy, Environment and Materials
King Mongkuts University of Technology Thonburi, Bangkok, Thailand
E-mail: somboon.ph@airportthai.co.th
ABSTRACT
This research explored the motivation of motorcycle theft by interviewing inmates and
investigation police officers. The basic process of theft consists of motivation, decision making and
unlocking techniques. A major motivation of motorcycle theft is low risk of arrest. When thieves
find a motorcycle target that is inadequately protected, they may decide to steal it. It was found that
security protection devices of motorcycles can be divided into 6 types, each of which has
weaknesses. The best way for prevention of the motorcycle theft is an electronic anti-theft device.
Factory-installed protection devices are easily destroyed by thieves using simple tools. Although
motorcycle owners add more theft-protective devices to lock their motorcycles, thieves can learn
how to steal from friends or by themselves.
Keywords: motivation, motorcycle theft, low risk of arrest, protective devices
INTRODUCTION
Illegal actions are caused by both relevant and external factors. A relevant factor is the
motivation for crime, and an external factor is for example the chance of success. Jan and Kristiina
(2000) indicated that a motivational factor, according to conventional criminological theories, is
that crime is related to economic and/or social deprivation or inequalities. Opportunity factors,
according to opportunity theory, are the level of crime as determined by the presence of suitable
targets of crime and the extent of informal social control. Crime levels can be interpreted as the
convergence of sufficient numbers of motivated offenders, relatively weak mechanisms of social
control, and the presence of suitable targets of crime. Habibullah and Baharom (2008) found that
murder, armed robbery, rape, assault, daylight burglary, and motorcycle theft exhibit long-run
relationships with economic conditions, and the causal effect in all cases runs from economic
conditions to crime rates, and not vice versa. This concept corresponds to Marcelo (2004) which
commented that crime opportunities are heavily influenced by socio-economical factors. Criminal
decision making does not take place in a vacuum; it is embedded in an ongoing process of human
existence (Wright and Decker, 2002). Before committing to a final decision to action, criminals
will weigh the benefits of illegal activity versus working, the likelihood and severity of
punishment, as well as the financial benefits of the outcome (Trogdon, 2006). Research found that
the possible probability for such criminality depended on 2 factors which were place and timing
(Felson and Clarke, 1998). Nowadays, motorcycles are necessary for the public with income
ranging from the low-range to the middle-range. Moreover, it can be concluded that motorcycles
are important for such people in earning for their lives. Though there is active development of
Page 140

July 9-11, 2012
theft-protective devices for in motorcycles, it is still impossible to protect motorcycle from theft.
Thieves are able to somehow train themselves to break or damage such devices.
It can be said that current economic situation leads to the problem and some people cannot
afford their living. Both developed and developing countries are now facing increased criminal
activity. In Thailand, the statistics of motorcycle theft was in the second rank of general theft
category. During 2001-2009, the average annual rate of motorcycle theft was 18,705 and the
recovery rate was 3,168 units per year (Table 1). When considering the economic loss, motorcycle
theft is quite serious in Thailand.
Table 1 Comparative notification stolen of motorcycles with cars and recovery across Thailand
Lost
Years
Recovery
Motorcycles
Cars
Motorcycles
Cars
2001
17,546
3,302
4,217
344
2002
18,736
3,200
3,909
306
2003
18,950
2,747
2,818
230
2004
15,810
3,048
2,410
198
2005
17,523
2,820
2,832
194
2006
20,478
2,841
2,686
186
2007
19,853
2,976
3,038
241
2008
20,039
2,712
3,588
272
2009
21,039
3,043
3,676
257
2010 (First 3 quarters)
14,846
1,196
2,818
192
Average 9 years
18,705
2,972
3,168
248
Average last 3 years
20,310
2,910
3,434
256
The objective of this research is twofold. First, we want to explore existing anti-theft or
other protective devices for motorcycles which are commonly used. Secondly, we want to examine
the motivations that lead to motorcycle theft.
METHODS
In this research we interviewed of 19 prisoners at Sara Buri Provincial Prison and Bangkok
Remand Prison. These prisoners are highly-skilled and keen in motorcycle theft. Additionally, we
also interviewed 3 police officers who were deputy superintendents of investigation departments of
the police stations.
Page 141

July 9-11, 2012
In the interviews, we started by creating trust between the interviewer and the prisoners
who were interviewed. We introduced ourselves, who we were and what the purpose of the
interview was. We told them that the information obtained from interviews will not affect their
case. Information from official records was also considered during the interview. The questions
used in the interview are as follow;
1. When you get a motorcycles already. How do you do with it?
2. When you get a motorcycles already. What do you use it?
3. How do you expect to do about it?
4. What is the driving force to steal a motorcycle?
5. Why do you steal a motorcycle instead of a car?
RESULTS
Existing protective devices
The existing theft-protective equipment can be categorized into 2 groups: the factoryinstalled one to the motorcycle and the optional one which the owner provides to make it more
secured.
Electrical system lock: This electrical system lock is divided into two types. The first one
is the factory-installed lock with the motorcycle. The lock key will control all motorcycle electrical
system. If the key is not at the position ON, the electrical system will not work; therefore, the
motorcycle engine cannot be started up. Another one is electronic anti-theft device. The owner uses
a one-way or two-way motorcycle alarm and installs it to the existing electrical system in order to
prevent the engine starting (immobilizer) and to give alarm when the motorcycle is disturbed.
(Fig.1)
Fig. 1 Two-way Motorcycle Alarm

Mechanical lock: There are four types of mechanical lock;
1. Steering Lock: This is the factory-installed mechanical lock of the motorcycle in order
to block the direction of front wheel not to move freely. If the lock is not unlocked by the key, no
one can drive the motorcycle. Today, the electrical system lock and the steering lock are at the
same position and using the same key to unlock both. The key position of the steering lock is just
above the electrical system lock position (Fig.2).
Page 142

July 9-11, 2012
Fig. 2 Positions of the Electrical System Lock and the Steering Lock
2. Main Stand Lock: The motorcycle owner uses some kind of lock to lock the main stand of
the motorcycle. To lock the main stand is to immobilize the motorcycle. In the locked position, the
front wheel will be raised from the floor by the main stand (Fig.3).
Fig. 3 Main Stand Lock

3. Wheel Lock: This is sometime called Disc break lock. The owner locks the frontwheel disc brake in order to prevent the front wheel (and back wheel) from rotating (Fig.4).
Fig. 4 Wheel Lock at the Front-wheeled Disc Brake

4. Pillar or Ground Chain Lock: For this a mechanical lock, the owner uses a chain to lock
certain part of the motorcycle with the pillar/floor or use the factory compact lock set to lock the
wheel or motorcycle body with the floor (Fig.5).
Fig. 5 Locking the Motorcycle with the Floor
Page 143

July 9-11, 2012
Motivation of Motorcycle Theft
From the interviews of prisoners and police officers, most of the motorcycle thieves have
debts from gambling, drugs, or midnight motorcycle races. It is important to note that they do not
have jobs. Some prisoners are judged in robbery cases more than two times. Data obtained from
the interviews are summarized in Table 2 and explained in more detail as follow.
Easy to steal: The response of interview, 15 of 22 people said in a same manner, It's easy
to steal a motorcycle. There are many reasons to support this quote. The weakness of electrical
system lock is that it is easy to bypass the system to start motorcycle engine. Its mechanism of
mechanical lock is not complex and strong enough to prevent the destruction or dismantlement by
simple tools. As for electronic anti-theft device, the control module, antenna and power supply of
control module are the weakness of this lock. The comparative number of loss notification of
motorcycles and cars from Table 1 which shows that the average number of motorcycles stolen is
higher than cars by at least 10 times is a clear indication of the relative case to steal motorcycle.
Good price: Thirteen interviewees, Motorcycle can be sold easily and with high prices.
People in nearby countries need motorcycles from Thailand. In some countries, it is possible to
register vehicles by not paying attention to how the vehicle was obtained. The price of a
motorcycle in the black market (especially in the eastern border) is around 5000-20000 THB.
Low risk of being arrested: The highest numbers of interviewees 17 of 22 people said
The chance of being arrested is minimal. The theft of a motorcycle has a lower risk of arrest than
the theft of a car. Due to its smaller size and lighter weight, a motorcycle can be ridden away
quickly and is easy to hide. Moreover, it is easy to disassemble and sell spare parts to motorcycle
repair shops.
Peer pressure: There are 12 of 22 interviewers who replied, Friends pressure and group
norms are the reasons for stealing. Among teenagers, friends are important and performing
actions in order to be accepted by friends can be the force to do something illegal. If the first time
of stealing succeeds, then it may lead to more stealing.
For committing other crime: The same number of interviewees Peer pressure (12 of 22
people) said, To use stolen motorcycles to commit other crimes. In criminal circles, most
vehicles used are motorcycles because of flexibility or ease of abandonment during escape efforts
and lack of fear that the motorcycle will be used as evidence because it is a stolen motorcycle.
Motorcycle modification: One half of the interviewees (11 of 22 people) said, The stolen
motorcycle parts to modify their own. This is often case for midnight racing groups, the racers
have uncertain income or no income but enjoy modifying their motorcycles. Most of the parts are
generally obtained from stealing.
Table 2 Ranking of motivation for motorcycle theft
DISCUSSION
According to the literature, the crime is related to the economy, discrimination or social
inequality. But if we pierce down to the theft of motorcycles which is part of the crime it is found
that there is a difference. The most important motivation of motorcycle theft is not related to the
economy, discrimination or social inequality. The result of interviews showed that, Low risk of
arrest is key motivation for motorcycle theft with the highest respondents of 17 people. There are
Page 144

July 9-11, 2012
many factors that lead to "Low risk of arrest". Weight and size of the motorcycle is a first factor
that makes it easy to escape and hide. When the motorcycle is stolen, thieves will use their
expertise to escape from the police to the hiding place. Disassembly is one of the factors that cause
problems for the police. The police cannot arrest or accuse a suspect based on stolen parts theft.
Easy to steal is the second most important motivation for motorcycle. The owners will
reduce this theft motivation by the preventive measures, which include the use of appropriate
protective devices and park in a safe place. There is no protective devices that can prevent a
motorcycle completely. However, the selection of a complex mechanical lock would help. Parking
in an out of sight place will increase the chance of theft.
One limitation of this type of research is that it is difficult in an interview to get
information from the prisoner about his illegal acts. Some people were reluctant to speak but there
were many people who understood the purpose of the interview and provided information
willingly, and 4-5 people even take pride in providing data.
CONCLUSION
Motorcycle theft is a result of many motivations. Low risk of being arrested is most
important motive and the second is easy to steal. If we want to reduce the number of motorcycles
stolen, the first thing is required to reduce these motivations. To reduce the motivation of low risk
of arrest is difficult because the nature of motorcycle enables the thieves to escape and hide easily.
The best ways to reduce the opportunities for theft are parking a motorcycle in an appropriate area
where there are security guards, lighting or crowded area can reduce the chances of theft. The ease
of stealing is dependent on the quality, type and amount of the lock. There is perfect of anti-theft
lock. The time required and difficulty to steal will increase if the owners take good care and lock
their motorcycle property.
Page 145

July 9-11, 2012
REFERENCES
Felson, M. and Clarke, R. V. 1998. Opportunity Makes the Thief: Practical Theory for Crime
Prevention. Policing and Reducing Crime Unit Research, Development and Statistics
Directorate, 50 Queen Annes Gate, London.
Holly Trogdon 2006. The Unemployment - Crime Relationship (By htrogdon@hotmail.com For
Methods in Economics ECO4451 Final Paper Dr. Dickie 4/21/06)
Jan v. D. and Kristina K. 2000. Piecing Together Cross-National Crime Puzzle. National Institute
of Justice Journal
Marcelo, F. A. 2004. CRIME TRENDS IN WESTERN EUROPE FROM 1990 TO 2000.
European Journal on Criminal Policy and Research, Volume 10 (2-3), 163-186.
Muzafar Shah Habibullah and A.H. Baharom 2008. Crime and economic conditions in Malaysia:
An ARDL Bounds Testing Approach. MPRA Paper 11910, University Library of Munich,
Germany.
Richard Wright and Scott H. Decker 2002. Robbers on Robbery: Prevention and the Offender
University of Missouri-St. Louis
Page 146

July 9-11, 2012
HUO27-7
GLOBALIZATION, GOVERNANCE AND THE ROLE OF

THE STATE
Syaifudin Zakir
Department Public Administration, Faculty of Social and Political Sciences, Sriwijaya University,
Palembang, 30139, Indonesia
Email: syaifudinzakir@yahoo.com; szakir@unsri.ac.id
Abstract
Globalization plays many important roles in reshaping the meaning of government and the
implication of the state actions. In the same coin globalization influence the local policy and mobility
of capital, goods and people across the national borders, Globalization also create the new dependency
of development to the countries with the low comparative advantages, at the same time also bring the
alternative for seeking the cheap market price and labor.
Keywords: globalization, governance, the role, the state
INTRODUCTION
Globalization can be defined as the mobility of capital, goods and people across the national
borders. Globalization also can be perceived as the journey back to the future period, representative of
the open trade markets, migration and transitory production in all over the world (Phillip, 1996). In
addition, globalization acts at three levels of ideology, namely economic, politic and cultural. The
evolution of Globalization can be traced from 1970. It was the time when global capitalist economic
expansion increased dramatically. The globalization process marked firstly by the experience of oil
crises in 1973, which propelled the nation state to reschedule their development plan. Nation-state at
that time believed they could not avoid entering the global system. Because of that during 1970-1990
emerged the institutional development all over the world such as offshore banking, European
Economic Union, AFTA and GATT (now WTO).
Globalization
The process of globalization of the world economy, nevertheless, synonymous with the triumph
of capitalism and it is assumed that the western societies play a leading in this process. What marks
the process of globalization is off from the perspective of dependency, which judged the expansion of
capitalism, has marked the division between the developed (north) and underdeveloped (south), now it
is no longer applicable. The capitalism now is embedded into the world system that propels every
nation-state to involve in globalization. Even in the concept has proposed by the very well known
phrase of Washington Consensus. Recently, the fast movement of rivalry of this consensus in the
name of anti-globalization has run world wide since the consensus also bring the impact of
dissatisfaction amongst anti-globalization protestors, developing country politicians and officials,
Page 147

July 9-11, 2012
trade negotiators, and numerous others. It is often used interchangeably with the phrase neoliberal
policies. (Williamson, 2002).
Globalization is a term used to describe the acceleration and intensification of economic
interactions through increasing internationalization of production, distribution, and marketing of
goods, services and information. The basic ingredients of globalization can be summaries as industry,
investment, individual, and information. In the twentieth century, the transaction cost for the
international trade decreased not only because of technological advancement, but in addition because
of a wave of deregulation and cooperation among many countries. In particular, the costs of
transportation and communication have fallen significantly, which have been conducive to creation of
the new world economy. Globalization is shaping new economic and socio-environmental setting at all
levels with profound implications for developments (Varizi and Sharif, 2003).
On the other hand, globalization is in the core interest of multinational enterprises, though
their possibilities to influence and control the process are not so great as is often assumed; the
direction and intensity of the globalization process are determined above all by the decisions of
influential national government and international organizations, which initiate economic policy
measures (compliance with minimum standards), formulating important framework conditions and in
this way seeking to control and shape these processes. The social impacts of these processes and the
responses to them of those affected are both highly complex and contradictory in nature. Some see
here the emergence of undreamed changes, other sees them at the mercy of a development in which
familiarity with the framework and the agenda given until now is being lost (Sassen, 2003).
The Paradigm Shift of Governance Concepts
The notion of paradigm arises from the world of Khun (1970). He opposes the conventional
wisdom that, in the natural sciences, knowledge accumulates gradually and constructed from
individual perspective. To explain the concepts of paradigm, Khun used the historical approach.
According to him, history as a repository of facts, theories, and methods collected in the previous and
current texts, could produce a decisive transformation in the image of science by which we possess
right now. Historian, in the other hand, appears to have two main tasks. First, it determines what man
and at what points in time each contemporary scientific fact, law and theory was discovered or
invented. Second, the history also will describe and explain the congeries of error, myth and
superstition that have inhibited the more rapid accumulation of the constituents of the modern science
text.
As the time goes by, it is becoming harder for the historian to fulfill their task in the concepts
of development by accumulation, which assigns to them. Simultaneously, historian also confronts
growing difficulties in distinguishing the scientific component of past observation and belief from
what it already perceived as myth and superstitions. The result of all these doubts and difficulties is a
historio-graphic revolution in the study of science. They attempt to find the historical integrity of that
science in its own time. Furthermore, they insist upon studying the opinions of that group and other
similar ones from the viewpoints that gives those opinions the maximum internal coherence and the
closest possible fit to nature. Indeed, the historical study can possibly effect the sort of conception of
science and also it is a purely descriptive discipline.
Page 148

July 9-11, 2012
Those remarks above permit as to consider the concepts of paradigm shift or scientific
revolution as Khun mentioned. The scientific revolutions or paradigm shift is the non-cumulative
developmental episodes in which the older paradigm is replaced in whole or in part by incompatible
new one (Khun, 1970 p.92). He also added the paradigm shift related to the discoveries or invention of
new theories. There are in principles, only three types of phenomena about which a new theory might
be developed (Khun, 1970 p.97). The first consists of phenomena already well explained by existing
paradigms, and these seldom provide either motive or point of departure for theory construction. The
second class of phenomena consists of those whose nature is indicated by existing paradigm but
whose details can be understood only through further theory articulation. These are the phenomena to
which scientific direct their research much of the time, but that research aims at the articulation of
existing paradigms rather than at the invention of the new ones. The third of phenomena is the
recognized anomalies whose characteristic feature is their stubborn refusal to be assimilated to
existing paradigms. This type alone gives rise to new theories.
Khun also portrays that the paradigms shift as the route to normal science. There are several
stages, in order to reach the normal science: first, there is non-guided, more or less random collection
of facts, which leads into the second, pre-paradigm stage, where school compete with one another to
have their view of a discipline, and their interpretation of the data, accepted by others. At the third
stage, one paradigm triumphs and this, in turn, leads to the stage of normal science, which is
characterized by a general acceptance of an underlying world view, its associated norms and values
and its method to solve the problem (Harisson 1988 p.164)
The transposition of paradigm to other paradigm cannot be made a step of the time, it must
occur all at once or not at all. The transfer of allegiance from paradigm to other paradigm is a
conversion of experience that can not be forced. From that explanation, we can understand that the
new paradigm shift is not just the refusal of the old paradigm, in addition to that, the new paradigm
also can embraced the old paradigm and form the new concepts which have better explanation than
before.
DISCUSSION
The Concepts of Governance (New Dependency theory)
Dependency perspective emerged in the early of 1960, because of the failure of ECLA to
improve the economic condition of Latin America. The other concept that influenced the dependency
perspective was the neo Marxist view. The Neo-Marxist saw that imperialism occurred in the Third
world countries, so the third world needed to advocate instant revolution, and development of
peasantry in the countryside. The dependency perspective treating the dependency of the third world
to western countries as the general, external, economic process that leads to regional polarization and
underdevelopment.
The new dependency perspective, in the other hand, has modified some basic assumption of
the classical dependency perspective. Thus the new dependency perspective has put forward many
new concepts. One of the concepts was the triple alliance between the governance, the bourgeoisie and
the multinational corporation. Related to those contexts, ODonnel (1978) observed that there was an
emerging of Bureaucratic-Authoritarian State in Latin America countries. However, unlike the
traditional authoritarianism and Fascism. The Bureaucratic-authoritarian state has possesses some
Page 149

July 9-11, 2012
characteristics: dominance of bureaucrats, political exclusion, economic exclusion, depoliticization,
and deepening of dependent capitalism.
The emergence of BA governance came from the condition of economic and political crises of
dependent capitalism in Latin America countries in the post war era. The deepening of
industrialization has colored the development in these countries; this deepening industrialization has
triggered the social movement from the working classes. These working classes asked for higher
wages, tighter control of foreign corporation and higher taxes for the rich. In order to maintain the
situation, in which the governance can still maintain their relationship with the multinational
corporation and the upper class, the military bureaucratic elite had to solve the crisis by instituting the
BA State or governance.
From the viewpoint of authoritarian model, the BA State or governance is more likely to
pursue egalitarian development policies than are democratic regimes. Central of this argument is the
contention that authoritarian regimes may do better job of protecting the interest of the poor and the
working classes in developing societies than the democratic can. It is because the available politics
rights and their expression through electoral can not be taken advantage of by the more disadvantaged
elements of the society. In the other word, inequalities in the distribution of material resources are
reproduced in inequalities in political influence.
Taking from that perspective, ODonnel argued that even though for the first stage, the BA
state or governance limited the civil society movement, but after the BA state has consolidated its
power, the BA state thus open up again toward civil society. Although the authoritarian perspective
has some advantage to protect the interest of the poor, but in practice many of authoritarian countries
failed to do so. Taking example from the Latin America countries, many of authoritarian governance
fall into deep dependency to foreign debt. The other factors that influence to the failure of
authoritarian model is the prerequisites from the World Bank and IMF. As we all know, many of Latin
America Countries has fallen into deep obligation to the World Bank and IMF. One of the conditions
that the authoritarian governance had to fulfill is democracy, in order to get the loan from them.
Related to that, the other section will explain the emerging of democracy model in the third world
The Concepts of Governance (Leftwich)

The modernization theory asserted that democracy is the prominent outcome of socioeconomic development, and not as a condition of it. Democracy in this term related to the high level of
literacy, communication and education, established and secure middle class, a vibrant civil society,
limited social inequalities. The evidence of development in western countries has proved and certainly
sustains this view. The modernization theory, in addition, have underline that democracy is a
consequence of development. However the critics argue that democracy and development are both
compatible and functional for each other. They also argued that a slightly lower rate of growth is an
acceptable price to pay for a democratic polity, civil liberties and good human right record.
The assertion of good governance and democracy is not just desirable, but also it is the
essential factor condition for development of all societies. Taken together, democratic good
governance refers generally to political regime based on the model of a liberal-democratic polity,
which protect human and civil right, combined with a competent, non-corrupt and accountable public
administration. In addition, the notion of good governance has been taken from democratic model.
Page 150

July 9-11, 2012
From this view, democracy is perceived to facilitate equality indirectly because economic
development itself is argued to aggravate inequalities.
The concepts of good governance began seriously in 1980s because of the experience of
structural adjustment lending, the resurgence of neo-liberalism in the west, the collapse of official
communist regimes and the rise of pro-democracy movement in the developing countries and
elsewhere.
The experience of structural adjustment in the 1980s.
Structural adjustment is the term that used by the World Bank and IMF to overcome the problem
of developmental stagnation by promoting open and free market economies, supervised by
minimal states. However this strategies has been so political because its involving profound
change in the bureaucratic system of the governance.
The political influence of the neo-liberalism
For the promotion of the economic adjustment in the third world, the neo-liberalism theorists
suggest and emphasize on the market deregulation, privatization, supply side economy and
encouragement of individualism and the enterprise culture. The neo-liberalism also emphasizes
on functional theory of politics, which links its concern with the market and economic growth to
its concern with democracy. It assumes that the democratic politics is also necessary for a thriving
free market economy and vise-versa.
The collapse of communism
The fall of communism indicated that the liberal economic theory of communist states was unable
to produce sustained economic growth, and their political structure prevented the economic
change. The collapse of communist regimes enabled the western government to exercise the
political leverage without fear of giving advantages to Soviet Unions and its allies. Even recently
the China Miracles become the main discourse among the economic development phenomena.
The impact of the pro-democracy movements
The pro-democracy movement in several countries also promotes the democratization in a host
country such as in Philippines, South Korea, Bangladesh, Indonesia and many other regime
countries.
ACKNOWLEDGEMENTS
In the global context, the concepts of pronouncement on governance, democracy and the
relationship of either or both to development have three main components: systematic, political and
administrative.
First, the concept of governance is wider than that conventional term of governance concept.
The conventional concept refers to the formal institutional structure and location of authoritative
decision making in the modern state, whereas the broad view, the governance refers to a looser and
wider distribution of both internal and external political and economic power. It also refers to a system
of political and socioeconomic rules by which the productive and distribution of life of the society is
governed.
Second, in term of political sense, good governance implies the state enjoying both legitimacy
and authority, derived from a democratic mandate and clear separation of legislative, executive and
judicial powers.
Page 151

July 9-11, 2012
Third, from the administrative view of point, the governance means an efficient, open,
accountable and audited public service which has the bureaucratic competence to help design and
implement appropriate policies and manage whatever public sector there is.
However, the relationship between the democracy and development is not necessary based on
the real facts that happen in the state. These facts start from the hard fact that both democratic and
non-democratic states have been able to generate high levels of economic development. The facts also
generate the idea that it is not the combination of liberal economies and democratic politics, which
will determines developmental outcomes but the manner of their interaction. From that, some
condition has to be fulfilled for enduring democratic politics, namely:
The geographical, constitutional, and political legitimacy of the state is essential.
Democratic politics in any legitimate polity presuppose a secure and broadly based
consensus about the rules of political games.
Sustaining democratic politics also depends on governmental restraint on the extent of
policy change undertaken by the winning party or parties
A rich and pluralistic civil society
There is no serious threat to the authority and power of the state such as private
armies.
Democratic politics has not been easy to sustain in societies divided by regional
tensions or ethnic, cultural or religious pluralism, especially where this is compounded by real
or perceived material inequality.
Deepening economic will not help the condition for democratic endurance.
The Role of the State
Look at the J.P. Nettls classical articles 1968, as he was convinced that stateness as the
system of public authority in which other kinds of institutions (parties in Britain, the law and legal
institution in the US) were salient, while another debate are less about the form of public institutions
than about the extent to which private power can (or should) be checked by public authority.
Reinvigorated political faith in the efficacy of markets combine with a rediscovery of civil society
creates a charismatic set of substitutes for public institutions and corresponding set of arguments for
the eclipse of the state.
The changes of the state role, from the National State to the Global State/Regional structure
make the term of eclipse of the state seem will be occurred and thus for further will be weaken the
state itself. Because in the globalization the national agenda is depended on or at least must be in
accordance with the global agenda and resources. At the other hand the emergence of civil society and
the business group will produce the more complex structure and the complex issues that must be faced
by the state such as: Cross border original cooperation, the discovery of city and industrial zone, and
the changing scale of the politics. In another words the globalization has a direct effect to the role of
the state as a challenge to the sustainable development, since governments everywhere are losing
control over decisions within their countries as global economic and communications forces directly
affect the citizens (Lubbers, 1999).
Page 152

July 9-11, 2012
In a broad meaning globalization also threat an overall decline in ability of national
governments, intergovernmental organizations to maintain and improve the standards of living,
because of its effects on:
1. Create the deficit of security: cross-border crime, inability of government to
respond the civil violence in other countries, even the terrorism.
2. Deficit in social: increasing the inequality (within and between countries) in
incomes and in ability to use the technology.
3. Deficit in environmental.
4. Deficit in democratic: national leaders have difficulty building public support for
cooperation on complex global issues (Kyoto Protocol); and there is no global parliament (sovereignty
of the people).
The state role in the globalization will not be eclipse if the state/governance can create:
1. The symbiosis of governments, business, and civil society. On the other hand to
faced the external threatens the state must perform the most economically and perform the competitive
advantage in the global economy (Lubbers, 1999).
2. In political economy policies, it is necessary to create the maximize efficiency
(welfare) policy that required an active, competent state that is able to secure the compliance of other
states with its rule (Evans, 1997).
3. Strong state that constructed by the strong civic association associated with
effective public institutions, or state organization and civil society (Putmans and Chazan in Evans,
1997).
Alternative Development Discourses
Globalization has deconstructed the development discourses in the theory of development
through utilized in the explaining development; representation and images in development; and
constituted the historical of development based on the facts:
Based on the level of analysis, the globalization process occurs in global or world level.
Based on the capability of citizen, goods, capital movement, the globalization process tends to
open global movement, widely. In this case because the borders between nation states are blurred,
these movements can easily occur.
Globalization processes include the changing of the bi-polar world into the uni-polar world. The
fall of communism indicated the triumph of neo-liberal capitalism. But on the other hand, the
globalization also marks by the rise of civil society. The civil society works on the global level
facing the triumph of capitalism and broke down the monopoly of capitalism. The modernization
process has neglected the possibility of the emerging of the civil society.
On the developmental framework, the globalization process has moved into the sustainable
development. This process perceive that environmentally sound economic development, which
entails the almost impossible attempt to make capitalism models of development compatible with
the environment concern.
On the political sphere, the globalization process has moved beyond the modernization process.
The globalization tends to create the global governance, which concern how the world
Page 153

July 9-11, 2012
governance correlated together to live in realm of capitalism, whereas in modernization process,
the governance only concern in national level.
Globalization as the stages era of modernization is often discussed but seldom defined
phenomenon at the broad level. Globalization is an increase in the impact on human activities of
forces that span national boundaries. These activities can be economic (changing the natures and
qualities of five economic dimensions; trade, finance, aid, migration, and ideas), social, cultural,
political, technological, or even biological, as in the case of disease. Globalization also considered as
the dimension of fighting global poverty through encompassing the development policies that reflect
major measurements of income, health, education, empowerment, and working condition. These
notions really need the international agreements, institutions, and key players (Goldin and Reinert,
2006: p 2-16)
Page 154

July 9-11, 2012
REFERENCES
Evans, Peter B. 1997, The Eclipse of the State? Reflection on Stateness in an Era of Globalization,
John Hopkins University Press, USA.
Goldin, Ian and Kenneth Reinet, 2006, Globalization for Development, Trade, Finance, Aid,
Migration, and Policy, The World Bank and Palgrave Macmillan, Washington DC, USA
Inkeles, Alex and Larry Sirowy, 1991, The Effects of Democracy on Economic Growth and Inequality,
in Development and Underdevelopment, London, Lynne Rienner Publishers.
Kuhn, Thomas S., 1970, The Structure of Scientific Revolutions, The University of Chicago, USA.
Lipset, S.M, 1981, Economic Development and Democracy, p.27-63, in S.M. Lipset, Political Man,
Garden City, N.Y: Anchor
Lefwich, Andrian, 1993, Governance, Democracy and Development, London, Rouledge.
Luubers, Ruuds, F.M., 1999 Globalization, Governance and Sustainable
Globus,Netherlands.Available from: URL:
http://old.mgimo.ru/fileserver/2004/kafedry/mirec/konf_2-12-05/primarysecondary_globaliz.pdf
Development,
Marsh, Ian, 2000, Sociology: Making Sense of Society, England, Prentice Hall.
Martinussen, John, 1997, Society, State and Market, Zed Books Ltd, London& New Jersey
McClelland, David. 1964, The Business Drive and National Achievement, p.161-173 In Amitai
Etzioni and Eva Etzioni (eds) Social Change, New York, Basic Books.
McMichael, Philip, 1996, Development and Sosial Change: A Global Perspective, New York, Pine
Forge Press.
Preston, P.W., 1996, Development Theory An Introduction, Blackwell Publishers, Oxford, UK.
Sassen, Saskia, 2003, How Globalization Changes the Role of the State, University of Chicago
So, Alvin Y, 1990, Social Change and Development: Modernization, dependency, and World System
Theories, United States, Sage publication.
Sharif, Varizi Manouchehr and Rassafi, Amir Abbas, 2003, Globalization and Sustainable
Development: European Experience, Sharif University of Technology, Iran
Williamson, John. Did the Washington Consensus Fail? Outline of Remarks at CSIS. Washington
DC: Institute for International Economics, November 6, 2002. Available from: URL:
http://www.cid.harvard.edu/cidtrade/issues/washington.html.
Page 155

July 9-11, 2012
HUO167-8
PROBLEM OF QUALITY MANAGEMENT IN SMALL AND

MEDIUM ENTERPRISES
Anil Kumar
Associate Professor, Haryana School of Business,
Guru Jambheshwar University of Science & Technology, Hisar 125001 (Haryana),India,
Email: anil_k6559@yahoo.co.uk
Abstract
This paper examines the problems of quality management faced by entrepreneurs of small
and medium enterprises. A sample of 350 entrepreneurs has been taken from the five States of
Northern India i.e. Haryana, Punjab, Rajasthan, Himachal Pradesh and National Capital Region
(NCR). Questionnaire containing various aspects relating to problems of quality management of small
and medium enterprises on Likert type five degree scale was administered to entrepreneurs of small
and medium enterprises. The data has been classified on the basis of experience of entrepreneurs.
Factor analytical technique and one way analysis of variance have been applied to analyze the data.
The factor analytical technique has reduced the fifteen statements into four factors. These are related
to lack of competencies in quality management, difficulty to adopt acceptable quality standard, lack of
quality commitments and lack of planning and resources. Analysis of data highlights that there exist
significant variations between experience of entrepreneurs and first, third and fourth factors relating to
problem of quality management emerged from the factor solution. The entrepreneurs should go for the
regular training programs in the area of quality management in addition to other areas of management.
Institutions involved in the entrepreneurship development should lay more emphasis on this emerging
area. There should be constant interaction between the industrial organizations of large, medium and
small enterprises. It will help the entrepreneurs of small and medium enterprises to learn the various
aspects of quality management. The reason being, improvement in quality management is a long term
process and only way to bring quality improvement is to bring innovations in all areas of management.
Moreover, all this process will bring improvement in managerial commitments in the area of quality
management
Keywords: quality, training, planning, resources, compensation
small and medium enterprises is the problem

INTRODUCTION
of quality management. Quality management is
The contribution of small and medium
the system of establishing defect prevention
enterprises in terms of its role in gainful
action and ensures within an organization on a
employment opportunities, reduction in
permanent basis for the purpose of conforming
regional inequalities, income distribution and
products or services. The objective of quality
solution to various socio-economic problems is
management is to quickly produce safe
being recognized in all economies of the
products, with low cost, and to customer
world. But at the same time small and medium
satisfaction. Lakhe (1994) highlighted the
enterprises are facing large number of
role of training at
the initial stages in
problems in the era of new economic regime.
implementation of TQM. It is necessary to
One of the main challenges faced by these
Page 156

July 9-11, 2012
understand TQM philosophy and requirement
for the coming future to achieve regarding
quality goals. Hemsworth (2005) examined the
significance of benchmarking
in
implementing
of
quality
management
practices. Mohammad (2006) observed many
factors
responsible
for
successful
implementation of TQM in business
organizations. Support and commitment of top
management, effective and strong leadership,
strategic quality planning, communication
process in the business organization,
understanding of the vision and mission,
quality goals of the organization, training and
education,
effective
human
resources
management,
employee
empowerment,
employees commitment and voluntary
participation are major factors. Randy (1998)
observed that to be effective in quality
management, employee should be given
power, information, knowledge and rewards
for their contribution in business performance.
Salaheldin (2009) observed that the lack of
support from top management was the biggest

problem impeding the implementation of QCs
(quality control).
MATERIAL AND METHODS:
The objective of the study is to analyze
the problems faced by the entrepreneurs of
small and medium enterprises in the area of
quality management.
To achieve this
objective, five States of Northern India i.e.
Haryana, Punjab, Rajasthan, Himachal Pradesh
and National Capital Region (NCR) have been
taken for the study. To analyze the various
types of obstacles regarding the implementing
quality management, a sample of 350
entrepreneurs have been selected from the five
States of Northern India. A Questionnaire
based on Likert type five degree scale from to
a great extent to not at all was developed and
administered to the entrepreneurs of the small
and medium enterprises.
Factor analytical
and one way analysis of variance techniques
have been used to analyze the data.
RESULTS AND DISCUSSION:

Table 1. KMO and Bartletts Test
Kieser-Meyer-Olin Measure of
Sampling Adequacy
Bartletts Test of Sphericity
.793
Approx. Chi-Square
df
Sig.
Cronbachs alfa=0.931
7595.657
105
.000
The Table 1 highlights the results of Kaiser-Meyer-Olkin (KMO) and Bartletts test of
sphericity. The KMO test measure of sampling adequacy equal to 0.793 vividly reveals that data is fit
for factor analysis.
Bartletts test of sphericity (7595.657)
further corroborates our findings. The value of
Cronbachs alfa is 0.931.The naming of
factors and their explanation have been

given in the table 2.
Page 157

July 9-11, 2012
Table 2: Naming of factors
Name of factor
Name of statement
Lack of competencies in
quality management
Lack of training to
implement
quality
management
.829
Lack
of
relevant
information to identifying
potential areas of quality
improvement
Lack of a company-wide
definition of quality
Lack of competencies to
implement
quality
management
Frequent turnover of
employees
Lack of knowledge
Geographical distances
from suppliers
.836
Difficulty
acceptable
standard
Lack
of
commitments
to
adopt
quality
quality
Lack of planning and

resources
Factor loadings
Eigen Value
4.019
.863
.585
24.154
3.623
21.731
3.260
15.091
2.264
.762
.750
.647
.646
.779
.715
.911
High
cost
of
implementation
Inadequate resources to
employee TQM
.817
.826
There is no joint planning

with supplier
of
.724
Quality is not defined by

the
customers
and
suppliers
No benchmarking of
other companies practices
or product
Work overloads
Problem
of
time
constraint
Compensation is not
linked with quality goals
Lack of competencies in quality

management (F1):
It is an important factor which
accounts for maximum percentage of
variance equal to 26.792. Four statements
have been loaded on this factor. The loading
of four variables indicates that lack of
competencies in
Per cent
variance
26.792
.803
quality management is one of the hurdles

of
entrepreneurs
to
adopt
quality
management in their organizations. These
four statements have eigen value 4.019. The
eigen value more than 4 further shows that
this factor needs consideration by the
entrepreneurs. It is becoming more
important in the era of free market
Page 158

July 9-11, 2012
economies. The entrepreneurs should
develop competencies to adopt quality
management in their enterprises It will help
them in giving company wide definition of
quality. This process will help the
entrepreneurs to indentify the potential
areas of quality management
Difficulty to adopt acceptable quality
standard (F2):
The second factor, which accounts
for 24.154 per cent of variance consists of
six statements and has been designated as
difficulty to adopt acceptable quality standard.
The eigen value for these six variables is
3.623. It is only through
enhancement of
knowledge and information that quality
management program can be more successful.
The entrepreneurs
of small and medium
enterprises should get feedback from their
employees and customers on the various
issues relating to quality management in
their organizations. It will also help the
entrepreneurs
in
providing
proper
instruction to their suppliers and quality
managers.
Lack of quality commitments (F 3):
The next factor in terms of
importance consists of three statements and
has been termed as lack of quality
commitments. These factors account for
21.731 per cent of variances explained. The
eigen value of these three statements is
3.260. Eigen value more than three further
highlights that lack of quality commitments
factor acts as hurdle for the entrepreneurs of
small and medium enterprises. The
entrepreneurs should design the whole
production process matching appropriate
quality standards by providing higher
budget and time resources to achieve
desirable targets. This all requires more
resources
and
improved
managerial
commitments in terms of time and cost
towards achieving the better results of
quality management.
Lack of planning and resources (F4):

The fourth factor, which accounts
for 15.091 per cent of variance, consists of
two statements. This factor has been
designated as inadequate planning and
resources. The eigen value for these two
statements is 2.264. Eigen value more than
two further highlights that significance of
this factor in the area of quality
management. The entrepreneurs must go for
adequate planning in order to overcome the
various obstacles in the area of quality
management. Resources needed for quality
improvement be provided to entrepreneurs
by the financial institutions on the liberal
terms and conditions.
Table 3: Experience-wise one-way ANOVA
results
Name
factor
of F-value
d
f
Level
of
significanc
e
.042
Lack
of 2.755* 3
*
competencies
in
quality
management
.049
3
Difficulty to
adopt
acceptable
quality
standard
Lack
of 2.902* 3
quality
*
commitment
s
Lack
of 3.339* 3
*
planning and
resources
Note: ** indicates 5 per cent
significance
Page 159
.986
.035
.020
level of

July 9-11, 2012
The table 3 shows result of one way
analysis of variance with the experience of
entrepreneurs. Experience of entrepreneurs
and all the factors relating to problem of
quality management emerged from factor
solution except second factor i.e. difficulty to
adopt acceptable quality standard found to be
statistically at 5 per cent level of
significance. It shows that experience of
entrepreneurs
influence
the
quality
management of the enterprise.
FINDINGS:
The foregoing analysis reveals that
factor analysis has reduced the various
problems relating to quality management into
four factors. These are lack of competencies in
quality management, difficulty to adopt
acceptable quality standard, lack of quality
commitments and lack of planning and
resources. The entrepreneurs should go for the
regular training programs in the area of quality
management in addition to other areas of
management. Training will help the
entrepreneurs to enhance their competencies in
the area of quality management Institutions
involved in the entrepreneurship development
should lay more emphasis on this emerging
area. There should be constant interaction
between the industrial association of large,
medium and small enterprises. It will help the
entrepreneurs of small and medium enterprises
to learn the various aspects of quality
management. The reason being, improvement
in quality management is a long term process
and only way to bring quality improvement is
bring innovations in all areas of management.
Moreover, all this process will bring
improvement in managerial commitments in
the area of quality management.
Page 160

July 9-11, 2012
REFERENCES
Hemsworth D. 2005. Determining the Impact of Quality Management Practices and PurchasingRelated Information Systems. The journal of Enterprise Information Management, 18:169194.
Lakhe, R. R. and Mohanti, R.P. 1994. Total Quality Management Concepts, Evolution and
Acceptability in Developing Economies International Journal of Quality & Reliability
Management. 1: 9-33.
Mohammad, A. R. M. 2006. The Impact of Organizational Culture on the Successful
Implementation of Total Quality Management. The TQM Magazine, 18: 606-625.
Randy, K. C. 1999. Employee Involvement in Total Quality Management Programme: Problems
in Chinese Firms in Hong Kong. Managerial Auditing Journal, 14: 8-11.
Salaheldin, I. S. 2009. Problems Success Factors and Benefits of QCs Implementation: A Case
of QASCO. The TQM Journal, 21: 87-100
Page 161

July 9-11, 2012
HUO52-10
Preparing Thai University Library Facilities and Services for

ASEAN Students from Neighboring Countries
Qualitative Research of Cambodian Students Perception
Kimcheang Hong *, Samonya Thawinyarti*, Suphapipat Wannasiri*,
Assoc.Prof. Rana Pongruengphant**, Ph.D, Hermann Gruenwald, Ph.D**
Burapha University, 169 Long-Hard Bangsaen Road, Saensook, Meung, Chonburi 20131
Email: samon_ya@hotmail.com
ABSTRACT
With the advent of the ASEAN community approaching in 2015, Thailands universities
are preparing to better serve the increasing number of foreign students from neighbouring ASEAN
countries. To this point we conducted qualitative research with undergraduate Cambodian students
studying in Thailand as participants. In-depth focus group open ended interviews with follow-up
probing collected the perceptions of the foreign students in regards to their satisfaction with library
facilities and services. The study took place at a prestigious Thai university serving the eastern
seashore part of Thailand with an international reputation far beyond. The study can be easily
replicated at other institutions of higher education with various domestic and international student
populations. The collected in-depth data was audio visual recorded and subscribed following a
grounded theory approach of cataloguing and analysis, resulting in sample statements and
summaries. The four main categories addressed were: Library Circulation, Consultation and
Reference Librarian, Library Facilities, and IT Services. The foreign students associated these
functionalities with the university library as they were located in the library building. Basic library
service satisfaction is high despite language barriers and unfamiliarity with the system. In order to
satisfy the basic needs of foreign students the university libraries take on the roles of university
bookstore (textbooks), university food services, Student union, university IT-Services (computer
center) and university housing (dormitory). University library facilities are not designed for this
and may be ill equipped to serve these combined functions which fall under student life and may
be better served through other venues on or off campus. The study contributes to the body of
literature beyond university library system/facilities satisfaction to international student services
and changing university student life in light of the ASEAN community.
Keywords: ASEAN foreign students, university library perception, qualitative grounded theory
research, Thai University
*
Doctoral Students, Innovative Administration and Educational Leadership Center, Burapha

University.
**
Assoc.Prof. Rana Pongruengphant, Ph.D, Dean of International College, Burapha University.
**
Hermann Gruenwald, Ph.D, Lecturer of International College, Burapha University.
Page 162

July 9-11, 2012
INTRODUCTION
Libraries have changed significantly
from storerooms for books and journals to the
powerful resources of knowledge and
information since the middle of the 20th
century. The very success of library services is
dependent on user satisfaction. Users are
getting satisfied when the library is able to
respond their actual needs and expectations. A
quality service is said to be one, which satisfies
the users expectations resulting in a positive
experience. Throughout the history, libraries
were mainly concerned with collection
development and processing. (Lewis, B.R.
1991) The library professionals gave less
concern to quality in product and services never
checked whether the users were satisfied or not.
Gradually the socio-economic changes have
prompted the libraries to improve their services.
The staff has a vital role in the satisfaction of
users. The library being a service organization,
its prime objective is to provide the right
documents, information, services, and other
academic resources to its users.
To understand whether library
performance is paralleled with users needs, an
assessment of users satisfaction or perception
is required (Bavakutty, M. and Majeed, K.C.
Abdul, 2005.) This is crucial because the result
of the assessment of library service quality
provides an important feedback which could
help improve its service to its users ( Filiz,
2007). Moreover, service provision could result
in better achievement of students, as students
use the library for academic purpose (Hebert et
al., 2006), library resources and services have a
significant effects on library users educational
outcomes (Whitmire, 2002;
Nagata et
al.,2007). Nevertheless, students perceptions
about libraries seem to have been largely
ignored by library management in developing
countries.
At Burapha University (BUU),
where the number of both Thai and
international students from the ASEAN
community keep increasing from year to year,
the university has developed itself into one of
the best institutions of higher education in the
eastern part of Thailand. With this
development, the utilization of academic
resource has been noticeably increased by both
local and international students. However, the
level of ability to utilize the library services is

not the same among students from different
countries. Thai students who are more familiar
with the domestic library system may be able to
take greater advantage of the existing system
than international students who are less familiar
with the library system. This may result in
different levels of expectations towards the
library services from different groups of library
user.
According to the 2012 annual report of
HRH princess Maha Chakri Sirindhorns
project, the number of Cambodian students
who are granted royal scholarships to study at
BUU has been increasing in recent years. These
students are required to maintain certain levels
of academic excellence. To meet this
requirement, students have to utilize all types of
academic resources effectively; as selfmotivated learners they obtain knowledge by
heavily utilizing all the services housed in the
library building. However, the perception of
Cambodian students of the library services
remains unknown as no study has been
previously conducted to measure their
perceptions and recommendations. Having
Cambodian students as the respondents of this
study is very significant for the ASEAN
community, as these students will serve as a
relevant reference on what library services are
being perceived as being beneficial to foreign
students from neighboring ASEAN countries.
Therefore, this study aims to investigate
Cambodian students recommendations for
services associated with the university
library at Burapha University and the greater
impact on student life on campus as well as
higher education in ASEAN.
METHODOLOGY
This qualitative research study
explores Cambodian students perceptions for
the BUU library and helps to prepare Thai
university library facilities and services for
ASEAN students from neighboring countries.
The qualitative study used a focus groups
approach with open ended questions followed
up by probing to collect the users perceptions.
Therefore, the design of this research study
employed a qualitative instrument with the
Page 163

July 9-11, 2012
interviewers as the primary research instrument
with grounded theory assisting in the analysis.
Participants
The participants of this study consisted
of undergraduate Cambodian scholarship
students who are the recipients of a scholarship
program from Her Royal Highness Princess
Maha Chakri Sirindhorn and are studying in
various undergraduate degree programs at
BUU, Thailand. The participants consisted of
fifteen Cambodia male students who are in
their second year at BUU working towards
graduation in two years. Their ages were
between 19 and 22 years and they all live on
campus in university housing. All
participants were selected using convenient
sampling techniques based on a voluntary
basis.
Research Procedure
There are four phases in this research
procedure. The first phase involved secondary
research in form of a study of BUU library
document, theoretical concepts and an in-depth
literature review. The second phase was
concerned with the development of research
instrument, namely guided open ended
questions for the focus group discussion. The
third phase was the field work in which data
was collected through audio and video taped
focus group discussion. The fourth phase
concerned analyzing the data using grounded
theory procedure to summarize the findings and
writing them up.
Research Instruments
The instrument used in this study was
an in-depth focus group interview which had an
open ended format. Eight guided questions
were developed to elicit the information from
participants regarding four aspects related to the
library namely library circulation, library
consultation and reference librarian, library
facilities, and IT services.
Data Collection and Analysis
To get the insightful data, researchers
first explained the participants the purposes of
the in-depth focus group open ended
discussion. Researchers also informed
participants about confidentiality issues, and
asked them if they had any concerns before
agreeing to the terms of the interviews and
being video and audio tape recorded. When the

focus group discussion was organized, one
researcher acted as a mediator and another
worked as a note taker. Researchers used
discussion guidelines to elicit strength and
weakness of services, and suggestion to
improve the library services. To obtain all
needed data, the discussion was both audio and
video recorded. Following data collection, the
raw data was transcribed and analyzed using
several qualitative statistical techniques
according to grounded theory: descriptive
statistic, coding and content analysis.
FINDINGS
The findings of the study can be
summarized into four main areas: Library
circulation, Library Facilities, and IT Services.
First, students typically found the
library circulation service very helpful in
meeting their needs. They reported to be using
library books as required reading for their
courses, particularly in subjects such as Thai
language, mathematics, physics, electronics,
computers and environment. Also, they were
satisfied with the selection of books as they
were most current and could provide them with
up-to-date information and knowledge. They
viewed that using library circulation helped
them to reduce their reading material expenses.
Although students in general reported
satisfaction with the library circulation system,
they also expressed their concerns with the
limitations of the circulation material, such as
insufficient number of English textbooks. There
are frequently no books on the shelves even the
database indicated that the books are in the
library.
Second, students reported that the
librarians are friendly. The librarians usually
provide students with guidance mostly
concerning library regulation. Students further
viewed that the communication with librarians
helps enhance their Thai language proficiency.
On the other hand, students never ask librarians
for help when they encounter problems. Instead
they sought for assistance from their fellow
senior Cambodian students.
Third, students found the library
facilities as a comfortable place to study. Of all
floors, students preferred the ground floor the
most as it is open 24 hours and it can be used as
Page 164

July 9-11, 2012
place for discussion with friends. In addition,
they considered the sixth floor as the best place
to study due to its modern facilities. Likewise,
they said that third floor is good for individual
studies as it provides many study carols. Plus,
students found that the small meeting rooms are
their favorite place for group discussion
particularly before exams. Interestingly
Cambodian students expressed a high
intolerance concerning odor library smell
stemming from books enhanced due to the
proximity to the ocean. The second floor is also
heavily used and therefore overcrowded prior
to exams.
Fourth, students reported to greatly
appreciate the information technologies
services of the library. They are really positive
about the free internet service provided by the
library. First, library internet speed in general is
fast and available 24 hours. Second, using the
internet helps them to be able to access all
kinds of electronic resources. Furthermore,
desktop computers, virtual library, and other
learning technologies, such as audiotapes, CDs
and DVDs are quite attractive and provide them
with new learning experience. Nevertheless,
students did not know how to search for books
in the on-line database system as they did not
receive any training in how to access this free
service.
To sum it up, Cambodian students felt
positive about using the library services as the
library has great fast internet connection, the
latest books and journals, outstanding learning
technologies, and its great facilities provide a
comfortable place for both individual and group
studies. Nevertheless, students commented
negatively on the insufficient number of text
books, overcrowding during the examination
periods, limitation of communication between
students and librarians, and the lack of a library
orientation sessions for international students.
Additionally, students propose several
suggestions. First more textbooks and journals
in electronic format should be provided as they
believe that using informational technologies
would be a good experience and economical.
Meanwhile, students proposed that the library
database system should be updated because the
current system is difficult to use. Second, seats
and tables should be added. Third, if possible,
the library working hours should be extended
until midnight. Students similarly reported that

no place is better than the library for their
academic life. Students stated that the best time
for them to use the library is during the night
time as they are free from their regular class
time. Finally, food services on the ground floor
of the library building should be improved.
Students reported that they prefer having meals
in the library in order to save time. Also the
food provided in the library is limited and does
not meet the students demand. In addition,
students suggest a refrigerated water fountain
with free drinking water at the ground floor of
the library building.
In conclusion, the four main categories
were addressed, namely Library Circulation,
Consultation, Library Facilities, and IT
Services. Cambodian students associated these
functions with the university library as they
were located in the library building. Basic
library service satisfaction is high despite
language barriers and unfamiliarity with the
library system. In order to satisfy the basic
needs of Cambodian students, within the
university there should be enough loaner
textbooks, food services, IT-Services, and
larger meeting areas with more amenities free
of charge.
DISCUSSION
The findings were discussed into four
aspects,
namely
Library
Circulation,
Consultation, Library Facilities, and IT
Services. First, it was found that the library
circulation service was satisfactory and
appealing. Students prefer using this service
because of two reasons. First, they found that
library is a good and closest place for
borrowing books required for their courses.
Second, the library provides them with
currently published books and periodicals in
both Thai and English, students believe they
can gain up-to-date knowledge from theses
resources. These findings are consistent with
Hebert et al. (2006); Sam et al.(2005) and;
Singh & Okakwe (2011) in which students
used the library for academic purposes.
Particularly, international students were
active in reading English books to gain more
knowledge.
Second, it was found that the
students are not willing to communicate with
Page 165

July 9-11, 2012
the librarians in many cases. Students choose
to consult with friends or Cambodian seniors
when they face problems. This is due to the
language barrier. They feel more comfortable
to talk with persons whom they are familiar
with. This finding is paralleled with that of
Nimsomboon and Nagata (2003) who found
that library users seldom contact the
librarians for assistance.
Third, it was found that the library is
a comfortable place for their studies. This is
due to the fact that the library is particularly
designed for academic purposes. Also it is
centrally located on campus so that students
found it easy to access. However, book odor,
insufficient seating and noise seem to be
problematic. This is consistent with the
findings of Ahmed and Irum (2011) which
revealed that undergraduate students are not
satisfied with available facilities in the
university library. The problem with
insufficient seating and overcrowding is due
to the increasing number of students to be
handled by an aged building that was
designed decades ago.
Finally, students reported that IT is
one of their favorite free services provided by
the library. They stated that 24-hour wireless
internet and ICT facilities (virtual library)
such as DVD, desktop computers are
appealing. This finding supported that of Sam
et al (2005) and Singh &Okakwe (2011) who
found that active library users are mostly
interested in ITC. The findings are also
paralleled with the concepts of quality
service of Parasuraman, Zeithaml and Berry
(1985) who confirmed approachability and
ease of contact could satisfy customers.
However, the finding of this study indicated
that internet was sometimes inaccessible.
This problem may have resulted from many
concurrent users particularly, just prior and
during the examination period.
In summary the students suggest that

the library facilities should be upgraded:
more textbooks added, food services
increased, IT-Services enhanced, and larger
meeting areas with more amenities free of
charge. Historically university library
facilities were not designed for all this and
may be ill equipped to serve these combined
functions which fall under student life. In
particular international students needs may
be better served through other venues on
(student union, international dorm, bookstore,
textbook/computer loaner, etc.) or off campus
(convenient store, restaurant, wireless service
provider). The study contributes to the
body of literature beyond university library
system/facilities satisfaction to international
student services and changing university
student life in light of the ASEAN
community.
RECOMMENDATIOIN
The findings from this study generated
some recommendations for further studies. It is
recommended that future studies should extend
to investigate a broader sample of ASEAN
students in order to gain a better understanding
of students expectations on library service.
Also, since the findings of this study are
relevant to its own context, it is remarkable to
conduct further research studies in other
contexts, such as with other participants of both
genders from other countries and at other
university locations.
Page 166

July 9-11, 2012
REFERENCES
Ahmed, S.L and Irum, M.A. 2011. Usage of Available Library Facilities By Students at
Undergraduate Level. International Journal of Academic Research 3 (2).Retrieve from
www.ijar.lit.az.
Bavakutty, M. and Majeed, K.C. Abdul.2005. Methods for Measuring Quality of Libraries.
New Delhi: EssEss Publications.
Filiz, Z. 2007. Service Quality of University Library: A survey amongst students at
Osmangazi University and Anadolu University. Ekonometrive IstatistikSayi (5). 1-19.
Hebert, T and Wolk. R. 2006. Back to the Maxwell Librarys Future Student Library an
Information Resource Usage. Retrieved from www.bridgew.edu
Lewis, B.R.1991. Managing Service Quality. In Managing Quality. New York: Academic
Press, 234-235
Nagata, H.,A. Toda and Kyotamaki,P. 2007. Students library use and their learning outcomes: A
Study on outcomes assessment in college and university, Library.J.Jap.Soc.Library
Inform.Sci.,53:17-34
Nimsomboon, N. and Nagata, H.A. 2003.Assessment of Library Service Quality at Thammasat
University Library System. Retrieved from www.kc.tsukuba.ac.jp/divcomm/report0403.pdf
Parasuraman, A; Zeithaml, V.A; and Berry, L.L. 1985.Conceptual Model of Service Quality and Its
Implications for Future Research.Journal Marketing, 49. 41-50
Singh, O.C and Okakwe, J.2011. Significant Predictors of Library Use by New International Students;
The case study of University of Malaya ,Kuala Lumpur, Malaysia. AsianJouranal of
Applied Sciences,4:53-62. Retrieved from www.
Scialert.net/fulltext/?doi=ajaps.2011.53.62&org=12
Whitmire, E. 2002. Academic library performance measures and undergraduates library use and
educational outcomes. Library & Information Science Research, 24, 107
Page 167

July 9-11, 2012
HUO31-12
Investigation of Thai University Students' Attitudes towards

Native/Non-native Speakers of English
Watthana Suksiripakonchai
39/142 South Sathorn Road, Sathorn, Bangkok, Thailand, 10120
erskine_21@hotmail.com
ABSTRACT
Issues regarding native and non-native speakers of English are an important topic in ELT.
Since Kachru established the three circles of English in 1985, criticisms of the circles have been
raised as to whether speakers from some countries such as Singapore and India could be
categorised as native speakers of English. In this study, attitudes towards perception of native
speakers of English were examined. Twenty students were randomly selected to voluntarily
participate in the study. They were asked to listen to short recordings made by six speakers from
various nationalities. They were also asked to complete a questionnaire about each recording to
elicit their attitudes regarding the voices they heard. The results show that most Thai students still
prefer native English pronunciation models. Pedagogical recommendations are discussed to offer
assistance to Thai students in relation to adoption of English pronunciation models.
Keywords: English as an International Language, English as a Lingua Franca, native and nonnative speakers of English
INTRODUCTION
The issues regarding native and non-native speakers of English are important in English
language teaching. While there are still people who are of the opinion that native speakers of
English from the inner circle of English proposed by Kachru (1985) are superior to those nonnative speakers of English who come from either the outer circle or the expanding circle, there is
also no denial that the role of English as an international language or the concept of English as a
lingua franca have played a significant role in modern English language teaching. In fact, Graddol
(2006) suggested that the number of people who speak English as a second or foreign language
outnumbered the number of people who use it as their first language. Nevertheless, in many
countries including Thailand, native speakers of English are perceived to be better than non-native
speakers of English, especially in English language teaching (Todd, 2006:1). This paper
investigated attitudes of students towards pronunciation of native speakers of English compared to
non-native speakers of English in order to answer the following research questions:
1. What are the students attitudes towards native speakers of English?
2. What are the students attitudes towards non-native speakers of English?
3. How do pronunciation models of English affect students pronunciation learning
outcome?

English as an International Language
Kachru (1985) proposed the circles of English, which consist of the inner, the outer and
the expanding circles. Although Kachrus proposal is mainly based on geography in which it has
received criticisms and would be argued against by a number of linguists such as those who
believe that some countries such as India and Singapore can be considered as inner circle
Page 168

July 9-11, 2012
countries. This argument was initiated by some linguists who believed that English was no longer
the language owned by the inner circle countries. For example, Smith (1983:2) stated that English
now belongs to the international community; it is not the language of the so-called native speakers
of English anymore. The argument for the concept of English as an international English is further
supported in the quote by Brumfit (1995:16):
Not only has English become international in the last half century, but scholarship about
English has also become international: the ownership of an interest in English has become
international. We are no longer a language community which is associated with a national
community or even with a family of nations such as the commonwealth aspired to be
As it can be seen by the argument proposed by the two scholars above, it is not surprising
that such argument is becoming popular in English language teaching. This is because it is a
known fact that English is used not only in the United Kingdom or the United States, but it is also
used almost everywhere in the world. For example, Punthumasen (2007:3) stated that Thailand
recognises English as a global language and it is taught as the first foreign language in schools.
Another term usually found in the study of modern English language is English as a
lingua franca. Unlike the English as an international language concept, which mainly means nonnative to non-native English communication, Seidlhofer (2001:143-144) as cited in OKeefe et al
(2007:28) explained that English as a lingua franca refers to the means of communication for
speakers whose language is not the speakers native language. This means that English as a lingua
franca can be a conversation between a native English speaker and a non-native English speaker or
it can be a talk between a non-native English speaker and a native English speaker. This is often
the case it places such as Thailand. Prapasit (2003:28) stated that English is commonly used by
Thai nationals with foreign nationals in large cities such as Bangkok. To consider Prapasits
statement, foreign nationals who communicate with Thai speakers of English can be either native
speakers of English or non-native ones. Therefore, Thai speakers of English are not limited to one
form of English that is native English model. Thus, in relation to the teaching of English:
The gist of Kacrus proposal has been that in teaching English to L2 learners, teachers
should expose their students to not only the main stream of English but also to a wide
variety of Englishes that, in some case, may be more relevant to those learners,
professionally and academically (Saengboon, 2002:48)
This means that it is important for teachers to ensure that both native and non-native forms
of English are introduced in class particularly non-native models, which may be more appropriate
to some students in certain countries than the native speaker model.
Relation between Native and Non-native Speakers of English
Some scholars raise some questions such as who are considered native speakers of English
and what are the criteria to consider ones as native speakers of English. For many English
language learners, their goal is to approximate their pronunciation as close as possible to that of a
native speaker of English (Timmins, 2002 as cited in OKeefe et al. (2007:27). Nevertheless, some
scholars such as Jenkins (2000:1) has argued that it is unrealistic and unnecessary in the
international use of English for an English language learner to aim for the native-like
pronunciation. Radwanska-William (2008:140) initiated the idea that the native speaker concept is
simply used in a metaphorical sense based on either a linguistic point of view or a sociolinguistic
point of view.
From a linguistic point of view, there is an argument whether a native speaker of English,
in a traditional sense meaning speakers of English from an inner circle country possesses superior
linguistic competence than a non-native speaker of English. Chomsky believed that non-native
speakers of English were imperfect, unreliable and that they did not have the knowledge of an
Page 169

July 9-11, 2012
idealised speaker-hearer in which native speakers of English did (Radwanska-William, 2008).
Nevertheless, this notion is in the decline. As Davies (2003:8) stated that a highly proficient nonnative speaker may also have acquired both linguistic and communicative competence and be,
therefore, in terms of what is required in formal higher education and in intuitions about Standard
English, indistinguishable from a native speaker. Todd (2006:7) conducted research about using
native speakers as a model of English proficiency by exploring their linguistic competence
(writing skills) of native English speakers. He found in his study that native speakers of English
could not be relied upon due to some caveats concerning some linguistic mistakes made by the
native speakers. That is, according to Todds study, native speakers made some spelling mistakes
and grammatical mistakes that would lead to students obtaining incorrect information. On the
other hand, a proficient non-native speaker may be very careful when using English and that they
may make less mistakes when teaching students. The term native speaker may not be necessarily
used to distinguish the two types of speakers; therefore, supporting the concept proposed by
Radwanska-William native speaker as a metaphor.
From a sociolinguistic aspect, the concept of native speaker is simply a social condition. It
is normal for a language community to consider its members as native speakers and outsiders as
non-native speakers. That is being a native speaker may be based primarily on the attitudes of
members of a community (Davies, 2003:57). Higgins (2003:616) explained that the concept of
native and non-native speaker is more of a social construction than a linguistically based
parameter and that speakers own ideological stances toward their linguistic identities should be
more significant than the label they are given by others Thus, anyone can be a native speaker of
English from a sociolinguistic point of view as it seems to depend upon the attitudes of members
of the group and their feelings of identity.
Students Attitudes and Impact on Learning English Pronunciation
There are a number of factors that can affect someones ability to learn English pronunciation
such as age, native language, exposure to the English language, identity, attitude and so on. In this
research, the focus is placed upon the attitude factor. It is important here to define what is meant by the
term attitude. Allport (1935) defined attitude as a state of readiness of a mental and neural condition
through experiences that are related to objects or situations. Thurstone (1946) as cited in Rinswat
(1996:45) defined attitude as the intensity of positive or negative effect toward a psychological object
and [a] psychological object means a symbol, person, phrase, slogan, or idea about which people can
differ with respect to positive or negative effect. It can be seen that both definitions of the term attitude
involves a mental or psychological state derived from various experiences. In this research, an attitude
means a positive or negative perception or state of mind towards native and non-native English
pronunciation.
Zhang (2009:41) stated that students with negative attitudes towards learning a language
could be influenced negatively by such attitudes. For example, Punthumasen (2007:4) claimed that
one factor that led Thai students to unsuccessful or unsatisfactory outcomes in learning English
was their attitude, which was the fact that they found the subject matter boring.
Attitudes of a listener can also impact on how the listener decodes information. For
example, Kachi (2004) conducted interviews and word-for-word dictation tasks on Chinese,
Japanese and Indian speakers of English. Kachi asked speakers from the three English
backgrounds to listen to a recording of Japanese-accented English. The results from the interviews
revealed that the Chinese and the Japanese speakers found the recording easier to understand as
they were more sympathetic towards the Japanese accent. On the other hand, the Indians did not
have a positive attitude towards the Japanese accent; therefore, they rated the Japanese recording
very poorly. An important aspect of students attitudes that is worth considering is the attitudes
towards learning English as a second or foreign language. This means it is possible that students
failure to master English pronunciation is because they lack positive attitudes to learn (Rinswat,
Page 170

July 9-11, 2012
1996:48). For example, in Thailand, people mainly use Thai language to communicate in their
everyday life and using English is minimally required; therefore, it is not surprising that Thai
people may not necessarily have positive attitudes or motivation to learn English let alone English
pronunciation. Therefore, in a pronunciation class it is important for a teacher to help students
build up their positive attitudes towards learning pronunciation.
Research design and participants
This study consists of 20 second year students of the Airline Business programme, Suan
Dusit Rajabhat University. The students were asked to listen to recordings made by speakers of
English from various nationalities based on Kachrus circles. While listening to each recording, the
students were asked to write down a short statement they heard from the recording. In addition,
immediately after each recording, the students were asked to rate the comprehensibility of each
recording in order to find some pronunciation models that were easier for them to understand.
Towards the end of the comprehensibility test, students were asked to, in their own opinions,
decide whether each recording they listened to was spoken by a native speaker of English or a nonnative speaker of English. Finally, students were asked to complete questionnaires regarding their
attitudes towards native speakers of English and non-native speakers of English.
Research instruments
1. Intelligibility test. The intelligibility test was used to measure how intelligible students
were in relation to their listening skills. It was also used to test whether students were able to
identify a native and non-native speaker of English. The test was made of six recordings of
statements produced by six speakers comprising an Australian, a New Zealander, a Filipino, an
Indian, a Chinese, and a Thai. This selection was in accordance with the Circles of English with
Australia and New Zealand being the inner circle, the Philippines and India being the outer circle,
and China and Thailand being the expanding circle. Each speaker produced six similar statements
in which each statement was made up of no less than seven words but not more than nine words to
assist students with their working memory as suggested by the Magical Number Seven, Plus or
Minus Two rule of George A. Miller (1956). These were also common statements that the
students in the airlines business area often heard in their daily conversations or classrooms.
2. Comprehensibility test. The comprehensibility test was used to measure the students
comprehensibility in relation to the six recordings they heard. A Likert Scale was used to measure
students comprehensibility ranging from 1) The voice is difficult for me to understand, 2) The
voice is a little difficult for me to understand, 3) The voice is neither difficult nor easy for me to
understand, 4) The voice is quite easy for me to understand and 5) The voice is very easy for me to
understand.
3. Questionnaires. The questionnaire method was used to elicit the students attitudes
about each recording they heard. The questionnaires were also used to explore their attitudes about
various pronunciation models they preferred including both native and non-native speakers of
English.
RESULTS
In the intelligibility test, students were asked to write down the six statements they heard.
The first statement ladies and gentlemen, welcome aboard flight QF2 to Bangkok produced by
the Chinese speaker of English. Eighteen students wrote down ... welcome about flight QF2 ...
instead of ... welcome aboard flight QF2. This is because the Chinese speaker pronounced the
term aboard very close to how the word about is pronounced. The other two students could not
identify that part of the first statement. The second statement good morning ladies and gentlemen,
its your captain speaking. Most students had difficulty identifying the second part of the sentence
its your captain speaking. The Filipino speaker emphasised the word speaking at the end of
Page 171

July 9-11, 2012
the statement making the words preceding it slightly difficult for students to identify. As for the
statements produced by the New Zealander, Thai and Indian, most students managed to write
down what they heard from each recording correctly. However, the statement produced by the
native Australian speaker appeared to be most difficult to the students. Most students were able to
identify the first part of the statement ladies and gentlemen. Nevertheless, the rest of the
statement ... welcome aboard flight QF1 to Brisbane was not written down by most students.
Table 1 indicates the results regarding the students ability to guess or identify whether the
voices they heard were produced by native or non-native speakers of English. The first statement
was produced by a Chinese speaker of English in which 65% of the students identified the voice
produced by the Chinese speaker as non-native speaker of English. The voice produced by a
speaker of English from the Philippines was believed to be the voice of a native speaker of English
from 70% of the students and 85% stated that the voice of a New Zealander was the voice of a
native speaker of English. In the case of an Indian speaker, it was clear to the students that it was
the voice produced by a non-native speaker of English with 90% stating the Indian voice to belong
to a non-native speaker. The percentage was higher reaching up to 95%, in the case of a Thai
speaker of English being a non-native speaker of English. As for the Australian speaker, 85% of
the students believed it to belong to the native pronunciation model.
Table 1 Identifying Native and Non-native Speakers of English
Sentence
1
2
3
4
5
6
Nationality
Chinese
Filipino
New Zealander
Indian
Australian
Thai
NS
35%
70%
85%
10%
85%
5%
NNS
65%
30%
15%
90%
15%
95%
Table 2 demonstrates the students comprehensibility level regarding the recordings they
heard in the intelligibility test. The results indicated that the two native speakers of English from
New Zealand (20%) and Australia (35%) were rated most difficult to understand. On the other
hand, the Thai speaker of English (5%) and the Indian speaker of English (5%) were rated very
difficult to understand. It is interesting to see that only 5% of the students rated the Australian
voice to be the easiest to understand and the New Zealand pronunciation, another native model,
was not found to be the easiest to understand (15%). In this study, the Thai speaker of English was
rated as having the easiest voice to understand (45%). The other non-native pronunciation models
were rated easier than native ones the Indian (30%) and the Chinese (20%).
Table 2 Comprehensibility Rating Results

Rating Descriptions
1. The voice is difficult for me to
understand
2. The voice is a little difficult for me
to understand
3. The voice is neither difficult nor
easy for me to understand
4. The voice is quite easy for me to
understand
5. The voice is very easy for me to
understand
Statement No.
3
4
New
Indian
Zealander
20%
5%
1
Chinese
2
Philippine
5
Australian
6
Thai
10%
15%
35%
5%
20%
55%
30%
5%
20%
45%
20%
25%
25%
40%
25%
15%
10%
20%
35%
25%
20%
15%
30%
5%
45%
Page 172

July 9-11, 2012
Table 3 shows the students attitudes towards native and non-native speakers of English as
a teacher. 75% of the students preferred teachers who were native speakers of English and 70%
stated that they felt more comfortable and easier learning pronunciation with native speakers of
English. It is interesting to note that students did not have strong negative attitudes towards nonnative speakers of English as 70% responded neutral to the attitude of dislike towards the nonnative speaker model. Only 10% of the students felt that native speakers of English were easier to
understand. However, one aspect of the native speakers of English that all students agreed upon
was the fact that they believed the native speaker pronunciation held more prestige. This is not
surprising when 75% stated that they would like to be able to sound like a native speaker of
English. The majority of students were of the opinion that English was an important factor in life
as 95% disagreed with the fact that English was not an important language to learn. Another
interesting finding is that only 5% of the students reported that to be successful in speaking
English, one would have to be able to speak like a native speaker of English.
Table 3: Students Attitudes towards Native and Non-Native Speakers of English
Questions
Agree
Neutral Disagree
1. I prefer teachers who are native speakers* of English.
75%
20%
5%
2. I feel more comfortable or find it easier learning
70%
30%
pronunciation with native speakers of English.
3. I do not like the way non-native speakers of English speak.
15%
70%
15%
4. I find it easier listening to native speakers** of English
10%
50%
40%
compared to non-native ones.
5. I find the way of speaking of native speakers of English
100%
more attractive than non-native ones.
6. I would prefer to be able to speak like a native speaker of
75%
25%
English.
7. I would feel embarrassed or less confident if I could not
50%
25%
25%
sound like a native speaker of English.
8. Because I do not sound like a native speaker so I feel less
70%
25%
5%
confident speaking English.
9. I do not like learning English so trying to sound like
5%
95%
a native speaker of English is not important to me.
10. I think the only way to become successful in speaking
5%
30%
65%
English is to be able to sound like a native speaker of English.
The following section is the responses of students in relation to their attitudes towards
native and non-native speakers of English.
1. Do you want to learn English pronunciation with native or non-native English teachers? Why?
The majority of students responses were in favour of the native English teachers. They
were of the opinion that they would rather learn English pronunciation with native speakers of
English rather than non-native speakers of English because they believed native speakers were the
owner of the English language; therefore, they would have clear English pronunciation. They also
thought that native speakers of English had correct English accent. Nevertheless, in their mind,
native speakers of English meant foreign nationals (Caucasian) in which this could mean any
European speakers of English. Only two students stated that they would rather learn English
pronunciation with Thai teachers as they believed that this would be easier for them in terms of
less misunderstanding and opportunities to ask questions.
Page 173

July 9-11, 2012
2. Do you want to be able to speak English like a native speaker of English or is it not important to
you? Why?
Most students responded yes, I would like to be able to speak English like a native
speaker of English. The majority of the respondents stated that they would like to sound like a
native speaker of English because they would like to be able to communicate with foreign
nationals. Some stated that they would like to speak like a native speaker of English because they
would like to have a correct English accent. Others reported that they believed being able to speak
like a native speaker of English would be beneficial to their future career. One student stated that
he would like to speak like a native speaker of English because their accent sounded smart. There
were two students who responded negatively towards the native speaker of English pronunciation
model. They stated that being able to speak English like a native speaker was not necessary as they
only wanted to be able to communicate effectively in English.
3. Do you find the way native speakers of English speak easier or more difficult to understand
compared to non-native speakers of English? Why?
More than half of the students produced negative responses towards native speakers of
English. The stated that it was more difficult listening to native speakers of English because native
speakers of English often speak too fast making it difficult to understand. Some stated that they
were not familiar with native speaker accents, which made it difficult for them to understand when
listening to native speakers of English speak. A few students, although agreed with the fact that
native speakers of English were more difficult to understand, they enjoyed listening to speech
produced by native speakers of English because they sounded more authentic. Only few students
stated that native speakers of English were easier to understand and their reason was native
speakers of English had correct accent.
4. What do think will make you a successful speaker of English?
All of the students responses indicated that it was important for learners to practise
English by speaking and listening to English. More than half of the students stated that practising
or learning English with foreign nationals, listening to foreign nationals, watching or listening to
foreign movies or music would help them to become successful speakers of English. Some stated
that to be successful, they would have to know more vocabulary.
DISCUSSIONS
The findings from this research indicate that most students were able to identify who
native speakers of English were in accordance with Kachrus circles of English, but this is not
absolute as many of them regarded speakers from the Philippines as native speakers of English and
even as high as 35% thought that the Chinese speaker was a native speaker of English. Therefore,
it is possible to draw a conclusion that pronunciation alone is not enough for students to identify
which recording was produced by a native speaker of English; therefore, it would be possible for
them to form an opinion that speakers of English from the Philippines were native speakers of
English and for some students this could be speakers of English from China, India or even
Thailand. According to the comprehensibility test made by the students, the two native speakers of
English (Australian and New Zealander) were rated as most difficult to understand whereas nonnative speakers of English such as the Thai and the Indian were rated as very easy to understand.
The twenty students did not do well understanding the pronunciation model produced by the
Australian and the New Zealander. They performed well for the non-native speaker model
particularly the Thai pronunciation. As a result, it could be concluded that, maybe the native
speaker model is not appropriate as a standard for all to follow in Thailand. In other words, it
should not be the only pronunciation model that students are encouraged to follow as other nonnative pronunciation models may be more appropriate. If non-native pronunciation models are not
Page 174

July 9-11, 2012
considered as negative or less prestigious models, it might be possible that the students
performance may not be as low as how it is now. If a scholar such as Jennifer Jenkins who stated
that a native speaker pronunciation model is not only necessary but also unrealistic is correct,
perhaps it would be more realistic to achieve a non-native pronunciation model. Therefore,
pronunciation models do have an impact upon students learning outcome, which is an answer to
research question number 3. The results from the questionnaires help to answer research questions
number 2 and 3. This is because they indicate that most students have positive attitudes towards a
native speaker pronunciation model and most of them would prefer to have such pronunciation
model. The non-native pronunciation models are less popular although they are not completely
unwanted as some students did not mind the idea of having a non-native speaker model. This is
because they were more interested in the idea of successful communication rather than trying to
sound like a native speaker of English. Choosing a pronunciation model is an important step for
students, it is essential that teachers inform the students that non-native pronunciation models are
not wrong and that they may even be more appropriate particularly in a non-native speaker
context.
Page 175

July 9-11, 2012
REFERENCES
Allport, G.W, (1935), Attitudes. In C. Murchison (Ed.), A Handbook of social psychology ,
pp. 798-884, Worcester, MA: Clark University Press.
Brumfit, C.J, (1995), The Role of English in a changing Europe: where do we go from here?, Best
of ELTECS, UK: The British Council.
Davies, A, (2003), The Native Speaker: Myth and Reality, UK: Multilingual Matters Ltd.
Graddol, D, (2006), English Next, UK: British Council.
Higgins, C, (2003), Ownership of English in the Outer Circle: An Alternative to the NS-NNS
Dichotomy, TESOL QUARTERLY, Vol. 37, No. 615-644.
Jenkins, J, (2000), The Phonology of English as an International Language: New Models,
New Norms, New Goals, Hong Kong: Oxford University Press.
Kachi, R, (2004), Factors Predicting Native and Nonnative Listeners Evaluation Reactions to
Japanese English, Unpublished PhD Dissertation, Ohio State University.
Kachru, B.B, (1985), The Other Tongue. English Across Cultures, Urbana, IL: University of Illinios
Press.
Miller, A. George, (1956), The Magical Number Seven, Plus or Minus Two: Some Limits on Our
Capacity for Processing Information, The Psychological Review, Vol. 63, 81-97.
Prapaisit, L, (2003), Changes in Teaching English After the Education Reform in Thailand,
PhD Dissertation, Michigan State University.
Punthumasen, P, (2007), International Program for Teacher Education: An Approach to
Tackling Problems of English Education in Thailand, The 11the UNESCO-APEID
International Conference Reinventing Higher Education: Toward Participatory and
Sustainable Development, Bangkok, Thailand.
Radwanska-Williams, J, (2008), The Native Speaker as a Metaphorical Construct in
Metaphor for Learning, (Erich, A, Berendt, ed) Amsterdam: John Benjamins, pp. 139-156.
Rinswat, P, (1996), A Comparison between Thai Student Attitudes Toward English as a
Foreign Language and Their English Proficiency at Four Public (State) Universities in
Bangkok, Thailand, PhD Dissertation, University of Southern California.
Zang, Q, (2009), Affecting Factors of Native-Like Pronunciation: A Literature Review,
Comprehensive Perspective, Vol. 27, Issue. 2, 33-52.
Saengboon, S, (2002), Beliefs of Thai EFL Teachers about Communicative Language
Teaching, PhD Dissertation, Indiana University.
Seidlhofer, B, (2001), In OKeeffe, A, McCarthy, M, and Carter, R, (2007), From Corpus to
Classroom: Language Use and Language Teaching, UK: Cambridge University Press.
Smith, L.E, (1983), English as an International Auxiliary Languages in L.E. Smith (ed):
Readings in English as an International Language, Oxford: Pergamon Press.
Timmins, I, (2002), Native-Speaker Norm and International English: A Classroom View. In
OKeeffe, A, McCarthy, M, and Carter, R, (2007), From Corpus to Classroom:
Language Use and Language Teaching, UK: Cambridge University Press.
Todd, R.W, (2006), The Myth of the Native Speaker as a Model of English Proficiency,
King Mongkuts University of Technology Thonburi Journal of Language Education, Vol.
8, 1-7.
Page 176

July 9-11, 2012
HUO108-13
Security Resources Managements Perspective on

Global Change
Suphanee Navakul
Faculty of Political Science and Law, Burapha University,
Chonburi, Thailand
E-mail: suphanee.navakul@hotmail.com; suphanee@buu.ac.th
ABSTRACT
This article has three main objectives. First, it presents the studies of globalization
including definition, its components, and advantages and disadvantages. In addition, it
demonstrates globalization affecting the global changes which are impact on Thailands
development strategies. Second, it indicates the similarities and differences between Security
Resources Management and Resource Dependence Theory. Last, it analyzes how to implement
Security Resources Management in term of Human Resources and Natural Resources. As a result,
local communities should make a decision on Security Resources Management.
Globalization consists of three components, namely economy, politics, and society. The
advantages of globalization are economic growth, steady state growth rates, voluntary solidarity
and increasing of life expectancy while countries might be confronting the risks of conflicts,
insecurity and inequality as disadvantages. However, the different levels of advantages and
disadvantages of countries depend on their contexts. Globalization brings some changes to
Thailand, therefore the development strategies should be generated to response these changes.
Security Resources Management or SRM consists of two dimensions: developing
resources and strengthening securities. The focal of SRM is that the security of resources should
be always considered by the decision makers at all levels including national, local, organizational,
and individual.
In order to implement SRM on Thailands strategies, the two dimensions matrix must be
analyzed on human resources, knowledge-based economy, societies, food and energy, economic
and cooperation in the region, and natural resources and environment. In this article, only human
resources and natural resources are analyzed because they play the most important roles on the
development.
Finally, it proposes that the national strategies should promote the protection of the
important natural resources from being undervalued and poorly safeguarded. It is also required
solving the problem that the local poor depend heavily on natural resources and exploit them in
unsustainable ways. Moreover, local communities should set up their objectives of development
under the interests and capabilities because they have knowledge and understanding of their own
resources management more than others.
Keywords: globalization, global change, resource dependence theory, security resources
management
INTRODUCTION: GLOBALIZATION, GLOBAL CHANGES, AND STRATEGIES

In this part, the literature review illustrates globalizations definition, its components, and
some studies shown advantages and disadvantages to the local. It demonstrates globalization
affecting the global changes which are impact on Thailands development strategies later.
Page 177

July 9-11, 2012
As per International Monetary Fund, globalization has become into common usage since
the 1980s and is defined as the increasing integration of economies around the world, particularly
through trade and financial flows. The need to attract external financial flows which could
contribute to the creation of jobs and the growth of the economy required, in particular, in the
context of the globalization of capital markets, a greater effort in favor of national capital markets.
The development of such markets, combined with national capacity building and the establishment
of institutions connected to the international financial centers, would help to enhance the
effectiveness of financial mediation in the allocation of resources, to channel external flows, and to
increase and diversify the volume of medium and long term financial resources necessary for the
economic development of these countries. Lastly, these flows, both internal and external, can not
fail to constitute a source for the mobilization of additional resources through appropriate taxation.
Globalization consists of three components: economic, political and social. This is
supported by KOF Index of Globalization which measures the three main dimensions of
globalization: economic globalization, characterized as long distance flows of goods, capital and
services as well as information and perceptions that accompany market exchanges, political
globalization, characterized by a diffusion of government policies and social globalization,
expressed as the spread of ideas, information, images, and people, in 2009 Thailands composite
index was 64.15 increased significantly from 28.99 in 1970. In addition, three indices measuring
these dimensions, sub-indices refer to actual economic flows, economic restrictions, data on
information flows, data on personal contact, and data on cultural proximity. As shown in Table 1
Thailands Index of Globalization, the Economic Globalization increased 243% greater than others
while Social Globalization increased 209% as same as Political Globalization.
Table 1 Thailands Index of Globalization from 1970s to 2009

Source: Adapted from KOF, 2010
Type of Index
1970
1980
1990
2000
2009
Composite Index
28.99
33.04
38.21
58.04
64.15
Economic Globalization
28.66
34.18
39.64
59.91
69.55
Political Globalization
38.96
47.09
45.61
77.37
81.59
Social Globalization
22.30
22.04
31.61
42.65
46.62
Many studies indicate that globalization promotes some advantages to countries including
the economic growth, steady state growth rates, voluntary solidarity and increasing of life
expectancy.
Economic growth, the study of Mutascu and Fleischer (2011) reveals that if countries tend
to maximize the economic growth, they must globalize more. This connection is functional only
on medium and long term, but with a flat intensity. Dreher and Axel (2006) also conclude that
globalization increases economic growth. They develop an index of globalization covering its
three main dimensions: economic integration, social integration, and political integration. Using
panel data for 123 countries in 1970-2000 it is analyzed empirically whether the overall index of
globalization as well as sub indexes constructed to measure the single dimensions affect economic
growth. As the results shown, globalization indeed promotes growth. The dimensions most
robustly related with growth refer to actual economic flows and restrictions in developed
countries. Although less robustly, information flows also promote growth whereas political
integration has no effect.
Page 178

July 9-11, 2012
Rao et al. (2011) indicate that countries with higher levels of globalization have higher steady state
growth rates (SSGR) but the growth effects on SSGRs are smaller than in many studies.
An Empirical Analysis of Individual Preferences in 26 European Countries studied by
Koster and Ferry (2009) investigates what these preferences are influenced by globalization: the
economic, social and political openness of countries. The consequences of social openness for the
people's preferences confirm the hypothesis that people prefer voluntary solidarity to compulsory
solidarity and the market mechanism. The risks that individuals face in everyday life, such as
illness and unemployment, can be covered using market, government, or community mechanisms.
The market can function with a lower level of solidarity compared to the other two mechanisms;
the government mechanism requires the highest level of compulsory solidarity and communities
are associated with voluntary solidarity. Social context affects individual preferences with regard
to any one of these mechanisms.
Ekman (2003) studied the relationship between globalization and public health outcomes
and found that globalization increased life expectancy. The study is used aggregate level panel
data for 123 countries in the period 1975-2000. A positive (seemingly non-linear) correlation can
be detected between a composite measure of globalization and population health as measured by
life expectancy at birth.
From the advantages above and the index of globalization, it seems that currently Thailand gains
more benefits from economic than in the past decades.
However, globalization brings some disadvantages to the local, especially developing countries
including Thailand. Conflicts, insecurity and inequality are found in the studies below.
Stanton et al. (2007) concludes that cultural engagement in social forms and political
forms leads to increased conflict. Economic engagement led to a decrease in conflict behavior,
while political globalization increased both protest and rebellion. The study is designed to answer
the simple question: do globalization and westernization affect ethnic conflict? To this end they
examine how globalization in its constituent parts affects ethnic conflict.
In addition, economic globalization (Dreher and Gaston, 2008) has exacerbated wage
inequality in developed countries. There is no shortage of theories that purport to explain why
globalization may have adverse, insignificant, or even beneficial effects on income and earnings
inequality. Surprisingly, the empirical realities remain an almost complete mystery. In this paper,
Dreher and Gaston use data on industrial wage inequality, household income inequality as well as
measures of the economic, social and political dimensions of globalization to examine this
controversial issue. Overall, while Dreher and Gaston find that globalization has exacerbated
inequality; this is particularly true in the case of income inequality in OECD countries.
Brooks (2008) explains that risk protection in developing countries has been much less
supportive of economic integration than it has been in advanced industrial nations. State
intervention to smooth over distributional conflicts and dampen insecurity in lower-income nations
thus may not follow closely the logic observed among the rich nations. The analysis finds evidence
to suggest that risk protection systems in developing countries mediate globalization's effect on
public sector interventions in ways that differ sharply from the dynamic observed in the developed
economies.
In consequence of the globalization, countries including Thailand could take advantages of
economic growth, steady state growth rates, voluntary solidarity and increasing of life expectancy.
At the same time, those countries may confront the risks of conflicts, insecurity and inequality.
However, the different levels of advantages and disadvantages of countries depend on their
contexts.
Economic, political, and social globalizations bring some changes to countries. In hence,
the development strategies should be generated to response these changes.
Thailand has been confronting six external or global changes (Vimolsiri, 2011) including
global economic recovery, changing global rules & regulations, development trend towards a
multi-polar world where Asia has a leading role, global warming, food and energy security, and
changing technology. Those changes are affecting Thailands development approach and
strategies. In addition, there are six risks (Vimolsiri, 2011) that strategic analysts shall concern.
Page 179

July 9-11, 2012
They consist of weak public administration, threats towards national security, deteriorating in the
natural resources and environment, vulnerable economic structure, declining proportion of
working age population, and loss of traditional values. In order to response these changes and
risks, Porametee Vimolsiri proposed six development strategies. These strategies are promoting
the just societies, developing human resources to promote lifelong learning society, balancing food
and energy security, creating the knowledge-based economy and enabling economic environment,
strengthening economic and security cooperation in the Region, and managing natural resources
and environment towards sustainability.
Above literatures demonstrate that globalization with advantages and disadvantages bring
some changes to each country. For Thailand, six global changes are affecting and six strategies are
generated to response these changes as per Figure 1.
Globalization:Economy,Politics,
Society
Advantages:economicgrowth,
steadystategrowthrates,
voluntarysolidarityand
increasingoflifeexpectancy
GlobalChangesaffectingThailand
globaleconomicrecovery
changingglobalrulesand
regulations
developmenttrendtowards
amultipolarworldwhere
Asiahasaleadingrole
globalwarming
foodandenergysecurity
changingtechnology
ThailandsStrategies
promotingthejustsocieties
developinghumanresources
balancingfoodandenergysecurity
creatingtheknowledgebased
economy
strengtheningeconomicand
securitycooperationintheRegion
managingnaturalresourcesand
environmenttowards
sustainability
Figure 1 The Relationship of Globalization, Global Changes, and Thailands Strategies

Source Adapted from Vimolsiri, 2011
SECURITY RESOURCES MANAGEMENT IN TERMS OF HUMAN RESOURCES AND

NATURAL RESOURCES
Global changes are affecting development strategies directly that human and natural
resources are the vital to drive the strategies. In this part, Security Resources Management or SRM
will be described and compared with Resource Dependence Theory or RDT. SRM will be later
analyzed in terms of human resources and natural resources.
SRM includes several elements; for instance, human resource, land and forest, water,
energy, etc. Therefore, SRM might be compared with RDT. RDT was developed in the 1970s by
Jeffrey Pfeffer. RDT recognizes the influence of external factors on organizational behavior and,
although constrained by their context, managers can act to reduce environmental uncertainty and
dependence. Central to these actions is the concept of power, which is the control over vital
resources (Ulrich & Barney, 1984). The most central idea of RDT is that organizations, as open
systems, had to both obtain resources and, after some transformation, deliver the goods or services
thereby produced to some customers broadly defined that would then provide the money to permit
the organization to acquire more inputs and continue the cycle.
SRM consists of two dimensions: developing resources and strengthening securities. The
focal of SRM is that the security of resources should be always considered by the decision makers
at all levels including national, local, organization, and individual. These levels are analyzed as
open systems as the same as RDT. The SRM cycle of acquiring resources is based on sustainable
development; for example, we obtain woods and deliver furniture, whereas renewable forest must
be compulsory acquisition. As mentioned above, both SRM and RDT have the similar cycle of
acquiring resources. The control over vital resources is the same action of both SRM and RDT.
There are four different ideas between SRM and RDT.
First of all, SRM does not only emphasize on the organization level but also covers the
other three levels: national, local, and individual.
Page 180

July 9-11, 2012
DevelopingLevel
Secondly, SRM promotes all stakeholders to develop their resources and strengthen the
securities while the concept of power is used by managers to control over vital resources in RDT.
Thirdly, SRM aims to strengthen securities of resources while RDT focuses on the
reduction of environmental uncertainty and dependence.
Lastly, SRM is an interdisciplinary; whereas, RDT is related to organizational behavior
and organizational theories.
As mentioned above, SRM consists of two dimensions; developing resources and
strengthening securities as per Figure 2. In the other words, all development concepts or
approaches under SRM must recognize which levels the developing and security are. The progress
of developing and security must be always monitored periodically. For example, when an
economic policy is formulated such as a budget allocation to local community, it must aim not
only at the poverty reduction (as an approach of economic development) but also the economic
security or stability. The developing level might be in the D2 because the poverty (Warr, 2009) has
declined remarkably over time despite a steady increase in income inequality. The income
inequality is shown that economic security might be in the S1 only owing that economic stability
must be improved. It implies that resources are managed inefficiently. S3 is the ideal level of
security while each resource has its limitation for development. It is difficult to summarize the
most suitable level for development.
D3, S1
D3, S2
D3, S3
D2, S1
D2, S2
D2, S3
D1, S1
D1, S2
D1, S3
D: the abbreviation of Developing Level

which are 3 = the greatest level, 2 =
moderate, and 1= low
S: the abbreviation of Security Level

which are3 = the greatest level, 2 =
moderate, and 1= low
SecurityLevel
Figure 2 The Two Dimensions Matrix of Security Resources Management

In order to implement SRM to Thailands strategies, the two dimensions matrix must be
analyzed on human resources, knowledge-based economy, societies, food and energy, economic
and cooperation in the region, and natural resources and environment.
In this article, human resources and natural resources are analyzed since they play the most
important roles on the development.
Human resource is the greatest asset that any organization possesses and it must ensure
that this potential is harnessed to the maximum to contribute positively towards the growth of the
organization. Although Thailand officially focused on human resources development in the eighth
National Economic and Social Development Plan (1997-2001), Human Development Index or
HDI ranked by United Nations Development Program or UNDP, value for 2011 is only 0.682 or in
the medium human development category. The positioning is at 103 out of 187 countries and
territories. However, between 1980 and 2011, Thailands HDI value increased from 0.486 to
0.682, an increase of 40.0 per cent or average annual increase of about 1.1 percent (UNDP, 2011).
Page 181

July 9-11, 2012
The two dimensions matrix might be D2, S1 because the progress of development is 40 per cent
but the positioning the country at 103 out of 187 countries and territories.
Resource Management and the Effects of Trade on Vulnerable Places and People:
Lessons from Six Case Studies reported by World Bank illustrates the complex relationships
between international trade, vulnerable ecologies and the poor (The World Bank, 2010). The cases,
taken from Africa, Asia and Latin America and conducted by local researchers, are set in places
where the poor live in close proximity to ecologies that are important to global conservation
efforts, and focus on the cascading consequences of trade policy for local livelihoods and
environmental services. The study has two findings shown that natural resources are poorly
secured. The development approach should focus on 1) how to avoid the important natural
resources from being undervalued and poorly safeguarded, and 2) how to solve the problem that
the local poor depend heavily on natural resources and sometimes exploit them in unsustainable
ways.
There are three interesting findings of Thailand from Natural Resource Management
Country Studies by UNDP.
First, it is evident that the conflict over natural resources management in Thailand stems
from the myopic process behind policies and laws that seek to govern resource management.
Second, it has been found that strict enforcement of laws have not worked in arresting
problems of natural resource management but instead exacerbated it. This can be attributed to two
factors: the conflicting and overlapping nature of different laws governing natural resource
management in Thailand; and the noninvolvement of communities as right holders in natural
resource management.
Last, there is a need to acknowledge the specific needs, perspectives, and roles of women
in natural resource management in Thailand. Their active participation in decision-making and the
equitable sharing of benefits between men and women is crucial for ensuring the long term
sustainability of natural resource management.
The two dimensions matrix might be D1, S1 because the conflict over natural resources
management, the conflicting and overlapping nature of different laws governing natural resource
management, and the noninvolvement of communities as right holders in natural resource
management indicate that current developing level is low. Gender in Natural Resource
Management is shown the insecurity or the long term sustainability of natural resource
management.
The results from above studies, besides human resources development, it is proposed that
decisions taken locally play an important role in how natural resources are used, which in turn has
ramifications for income and for the environment. Figure 3 Understanding State Behavior might
be useful for all levels of decision makers under SRM. It shows that objectives are shaped by
interests, capabilities, opportunities, and threats.
Objectives, the scope of objectives are usually broad, covering a wide range of political,
social and economic issues. Some policy objectives may more immediate, short-term or shortrange, while others may be long-range objectives to be achieved incrementally over a period of
decades.
Interests
Opportunitie
Objectives
Capabilities
Figure 3 Understanding State Behavior (Viotti and Kauppi, 2001: p. 75).
Page 182
Threats

July 9-11, 2012
Interests of nations might be classified as national survival, economic vitality and
prosperity and societys core values.
Within the global system, opportunities present themselves that, if handled properly, can
help to achieve specific objectives.
Threats emanating from the global system have to be dealt with if they interfere with the
achievement of objectives.
From the perspective of SRM, the national strategies should promote the protection of the
important natural resources from being undervalued and poorly safeguarded. It is also required
solving the problem that the local poor depend heavily on natural resources and exploit them in
unsustainable ways.
Moreover, local communities who have knowledge and understanding of their own
resources management including natural resources more than the central government making
national strategies should set up their objectives of development under their interests and
capabilities.
Page 183

July 9-11, 2012
References
Brooks, Sarah M. 2008. Globalization and Risk Redistribution in the Developing World. Ohio
State University, mimeo.
Dreher, Axel. 2006. Does Globalization Affect Growth? Evidence from a New Index of
Globalization. Applied Economics 38, 10: 1091-1110.
Dreher, Axel and Gaston, Noel. 2008. Has Globalisation Increased Inequality?. Review of
International Economics 16, 3: 516-536.
Ekman, Bjrn. 2003. Globalization and Health: An Empirical Analysis Using Panel Data.
Lund University, mimeo.
KOF. 2010. KOF Index of Globalizationhttp. Retrived March 30, 2012. From
www://globalization.kof.ethz.ch
Koster, Ferry. 2009. Risk Management in a Globalizing World. An Empirical Analysis
of Individual Preferences in 26 European Countries. International Social Security
Review 62, 3: 78-98.
Mutascu, Mihai and Fleischer, Anne-Marie. 2011. Economic Growth and Globalization in
Romania. World Applied Sciences Journal 12, 10: 1691-1697.
Rao, B. Bhaskara, Artur Tamazian and Krishna Chaitanya Vadlamannati. 2011. Growth Effects
of a Comprehensive Measure of Globalization with Country Specific Time Series
Data. Applied Economics 43, 5: 551-568.
Stanton, S. Jr., Joseph J. St. Marie and Shadad Naghshpour. 2007. The Effects of Globalization
on Ethnic Conflict; A Cross-Sectional Time-Series Analysis, 1970-2003. University of
Southern Mississippi, mimeo.
Vimolsiri, Porametee. 2011. Economic Outlook in 2011 and the Draft 11th National Economic
and Social Development Plan. Presented at Food for Thought: Economic Outlook
FY2011 Conference, Thailand, 27 January.
Ulrich, D., and Barney, J. B. 1984. Perspectives in organizations: Resource dependence,
efficiency, and population. Academy of Management Review, 9: 471-481.
UNDP. 2011. Natural Resource Management Country Studies: Thailand. Retrived Apr 25,
2012. From
http://regionalcentrebangkok.undp.or.th/practices/governance/documents/NRM_Thailand.
pdf.
Viotti, Paul R. and Kauppi, Mark V. 2001. International Relations and World Politics:
Security, Economy, Identity. 2nd Edition. USA: Prentice-Hall, Inc.
Warr, Peter. 2009. Poverty Reduction through Long-term Growth: The Thai Experience.
Asian Economic Papers 8:2.
World Bank. 2010. Resource Management and the Effects of Trade on Vulnerable Places and
People: Lessons from Six Case Studies. Policy Research Working Paper No. 5258.
Page 184

July 9-11, 2012
HUO105-15
The Effect of Language Handbook Guideline for Developing

English and Arabic Speaking Proficiency of Nursing Staff in a
Private Hospital Readiness for ASEAN Community
Siriporn Poonruksa
Faculty of Nursing Science, Assumption University, Bangkok 10240, Thailand
Email: siripornPnr@au.edu
ABSTRACT
At present time to 2015, ten countries in ASEAN are moving towards ASEAN
community. Healthcare has been one of the priority sectors identified for accelerated economic
integration. Mutual Recognition Arrangements on nursing service would strengthen professional
capabilities by promoting the flow of relevant information and exchange of expertise, experience,
and best practices suited to the specific needs of ASEAN member countries. Now, the top five
customers in the private hospitals of Thailand are from countries that use English and Arabic
languages for communication. So nurses should be able to train the conversation in Arabic and
English languages effectively in order to convey message and provide nursing care that fit with the
customers need. In this study, Continuous Quality Improvement process and one group pre-test
post-test experimental design were mutually applied which aimed to compare English and Arabic
speaking proficiency of nursing staff before and after implementing a toll for the speaking skill
development. Participants composed of 19 nurses and non-nurses who were purposively
randomized into experiment group. Language handbook guideline was created based on
information deriving from staff nurses brain storming. The handbook details involved common
vocabularies and sentences in nursing practice including customer greeting, admission and
discharging, sign and symptom assessment, medication administration, and pre and post operative
care. Content validity was tested by three international interpreters who have been spoken two
languages. Pre-test of two languages was employed then the handbook was introduced to
participants for practicing their communication. After one month, post-test was conducted and the
results revealed that participants speaking proficiency scores after practicing with handbook
guideline were statistically significant increased. Moreover, they expressed high level of
satisfactory score towards language guideline book. The research result was recommended to a
nurse director to use this language handbook guideline continually for improving nursing staff
speaking skill.
Keywords: nursing staff, CQI, private hospital, English and Arabic proficiency, ASEAN
community
INTRODUCTION
In 2015, ten countries in Southeast Asia including Brunei Darussalam, Cambodia,
Indonesia, Lao People's Democratic Republic (PDR), Malaysia, Myanmar, Philippines, Singapore,
Page 185

July 9-11, 2012
Thailand, and Vietnam will move towards ASEAN Community. Healthcare has been one of the
priority sectors identified for accelerated economic integration. This means eliminating barriers to
trade in the healthcare sector, including the movement of health professional services across
countries in the region. The new commitment was meant to reverse negligible trading activities in
the health services, which for a long time had lagged behind, together with distribution services,
educational services, environmental services, recreational services, and cultural sporting services
(ASEAN ANU Migration Research Team, 2005).
The decision of the Bali Concord II adopted at the Ninth ASEAN Summit held in 2003
calling for completion of Mutual Recognition Arrangement (MRA) for qualifications in major
professional services by 2008 to facilitate free movement of professionals/skilled labour/talents in
ASEAN; and providing an MRA on nursing services that would strengthen professional
capabilities by promoting the flow of relevant information and exchange of expertise, experience,
and best practices suited to the specific needs of ASEAN member countries. The objectives are 1)
facilitate mobility of nursing professionals within ASEAN; 2) exchange information and expertise
on standards and qualifications; 3) promote adoption of best practices on professional nursing
services; and 4) provide opportunities for capacity building and training of nurses (ASEAN
Secretariat, 2009).
As mentioned earlier that healthcare has been one of the priority sectors identified for
accelerated economic integration toward a single ASEAN market (ASEAN Secretariat, 2011). In
addition, two service sub-sectors in the healthcare industry have been specifically targeted for
progressive liberalization, namely, (a) the services of medical professionals, including medical and
dental professionals, midwives, nurses, physiotherapists, and paramedical personnel (b) health
services, covering hospital services and the services of medical laboratories, ambulances, and
residential health care other than hospitals. This huge consumption value has attracted
multinational corporations to engage in the production and supply of various healthcare goods and
services in the Asian market (ASEAN Secretariat, 2006).
V Hospital, which is certified by Joint Commission International Accreditation (JCI) and
Hospital Accreditation (HA), has followed the trend of this opportunity. According to the hospital
statistics stated that the top 5 customers are from countries that use Arabic language, such as
United Arab Emirates, Kuwait, Saudiarabia, and from countries that use English language, such as
United States, Philippines, and Myanmar. But almost nursing staff are unable to speak Arabic and
English languages well especially while providing nursing care to serve needs of clients from these
countries. The hospital executive also expects the high growth rate of clients and income which
related to quality of nursing care and effective communication. Therefore, nurses should be able to
have some conversations in Arabic and English languages while providing nursing care to clients.
Thus, this research was developed and combined Deming cycle; Plan, DO, Check, and Act (Jones,
2007) to train nursing staff for English and Arabic speaking skills to serve need of clients.
Because after survey the need of staff from four units (Intensive Care Unit, Medical unit, Arabic
Unit, and International Unit), they have had intention to improve the communication skill and
culture understanding with the clients from the countries as mentioned. Because they realized that
communication is very important for everything done in the hospital. Miscommunication may
make low level of clients satisfaction towards nursing care which effects directly to the
decreasing number of client admission and revenues to the hospital.
Page 186

July 9-11, 2012
REVIEW OF RELATED LITERATURE
During the last decade, it is clear that the global trading system has become much more
liberalized and the world economies have become increasingly integrated. Especially, since the
latter half of the 1990s, with the slowdown of the World Trade Organization (WTO) multilateral
trade negotiations, it is clearly evident that there has been an exponential increase in the number of
Regional Trade Agreements (RTAs) and Free Trade Areas (FTAs) in every part of the world. For
instance, in the Americas, the North America Free Trade Agreement, or NAFTA, was formed in
1994, and now countries within that region are moving ahead to create the Free Trade Area of the
Americas. Likewise, the recent successful enlargement of the European Union from 15 to 27
countries has been evident. In Asia, China, Japan, South Korea, and India have begun a series of
FTA negotiations with their major trading partners. And beside the ASEAN Free Trade Area, or
AFTA, the ASEAN countries are currently engaging in the process of establishing an FTA with
China, India, and Japan (Boontong and Kowinta, 2009) through the ASEAN plus 3 (China, Japan,
and South Korea) and plus 6 (Australia, New Zealand, and India) initiatives (Poonruksa, 2012). In
todays changing world, trade in health services becomes an important component in international
trade for many countries. So, Thailand as well as many countries cannot avoid being linked with
the world economy and society (Boontong and Kowinta, 2009).
The Association of Southeast Asian Nations (ASEAN) was established on 8 August 1967.
The Member States of the Association are Brunei Darussalam, Cambodia, Indonesia, Lao People's
Democratic Republic (PDR), Malaysia, Myanmar, Philippines, Singapore, Thailand and Vietnam.
The ASEAN Secretariat is based in Jakarta, Indonesia (ASEAN Secretariat, 2011). Thailand has
worked closely with the ASEAN members to create the ASEAN Free Trade Area and is now
proceeding forth with the establishment of the ASEAN Economic Community, or the AEC. The
AEC will turn ASEAN into a single market and production base, with over 500 million consumers,
and the free flow of goods, capital, services, investment, and skilled labors, as well as transport
linkages and communication interconnectivity by the year 2020. Under the AEC initiative, three
pillars; Political-Security Community, Economic Community, and Socio-Cultural Community
have been focused. Moreover, 12 priority sectors have been identified for comprehensive
integration and the roadmap for these priority sectors is currently being developed. These sectors
include: wood-based products, automotives, rubber-based products, textiles and apparels, agrobased products, fisheries, electronics, e-ASEAN, healthcare, air travel, tourism and logistics.
Among these 12 priorities, healthcare has been targeted as a priority sector that will accelerate the
target year earlier in 2010 instead of 2015 (Boontong and Kowinta, 2009; Prakongsai and
Pachanee, 2011; Poonruksa, 2012).
In relation to free flow of skilled-labor and human development, ASEAN has been
working on Mutual Recognition Arrangements (MRAs) to facilitate the free movement of skilled
labor in the region. To date, eight MRAs have been concluded for the following professional
groups: (i) Engineering Services (signed in December 2005); (ii) Nursing Services (signed in
December 2006); (iii) Architectural Services (signed in November 2007); (iv) Framework
Arrangement for the Mutual Recognition of Surveying Qualifications (signed in November 2007);
(v) Tourism Professionals (signed in January 2009); (vi) Medical Practitioners (signed in February
2009); (vii) Dental Practitioners (signed in February 2009); and (viii) MRA Framework on
Accountancy Services (signed in February 2009) (ASEAN Secretariat, 2011).
Page 187

July 9-11, 2012
As mentioned in the above paragraph that the Mutual Recognition Arrangements for
Health Professionals including Professional nurse, Medical practitioner, and Dental practitioner
have been signed. The MRAs will facilitate the movement of health professionals in the coming
year. Up to the agreement, the impact on the movement of health workforce into and out of each
ASEAN member country will create critical problems to health systems in the next decade for both
nursing staff and clients. So, it is the responsibility of the government and professional
organization to ensure that health of the population is not threatened by trade policies (Boontong
and Kowinta, 2009) that motivate nurses from the member country to work in Thailand. Currently,
different nursing competencies, cultures, and language used for communication are major concerns
for all health care personals. Therefore, it is priority for staff nurses in each hospital to get training
on communication in order to have competency to care clients from countries in the ASEAN
community.
After initial survey target international customers from many renewed private hospitals in
Bangkok, the results indicated that majority group of them are customers who speak English and
Arabic languages. Thus, this research was initiated to develop language manual guideline and test
its efficiency in order to apply for communication skill improvement among nursing personals.
METHODS
In this study, Continuous Quality Improvement (CQI) process and experimental research
design are mutually integrated. Four steps of CQI process; PLAN, DO, CHECK, and ACT
(PDCA) were focused as the process to approach participants while working in their units (Carroll,
2006). One group pre-test post-test design was applied in the DO and CHECK steps. In planning
step, the tool for improving English and Arabic languages was created based on needs of staff
nurses from four units that needed to learn how to speak English and Arabic languages as well as
understood clients culture by using attractive strategy for learning because they had time
limitation. To get information for developing the tool for language and culture understanding
practicing, research cooperated with unit managers to arrange meeting among nurses and nonnurses staff to have participation in this research by writing Thai vocabularies and sentences that
they would like to practice in Arabic and English languages and use for clients in their units.
Finally, researcher got five themes for creating language handbook guideline named ABC-Alif
Ba Ta. These five themes consisted of customer greeting, admission and discharging, sign and
symptom assessment, medication administration, and pre -post operative care respectively. After
that content validity was tested by three expert interpreters who have been spoken English and
Arabic languages in daily work. Three nurses and three non-nurses staff were assessed for
objectivity and reliability (0.785) of the tool before implementing as the intervention in this study.
V hospital, a small private hospital in Bangkok, was a setting for this study. There were 19
participants purposively randomized into the experiment group. Most of them were nurses and
non-nurses staff who worked in each shift of four units. Pre-test related to knowledge on English
and Arabic languages was employed. Then language handbooks were disseminated to participants
and took time one month for practicing. The post-test was also done to compare scores after
language handbook implementing. The example of handbook guideline is shown in the following
details.
Page 188

July 9-11, 2012
Thai
,
English
Good morning
Arabic
Thai
English
Arabic

Lie down flat

position
Good evening
Until
()
Good evening
Try to ambulate
How are you?
Press on the
wound when
coughing
Do you want
some help?
Clear liquid/
liquid diet
I am fine.
Regular diet
Good bye
Can sip water
See you next

time
Soup
Excuse me
Boiled rice
Please speak
slowly
Take a deep
breath
, ,
Yes
Ough
,,
No
Bleeding
Thank you
Lie down flat

position
Thank you very

much
Until
Thank you very

much
Try to ambulate
No problem
Press on the
wound when
coughing
Page 189

July 9-11, 2012
RESULTS
The pre-test and post-test results revealed that means of post-test scores of participants in
every unit were higher than means of pre-test scores (Figure 1-4). It was noticed that mean score
of staff in Arabic unit (8 B unit) was higher than other units because they quit familiar which some
basic vocabularies used for Arabic clients more than other staff in this hospital. When comparing
mean scores of pre-test and post-test by T-dependent statistic, results indicated that mean score of
post-test was higher than mean score of pre-test with statistically significant (T18 = 4.444, p =
0.00), (Table1).
Figure 1 Pre-Post Test: ICU
Figure 2 Pre-Post Test: 8B Unit
Page 190

July 9-11, 2012
Figure 3 Pre-Post Test: 10A Unit
Figure 4 Pre-Post Test: 10B Unit

Table1 Paired Samples Test
Mean
S.D
Std. Error Mean
Pre-test
6.8947
19
2.18314
.50085
Post-test
8.9474
19
1.35293
.31038
t
4.444
Sig
.000*
Moreover, the satisfactory scores toward language handbook guideline ABC-Alif Ba Ta

were assessed among participants in five aspects including book style, content, utilization,
convenience, and overall satisfaction. The data demonstrated that most of them were extremely
satisfied with handbook guideline with means 3.51 out of 5.00 (Figure 5-9).
Page 191

July 9-11, 2012
Book Style Satisfactory Score
Content Satisfactory Score
Utilized Satisfactory Score
Page 192

July 9-11, 2012
Convenience Satisfactory Score
Overall Satisfactory Score

DISCUSSION
The results in this study indicated the effectiveness of language handbook guideline
ABC-Alif Ba Ta that could use to improve English and Arabic speaking proficiency of nursing
staff in V hospital. It could explain that details in the language handbook guideline were written
from participants opinions those closed to their regular works conversation. In addition, these
details were cross checked with interpreters who have been spoken two languages and suggested
researcher to use Karaoke pronunciation for simple understanding. So, it made language
handbook guideline easier for participants understanding and practice. It was observed that pre
and post test scores of participants from Arabic, Intensive Care Unit, and International units were
higher than Medical unit. The results occurred because some of them were trained for basic Arabic
and English communication skills but they lacked of communication skills regarding technical
terms in nursing that they should talk while providing nursing cares to clients such as medication
administration and pre-post operative care because normally interpreters would take part of these
conversation.
For the satisfaction of participants towards book style, content, utilization, and
convenience which indicated high scores, this phenomena could explain that the handbook was
designed in a small size and colorful feature. Thus, it was easy to carry and practice during shift
work as well as attracted users for repeated reading.
Page 193

July 9-11, 2012
RECOMMENDATION AND SUGGESTION
For these result, nursing staff in this hospital agree to continue using this handbook in
order to improve their English and Arabic proficiency. However, this research was conducted
among a few staff from four units. Thus, researcher would suggest the authority person of nursing
organization in this hospital to expand the utilization of language handbook for all nursing staff
and also shared experiences to other hospitals. In addition, it would suggest for writing more
vocabularies and sentences related to nursing care in the real working situation into this handbook
in the near future. For nursing instructors, this handbook guideline will be applied for increasing
students communication competency before graduating to prepare them ready to serve customers
need in the ASEAN communication era.
ACKNOWLEDGEMENTS
Researcher would like to sincerely thank unit managers and staff nurses of four units who
participated very well in this research. And also thank three interpreters for their kind contribution
to check the accuracy of content in a handbook.
Page 194

July 9-11, 2012
REFERENCES
ASEAN ANU Migration Research Team. (2005). Movement of workers in ASEAN: Health Care
and IT Sectors, REPSF Project No. 04/007. Retrieved from
http://www.aseansec.org/aadcp/repsf/docs/04-007-FinalMainReport.pdf
ASEAN Secretariat. (2006). ASEAN Mutual Recognition Arrangement on Nursing Services.
Retrieved from http://www.aseansec.org/19210.htm
ASEAN Secretariat. (2009). Roadmap for an ASEAN Community 2009-2015. Jakarta:
ASEAN. Retrieved from http://www.aseansec.org/publications/RoadmapASEAN
Community.pdf
ASEAN Secreariat (2011). Master Plan on ASEAN Connectivity, Jakarta. Retrieved from
http://www.aseansec.org/documents/MPAC.pdf
ASEAN Secretariat. (2011). ASEAN Economic Community Fact Book. Retrieved from
http://www.aseansec.org/publications/ASEAN_AECFactBook.pdf
Boontong, T., & Kowinta, O. (2009). Capacity Building on Trade in Health Services for Human
Resources for Health. Available from
http://whothailand.healthrepository.org/bitstream/123456789/737/1/080016.pdf
Carroll, P. (2006). Nursing Leadership and Management: A Practical Guide. New York:
Thomson/ Delmar Learning.
Jones, R.A.P. (2007). Nursing leadership and management: Theories, processes, and practice.
Philadelphia, PA:F.A.Davis.
Poonruksa, S. (2012). Handout of introduction to multiculturalism in health care. Faculty of
Nursing Science, Assumption University of Thailand, In print.
Prakongsai, P. and Pachanee, C. (2011). ASEAN collaboration on disease control and prevention.
Presentation to the 21st National Seminar on Epidemiology, 6 July 2011, Ambassador
Hotel, Bangkok.
Page 195

July 9-11, 2012
HUO39-16
The Study of Creative Thinking Level of Primary Students

in Watsaweatachat School
Wandee Srikongchan, Sittichai Kaewkuekool, Sopon Mejaleurn
Faculty of Industrial Education and Technology,
King Mongkuts University of Technology Thonburi
126 Pracha-utid Road, Bangmod, Toongkru, Bangkok 10140
E-mail: watsaweat@hotmail.com, sittichai.kae@kmutt.ac.th, sopon.mee@kmutt.ac.th
Abstract
The objective of this research was to study the creative thinking level of primary students
in Watsaweatachat School. Purposive sampling was used to select the sample which consisted of
64 Prathomsuksa 5 students from Watsaweatachat School studying in the second semester in the
academic year 2011. The data was analyzed by finding the mean of percentage and standard
deviation. The research data was collected by using Torrance Test of Creative Thinking Figural
Form A. This test integrated Picture Construction, Picture Completion and Use of Parallel Line.
The result of this study showed that the overall creative thinking level of Prathomsuksa 5 students
in Watsaweatachat School Bangkok was moderate. To state further, Elaboration and Fluency
showed a moderate level, whereas Originality and Flexibility showed a low level.
Keywords: Creative Thinking, Thinking Skill, Primary
1. Introduction
Each individual has a unique human
thinking process. Psychologists, educators and
researchers are showing increased interest in
cognitive styles and learning styles, which are
the fundamental factors that enhance effective
learning for learners at all levels.
Creative thinking ability is one of the
most important skills that teachers must
develop in learners. Creative thinking skills are
critical to individual success and development
of the nation. Every individual possess creative
thinking ability. Psychologists and educators
have expressed various viewpoints on the
concept of creative thinking. Guilford (1950)
[1] proposed the concept of "divergent
thinking" in the 1950s, when he noticed that
creative people tend to exhibit this type of
thinking more than others.
Creativity has growing significance in
contemporary world, and received increased
attention in recent educational reforms around

the world. What is creativity?
Sternberg and Lubart (1999) [2] states,
Creativity is the ability to produce work that is
both novel and appropriate. In education field,
creativity is believed to be acombination of
abilities, skills, motivation, attitudes and other
factors (Ripple,1999) [3]. Among all these
attributes, creative thinking is always
considered as central to creativity development.
From the cognitive approach, leading scholars
of creativity consider divergent thinking as the
essence of creative thinking (Guildford, 1950 ;
Torrance,1974) [4].The most influential
definition of divergent thinking includes the
elements in Guilfords (1950) Structure of the
Intellect (SOI) Model: Fluency, Flexibility,
Originality and Elaboration. Fluency refers to
the number of relevant responses. Flexibility
Page 196

July 9-11, 2012
represents change in though originality
refers to the number of unusual, but relevant
ideas as measured by the statistical
infrequency of the idea. Elaboration refers to
the number of details used to extend a
response (Torrance, 1974) [4]. In contrast,
some scholars take an effective approach. In
Williams Taxonomy of Creative Thought,
Williams (1980)[5] suggests that effective
factors
such
as
curiosity,
imagination,challenge-taking and risk-taking
attitudes are conducive to creativity
development,and motivational factors like
interest, value and confidence in creative
thinking are also important determinants.
Spraker (1960) [6] states that creative
thinking is the ability to find new and
innovative keys to problems. Wallach and
Kogan (1965) [7] believes that creative
thinking is an Associative Thinking, which is
a holistic process that looks for relationships
even though no causal link is apparent.
Simpson(1992) [8] states that creative
thinking is the ability to think innovatively
with a broader outlook towards new ideas.
2. Research Methodology
2.1 Purpose of the research
The main purpose of the research
was to study creative thinking level of
primary students in Watsaweatachat School.
2.2 Research Design
This research data was collected
solely by the researcher. Watsawettachat
School was the most favorable sample
because the school supports creative thinking
development. Similarly, Prathomsuksa 5
students were found to be the optimal sample
because this age group is the most suitable for
the development of creative thinking skill.
The researcher used Torrance Test of
Creative Thinking Figural Form A which had
a reliability of .804. This test integrated
Picture Construction, Picture Completion and
Use of Parallel Line. Students were given 10
minutes for each activity with a total time of
30 minutes for the test. This Torrance Test of
Creative Thinking Figural Form A was
translated and modified by Aaree
Rungsinun(1978,1979,1980 reference from
Aaree Phuntumanee, 2004) [9]. It was used to

measure creative thinking level of Thai students
from Kindergarten to Prathomsuksa 4 in the year
1978; from Prathomsuksa 5 to Prathomsuksa 9 in
the year 1979; and in Higher Education in the
year 1980.
The test proved a reliability of scoring
with students from Prathomsuksa 1 to
Prathomsuksa 4, showing a high level of Fluency
of 1.0, as well as a high level of Originality and
Elaboration of .99.
Quality of Research Tool
In this research, researchers and experts
have examined the quality of the research tool
and validated the reliability of scoring between
0.95 and 0.98. Comparing with the required
standard
reliability
of
0.50
(Sirichai
Kanjanawasi,2001)[10],the research tool showed
a high level of reliability scoring as illustrated in
Table 1 below:Table 1 Reliability Coefficient of Research
Tool
Variable
Creative Thinking
Fluency
Originality
Flexibility
Elaboration
Reliability
0.98
0.96
0.95
0.98
Table 1 shows a reliability of scoring in

Fluency 0.98, Originality 0.96 Flexibility 0.95
and Elaboration 0.98.
2.2 The Sample of the study
The sample, which was selected using
purposive sampling, included 64 Prathomsuksa 5
students of Watsaweatachat School studying in
the second semester in the academic year 2011.
Data Analysis
The score for each creative thinking
variable will be converted out of 100. The
average score for the four variables will then be
taken as the absolute score, which will be
measured against the criterion shown in Table 2
below:-
Page 197

July 9-11, 2012
Table 2 Analysis of Creative Thinking Level
3.2 Discussions
Creative Thinking Level
Scoring
Level
The research result showed that overall
Prathomsuksa
5 students have a moderate
0.00 19.99
Very Low
creative thinking score, with a moderate level of
20.00 39.99
Low
Fluency and Elaboration, and a low level of
Flexibility and Originality. The potential cause of
40.00 59.99
Moderate
low creative thinking level is the negligence of
teachers in focusing on developing students
60.00 79.99
High
creative thinking ability. In todays world,
creative thinking ability is very essential and can
80.00 100.00
Very High
be developed by using various approaches such
as teaching, training and creating an environment
which can enhance freedom in learning.
3. Results and Discussions
The creative thinking variable of
Fluency can be developed by teaching the skills
3.1 Result
of Word Fluency, Associational Fluency,
Expressional Fluency and Ideational Fluency.
Table 3 Creative Thinking Level of
Likewise, Elaboration can be developed by
Prathomsuksa 5 Students
teaching students the observational skill and the
step-by-step thinking method, which will
SD
Creative enhance the ability to think in a more detailed
Variable
x%
Thinking manner. However, Elaboration also depends on
Level
age factor (Aaree Phuntumanee, 2004)
[11].Furthermore, to improve Originality and
1. Fluency
42.31
15.76
moderate Flexibility, students should be taught to think
innovatively and generate new ideas. Teachers
2. Flexibility
26.42
10.55
low
can assist by teaching students to analyze
problems in different views and learn new
3. Originality
20.18
9.13
low
solutions to those problems.
4. Elaboration
41.01
20.13
moderate
4. Conclusion
Prathomsuksa
5
students
of
40.32
17.76
moderate
Total
Watsaweatachat School showed a moderate level
of creative thinking. Since Torrance Test of
Creative Thinking Figural Form A integrates
Picture Construction, Picture Completion and
According to the analysis, taken as a
Use of Parallel Line, students who are not good
whole, Prathomsuksa 5 students showed a
at art may find it difficult, hence the low result.
creative thinking score of 40.32, which is
However, the research results are limited only to
moderate. On an individual basis, the result
Watsaweatachat School.
showed a moderate level of creative
thinking variables of Fluency and
5. Acknowledgement
Special thanks to Assoc.Prof.Sittichai
Elaboration
of
42.31
and
41.01
Kaewkuekool
and Asst.Prof.Sopon Mejaleurn for
respectively,
whereas Flexibility and
words
of
advice.
Originality showed a low level of 26.42 and
20.18 respectively.
Page 198

July 9-11, 2012
References
Guildford, J. P.. Creativity. American Psychologist, 5, (1950), pp. 444-454.
Sternberg, R. J. & Lubart, T. I.The concept of creativity: Prospects and paradigms. In,(1999).
Ripple, R. E. Teaching creativity. In M. A. Runco & S. R. Prirzer (Eds.),Encyclopedia of
creativity San Diego, CA: Academic Press(1999), pp.629-638.
Torrance, E. P. Torrance tests of creative thinking. Lexington, MA: Personnel Press, (1974).
Williams, F. E.,Creativity assessment packet. East Aurora, N.Y.: DOK, (1980).
Spraker, S. A Study of Comparative Emergence of Creative Behavior During the Process of
Group and Individual Study of Mathematics, Ph.D. Dissertation Abstracts. (1960),p. 4637.
Wallach, Michael A. and Nathan Kogan. Model of Thinking in Young Children. New York :
Holt, Rinehart and Winston, Inc., (1965).
Simpson, R.W. Creative Imageination,American Jurnal of Psychology. 29,(1992), pp.234 243.
Aaree Phuntumanee, Creative Thinking ,Bangkok,(2004), p.1412.
Sirichai Kanjanawasi, Classical Test Theory, 4th Printing, Bangkok : ChulalonkornPrinting, (2001).
Aaree Phuntumanee ,Practice Thinking, Think Creatively ,3rd Printing ,Bangkok: Yai Mai
Printing,(2004).
Page 199

July 9-11, 2012
HUO84-19
Visitor Perception in Architectural Monument:

Case Study of The Historic City of Ayutthaya
Patiphol Yodsurang
Montfort Del Rosario School of Architecture and Design, Assumption University
88 Moo 8 Bang Na-Trad Km.26 Bangsaothong, Samuthprakarn, 10540, Thailand
Email: Patipholyds@au.edu
ABSTRACT
Architecture can speak for itself, but nowadays a large section of people visually illiterate.
The new generations of visitors, who have not an eye for architecture, have no ability to read and
learn architecture and its environment. Heritage Interpretation is presented in ways that help
visitors discover the hidden messages in historical monuments and be understood by its visual
elements.
The Historic City of Ayutthaya is listed as the World Heritage which expresses ideas,
beliefs, and creativity of Ayutthaya people. It is subsequently extremely popular for Siamese
architecture. The problem is those surviving monuments of Ayutthaya are mainly of brick
structure and most of them had fallen off. Yet, the physical remaining in the Historic City might
lose some potential in visual presentation in architecture. In designing of interpretation
programmes or service, it is indispensable to create them sense and aware of its existence in its
visual elements of building.
In order to improve the existing interpretation service, and analyze the current situation,
problem faced, limitation, and restriction in-situ, this study has pointed out the importance of
architectural monument interpretation and presented the way general visitors perceive a message
from heritage, particular in the complex of architectural monuments in the historic city of
Ayutthaya. A wide variety of heritage attraction and visitors motivation in Ayutthaya had reflected
on how they can access visual information from architecture. The database can be used for
determining and proposing of the interpretation framework and strategies model to catch up on the
new visitors interest. The Historic city of Ayutthaya will become the complete source of learning
outside the classroom, which cultural tourism will be followed by.
Keywords: Interpretation, Tourism, Architectural heritage, Historic city of Ayutthaya, World
Heritage
INTRODUCTION
The Historic city of Ayutthaya is considered to be property of outstanding universal value
and is listed as a World Heritage in 1991 under criteria III, bear a unique or at least exceptional
testimony to a cultural tradition or to a civilization which was living or which has disappeared. It
is extremely popular in Siamese architecture, and many examples can be contemplated throughout
the entire region. They were the evidence of the highest prosperity of Southeast Asian civilization
in the fourteenth to nineteenth centuries. The numerous palaces, temples, fortresses, as well as
architecture, paintings, sculptures, and literature, are testimonies to this great civilization. To
compete with the old capital, the kings of Ayutthaya richly endowed the monasteries, which
acquired gigantic proportions.
Unfortunately, after the city was completely abandoned due to Ayutthayan-Burmese war
which broke out in 1767, some brick and other material were dismantled and subsequently were
Page 200

July 9-11, 2012
removed to construct a new city of Thonburi and Bangkok. Today, the sites characteristic
architecture of brick and stucco is devoid of its decoration and completely exposed to the
elements. The survey on physical remaining of Ayutthaya has revealed that the monuments in the
city island almost are abandoned temple and historical ruin where a large number of tourist
attractions are located in. Meanwhile almost of living monuments (mainly are temple) are located
outside the city island. The survey has also revealed that some monuments disappeared from
survey of Phraya Boranratchathanin which was first published in 1926.
The value of architectural heritage lies not only in its appearance, but also in the integrity
of all its components (ICOMOS, 2003a), structure, materials, order, style, function, setting, and
restoration as a unique product of the specific building technology of the time. These create the
most permanent and illuminating of unwritten records. Architecture is a living language that may
be understood without acquiring a lot of detailed technical knowledge (Gloag, 1925).
Even Though Architecture can speak for itself, but since the nineteenth century a large
section of people have become visually illiterate, and unable to learn anything from architectural
environment and often unaware of its existence (Gloag, 1925). We must accept that general
visitors have no insight what they have seen in Ayutthaya. So, it is indispensable to improve the
interpretive media and service readiness in various kind of aspect and should have a special design
to illustrate and support the heritage interpretation itself to catch up on the visitors interest.
The origin of heritage interpretation dates back to the nineteenth century in the United
States with the publication of Freeman Tildens Interpreting Our Heritage in 1957. It was
considered the first book to define the profession of interpretation (HICIRA, 2005). For Tilden,
interpretation was a mission-based communication process that forges emotional and intellectual
connections between the interests of the audience and the meanings inherent in the resource. The
logic underlying Tildens philosophy of Interpretation was protection through appreciation,
appreciation through understanding, and understanding through interpretation (Tilden, 1977).
Following Tilden, many interpreting associations redefined the term in their own ways as
a guideline for their purposes. Until 2008 ICOMOS1 adoption ratified the Charter for the
Interpretation and Presentation of Cultural Heritage Sites in Quebec. This Charter first clearly
denotes that interpretation was such a totality of activity, reflection, research, and creativity
stimulated by a cultural heritage site (Silberman, 2006). Although the principles and objectives of
this Charter may equally apply to off-site interpretation, its main focus was interpretation and
presentation at, or in the immediate vicinity of, cultural heritage sites (ICOMOS, 2008).
Interpretation as a discipline permits actions for achievement of certain established objectives
entailing exploration and development of the sites value. Correct operation of the resource must
avoid deterioration through improper use by visitors. The aim was that the visitor would
understand the experience and feel the nature of the site, enjoy while respecting it; a nondestructive enjoyment (HICIRA, 2005). There were no definite rules about what an interpretation
plan must contain. Its content will depend on what you want it to achieve (Carter, 2001).
The characteristic of Architecture beyond a place of habitat is the visual information
represented in architecture. Visitors perceive architecture by its visual elements of line, shape,
form, color, texture, and space. Yet, these visual elements can also generate and illustrate a
conceptual link with its entire value which was a sense of place. Architecture may serve
interpretation as a playground and let visitor play with it to encourage interaction. This study has
pointed out the importance of architectural monument interpretation and presented the way general
visitors perceive a message from heritage, particular in the complex architectural monuments in
the historic city of Ayutthaya. A wide variety of heritage attraction and visitors motivation in
Ayutthaya had reflected on how they can access visual information from architecture.
International Council on Monuments and Sites (ICOMOS) is a non-governmental international

organization dedicated to the conservation of the world's monuments and sites.
Page 201

July 9-11, 2012
This study deals with a number of visitors who visited Ayutthaya without an interpreter,
along with a survey on heritage interpretation and proposed a standard for architectural heritage
interpretation. A database of tourism statistics and visitors analysis was used for determining and
analyzing visitor behavior in the historic site. One important thing is to analyze the interpretive
infrastructure currently available for tourism and identify gaps for proposing tourism or educationrelated documents and feasibility studies for possible future interpretation programmes and
services.
This research employed visitor surveys and observations to assess the factors that
significantly influence visitor behavior and motivation in-situ. The quantitative data derives from
visitor surveys and fits together with qualitative interviews with involved bodies which will be
analyzed.
RESULTS
From interpretive infrastructure surveying has revealed that the existing interpretation
infrastructures and facilities in the historic city of Ayutthaya were inadequate, and park officials
and residents were not trained to host visitors (Chotigavanit et al, 1995). The master plan cannot
make it effective. Visitors receive information piece by piece which is not linked together. That
means the existing interpretation programme does not work under any set of theme. The local
stakeholder was separated from the heritage managerial reality. The survey has also revealed the
current state of Ayutthaya is lack of Informative Management and Information service. All
existing interpretation were based on linguistic-historical information and not linked together.
Tourist facilities at the Ayutthaya Historical Park were located in Tourist Information
Center, The Tourism Authority of Thailand Ayutthaya branch. Unfortunately, only 1.5% of the
visitors visited here in 2008. Visitors were not aware of the existence of this center.
The ticket office responsible for The Fine Arts Department on each Historical site only
provided printed materials, postcards, souvenirs and films for sale. The officer could speak only
Thai and gave no more information service in depth. A free guided tour can offered only for Thai
non-business visitation in and around the Ayutthaya Historical site. However advance reservation
was required due to a lack of park staff. While a local guided tour offered by the local private
sector such as Tuk-Tuk drivers, part-time students, local sellers etc. Nevertheless, they must be
registered and trained in an academic approach
Roughly, 3.6 million visitors came to Ayutthaya in 2008, 11% of which who visited the
historical park. Amongst those visitors, a significant part of foreign visitors were Japanese at 41%,
European and American at 38%, and other Asian countries at 11% of all tourists. In other words, it
could be said that no more than 40% of foreign visitors came from English speaking country.
Table 1 Percentage of visitors classified by travel arrangement
Page 202

July 9-11, 2012
Table 2 Percentage of visitors classified by Basic knowledge of Thai art and Architecture
The survey2 revealed one significant data. From a sample group of visitors, 90% of them
visited the Historical Park without any site interpreter who was engaged with the public
communication of information on the site. More than a half of them had no art or architectural
background when visiting the architectural remains of the Historic city of Ayutthaya by
themselves.
Because of the lack in public transportation service for roaming around the Historic site,
private cars and coaches were used for transportation, which usually took 3-6 hours or 6-12 hours.
That means visitors could decide which places to go, where to stop, and how to access the site by
themselves.
The survey allowed visitors to evaluate the existing interpretation programme and service
as well as to point out the limitation of heritage learning of the site. Signboards, friends/relatives
and site staff were important during their visit. But no information signboards were used by
foreign visitors, while guidebooks, friends/relatives and tourist guide were important. A
subsequent survey on informative materials at the site had revealed that only 50% of visitors
believed that the signboard was the most useful in helping them understand the site. It may be
because the signboards were not in their language, in a poor condition, or they had their own
guidebook. Less than half could grasp what was being explained about the site.
Table 3 Percentage of visitors classified by satisfying factors about information at the site
2
The visitors survey has done in 3 difference languages; Thai, English, and Japanese.
Page 203

July 9-11, 2012
For satisfaction and understanding factor, visitors were satisfied from visiting a historical
site, historical ambience, and site accessibility but seemed dissatisfied in the disability access to
the architectures. After attending an interpretation, half of the visitors did not understand the art,
architecture and its meanings, historical signification, and building at the time it was build. Only
75% of Thai visitors understood the historical significance. It was emphasized that the site needs
to improve art and architectural interpretation to increase the satisfaction and understanding level.
There was diversity in terms of cultural background and language uses. A large portion of
them had no art and architectural background while they were visiting the architectural remains of
Ayutthaya. The research mainly focused on 90% of visitors who visited Ayutthaya without an
interpreter. Roughly, the focused group was formed of 991 Thais and 103 foreigners who visited
the area in one day. This was one significant key role to success in planning service for
interpretation of heritage in Ayutthaya. That means this large section of visitors used and learned
through self-learning materials which is available on the site.
The survey revealed that a large portion of visitors were interested in the outstanding Thai
art and architecture besides historical value and significant of Ayutthaya, while the existing
interpretation programme and service can offer only historical based information. The underlying
motivation was that the Historic city of Ayutthaya provides such kind of interpretive materials for
presentation of the art and architectural significance; a focal point which the existing interpretation
seems not concerned to. The question arose as to how we can reveal the importance of art and
architectural feature to those general visitors.
DISCUSSION
Visitors to Ayutthaya had a wide variety of
interest according to their background and
motivation to visit. As interpretation tools and
materials, architectural heritage had somewhat of an
advantage more than anything else. When they were
introduced into the architectural territorial, they will
be involved with the space and together with
interpretive materials learn something according to
the objective which was set under the sub-theme of
the site. It will create a sense of place in their mind
which can forge the relationship between visitor and
architectural setting. Architectural heritage can be
understood by its visual element. The problem was
that surviving monuments of Ayutthaya were mainly
of brick structure and most of them had fallen off.
One important thing was how to create the sense and Table 4 Interpretation and perception in
awareness of its existence; form, color, space and architectural territorial
composition of building.
The surviving monuments of Ayutthaya attract both Thai and foreigner visitors. All
remaining structures and ruins represent themselves through its visual information and its
supporting materials. However, Ayutthaya offers a huge and complex story. Each monument has
its own story which was illustrated and reflected on the story of Ayutthaya as a whole. In order to
achieve better understanding and provide consistent information to all visitors, the site interpretive
structure in any course could be categorized as;
1. Museum and library center,
2. Archaeological and historical site,
3. Build environment and vernacular architecture,
4. Living monument with religious activities, and
5. Pilgrimage tour
Page 204

July 9-11, 2012
Table 5 Architectural heritage theme and place for visitation, classified by interest of the audience
The differentiation between each visiting thematic also reflected on how difficult it was to
access the visual information of remaining architecture and visitors background knowledge. However,
the lacking amount of remaining physical evidence might have lost some potential in visual
presentation of the architecture. In order to achieve architectural interpretation, it is indispensable to
increase intensity of visual information through both visual and simulated virtual architectural
information to increase realism and provide a more intuitive and immersive experience.
Visitors immediately perceived architectural objects through its visual information through all
their senses. However, they may not perceive normatively, but rather as experienced background and
set-up conditions for architectural creations that create emotional senses on their mind. As a result,
together with interpretive material as a combination between this may forge emotional and intellectual
connections between visitors and architectural heritage as described in Tildens identification of
interpretation.
ACKNOWLEDGEMENTS
The preparation of this important study would not have been possible without the support, hard
work and endless efforts of a large number of people in the World Heritage Studies Programme in the
University of Tsukuba, Faculty of Architecture Assumption University, Thailands Fine Art
Department and Ayutthaya historical park office, the Tourist Agency of Thailand, UNESCO Bangkok
office, and particular a huge amount of financial support from the Rotary-Yomeyama scholarship.
Page 205

July 9-11, 2012
REFERENCES
Carter, J. 2001. A Sense of Place: An Interpretive Planning Handbook. Tourism and
Environment Initiative, Inverness.
Chotigavanit, S. Sangkhanukit, P. Smitthi S. Young, P. Ayutthaya, Thailand. In: The Future
of Asias Past: Preservation of the Architectural Heritage of Asia; Chiang Mai, Thailand;
1995 Jan 11-14; Session 4. California: Westland Graphics Burbank, 1995
Edwards, B. 2008. Understanding architecture through drawing. Taylor & Francis, New York.
Gloag, J. 1977. The architectural interpretation of history. St.Martins Press, New York.
Heritage Interpretation Center: HICIRA. 2005. The HICIRA Handbook. Municipis de la
provincial de Barcelona, Barcelona.
ICOMOS. 2003a. Recommendations for the analysis conservation and structural restoration
of architectural heritage.
ICOMOS. 2003b. Principles for the analysis, conservation and structural restoration of
architectural heritage.
ICOMOS. 2008. Charter for the Interpretation and Presentation of Cultural Heritage Sites.
Jackson, Sir T. G. 1925. Architecture. Macmillan and co., limited., London.
Phengtako, P. Laws and regulations to support conservation and development of Ayutthaya
Historic city. In: 7th Seminar on the Conservation of Asian Cultural Heritage: The World
Cultural Heritage in Asian Countries - Sustainable Development and Conservation -;
Tokyo, Japan; 1997 Dec 21-25. Tokyo: Tokyo Research Institute of cultural properties,
1998.
Silberman, N. 2006. The ICOMOS Charter Initiative-- Rethinking the Role of Heritage
Interpretation in the 21st Century. The George Wright Forum, Michigan.
Tilden, F. 1977. Interpreting Our Heritage. 3rd Edition.: The University of North Carolina
Press, North Carolina.
Veverka, A. J. 1994. Interpretation Master Plan. Acorn Naturalists, California
Page 206

July 9-11, 2012
HUO170-20
Implementation of Student-centered Methods and Approaches in

Engineering Education
a
Slavko Kocijancica and Anuparp Boonsongsrikulb

University of Ljubljana, Faculty of Education, Department of Physics and Technology, Slovenia
b
Burapha University, Faculty of Engineering, Department of Electrical Engineering, Thailand
E-mail: slavko.kocijancic@pef.uni-lj.si
ABSTRACT
We live in an era of rapid development of technology, which requires from engineering

educators special efforts in order to adequately prepare their students, future engineers, for
employment as well as for lifelong learning. Major challenges include the introduction of
contemporary topics into courses, implementation of up-to-date appliances and devices,
consideration of implementation of e-learning, etc., all of which are closely related to the teaching
methods and approaches. While contemporary technologies influenced engineering education
significantly and required continuous development, development of teaching methods and
approaches is not so noticeable. Teacher-centered learning seems to dominate in engineering
education compared to more active teaching methods oriented to student-centered learning. The
paper briefly clarifies the meaning of cognitive levels in engineering education. In order to
accomplish higher cognitive levels according to revised Bloom taxonomy, it outlines definitions
of problem-based, experience-based and project-oriented learning. To illustrate the implementation
of cognitive levels, examples of problem-based and project-oriented laboratory activities in
electrical engineering are outlined. To conclude, engineering educators ought to be more familiar
with didactic theories and by studying examples of good practice to implement more studentcentered activities.
Keywords: engineering education, technology education, active learning, project oriented
learning, experience based learning, problem based learning.
INTRODUCTION
Rapid development of technology in
recent decades is a challenge for engineering
education in various aspects. Among other
issues, engineering educators need to
consider: (i) contemporary content of the
courses, (ii) state-of-the-art appliances and
devices, (iii) potential of e-learning, and (iv)
teaching methods and approaches.
Most obvious aspect in contemporary
engineering education is how to incorporate
topics about recent technologies into the
syllabus. Even though students as well as
employers expect state-of-the-art content of
the courses, it is not straightforward how to
introduce such topics not being detrimental
to fundamental knowledge. Furthermore,
new technologies are often very complex and

require adaptation of learning contents
considering prior knowledge of students. For
example, liquid crystal displays (LCDs) are a
part of a number of different appliances, but
it is not generally taught about the physic
behind the liquid crystals. Pavlin et al.
(2010) presented some experimental ideas
how to teach about liquid crystals to prehigher students. Another emerging theme is
about nanotechnology. This multidisciplinary
field is a result of progress in science and
engineering
at
the
nanoscale,
so
consequently there is a demand for specific
professional knowledge and skills (Ernst,
2009). In electrical engineering, fast
development of embedded systems requires
Page 207

July 9-11, 2012
implementation of complex hardware
facilities incorporating, for example, an
ARM9 based reference platforms (Huang
and Hu, 2007). Nevertheless, there are
numerous examples of studies regarding
introducing contemporary content into
engineering courses.
Technology-enhanced
education
implements
various
state-of-the-art
appliances and devices. Remote laboratories
in science and engineering are solution for
construction of real (not virtual) experiments
and exercises in a distance-learning manner
(Cooper, 2008). Computers equipped with
the data acquisition systems (DAQ) have
become a part of laboratory apparatus.
Kocijancic and Jamek (2008) reported about
computerized laboratory activities in a
course of operation of electrical machines.
DAQ systems can be also effectively
implemented in teaching programming
languages (Kocijancic et al., 2008).
Internet age has a significant effect
on education through e-learning, virtual
laboratories, computer simulations etc. Elearning is emerging method for distributing
education resources. Lin et al. (2010)
reported that students supported multimedia
e-learning system developed at the
technology university in Taiwan. Computer
simulations of phenomena and devices are a
key element of so called virtual laboratories,
which are usually cost effective compared to
real laboratories (Makasiranondh, 2010).
However, practical hands-on skills are still
highly required by potential employers, so elearning is often combined with campus
based learning in so called blended learning
approach (Deghaidy and Nouby, 2008).
While contemporary technologies influenced
engineering education significantly and
required
continuous
development,
development of teaching methods and
approaches is not so noticeable. The mission
of educators is to adequately prepare students
for employment as well as for lifelong
learning. Accordingly, learning objectives
need to be taken into account. Educational
psychologists classify learning objectives
into three domains: cognitive (knowledge,
mental skills, processing of information),
affective (attitudes and feelings) and
psychomotor (manipulative or physical
skills). The prevailing domain in (especially)

higher education is cognitive, though the
other two are not negligible. Most prevailing
for cognitive domain is so called Bloom
taxonomy (classification) first published in
1956 (Bloom et al., 1956). During the 1990's,
Anderson and Krathowohl (2001) updated
the taxonomy, hoping to add relevance for
21st century students and teachers
(Forehand, M., 2005). The revised Blooms
taxonomy introduced the following six
cognitive levels quoted from lower to higher
order thinking skills (OTS): (i) remembering
recall or remember the information, (ii)
understanding explain ideas and concepts,
(iii) applying using information in a new
way, (iv) analyzing distinguish between
different parts, (v) evaluating justify a
stand or decision, and (vi) Creating create
new product or point of view.
The three lowest levels as
hierarchically ordered are necessary in
learning processes. However, the three
higher levels may be considered as parallel.
Lower cognitive levels are not necessarily
easy for students and high levels difficult.
For example, remembering (1st level) may be
difficult if there is a lot of information to
remember. Creating new product (5th level)
can be easy if students are highly motivated.
Learning processes is not always
necessary for starting with lower and
following by higher cognitive levels. For
example, one can start with application
before introducing concepts. From this
viewpoint, two very distinct and opposing
instructional approaches are inductive and
deductive. In deductive teaching (ruledriven, top-down), educator typically
provides information on rules and general
principles, describes or demonstrates chosen
examples to confirm the concept, and finally
gives students a chance to practice, evaluate
and create. In inductive teaching, an educator
provides real-world examples, then the
students practice in order to figure out the
general concept and rules by themselves.
While deductive teaching is more teachercentered, inductive teaching is studentcentered. Learning is supposed to be a
balanced combination of both approaches in
order to achieve comprehensive and effective
knowledge and skills.
Page 208

July 9-11, 2012
Prince and Felder (2006) claim, that
deductive instruction is dominant in
engineering and science teaching. To
develop higher cognitive levels, the authors
emphasize inductive teaching methods
dividing them into (i) inquiry learning, (ii)
problem-based learning, (iii) project-based
learning, (iv) case-based teaching, (v)
discovery learning, and (vi) just-in-time
teaching.
BRIEF DEFINITIONS OF CHOSEN
STUDENT-CENTERED METHODS
In the paper we focus on three terms
related
to
student-centered
methods
significant for engineering education.
Problem-based learning: Finkle and Torp
(1995) define problem-based learning as "a
curriculum development and instructional
system that simultaneously develops both
problem solving strategies and disciplinary
knowledge bases and skills by placing
students in the active role of problem-solver
confronted with an ill-structured problem
that mirrors real-world problems."
Experience-based learning is "that
the experience of the learner occupies central
place in all considerations of teaching and
learning. This experience may comprise
earlier events in the life of the learner,
current life events, or those arising from the
learner's
participation
in
activities
implemented by teachers and facilitators."
(Andresen et al., 1999). Similar terms are
experimental learning, learning-by-doing and
discovery learning.
Project-oriented learning engages
learners in some kinds of projects that
usually will lead to products. However, the
main goal of the process is the learning effect
and not the product itself.
More information and links about problembased and project-oriented learning can be
obtained
online
from
http://edutechwiki.unige.ch/en/.
ANALYSIS OF STUDENT-CENTERED
METHODS
IN
ENGINEERING
EDUCATION
Engineering educators are generally
well qualified in their professional
disciplines. Conversely, this is not so
obvious
regarding
their
teaching
competencies. At the Burapha University

(BUU), Faculty of Engineering, Bangsaen,
ChonBuri, Thailand we had a discussion
group on 2nd February 2012 with a working
title Methods of Contemporary Teaching in
Engineering Education attended by 11
educators, 3 students (all BUU) and the first
author of this paper. We discussed two areas:
(i) current knowledge and motivation of
students, especially freshmen students and
(ii) teaching methods and approaches.
(i) General opinion was that
knowledge as well as motivation of freshmen
students is decreasing in recent years.
Consequently, professors are not entirely
satisfied with the knowledge of the average
student during whole study including when
graduating.
(ii) Educators are inadequately
familiar with general didactic terms such as
cognitive
taxonomy,
experience-based
learning, inquiry-based learning, problembased learning, project-oriented learning, etc.
Furthermore, they agreed that they test their
students mostly on lower cognitive levels.
In order to get quantitative
information about the discussed topics, we
prepared an online questionnaire. We invited
educators to fill-out the questionnaire from
Thailand that is from Burapha University,
Faculty of Engineering as well as from two
universities from Slovenia (Europe),
University of Ljubljana, Faculty of Electrical
Engineering and Faculty of Mechanical
Engineering and University of Maribor,
Faculty of Electrical Engineering and
Computer Science. Collecting information
by the questionnaire is currently work in
progress so we cannot report about the
outcomes.
EXAMPLES OF STUDENT-CENTERED
ACTIVITIES
Implementation of student-centered
methods in engineering is not as
straightforward as it seems from definitions.
Actual activities usually combine different
methods and sometimes it is difficult to
classify them say as problem-based or
experience-based learning. Furthermore,
different courses have diverse possibility to
introduce the student-centered methods. For
example, there are obviously more chances
Page 209

July 9-11, 2012
for student-centered methods in courses in
robotics as in electrodynamics course. Most
often educators report about implementation
of project-oriented learning, for example,
about implementing contemporary magnetic
sensor in pre-higher technology education
(antej and Kocijancic, 2011) or projects in
robotics to undergraduate mechanical
engineering students.
To illustrate some student-centered
methods, the paper presents some activities
that were developed and implemented at the:
University of Ljubljana, Faculty of
Education, Department of Physics and
Technology,
Slovenia
Europe
(abbreviation UL) and
Burapha University, Faculty of Engineering,
Department of electrical Engineering,
Thailand (abbreviation BUU).
Examples of problem-based tests in
introductory electrical engineering
Engineering students at BUU have
theoretical course in Electrical Circuits 1 in
the 4th semester followed by Electrical
Engineering Laboratory 1 in the 5th semester.
Usual exercise lasts 150 minutes, once per
week, 16 weeks. Main objectives of the
course are: (i) to acquire electrical instrument
skills, (ii) to handle electronics components
and practice wiring of simple circuits, (iii) to
present measured data numerically and
graphically as well as to analyze the data,
and (iv) to employ theoretical knowledge and
mathematical skills in practical situations.
Because of a large number of
students (more then 100), the exercises are
organized in teams of three students per
working place. Since they work in teams,
some students may not be motivated to
actively do the lab exercises because her/his
student colleague may do the most of the
required work. To test each student
individually, we introduced problem-based
test two times in a semester. Thus,
approximately every 7th exercise, each
student has 50 minutes to practically solve
given problem. Therefore, instead of 150
minutes work in a group of three students,
each student has 50 minutes to solve the
problem by her/himself emphasizing
practical work. To illustrate activity we
outline two typical example problems.
Problem 1
Suppose R1, R2 and R3 are 1k in a circuit
below. What are electrical currents I1, I2 and I3
measured by a multi-meter? Compare theoretical
and measured values of I1, I2 and I3.
1. Measure the currents using ammeters and

compute values of I1, I2 and I3 using
Kirchhoffs laws.
physics
Measured values (mA)
Theoretical values
(mA)
I1=
I1
VR1/R
1
I2=
VR2/R
2
I3=
I2
I3
VR3/R
3
To compute the electrical currents,

students need to write down complete
procedure including the system of equations.
According to revised Blooms taxonomy, the
tasks required 1st to 3rd cognitive levels. After
students finish the measurements and
calculations, they need to decide between
true or false questions for a series of 7
statements. First five (2.1 to 2.5) are rather
straightforward requiring 1st and 2nd
cognitive levels while 2.6 and 2.7 require 3rd
Page 210

July 9-11, 2012
and 4th cognitive levels. Only last three
statements are presented.
2. Make correct signs
(true) or (false)
in front of the following statements:
2.5) Kirchhoffs Voltage Law said that
the directed sum of the voltage around
any closed circuit is zero.
2.6) If wires are unplugged from the 5 V
power supply and placed apart (not
connected), voltage on R1 is equal or
similar to voltage on R3.
2.7) If R3 is taken off, electrical current
A.
through R1 is
Statement 2.6 is , the other two
are . In the last part of the test, students
need to explain their choice for true/false,
what is obviously the 5th cognitive level
(evaluation) in revised Blooms taxonomy.
3.1) Explain your choice between true

and false for statement 2.6.
2.
Fill-in a correct answer in the blanks
according to the following questions:
2.1) Resistance color code of 470 is
2.2) Peak voltage on R =
3.2) Explain your choice between true

and false for statement 2.7.
The aim of the next problem is to test
if students know how to measure the
lagging and leading phases.
2.3) Root mean square (RMS) voltage on

R = .
3. Answer the following questions:
3.1) For an inductor, which one between
current phase and voltage phase is
lagging?
Problem 2
Make a RL circuit using a function
generator and an oscilloscope (see the
scheme below). Set function generator to
generate AC sine signal with 5 V peak
voltage and frequency to 1 kHz. Suppose
R is 470 and an inductor is of an
unknown value.
1. Measure voltage on an inductor and
draw its signal and fill corresponding
values in blanks.
3.2) If R is increased more than 50 M,

what is the current phase compared to the
voltage phase? Why does this happen?
Tasks 1, 2 and 3.1 require instrument
skills, graphical presentation of signals and
analysis of measured data on cognitive levels
1 and 2. The task 3.2 is level 5 and 6.
Examples of problem-based tasks in
electronics
The Two-subject Teacher is a study
program at UL for teachers at lower
Page 211

July 9-11, 2012
secondary school (age of pupils 12 to 15).
Technology subject can be combined with
Math, Physics or Computing. Besides
courses for both subjects, students have
pedagogic module comprising courses about
general didactics, psychology, etc.
One of the modules is Electrical
engineering. In 2nd semester they have a
course in electrotechnics, in 4th semester is
electronics, in 5th semester projects in
electronics and in 7th semester they have a
course in robotics. All courses comprise
theoretical lectures as well as laboratory
exercises in parallel.
Since students have some basic
knowledge and skills before they enter the
course in projects in electronics, exercises
have no precise instructions, pre-prepared
tables, questions, etc. Generally, students
only get the problem they need to solve, so
problem-solver is confronted with an illstructured problem that mirrors real-world
problems (see definition of problem-based
learning above). The students need to design
the circuit themselves, wire it, test it and
prepare a report, where they need to justify
their design. In the phase of circuit design, if
applicable for a chosen problem, they may
simulate the designed circuit before wiring
the real circuit (using Yenka Design and
Technology, www.yenka.com). It is obvious,
that cognitive levels from 4 to 6 are
dominating. To illustrate the concept, we
present two example problems.
The first example is about using JK
flop. During this exercise, students
simulation software and do not make
circuits. The general problem has 5
problems.
flipuse
real
sub-
Problem 1
Use JK flip-flop to simulate circuits with
different functions. Save files created by
Yenka simulation software to your folder for
each circuit (note that tasks 3 and 5 require 2

circuits each!).
1. Through the internet search for a datasheet about integrated circuit (IC)
74HC76. There are two JK flip-flops (f-f)
in the IC. From the rule table, find those
functions which correspond to RS f-f, D
f-f and T f-f.
2. Describe the basic operation of the RS f-f.
Then use JK f-f to design RS f-f.
3. Do the same as in task 2 in order to
design D f-f and T f-f.
4. Use JK flip-flops (f-fs) to design 4-bit
shift register with serial input and parallel
output.
5. Do the same as in task 4 in order to
design 4-bit shift register with parallel
input and serial output and parallel input
and parallel output.
The solution for tasks 3 is shown in Fig. 1.
Fig 1. Simulation circuits of D flip-flop and

T flip-flop developed in simulation software
named Yenka.
Required cognitive levels to accomplish
this problem vary from 3 to 5.
Page 212

July 9-11, 2012
In the next problem, students need to
create a new product, so they reach the
highest (6th) cognitive level.
Problem 2
We need to design a circuit which will
turn on a red light signal, if the temperature
would be above chosen limit temperature.
The green light signal should be turned on
for the first time when the temperature is
above limit temperature and should stay
turned on even if later the temperature
decreases below the limit. Limit temperature
should be adjustable with a potentiometer.
Circuit should have a button which can be
used to turn off the green light.
Possible solution for task 3 is shown in
Fig. 2. Note that students need to design and
test real circuit.
a report where they are also required to

propose improvements.
We present a project, when the initial idea
was to develop a robot hen according to the
story The Goose That Laid the Golden Eggs.
If the hen finds seeds, it lays an egg. The
construction shown in Fig. 3 consists of
controller unit developed at UL, 2 DC
motors for 2 wheels (instead of gooses legs),
2 servomotors, one to move its neck and one
to lay an egg and infrared distance sensor
instead of eyes. Project integrated material
processing and mechanical assembling,
electronics circuit design and programming
of ATMega-16 microcontroller in Bascom
programming language. Video is available
on
Youtube.
www.youtube.com/watch?feature=player_e
mbedded&v=2kNMzcLtdCg.
213
Fig 3. Photograph of a robot hen that leg

golden eggs.
This example project definitely reaches
highest cognitive levels 5 and 6.
Fig. 2. Simulation of solution of problem 2.
CONCLUSIONS
Example of project-oriented learning in

robotics
Course in robotics at UL starts with
guided laboratory exercises, while the last
third is dedicated to projects. Teams with up
to two students suggest an idea for the
project. After some discussions, they design,
accomplish and test the outcome. They write
Educators of future engineers have

difficult mission in order to provide
contemporary courses due to rapid
development of technologies. Introducing
state-of-the-art course content, prevailing
appliances and devices, e-learning support,
etc. are some of the challenges. On the other
hand, they may not be adequately concerned
about their teaching methods, especially
Page 213

July 9-11, 2012
regarding student-centered activities. There
may be many reasons for that; one of them is
a lack of knowledge on different teaching
methods and approaches. Furthermore, it is
not straightforward to implement general
didactic theories and concepts in concrete
courses. It is therefore essential for
engineering educators to become more
familiar with didactic theories and to study
examples of good practice in order to
implement more student-centered activities.
This is however difficult to imply in large
number of students in a lab group and also
requires much more effort of educators.
Page 214

July 9-11, 2012
REFERENCES
Anderson, L.W. and Krathwohl, D.R. (Ed.). 2001. A taxonomy for Learning, teaching, and
assessing: A revision of Blooms taxonomy of educational objectives. Addison Wesley
Longman, New York.
Andresen, L., Boud, D. and Cohen, R. 1999. Experience-based Learning, pp. 225-239. In: Folley,
G. (Ed). Understanding adult education and training. Second edition.. Allen & Unwin,
Sydney; [cited 2012 Mar 22]; Available from:
http://complexworld.pbworks.com/f/Experience-based%2520learning.pdf.
Bloom, B.S. (Ed.), Engelhart, M.D., Furst, E.J., Hill, W.H., & Krathwohl, D.R. 1956. Taxonomy
of educational objectives: Handbook I: Cognitive domain. David McKay, New York.
Cooper, M. 2008. Remote laboratories in teaching and learning issues impinging on
widespread
adoption in science and engineering education. International Journal of Online Engineering (iJOE)
[serial online] 1 (1) [cited 2012 Mar 22]; Available from: URL:
http://oro.open.ac.uk/9748/1/iJOE-2005-11.pdf
Deghaidy, H. and Nouby, A. 2008. Effectiveness of a blended e-learning cooperative approach in
an Egyptian teacher education programme. Computers & Education 51 (3): 988-1006.
Ernst, J. V. 2009. Nanotechnology Education: Contemporary Content and Approaches. The
Journal of Technology Studies [serial online] 35 (1) [cited 2012 Mar 22]; Available from:
URL: http://scholar.lib.vt.edu/ejournals/JOTS/v35/v35n1/ernst.html
Finkle, S.L. y Torp, L.L., Introductory Documents, Illinois Math and Science Academy, 1995.
Forehand, M. 2005. Bloom's taxonomy: Original and revised. In Orey, M. (Ed.), Emerging
perspectives on learning, teaching, and technology ; Department of Educational
Psychology and Instructional Technology, University of Georgia; [cited 2012 Mar 22]; Available
from: http://projects.coe.uga.edu/epltt/index.php?title=Bloom%27s_Taxonomy
Huang, Y-L. and Hu, J-S. 2007. The Curriculum and Teaching Laboratory for Embedded Systems.
In: 2007 Workshop on Embedded Systems Education ; Salzburg, Austria; 2007 Oct 4-5;
pp. 11-18. Sweden: Royal Institute of Technology, 2007; [cited 2012 Mar 22]; Available
from:
http://www.lulu.com/items/volume_65/7343000/7343892/1/print/WESE2007_Proceeding
s_Complete_--_lulu_for_print.pdf#page=17
Kocijancic, S. and Jamek, J. 2008. Investigating the operation of electrical machines with
computerised laboratory activities. International Journal of Engineering Education 23 (1):
30-35.
Kocijancic, S., Kuar, T. and Rihtari, D. 2008. Introducing Programming Languages Through
Data Acquisition Examples. International Journal of Emerging Technologies in Learning
(iJET) 3 (S2): 28-33.
Lin, Y-C., Chen, Y-C. and Yeh, R.C. 2010. Understanding college students continuing intentions
to use multimedia e-learning systems. World Transactions on Engineering and Technology
Education [serial online] 8 (4): 488-493 [cited 2012 Mar 22]; Available from: URL:
http://www.wiete.com.au/journals/WTE&TE/Pages/Vol.8,%20No.4%20%282010%29/1420-Lin-Y-C.pdf
Makasiranondh, W., Maj, S. P. and Veal, D. 2010. Pedagogical evaluation of simulation tools
usage in Network Technology Education. World Transactions on Engineering and
Technology Education [serial online] 8 (3): 321-326 [cited 2012 Mar 22]; Available from:
URL: http://www.wiete.com.au/journals/WTE&TE/
Pavlin, J., Susman, K., Ziherl, S., Vaupoti, N. and epi, M. 2010. How to teach liquid crystals.
Molecular Crystals and Liquid Crystals 547 (1): 255-261.
Prince, M. J. and Felder, R. M. 2006. Inductive Teaching and Learning Methods: Definitions,
Comparisons, and Research Bases. Journal of Engineering Education 95 (2): 123-138.
Page 215

July 9-11, 2012
antej, G. and Kocijancic, S. 2011. Commencing projects that implement the use of magnetic
sensors in pre-higher technology education. In: Pudlowski, Z. and Kocijancic, S. (Ed). 2nd
World Conference on Technology and Engineering Education ; Ljubljana, Slovenia; 2011 Sept 58; pp. 124-127. Melbourne, Australia: World Institute for Engineering and Technology
Education (WIETE), 2011; [cited 2012 Mar 22]; Available
from:http://www.wiete.com.au/conferences/2wcte /papers/23-07-Santej-G.pdf
Pages/Vol.8,%20No.3%20%282010%29/13-12-Makasiranondh.pdf
Page 216

July 9-11, 2012
HUO98-21
The Synthesis of Self Assessment Reports

and Analysis of The Audience Satisfaction
of The Thai Teacher TV Project for Two Years
Pongthep Jiraro
Faculty of Education Burapha University
169 , Longhad Bangsean Road, Seansuk , Muang , ChonburiThailand 20131.
E-mail: Pongthep @ buu.ac.th
ABSTRACT
The objectives of these studies were to synthesize the self assessment report (SAR)
of the Thai teacher TV project and to analyze the level of satisfaction of the project audiences
in the past two years. The subject from 5 documents (SAR) and 1, 370samples from the
project target groups, the collecting data from questionnaire . The research found that the
satisfaction in general was good. The most satisfaction is a worthiness of watching , but The
lowest satisfaction is channel to approach. Age of target groups has negative relation with
satisfaction in channel to approach. Age of the target group has positive relation with
satisfaction in the content of presentation. The strength of this project was effective website.
The product of this project was importance source for teacher and other educational staffs,
many channels to approach, and the project has a good internal quality assurance system for
the quality control. Finally, the main suggestion for the project as an emphasis on the website
approach , free TV should fine a suitability time for the target groups and activity of this
project to increase and encourage more satisfaction .
Keywords: Self Assessment Reports , Satisfaction , Thai Teacher TV Project
INTRODUCTION
Thai Teacher TV project has managed for 2years. We did an internal quality assurance to
guarantee the quality of the project. We did project assessments continuously and self assessment
reports are 5reports for more information. Next, we synthesized a self assessment report to the
overall image to show the development of the project from assessment within tangibles and
continuously. This research is important step to get information for project development. The
result of this project had many advantages for project executive and project inventor for next step.

This research used self assessment report (SAR) of project ) 5-1April 2010 to September
2011 (and the audiences of teacher TV project in the education International conference
EDUCA 2011, the amount whole30 , 329persons. An implement to collect data is questionnaire ,
the amount 1, 370whole. The data was analyzed by frequency distribution, percentage, Mean and
standard deviation (SD). Then, we compared Mean of teachers satisfaction by independent t-test,
analysis of variance (One-way ANOVA), Pearson's product moment correlation and content
analysis.
Page 217

July 9-11, 2012
Results
Table 1 A comparison of teachers satisfaction for teacher TV project for two years in different
teachers education background by one-way ANOVA
variable name
source
variance
Satisfaction of approach
Between
channel
Groups
Within
Groups
Total
List of the presentations
Between
Groups
Within
Groups
Total
Worthiness of watching
Between
Groups
Within
Groups
Total
Activity of Teacher TV
Between
Network
Groups
Within
Groups
Total
Impact by this project
Between
Groups
Within
Groups
Total
totally satisfaction
Between
Groups
Within
Groups
Total
* P < .05 , ** P < .01 , ** P < .001
of SS
df
MS
Sig
3.160
1.053
1.879
.131
765.093
1365
.561
768.252
6.246
1368
3
2.082
444.650
1366
.326
450.896
4.839
1369
3
1.613
505.172
1366
.370
510.012
8.607
1369
3
2.869
635.186
1365
.465
643.793
6.068
1368
3
2.023
772.192
1365
.566
778.261
4.919
1368
3
1.640
374.786
1366
.274
379.705
1369
6.396*** .000
4.362**
.005
6.165*** .000
3.576*
.014
5.976*** .000
Table 2 Mean (M) and standard deviation(SD) of Satisfaction of approach channel follow with
part of satisfaction and total
part of
statement
satisfaction
1
Satisfaction of approach channel
2
List of the presentations
3
Worthiness of watching
4
Activity of Teacher TV Network
5
Impact by this project
total satisfaction
Page 218
M
3.6177
4.0055
4.0975
4.0774
4.0368
3.9518
SD
.74939
.57390
.61036
.68601
.75426
.52665
satisfaction
good
good
good
good
good
good

July 9-11, 2012
The satisfaction for the content of presentations from Teacher TV Project totally is
good levels (M = 3.95, S.D. = (0.53, by the worthiness of watching was the highest
satisfaction, (M = 4.10, S.D. = (0.61, but by approach channel is the lowest (M = 3.62, S.D. =
(0.75.
A comparison of the presentation content of the audience different by education in
total finding that was the satisfaction of the master's degree higher than bachelor's degree and
lower the bachelor's degree (.05 significance level) . The list of the presentations finding that ,
person have the qualification lowers the bachelor's degree , there is the a less satisfaction than
bachelor's degree , master's degree , doctorate , and master's degree were higher than the
bachelor's degree(.05 significance level) . The activity of Teacher TV Network lowers the
bachelor's degree , there is a lower satisfaction. The bachelor's degree , master's degree was
higher than the bachelor's degree (.05 significance level). The worthiness of watching , the
satisfaction of the lowers bachelor's degree is the a less satisfaction , bachelor's degree , master's
degree , and master's degree more satisfaction than bachelor's degree(.05 significance level) . 05
. The impact by this project , the satisfaction of lowers bachelor's degree , and the bachelor's
degree are the less satisfaction than master's degree(.05 significance level) . 05.The status
differently for impact by this project , the satisfaction of the executive higher than
undergraduate teacher , and a parent(.05 significance level) .
The coefficient is related of the satisfaction with , age finding that , age of the target
group has the relation in approach channel in the negative (.05 significance level), and finding
that , age of the target group has the positive relation with satisfaction on the presentation list
(.05 significance level) .
The concluding of internal quality assessment of Teacher TV project the past 2 year
by Self Assessment Report(SAR) finding that , the proceeding of Teacher TV project , it has
continue developed , first time was at fair level , after that the results were good to excellent
in the finally two years.
The strength of the project is the effective website , the result of the project is an
important knowledge source for a teacher and education staffs , there is a various content , the
project systematically of internal quality assurance continually, the project has many of
readiness by input of project , there is administrative project development is in high-level.
The weakness of this project in Self Assessment Report , the summarize the weakness of
the project in the following , the satisfaction of the project that still doesn't arrive at excellent
level , administration risk system of the project lacks the continuity in the activity develops , the
lower training to the staff in the project , and the satisfaction of a member in attending activity
of the Teacher TV project still not high satisfaction as expected , the data feed back a few
development and still don't become visible , and still not continual as expected.
Page 219

July 9-11, 2012
Diagram 1
total
A development of self assessment result

of teacher TV project for two years
verygood
good
verygood
good
neutral
times
Discussion
The total satisfaction was good. The worthiness of watching was the highest satisfaction ,
but the approach channel is the lowest because the presentation in project was worthwhile to
cause the idea or trend in the routine work for them ,but however still get into trouble the lead
presents by free TV which majority likes and can appreciate easy but the presents while
inappropriate suit is the cause of the lowest approach channel.
Every total satisfaction cause who have higher educate qualification will more satisfaction
than other, particularly the master's degree in education has higher satisfaction than other because
more Thai teachers get master's degree because of level master's degree education has higher
possibility master's degree can synthetic and analysis well. Teacher TV project effect was good
for audience should must have advanced stage skill in synthetic and analysis about something for
integrating or applying. Then, the project made many advantages for teacher and teachers
satisfaction.
In different status of audiences, the impact of this project found that the satisfaction of
the
executive
higher
than
undergraduate
teacher
and
parents
because
the executive is an advantage from the project most because of the list of Teacher TV project
emphasizes to develops a teacher throughout both of substance that covers every substance group
and limitation development teacher reduction and they can do all of provincial time throughout
no limited by local. This project can develop teachers. The executive can go to one level.
Moreover, the executive has still the trend or the substance or the way from the list in the project
can develop teachers. The results show that master's degree qualification has more satisfaction
teacher TV project than other because of the executive has important property assembles a
position must master's degree everybody qualification before reaches a position that the official
has noted for the confidence system to administrates the education and a parents who use
education of the school service that who come to the executive of master's degree at least.
The coefficient is related of the satisfaction with age finding that age of target group has
relation in approach channel. In the minus show that old age are lower satisfied in approach
Page 220

July 9-11, 2012
channel than the young age and the young age more satisfied than older because of old people
will more like from free the TV. They do not like high technology such as , a television changes
the artificial satellite or from the Internet but free TV cannot finding because of don't wish the
profit. Then the time for the presentation inappropriate to suit as expected , such as late at night
or present time everybody can not open can watch it so satisfaction is low but the lower old
age higher easiness and convenient in using technology assemble with the project has the
completeness network , Internet ,and so convenient in reaching or download can keep to
study when they needs. So, the younger get higher satisfaction than the another.
The result show that age of the target group positive relation with satisfaction on the
presentation list show than the old age higher satisfied the present than other and in younger will
lower satisfied because a younger audience tends that the qualification is uneducated more
and lack analysis or synthetic skill and without expertise applicability hoping will apply
immediately the substance that correspond the younger requirement make to have the lower
satisfaction for the older are higher correspond education and advanced stage level ,so they
high satisfied because of this project has already can induce applied or analysis and synthetic
more than other so it higher satisfaction than other , correspond with the result of the research
above.
Suggestion
1. The revelation spreads the project should encourage appreciate with internet or website
too much because this way can accept everywhere and all time.
2. The public television should fine the time that the suitability to should for a teacher
that they can reach to see at a house or their residence .
3. The project should develop an administration risk system of the project about passing
on knowledge understanding and builds good attitude of the project continuity in the activity
develops the officer by the training. The seminar to gives the knowledge to the staff within the
project.
4. The project should to encourage the audience who attend Teacher TV network for
the higher satisfaction more and more .
Policy Suggestion
.1After , there is completed innovation by first already, an institute should manage the
next by where is responsible affiliated with education foundation organization.
.2Teacher education foundation developments should fix to the policy , there is the
official letter from education foundation or local education to go to still , secondary education ,
and due to the school .
.3The public information should show in two ways. One is follow by government service
system. Another one is the privacy advertising.
.4The project should join with the institute produces an undergraduate , Science of
Education student , education science , and government officer institute emphasizes
undergraduate development , teacher student , have applying has from the project.
.5The project should supposed affecting with the human developing in primary
education, by might apply it to claim as same as the part of staff training and can apply to
the property of a teacher who has training.
.6The project should bring to the part of school quality assurance for the
development of teacher .
ACKNOWLEDGEMENTS
Grateful acknowledgement is given to department of research and applied
psychology, faculty of education , Burapha University.
Page 221

July 9-11, 2012
REFERENCES
Aneksuk ,Sompoch and other. 2011. An opinion of television teacher program from the
television media , DVD , and website (April - December 2011)
Chaiwimon, Rapin and other. 2010. Knowledge and Teaching skills Needs Assessment of the
Teachers at the basic education level for the development of Thai Teacher TV
system.
Faculty of Education , Burapha University . 2010 . Operating Trend Teacher TV project: Chonburi,
Faculty of Education , Burapha University.
Jiraro, Pongthep. 2010. Needs Assessment of Educational Research & Development from
Teacher TV Issue for the Basic Educational Teachers In Chon buri Province
Thailand.
Jiraro, Pongthep and other. 2011. Analysis and Development of the Internal Quality
AssuranceSystem for Thai Teacher TV Project.
Project Evaluation and Internal Quality Assurance Committee.2010-2012 .Self Assessment
Report of Teacher TV project (Volume 1-5). Chonburi, Faculty of Education ,
Burapha University.
Suratrungchai, Vichit and others. 2010. Analysis of Educational Policies and Other Related
to Teacher TV Project.
* The instructor in Department of Research and Applied Psychology Faculty of Education

In Burapha University Thailand.
Page 222

July 9-11, 2012
HUO143-23
VIEWS OF TOURISM IMPACTS FROM THE CULTURAL

MARGINS OF THAI SOCIETY
Kanokkarn Kaewnuch3and Chokechai Suveatwatanakul
NIDA centre of Integrated Tourism Management Studies (NITs)
National Institute of Development Administration
118 Moo3, Sereethai Road , Klong-Chan, Bangkapi,Bangkok 10240 THAILAND
E-mail: kkaewnuch@gmail.com
ABSTRACT
The tribal people in Thailand have been promoted as a cultural tourism attraction for
several decades and have been the focus of a range of research studies. This paper seeks to extend
our understanding of these two culturally distinct groups. The analysis discusses the perceptions of
Karen and Hmong employees working for external tourism actors (ETAs), tourism enterprises
managed by Thai nationals. The analysis focuses upon the respondents perceptions regarding their
perceptions of impacts arising from working with the Thai. Focus groups were undertaken and two
hundred questionnaires administered. The research demonstrated that the cultural backgrounds and
ethnicities of these two tribes do effect their perceptions resulting in differences in their views of
and attitudes to employment in the tourism industry.
Keywords: hill tribe, tourism, perception, impact

1.INTRODUCTION
In recent years there has been a growth in multi-cultural working environments (Fine et al.
1990; Triandis et al. 1993), not only in the developed world (Berry 1997) but also in less
developed countries and regions, (Wilson et al. 2001). Vergunst (2008) argues that as societies
develop economically there is an increased demand for resources, including human resources and
as a result, there is an increased degree of interaction between people from more developed, often
urban areas and those from the less developed, often rural areas, despite similarities or
dissimilarities in culture and/or ethnicity. Many countries in both the developed and developing
world view the tourism industry as an agent for developing rural areas and in some countries,
including Thailand, tourism is associated with the development of remote areas inhabited by hill
tribes (Rajani 2002; Sutamongkol 2007). The Thai government has for some time recognised
tourism as an opportunity for reducing the prosperity gap between urban and rural areas, retaining
the population and improving the welfare of rural communities (Community Based Tourism
Institute (CBTI) 2008). Therefore, the Thai government promotes the development of hill tribe
tourism to both private and public sector investors in order to create job opportunities and thereby
improve the incomes of local people.
The relationship between tourism and hill tribe people can be examined from a number of
different angles. Some of these have been well explored over a relatively long period. For
example, hill tribe craft studies and hill tribe tourism impacts have been undertaken in the late
1970s and 1980s (Cohen 2000). Previous tourism impact studies (Cohen 1979, Dearden 1992,
3
Lecturer, NIDA centre of Integrated Tourism Management Studies (NITs)
Page 223

July 9-11, 2012
Parnwell 1996) have examined the perceptions of host populations towards their involvement in
the tourism industry in general. Specific research on the perceptions of employment by minority
population groups such as hill tribes with incoming external tourism actors has, however, not been
reported. In this research external tourism actors (ETAs) are defined as Thai entrepreneurs who
tend to dominate a host community due to their higher social status and wealth when compared to
the hill tribe people. They are individuals from outside the tribal community who are not tourists,
who are not there for leisure purposes and who tend to stay for longer than 12 months. They are
attracted by the opportunity to develop their businesses in a new location. In Doi Inthanon they
have sought to develop tourism enterprises which include accommodation, catering outlets, tour
operations, souvenir shops, spas and tourism adventure activities.
The perceptions and attitudes of residents towards tourism employment has been
investigated in a number of studies (Pizam 1978; Lankford 1994; Andriotis 2005). However,
relatively little research has thus far been conducted on the perceptions of a tribal peoples who
work with ETAs, let alone comparing perceptions of two different tribal groups towards tourism
employment with ETAs, hence the purpose of this study was to improve our knowledge about the
experience of hill tribe communities as they integrate into Thai society. Two hypotheses were
considered; one (Ho) is that the respondents from each of the different tribes have similar
perceptions and values in relation to impacts from employment with individuals from outside their
community. The alternative hypothesis (H1) is that ethnic tribal and cultural differences will result
in differences in their views of perceived impacts by individuals of another culture in this instance
Thai national who are the majority of the Thai population.
Having introduced the background of tourism in Thailand and described the emergence of
hill tribe tourism. The rational and focus of the paper were presented. Followed by the researchs
hypothesis. The next section examines the literature related to the focus of the paper and the
theoretical framework applied in this study. Then characteristic of the selected hill tribe people and
their relationship with Thai society were reviewed. The research methodology was explained in
the following section. This is followed by the discussion of the research findings and reviewed
them in relation to the social exchange theory. The conclusions and recommendations for further
research were presented in the last section.
2. LITERATURE REVIEW
This paper will review the literature relevant to a study of residents perceptions of the
socio-cultural impacts from the interaction with ETAs. Since the focus of this paper revolves
around residents perceptions, therefore, it seems appropriate to review the relevant literature by
starting with review definitions of perceptions leading to influences of perceptions. Moreover, as
the focus of this research is on the perceived impacts between two parties of different cultures,
therefore, this section also considers a review of tourism impacts from host and guest interaction.
2.1 Definitions of perception
Schiffman and Kanuk (1987) give a broad definition for perception as the process through
which people see the world around themselves. In academic terms, they define the term more
specifically as a process by which an individual selects, organises, and interprets stimuli into a
meaningful and coherent picture of the world (Schiffman and Kanuk 1987, p. 174). Samovar and
Porter (1991), Rungapadiachy (1999) offer a similar definition defining perception as the method
by which stimuli are chosen from the external environment and interpreted into profound
meaningful internal experiences. Markin (1974); Mitchell (1987); Moutinho (1987); Truong and
King (2006) among others refer to perceptions as the processes that shape and produce what
people actually experience. Cole and Scriber (1974) partially agree with the previous definitions
yet have proposed a slightly different one that .perceptions, memory and thinking all develop
as part of the general socialisation.and are inseparably bound up withsocial relations..
According to Hargie (1986, p.47) perceptions are the impressions people form of one another and
Page 224

July 9-11, 2012
how interpretations are made concerning the behaviour of others while according to Smith (2002)
perception is a primary aspect of judgment. Perception is significant in supporting the views of an
individual, and their thinking, about the world. It determines how individuals experience objects or
events (Haakonssen 2006). Merleau-Ponty (2002, p.xi) Perception is the background from which
all acts stand out, and is presupposed by them. The emphasis of these later definitions are
particularly relevant to this investigation.
2.2 Influences of perception
According to Bronfenbrenner (1977; 1979) perception is not totally objective, it depends
on neonatal, childhood, and later experiences (Freud 1930; 1953-7; Klein 1959; 1986). According
to Supaap (1993) there are five determinants of changes in perception; these are family, friends,
school, career and the media. Pert (1997) affirms that perception is selective in what it wishes to
allow in, it also puts its own interpretation on what it lets in. Thus perception is the link between
the internal world of an individual and their external worlds, these perceptions are heavily affected
by emotions (Rungapadiachy 1999). According to Reisinger and Turner (2003) perceptions are
influenced by a number of external factors, economic, social, cultural, geographical, and internal
factors, demographic, psychographic, behaviouristic. Samovar and Porter (1991) point out that one
of the main factors that directly influence perception is culture. They explain that culture strongly
influences the environment in which people are raised, in that it exposes them to experiences and
produces meanings. Tajfel (1969) offers a similar view by suggesting that culture is a factor that
teaches people how to perceive experiences and interpret meanings, it also determines which
stimuli and criteria of the perceptions are important. Therefore, the perceptions of an individual
can be determined by culture, from which it can be concluded that, people may have different
perceptions because they have different views of the world which are constructed by their own
culture (Krench and Crutchfield 1948; Robertson 1970; Brislin and Cushner 1996).
Maznevski (1995) supports the idea by arguing that people from different cultures will
notice different pieces of information and interpret them differently. The differences in perceptions
result from the environment in which people live in or their experiences (Reisinger and Turner
2003).
In terms of perceptions of tourism development, several scholars (e.g., Pizam 1978;
Thomason et al. 1979; Murphy 1983; Tyrell and Spaulding 1984; Ap and Crompton 1993;
Brougham and Butler 1981; Husbands 1989; Lawson et al. 1998; Ryan and Montgomery 1994)
have focused on the perceptions of tourism held by residents of the same destination community
and as with Ryan and Montgomery (1994) in their study in the English Peak district, found that
residents held different perceptions and interests. Therefore, it can also be concluded that people
who live in the same community and share the same culture do not necessarily have shared
interests or perceptions and they often hold very mixed views (Hall, 1994).
2.3 Impacts result from the interaction of host community and guests (ETAs)
According to Brislin and Cushner (1996) there is an increase in intercultural and intracultural interactions throughout the world, which has an influence on behaviours, thought patterns,
socio-economic status, culture and religion etc. Ap (1990); Allen et al. (1993); Sharpley (1994);
Mathieson and Wall (2006) believe that the key to the socio-cultural impacts of tourism is the
interaction between hosts and guests. The interaction between people of different cultural
backgrounds may result in positive as well as negative outcomes (Williams 1947; Rose 1948;
Saenger 1953; Allpoty 1954; Cook 1962; Brewer and Miller 1996; Berry 2005). In the next section
the negative outcomes of the interaction between people from different cultures will be discussed
focusing on the ETAs and host residents. This is followed by a consideration of the positive
outcomes of the interactions of these two groups.
Page 225

July 9-11, 2012
Negative outcomes from the interaction between ETAs and host residents
Local people in remote / rural areas not only suffer from influx of tourists but often suffer
from invasion of outsiders who may be foreigners or mainstream Thai who open their tourism
businesses and take advantages of local resources in rural areas. As a result, local residents are
invaded by outsiders who hold different values which disrupts their culture. According to Liu et al.
(2007) tourism development in developing countries or less developed destinations is usually
dominated by the outsiders, which in this research will be referred to as ETAs who have abilities
in terms of power, connection and finance to develop tourism and own large scale activities such
as accommodation, travel, tour, catering, etc.
Host communities often are the weaker party in interactions with their guests and service
providers (UNEP 2002; Shaw and Williams 2004). Therefore, if one culture from a stronger party
interacts with a weaker one, the local community often loses its own culture, such as language,
value of beliefs, tradition etc. (Shaw and Williams 2004). As a result, not only the local residents
may lose their culture but may also become confused about their identity (Andronicou 1979).
However, Maznevski (1995) argues that when people adapt to a new lifestyle or accept a new way
of thinking does not mean they have to forget their own lifestyle or erase their prior way of
interpreting situations.
According to Keen (2002) while tourism development in rural areas may bring benefits the
destination may face serious issues such as cultural conflict and culture shock from the intrusion of
ETAs. ;(1977)Downs and Stea Andronicou (1979) ) and Hofstede2001 (share a similar view by suggesting that
the interaction between host and ETAs can cause original residents to view their community
differently which can weaken their value of beliefs due to the forces of shared culture. Huang and
Stewart (1996) and UNEP (2002) also support this idea by pointing out that the movement of
outsiders into a certain destination or a community and due to their different in cultures may
influence and restructure the host culture. For example, the agriculture which was the basis of
traditional life is replaced by, and becomes secondary to tourism (Poostchi 1986;
Rattanasuwongchai 1989; Ryan 1991; Archer et al. 2005). In the case of Thai highlanders, these
people left their traditional career path (crop cultivation and traditional farming practices in
mountain areas) to work for the ETAs in tourism industry (Cohen 2006; Pinsarn 2006).
Not only is there a decline in traditional career paths, there is also a conflict from income
contribution (Cohen 2006; HADF 2007). When the ETAs such as tour agency bring in a group of
tourists to the community they either go trekking, stay in local homestay accommodation, or join
other local activities. The ETAs are usually the ones who manage the money gained from tourists
and they often pay the local residents unequally to one another. This often creates conflicts among
residents themselves or fights between local residents and ETAs over the actual benefits they
should get from the business. As a result of all the financial the sense of harmony in the
community may be destroyed due to the business competition among the local residents
themselves which often weakens the community (HADF 2007).
McMillan and Chavis (1986) point out that the differences in cultural backgrounds and
social values between residents and outsiders can cause a problem of fractionalisation in society
which divides people into groups. As a result, it can create boundaries between residents in a
community. An irridex model by Doxey (1975) indicates that the interaction between local
residents and outsiders from two or more cultural groups, as cross-cultural contact, may not always
necessarily give positive outcomes it however, can cause friction and irritation and increases the
gap between the cultures.
Moreover, due to their differences in lifestyles and social values, ETAs and host residents
may have different expectations for their shared community (Huang and Stewart 1996). Bochner
(1982) suggests that the interaction between host and ETAs can be a threatening experience,
participants may feel like outsiders, intruding, undermining values of the other culture. It has been
argued that the more frequent interaction between people of different cultural backgrounds, the
more negative the feelings that may develop (Hofstede 1980).
Page 226

July 9-11, 2012
Feather (1976); Jackson (1989); Nyaupane, et al. (2008); Salem (2010) and also agree
that there is a negative outcome from interaction between people from different cultural
backgrounds, they affirm that differences in national origin, cultural values and cultural gaps
generate clashes of values, conflicts and disharmonies in the host community (Young 1973; Peck
and Lepie 1977; Petit-Skinner 1977; Reiter 1977; Urbanowicz 1977; Boissevain 1979; De Kadt
1979; Biddlecomb 1981; Cooke 1982; Ngunjiri 1985; Bianchi 2003; Reisinger and Turner 2003).
According to Reisinger and Turner (2003) the development of positive attitudes is not possible
since the contact between outsiders and host is superficial. Hofstede (1997, p.215) states that
interactions between outsiders and host residents is the most superficial form of cultural
encounter. Some researchers (e.g., Brewer and Miller 1984; Furnham and Bochner 1986; Milman
et al. 1990; Pizam et al. 1991; Anastasopoulos 1992; Marx 2001) state that interaction of outsiders
and host residents or the encounter between two or more groups of people with different cultural
backgrounds does not contribute to a significant positive attitude change. The results of the
interaction between outsiders and the host residents are less likely to be positive since their
relationships are mainly based on economic exchange which may add extra tension to their contact
(Uriely and Reichel 2000). Hofstede (1997) and Reisinger (2009) also suggest that this kind of
social interaction can cause original residents to view their community differently which can
weaken their value of beliefs due to the forces of shared culture.
Positive outcomes from the interaction between ETAs and host residents
It is widely recognised that the income from tourism is often much higher than what rural
people can earn from agriculture (Rajani 2002; Buadang 2004; Karabati et al. 2009), as a result,
working with ETAs has been accepted willingly in many rural areas in spite of its negative effects
(Poostchi 1986; Rattanasuwongchai 1998).
Despite its negative outcomes, it has been argued that the interaction between outsiders
and host residents may result in gaining knowledge of each other which can lead to enhancement
of attitudes towards each other and give them an opportunity to learn about the others culture and
foster social interaction (Bochner 1982). A number of scholars (e.g., Mann 1959; Nunez 1963;
Cohen 1971; Li and Yu 1974; Fulbright 1976; Robinson and Preston 1976; Bochner 1982; Pearce
1982a; Pizam 1982; Fisher and Price 1991; Pettigrew 1998; Uriely and Reichel 2000; Litvin 2003;
Reisinger and Turner 2003; Snow 2008) mention not only the negative outcomes from the
interaction between host and ETAs but also suggested that the higher the intensity of the same
contact may also results in the positive change in attitude toward hosts as well as postive outcomes
in terms of mutual appreciation, understanding, respect, tolerance and liking. Li and Yu (1974) and
Feather (1981) highlight that those who had been involved longer and those who had more time to
interact and became familiar with each other tend to develop more favorable attitudes to each
other. Cook (1962) and Thyne et al. (2006) explain that this interaction allows participants to get
to know and understand one another. Buck (1978); Bochner (1982); Pizam (1982); Uriely and
Reichel (2000) also believe that social interaction of people who have different backgrounds can
benefits host community, intrusion of outsiders not only restructure local culture but it also
improve and preserve locals traditional values.
As mentioned, people from different backgrounds tend to have different expectations
regarding their community due to their differences in lifestyles and social values. This however,
can have a positive and beneficial impact as when local people interact more with ETAs, they may
be inspired by successful careers, determination and independent thinking of ETAs, and may in
turn develop greater ambitions for themselves after they interacted, particularly after they have
worked with ETAs, that may help increase their determination to work harder in order to achieve
these ambitions (Davidson 1989). Moreover, the benefits from social interaction can result in
learning and adopting change to create and sustain social value (Dee 1998; Hogh 1998; Warren
1998). Despite the negative view of McMillan and Chavis (1986) about impact from interaction
between people with different cultural backgrounds and value of beliefs may result in
fractionalisation in society and boundaries between residents in a community. On the contrary,
Page 227

July 9-11, 2012
several studies (e.g., Myers 1962; Kakabadse et al. 2004) reveal that by working together in the
shared event can help bring people closer to one another because their involvement helps create
bond between community members. This notion is also supported by Huang and Stewart (1996)
which affirm that residents and outsiders may not have the same cultural background, and may not
necessarily have any connection to bonding, but they do share an extended amount of time
together during their involvement with one another through tourism employment, therefore, by
working together may reconcile any bonding lost due to differences in their cultural backgrounds.
In conclusion, some literature (e.g., Ap 1992) suggest that their judgement of positive or
negative outcome depends on whether or not the benefits host residents gain can outweigh the
negative outcomes. While others (e.g., Pearce 1989) believe otherwise by suggesting that the
interaction between ETAs and host residents only confirms previous attitudes toward each other,
regardless of whether these attitudes are positive or negative. Therefore, there is no confirmation
on whether an outcome of the interaction between host residents and ETAs can be more positive or
more negative, as it depends on value and judgement of individual.
2.4 Social Exchange Theory
Sutton (1967) asserts that host and guest contact can be compared to a social exchange,
therefore, the social interaction between outsiders and host residents can be assessed in terms of
perceived costs and benefits. Social exchange theory (SET), a model rooted in social psychology
was first developed by Emerson (1962) and has been widely used in tourism research to determine
residents perceptions in tourist destinations (Perdue et al. 1987; Nash 1989; Ap 1992; Allen et al.
1993; Andereck and Vogt 2000). Several researchers have applied this theory to study diversity of
perceptions in a single community (Perdue et al. 1987; Ap 1992; Madrigal 1993; Riley 1995;
Jurowski et al. 1997; Snepenger et al. 1998). These studies found that host residents favour
tourism when the benefits they acquire from tourism is greater than their losses. The theory
assumes that people select exchanges having assessed the rewards and the costs (Ap 1992).
Theoretically, residents who view the results of tourism as personally valuable and believe that the
costs do not exceed the benefits will perceive more positively and favour the introduction of
tourism (Turner 1986; Ap 1992) and these studies support this hypothesis. Reisinger and Turner
(2003) suggest that the measurement of the perceived costs and benefits depends upon the cultural
similarity and differences between participants. The more similar people are the more likely they
perceive their interaction as rewarding, and the more different they are the more likely they
perceive their interaction as being costly for them.
3. METHODOLOGY
A two stage integrated methodology was adopted to gather primary data. In the first stage
focus groups were conducted with respondents from each tribe who were employed by ETAs. The
village headman from each tribe assisted in bringing together individuals who work with ETAs
and who were willing to participate in the focus group. A focus group comprising six Karen
villagers were conducted in the Karen village headmans home, while the focus group with Hmong
took place in the resting area in the Hmong village. The profiles of the focus group respondents is
given in Table 1
Page 228

July 9-11, 2012
Table 1 Focus groups participant profiles
Karen
Name
Gender
Age
Hmong
ETA related job
Name
Gender
Age
ETA related job
Ying
Female
18
a food server
Pai
Female
19
a food server
Rongroj
Male
23
a guest house
Pee
Male
24
a campground
manager
supervisor
Mam
Female
27
a resort manager
Ae
Female
34
Somran
Male
Tong
Male
Sae-Ya
Male
25
a singer
a housekeeper/farmer Sit
Male
27
a tour guide
34
a porter/farmer
Nikom
Male
29
a hotel sous chef
42
a homestay
Nong
Female
31
a homestay manager
manager/ trekking
guide
The focus group discussions explored perceptions of the Karen and Hmong regarding
impacts perceived from working with ETAs. The data from these focus groups were analysed,
using content analysis, and grouped together to identify the major themes relating to the
respondents experience of employment with ETAs a number of which had not emerged from the
preceding review of the literature. These findings together with the findings of the literature review
were used to create and design a questionnaire which was distributed to a sample of respondents in
the selected communities in order to identify the perceptions and attitudes of Karen and Hmong
respondents. The respondents were asked to indicate their level of agreement with a series of
statements relating to the impacts they perceive to result from their working with ETAs. Each
statement was evaluated on a five point Likert scale, where 1=strongly disagree and 5=strongly
agree.
A pilot study leading to a modification of the questionnaire was undertaken with a sample
of respondents who had experienced the role of ETAs in the expansion of tourism in Doi Inthanon
and were therefore able to relate to the questionnaire. The results from the pilot tests demonstrated
that some further clarification was required and also demonstrated that face-to-face interviews
would be essential as some of the respondents had difficulties in understanding the Thai language
and others did not like to read the questions, hence in order to gain as accurate information as
possible interviewer completion was essential.
It was clear from the focus groups and general observations in the villages that the
majority of both tribes are still employed in agriculture or other non ETA-related jobs.
Unfortunately no records or data exists as to how many of the Karen and Hmong in Doi Inthanon
work with ETAs. An estimate of made by the village headmen from both tribes indicated that
approximately 150 of their tribal members work for ETAs, representing approximately 15% of
each tribal community. Based upon this information a sample size of 100 respondents from each
tribe who work for ETAs was agreed. Logistical and pragmatic factors, not least the difficulty of
finding respondents at home during daylight resulted in a snowballing approach to sampling being
applied in order to reach 100 respondents from each tribe who were working with ETAs.
Data was analyzed using SPSS Version 16. Descriptive data including frequency, mean score
Page 229

July 9-11, 2012
and median were used in discussing the distribution of responses gathered during the quantitative
survey. Differences between the samples were determined based upon the Mann Whitney U test.
In addition to the Mann-Whitney U test, the chi-square test was used in the analysis of the nominal
and categorical data collected (Field, 2006). In both cases the significant value for rejecting the
null hypothesis was 0.05 (Bryman and Cramer, 2001; Field 2006; Pallant 2001).
4. FINDINGS AND DISCUSSION
4.1 Perceptions of impacts arising from working with ETAs
Regarding similarities in the perceptions of the Karen and Hmong of the impacts upon
themselves and other employees resulting from their working with ETAs, Karen and Hmong
respondents share a number of perceptions of the impacts of their having worked with ETA's these
include a perception that there was a greater demand for female as opposed to male labour. A
finding supported by many other researchers including; De Kadt (1979), Sheldon and Var (1984),
Husbands (1989), Crompton and Sanderson (1990), Perdue et al. (1990), Madrigal (1993), Gilbert
and Clark (1997), Walpole and Goodwin (2001), Weaver and Lawton (2001), Ratz (2003), Sekhar
(2003), Kuvan and Akan (2005), Lawton (2005), Lepp (2007) and Perez and Nadal (2005), who
all reported that respondents engaged with tourism activity often felt tourism had created
employment opportunities, especially for female labour.
Moreover, the results also show that by working with ETAs and this in many cases also involved
their encountering tourists, had given respondents more confidence and allowed them to be more
open and to work and interact more easily with other nontribal people. This gain in confidence
may reflect this particular cultural context as other researchers have reported situations where there
was no gain in confidence by employees for example Milman and Pizam (1988) study in Central
Florida. Although both cases concerned the tourism industry, the hill tribe people in this study
were not only interacting with tourists but also with ETAs as they were working under the
management of ETAs or in businesses owned by ETAs. This may have resulted in their being
more familiar and adjusted to the idea of having cross cultural working contacts and might be the
reason for their increased confidence to work for and interact with others. Conversely the study in
Central Florida considered those working in locally owned and managed tourism operations and
who therefore mainly encountered cultural diversity when interacting with tourists. This may have
limited their opportunity to gain experience from working together with people from different
cultures. It can be argued that although people may work in the same industry they may not share
similar experiences. Alas and Vadi (2004) support this by arguing that people in different
organisational cultures may have a different understanding and perspective concerning of their
work experience.
Both groups also recognised that while their income increased so did their expenditures.
They were also inclined to agree that they have changed themselves to become more Thai like
and their working styles to fit their co-workers style and the culture of the workplace after they
started working with ETAs. This can be explained in terms of organisational culture in that
people within organisations act and make decisions not just on the facts of a case but also in
response to the organisations culture by acting accordingly to the corporate culture and its values
(Schein 2004; Seel 2005). The importance of keeping in touch with their tribal friends was
reflected in their concern from working with ETAs. While the results demonstrate that the Karen
and Hmong had similar perceptions of many positive impacts they differed with respect to others
Having reviewed the similarities in their perceived impacts from working with ETAs, now
lets turn to the differences in perceptions of the Karen and Hmong towards impacts upon
themselves from their working with ETAs. The results from the Mann-Whitney U test showed that
the two ethnic groups perceived seven of the thirteen impacts differently. A feature that
distinguished the Karen from the Hmong was their degree of agreement in regard to the positive
impacts from working with ETAs. The Karen tended to agree more with all the impacts mentioned
and this increased their desire not only to promote tribal cultural products such as their traditional
Page 230

July 9-11, 2012
dress, music and other cultural aspects to tourists, but also it offered a chance to learn new skills,
e.g., social interaction and management skills, improve their Thai and English, together with a
chance to learn other (nontribal) cultures including traditions, beliefs, dress and music and a
chance to develop friendships with nontribal people. These findings were consistent with those of
Brunt and Courtney (1999), Mason and Cheyne (2000), Tomljenovic and Faulkner (2000) and
Northcote and Macbeth (2005). Moreover, Liu and Var (1986) argued that tourism activities can
offer residents more choices of entertainment and encourage a variety of cultural activities.
The finding demonstrates that the cultural conflicts resulting from the arrival of ETAs are
perceived differently by the Karen and Hmong. This issue was less obvious to the Karen when
compared to Hmong. A possible explanation could be due to the characteristic of Karen, as Karen
people are more easy going and this may help them to better adapt to different cultures. A number
of Thai hill tribe case studies e.g., Buadang (2006), Sutamongkol (2007a), Naruemon and
Poonpreecha (2008) support this finding by suggesting that many Karen people tend to accept the
differences between their cultures and others and some Karen groups have assimilated Thai culture
rather than opposed it.
Another finding shows that the Karen were more in favour of ETAs than the Hmong, may
be due to the fact that the Karen had been working consistently with ETAs, for a longer period
than the Hmong. As a result, the Karen may have bonded with ETAs and become more familiar
with them causing a sense of appreciation to develop regarding the benefits people receive from
ETAs. Conversely if the employment experience is perceived negatively this may result in
residents having a negative perception towards the industry as a whole (Teye et al. 2002). To
summarise, it was demonstrated that the perceptions of impacts regarding employment, of Karen
and Hmong were similar and indeed many parallels may be drawn between them.
5. CONCLUSIONS
The research demonstrated that the Karen and Hmong shared a similar awareness of a
number of employment related issues, they did differ in the degree of their agreement. Generally
the Karen tended to agree more in regard to their bonding and developing friendships with the
Thais they worked with, to their having an increased understanding of other cultures, the new
skills acquired, and their increased appreciation of their own culture through sharing and
exchanging their cultures. This greater appreciation of their acquisition of skills and cultural
understanding reflects both their length of exposure to the tourism industry and to their established
cultural legacy (Hofstede 2001; Macleod 2004).
The results indicate that the differences in their views of the impacts of employment
between the Karen and Hmong are due to their differences in culture and historical backgrounds.
Therefore, the null hypothesis that all hill tribe people living together among Thai people, hold
similar values and perceptions of impacts from working with the Thai, is rejected and the
hypothesis that tribal cultural differences result in differences of their views of impacts is accepted.
The findings give support to the argument that it is inappropriate to view the culture of hill tribe
people' as being homogenous and confirms the view of Mayo and Jarvis (1981) that culture causes
different nationalities to arrive at similar perceptions. Each tribe has its own culture and values and
therefore they often think and behave differently. However, the results can only be generalised
cautiously as applying to the Karen and Hmong tribes since it was based on the perceptions of
particular groups of Karen and Hmong from Doi Inthanon, Chiang Mai, Thailand. Therefore,
future studies are needed to consider different locations or different groups of respondents
comparing differently variables such as, their length of employment in the tourism industry, the
age and gender of the respondents it maybe that younger hill tribe members (adolescents and
youth) might embrace the ways of outsiders more readily than older hill tribe members. Different
levels of education can be another aspect that may have an influence on hill tribe people
perceptions and their choice of actions.
Page 231

July 9-11, 2012
REFERENCES
Allen, L.R., Long, P.T., Perdue, R.R. and Kieselbach, S., 1988. The Impact of Tourism
Development on Residents' Perceptions of Community Life. Journal of Travel Research.
27(1), 1621
Andriotis, K., 2005. Community groups perceptions of and preferences for tourism development:
evidence from Crete. Journal of Hospitality & Tourism Research. 29(1), 67-90.
Ap, J., Crompton, J.L., 1993. Resident strategies for responding to tourism impacts. Journal of
Travel Research. 32(1), 47-50.
Berry, J. W., 1997. Immigration, acculturation and adaptation. Applied Psychology: An
International Review, 46, 5-34.
Brislin, R. and Cushner, K., 1996. Intercultural interactions: A Practical Guide (2nd ed.) London:
Sage Publications.
Bronfenbrenner, U., 1979. The ecology of human development: Experiments by nature and
design.Cambridge, MA: Harvard University Press.
Brougham, J.E. and Butler R.W., 1981. A segmentation analysis of resident attitudes to the social,
impact of tourism. Annals of Tourism Research 7 (4), 56990.
Brunt, P. and Hooton, N., 2010. Community responses to tourism and crime. Crime Prevention
and Community Safety. 12, 42-57.
Choy, D. 1995. The quality of tourism employment. Tourism Management, 16, 129-137
Cohen, E., 2000. The commercialization of the arts and crafts of Thailand. London: Curzon Press.
Cooper, C., Fletcher, J., Fyall, A., Gilbert, D., Wanhill, S., 2008. Tourism Principles and Practice.
(4th edition) Harlow: Longman.
Dearden, P., 1991. Tourism and sustainable development in Northern Thailand. The geographical
review. 81 (4), 400-413
De Kadt, E., 1979. Tourism Passport to development? Oxford University Press, Oxford Earley
and Randel (1997)Field, A., 2006. Discovering statistics using SPSS. London: Sage
Publications.
https://edis.ifas.ufl.edu/hr024
Granrose, C.S. and Oskamp, S., 1997. Cross-cultural work groups: Claremont Symposium on
Applied Social Psychology. London: Sage Publications.
Hall, C. M., 1992. Tourism in Antarctica: Activities, Impacts, and Management. Journal of Travel
Research, 30 (2 9).
Hindess, B. 1988. Choice, Rationality and Social Theory. London: Unwin Hyman.
Hofstede, G., 2001. Cultures consequences: comparing values, behaviours institutions and
organizations across nations. California: Sage Publications Inc. Huntington (1993
Inthanon, R. 2007. : Doi Inthanon. Chiang Mai: DINP.
Lankford, S., 1994. Attitudes and perceptions toward tourism and rural regional development.
Journal of Travel Research 32(2), 35-43.
Macleod, D. V. L., 2004. Tourism, globalization and cultural change: an island community
perspective. Clevedon: Channel View Publications.
Perdue, R., P. Long and L. Allen., 1987. Rural resident tourism perceptions and attitudes Annals of
tourism reserch. 14(3), 420-429.
Pizam, A., 1982. Tourism manpower: The state of the art. Journal of Travel Research 12, 5-9.
Rajani, B. (2002) : Hill tribe communities. Chiang Mai: Amarin Printing and
Publication.
Reisinger, Y. and Turner, W.L., 2003. Cross-cultural behaviour in tourism:
Concepts and analysis. Oxford: Bitterworth-Heinemann.
Riley, M., Ladkin, A. and Szivas, E., 2002. Tourism Employment: Analysis and Planning.
Clevedon: Channel View Publications.
Page 232

July 9-11, 2012
Robinson, M. and Johnson J.T., 1997. Is it emotion or is it stress? Gender stereotypes and the
perception of subjective experience. Londong: SpringerRoyal Project Foundation (RPF)
2003
Ryan, C., and Montgomery, D., 1994. The attitudes of Bakewell residents to tourism and issues in
community responsive tourism. Tourism Management, 15(5), 358369.
Samovar, L.A., and Porter, R.E., 1991. Intercultural communication: A reader (6th ed.). Belmont,
CA: Wadsworth Publishing Company
Sharpley, R.J., 1994. Tourism, tourists and society ELM, Huntingdon.Sheldon and Var (1984
Smith, A., 2002. The problem of perception. America: President and Fellows of Harvard College
Szivas, E., Riley, M., & Airey, D., 2003. Labour mobility into tourism: Attraction and satisfaction.
Annals of Tourism Research, 30, 64-76
Thai Development Research Institute (TDRI) 1997 Tribesman and peasants in Northern Thai
Hills. Proceedings of the first symposium of the Tribal Research Center, Chiang Mai: TRC
Theobald, W., 1998. Global tourism 2nd edition. London: Heinemann Educational Publishers
Triandis, H.C., 1976. The future of pluralism. Journal of Social Issues, 32, 179-208
Tribal Research Institute (TRI) 2007 General information programme and hill tribe peoples.
Chiang Mai: Chiang Mai University
Tribe, J. and Lewis, A. 2003. Attitudes of the young to careers in hospitality and tourism: review
and recommendation. In: Kusluvan, S., eds Managing Employee Attitudes and Behaviours
in the Tourism Industry, Nova Science, New York
Turner, J.C., 1981. The experimental social psychology of intergroup behaviour, In: Turner, J.C.
and Giles, H. (eds), Intergroup Behaviour, Blackwell, Oxford.
Wright, T. and Pollert, A., 2006. The experience of ethnic minority workers in the hotel and
catering industry: Routes to support and advice on workplace problems, Working Lives
Research Institute, London Metropolitan University
Page 233

July 9-11, 2012
HUO192-26
Knowledge Management Model for Local Occupation

Development: A Case Study of Nonthaburi Province, Thailand
Chinawong Sringam
Faculty of Management Science, Phranakhon Rajabhat University, Bangkok 10220, THAILAND
E-mail: csringam@yahoo.com
ABSTRACT
This research aims to investigate the knowledge management (KM) circumstances for the
local occupation development, and to construct a KM Model for the local occupation development
in Nonthaburi Province, Thailand. An action research technique emphasizing qualitative research
method was employed in the study. The target population comprised leaders and members of local
occupation groups. The research findings revealed that the KM circumstances of the local
occupation groups mainly covered the preservation and transmission of knowledge relating to local
wisdoms from ancestors and the creation of new knowledge. The group members learned and
shared their knowledge and experiences, and they also utilized the knowledge to develop their local
products. In relation to the KM model, a practical model detailing major steps and the relationship
of significant components was developed and proposed. In applying the KM model, local
communities and related organizations, both public and private sectors, needed to be concerned
with the philosophy of sufficiency economy, the community contexts and the community based
development.
Keywords: knowledge management, local occupation development, model construction
INTRODUCTION
The
development
of
local
occupations in local communities throughout
the country has been a major focus of Thai
government since 2001 as stated in the
Eighth National Economic and Social
Development Plan (1997-2001) (Office of the
National Economic and Social Development
Board, 1997). The government has set up the
national policy and strategies of developing
local communities using the community
based
approach
by
enhancing
the
opportunities for community people to get
involved in applying local wisdoms,
community resources and human capital to
conduct local occupations to earn their living
as well as to improve their quality of lives.
In addition, in developing the communities, it

is essential to sustainably develop the local
societies by developing human resources and
applying the sufficiency economy philosophy
initiated by His Majesty King Bhumibol
Adulyadej, the present King of Thailand.
Nonthaburi Province is an ancient
province located in the central part of
Thailand, next to Bangkok, the capital city of
the nation. Its unique culture relating to local
occupations is a major concern of local
communities and related organizations in
terms of preservation and transmission of
these occupations, perceived as local
wisdoms, to the next generation. In relation
Page 234

July 9-11, 2012
to occupation development in local

communities, the government project of
One Tambon (meaning one sub-district),
One Product or OTOP has been launched by
local authorities in every province of the
country for almost 11 years (One Tambon,
One Product, 2012: Online). However, the
follow-up study stated that there were still
some problems and obstacles regarding the
knowledge management (KM) system for the
occupation
development
in
local
communities in Nonthaburi Province
(Phranakhon Rajabhat University, 2005).
As knowledge management generally
comprises a variety of strategies and
practices used in an organization to identify,
create, capture, refine, store, manage, and
distribute knowledge for the improvement of
organization
performance
(Knowledge
Management, 2011: Online, Laudon &
Laudon, 2002; Turban et al., 2001), it is
important that local authorities have clear
concepts about KM, and KM should be well
organized and applied to help improve the
community productivity. In relation to the
KM process to be applied in local
organizations, there are differences of major
steps of KM among academics in this area of
study (Laudon & Laudon, 2002; Turban et
al., 2001; Holsapple & Joshi, 2001).
However, it can be concluded that knowledge
management is mainly about the management
of knowledge covering organizing, sharing,
and using knowledge to improve work
performance and achieve competitive
advantages for an organization. KM process
comprises the following 4 major steps: 1)
knowledge
creation,
2)
knowledge
codification, 3) knowledge distribution, and
4) knowledge utilization. These four major
steps will be used to propose a KM model
which will be properly used in local
communities in Nonthaburi Province and
neighboring provinces with similar contexts.
The proposed KM model is expected to
develop local occupations for increasing local

peoples incomes and, definitely, improving
the quality of peoples lives. Although
numerous previous studies have investigated
the current situation of KM and KM
application in organizations, in particular the
local communities and administration in Thai
context, a practical KM model, appropriate in
practice to the Thai context, has not been
developed and proposed (Bhusahas, 2004;
Panshe, 2005; Puangchan & Yakao, 2006;
Praichanchit, 2006; Simaruk, 2003).
This research, therefore, aims to
investigate the knowledge management (KM)
circumstances
for
local
occupation
development, and to construct a KM Model
for the local occupation development in
Nonthaburi Province. The research findings
should benefit the local occupation
development in local communities and
related organizations.
This study employed an action
research technique emphasizing qualitative
research method (Neuman, 2006). The target
population comprised leaders and members
of local occupation groups in Bangyai
District of Nonthaburi Province in 5
categories as follows: 1) art and handicrafts,
2) local food products, 3) apparel accessories,
4) flowers and plants, and 5) medicine and
household products. Therwere 19 groups
altogether and 12 groups were randomly
selected as samples. Questionnaires were
used as primary research tools to collect data
concerning the knowledge management
(KM) circumstances for the local occupation
development from leaders and members of
the selected groups. In addition, structured
group-interviews with the group leaders and
members, observations of group work
performance and local community meetings
for confirming and refining the obtained data
and information were research tools and
techniques used to collect qualitative data.
Page 235

July 9-11, 2012
he research procedures included

major phases as follows: 1) document
nalysis, 2) research tools construction and
development, 3) community study and data
collection, 4) data analysis and synthesis, 5)
draft KM model development and 6) KM
model verification and refinement.
In relation to the analysis of
collected data, frequency and percentage
were performed to display general
information regarding the local occupation
groups and products. Content analysis was
RESULTS
The findings disclosed the general
information regarding the samples of 12
local occupation groups as follows: the
majority of the samples were local food
products groups (33.32%), the other groups
were art and handicrafts groups, apparel
accessories groups, flowers and plants
groups, and medicine and household
products groups (16.67%, 16.67%, 16.67%,
16.67% respectively). In relation to local
products, it was found that most of the
products were from local food products
groups (27.27%), and art and handicrafts
groups (27.27%), others were from apparel
accessories groups (18.18%) and medicine
and household products groups (18.18%),
and the rest of them were from flowers and
plants groups (9.10%).
The major findings can be concluded
into two parts according to the research
objectives as follows: 1) the current
knowledge management (KM) circumstances
for local occupation development, and 2) the
proposed KM model to be applied to develop
local occupations in local communities of
Nonthaburi Province and the neighboring
provinces, particularly in the central part of
Thailand.
1. Current knowledge management
circumstances:
applied to analyze obtained qualitative data.

Best practices collected from the local
occupation groups were integrated with
practical guidelines and related theories,
namely the managerial system approach, KM
process, sufficiency economy philosophy,
local wisdoms and community development.
Then the KM model was synthesized and
proposed. The triangulation technique
covering academics, practitioners, local
occupation group leaders and members was
applied to verify the KM model as well as to
make refinement of the KM model
The research findings revealed that
local people gathered into small groups
according to their own interests and needs
for part-time occupations, leisure-time usage,
and community environment problemsolving for the purposes of increasing
incomes and utilizing local resources for
local goods production. The body of
knowledge of related local occupations and
local wisdoms was mainly transmitted from
ancestors
through
informal
training,
sometimes called family training, and field
study and some knowledge was also newly
created. The transmission of the knowledge
was conducted in some local occupation
groups through leaflets and papers, of which
the same way of knowledge transmission
was also found in Simaruks study (Simaruk,
2003). Some occupational training sessions
were conducted for children and students in
schools. The group members learned and
shared their experiences, and they also
utilized the knowledge to develop their local
products in order to earn their living. At the
beginning, local authority and administration
provided some support such as providing
budget
to
the
groups,
conducting
occupational training, and facilitating
necessary
material
and
equipment.
However, there were some problems in
establishing the local occupation groups.
That is to say, the groups were fully formed
at the beginning phase, but in the long-term,
Page 236

July 9-11, 2012
the group members failed to cooperate and

keep on working together. This is because
the group members lack clear goals and
objectives, and expected outcomes and the
group members do not realize the shared
value of the organization. This finding was
the same as that found in Bhusahass study
(Bhusahas, 2004). Moreover, in some
groups, the way they manage the knowledge
needed for the groups to develop their local
products do not exist and it is not obviously
found. Another big problem is that the group
members do not realize the significance of
the KM measurement approach and the
system of KM measurement and evaluation
in most groups is not found.
In regard with general suggestions
from the group members, it is suggested that
related organizations, both public and private
sectors, in the local area provide additional
budget to the groups, organize special
training courses in local product packaging,
marketing strategies and promotion, and
develop a KM system for the improvement
of
the
local
occupation
groups
performances.
members can identify community needs, and

then, establish local occupation groups of
interested people. In the planning and
implementation phase, the group members
collaboratively plan the local occupation
group activities, set up criteria, goals and
key performance indicators (KPIs) followed
by the KM process including knowledge
creation and codification, knowledge
sharing,
knowledge
distribution
and
utilization. In the evaluation phase, the set-up
goals and key performance indicators (KPIs)
need to be measured and evaluated. If
achieved, the group goes on to the next cycle
of local occupation development. If not
achieved, the group goes back to get started
again at the knowledge sharing step which
will help the group members to be retrained
and well-equipped. In this phase, an annual
report or a fiscal year report, should be
prepared and distributed to both internal and
external groups as well as business networks
and partners.
The KM model details the major
process and the relationship of significant
components as follows:
2. Proposed knowledge management

(KM) model for local occupation
development:
The managerial system approach,
KM
process,
sufficiency
economy
philosophy and best practices from the local
occupation groups were integrated and the
KM model was synthesized and proposed.
The KM model for local occupation
development is a process model comprising
the following three major phases: 1) the prestage phase, 2) the planning and
implementation phase and 3) the evaluation
phase. The main purpose of the pre-stage
phase is to systematically establish local
occupation groups. By looking at the
community context and applying sufficiency
economy philosophy, the community
Page 237
Identification of community needs

based on community contexts and
sufficiency economy philosophy by
organizing the community meeting,
and community field study
stablishment of local occupation
groups
of
interested
people
including
guidelines
of
the
occupation group management,
regulations,
benefits
and
responsibilities and participation of
the group members by organizing
group members meeting led by the
community leader and local wisdom
experts
Planning local occupation group
activities and setting up criteria,
goals, and key performance

July 9-11, 2012
indicators (KPIs), identifying the

body of knowledge needed for
occupation development, setting up
guidelines for follow-up study,
supporting activities and evaluation
by organizing group members
meeting led by community leader
and local wisdom experts
Knowledge
creation
and
codification covering newly
created knowledge such as the
knowledge relating to the creative
patterns of the apparel accessories
according to the customers needs
and the advancement of plastic
beads and artificial pearls and
knowledge about local occupation
(local wisdoms) transmitted from
ancestors. Professional training can
be conducted by occupation trainers
and local wisdom expert
Knowledge sharing by means of
sharing and exchanging knowledge,
training and coaching, field study,
independent study, etc. Groups of
interest and informal meeting can be
conducted.
Page 238
Knowledge
distribution
and
utilization with the support of
community managerial resources
(4Ms) and local wisdoms followed
by a formative follow-up study,
results based supervision and
reinforcement by group leaders and
local authority officers
Evaluation according to the set-up
criteria, goals, and KPIs, results of
group performances, if achieved,
go on to the next cycle of
continuous development. But if
they are not achieved, they go
back to knowledge sharing step.
This can be conducted by using
measurement
tools
and
measurement techniques relevant to
occupation groups and community
contexts, conducted by both internal
members and external experts
Reporting which is not actually a
part of KM, but is a systematic way
of disseminating results of local
occupation development to internal
groups for mutual understanding; as
well as to external groups, business
networks and partners for further
business cooperation

July 9-11, 2012
The process of the knowledge management model for local occupation development is represented
on Figure 1 below:
Figure 1: The knowledge management model for local occupation development
Page 239

July 9-11, 2012
DISCUSSION
Knowledge management (KM) is
generally dealing with the management of
knowledge in related tasks and activities. It
mainly includes organizing, sharing and using
knowledge in order to create value of products
and services, and achieve competitive
advantage for an organization. In the study,
KM is applied to the development of local
occupations based on the community contexts
in terms of its readiness of resources,
especially human resources, and local
wisdoms. The main purposes of utilizing KM
in local organizations are to preserve and
transmit knowledge and local wisdoms
regarding local occupations for community
people to earn their living as well as to
maintain and modify the knowledge needed
for occupation development. In applying the
developed KM model, some guidelines are
advised. Firstly, the establishment of local
occupation groups is essential, and the
participatory cooperation of group members in
identifying guidelines of the group
management, regulations, benefits and
responsibilities and participation of the group
members is essential as well. Secondly, the
major steps of knowledge management to be
properly applied include knowledge creation
and
codification,
knowledge
sharing,
knowledge distribution and utilization. Lastly,
the measurement and evaluation system needs
to be conducted for the organizations further
improvement and/or for the continuous
development in the next cycle. After the
evaluation process, the official report, such as
annual report or fiscal year report, must be
well prepared and distributed to internal
groups and external groups for mutual
understanding
and
further
business
cooperation.
In applying the KM model step-bystep, group members should utilize effective
working techniques such as brainstorming,
team working, problem based learning (PBL),

community based approach, participation and
collaboration, and create networking with
other public and private organizations for
primary purpose of sharing and exchanging
knowledge and experiences. This will
definitely help improve their local occupations
of the groups. Moreover, the group members
should participate in setting up their own
criteria, goals and key performance indicators
(KPIs), work collaboratively and develop their
own KM evaluation system in order that they
can improve their capabilities to meet their
criteria and the organizations performances.
Recommendations are made for the
local occupation groups and the local authority
and administration to take into considerations
in order to work closely with community
members. In applying the developed KM
model, the local authority and administration
should provide financial and academic support
in establishing local occupation groups at the
first start. After that, the community members
should be encouraged to work collaboratively
among themselves. That is, they should be
able to stand on their feet in planning,
implementing, and evaluating all kinds of
related tasks on their own, based upon their
community contexts, problems and needs, etc.
In some cases, however, the training sessions
should be conducted to support the groups by
related organizations (Department of Nonformal Education, 2005). The sessions which
are suggested include marketing strategies,
packaging, evaluation of the organizations
performance, business networking and
partnership, and innovative management
utilizing information and communication
technologies (ICTs) according to community
readiness and flexibility.
As community resources and local
wisdoms are quite important, it is suggested
that community members should pay much
more attention to preserving these valuable
Page 240

July 9-11, 2012
things. The philosophy of sufficiency

economy as the middle path for appropriate
conduct must be applied in planning and
making use of these resources (Philosophy of
Sufficiency
Economy,
2012:
Online).
Moreover, human resources, as the human
capital, need to be continuously developed.
This will lead to the improvement of the
community productivity as well as the
learning community. Most importantly,
community members must be very concerned
with the preservation and transmission of local
occupations, perceived as precious local
wisdoms, to the next generation.
ACKNOWLEDGEMENTS
The author is very grateful to all
participants in the study for their cooperation,
participation, valuable information and
insightful suggestions. The author is also very
grateful to Phranakhon Rajabhat University
for the research fund supported.
Page 241

July 9-11, 2012
REFERENCES
Bhusahas, A., 2004. Research for Developing and Improving the Community Knowledge
Management Mechanism: Num-Lang and Num-Kong Areas of Pangmapa District, MaeHongsorn. Office of the National Research Council of Thailand, Bangkok.
Department of Non-formal Education. 2005. Non-formal Education Management for Community
Strengthening and Poverty Overcoming. Rangsri, Bangkok.
Holsapple, C. W. and Joshi, K. D. 2001. An Investigation of Factors that Influence the
Management of Knowledge in Organizations, Journal of Strategic Information Systems
9(2/3): 235-260.
Knowledge Management. [Online]. [cited 2011 December 15]. Available from: URL:
http://en.wikipedia.org/wiki/Knowledge capture
Laudon, K. C., and Laudon, J. P. 2002. Management Information Systems: Managing the Digital
Firm. 7th ed. Upper Saddle River. Prentice Hall, New Jersey.
Neuman, W. L., 2006. Social Research Methods: Qualitative and Quantitative Approaches. 6th ed.
Pearson Education, Inc., Boston.
Office of the National Economic and Social Development Board. 1997. The Eighth National
Economic and Social Development Plan (1997-2001). Office of the National Economic
and Social Development Board, Bangkok.
One Tambon, One Product. [Online]. [cited 2012 February 7]. Available from: URL:
http://www.otopcdd.com/index.php
Panshe, C., 2005. Research and Development on Life Library: Local Wisdom Knowledge
Management for the Development of Traditional Bakery of Kudee-Chean, Thonburi.
Thonburi Rajabhat University, Bangkok.
Philosophy of Sufficiency Economy. [Online]. [cited 2012 January 27]. Available from: URL:
http://www.reflectedknowledge.com/clients/GSB/sufficiency/sufficiency.htm
Phranakhon Rajabhat University. 2005. The Follow-up Study of Community Development Plan:
Bangyai District of Nonthaburi Province. Phranakhon Rajabhat University, Bangkok.
Praichanchit, S., 2006. Learning Process and Community Knowledge Management on Traditional
Culture and Local Wisdoms. Office of the National Research Council of Thailand,
Bangkok.
Puangchan, S. and Yakao, P., 2006. Local Wisdoms Knowledge Management of Wooden
Handicrafts of Ban-Luk. Lampang Rajabhat University, Lampang.
Simaruk, S., 2003. Knowledge Management Mechanism Development for Local Area
Development at Sub-district Level. Office of the National Research Council of Thailand,
Bangkok.
Turban, E., Rainer, R.K. and Potter, R. 2001. Introduction to Information Technology. John
Wiley & Sons.,Toronto.
Page 242

July 9-11, 2012
HUO109-28
SNSCombiner: A Module for Combining Social Networking

Services to Identify Users Interests in Tourism Domain
Komkid Chatcharaporn, Jitimon Angskun, and Thara Angskun

School of Information Technology
Suranaree University of Technology
111 University Avenue, Nakhon Ratchasima 30000, THAILAND
E-mail: komkid1@hotmail.com, jitimon@sut.ac.th, angskun@sut.ac.th
ABSTRACT
Currently, the popularity of social networking services (SNS) such as Facebook, Twitter
as well as Foursquare make users clearly express their lifestyles and interests. These services are
enormous resources for identifying users interests. The identification of user interests in tourism
domain is mainly focused on attractions or point of interests (POIs). Unfortunately, using single
resource is not adequate to provide the complete attraction information. Hence, this paper
proposed a module for combining SNS to identify users interests in tourism domain called
SNSCombiner. The main objective is to improve the accuracy of place category identification
based-on users interests. The method can be classified into five approaches: 1) Facebook only
approach, 2) Facebook & Foursquare approach, 3) Facebook & ML approach by using places
name, 4) Facebook & ML approach by using places name and description and 5) Hybrid
approach. There are 11 place categories from QALL-ME ontology and 1100 instances of dataset
from the Facebook were used to evaluate each approach. The experimental results indicated the
hybrid approach achieve higher accuracy rate than other approaches in most category, however it
took the longest processing time. On the other hand, the approach which took the shortest
processing time is the Facebook & ML approach by using places name.
Keywords: Social Networking; Tourism Domain; User Interests; SNSCombiner
INTRODUCTION
Social networking services (SNS) have become one popular kind of services on the
Internet from both personal computer and mobile users. According to a report by the comScore
Company in 2011, the SNS usage continues to grow rapidly, particularly the social networking
leaders such as Facebook, Twitter as well as LinkedIn (comScore, 2011). Facebook is the worlds
largest SNS with over 800 million users, Twitter and LinkedIn are now reach 160 and 100 million
users respectively. Furthermore, there is a new SNS from Google called Google+ which reaches
25 million users faster than any other social network in history. Currently, Google+ has 65 million
users. Boyd and Ellison (2007) studied the SNSs characteristic. Their work revealed that the SNS
allows users to generate their profile, interact with other users and traverse their list of connections
within the system. These make the SNS become enormous resources for capturing and storing
personal data.
The SNS users usually express themselves, exhibit their lifestyle, and share their interests
through interaction within the SNS. For example, sharing their contents to their friends and paying
attention on contents generated by others. These contents include texts, messages, photos, videos,
webpages, comments and places. The SNS has a function called Like which allows users to
Page 243

July 9-11, 2012
show their interests of the contents. Recently, Like is a very popular social function on the SNS.
It is used to display relationship between users and the contents they like. The relationship is
occurred when the users press the like button (Jin et al., 2011). The Like button in some SNS is
labeled as Favorite or +1. After pressing the Like button, the users interests will be captured
and stored in the system and the users can backtrack to see them later.
The expression of users interests by pressing the Like button can also be related with the
places where he or she likes. In 2010, the Facebook had released location based service called
Facebook Places. It allows the Facebook Fan Page to be tied with a locations information
(Oreskovic, 2010). Hence, many businesses which have the Facebook Fan Page can show their
places location to their customers by using this service. The customers can press Like to those
places while they are visiting the places immediately. The service does not only support the
contents on the Fan Page but also supports Events Page on the Facebook. These make the contents
with the location information on the Facebook are widely spread.
The contents with the location information can reflected the interests of user in tourism
domain when they are visiting the places and pressed Like button. The users interests stored in
the SNS system can provide personalized information in tourism domain. The users interests may
answer question about the places where the user likes (i.e., what kinds of place does the user love
to visit?). For example, the user who enjoys Japanese foods or shopping centers may like these
kinds of place more than others. Currently, the SNSs provide tools to retrieve the users interests
from their systems, e.g., Facebook Graph API which is very popular Facebook API (Ko, Cheek,
and Shehab, 2010). The API helps developers to manage information from the Facebook server
conveniently. In addition, it can also be applied with several programming languages.
Chatcharaporn et al. (2011) examined availability of places categories on the Facebook.
The examination found that the categories definition was too broad. It did not have specific
categories for tourism domain such as temple, aquarium, village, mountain as well as beach. It
may cause problems when users create the Place Page (the Facebook Fan Page with location
information), because they cannot find the suitable category for the places. Even though, the
Facebook has subtext (places metadata), but it may not provide correct categories for all places.
For example, Temple of the Emerald Buddha, which is one of the most popular destinations in
Thailand (Metreveli and Timothy, 2010) has Local Business category in both of the available
category of Place Page and the subtext field (Facebook, 2012). The temple should be in Temple
category. This problem makes identifying type of user's favorite places very difficult. To overcome
the mentioned problem, Foursquare might be a very interesting data source, because Foursquare
is one of the most popular location-based social networks. It has very up-to-date the places
information, which comes from more than 10 million active users (Ye et al., 2010).
Due to the fact that Foursquare is SNS which emphasizes on location based service, thus
it has more places categories than the Facebook. The places categories from the Foursquare
could be used to improve the incorrect places categories classification problem in the Facebook.
Thus, combining strength in finding users favorite places of the Facebook and strength in rich
places categories information of the Foursquare could create a novel method for finding the
correct places categories of users interest places. This method can be applied with a personalized
system called SMARP (Social network in Mobile Augmented Reality for Personalization)
(Chatcharaporn et al., 2011). The method could be utilized in the SNS stream manager component
of the SMARP system for extracting users interests in tourism domain.
The design and development of a SMARPs module called SNSCombiner is proposed in
this paper. SNSCombiner is a module for extracting users favorite places from the Facebook,
combining the places information between the Facebook and the Foursquare, and summarizing
the appropriate categories for the places. The module is used to support the SNS Stream Manager
component of the SMARP system to get additional users interests from the SNS. The output of
the SNSCombiner module includes users favorite places along with their categories.
This paper is organized as follows. Section 2 presents the SNSCombiners framework and
its four main components. The experimental evaluations are explained in Section 3. The last
section presents conclusion and future work.
Page 244

July 9-11, 2012
SNSCOMBINER FRAMEWORK
Before getting into the details of SNSCombiner, the brief overview of the SMARP system is
introduced in this section. SMARP (Chatcharaporn et al., 2011) is an implementation of mobile
augmented reality based on social network, which provide personalized contents for each user. Figure
1 illustrates the SMARP framework which consists of four main components: (1) SMARP browser is
a component that interacts with user and displays places information in augmented reality (AR)
format. (2) Inspector has responsibilities to authenticate user accounts, update the users interest data,
and co-operate with other modules in the system. (3) SNS Stream Manager has important role to
retrieve the users interests from the SNS server and store them in database. (4) Content Matcher has
role to combine information between the users interests and the place information which obtained
from AR Content Manager. It also sends the results back to display to the user. (5) AR Content
Manager is used to retrieve the place information in AR format from AR content provider.
Fig. 1 The framework of SMARP system

As mentioned in Section 1, the SNSCombiner is a module which plugged into the SNS Stream
Manager component of the SMARP system. The rest of this section focuses only SNSCombiner
module. As shown in Figure 2, the SNSCombiner is a part of the SNS Stream Manager. It has three
sub-modules which are: (1) Facebook Connection & Retrieval Sub-Module, (2) Foursquare
Connection & Retrieval Sub-Module and (3) Summarization Sub-Module. The output from this
module finally is sent to the Inspector and stored in database.
Page 245

July 9-11, 2012
Fig. 2 Framework of SNSCombiner.

1) Facebook Connection & Retrieval Sub-Module
The first sub-module includes a set of PHP scripts and SNSCombiner Facebook App which is
used to retrieve the users interests from the Facebook server by connecting via the Facebook API.
The sub-module sends requests to the Facebook server by using Open Graph API (Ko, Cheek, and
Shehab, 2010). After that the API will return responses back to the sub-module in JSON format
(Chuang et al., 2011). An example of the retrieval script is illustrated in Figure 3. The script is used to
fetch the users liked information and convert the responses into array. It must limit number of the
information every time to prevent unsuccessful retrieval. There are many interests of user from the
Facebook but this research only focused on the interests in the tourism domain. Thus, this sub-module
is set to filter only the users favorite places from the entire responses. The users favorite places
information includes name, description, category, latitude, longitude, check-in count, as well as
subtext. After the sub-module has received the returned responses, it converts them from JSON format
to array and sends the converted data to the Foursquare Connection & Retrieval module.
a) SNSCombiner Facebook App: Facebook plays an important role in the
SNSCombiner as data source which provides the information of users interests. There are regulations
for retrieving the users interests which the developer must follow on the Facebook. For instance, the
developer needs to build the Facebook application as middleman to cooperate between Facebook
server and developer server. In addition, the user who registered the application must grant
permissions to the application that made it can access the user information in the Facebook server.
Although, the application is created on the Facebook server, but the user interest informations
requests are from the developer server. When the application receives information from the Facebook
server, it sends the information as responses back to the developer server for further processing. The
cooperation between the two servers used the Open Graph API which now becomes Facebooks
Page 246

July 9-11, 2012
standard API. In this research, the Facebook application is created to retrieve user's interests called
SNSCombiner Facebook App.
$likes =
array_values(idx(FBUtils::fetchFromFBGraph("me/likes?access_token=$token&limit=1
00"), 'data'));
Fig. 3 An example of user interests retrieval script

2) Foursquare Connection & Retrieval Sub-Module
The second sub-module starts its work when the first sub-module has already sent the results to
it. Although, there are many details of places data from the Facebook but only three of them are used
as the Foursquare APIs parameters for querying. The three data include name, latitude and longitude.
These values are attached with the Foursquares application ID and secret code every time when the
sub-module sends requests to the Foursquare server using the Foursquare API. The API will return the
responses in JSON format. The responses include places detail such as ID, name, contact, category,
location and stats. The JSON format can be converted to array by using PHP scripts. Finally, both of
the converted data from Foursquare and Facebook are sent to next sub-module.
a) SNSCombiner Foursquare App: Presently, Foursquare is one of the most popular
location-based social networks. It has up-to-date place information which came from crowdsourcing
and it also has a plenty of place categories. Similar to the Facebook, the Foursquare provides APIs to
support developer. The developers need to create the Foursquare application before they can access
and retrieve the information they want from the Foursquare server. The application has role as medium
to support information exchange between the Foursquare server and the developer server similar to the
Facebook application. In this research, the Foursquare application called SNSCombiner Foursquare
App is built to act for the information request and response using the Foursquare API.
3) Summarization Sub-Module
The last but not the least sub-module has roles to receive the places data from the previous submodule. It also processes them to summarize the suitable places categories for users favorite places.
The summarization is a very important process because a users favorite places can be related with
multiple or no categories. Thus, there are many approaches could be used in this sub-module to
summarize places categories. Details of each approach can be described as follows:
a) Facebook Only Approach: The first approach uses values of the Facebook Fan
Page category and subtext from the Facebook database to summarize the places categories for each
users favorite place.
Page 247

July 9-11, 2012
b) Facebook & Foursquare Approach: The second approach uses the queried
results from the Foursquare Connection & Retrieval Sub-Module. The results consist of name, contact
location and their category. This approach uses only the category returned from Foursquare to decide
an appropriate category for those users favorite places obtained from the Facebook.
c) Facebook & ML Approach by using Places Name: The machine learning (ML)
technique (Chatcharaporn et al., 2012) for categorizing tourist attraction is used in this approach. It is
used to build a classification model with Nave Bayes learning algorithm. Only name of places is
considered this model. The place data for building the model are obtained from the famous traveling
website named Lonely Planet.com. The classification model is used to predict and assign the places
categories to the users favorite places.
d) Facebook & ML Approach by using Places Name and Description: The forth
approach also uses the ML technique to construct a classification model. The model is constructed by
Nave Bayes learning algorithm. The place data which are used to create the classification model in
this approach are both Name and description of the places from Lonely Planet.com.
e) Hybrid approach: The final approach combine the advantage of four previous
approaches to get more accurate results of assigning the place category for each users favorite place.
It uses four results from the four approaches to summarize. If there are similar categories greater than
or equal to 2 from 4 results, this approach will be used them to decide the place category. After that,
when the process is terminated, it will start the process again with next transaction.
The performance of each approach is evaluated and discussed in Section 3. After the
summarization, the results including the place information and the summarized category will be sent
to the Inspector and stored in the SMARP database. Later, these categories are used to analysis and
process with data mining technique and location based technology. The technique can provide patterns
of users lifestyles about their favorite places. The patterns can be used to develop personalized engine
for matching and recommending the places when the users are travelling to unfamiliar places. The
location based technology such as GPS and other location based services are used to find the available
places around the users and it can also provide the further place information.
EXPERIMENTAL EVALUATIONS
This section begins with the explanation of experimental environments which include dataset
and hardware and software specifications. Then, the details of system evaluations are explained with
their experimental results. Lastly, there is a discussion about the facts from the experimental results.
1) Dataset
A new Facebook user was created to test in the experiments for extracting only users favorite
places from the Facebook. The new user was assumed that it had interest in many categories of place.
To restrict the scope of place categories, all of them are based on a tourism ontology named QALLME ontology (Ou et al., 2008). The ontology has 4 main categories of places with 34 sub-categories
but only 11 sub-categories were selected in this research which included:
a) Accommodation: Bed & Breakfast, Hostel, Hotel and Resort
b) Attraction: Cultural Heritage, Natural Heritage, and Religious Heritage
Page 248

July 9-11, 2012
c) Gastro: Bar & Pub, Caf, Club, and Restaurant
d) Infrastructure: Cinema
Each category had one hundred places and they are selected from the Facebook randomly. All
of the places were in Thailand and their name was labeled in English language only.
2) Hardware and Software Specifications
All of experiments are tested with a personal computer with Microsoft Windows 7 Operating
System. The computer has Intel Core i5 2410M 2.30 GHz, 4 GB of Memory, 500 GB of storage. It
connected to the Internet via 802.11g wireless LAN. The SNSCombiner was implemented with PHP
version 5.2.6. The server for installing and testing the SNSCombiner is the free hosting service from
the Facebook called Heroku.
3) Evaluation
The evaluation is divided into 2 topics which include accuracy of output and processing time.
The accuracy was measured by correctness of summarized category for each place manually. The
processing time was average time from each approach.
4) Experimental Results
a) Accuracy Evaluation
The accuracy evaluation was conducted with 5 summary approaches with the 1100 instances
of 11 place categories. The purpose of this evaluation is to find performance of each approach when it
was used to summarize the place category from the SNS. The result of accuracy evaluation is shown in
figure 4. The first approach was Facebook only approach. It provided the lowest accuracy for all place
categories because there were still many places with incorrect category on Facebook. The second
approach was Facebook & Foursquare approach. This approach presented more than 70 percent of
accuracy rate with restaurant, caf, and hotel and resort. The disadvantage of the second approach was
the Foursquare could not provide category for some places. This answered question why some kind of
places had low accuracy. The third approach was Facebook & ML Approach by using Places Name.
The approach served high accuracy rate with hostel, caf and cinema category because the places
name in these categories had significant words for identifying themselves to the categories. The forth
approach was Facebook & ML Approach by using Places Name and Description. The approach was
good to classify the places in cinema, caf and club because some significant words in places detail
could use to summarize with more accuracy than places name only. The last approach was hybrid
approach. It seemed to be the best approach for all categories but the hostel was only one category
which the approach could not do better than the third approach. The approach provide accuracy rate
higher than 80 percent with hotel and resort, caf, religious heritage and cinema.
Page 249

July 9-11, 2012
Fig. 4 The Accuracy Evaluation Result

b) Processing Times Evaluation
The processing times evaluation was conducted with processing times of each summary
approach. It was average time from the approach processed with 100 instances of dataset. Because the
machine learning approach needed to learn the dataset before it could do the summarization. It took
longer times to summary than others. Hence, the 100 instances of dataset was reasonable quantity to
compare their processing times. The results of processing times displayed in figure 5. The connection
between SNSCombiner and two SNS servers made the Facebook & Foursquare approach took long
time to process data. The approach which used the shortest processing times was the Facebook only
approach. The Facebook & ML approach using places name took marginally longer time than the
Facebook only approach. The processing times of Facebook & ML approach using places name and
description was around 45 seconds. The hybrid approach took the longest time to process. Its time was
little longer than the Facebook & Foursquare approach.
Fig. 5 Processing Times Evaluation Result
Page 250

July 9-11, 2012
CONCLUSION & FUTURE WORK
This paper presents a novel method for improving the accuracy of place category
identification based-on users favorite places on the SNS. The improvement uses the combination of
the SNS such Facebook and Foursqaure to support each other. This paper also introduces
implementation of the SNS combination to a module called SNSCombiner. The main role of the
module is to collect the places data from the SNS and summarize information for assigning their
categories. The experimental results indicated that the hybrid approach is the best approach for
summarizing. It could provide the highest accuracy rate for almost all place categories. However, it
took the longest time to process the summarization.
The module will be used to plug with SNS Stream Manager component of the SMARP system
in near future. It also used to get more the users interests in tourism domain on the SNS. The users
interest information could be adopted with the other data mining techniques and location based
technology to provide the personalized information to the travelers.
Page 251

July 9-11, 2012
REFERENCES
Boyd, D. M., and Ellison, N. B. 2007. Social Network Sites: Definition, History, and Scholarship.
Journal of Computer-Mediated Communication 13 (1):210-230.
Chatcharaporn, K., Angskun, J., and Angskun, T. 2011. Mobile Augmented Reality Based on
Social Network. IC2IT 2011: Proceedings of the 7th International Conference on Computing
and Information Technology; 2011 May 11-12; Bangkok, Thailand. Bangkok: KMUTNB;
2011. p.133-138.
Chatcharaporn, K., Angskun, J., and Angskun, T. (in press). 2012. Tourist Attraction Categorization
using Natural Language Processing Based on a Statistical Approach and Machine Learning.
Suranaree Journal of Science and Technology.
Chuang, C. Y., Lin, Y. B., Ren, Z. J., and Yeh, Y. T. 2011. User-Generated E-Books from Facebook
Contents. IWCMC 2011: Proceedings of the 7th International Wireless Communications and
Mobile Computing Conference; 2011 July 4-8; Istanbul, Turkey. New York: IEEE; 2011. p.
1918-1922.
comScore. 2011. Its a Social World: Top 10 Need-to-Knows About Social Networking and Where
Its Headed [cited 2012 Mar 03]. Available from: URL:http://www.brandchannel.com/images/
papers/534_comscore_wp_social_media_report_1212.pdf
Facebook. 2012. Wat Phra Kaew (Temple of the Emerald Buddha) [cited 2012 Mar 26].
Available
from: URL: https://www.facebook.com/pages/Wat-Phra-Kaew-Temple-of-the-EmeraldBuddha/277250742323575
Jin, X., Wang, C., Luo, J., Yu, X., and Han, J. 2011. LikeMiner: a system for mining the power of
'like' in social media networks. KDD 2011: Proceedings of the 17th ACM SIGKDD
international conference on Knowledge discovery and data mining; 2011 August 21-24; New
York: ACM; 2011. p. 753-756.
Ko, M. N., Cheek, G. P., and Shehab, M. 2010. Social-Networks Connect Services. Journal of
Computer 43 (8):37-43.
Metreveli, M. and Timothy, D. J. 2010. Religious heritage and emerging tourism in the
Republic of Georgia. Journal of Heritage Tourism 5 (3):237-244.
Oreskovic, A. 2010. Facebook "Places" lets users track friends and services [cited 2012 Feb 29].
Available from: URL: http://www.reuters.com/article/2010/08/19/us-facebookidUSTRE67I1A320100819
Ou, S., Pekar, V., Orasan, C., Spurk, C., and Negri, M. 2008. Development
and Alignment of a Domain-Specific Ontology for Question Answering. LREC 2008:
Proceedings of the 6th International Language Resources and Evaluation; 2008 May 28-30;
Marrakesh, Morroco. La Valletta: ELRA; 2008. p. 2221-2228.
Ye, M., Yin, P., and Lee, W. C. 2010. Location recommendation for location-based social
networks. GIS 2010: Proceedings of the 18th SIGSPATIAL International Conference on
Advances in Geographic Information Systems; 2010 November 2-5; San Jose, California.
New York: ACM; 2010. p.458-46
Page 252

July 9-11, 2012
HUP64-1
The Marketing Value Model in using Spa Service

of the Foreign Tourists in Chiangmai Province
Parasee Anek
Siam University , Bangkok ,10160, Thailand
Email: parasee@ymail.com
Abstract
This study was a descriptive research by in-depth interview and focus group for the
qualitative research for the quantitative research questionnaire was the primary used instrument
in this study. The population research of the study consisted of 1,100 foreign tourists in
Chiangmai. The statistics used for the data analysis were descriptive statistics. Structural equation
modeling was used to assess model fit and investigation for parsimonious model to explain the
caused related on foreign tourists perception.
Research findings showed the marketing communication, the practical service quality,
and the identity of Thai Lanna spa was considered to be related for the spa value perception.
They had factor loading of 0.298, 0.106 and 0.523 which represented the important of these
factors in spa marketing value of foreigner tourists perception. The study found that the
statistical model developed by this research is consistent with the empirical data from chi-square
test does not seem statistically significant at 0.05 (p = 0.126) for all indices including GFI =
0.991, AGFI = 0.980, NFI = 0.989, IFI = 0.998, CFI = 0.998 passing in the criteria above 0.90.
Whereas for index set at less than 0.05, it showed that the index RMR = 0.015 and RMSEA =
0.013 also are accepted. In addition passing the same index, CMIN/DF is equal to 1.184 which is
close to 1, the developed model has shown the ability to predict value perception to acceptable
degree with a multiple correlations squares (R) of 0.600 (60%).
Keywords: Spa, Marketing Communication, Practical Service Quality, Identity of Thai

Lanna Spa, Spa Value Perception
1. Introduction
Thailand is home to Asia's first
internationally-accredited hospital and also
enjoys an established reputation as 'Spa
capital of Asia' (Tourism Authority of
Thailand, n.d.). Spas can be found at all the
major tourist destinations in Thailand such
as: Bangkok, Phuket, Pattaya, Ko Samui,
Chiang Mai and Hua Hin (Tourism Authority
of Thailand, n.d.). In fact, Thailand is the
second highest ranked spa destination of the
world with an overall grade of 93%+ (just
slightly behind Australia). Chiva Som
International Health Resort located in Hua
Hin, is ranked number one in the world while
the Regent Chiang Mai Resort and Spa is

ninth. Thailand is recognized as a global
leader in the health spa industry, which has
grown rapidly in Thailand in recent decades.
People choose to visit health spas in
Thailand not only as a means of stress relief
and to relax, but also for advice on how to
develop healthy habits and improve physical
fitness (Tourism Authority of Thailand, n.d.).
The Royal Thai Government sees vast
potential in the development of Thailand's
healthcare and health-related services. The
mission spearheaded by the Ministry of
Public Health and the Ministry of Commerce
Page 253

July 9-11, 2012
aims to firmly establish Thailand's leadership
position on three fronts-as 'Health Tourism
Hub of Asia', the 'Wellness Capital of Asia'
and 'Thai herbs for health'. Destinations
targeted for this plan are Bangkok, Chiang
Mai, Phuket and Samui (Tourism Authority of
Thailand, n.d.). As 'Health Tourism Hub of
Asia', the priority for medical services is to
ensure that the destination is perceived as
being a quality destination in the delivery of
superior medical and health-related services
(Tourism Authority of Thailand, n.d.). There
are three product champions under the "Health
Services" category, which are health spas,
traditional Thai massage, and long-stay
healthcare products and services.
Chiangmai considered the land of
healthy smiles introduces the miracles of
medical procedures and holistic treatment of
mind and soul. The exposure of health &
wellness includes a wide variety of world
renowned day spas, medical spas to choose
from.
Health
and
wellness
based
accommodation, spa treatment, medical
treatment and food will be get in touch with
inner. Achieve holistic health through the
many offering of Chiangmais most reputed
spas center. Experience the benefits of Lanna
Exotic Massage (traditional Thai massage)
available only in Chiangmai. The choice with
6 categories of spa available : Day Spa,
Hotel/Resort Spa, Destination Spa, Medical
Spa, Mineral Spring Spa and Spa Cuisine.
Services are subject to demand
fluctuations which can cause problems when
organizations try to mach supply and demand
(Lewis, 1991). This challenge for service
marketer to govern between the demands on
peak times that make that customer pleasant
service. It is a decision of how best to
communicate the product to target audience
and how to persuade them to buy it (Lovelock,
Patterson and Walker, 1998). No marketing
program can be executed with a competent
marketing
communication
plan.
The
components are essential roles: providing
needed data and guidance, persuading target
customers the merits of a specific product, and
inspire to take action at specific times
(Lovelock and Wright, 2002). The intangible
nature of service offer commonly results in
consumers perceiving high risk in buying
process, which the promotion must aspire to
overcome. A number of methods are

commonly used to restorative, including
evolution of the strong brands; stimulus the
word-of-mouth commendation; promotion of
trial usage of service; and promotion and
public relations. The service marketer should
constantly
arouse
a
word-of-mouth
communications (George and Berry, 1981)
using regular advertising. Communication
includes informing the customer in a language
they can understand (Parasuraman, Zeithaml
and Berry, 1985). Refers to the ways in which
equipment and furnishings arranged and the
relationships among them. Functionality refers
to the ability of the same items to facilitate
performance and the accomplishment to goals
(Bitner, 1982). Signs displayed on the exterior
and interior of a structure are explicit form of
the spa communications. They play an
important part in communicating the firm
image (Bitner, 1992). Physical evidence, like
the environmental decorates and designs
significantly influence the customers
expectations of the service (Shostack, 1977).
As the reputation of the Thai spa very famous,
the customers expect to have excellent spa
services. For the spa industry, quality of
service is becoming an essential factor in
customers demand for higher standard of
service, where they can choose, will tend to
choose the spa services which give the best
quality of service. It is important to know why
service quality should be measured. Edvardsen
et al, (1994) stated that the starting point in
developing quality in service is measurement.
The
SERVQUAL
is
an
instrument
(Parasuraman et al, 1988) that tends to have
the greatest potential for applicability in spa
industries. The SERVQUAL approach:
Tangibles: Appearance of physical
facilities,
equipment,
personal
and
communication materials are included.
Reliability: Ability to perform the promised
service dependably and accurately.
Responsiveness: Willingness to help
customers and to provide prompt service.
Assurance: Knowledge, courtesy of
employees, their ability to inspire trust and
confidence are included.
Empathy:
Provision
of
caring
individualized attention that the firm provides
to its customers is included.
Page 254

July 9-11, 2012
Thai Lanna Spa Identity has been
developed, in collaboration between the
Chiang Mai province and the Chiang Mai
University.
The meaning of Thai Lanna Spa Identity
Identity refers to five elements, which are
image, taste, scent, sound and touch. These
effect people's perception of Thai spa.
Thai Lanna Art describes tradition and the
culture from the North of Thailand, dating
from before the King Mungrai era until now,
and including that all tribes in the North.
Spa means the spa and health care
business which comine the knowledge of
massage, hydrotherapy and any kind of
holistic health care.
Combining Thai Lanna culture in design,
decoration, spa equipment, natural sound,
aromatic plants, herbs, local massage, rituals
and stories, the Northern spas have the
opportunity to create their own brand and
position in the market according to their
preference and ability.
H4:
Marketing communication has
a positive effect on practical service quality
H5: Marketing communication has
a positive effect on identity of Thai Lanna spa
2. The Research Objectives

1) To survey a characteristic spa in
Chiangmai by analyze toward the problem
among spa provider and client (receiver) to
make a value added to spa business in
Chiangmai.
2) To analyze the component
relationship of spa marketing value in
marketing communication (advertising and
sales promotion, word-of-mouth, image),
practical service quality (reliability, assurance,
tangible, empathy, responsiveness), and
identity of Thai Lanna spa (sense of sight,
sense of taste and smell, sense of sound, sense
of touch)
3) To analyze and develop the
marketing value model from the spa service
value perception of foreign tourists in
Chiangmai.
4. Methodology
A two-stage methodology was applied
in this research. A mixture of both qualitative
and quantitative methods was used to provide
the necessary research results for triangulation
to improve internal validity and to achieve a
better understanding of the subject (Perry
1998) Following this,
Stage 1: Exploratory research
Exploratory research was conducted
through the use of two focus groups consisting
of eight respondents per group. Each group
was selected to form a homogeneous group
reflecting a range of the total study population
(Kitzinger 1995). Interview questions for the
focus groups were developed from the initial
research question and objectives. In addition
to this, results were taken from the literature
review in order to both obtain relevant
background information for a better
understanding of issues and to help define the
problem and develop hypotheses for
subsequent testing (Churchill & Iacobucci
2002). The data gained from the focus groups
was then used to refine and develop the final
model and to generate possible questions for
further research to be used in an online survey
in the next stage.
Stage 2: Explanatory research
The purposive sampling by control
characteristics of interest. A questionnaire was
developed based on both the literature and
exploratory study. The sample for the study
was comprised of foreigner tourists in
Chiangmai. The 1,100 respondents were
randomly assigned to respond to the
questionnaires with their reliability by
Cronbachs alpha which was higher than 0.70.
3. Research Hypothesis
H1: Marketing communication has a
positive effect on spa marketing value
perception
H2: Practical service quality has a positive
effect on spa marketing value perception
H3: Identity of Thai Lanna spa has a
positive effect on spa marketing value
perception
5. Results and Discussions

Exploratory factor analysis (EFA)
The Bartletts test of sphericity was
used to determine the appropriateness of factor
analysis by testing the magnitude of the
correlations of the entire correlation matrix
(Hair et al. 1998). Results from the Bartletts
test indicated significant correlations among
measurement variables in each construct
Page 255

July 9-11, 2012
shown that the KMO and Bartlett's Test =
0.879 (87.9%) The KMO value of all
constructs was greater than 0.6. This indicated
that the relationships among variables were
statistically significant and these variables
were suitable for applying exploratory factor
analysis to provide a more parsimonious set of
factors (Tabacknick & Fidell 1996). The
results of the exploratory factor analysis are
reported next.
Confirmatory Factor Analysis (CFA)
The analysis revealed an acceptable fit
to the data, based on fit criterion (>.9) as
outlined by Arbuckle (1995) for NFI, CFI, and
GFI, as a cutoff criterion (<.05) as suggested
by Brown & Cudeek (1993) for RMSEA and
RMR. Although the chi-square

statistic was significant, this statistic is know
for its sensitivity to sample size and as a result
greater emphasis was placed on additional fit
(Bollen, 1989) this table summarizes
measurement model results
Structural equation modeling (SEM)
SEM was employed to examine the
relationship between the factors of Marketing
communication, practical service quality,
identity of Thai Lanna spa. The construction
of the observed and latent variables in the
SEM model was presented in this figure.
Chi-square = 93.536, df = 79, P = 0.126,

GFI = 0.991, RMSEA = 0.013
Marketing communication = 0.731
(Advertising and Sales promotion) + 0.597
(Word-Of-Mouth) + 0.563 (Image)
Practical service quality = 0.666
(Reliability) + 0.690 (Responsiveness) +
0.816 (Assurance) + 0.809 (Empathy) +
0.687 (Tangible)
Identity of Thai Lanna spa = 0.744
(Sense of Sight) + 0.850 (Sense of Taste
and Smell) + 0.676 (Sense of Sound) +

0.645 (Sense of Touch)
In terms of the structural equation modeling,

the results indicated that relationship between
the Marketing communication, practical
service quality, identity of Thai Lanna spa
path coefficient = 0.298, 0.106 and 0.523, and
hence supports all hypothesis. From the result
can found the marketing value model in using
spa service in Chiangmai Province shown that
:
Page 256

July 9-11, 2012
6. Conclusion
Research consistently shows that
customers often judge the quality of the
service they receive largely on their
assessment of the people providing the
service (Lovelock and Wright, 2002).
The result can found from the beginning
is marketing communication has a
positive effect on the spa value
perception in a practical service quality
and identity of Thai Lanna spa can
explain that the spa advertising and sales
promotion , word-of-mouth and good spa
image are a spa marketing instruments
communicate to the foreigner tourists in
Chiangmai , accept with George and
Berry, (1981) the service marketer should
constantly stimulate word-of-mouth
communications apart from using regular
advertising Communication includes
informing the customer in a language
they can understand (Parasuraman,
Zeithaml and Berry, 1985). It can make
them want to try spa service in
Chiangmai , It is a decision of how best
to communicate the product to target
audience and how to persuade them to
buy it (Lovelock, Patterson and Walker,

1998) when a foreigner tourists get the
spa experience by the reliability ,
responsiveness , assurance , empathy
,and tangible of spa therapist with the 5
sense of Thai Lanna spa from sense of
sight , sense of taste and smell , sense of
sound , and sense of touch they get the
impression with the spa value perception.
These experience and perceptions have a
influence on their satisfaction and loyalty
(Yelkur, 2000) and Bitner , (1990) that
the physical surroundings and other
visible cues can have an effect on the
impressions customers form about the
quality of the service they receive.
Page 257

July 9-11, 2012
References
Bitner, M. J. (1982). Servicescapes: the impact of physical surroundings on customers and
employees. Journal of Marketing, 56, (4),57-71.
Bitner, M. J. (1990). Evaluating service encounters: the effect of physical surroundings and
employers responses. Journal of marketing, 54(4), 69-82.
Bitner, M. J. (1992). Servicescapes: the impact of physical surroundings on customers and
employees. Journal of Marketing, 56(4), 57-71.
Churchill, G.A. Jr. & Iacobucci, D. 2002, Marketing Research: Methodological Foundations, South
Western, Ohio, USA.
Edvardsen B. & Tomasson B. & Ovretveit J. (1994). Quality of Service: Making it Really Work,
New York, McGraw-Hill.
George, W. R. and Leonard, L. B. (1981). Guidelines for advertising services, Journal of Business
Horizons, 24(7-8), 53-56.
Hair, J.F., Anderson, R.E., Tatham, R.L., & Black, W.C. 1998, Multivariate Data Analysis,
5th edn., Prentice Hall, Englewood Cliffs, New Jersey.
Kitzinger, J. 1995, Introducing Focus Groups, British Medical Journal, vol. 311, issue 7000, July
29, pp. 299-302.
Lewis, B. R.(1991). Customer care in service organizations. Journal of Management Decision,
29(1), 31-34.
Lovelock, C. and Wright, L. (2002), Principles of service marketing and management. USA:
Prentice Hall.
Lovelock, C. H., Patterson, P. G. and Walker, R. H. (1998), Service marketing. Australia and New
Zealand: Prentice hall.
Parasuraman A. & Zeithaml V.A. & Berry L.L.(1985). "A conceptual model of service quality and
its implications for future research". Journal of Marketing, 49, 41-50
Parasuraman A. & Zeithaml V.A. & Berry L.L. (1988). "SERVQUAL: A multiple item scale for
measuring customer perceptions of service quality". Journal of Retailing, 64,(1).12-40.
Perry, C. 1998, A Structured Approach for Presenting Theses, Australasian Marketing Journal,
June, vol. 6, no. 1, pp. 63-86.
Shostack, L. G. (1977). Breaking free from product marketing. Journal of Marketing, (4), 73 - 80.
Tabachnick, B.G. & Fidell, L. S. 1996, Using Multiariate Statistics,3rd edn., Harper Collins
College, New York.
Tourism Authority of Thailand. Health Tourism The Rising Star: Strategies for Success: Thailand
as a Centre of Excellent Health of Asia , Retrieved October , 20 2010
fromhttp://www.tatnews.org/emagazine/1983.asp
Tourism Authority of Thailand. Spa in Thailand, Retrieved October , 20 2010, from
http://www.tourismthailand.org/interesting-article/content-428-1.html
Yelkur, R. (2000). Customer satisfaction and the services marketing mix. Journal of Professional
Services Marketing, 21(1).
Page 258

July 9-11, 2012
HUP110-2
STUDENTS SATISFACTION WITH LEARNING

PROGRAM, LECTURERS AND TEACHING METHODS
WITHIN STUDYING IN PHYSICAL EDUCATION
SUBJECT AT UNIVERSITY OF SCIENCES HO CHI
MINH CITY NATIONAL UNIVERSITY.
Nguyen Tra Giang (1), Ngo Tuan Anh (2), Lam Quang Thanh (3)
(1) Faculty of Sport Science, Burapha University, Chonburi 20131, Thailand.
Email:nguyentragiang_hus@yahoo.com
(2) University of Science Hochiminh city National University, Hochiminh city, Vietnam.
(3) Vietnam Sports General Department
ABSTRACT
The purposes of this study were to examine the satisfaction levels of students and to
evaluate the different in satisfaction between male and female students with learning program,
lecturers and teaching methods toward studying in Physical education classes at in University of
Science, HCMC National University. The sample size in this study was included 150 male and 150
female students. Furthermore, Cronbach alpha and Independent t-test to analysis the data was used
in this study.
The results and discussions revealed that there were not significant differences between
male and female students with Learning program, Lecturers and teaching methods factors (Sig
>0.05) toward studying in Physical education subjects. Following the results, we found that most
of students were satisfied with Learning program, Lecturers and teaching methods although the
levels were not so very high. Thus, Learning program, lecturers and teaching methods need to be
improved to make the students noted highest satisfaction in learning Physical education subjects.
Keywords: satisfaction, physical education subject, learning program, lecturers and teaching
methods, male students, female students.
INTRODUCTION
In recent years, more and more people in the world have participated in sports and
physical activities. It has become an essential part of the daily life of many Americans (Ellard,
1984; Streff, 1991) and this trend also has a great influence on Vietnamese peoples lifestyle.
Besides, on April 12th 1997, the Minister of Vietnam Ministry of Education and Training signed a
decision 12/02 GD-T named Enforce the Physical education program in Universities and
Colleges because Physical education is one of the goals of comprehensive education of the
Vietnamese Party and State, and within the Vietnamese national education system. Furthermore,
learning program, lecturers and teaching methods are important factors to attract students
participate in Physical education class at the universities (Lin, 1994) because if they are poor
lecturers and not enthusiasm, poor teaching methods, and simple learning program as well, they
will not be able to attract enough students to join it frequently (Huang, 1992). Thus, the
development of learning program, lecturers and teaching methods are issues that sports experts
should have the great consideration.
According to the instruction No. 904/H dated on 2/17/1994 about new physical
education process of Vietnam Ministry of Education and Training, the Physical Education
Department of University of Sciences, HCMC National University has been continuously trained
Page 259

July 9-11, 2012
the lecturers and staff in quantity and professional skills, deployed in depth physical activities in so
many practical and effective ways. However, no researches have mentioned students satisfaction
with learning program, lecturers and teaching methods at University of Science, HCMC National
University. So this study was carried out to understand what University of Science, HCMC
National University students needs are regarding lecturers and teaching methods. Then, our
research will help teachers realize the strengths and shortcomings that have plans to improve the
quality of teaching and service to achieve the goals that Physical education department and the
University were set.
The objectives of this study were to examine the satisfaction levels of students and to
evaluate different in satisfaction between male and female students with learning program,
lecturers and teaching methods toward studying in Physical education classes at in University of
Science, HCMC National University. Therefore, this study came along with the hypothesis: There
is a significant difference in satisfaction between male and female students with learning program,
lecturers and teaching methods toward studying in Physical education subjects at University of
Science, HCMC National University.
METHODS
Population: All students who study in Physical education classes at University of Science,
HCMC National University.
Sample: In this study, researchers are teaching the physical education classes on Monday,
Tuesday and Friday, then it was reasonable to use cluster sampling as the method to select
samples. Hence, the sample size was 300 students who included 150 male students and 150 female
students.
Measure
A self-constructed survey questionnaire was used and it was included 22 items with 2
sections: 8 items of learning program factor, and 14 items of lecturers and teaching methods factor.
Then, students answered on 5-Likert scale which includes 5 items: "strongly dissatisfied",
"dissatisfied", "neutral", "satisfied" to "strongly satisfied".
Validity and Reliability
The questionnaire was developed in Vietnamese language that including 22 items. Then,
the Content Validity Index (CVI) was used to establish validity, three experts were asked to
evaluate the questionnaire for clarity, readability, item relevance, discrimination, and inclusiveness
of items. CVI of all instruments were 0.98. Then, 50 students were tested those instruments for
internal consistency with the same criteria as the subjects at Physical Education classes
University of Science. Appendix A showed the coefficient alpha values in the interval of .8215 to
.8379 for 2 subscales (learning program, lecturers and teaching methods) which are above the
minimum level of 0.7 recommended by Nunnally & Bernstein (1994).
Data collection
From March 2010, the researcher developed the Vietnamese questionnaire version from
the secondary information such as the other researches, the books and internet, etc. After that, this
questionnaire was checked and edited by the experts and advisors. Then, in April 2010, the
researcher began to collect data.
Data Analysis
Mean and standard deviation were used to examine level of students satisfaction.
Independent t-test was used to evaluate different satisfaction between male and female students
with learning program, lecturers and teaching methods.
Page 260

July 9-11, 2012
RESULTS AND DISCCUSIONS
Table 1: Results of Mean, Standard deviation and Independent t-test of male and female students
satisfaction in Learning program factor (n = 300)
Students
Items
n
SD
t
Sig
Gender
satisfaction
level
-The contents of the
Male
150 3.55
0.67
Satisfied
LP1
learning program are
- 0.602 0.552
reasonable.
Female 150 3.60
0.69
Satisfied
-The credit total of all
the physical education
subjects in a term is
reasonable.
LP2
-The obligatory
subjects are
reasonable.
LP3
-The optional subjects

are reasonable.
LP4
-The schedule for

every subject is
arranged reasonable.
LP5
-The schedule for

extracurricular
activities is reasonable.
LP6
Male
150
3.63
0.81
Satisfied
Female
150
3.60
0.79
Satisfied
Male
150
3.39
0.68
Neutral
Female
150
Male
Neutral
3.41
0.73
150
3.56
0.69
Satisfied
Female
150
3.59
0.85
Satisfied
Male
150
3.29
0.77
Neutral
Female
150
3.09
0.92
Neutral
Male
150
3.27
0.78
Neutral
Female
150
3.20
0.79
Neutral
0.291
0.772
- 0.242
0.807
- 0.303
0.765
1.974
0.05
0.734
0.465
-The examinations for

Male
150 3.63
0.82
Satisfied
LP7
each subject are close
1.942
0.054
to the learning
Female 150 3.45
Satisfied
0.85
program.
-The examination
Male
150 3.71
0.74
Satisfied
LP8
organization is well
0.692
0.491
done and the
Female 150
Satisfied
3.65
0.77
examiners are
completely serious.
p < 0.05
Criteria: Satisfaction level (1.00 1.80: absolutely dissatisfied; 1.81 2.61: dissatisfied; 2.62
3.42: Neutral; 3.43 4.23: Satisfied; 4.24 5.00: absolutely satisfied)
Table 1 revealed that both male and female student noted satisfaction in items LP1,
LP2, LP4, LP7, LP8 and male had higher satisfaction in items LP2, LP7, LP8 than female, but
male had lower satisfaction in two items LP1, LP 4 than female. Finally, there were no
significant differences between male and female students in these items LP1, LP2, LP4, LP7,
LP8 (Sig >0.05).
In addition, It was scored neutral in both male and female students with items LP3,
LP5, LP6 and male had higher score in itemLP5, LP6 and they had lower score than female in
Page 261

July 9-11, 2012
item LP3 but there were no significant differences between male and female students in these
items LP3, LP5, LP6 (Sig >0.05).
Totally, there was no significant difference between male and female students in
Learning program factor. These differ from the hypothesis above but it was true with the real
situation because this learning program based on the regulations of the instruction of Physical
Education subject in the University from Vietnam Ministry of Education and Training (1995). In
this instruction, they said that to ensure the content, the credit of Physical education subject in 1
term, to arrange the schedule for the obligatory subjects, optional subjects are reasonable, etc.
Table 2: Results of Mean, Standard deviation and Independent t-test of male and female students
satisfaction in Lecturers and teaching methods factor (n = 300).
Items
- The lecturer has good
and understandable
teaching methods.
-The lecturer has
thorough professional
knowledge and updates
the in-charge subject.
-The lecturer supplies
the syllabus of each
subject.
-The lecture combines
the teaching with the
education of the
students
characteristics and
morality.
-The lecturer is dressed
politely and behaves
correctly towards the
students.
-The lecturer always
does the teaching in
accordance with the
teaching plan.
The lecturer is always
concerned to supports
weak students in the
class.
-All questions about
the Physical education
subject can be posed to
the lecturer in charge
(through direct
discussion, email,
telephone etc.).
Coding
LTM1
LTM2
LTM3
LTM4
SD
Students
satisfaction
level
3.66
0.78
Satisfied
150
3.55
0.86
Satisfied
Male
150
3.60
0.72
Satisfied
Female
150
3.67
0.76
Satisfied
Male
150
3.53
0.69
Satisfied
Gender
Male
150
Female
Female
150
3.51
0.70
Satisfied
Male
150
3.40
0.77
Neutral
150
3.57
0.75
Male
150
3.44
0.81
Satisfied
Female
150
3.45
0.88
Satisfied
Male
150
3.39
0.78
Neutral
Female
150
3.40
0.73
Neutral
Male
150
3.63
0.81
Satisfied
Female
150
3.77
0.80
Satisfied
Male
150
3.47
0.84
Satisfied
150
3.65
0.84
Female
LTM5
LTM6
LTM7
Satisfied
Sig
1.196
0.233
-0.852
0.394
0.166
0.869
-1.973
0.050
-0.143
0.892
-0.154
0.879
-1.581
0.116
-1.934
0.055
LTM8
Female
Page 262
Satisfied

July 9-11, 2012
Items
-There are various
forms to evaluate the
students' performance
in each sport in
Physical Education
subject so the
evaluation has better
accuracy.
-The lecturer applies
the team-work method
in the class the
students can achieve
the knowledge
objectives of subject.
-The students can
achieve the skill
objectives.
Coding
Male
150
3.29
SD
Students
satisfaction
level
0.76
Neutral
Sig
1.034
0.302
0.363
0.717
2.119
0.035
0.648
0.517
1.594
0.112
LMT9
Female
LTM10
Neutral
150
3.19
0.80
150
3.28
0.77
150
3.25
0.82
Male
150
3.33
0.72
Neutral
Female
150
3.16
0.70
Neutral
Male
150
3.30
0.70
Neutral
Female
150
3.25
0.72
Neutral
Male
150
3.31
0.72
Neutral
Female
150
3.18
0.73
Neutral
Male
Female
LTM11
-The lecturer renovates LTM12

the teaching methods.
-The university is
concerned to the
teaching quality.
Gender
LTM13
Neutral
Neutral
-The students' general

Male
150 3.38
0.64
Neutral
LTM14
remark on the
1.494
0.136
University's training
Female
Neutral
150 3.26
0.75
quality of the Physical
Education subject.
p < 0.05
Criteria: Satisfaction level (1.00 1.80: absolutely dissatisfied; 1.81 2.61: dissatisfied; 2.62
3.42: Neutral; 3.43 4.23: Satisfied; 4.24 5.00: absolutely satisfied)
Table 2 showed that both male and female student scored satisfaction in items LTM1,
LTM2, LTM3, LTM5, LTM7, LTM8 but male had higher satisfaction in items LTM1, LTM3
than female, and male had lower satisfaction in items LTM2, LTM5, LTM7, LTM8 than female.
Thus, there was no significant difference between male and female students in items LTM1,
LTM2, LTM3, LTM7, LTM8 (Sig >0.05).
Furthermore, both of male and female students got neutral in items LTM6, LTM9,
LTM10, LTM11, LTM12, LTM13, LTM14 and male had higher score in items LTM9, LTM10,
LTM11, LTM12, LTM13, LTM14 than female, and they got lower score than female in only one
item LTM6. Thus, there was no significant difference between male and female students in
these items LTM6, LTM9, LTM10, LTM11, LTM12, LTM13, LTM14 (Sig >0.05). Besides, in
item LTM4, male scored neutral and female scored satisfaction but there was not also significant
difference between male and female students in this item (Sig=0.05).
Finally, there was no significant difference between male and female students in
Lecturers and teaching methods factor. These differ from the hypothesis above but it was true with
the real fact that most of students enjoyed with the lecturers and teaching methods because they
Page 263

July 9-11, 2012
always make their lectures interesting so there had no sex different with what they gain from the
lecturers (Adediwura & Bada, 2007).
CONCLUSIONS
In summary, we found that most of students were satisfied with Learning program,
Lecturers and teaching methods although the levels were not so very high. Thus, Learning
program, lecturers and teaching methods need to be improved to make the students noted highest
satisfaction in learning Physical education subjects.
Appendix A: Internal Consistency Analysis of Student satisfaction scale
Subscales
Numbers of Items
Learning program
LP1, LP2, LP3, LP4, LP5, LP6, LP7, LP8
Lecturers and
LTM1, LTM2, LTM3, LTM4, LTM5,
Teaching methods
LTM6, LTM7, LTM8, LTM9, LTM10,
LTM11, LTM12, LTM13, LTM14, LTM15
Page 264
Cronbachs Alpha
.8215
.8379

July 9-11, 2012
REFERENCES
Journal article
1. Adediwura, A. A. & Bada, T. (2007). Perception of teachers knowledge, attitude and
teacher skills as predictor of academic performance in Nigerian secondary schools.
Educational Research and Review, 2(7), 165-171.
2. Lin, M. J. (1994). The use of SWOT analysis in public sports facilities. Physical
Education of the republic of China, 29, 47 54.
3. Huang, W. Z. (1992). The importance of planning sports facilities. Physical Education
Quarterly, Taipei, Taiwan, 95, 15 19.
Publishing data
1. Ellard, J. J. A. (1984). A competency analysis of managers of commercial recreational
sport enterprises. Doctoral dissertation, Indiana University.
2.
Vietnam Ministry of Education and Training (1995). Instruction of Physical
Education subject in the University. Socialist Republic of Vietnam.
3. Streff, L. L. (1991). A determination of member satisfaction at three different types of
fitness centers. Master thesis, Arizona State University.
Page 265

July 9-11, 2012
HUP112-3
FOREIGN STUDENTS MOTIVATION IN VIETNAMESE

LANGUAGE COURSE AT FACULTY OF VIETNAMESE
STUDIES, UNIVERSITY OF SOCIAL SCIENCE AND
HUMANITIES HO CHI MINH CITY NATIONAL
UNIVERSITY.
Nguyen Thu Lan (1), Nguyen Tra Giang (2), Nguyen Van Chanh (3)
(1) Faculty of Vietnamese Studies , University of Social Science and Humanities
Hochiminh city National University, Hochiminh city, Vietnam.
Email: thulankoneko@yahoo.com
(2) Faculty of Sport Science, Burapha University, Chonburi 20131, Thailand.
(3) Faculty of Socialist Studies, University of Social Science and Humanities Hochiminh
city National University, Hochiminh city, Vietnam.
ABSTRACT
The purposes of this study were to examine the motivation levels of full-time and shorttime students and to evaluate the different in motivation between them in Physiological needs,
Safety needs, Social needs and Esteem needs toward learning in Vietnamese language course at
Faculty of Vietnamese Studies, Social Science and Humanities University Hochiminh city
National University. The sample size in this study was included 57 full-time students and 40 shorttime students. Furthermore, the Cronbach alpha and Independent t-test was used to analysis the
data in this study.
The results and discussions showed both full-time and short-time students scored very
high motivation level in items PN1, PN3, SaN1, SoN1, SoN2, SoN3, EN1and EN2 (Sig > 0.05).
Thus, there were not significant differences between them and these differed from the hypotheses.
However, full-time students had higher motivation than short-time students in item PN2 and
they also scored very high level while short-time students noted neutral and low level in item
SaN2, SaN3. Especially, full-time students had lower motivation than short-time students in
item EN3. Hence, there were significant differences between them in these items (Sig < 0.05)
and these supported the hypotheses. Conclusions for the item SaN3, the Faculty of Vietnamese
Studies should to apply these results to renew the class time which suitable to short-time students
to make they get more motivation.
Keywords: motivation, Vietnamese language course, full-time students, short-time students.
INTRODUCTION
According to Maslow's need theory, the basic levels of needs (physiological, safety,
society, esteem, and self-actualization) must at least partially meet the satisfaction of the individual
before the higher levels of need can act (Brown & Cullen, 2006). To satisfying the various
intrinsic and extrinsic needs of each individual's life (including the knowledge explosion, social
interaction, personal achievement, mental and physical relaxation, etc.). Motivation is the
important factor which must be considered (Chang & Kao, 2001) because it can direct the
individual to fulfill his/her needs and simultaneously, reduce depression and anxiety (Kotler,
1991). Thus, according to the Maslows needs in learning background, the students go to the
universities with the exhausted metal will not active to study.
Page 266

July 9-11, 2012
Faculty of Vietnamese Studies under University of Social Science and Humanities Ho Chi Minh
city National University was established in 1998, is a Vietnamese teaching place in Vietnam
present, with the large of number foreign students, especially with the learning program of
Bachelor and Masters degree for foreigners. In addition, the Faculty also organizes specialized
Vietnamese courses for student groups in oversea universities. However, there have no researches
have mentioned in students motivation that learning Vietnamese language course in this faculty.
Therefore, this study was determined the difference in the motivation of full-time students and
short-time students who learning Vietnamese in order to help managers see differences in
motivation of two groups clearly and also help them to have the plan to improve the quality of
management, teaching and service as well as giving the curriculum to achieve scientific goals that
the Vietnamese Studies Faculty has set. (Website of Vietnamese Studies Faculty, 2012).
The objectives of this study were to examine the students motivation level and to evaluate
the different in motivation between full-time and short-time students in learning Vietnamese
language course at Faculty of Vietnamese Studies, University of Social Science and Humanities
Ho Chi Minh city National University. Therefore, this study came along with the hypothesis: there
is a significant difference in motivation between full-time and short-time students toward learning
in Vietnamese language course at Faculty of Vietnamese Studies.
METHODS
Population: All students who study in Vietnamese course at Faculty of Vietnamese
Studies, University of Social Science and Humanities Hochiminh city National University,
Hochiminh city, Vietnam.
Sample: In this study, researcher is teaching the Vietnamese language course on
Monday, Tuesday and Thursday, then it was reasonable to use cluster sampling as the method to
select samples that are learning on these days. Hence, the sample size was 97 students who
included 57 full-time students and 40 short-time students.
Measure
The questionnaire was based on principles of Maslow's needs theory containing 12 items
for answer to 4 level of that theory: Physiological needs, Safety needs, Social needs and Esteem
needs. After that, 12 items were coded in the following appendix A. Besides, students answered
on 5-Likert scale which includes 5 items: "strongly disagreed", "disagreed", "neutral", "agreed" to
"strongly agreed".
Validity and Reliability
The questionnaire was developed in Vietnamese language that including 12 items. Then,
the Content Validity Index (CVI) was used to establish validity, three experts were asked to
evaluate the questionnaire for clarity, readability, item relevance, discrimination, and inclusiveness
of items. CVI of all instruments were 1. After that, 30 students were tested those instruments for
internal consistency with the same criteria as the subjects at Vietnamese language course Faculty
of Vietnamese Studies. Appendix B showed the coefficient alpha values in the interval of .7383 to
.8979 for 4 subscales (Physiological needs, Safety needs, Social needs and Esteem needs) which
are above the minimum level of 0.7 recommended by Nunnally & Bernstein (1994).
Data collection
From September 2011, the researcher developed the Vietnamese questionnaire version
based on Maslows needs from the secondary information such as the other researches, the books
and internet, etc. After that, this questionnaire was checked and edited by the experts. Then, in
January 2012, the researcher began to collect data.
Data Analysis
Mean and standard deviation were used to examine level of students motivation.
Independent t-test was used to evaluate the different of motivation between full-time students and
short-time students with principles of Maslows needs theory.
Page 267

July 9-11, 2012
RESULTS
Table 1: Results of Mean, Standard deviation and Independent t-test of full-time students and
short-time students motivation in 4 level of Maslows needs theory factor (n = 97).
Items
Students
PN1
Full-time
Short-time
Full-time
Short-time
Full-time
Short-time
Full-time
Short-time
Full-time
Short-time
Full-time
Short-time
Full-time
Short-time
Full-time
Short-time
Full-time
Short-time
Full-time
Short-time
Full-time
Short-time
Full-time
Short-time
57
40
57
40
57
40
57
40
57
40
57
40
57
40
57
40
57
40
57
40
57
40
57
40
PN2
PN3
SaN1
SaN2
SaN3
SoN1
SoN2
SoN3
EN1
EN2
EN3
SD
4.70
4.60
4.30
2.95
4.58
4.38
4.44
4.58
4.25
2.88
4.40
2.55
4.81
4.70
4.33
4.38
4.63
4.43
4.65
4.70
4.75
4.65
3.04
4.25
0.46
0.50
0.73
0.99
0.57
0.63
0.63
0.55
0.71
0.52
0.73
0.90
0.34
0.64
0.74
0.71
0.56
0.71
0.48
0.46
0.43
0.48
0.53
0.81
Motivation
level
Very high
Very high
Very high
Neutral
Very high
Very high
Very high
Very high
Very high
Neutral
Very high
Low
Very high
Very high
Very high
Very high
Very high
Very high
Very high
Very high
Very high
Very high
Neutral
Very high
Sig
1.036
0.303
7.736
0.000
1.671
0.098
-1.109
0.270
10.974
0.000
11.158
0.000
1.184
0.240
-0.278
0.781
1.536
0.129
-0.520
0.604
1.112
0.269
-8.317
0.000
p < 0.05
Criteria: Motivation level (1.00 1.80: very low; 1.81 2.61: low; 2.62 3.42: neutral; 3.43
4.23: high; 4.24 5.00; very high)
Table 1 indicated that:
Both full-time and short-time students had very high motivation level in items PN1,
PN3 so there were not significant differences between them in these items (Sig >0.05). However,
full-time students had higher motivation than short-time students in item PN2 so there was a
significant different between them in this item (Sig <0.05).
Both full-time students and short-time students scored very high motivation level in item
SaN1 so there was not a significant different between them in this item (Sig >0.05). But, there
were significant differences between them in two items SaN2 and SaN3 because full-time
students score very high motivation while short-time students scored neutral and low motivation
(Sig <0.05).
For Social Needs factor, there were not significant differences between them in
Physiological Needs factor (Sig <0.05) because both full-time and short-time students scored very
high motivation level in 3 items SoN1, SoN2, SoN3.
Both full-time and short-time students had very high motivation level in two items
EN1, EN2 so there were not significant differences between them in these items (Sig >0.05).
However, full-time students had lower motivation than short-time students in item EN3 so there
was a significant different between them in this item (Sig <0.05).
Page 268

July 9-11, 2012
Totally, there was a significant different between them in 4 factors (Sig <0.05) because
full-time students noted higher motivation ( X = 4.41) than short-time students ( X = 4.09).
DISCUSSION
With the Physiological needs factor, there were not significant differences between fulltime and short-time students in items PN1, PN3, these differ from the hypotheses of the study.
However, this result can be acceptable because University of Social Science and Humanities
located in District 1 is the central district of Hochiminh city and other government offices,
consulates of foreign countries, foreign companies are concentrated in this district with shopping is
the largest and most beautiful places in the city with high rise buildings and houses of ancient
architecture in which France, the United States to leave. In addition, the lecturers of Vietnamese
Studies Faculty always access to knowledge and ways of thinking, new teaching. These are two
important points attract both of full-time and short-term students to study at the Faculty of
Vietnamese Studies. However, for item "PN2", there was a significant difference between them so
this supports to the hypothesis which showed that full-time students were satisfied with the courses
in while short-time students said that the program was not diverse and somewhat inconsistent with
the level and their Vietnamese ability. (Website of Vietnamese Studies Faculty, 2012).
With the Safety needs factor, there was no significant different between them in item
SaN1, this differs from the hypothesis but it is true to the fact that Vietnamese Studies Faculty is
the most prestigious teaching Vietnamese place in Vietnam present. In addition, with financial
resources and facilities funded by the managing board of the University of Social Sciences and
Humanities as well as Ho Chi Minh City National University, it is always the evidence and ensures
the sustainable operation of the faculty. Besides, the faculty always has relationships with a wide
range of universities, research institutions ... in the country and abroad. However, there was a
significant different between them in two items SaN2, SaN3 but these support the hypothesis
because there are currently about 12,000 foreign workers from 73 countries to work in Hochiminh
city and tend to rise in the last 2 years; therefore, full-time students said that learning Vietnamese
will help them have the opportunity to find a good job in Vietnam with a suitable salary, so most
of them agreed with very high level in item SaN2. However, only short-time students agree with
neutral level for this item SaN2 because most of them are those who have jobs and for an objective
reason that they have to live in Vietnam such as: their companies open branches in Vietnam or
they get married with Vietnamese etc.. In addition, full-time students also agreed with very high
level in item SaN3 so that point shows that they were very satisfied with class time as well as the
number of hours for a session. As for short-time students, they agreed with the level of low to
demonstrate that they were not satisfied because most of them are adults with jobs and only have
time in class in the early morning or on Saturday, Sunday etc
With the Social needs factor, there were not significant differences between them in all
items SoN1, SoN2, SoN3, these differ from the hypotheses. Because of study, both of them also
participate in social activities and community to promote their capabilities as well as increasing the
knowledge of social, communication skills and teamwork (Website of Vietnamese Studies Faculty,
2012). Especially the students also participate in many activities such as: music performances,
sport for students, cultural festivals, social work such as: helping the poor, disabled children,
solitary, blood donation.etc Therefore, participation in social activities as well as cultural
exchanges with Vietnamese students has helped them improve their communication skills in
Vietnamese language as well as get a better, deeper cultural and human Vietnam.
With the Esteem needs factor, there were not significant differences between them in two
items EN1, EN2, these also differ from the hypotheses. Because full-time students said that
since they can speak Vietnamese and they have more confidence in front of the crowd, as they can
say their opinion confidently in front of their teachers and friends. Besides, Vietnamese friends
also listen their ideas comments on a problem because they use Vietnamese makes people feel
understand, friendly and closer. It also factors that make them gain respect from others. Short-time
students also said that when they use Vietnamese they are very easily make friends, learn from
Page 269

July 9-11, 2012
business partners as well as easy exchange or debate their views in meetings in the company,
which makes them feel very confident in their work and in daily life. Besides, they found that they
always get the respect from the partners and colleagues in the company when they speak or talk
about work by Vietnamese. With item EN3, the majority of full-time students answered for this
item with the neutral level because according to their age students that it is difficult to increase the
social value and social status. But for short-time students, they agreed with the level of very high
because they said when they speak Vietnamese they can work in a more professional with the
ability to fluently Vietnamese, and there are always innovations and new job skills. That makes
them feel satisfied with the social values are also likely to rise to higher positions at work in the
future. Thus, there are significant differences between them in this item and this also supports the
hypothesis.
CONCLUSION
In summary, we found that most of full- time and short-time students got very high
motivation, but short-time students had low motivation in only item SaN3 so to make they get
more motivation, the Faculty of Vietnamese Studies should to apply this results to renew the class
time which suitable to short-time students.
LIMITATION OF THIS STUDY
According to the definition and explanation of the Maslows needs theory, it is so hard to
get the level 5 (self-actualization) so researcher eliminated this level in the questionnaire.
ACKNOWLEDGMENT
This study was totally supported by a research grant for Research of University of Social
Science and Humanities Ho Chi Minh city National University, Vietnam.
Appendix A: Coding items
No
Coding
1
2
3
PN1
PN2
PN3
4
5
6
SaN1
SaN2
SaN3
7
8
9
SoN1
SoN2
SoN3
10
11
12
EN1
EN2
EN3
Items
Physiological needs
The Vietnamese Studies Faculty locates at a convenience location.
The suitable learning program.
The lecturers have good teaching methods.
Safety needs
Vietnamese Studies Faculty is a reputed teaching place.
Help me find well paid jobs.
With flexible timetable.
Social needs
Can make me have more friends.
To improve my skills of teamwork.
To improve the knowledge and language.
Esteem needs
To bring the respect of others.
Can make me feel more confident.
Can bring me to higher standing in the society.
Appendix B: Internal Consistency Analysis of Student satisfaction scale

Subscales
Numbers of Items
Physiological needs
PN1, PN2, PN3
Safety needs
SaN1, SaN2, SaN3
Social needs
SoN1, SoN2, SoN3
Esteem needs
EN1, EN2, EN3
Page 270
Cronbachs Alpha
0.7383
0.7895
0.8979
0.7462

July 9-11, 2012
REFERENCES
Journal article
1. Brown, K., & Cullen, C. (2006). Maslows Hierarchy of Needs used to measure
motivation for religious behavior. Mental, Religion & Culture, 9 (1), 99-108.
2. Chang, H.M., & Kao, J. S. (2001). The relationship between leisure needs and its
constraints-in the examples of Zhang-Hua citizens. Journal of Sports, 30, 143-153.
Books in citation
1. Kotler, P. (1991). Marketing Management: Analysis, planning, and control (7th Ed.).
Englewood Cliffs, NJ: Prentice Hall.
2. Nunnally, J. C., & Bernstein, I. H. (1994). Psychometric Theory. (3rd Ed.). New York:
McGraw Hill.
Books not in citation
1. Krulglanski, A. W. (1978). Endogenous Attribution and Instrinsic Motivation. In M. R.
Lepper & D. Green (Eds). The hidden costs of reward: New perspectives on the
psychology of human motivation. Hilsdale, NJ: Erlbaum.
Electric citation
1. Website of Vietnamese Studies Faculty (2012). Objectives of Vietnamese Studies
Faculty. Available from: URL:
http://www.vns.edu.vn/vns/index.php?option=com_content&view=article&id=42&Itemid
=134&lang=en.
2. Website of Vietnamese Studies Faculty (2012). The point of Vietnamese language is a
communication. Available from: URL:
http://www.vns.edu.vn/vns/index.php?option=com_content&view=article&id=113&Itemi
d=136&lang=en.
3. Website of Vietnamese Studies Faculty (2012). The point of Vietnamese language is a
tool. Available from: URL:
http://www.vns.edu.vn/vns/index.php?option=com_content&view=article&id=113&Itemi
d=136&lang=en.
Page 271

July 9-11, 2012
HUP131-4
Factors supporting the Establishment of Learning Organization

for Governance Officers and Employees at Local
Administrative Organizations in Singburi province
Chavalit Supasaktumrong, Chirawan Somwang, Ph.D
Faculty of Management Science, Thepsatri Rajabhat University, Lopburi, Thailand 15000
Email: alit2001@hotmail.com ; Chirawan@msn.com
ABSTRACT
The purpose of this study was to 1) study factors supporting the establishment of learning
organization for governance officers and employees at local administrative organizations in
Singburi province, 2) examine the characteristics of learning organization at local administrative
organizations in Singburi province, 3) compare the characteristics of learning organization for
governance officers and employees at local administrative organizations in Singburi province
when classified by gender, age, education level, work position, workplaces, and work experience,
and 4) study the relationship between factors supporting the establishment of learning organization
and the characteristics of learning organization for governance officers and employees at local
administrative organizations in Singburi province. The research samples were 322 governance
officers and employees from local administrative organizations in Singburi province, selected by
the proportional stratified random sampling technique. Research findings indicated that
characteristics of learning organization for governance officers and employees at local
administrative organizations in Singburi province in overall were high level. According to the
comparison of characteristics of learning organization for governance officers and employees at
local administrative organizations in Singburi province, when classified by gender, education
level, and work position, there was no statistically significant difference. When classified by age,
workplaces, and work experience, there were statistically significant difference. Research results
also revealed that the correlation coefficient of characteristics of learning organization was at low
level. According to the multiple regression, there were two variables being able to predict the
characteristics of learning organization. These two variables were knowledge creation and
knowledge storage. A multiple regression equation for predicting characteristics of learning
organization can be expressed a follows: characteristics of learning organization = 3.757 (.192)
(knowledge creation) + (.199) (knowledge storage).
Keywords: learning organization, knowledge management, Senges fifth disciplines, and local
administrative organization
INTRODUCTION
In the world today, the dynamic of
global competition, technological advancement,
limited resources, corporate restructuring, and
unstable economic conditions are changing on
business. It is necessary that organizations
must learn and adapt to make improvements
in performance (Agboola, & Salawu, 2011).
Globalization and workforce diversity
are influence to organizational success. The
firms knowledge capital is increasingly

important. It could be indicated that
knowledge could be reached and learned to
improve individual and organizational
performance. Moreover, the most beneficial
assets are knowledge employees and their
productivity (Li et al., 2008). The knowledge
of employees is an essential strategic
resource for organizations. In addition,
knowledge management can be considered
Page 272

July 9-11, 2012
important for long-term success and stability
(Weldy, 2009).
The conceptualization of learning
organization is more important to modern
management practices because of the
increasing complexity, uncertainty, and rapid
change of organizational environment. It is
essential to understand the concepts of
learning organization and its characteristics.
It is also important to conceive how learning
organization is related to knowledge
management (Loermans, 2002).
Responding
to
the
dynamic
environment, new public management has
been used to reform public management for
Thai government. The instruments in
contexts of this reform comprised of the
strategic
performance
in
budgeting,
management, knowledge management, and
learning organization (Srimai, Damsaman, &
Bangchokdee, 2011).
Royal Decree on criteria and
procedures for good governance, B.E. 2546
(2003), section 11, determined the
government
agency,
for
result-based
management under this Royal Decree, shall
make itself to be global learning
organization. For this purpose, the
government agency shall acknowledge and
analyze information in all aspects. The
government agency shall also promote and
develop capability, vision, attitude and colearning of its official. In addition, cabinet
resolution, on the April 12, 2005, was
focused on the development in Thai
bureaucracy system especially supporting the
learning process and continuous development
to governance officers and agencies for
increasing the productivity (Office of the
Public Sector Development Commission,
2012).
Department of local administration,
one of the important government agencies,
has recognized the significance of learning
organization.
Therefore,
knowledge
management is integrated to provincial public
sectors. Knowledge management plans, local
development plans, and community plans are
determined for the governance officers
involvement and participation in knowledge
management process (Department of local
administration, 2012).
However, in the public sector reform in

Thailand, it revealed that provincial local
administrative
organizations
had
the
problems in knowledge management such as
incomplete and unconnected database,
inefficient
database
management,
an
inadequate budget, shortage in the R&D
(research and development), and lack of
innovation (Kriengsak Chareonwongsak,
2009).
Singburi
Local
administrative
organizations are consisted of 1 provincial
administrative
organization,
1
town
municipality, 7 sub district municipalities, and
6 Sub district administrative organizations.
Singburi Local administrative organizations
have been supporting the establishment of
learning organization. Governance officers
and employees have been developed their
knowledge and competencies for serving
needs of people and responding to rapid
change that it could be seen in many
important projects such as the development
of electronic form system, the development
of e-learning for governance officers and
employees,
computer,
computer
programming training courses, and the
competency training (Singburi provincial
office of local administration, 2012).
LITERATURE REVIEWS
Knowledge management
Fong and Lee (2009) describe that
knowledge management is the explicit control and
management of knowledge within an organization
to achieve firms objectives. Ringel-Bickelmaier
and Ringel (2010) illustrate that knowledge
management consists of activities related to the
capture, use and sharing of knowledge by the
organization. It also involves the management both
external and internal linkages within the enterprise.
Aktharsha and Anisa (2011) define
knowledge management as the strategies and
practices that involve with knowledge acquisition,
transfers, and shares with all employees in the
organization.
Sandhawalia and Dalcher (2010) illustrate
that there are four components of knowledge
process capabilities.
Knowledge acquisition refers to an
organizations capability to seek, identify, acquire,
and collect internal and external knowledge that is
important to its operations.
Page 273

July 9-11, 2012
Knowledge creation refers to an organizations
capability to develop and convert knowledge
through the processes and activities of synthesis,
refinement, integration, combination, coordination,
distribution, and restructuring of knowledge.
Knowledge storage refers to an
organizations capability to select a repository of
knowledge that it is acquired and created.
Knowledge transfer refers to an
organizations
capability
to
disseminate,
communicate, and share knowledge from one part
of the organization to another (or all other) parts of
the organization.
Learning organization
Boyle (2002) defines learning
organization as an organization that supports
the learning of all its members and converts
itself and its context. Chang and Sun (2007)
define learning organization as an
organizations capability in creating,
acquiring, interpreting, transferring and
retaining knowledge, and at purposefully
modifying its behavior to indicate new
knowledge and visions. Filstad and
Gottschalk
(2011)
describe
learning
organization as an organization that
continuously learns as it evolves to respond
to various pressures and where it supports the
learning of all its employees and transforms
itself into a learning unit.
Senge (1990) explained there were fifth
disciplines in learning organization.
Personal mastery refers to discipline of
continually clarifying and deepening our personal
vision, of focusing our energies, of developing
patience, and of seeing reality objectively.
Mental models refer to deeply ingrained
assumptions, generalizations, or even pictures of
images that influence how we understand the
world and how we take action.
Building shared vision refers to a practice of
unearthing shared pictures of the future that foster
genuine commitment and enrollment rather than
compliance.
Team learning starts with dialogue, the
capacity of members of a team to suspend
assumptions and enter into genuine thinking
together.
Systems thinking can be described as the
disciplines of building shared vision, mental
models, team learning, and personal mastery to
realize its potential.
RESEARCH OBJECTIVES
To study factors supporting the
establishment of learning organization for
governance officers and employees at local
administrative organizations in Singburi province.
To examine the characteristics of learning
organization for governance officers and
employees at local administrative organizations in
Singburi province.
To compare the characteristics of learning
Singburi province when classified by gender, age,
education level, work position, workplaces, and
work experience.
To study the relationship between factors
supporting the establishment of learning
organization and the characteristics of learning
Singburi province.
RESEARCH HYPOTHESIS
H1: There are no significant
differences in the characteristics of learning
employees
at
local
administrative
organizations in Singburi province when
classified by gender, age, education level,
work position, workplaces, and work
experience.
H2: There is relationship between
factors supporting the establishment of
learning organization and the characteristics
of learning organization for governance
officers
and
employees
at
local
administrative organizations in Singburi
province.
RESEARCH FRAMEWORK
1. The independent variables consist
of personal factors (such as gender, age,
education level, work position, workplaces,
and work experience) and components of
knowledge process capabilities (knowledge
acquisition, knowledge creation, knowledge
storage, and knowledge transfer).
2. The dependent variables are
Senges fifth disciplines which are personal
mastery, mental models, building shared
vision, team learning, and systems thinking.
Page 274

July 9-11, 2012
DATA COLLECTION
The research samples were 322
governance officers and employees from
Singburi
provincial
administrative
organizations, sub-district administrative
organizations and Municipalities. The
samples were selected by the proportional
stratified random sampling technique. The
research instrument was a set of
questionnaire with the reliability of 0.920.
The questionnaire used in this research
consists of three sections. The first section
inquires basic demographic information from
respondents. The second section of the
questionnaire illustrates information about
the
respondents
knowledge
process
capabilities, which consists of 22 questions
divided into four aspects (knowledge
acquisition, knowledge creation, knowledge
storage, and knowledge transfer). These five
dimensions further comprise of a number of
items measured on a five-point rating scale.
The third section assesses characteristics of
learning organization for governance officers
and employees at local administrative
organizations in Singburi province. The
instrument is divided into five aspects
(mental models, personal mastery, team
learning, building shared vision, and systems
thinking). It has 26 questions on a five-point
rating scale.
RESEARCH FINDINGS
Characteristics
of
learning
employees
at
local
administrative
organizations in Singburi province in overall
were high level. When considering by each
aspect, the arithmetic mean could be ranged
from maximum to minimum as follows:
mental models ( = 4.00, S.D. = 0.67),
personal mastery ( = 3.87, S.D. = 0.56),
team learning ( = 3.82, S.D. = 0.58),
building shared vision ( = 3.82, S.D. =
0.59), and systems thinking ( = 3.64, S.D.
= 0.63).
According to the comparison of
characteristics of learning organization for
province, when classified by gender,
education level, and work position, there was

no statistically significant difference (p> .05).
When classified by workplaces, there was
statistically significant difference at the level
of .05. When classified by age, there was
statistically significant difference at the level
of .01. When classified by work experience,
there was statistically significant difference at
the level of .001.
Table 1 Empirical results of the regression
between factors supporting the establishment
of learning organization and characteristics of
learning organization
Variables
Knowledge
acquisition
Knowledge
creation
Knowledge
storage
Knowledge
transfer
R2
Adj
R2
Sig.
0.254
0.065
0.32
0.1950
.033
From Table 1, the coefficient of

multiple determination is 0.065; therefore,
about 6.50%, where the test is significant at p
< .01.
Table 2 Determine the multiple regression
equation for predicting characteristics of
learning organization
Variables
(Constant)
Knowledge
creation
Knowledge
storage
3.757
SE
B
Beta
Sig.
11.060
.000
-.192
.080
-.242
-2.406
.017
.199
.096
.197
2.071
.039
The results in Table 2 demonstrate that

the correlation coefficient of characteristics
of learning organization was in low level.
From the above output, the regression
equation as follows: characteristics of
learning organization = 3.757 (.192)
(knowledge creation) + (.199) (knowledge
storage).
Page 275

July 9-11, 2012
DISCUSSION AND CONCLUSION
According to characteristics of
learning organization, the lowest mean was
the discipline of systems thinking. Therefore,
province should be encouraged to 1)
brainstorm and integrate their knowledge to
new knowledge or ideas, and 2) extremely
analyze the causes of problem and fact-based
decision making. The finding revealed that
different ages of governance officers and
employees had different attitudes on
characteristics of learning organization in the
aspects of mental models, building shared
vision, and team learning. It is essential for
local administrative organizations in Singburi
province to support them with the strategic
management of employee involvement,
teams, and employee empowerment. The
finding also demonstrated that governance
officers and employees in the different
workplaces had different attitudes on
characteristics of learning organization in the
aspects of personal mastery, mental models,
building shared vision, and team learning.
Therefore, local administrative organizations
in Singburi province should manage
knowledge activities for governance officers
and employees in the different workplaces,
which are achieved through facilitating,
motivating, leading, and supporting them to
suitable working environment. In addition,
local administrative organizations in Singburi
province should realize that learning
organization is an integrated approach for
learning and managing knowledge assets
within organizations, which is considered
essential for success.
RECOMMENDATION FOR
ORGANIZATIONAL PRACTICES
the results of this study present
beneficial information that could be used to
make improvements in organizational
practices. local administrative organizations
in Singburi province should focus on
supporting members from all organizational
levels to realize the importance of knowledge
management and learning organization. It is
necessary to improve communication and
participation by facilitating adoption of
learning organization dimensions at all
organizational levels. This would empower
all members in the organizations to take
action on learning to improve performance
and gain a competitive advantage. It is also
suggested to combine the significance of
knowledge management and learning
organization in the long-term vision and
objectives of organization and develop best
practices around them.
RECOMMENDATION FOR FURTHER
RESEARCH
There are significant opportunities to
broaden this research. First, this research
concentrated
on
local
administrative
organizations in Singburi province only,
future research should study different local
administrative organizations in other
provinces. Second, further research should
link between knowledge capabilities and
organizational performance. It is necessary to
understand the differences among knowledge
capabilities including firm level differences
and how this involves to organizational
performance. Third, an important area for
further research is to understand how
characteristics of the organizations culture
facilitate knowledge capabilities and learning
process.
Page 276

July 9-11, 2012
REFERENCES
Agboola,A.A., & Salawu, R.O. (2011). Managing deviant behavior and resistance to change.
International Journal of Business and Management, 6(1), 235-242.
Aktharsha, U.S., & Anisa, H. (2011). Knowledge management system and learning organization:
An empirical study in an engineering organization. Journal of knowledge management, 9(2),
26-43.
Boyle, E. (2002). A critical appraisal of the performance of Royal Dutch Shell as a learning
organization in the 1990s. The learning organization, 9(1), 6-18.
Chang, D.S., & Sun, K.L. (2007). Exploring the correspondence between total quality management
and Peter Senges disciplines of a learning organization: A Taiwan perspective. Total quality
management, 18(7), 807-8222.
Department of local administration. (2012). Knowledge management and new public management.
Retrieved January, 21, 2012, from http://www.thailocaladmin.go.th/ work/km/
home/kmstory/kmstory1.htm
Filstad, C., & Gottschalk, P. (2011). Becoming a learning organization: The espoused values of
police managers from two Norwegian districts. The learning organization, 18(6),486-500.
Fong, P.S.W., & Lee, H.F. (2009). Acquisition, reuse and sharing of knowledge in property
management firms. Facilities, 27(7), 291 314.
home/index_project.php
Kriengsak Chareonwongsak. (2009). Thailand must be Knowledge-based Economy, not only could be
Creative Economy. Retrieved June, 8, 2012, from http://www.bangkokbiznews.
com/home/detail/politics/opinion/kriengsak/20100215/100542.html
Li, J., et al. (2009). Workplace learning: The roles of knowledge accessibility and management. Journal
of workplace learning, 21(4), 347-364.
Loermans, J. (2002). Synergizing the learning organization and knowledge management. Journal of
knowledge management, 6(3), 285-294.
Office of the Public Sector Development Commission. (2012). Project of development on learning
organization and knowledge management in public sectors. Retrieved January, 10, 2012, from
http://km.opdc.go.th/web_opdc/
Ringel-Bickelmaier, C., & Ringel, M. (2010). Knowledge management in international organizations.
Journal of knowledge management, 14(4), 524 - 539
Sandhawalia, B.S., & Dalcher, D. (2010). Development knowledge management capabilities: A
structured approach. Journal of knowledge management, 15(2), 313-328.
Senge, M.P. (1990). The fifth discipline: The art & practice of the learning organization. New York:
Doubleday.
Singburi provincial office of local administration. (2012). Singburi Official Letters. Retrieved June, 8,
2012, from http://www.singburi-local.go.th/index.php?options=order
Srimai, Su., Damsaman, N., & Bangchokdee, S. (2011). Performance measurement, organizational
learning and strategic alignment: An exploratory study in Thai public sector. Measuring business
excellence, 15(2), 57-69.
Weldy, T.G. (2009). Learning organization and transfer: Strategies for improving performance. The
learning organization, 16(1), 58-68.
Page 277

July 9-11, 2012
HUP149-5
Volatility of International Tourist Arrivals to Thailand

Tanattrin Bunnag
Faculty of Sciences and Social Sciences, Burapha University, Sakaeo 27160
Email: ratanan@buu.ac.th
Abstract
This paper examines Volatility of International Tourist Arrivals to Thailand using monthly
time series data for the period 1976-2010. As Thailand has been a significant source of a substantial
number of tourists, international tourist arrivals to Thailand needs to be analyzed and estimated for
future planning. Being a major foreign exchange earner and an important source of job creation for
Thailand, tourism is an important industry.
In this study we will consider the volatility of international tourist arrivals to Thailand by
employing GARCH and GJR model. GARCH and GJR model are widely used to manage the risk
exposure of financial and tourism risk.
International tourists are divided into three types which are short haul, medium haul and
long haul. Malaysian tourists represent short haul tourists. Japanese tourists represent medium haul
tourists. And British and American tourists represent long haul tourists. This study can be used for
making policy because of the difference in tourism volatility. The sustainable tourism is also
considered with regards to the policy for Thailand tourism future development.
Keyword: Volatility, GARCH Model and GJR Model
1.1 Rational backgrounds and research question
1.1.1 Rational backgrounds
As Thailand has been a significant source of a substantial number of tourists, international
tourist arrivals to Thailand needs to be analyzed and estimated for future planning. Being a major
foreign exchange earner and an important source of job creation for Thailand, tourism is an
important industry.
Thailand's tourism industry makes up about 6.5 percent of the country's GDP. International
visitors spent more than 547 billion baht in 2008.
The average length of stay per tourist in 2007 was 9 days. In 2008, 52.37 % of international
tourists were East Asian, with Malaysia and Japan providing the most visitors. Close to two million
Malaysians visited Thailand. We assume they take short trips over the Thai-Malaysian border, and
we think the number of Malaysian visitors, unduly inflates the total number of international
visitors. Europeans provided close to 4 million visitors in 2008, about 27.22 % of the total. The
number of visitors from the Americas, South Asia and Africa, is much smaller. However, close to
700,000 Australians visited Thailand, which is actually an enormous number, when taking the total
population of Australia into account (Tourism Authority of Thailand, 2011).
Page 278

July 9-11, 2012
Table 1.1 Number of International tourist arrivals to Thailand 2007-2010
Year
Total number of International tourist arrivals to Thailand

Jan.-Mar.
Apr.-Jun.
Jul.-Sept.
Oct.-Dec.
2007
3,831,089
3,123,663
3,422,983
4,058,708
2008
4,326,793
3,549,567
3,380,301
3,327,559
2009
3,645,330
2,963,983
3,284,484
4,256,044
2010
4,659,750
2,899,778
3,761,459
4,615,413
Source of Data: Immigration Bureau, Police Department
(see in Table 1.1) The number of tourist arrivals in the first quarter and second quarter of
2009 were 3.64 million and 2.96 million, respectively. These figures were lower than during the
first two quarters of 2007 or 2008. In the third quarter of 2009 we see that the number of visitors is
similar to the number of visitors in both 2007 and 2008, suggesting that the worst was over. In the
fourth quarter of 2009, we saw more arrivals than in 2007 and 2008.
The first quarter of 2010 saw a significant increase of tourist arrivals, especially in January
and February. Related to the political disturbances during April and May 2010, the second quarter
arrivals of 2010 were low but not much lower than in the second quarter of 2009, which also was
characterized by riots and demonstrations. However, tourism rebounded strongly during the third
and fourth quarter of 2010, with arrivals higher than in any of the preceding years (Tourism
Authority of Thailand, 2011).
Considering the number of tourist arrivals and growth rate of tourist arrivals, it was found
that the majority of tourists are from Malaysia and Japan. This study can be used to compare with
the USA and the UK for making policy because of the difference in tourism volatility. The
sustainable tourism is also considered with regards to the policy for Thailand tourism future
development.
1.1.2 Research question

How to analyze the volatility of total number tourist arrivals, Malaysian tourist
arrivals, Japanese tourist arrivals, British tourist arrivals and Americantouristarrivals
1.2 Research methodology and literature review

1.2.1 Unit root tests
1.2.1.1 Augmented Dickey and Fuller tests
To test for the long run frequency, Dickey and Fuller (1979) proposed a
procedure based on the following auxiliary regression:
k
yt = + t + yt 1 + j yt k + t
j =1
Page 279
(1.1)

July 9-11, 2012
where y t = (1 L) designates the first different filter, t is the error term and ,
and are the parameters to be estimated.
1.2.1.2 Phillips and Perron tests
The Phillips-Perron test is a unit root test. It is used in time series analysis to test the
null hypothesis that a time series is I (1). It builds on the Dickey-Fuller test, but unlike the
Augmented Dickey-Fuller test, which extends the Dickey-Fuller test by including additional lagged
variables as regressors in the model on which the test is based, the Phillips-Perron test makes a
non-parametric correction to the t-test statistic to capture the effect of autocorrelation present when
the underlying autocorrelation process is not AR(1) and the error terms are not homoscedastic.
For analyzing the volatility, we use econometrics as follows:

1.2.2 Volatility Analysis
For analyzing the volatility, we use econometrics as follows:
1.2.2.1 Conditional Mean Model
The conditional mean model is to the autoregressive moving average, or ARMA
(p, q) model that is proposed by Box-Jenkins (1970) combining the AR (p) and MA (q). Such a
model states that the current value of some series y depends linearly on its own previous values
plus a combination of current and previous values of a white noise error term. The model could be
written:
( L) y t = + ( L) t
(1.2)
where
( L) = 1 1 L 2 L2 p L p and ( L) = 1 + 1 L + 2 L2 + + q Lq
or
yt = + 1 yt 1 + 2 yt 2 + + p y t p + t + 1 t 1 + 2 t 2 + + q t q ,
(1.3)
with
E ( t ) = 0 ; E ( t ) = 2 ; E ( t s ) = 0, t s
2
where yt , yt 1 ,..., yt p represent the current and lagged growth rate of tourist arrivals, p is the lag
length of the AR error term, and q is the lag length of the MA error term.
If there are the seasonal effects, it will be the seasonal autoregressive moving
average, or SARMA ( P, Q ) T , model is given below:
yt = + T yt T + 2T yt 2T + + PT yt PT + t + T t T + 2T t 2T + + QT t QT , (1.4)
Page 280

July 9-11, 2012
where yt , yt T ,..., yt PT represent the current and lagged growth rate of tourist arrivals, P is the
lag length of the SAR error term, and Q is the lag length of the SMA error term.
The series is described by an AR integrated MA model or ARIMA
( p, d , q) when y t is replaced by d1 y t and an SAR integrated SMA model or SARIMA

( P, D, Q)T when y t is replaced by D1 yt .
When we already construct the conditional mean model, after that we

will construct the conditional volatility model latter.
1.2.2.2 Conditional Volatility Model
In this paper, we use the symmetric Generalized Autoregressive Conditional
Heteroskedasticity (GARCH) model of Bollerslev (1986), and the asymmetric GJR model of
Glosten, Jagannathan and Runkle (1992), which discriminates between positive and negative
shocks to the tourist arrivals series will be used to forecast the required conditional volatilities.
The GARCH (p, q) model is given as (i )
Y t = E (Y t F t 1 ) +
where
(ii ) t = h1 / 2 t ,
p
(iii ) hit = i + i
l =1
2
i ,t 1
+ i hi ,t 1
(1.5)
l =1
The GJR (p, q) model is given as ( i ) Yt = E (Yt Ft 1 ) + t where

(ii ) t = h1 / 2 t ,
p
l =1
l =1
(iii ) hit = i + ( i i2,t 1 + I ( i ,t ) i2,t 1 ) + i hi ,t 1
(iv ) I ( i ,t ) = 1, i ,t 0
and
(1.6)
= 0, i ,t > 0
where Ft is the information set variable to time t, and : iid (0,1) . The four equations in the model
state the following : (i) the growth in tourist arrivals depends on its own past values; (ii) the shock
to tourist arrivals has a predictable conditional variance component, ht , and an unpredictable
component, t ; (iii) the conditional variance depends on its own past values and the recent shocks
to the growth in the tourist arrivals series; and (iv) the conditional variance is affected differently
by positive and negative shocks to the growth in tourist arrivals.
Page 281

July 9-11, 2012
For the GARCH (1, 1) to be stationary, we need
1 + 1 < 1
(1.7)
For the GJR (1, 1) to be stationary, we need
1
2
1 + 1 + 1 < 1
(1.8)
In equations (1.5) and (1.6), the parameters are typically estimated by the
maximum likelihood method to obtain Quasi-Maximum Likelihood Estimators (QMLE) in the
absence of normality of t , the conditional shocks (or standardized residuals). The conditional loglikelihood function is given as follows:
t2
1 n
l t = log ht +
2 t =1
ht
t =1
n
The QMLE is efficient only if t is normal, in which case it is the MLE.

When t is not normal, the adaptive estimation can be used to obtain efficient estimators, although
this can be computationally intensive. Ling and McAleer (2003b) investigated the properties of
adaptive estimators for univariate non-stationary ARMA models with GARCH (r, s) errors. The
extension to multivariate processes is complicated.
1.2.3 Literature Review

In volatility analysis, Riaz Shareef and Michael McAleer (2007) showed how the
GARCH(1,1) model and the GJR (1,1) model could be used to measure the conditional volatility in
monthly international tourist arrivals to six SITEs, namely Barbados, Cyprus, Dominica, Fiji,
Maldives and Seychelles, and to appraise the implications of conditional volatility of SITEs for
modeling tourist arrivals. For the logarithm of monthly international tourist arrivals, the estimates
of the conditional volatility using GARCH (1, 1) and GJR (1, 1) were highly satisfactory. The
sufficient conditions to ensure positivity of the conditional variance were met for all six SITEs,
except for Maldives. It was worth noting that the empirical log-moment and second moment
conditions were satisfied for both models and all six SITEs, which indicated model adequacy for
policy analysis and formulation. The asymmetric effects were generally satisfactory, with the
exception of Dominica. This implies that the effect of positive shocks on conditional volatility was
greater than negative shocks in the short and long run. Thus, the results for Dominica suggested
that an unexpected fall in monthly international tourist arrivals decreases the uncertainty about
future monthly international tourist arrivals, which was contrary to the results for the other five
SITEs.
For volatility analysis, Michael McAleer et al. (2005) studied a risk management
framework of daily tourist tax revenues for the Maldives using value at risk (VaR) to measure the
risk from growth of the number of tourist arrivals affecting the environment. The GARCH (1, 1)
and the GJR (1, 1) were used to forecast the required conditional volatilities. Riaz Shareef, et al.
(2007) showed how the GARCH (1, 1) model and the GJR (1, 1) model could be used to measure
the conditional volatility in monthly international tourist arrivals to six SITEs. Their results also
Page 282

July 9-11, 2012
show that the GARCH (1, 1) and the asymmetric GJR (1, 1) models provide an accurate measure of
risk.
In studies from literature reviews we will estimate and forecast by using the GARCH
(1, 1) and the asymmetric GJR (1, 1) in the conditional volatility model.
1.3 Objective of this Study
To analyze the volatility from the growth of the number of international tourist arrivals to
Thailand.
1.4 Data Collection
Based on the above methodology we can divide data collection as follows: we used the
secondary data from 1976 to 2010. The data used to measure the independent and dependent
variables are from the Tourism Authority of Thailand (TAT), the Bank of Thailand (BOT), and
Immigration Bureau (Police Department).
Note the three important dips in the tourist activity for the periods 1991, 1997 and 2005,
respectively. The first period is due to the negative impact of the Gulf War of 1991.The second is
due to the Tomyumkung economics crisis of 1997 in which the Asian tourist market seemed to
be the most affected. The third period is due to the Tsunami disaster of 2004.
1.5 Unit Root Tests
Standard unit root test based on the methods of Augmented Dickey-Fuller (1979) and
Phillips and Perron (1988) are reported in Table 1.2.
The ADF tests for a unit root are used for logarithmic variable series over the full sample
period. Note that the ADF tests of the unit root null hypothesis correspond to the following onesided test:
H0 : = 0
H1 : < 0
The ADF test results are confirmed by the Phillip-Perron test and the coefficient is
significant at the 5% level. The results of the ADF unit root tests are that when the ADF test
statistics are compared with the critical values from the nonstandard Dickey-Fuller distribution, the
former for all of variable series are less than the critical value at 5% significance level. Thus, the
null hypothesis of a unit root is rejected at the 5% level, implying that the series are stationary. By
taking first differences of the logarithm of variables, the ADF tests show that the null hypothesis of
a unit root is clearly rejected. The ADF statistics for the series are less than the critical value at the
5% significance level. Thus, the first differences of the logarithmic variables are stationary. These
empirical results allow the use of this data to estimate conditional mean and conditional volatility
model.
Page 283

July 9-11, 2012
Table 1.2 the result of unit root tests
Variable
ADF
PP
Without trend
Without trend
level
1st difference
level
1st difference
DTN
-7.6671***
-14.9299***
-33.4911***
-30.6096***
DNM
-4.9960***
-12.9948***
-37.5955***
-277.6326***
DNJ
-5.8683***
-16.9183***
-31.2189***
-108.3260***
DNUK
-3.8053***
-13.1170***
-20.9481***
-61.4773***
DNUS
-4.4828***
-20.5141***
-31.2214***
-77.3335***
Notes:
1. DTN denotes the growth rate of total number of tourist arrivals, DNM denotes Malaysian tourist
arrivals, DNJ denotes the growth rate of Japanese tourist arrivals, DNUK denotes the growth rate of
United Kingdom tourist arrivals, and DNUS denotes the growth rate of American tourist arrivals
2. *** denotes the null hypothesis of a unit root is rejected at the 1% level.
1.6 Volatility Model

The number and graph for total monthly tourist arrivals, monthly Malaysian tourist
arrivals, monthly Japanese tourist arrivals, monthly UK tourist arrivals, and monthly American
tourist arrivals are given in figure 1.1-1.5 and table 1.3-1.5, respectively. All data displays degrees
of variability and seasonality. The highest levels of tourism arrivals to Thailand occur during the
winter season in East Asia, Europe and North America, while the lowest levels occur during the
summer season in East Asia, Europe and North America. The descriptive statistics are given in
table 1.4. The total amount of tourist arrivals have a mean of 498,513.9 arrivals per month, a
maximum of 1,521,816 arrivals per month, and a low minimum of 74,611 arrivals per month.
Furthermore, the monthly Japanese tourist arrivals display the greatest variability with the mean of
59,159.07 arrivals per month, a maximum of 127,334 arrivals per month, and a low minimum of
13,117 arrivals per month. The monthly Japanese tourist arrivals have a standard deviation of
33,953.08, which is the highest standard deviation of all.
As the focus of this paper is not concerned with behavior of international tourist arrivals to
Thailand, but is on managing the risk associated with the variability in tourist arrivals. The paper
focuses on modeling the growth rate, namely the return in tourist arrivals. The graph for the returns
in total monthly tourist arrivals, Malaysian tourist arrivals, Japanese tourist arrivals, UK tourist
arrivals and American tourist arrivals are given in figures 1.6-1.10, respectively. The descriptive
statistics for the growth rates are given in table 1.5. Total monthly tourist arrivals display the
variability, with the standard deviation of 13.15%, a maximum of 46.12%, and a minimum of 45.32%. Furthermore, monthly Malaysian tourist arrivals display the greatest variability, with a
standard deviation 29.24%, a maximum of 126.61%, and a minimum of -59.65%. Each of the data
is found to be non-normal distributed, based on the Jaque-Bera Lagrange multiplier statistics for
normality.
Page 284

July 9-11, 2012
Table 1.3 Accumulation of the number of tourist arrivals to Thailand
Accumulation of
total number of
tourist arrivals by
residence
Accumulation of
Malaysian tourist
arrivals
Accumulation of
Japanese tourist
arrivals
Accumulation of
United Kingdom
tourist arrivals
Accumulation of
American tourist
arrivals
(1979-2010)
(1979-2010)
(1979 -2010)
(1979-2010)
25,975,942
20,587,357
8,793,307
9,140,592
(1976-2010)
191,429,339
Table 1.4 Descriptive Statistics (monthly arrivals)
Table 1.5 Descriptive Statistics for Growth Rate (monthly arrivals)
Page 285

July 9-11, 2012
Figure 1.1 Total monthly international tourist arrivals from 1976-2010
1600000
1200000
800000
400000
0
1980
1985
1990
1995
2000
2005
TOTAL
Figure 1.2 Monthly Malaysian tourist arrivals from 1979-2010
200000
160000
120000
80000
40000
0
1980
1985
1990
1995
MAL
Page 286
2000
2005

July 9-11, 2012
Figure 1.3 Monthly Japanese tourist arrivals from 1979-2010
140000
120000
100000
80000
60000
40000
20000
0
1980
1985
1990
1995
2000
2005
JAN
Figure 1.4 Monthly UK tourist arrivals from 1979-2010
90000
80000
70000
60000
50000
40000
30000
20000
10000
0
1980
1985
1990
1995
UK
Page 287
2000
2005

July 9-11, 2012
Figure 1.5 Monthly American tourist arrivals from 1979-2010
70000
60000
50000
40000
30000
20000
10000
0
1980
1985
1990
1995
2000
2005
USA
Figure 1.6 Total monthly tourist arrival growth rates from 1976-2010
60
40
20
0
-20
-40
-60
1980
1985
1990
1995
DTOTAL
Page 288
2000
2005

July 9-11, 2012
Figure 1.7 Monthly Malaysian tourist arrival growth rates from 1979-2010
160
120
80
40
0
-40
-80
1980
1985
1990
1995
2000
2005
DMAL
Figure 1.8 Monthly Japanese tourist arrival growth rates from 1979-2010
80
60
40
20
0
-20
-40
-60
1980
1985
1990
1995
DJAP
Page 289
2000
2005

July 9-11, 2012
Figure 1.9 Monthly UK tourist arrival growth rates from 1979-2010
80
60
40
20
0
-20
-40
-60
1980
1985
1990
1995
2000
2005
DUK
Figure 1.10 Monthly American tourist arrival growth rates from 1979-2010
120
80
40
-40
-80
1980
1985
1990
1995
DUSA
Page 290
2000
2005

July 9-11, 2012
1.7 SARMA models for conditional mean model
Since the ADF test procedures show that the tourist arrival growth rate series are integrated
of order zero, I (0) the latter is used to estimate the Box-Jenkins models. The autoregressive
moving average, or ARMA ( p, q ) model and the seasonal autoregressive moving average, or
SARMA ( P, Q)T are used in condional mean estimation.
Table 1.6 presents the results of the SARMA model for total tourist arrival growth rates,
model is given below:
Table 1.6 SARMA model for growth rates in total monthly tourist arrivals
Variable
Coefficient
t-Statistic
AIC/BIC
LM(SC)
1.660
1.103
AIC=7.241 F=1.282
AR(1)
-0.190
-3.694
BIC=7.273 p=0.076
SAR(12)
0.739
20.913
Table 1.7 presents the results of the SARMA model for Malaysian tourist arrival growth
rates, model is given below:
Table 1.7 SARMA model for growth rates in monthly Malaysian tourist arrivals
Variable
Coefficient
t-Statistic
AIC/BIC
LM(SC)
4.252
2.983
AIC=9.170 F=2.473
AR(1)
-0.474
-9.805
BIC=9.204 p=0.062
SAR(12)
0.385
7.818
Table 1.8 presents the results of the SARMA model for Japanese tourist arrival growth
rates, model is given below:
Page 291

July 9-11, 2012
Table 1.8 SARMA model for growth rates in monthly Japanese tourist arrivals
Variable
Coefficient
t-Statistic
AIC/BIC
LM(SC)
0.098
0.025
AIC=7.461 F=3.303
AR(1)
-0.173
-3.181
BIC=7.506 p=0.070
SAR(12)
0.958
86.397
MA(12)
-0.676
-16.551
Table 1.9 presents the results of SARMA model for UK tourist arrival growth rates, model
is given below:
Table 1.9 SARMA model for growth rates in monthly UK tourist arrivals
Variable
Coefficient
t-Statistic
AIC/BIC
LM(SC)
2.423
6.005
AIC=8.282 F=1.217
AR(1)
-0.275
-5.285
BIC=8.315 p=0.125
SAR(6)
-0.596
-13.675
Table 1.10 presents the results of SARMA model for American tourist arrival growth rates,
model is given below:
Table 1.10 SARMA model for growth rates in monthly American tourist arrivals
Variable
Coefficient
t-Statistic
AIC/BIC
LM(SC)
2.078
0.711
AIC=7.418
F=1.689
AR(1)
-0.276
-5.241
BIC=7.452
p=0.075
SAR(12)
0.856
31.625
Page 292

July 9-11, 2012
We use the two most commonly model selection criteria are the Akaike Information
Criterion (AIC) and the Schwarz Baysian Criterion (BIC), with the decision to base the model
choice being to select the model for which the appropriate criterion smallest.
For ensuring that the estimated residuals do not have serial correlation at the 5%
significance level, we use the Breusch-Godfrey Lagrange multiplier test of serial correlation, LM
(SC). It can be used to test for higher-order ARMA or SARMA errors, and is applicable in the
presence of lagged dependent variables. Using the Lagrange multiplier test, if the computed F
statistic exceeds the critical value at 5% level, this leads to the rejection of the null hypothesis of no
serial correlation.
Furthermore, the computed F statistics for the LM (SC) test are all less than the critical
value. Thus, the null hypothesis of no serial correlation is not being rejected for these models.
1.8 GARCH and GJR for conditional volatility model
The variable of interest for the Thailand government is the number of tourist arrivals at any
given month as this figure is directly related to tourism revenue. In this section, the tourist arrivals
are used to estimate the GARCH (1, 1) and GJR (1, 1) model. All estimation was conducted using
Eviews 6.0. The models are estimated using QMLE for the case p=q=1 in Table 1.11-1.12.
The estimated GARCH (1, 1) equation for monthly growth rates in the total number of
tourist arrivals is given as follows:
ht = 5.832+ 0.138 t 1 + 0.786 ht 1

2
(1.615 )
( 0.028 )
( 0.029 )
The estimated GARCH (1, 1) model of monthly growth rates in total number of
international tourist arrivals to Thailand for the short run persistence lies at 0.138, whilst the long
run persistence lies at 0.924. As the respective estimate of the second moment conditions,
1 + 1 < 1 for GARCH (1, 1), are satisfied. The QMLE are consistent and asymptotically normal.
This means that the estimates are statistically adequate and sensible for the purpose of
interpretation.
The estimated GJR (1, 1) equation for monthly growth rates in the total number of tourist
arrivals is given as follows:
ht = 5.829+ 0.123 t 1 + 0.025 I t 1 + 0.789 ht 1

2
(1.611)
( 0.048 )
( 0.059 )
( 0.030 )
The asymmetry coefficient is found to be positive and significant for the GJR (1, 1) model,
namely 0.123, which indicates that decreases in total number of tourist arrivals to Thailand increase
volatility. As the respective estimates of the second moment conditions, 1 +
1
1 + 1 < 1 for
2
GJR (1, 1) and where the figures in parentheses are standard errors, which indicates that the model
provides an adequate fit to the data. As 1 is estimated significant and 1 + 1 > 1 , it appears that
Page 293

July 9-11, 2012
volatility is affected asymmetrically by positive and negative shock, with previous negative shocks
having a greater impact on volatility than previous positive shocks of similar magnitude.
The estimated GARCH (1, 1) equation for monthly growth rates in Malaysian tourist
ht = 33.132+ 0.118 t 1 + 0.818 ht 1

2
(15.645 )
( 0.059 )
( 0.042 )
The estimated GARCH (1, 1) model of monthly growth rates in Malaysian tourist arrivals
shows the short run persistence lies at 0.118, while the long run persistence lies at 0.936. As the
respective estimate of the second moment conditions, 1 + 1 < 1 for GARCH (1, 1), are satisfied.
The QMLE are consistent and asymptotically normal. This means that the estimates are statistically
adequate and sensible for the purpose of interpretation.
The estimated GJR (1, 1) equation for monthly growth rates in Malaysian tourist arrivals is
given as follows:
ht = 26.257 + 0.071 t 1 + 0.100 I t 1 + 0.835 ht 1

2
(15.719 )
( 0.050 )
( 0.080 )
( 0.060 )
namely 0.071, which indicates that decreases in monthly Malaysian tourist arrivals to Thailand
increase volatility. As the respective estimates of the second moment conditions,
1
2
1 + 1 + 1 < 1
for GJR (1, 1) and where the figures in parentheses are standard errors, which
indicates that the model provides an adequate fit to the data. As 1 is estimated significant
and 1 + 1 > 1 , it appears that volatility is affected asymmetrically by positive and negative
shock, with previous negative shocks having a greater impact on volatility than previous positive
shocks of similar magnitude.
The estimated GARCH (1, 1) equation for monthly growth rates in Japanese tourist arrivals
is given as follows:
ht = 32.064+ 0.293 t 1 + 0.398 ht 1

2
(10.738 )
( 0.065 )
( 0.134 )
The estimated GARCH (1, 1) model of monthly growth rates in Japanese tourist arrivals
The estimated GJR (1, 1) equation for monthly growth rates in Japanese tourist arrivals is
given as follows:
Page 294

July 9-11, 2012
ht = 145.296+ 0.038 t 1 0.115 I t 1 + 0.148ht 1
2
( 73.385 )
( 0.132 )
( 0.124 )
( 0.452 )
namely 0.038, which indicates that decreases in monthly Japanese tourist arrivals to Thailand
1
2
1 + 1 + 1 < 1 for GJR (1, 1) and where the figures in parentheses are standard errors, which
and 1 + 1 < 1 , it appears that volatility is affected asymmetrically by positive and negative
shock, with previous positive shocks having a greater impact on volatility than previous negative
The estimated GARCH (1, 1) equation for monthly United Kingdom tourist arrivals is
given as follows:
ht = 3.273+ 0.092 t 1 + 0.890 ht 1

2
( 2.781)
( 0.038 )
(19.825 )
The estimated GARCH (1, 1) model of monthly growth rates in United Kingdom tourist
arrivals shows the short run persistence lies at 0.092, while the long run persistence lies at 0.982.
As the respective estimate of the second moment conditions, 1 + 1 < 1 for GARCH (1, 1), are
satisfied. The QMLE are consistent and asymptotically normal. This means that the estimates are
statistically adequate and sensible for the purpose of interpretation.
The estimated GJR (1, 1) equation for the United Kingdom tourist arrivals is given as
follows:
ht = 3.051+ 0.084 t 1 + 0.040 I t 1 + 0.883 ht 1

2
( 3.092 )
( 0.049 )
( 0.094 )
( 0.047 )
namely 0.084, which indicates that decreases in monthly United Kingdom tourist arrivals to
Thailand increase volatility. As the respective estimates of the second moment conditions,
1
2
The estimated GARCH (1, 1) equation for monthly growth rates in American tourist
Page 295

July 9-11, 2012
ht = 93.615+ 0.181 t 1 + 0.230 ht 1
2
(12.227 )
( 0.051)
( 0.073)
The estimated GARCH (1, 1) model of monthly growth rates in American tourist arrivals
The estimated GJR (1, 1) equation for American tourist arrivals is given as follows:
ht = 114.467 + 0.114 t 1 + 0.024 I t 1 + 0.326 ht 1

2
( 39.935 )
( 0.029 )
( 0.065 )
( 0.390 )
namely 0.114, which indicates that decreases in monthly American tourist arrivals to Thailand
1
2
Table 1.11 Estimated GARCH Model
Page 296

July 9-11, 2012
GARCH
Parameters
Total
Malaysian
Japanese
UK
American
5.832***
33.132***
32.064***
3.273*
93.615***
(1.615)
(15.645)
(10.738)
(2.781)
(12.227)
0.138***
0.118***
0.293***
0.092**
0.181***
(0.028)
(0.042)
(0.065)
(0.038)
(0.051)
0.786***
0.818***
0.398***
0.890***
0.230***
(0.029)
(0.059)
(0.134)
(0.045)
(0.073)
AIC
0.924
0.936
0.691
0.982
0.411
BIC
7.054
9.073
7.386
8.128
7.118
9.142
7.466
8.196
Diagnostics
Second moment
7.386
7.456
Notes:
Numbers in parentheses are standard error.
The log-moment condition is necessarily satisfied as the second the moment condition is satisfied.
AIC and BIC denote the Akaike Information Criterion and Schwarz Criterion, respectively.
*** denotes the estimated coefficient is statistically significant at 1%.
** denotes the estimated coefficient is statistically significant at 5%.
* denotes the estimated coefficient is statistically significant at 10%.
Table 1.12 Estimated GJR Model
Page 297

July 9-11, 2012
GJR
Parameters
Total
Malaysian
Japanese
UK
American
5.829***
26.257*
145.296**
3.051*
114.467***
(1.611)
(15.719)
(73.385)
(3.092)
(39.935)
0.123***
0.071*
0.038*
0.084*
0.114***
(0.048)
(0.050)
(0.131)
(0.049)
(0.029)
0.025*
0.100*
-0.115*
0.040*
0.024*
(0.059)
(0.080)
(0.124)
(0.094)
(0.065)
0.789***
0.835***
0.148*
0.883***
0.326*
(0.030)
(0.060)
(0.452)
(0.047)
(0.390)
AIC
0.925
0.956
0.128
0.987
0.452
BIC
7.060
9.074
7.649
8.134
7.118
9.153
7.740
8.212
Diagnostics
Second moment
7.412
7.792
Notes:
Numbers in parentheses are standard error.
The log-moment condition is necessarily satisfied as the second the moment condition is satisfied.
AIC and BIC denote the Akaike Information Criterion and Schwarz Criterion, respectively.
*** denotes the estimated coefficient is statistically significant at 1%.
** denotes the estimated coefficient is statistically significant at 5%.
* denotes the estimated coefficient is statistically significant at 10%.
1.9 Conclusion
The empirical study based on two widely-used conditional volatility models shows that the
volatility is affected symmetrically by positive and negative shocks, with the previous positive
shocks to the growth in tourist arrivals to Thailand having a greater impact on volatility than
previous negative shocks of similar magnitude.
This should be useful information for both private and public tourist providers to manage
sustainable tourism in Thailand.
Page 298

July 9-11, 2012
HUP10-6
Predictors of Effective Quality Assurance of

the EasternUniversity of Management and Technology
Suneerat Srisopa
The Eastern University of Management and Technology, Ubonratchathani, Thailand,
34000
E-mail: Suneerat@hotmail.com
ABSTRACT
This research aimed to study relationship between opinion and real practice that had an
effect on factors that affected the effectiveness of quality assurance (QA) in education of the
Eastern University of Management and Technology (UMT), and to analyze factors that affected the
effectiveness of QA in education of UMT. The sample group consisted of 73 teachers and 39
officers (the total was 112 people). Research instrument was a questionnaire about affecting factors
toward the effectiveness of QA of UMT. The reliability was 0.86. The statistics used in data
analysis were namely percentage, mean, standard deviation, Pearsons correlation coefficient, and
logistic regression analysis.
The research result found that:
Sample group had high-level opinion toward the effectiveness of QA and the effectiveness
of the university procedures in terms of leadership and education administration; however, the
factors in terms of organizational culture, resource support, database development, personnel
development, student development, academic service, art and culture preservation, and interested
person were at the moderate level.
The sample group had high-level opinion toward real practice in terms of leadership;
however, the factors in terms of organizational culture, database development, personnel
development, education administration, student development, academic service, research, art and
culture preservation were at the moderate level, and interested persons was at the low level.
The sample groups opinion and real practice toward the factor in terms of personnel
development had positive relationship at the significance level of .05.The correlation coefficient, r,
was equal to 0.18, and the factor in terms of database development could explain the variability of
the outcome organizational effectiveness after the evaluation of educational quality at the
significance level of .05, which explained 71.20 %.
Keywords: predictors, effective, quality assurance
Page 299

July 9-11, 2012
INTRODUCTION
Educational management is a crucial
mechanism in producing personnel resource
to have knowledge and ability to participate
in the country development, especially in the
knowledge-based
society
that
must
emphasize
necessarily
on
human
development to become most efficient for
entering into a competitive system with many
countries. The Education Act, B.E. 2542 in
Chapter 6 Standard and Quality Assurance in
Education, Section 47, enacted the system of
quality assurance in education to develop
educational quality and standard in every
levels, and Section 48 assigned original
affiliation and educational institution to
organized for QA system within educational
institutions by considering that QA is a part
of educational administration process that
must proceed continuously for leading to the
development of educational quality and
standard. The Eastern University of
Management and Technology had second
round QA, evaluated by the Office for
National Education Standards and Quality
Assessment (Public Organization) on July 24, 2550, which found that the university was
evaluated and given good-level quality
assurance. This indicated the ambition to
develop educational quality of the university.
Apart from this, there might be factors that
affected the effectiveness of educational
quality procedure of the university.
From the synthesis result of concepts and
theories including related researches on the
factors affected the effectiveness both inside
and outside the country, it could conclude
that, for the factors affected the effectiveness
of educational quality process, there were 7
factors that had relationship with the
effectiveness namely, good attitude towards
QA of the personnel, teamwork, personnel
development training, resource availability,
quality
culture,
leadership
of
the
administrators, and faculty size (Kittiya Sion,

2004). Furthermore, Kejkanok Aeuwong
(2004) who analyzed the factors that
supported and were obstacles toward the
process in QA of the educational institution
found that the factors that affected toward
QA system consisted of leadership,
organizational
culture,
personnel,
organizational structure, material and tools,
physical conditions, whereas external factors
that promoted QA process were social and
political factors.
In order that the procedure in developing
the quality of educational management and
the QA procedure of the university would
proceed with quality, the research team was,
therefore, interested in studying predictive
factors of the effectiveness of quality
assurance of UMT. And the data obtained
from the research would be useful
information to be employed as a guideline for
the procedure in developing QA, which
would bring about sustainability in QA of the
university in the future.
Population
The population was a total of 155
teachers and officers in the Eastern
University of Management and Technology
Sample group
The sample group consisted of 73
teachers and 39 officers (the total was 112
people)
in the Eastern University of
Management and Technology by using simple
random sampling.
Research Instrument
The instruments used in this research
was a questionnaire that asked about factors
that affected the effectiveness of QA of the
Eastern University of Management and
Technology, which included 2 parts of content
as follows:
Part 1 : General information of the
respondents, which included questions about
gender, age, the highest level of education,
work duration, and position at work
Page 300

July 9-11, 2012
Part 2 : Factors that affected the

effectiveness of QA, which included personal
factor in terms of attitude toward quality
assurance and other factors in terms of
leadership, organizational culture, resource
support, database development, personnel
development, educational
management,
student management, academic service,
research, art and culture preservation, and
interested persons. The questionnaire was
rating scale 0-4, which had the reliability
equal to 0.86.
Score Interpretation
3.20-4.00 means the performance is
at highest level
at high level
at moderate level
at low level
at lowest level
The outcome effectiveness after the
evaluation of QA was the score resulted from
the assessment of each QA indicators , done
by the institute quality assurance committee.
The full score was 3. The QA indicators
included the effectiveness in terms of
implementing plan (2 indicators), instruction
(12 indicators), student activity (2 indicators),
research (4 indicators), academic service (5
indicators), art and culture preservation (1
indicator), administration (9 indicators),
finance and budget (2 indicators), quality
assurance system (3 indicators)
Data Collection
1. The researcher sent documents to
the personnel of the Eastern University of
Management and Technology for having their
permission= to collect data.
2. Research assistants contacted and
coordinated the executives, teachers, and
officers for having their aid in collecting
research data.
3. The researcher received 112 sets of
the questionnaire, and there were 112 complete
sets of data, which counted 100 % of the

distributed questionnaire for collecting data.
4. The researcher used the
questionnaires with complete data for data
analysis.
Data Analysis
The researcher used the collected data
for data analysis according to statistical
methodology by using an instant computer
program SPSS (Statistical Package for the
Social Science) as follows:
1. Analyzing basic statistics of the
studied variables in order to know the
characteristics of the sample group by
calculating percentage, mean ( X ), and standard
deviation (S.D.)
2. Analyzing correlation coefficient
between independent variables and dependent
variables by using Pearsons product-moment
correlation coefficient.
3. Analyzing the predictive power of
the dependent variables with logistic regression
analysis.
RESULTS AND DISCUSSIONS
1. The score of the factor in terms of
personal attitude toward QA was at the high
level (mean = 2.63, S.D. = 0.43). The score
of personnel opinion toward the factors in
terms of leadership and educational
management was at the high level (mean =
2.57, 2.42 and S.D.
= 0.48, 0.56
respectively). The factors in terms of
organizational culture, resource support,
database development, student development,
academic service, research, art and culture
preservation, and interested persons were at
the moderate level (mean = 2.20, 1.60, 2.19,
2.19, 2.33, 2.02, 2.12, 2.23, 2.21
respectively).
The score of personnel real practice
toward the factor of leadership was at the
high level (mean = 2.49, S.D. = 0.48).
The factors in terms of organizational
culture,
database
development,
personnel
development,
educational
management, student development, academic
Page 301

July 9-11, 2012
development, research, art and culture
preservation, and interested persons were at the
moderate level (mean = 2.19, 2.18, 2.26, 2.36,
2.29, 2.06, 2.18, 2.05, 2.15 respectively). And
for the factor in terms of resource support, it
was at the low level (mean = 1.48, S.D. = 0.72).
The outcome organizational effectiveness
was at the high level (mean = 2.60, S.D. =
0.67), in terms of implementing plan, art and
culture preservation, and finance and budget of
having the highest average (mean = 3.00).
2. Personnels opinion and real
practice of the factor in terms of personnel
development had positive relationship at the
significance level of .05. The correlation
coefficient, r, was equal to 0.18
3. The factors in terms of leadership,
organizational culture, resource support,
database development, personnel development,
educational management, student development,
academic service, research, art and culture
preservation, and interested persons had
positive relationship with the outcome
organizational effectiveness at the significance
level of .05.
The correlation coefficient, r,was
equalto0.68,0.93,0/90,0.97,0.93,0.96,
0.97,0.87,0.89, 0.90 and 0.88 respectively.
4. In the test at the significance level of
.05, the variable introduced to the predictive
equation of the outcome organizational
effectiveness was the factor in terms of
database development. Such variable could
additionally explain the variability of the
outcome organizational effectiveness after the
evaluation of QA of UMT 71.2 %, which could
be written as the predictive equation of the
variable introduced to the predictive equation
of the outcome organizational effectiveness
after the evaluation of QA from outside of
UMT, as follows:
Predictive Equation in Standard Score
1n (outcome organizational effectiveness) = -205.14+82.54
(database development factor)
Or
Outcome organizational effectiveness
205.14+82.54 (database development factor)
= e-
This was agreeable with the research

of Amonwich Nakhonthup (2000: Abstract),
which did a study on In the Currents of
Quality, by studying concepts and guidelines
for QA in university level that many
countries were operating. The findings were
that the QA system in different countries had
shared characteristics as follows:
1. Autonomy and accountability
2. Set up central authorities in national
level both as government and independent
authorities for being responsible for QA, which
usually had function to promote and
coordinate by emphasizing on the role of
university and university public referendum in
being strictly responsible for its own
educational quality.
3. The core of QA relied on
encouraging the university to have a scrutiny
mechanism for its own work, which
accompanied by the scrutiny from outside.
4. The scrutiny mechanism from
outside often focused mainly on the utilization
by peer.
5. The crucial factors in QA were
namely, having and using information with full
efficiency since there has been database, good
administration, including the development of
performance indicators.
6. The main use was the
encouragement of university to develop itself
continuously.
This was agreeable with the research
of Weerawan Kerdthong et al. (2008: Abstract),
which studied about the factors that affected
the organizational effectiveness after the
evaluation of QA from outside in southern
region
of
Nursing
College,
Phaboromarajchanok Institute, Ministry of
Public Health. The research found that the
factors in terms of resource availability in
QA from outside, leadership of the
administrators, quality culture of educational
institution and personnel development for
QA from outside had positive relationship
with the process organizational effectiveness
at the significance level of .01 (r = 0.75, 0.75,
Page 302

July 9-11, 2012
0.72, 0.57 respectively). For the personal
factor in terms of attitude toward quality
assurance from outside had relationship with
the process organizational effectiveness at the
significance level of .05 (r = 0.19), and the
factors in terms of resource availability in
QA from outside and the personal factor in
terms of knowledge about QA could
additionally explain the variability of the
outcome organizational effectiveness after
the evaluation of QA from outside in
southern region of Nursing College,
Phaboromarajchanok Institute, Ministry of
Public Health 12 % at the significance level
of .05.
CONCLUSION
The database development factor
could explain the variability of the outcome
organizational effectiveness after the
evaluation of QA of the Eastern University of
Management and Technology at the
significance level of .05, which explained
71.20 %. The following was the predictive
equation of the outcome organizational
effectiveness after the evaluation of
educational quality from outside:
ACKNOWLEDGEMENTS
This research project is supported by
income budget of the Eastern University of
Management and Technology for which the
researcher is highly grateful. This research
used
quantitative
methodology
and
implemented the method through data
collection by using a questionnaire. The
researcher obtained the data through very
good cooperation from the administrators,
teachers, and officers of UMT.
Thanks to Asst.Prof.Dr.Veerasak
Jinarat, President Emeritus, Dr. Smarnjit
Piromruen, Dr. Pannathorn Chachvarat, and
Assoc.Prof.Dr. Veera
Chaisrisuk, who
devoted their time for advising and reading
the research and suggesting in many parts of
the research.
The researcher hopes very much that
the report of this research will be well useful
for the development of quality assurance of
UMT and for those who study and do
research.
Predictive Equation in Standard Score

1n (outcome organizational effectiveness)
= -205.14+82.54 (database development
factor)
Or
Outcome organizational effectiveness
= e-
205.14+82.54 (database development factor)
Page 303

July 9-11, 2012
REFERENCES
Amonwich Nakonthap. (2000). A Research Report on In Currents of Quality. Bangkok:
T T Print Ltd.
Kejkanok Aeuwong. (2004). Analyzing the Factors that Affected and the Factors that were
obstacles toward the System of Quality Assurance in Education of Basic Educational
Institution. Doctor of Education program in Educational AdministrationDissertation,
Graduate School, Chulalongkorn University.
Kittiya Sion (2004) . The Causal Model of the Efficiency of Quality Assurance for Health
Science Subject. Doctor of Education program in Research Methodology StudyThesis,
Chulalongkorn University.
Weerawan Kerdthong et al. (2008). Factors Affecting the Organizational Effectiveness after
the Evaluation of Educational Quality from Outside. Nursing College. Phaboromarajchanok
Institute, Ministry of Public Health, Southern region.
Page 304

July 9-11, 2012
STO172-1
Screening, Isolation and Identification of Extracellular

Polysaccharide Producing Bacteria from Sugar Cane Field
Patcharapa Klahana, Unchalee Singyoovonga, Atsuo Kimurab,
Yasuyuki Hashidokob, and Jintanart Wongchawalita
a* Faculty of Arts and Science laboratory,
Kasetsart University Kamphaeng-Saen campus, Nakhorn-Pathom,73140, Thailand
b* Faculty of Agriculture, Hokkaido University, Sapporo,060-8589, Japan
E-mail: yaimai_2409@hotmail.com; jintawong@hotmail.com
ABSTRACT
For the hypothesis of plant-soil microbe interaction, extracellular polysaccharide (EPS) are
synthesized from the soil bacteria which obtain the released sucrose from plant roots, so that soil
bacteria will return the benefit to plants by providing EPS, which are important to develop the soil
properties and promoted plant growth. Sugar cane field is an excellent bio-resource providing
precious carbon source for EPS-producing bacteria. Forty eight strains of microorganisms in the
rhizophere were isolated. From those isolates, 18 isolates formed viscous and mucous colonies on
modified Winogradskys (MW) agar plates, containing 1% sucrose and 0.005% yeast extract.
Among those 18 isolates, 14 strains were classified to be EPS producing bacteria by meaning of
16S rRNA gene sequencing. One strain, HSCL 1.10 phere was selected and identified to be the
nearest bacteria strain, namely, Pseudomonas sp. HSCL 1.10 with 99% identity. The optimal
culture condition to obtain the best growth and the highest yield of EPS production were studied.
Pseudomonas sp. HSCL 1.10 grew well in basal medium (MW medium) containing sucrose and
yeast extract and produced the maximum dry weight of EPS with 1,162 mg/100 ml.
keywords: plant-soil microbe interaction, extracellular polysaccharide, bioresource, EPSproducing bacteria
INTRODUCTION
The soil ecology is the relationship between plants and soil microorganisms. Plants
perform the photosynthesis to process the conversion of inorganic matter (CO2) into organic
compounds, especially carbohydrate (insoluble starch) in the leaves. Insoluble starch is converted
to soluble material like sucrose and transfered to the storage organ. Recently, it is pointed out that
plants release a large amount of sucrose from the surface of roots. Released sucrose is utilized by
soil microorganisms to promote their growth in rhizophere. Particularly, some strains of
rhizobacteria such as Agrobacterium radiobacter, Rhizobium sp., Xanthomonas camperstris,
Bacillus sp., Azotobacter vinelandii, Alcaligernes faecalis and Klebsiella pneumoniiae are able to
synthesize the extracellular polysaccharide (EPS) (Sutherland, 1985) from the sugar molecule
exuded from the roots, and also able to release the EPS into soil to provide the beneficial
conditions for both plants and soil microorganisms. Green surface of the earth is rich in sucrose
originated from plant, and we call this area as "sucrose-world", Significance: Since sucrose is
converted to high energy compound like UDP-Glc and/or UDP-Gal, UDP-Man to form -glucan.
Page 305

July 9-11, 2012
Recently, microbial EPS are becoming increase commercial important by using in food, cosmetic,
textile, agriculture, environment and pharmaceutical industrial products such as thickening and
gelling agents (Kang and Cottrel, 1979; Hebbar et al., 1992). The advantages of bacterial
polysaccharide are novel functionality as well as constant and reproducible chemical and physical
properties. Thailand is the tropical country rich in sucrose world. Especially sugar cane field (AuThong, Suphanburi) is an excellent environment providing precious microbial source for screening
and isolation of the bacteria producing EPS. Therefore, in this research, it is interesting to perform
isolation, production and extraction of EPS with better rheological properties and many
applications in industrial field. Thereby, the isolation and characterization of EPS-forming soil
bacteria from sugar cane field are also the remarkable researches.
Screening of an Extracellular Polysaccharide-Producing Bacteria
Rhizobacteria were isolated from soil on the surface of the sugar cane roots which were
sampled from sugar cane field at Au-thong, Supan-buri province. Then, these sugar cane roots
were soaked and slowly shaken in sterile water. To isolated the EPS-producing bacteria, the
diluted soil solution was spread on the agar plate containing modified Winogradskys nitrogen-free
mineral medium containing salts (KH2PO4, 50.0 g/l; MgSO4.7H2O; NaCl, 25.0; FeSO4.7H2O, 1.0;
Na2MoO4.2H2O, 1.0; MnSO4.4H2O, 1.0; and 1M NaOH to adjust pH to 6.2) 0.005% yeast extract
and 1.0% sucrose, solidified with 2.0% agarose (MWA) (Hashidoko et al., 2002). After incubation
at 30 C for several days, bacterial colonies forming EPS on the plate were collected. EPS-forming
colonies were easily detected by visual observation including its shape was colorless, transparent,
sticky, mucilaginous, elastic and dome-like. Single colony isolated was collected by plating on the
MWA-plate, and microbial strains were kept in glycerol at -80 C as a stock culture.
Phylogenetic Analysis
Isolated bacteria were identified on the basis of 16S rRNA gene sequence. The single
colony of all isolates was picked, inoculated to 3 ml of the MW broth containing 0.5% yeast
extract and 0.1% sucrose and then, incubated at 30 C for overnight. The genomic DNA was
prepared by the extraction of the cell pellet with the Isoplant II kit (Wako Pure Chemical Industrial
Ltd., Japan). Total DNA extracted was used for PCR-amplification of the 16S rRNA gene PCR
using the universal primers (27F; 5`-AGAGT-TTGATCCTGGCTCAG-3` and 1521R; 5`AAAGGAGGTGATCCAGCC-3`) for the 16S rRNA gene specific region. PCR amplification was
performed with the following cycling program; denaturing at 94 C for 5 min, 30 amplification
cycles of 94C for 1 min, annealing at 60 C for 1 min, and elongation at 72 C for 2 min, with the
extended elongation at 72 C for 5 min. The 1500 bp of PCR product was sequenced by ABI
PRISM 310 Genetic Analyzer. The nucleotide sequences of 16S rRNA gene of the unidentified
bacteria were compared to those of 16S rRNA gene of the know bacteria in the GenBank database.
Effect of carbon and nitrogen sources on extracellular polysaccharide production
To investigate the effect of carbon and nitrogen sources on the growth of the isolated EPSproducing bacteria, the identified EPS-producing bacterium was cultured in the MW medium by
varying the sources of carbon and nitrogen. The sugars including sucrose, glucose, maltose, lactose
or fructose were used as carbon sources. The growth rate of bacterium cultured in the different
carbon sources were determined by measuring the absorbance at 660 nm. After the growth rate
Page 306

July 9-11, 2012
reach the early of stationary phase, EPS was collected in order to extraction. The dry weight of
EPS for each condition was measured. The best carbon source is chosen on the basis of the dry
weight of EPS produced by the bacterial cultures in different carbon sources. Similarly, the effect
of nitrogen sources on the growth of the isolated EPS-producing bacteria were cultured in the MW
medium containing the 0.01% of the various nitrogen sources including yeast extracted, NaNO3,
tryptone or urea.
The production and extraction of EPS
EPS-producing bacteria was cultivated in MW medium containing the profitable carbon
and nitrogen sources under the optimized culture condition to obtain the highest yield of EPS. The
viscose medium was pasteurized at 70 C for 15 min, and then centrifuged at 10,000 rpm for 15
min to remove bacterial cells. The supernatant containing EPS was precipitated by addition of
double volumes of cold isopropanol and standing at 4 C for 24 hrs. The viscous pellet was
collected by centrifugation using 12,000 rpm for 20 min. EPS was further purified by precipitation
with alcohol and deproteination of EPS by Sevage reagent (chloroform/1-butanol, v/v = 4/1)
(Staub, 1965). Shaking of mixture on rotary shaker at 120 rpm was done for overnight. After
removed Sevage reagent, crude extracted of EPS was dialyzed against distilled water with three
changes per day. The extracted polymer solution was freeze-dried by lyophilizing and kept at -80
C until used.
RESULTS
Sampling soil and Screening EPS producing rhizobacteria
Rhizobacteria were isolated from soil on the surface of roots of sugar cane and soil around
the root of sugar cane, which were growing in the sugar cane field at Au-Thong, Suphan Buri
province. After incubation, total 48 isolates of the colonies forming bacteria on the plate were
collected (as shown in Figure 1A). Based on the preliminary identification, the viscosity and
characterization of the bacterial colonies were used for the indexes of EPS-producing
microorganisms. Eighteen isolates showed viscose and mucoid appearance which indicated that
these soil bacteria were able to produce EPS. Each of the 18 isolates was purified as a single
colony by streaking on MW agar plate
(as shown in Figure 1B). Morphological observations
were done and subsequently stored at - 80C in MW broth containing 15% glycerol.
Fig. 1 Preliminary screening (A) and pure isolated by cross streak technique (B) of EPS-producing
microorganism isolated from sugar cane field on Winogradskys mineral mixture nutrient agar
plate, using viscosity and size of the colony as index of EPS-producing microorganism.
Page 307

July 9-11, 2012
Phylogenetic analysis
Identification of bacterial strain was done based on 16S rRNA gene sequence
determination. The expected size of PCR product was 1500 bp as showed in Figure 2.
Fig. 2 Representative of the PCR products of 16S rRNA gene primer that amplified around 1,500
bp. Front lane ; DNA marker, Lane 2-8; the representative of amplified 16S rRNA genes from EPS
producing bacteria.
PCR products were sequenced by ABI PRISM 310 Genetic Analyzer with a BigDye
Termimator (version 3.0). The obtained sequences were compared to 16S rRNA gene sequence in
the GenBank database using the BlastN program to retrieve sequence similarity and bacterial
identification as shown in Table 1.
Eighteen isolates showed high identity between 95-99% with the corresponding 16S rRNA
gene sequences of soil bacteria groups, in particularly of rhizobacterial strains including,
Bacterium sp., Mitsuaria sp., Agrobacterium tumefaciens, Ensifer adhaerens, Mitsuria sp.,
Sinorhizobium sp., Cupriavidus gilardii, Pseudomonas sp., Agrobacterium tumefaciens and
Rhizobium sp.
Fig. 3 showed the phylogeny tree of relationships among 18 isolates. It indicated that all
bacteria in this research had the mutual parentage. Bacterium, Sinorhizobium sp. clone 4h-12,
Rhizobium sp. clone GI7-3-A09, Agrobacterium tumefaciens strain BLN4, Agrobacterium
tumefaciens isoate EFLRI 73, Ensifer adhaerens strain J2S2, Bacterium clone p02.C11 and
Mitsuaria sp. H24L1C had the similar character whereas Mitsuaria sp. KN1, Bacterium clone
nbw623a04c1, Cupriavidus gilardii strain AU3713, Pseudomonas sp. NII-1015 Sinorhizobium
medicae isolate EFLRI116 had the similar characterization. However the bacterial strain
HSCL1.10 Phere showed the biggest and the most viscose appearance colony, therefore, it was
selected to further study. HSCL1.10 Phere was identified to be a new strain of Pseudomonas sp.
HSCL1.10 with 99% similarity to Pseudomonas sp. NII-1015 which showed mucoid appearance
on MWA and the cells were Gram-negative and rod shape
(Figure 4) It is able to accumulate several polysaccharides (EPS) inside or outside of
(Hou et al., 1996).
Page 308
the cell

July 9-11, 2012
Table 1 The partial 16S rRNA sequences derived deposited in GenBank.
Isolated code
HSCC 1.1 Plant
HSCC 1.3 Plant
HSCC 1.4 Plant
HSCC 2.1 Plant
HSCL 2.1 Plant
HSCL 1.2 Phere
HSCC 1.2 Phere
HSCC 2.2 Plant
HSCC 2.4 Plant
HSCL 1.1 Plant
HSCL 1.2 Plant
HSCL 2.2 Plant
HSCL 2.3 Plant
HSCL 1.3 Phere
HSCL 1.10 Phere
HSCL 2.1 Phere
HSCC 1.4 Phere
HSCC 2.1 Phere
Nearest known bacterial strain

Bacterium
Mitsuaria sp. H24L1C
Bacterium clone ncd266h05c1
Agrobacterium tumefaciens strain BLN4
Ensifer adhaerens strain J2S2
Mitsuaria sp. KN1
Sinorhizobium sp. clone 4h-12
Bacterium clone p02.C11
Bacterium clone nbw623a04c1
Cupriavidus gilardii strain AU3713
Pseudomonas sp. NII-1015
Agrobacterium tumefaciens isoate EFLRI 73
Sinorhizobium medicae isolate EFLRI116
Rhizobium sp. clone GI7-3-A09
Accession
no.
AB589884.1
EU714910.1
EU714910.1
EU714910.1
HM270513.1
HM270513.1
HM270513.1
GQ181060.1
EU221356.1
HQ231945.1
FJ444721.1
FJ602413.1
GQ111262.1
AY860227.1
HM036665.1
EU445243.1
EU445260.1
FJ193930.1
% identity
99%
98%
98%
98%
99%
99%
99%
96%
99%
99%
99%
98%
95%
98%
99% (818/820)
99%
99%
99% (660/673)
Fig. 3 Phylogenetic analysis base on 16s rRNA gene sequences of 18 EPS-producing bacteria
isolates
from sugarcane field using Clastal W program.
A
Fig. 4 Colony characterization on MWA (A) and morphology (B) of Pseudomonas sp. HSCL 1.10
Page 309

July 9-11, 2012
The optimal condition and EPS production of Pseudomonas sp. HSCL 1.10
The optimal conditions of Pseudomonas sp. HSCL 1.10 were studied under
different carbon and nitrogen sources. For the carbon source study, sucrose was
preferentially utilized by the organism for maximum production of EPS compared to other
carbon sources used (Figure 5).
Fig. 5 Effect of sugars on EPS production by Pseudomonas sp HSCL 1.10; growth curve (A) and
EPS dry weight (mg/100ml) (B)
Figure 6 showed the result of nitrogen source which the maximum EPS production was
found in using yeast extract as nitrogen source, even though Pseudomonas sp. HSCL 1.10 grew
well in all of nitrogen sources.
Page 310

July 9-11, 2012
Fig. 6 Effect of nitrogens on EPS production by Pseudomonas sp. HSCL 1.10; growth curve (A)
and EPS dry weight (mg/100ml) (B)
After optimal condition was investigated, preferential carbon and nitrogen sources for
bacterial growth were added in the basal medium (MW). Pseudomonas sp. HSCL 1.10 produced
the maximum EPS dry weight of 1,162 mg/100 ml by using sucrose as carbon source and yeast
extracted as nitrogen source
DISCUSSION
We sampled the soil from the surface of the sugar cane root, which is known to be high in
rich sugar plant, for isolation of EPS producing bacteria. We segregated 48 isolates of
rhizobacteria; eighteen isolates could produce EPS by morphology characterization, viscose and
mucoid appearance. Nucleotide sequencing was performed on these eighteen to identify their
nearest strain, namely: Bacterium, Mitsuaria sp. H24L1C, Bacterium clone ncd266h05c1,
Agrobacterium tumefaciens strain BLN4, Ensifer adhaerens strain J2S2, Mitsuaria sp. KN1,
Sinorhizobium sp. clone 4h-12, Bacterium clone p02.C11, Bacterium clone nbw623a04c1,
Rhizobium sp. clone GI7-3-A09, Agrobacterium tumefaciens isolate EFLRI 73, Pseudomonas sp.
NII-1015, Sinorhizobium medicae isolate EFLRI 116 and Cupriavidus gilardii strain AU3713. The
phylogenetic tree predicted that these 14 strains had the mutual parentage relationship.
Pseudomonas sp. HSCL 1.10 was selected, from the 14 EPS producing bacterial strains, to
study the optimal condition for EPS production, measured by the largest and high viscosity colony
appearance on MWA. It was found that Pseudomonas sp. HSCL 1.10 grew well in basal medium
(MW medium), containing sucrose and yeast extract, produced the maximum EPS dry weight of
1,162 mg/100 ml. There are several reports on EPS production from Pseudomonas sp., which
agreed with our findings; Sudhamani et al. (2004) reported that Pseudomonas caryophylli
produced the highest EPS dry weight 1,700 mg/100 ml, also isolating an O-specific polysaccharide
from the lipopolysaccharide (LPS) of this strain (De Castro et al., 2001). EPS were reported to
have been isolated from Pseudomonas fluorescens Biovar II (Chin Chang Hung et al., 2005) and
from Pseudomonas oleovorans NRRL B-14682 (Filomena et al., 2009).
The experiments concluded that efficiently produced biologically functional EPS,
screened from the rhizosphere of wild or cultivating plants such as sugar cane, that have grown in
adverse soil, that the rhizophere produced and released EPS to the environment. Those microbe
interaction played an important role in plant adaptation to adverse conditions by increasing watercapturing, promoting nitrogen-fixation, inhibiting denitrification, phosphorus-solubilizing, heavy
metal trapping (Raffaella et al., 2006). EPS benefits are being promoted in industries such as food,
Page 311

July 9-11, 2012
agriculture, pharmaceutical, and environment (Filomena et al., 2009), thus, in the further, our
research is EPS structure analysis and EPS application.
ACKNOWLEDGEMENTS
This work was supported by Research Promotion and Technology Transfer Center
(RPTTC), Faculty of Liberal Arts and Science, Kasetsart University. The author thanks for Dr.
Jintanart Wongchawalit Prof. Yasuyuki Hashidoko and Prof. Atsuo Kimura who support the
author for doing some part of research in Japan.
Page 312

July 9-11, 2012
REFERENCES
Chin, C., H., Peter, H., S., and Jeffrey, B., G. 2005. Isolation and characterization of extracellular
polysaccharides produced by Pseudomonas fluorescens Biovar II. Carbohydrate Polymers
61:141147.
De Castro, C., Lanzetta, R., Molinaro, A., Parilli, M., and Piscopo, V. (2001). Acetyl substitution
of the O-specific polysaccharide caryophyllan from the phenol phase of Pseudomonas
(Burkholderia) caryophylli. Carbohydrate Research 335: 205211.
Filomena, F., Vitor, D., A., Joana, P., Nuno, C., Cristina, O., Lus, M., Loic, H., Rui, O., and
Maria, A., M. Reis 2009. Characterization of an extracellular polysaccharide produced by
a Pseudomonas strain grown on glycerol. Bioresource Technology 100: 859-865.
Hashidoko, Y. 2002. Ecochemical studies of interrelationship between epiphytic bacteria and host
plants via secondary metabolites. Bioscience Biotechnology Biochemistry 68: 1427-1441.
Hebbar, K.P., Gueniot, B., Heyraud, A., Colin-Morel, P., Heulin, T., Balandreau, J. and Rinaudo,
M. 1992. Characterization of exopolysaccharides produced by rhizobacteria. Applied
Microbiology and Biotechnology 38: 248-253.
Hou, C.T., Ahlgren, J.A., Brown, W. and Nicholson, J.J. 1996. Production of an extracellular
polysaccharide by Agrobacterium sp. DS3 NRRL B-14297 isolated from soil. Journal of
Industrial Microbiology and Biotechnology 16: 129-133.
Kang, K. S. and Cottrell, I. W. (eds.). 1979. Microbial polysaccharides. In H. J. Peppler and D.
Perlman. Microbial technology 1: 417-481.
Raffaella, D.C., Maria, D.A., Antonio, L., Fabio, M., Paola, C., Aldo, C. Michael, G., Roberto, C.
and Marco, G. 2006. Glucan and fructan production by sourdough Weissella cibaria and
Lactobacillus plantarum. Journal of Agricutural and Food Chemistry 54: 9873-9881.
Staub A.M. 1965. Removeal of protein-Sevag method. Methods in Carbohydrate Chemistry 5: 5-6.
Sudhamani, S., R., Tharanathan, R., N., and Prasad, M., S. 2004. Isolation and
characterization of an extracellular polysaccharide from Pseudomonas caryphylli CFR
1705. Carbohydrate Polymers 56: 423427.
Sutherland I. W. 1983. Extracellular polysaccharides. In H. Dellweg (Ed.), (vol. 3). Biotechnology
Weinheim Germany: Verlag Chemie.
Page 313

July 9-11, 2012
STO208-2
Isolation of the cellulose degrading microorganisms from three

earthworm species and the biodegradation of waste paper
sludge
SupphasinThaweesak, AnantachaiChaysang, AnuchidaPobpimay,
Parichart Yamsri, Witawat Jangiam
Department of Chemical Engineering, Faculty of Engineering, Burapha University, Saensook,
Meung, Chonburi, 20131, Thailand
E-mail: supphasin@eng.buu.ac.th
ABSTRACT
Lignocellulose material such as paper can be converted enzymatically to glucose by
cellulase from different origins.The earthworm is one of the typical organisms that has been
successfully used to convert cellulose into glucose. Cellulase activity was detected in the digestive
tract of three earthworm species, Eiseniafoetida (The Tiger worm),Eudriluseugeniae (African
Night Crawler),Perionyxexcavates (Blue worm).We studied the performance of microorganisms in
three earthworms on the breakdown of cellulose and paper sludge (Waste Paper Sludge; WPS)
from paper industry. A total of 24 potential cellulose degraded bacteria isolated from earthworms
feces were screened for glucose producer. Out of 24 isolates, 3 strains were able to degrade CMCellulose for 24 hours andthe most effective microorganism of each earthworm species were
selected. The three effective microorganisms wereperformed the degradationof paper sludge. The
microorganism from Eudriluseugeniae, AN03, is the most superior glucose producer. It was
alsomentioned that Eudriluseugeniae was the most effective for degrading waste paper sludge. Its
other applicability was also discussed.
Keywords: waste paper sludge, cellulose, cellulase, microorganism, earthworm.
INTRODUCTION
Waste paper is produced in massive amount each day and contributes extensively to
environmental pollution and it is known that cellulose, a major building block of paper products,
can be converted enzymatically to sugars including glucose (Nazhad et al., 1994), and
subsequently fermented to ethanol (Gregg and Saddler, 1995). Owing to the different purposes of
paper products their structural compositions differ, which produces varying susceptibilities to
cellulase action, a factor important for effective hydrolysis of cellulose materials (Lee et al.,1994).
Enzymatic driven conversion of cellulose toglucose has been investigated widely although an
analysis of different paper products to determine their relative susceptibility towards
saccharification by cellulase from different origins has not received much attention. Synergism
between individual components of cellulases from different origins on substrates such as
microcrystalline cellulose (Berghem et al., 1975), cotton (Sadana and Patil, 1985) and Avicel
(Kanda et al., 1976) has been applied with varying degrees of success. Wood (Wood, 1975)
described 'cross synergism' of cellulases as hydrolysis of cellulose by cellulase complexes from
different origins and reported on a high degree of cotton hydrolysis with the correct combination
of cellulases from Fusariumsolani and T. koningii. The aim of a synergistic approach in cellulase
technology is to obtain maximum glucose formation from cellulose materials.
Page 314

July 9-11, 2012
Earthworms have increasingly been used for organic waste management (animal and plant
wastes, municipal garbage, municipal and industrial sludges) in order to obtain a more stable and
easily handled material. This material, called vermin-compost, worm-cast or worm-worked
organic product, has been traditionally used as organic fertilizer, soil amendment and a component
of potting media (Handreck, 1986; Edwards & Burrows, 1988).
The sludges resulting from the depuration process of paper pulp mill wastewater are
difficult to eliminate. They are extremely stable due to the slow biodegradability of structural
polysaccharides (Adney et al., 1991), their major constituents. Previous studies have shown that
these wastes can be reutilized through vermicomposting (Butt, 1993; Elvira et al., 1995).
This studyexamines the performance of microorganisms in three earthworms on the
breakdown of cellulose and paper sludge (Waste Paper Sludge; WPS) from paper industry.
MATERIAL AND METHOD
CM-Cellulose and chemical preparation
Acetate buffer (2M, pH5.5) was prepared by dissolving anhydrous sodium acetate 164.06
gram with distilled water to make a total volume, 1 L. Then pipette 60 ml glacial acetic acid and
distilled water to make a total volume, 500 ml. After that mixing with 1000 ml of sodium acetate
solution and 190 ml of diluted acetic acid and adjusting pH to 5.5.Substrate solution (0.7% w / v)
was prepared by dissolving 7 gram of carboxymethyl cellulose sodium salt in acetate buffer.
Reagent A, anhydrous sodium carbonate, was prepared by dissolving 16 gram of potassium
cyanide and 0.9 gram of potassium cyanide with distilled water to make 1 liter of solution and
stored in brown bottle. Reagent B was prepared by dissolving 0.5 gram of potassium
hexacyanoferrate (lll) in 1 liter of distilled water and was stored in brown bottles. Reagent C, ferric
ammonium sulfate, was prepared by dissolving 1.5 gram sodium dodecyl sulfate with distilled
water then adding 4.2 ml of conc.H2SO4 then heat the solution at 50 C until it became
homogeneous solution. After the solution cools down, added distilled water to make 1 liter.
Screening of microorganisms
Theearth worms feces samples were diluted with LB broth then spreading onto plates and
incubated at 37 C for 24 hours. Colonies of microorganism were visually selected by different
colony characteristic.
CM-Cellulose test and glucose measurement
The microorganisms were cultured in 5 ml LB medium and incubated for 24 hours. Pipette
1 ml of microorganism solution to a flask 50 ml added with 15 ml Acetate buffer, and 15 ml
substrate solution then incubated at 37 C for 24 hours. The photometric analysis procedures were
pipette the previous solution 1 ml and added into a test tube then adding 1 ml reagent A and 1 ml
reagent B, make a homogeneous solution by shaking then incubated in boiling water bath for 15
minutes. After that cools down the solution in the test tube by leaving the test tube in a water bath
at room temperature for 5 minutes, followed by adding 5 ml of reagent C, mix well and leave it at
room temperature for 1 hour to make the blue complexes formed. Measure the absorbance of the
samples with spectrophotometer at 690 nm.
Study the microorganisms to degrade paper sludge
Providing a test tube contained 12 ml LB broth with microorganism. Then, adding the
paper sludge into the test tubes. Then, allowed the microorganisms to degrade the paper sludge at
specific time. Filtering the solution with Whatman No.1 filter paper and collect the filtrate and
measure the glucose by photometric analysis.
Page 315

July 9-11, 2012
Study the earth worm to degrade paper sludge
2 gram of paper sludge was added into a box the size 7x7x4 cm. then, added 1 gram of
earth worm. Allow the earthworm to digest paper sludge and collect a vermicast and added into a
test tube then adding 15 ml buffer and shaking continuously for 30 minutes.
Filtered the solution with Whatman No.1 filter paper and collect a filtrate and measure the glucose
by photometric analysis.
RESULT
Screening of microorganisms in three earthworms
The result of performance of microorganisms from three different earthworms on the

breakdown of CM-cellulose was shown in fig. 1
Fig. 1 The powerful of microorganisms in three earthworm species broke down CM-cellulose.
The screening of microorganisms in the digestive tract of three different earthworm
species, Eiseniafoetida (The Tiger worm),Eudriluseugeniae (African Night Crawler), Perionyx
excavates (Blue worm) were selected and cultured in LB broth containing CM-cellulose for 24
hours as in Figure 1. The microorganism from African Night Crawler in the third tube (African
Night Crawler 3) has the most powerful microorganism in all microorganisms from African Night
Crawler. And the most powerful microorganism in The Tiger worm and Blue worm were Tiger
worm in sixth tube (Tiger worm 6) and Blue worm in first tube (Blue worm 1), respectively.
Growth curve of the microorganisms selected from three earthworm species.
A total of 24 potential cellulose degraded bacteria isolated from earthworms feces were
screened for glucose producer. Out of 24 isolates, 3 strains were able to degrade CM-Cellulose for
24 hours. A comparison of the growth curve of 3 strains was shown in figure 2.
Page 316

July 9-11, 2012
Fig. 2 Growth curve of the 3 microorganisms that have the high powerful to degrade CMCellulose.
Fig. 2 showed that all strains have the same growth rate in LB broth. these 3 strains were used to
degrade the cellulose from the waste paper sludge.
Study the efficiency of the three microorganisms for degrading paper sludge.
The three effective microorganisms were performed the degradation of paper sludge. The
microorganism from Eudriluseugeniae, African Night Crawler 3, is the most superior glucose
producer as shown in figure 3.
Fig. 3 Amount of the three microorganisms which produce glucose
Page 317

July 9-11, 2012
Fig. 3 showed that African Night Crawler 3 had the most powerful among the three
different microorganisms from African Night Crawler, Blue worm and Tiger worm. 1 ml of
African Night Crawler 3 converts 2 grams of paper sludge to 0.011 microgram/ml glucose for 24
hours whereas 3 ml of African Night Crawler 3 converts 2 grams of paper sludge to 0.0132
microgram/ml glucose for 24 hours.
The powerful of African Night Crawler for degrading paper sludge.
Fig. 4 showed the glucose production rate of American Night Crawler (earth worm) which
using 1 gram of paper sludge as the substrate. On the date 2-5, we found that American Night
Crawler rapidly converted paper sludge into glucose. After six day, American Night Crawler
produced glucose at the slow conversion rate. The amount of glucose that in the experiment in day
8 were 0.1032 microgram/ml of glucose.
Fig. 4 Glucose production curve by American Night Crawler earth worm.

DISCUSION
This result is consistent with experimental studies of C. Elvirs, M.Goicoechea, L.
Sampedro, S. Mato and R. Nogales (Elvirs C. et al, 1996) was to study the biological properties of
paper sludge by the earthworm species Eiseniaandrei (African Night Crawler) within 40 days. The
experiment was set in containers with and without earthworms results show that the rate of growth
of the earthworm weight up to 0.90 g of soil to the ovaries prior to 21 (45% in 12 days) of
treatment. These results show that earthworms are digested by intestinal bacteria in the paper
sludge. (Edwards and Lofty, 1972).
ACKNOWLEDGEMENTS
This research was financially supported by the research and development supporting fund
from Faculty of Engineering, Burapha University (contract number 47/2553). The authors
gratefully to acknowledge the contribution from Department of Engineering, Faculty of
Engineering, Burapha University for providing utilities and instruments.
Page 318

July 9-11, 2012
REFERENCE
Berghem, L. E. R., Pettersson, L. G. and Axio- Fredriksson, U. (1975).The mechanism of
enzymatic cellulose degradation. Eur. J. Biochem., 53, 55-62.
C.Elvirs, M.Goicoechea, L.Sampedro, S.Mato&R.Nogales. (1996).Bioconversion of solid paper
pulp mill sludge by earthworms.Bioresource Technology 57 (1996) 173-177).
Edwards, C. A. & Burrows, I. (1988).The potential of earthworm compost as plant growth media.
In Earth- worms in Waste and Environmental Management, ed. C. A. Edwards & E. F.
Neuhauser, pp. 211-221. SPB Aca- demic Publishing BV, The Hague, The Netherlands.
Gregg, D. and Saddler, J. N. (1995). Bioconversion of lignocellulosic residue to ethanol: Process
flowsheet development. Biomass and Bioenergy, 9, 287-302.
Handreck, K. A. (1986). Vermicomposts as components of potting media.BioCycle, 28, 58-62.
Kanda, T., Wakabyashi, K. and Nisizawa, K. (1976).Xylanase activity of an endocellulase of carboxymethyl- cellulase type from Irpexlacteus. J. Biochem., 79, 997-1006.
Lee, D., Yu, A. H. C., Wong, K. K. Y. and Saddler, J. N. (1994). Evaluation of the enzymatic
susceptibility of cellulosic substrates using specific hydrolysis rates and enzyme
adsorption. Appl. Biochem. Biotechnol., 45/46, 407-415.
Nazhad, M. M., Ramos, L. P., Paszner, L. and Saddler, J. N. (1994). Structural constraints
affecting the initial enzymatic hydrolysis of recycled paper. Enzyme Microb. Technol., 17,
74-86.
Sadana, J. C. and Patil, R. V. (1985). The purification and properties of cellobiose dehydrogenase
from Sclerotiumrolfsii and its role in cellulolysis J. Gen. Microbiol., 131, 1917-1923.
Wood, T. M. (1975). Properties and mode of action of cellulase~ Biotechnol.Bioeng.
Symp., 5, II1-137.
Page 319

July 9-11, 2012
STO209-3
Isolation of the High Powerful Nitrate Degrading Bacteria from

Effective Microorganisms (EM)
Jutarut Kalaya, Bussaba Phonyotin, Arin Ngophuthong, Witawat Jangiam
Department of Chemical Engineering, Faculty of Engineering, Burapha University, Thailand.
E-mail: witawat@eng.buu.ac.th,
Phone: (66)38102222 Ext 3351, Fax: (66)38102222 Ext 3350
ABSTRACT
Thailand is an agricultural country likes many countries In the world. One of the
continuing problems is excessive use of chemical fertilizers. Surface runoff until ground water
becomes contaminated with synthetic nitrogen fertilizer. Nitrate contaminated in drinking water
can cause a major health impact on humans, mainly for babies and children. The study of
microorganisms degrading is necessary to be conducted. The study aims to search for the effective
microorganism from biological fertilizer in order to degrade nitrate (NO3). Six bacterial cultures
were examined for their ability to utilized nitrogen sources in term of amino acid, NH3, NO3, N2
gas. A microorganism named EM2 was found that it had ability to completely reduction of
nitrate to molecular nitrogen. Surprisingly, it only can utilize NO2 and NO3 as sources of nitrogen.
The optimum condition of EM2 to degrade nitrate was conducted. pH 6 was found to be suitable
for reducing nitrate. 1 g of microorganisms cell totally removed 200 ml/l nitrate within 4 hours and
able to degrade until 800 ml/l nitrate within 4 hours. EM2 can be used for many applications such
as immobilized cell reactor to reduce the amount of nitrate in drinking water.
Keywords: Microorganism, Denitrification, nitrate
INTRODUCTION
The contamination of nitrate in groundwater and surface water is an important
environmental problem in many parts of the world [1]. Agricultural areas that use large quantities
of fertilizers are result of contamination into the water [2]. Plants cannot use all the fertilizers
which farmers add in to the soil. More than half of the fertilizers are put down to loss of soil, water
and air. For example, fertilizer for planting grain crops only 33% of the fertilizer only put all the
plants used for growth. The remaining 67% are lost various ways, erosion of top soil, evaporated
erosion, nitrogen release of plant processes and processes reducing nitrate in the soil [3]. The use
of fertilizers in excessive amount could be polluting and can cause serious effects to human health
and the environment [4]. But anyway, the release of wastewater sludge to land is causing this
problem as well [5].
Considering the past 40 years we could found that rate of nitrogen fertilizer in Asia
increased by 17 times [6]. It is common to find nitrate contamination in the water area with use of
nitrogen fertilizers in large quantities. Nitrogen contamination in water can cause a phenomenon
called Algal Boom [7], a condition in which large quantity of nitrogen, phosphorus and
potassium. This phenomenon often found in winter or rainy season which the rain leaching
fertilizers out into water and the aquatic plants, especially algae, is highly growth and cause
Page 320

July 9-11, 2012
oxygen reduction in the water as a consequence, the aquatic animal die because of lack of oxygen.
In addition, people who live around the area of agriculture, or anyone who drink water from this
area will cause the risk regarding health problems from the contamination of nitrate such as Blue
baby syndrome and Methemoglobinemia in infant [8].
Therefore, it is necessary to reduce the amount of nitrate contamination in groundwater
and surface water. The aim of this study was to screen microorganisms which have the potential to
reduce nitrate (NO3) from biological fertilizer by culturing in various sources of nitrogen media
which are peptone broth, ammonium sulfate broth, nitrate broth and nitrogen free broth to know
the role of each microorganism in the nitrogen cycle (Fig. 1). Finally, we found that
microorganism EM2 has high potential to degrade nitrate.
Fig. 1 Nitrogen cycle

Materials
Most of chemicals were used as best grade and purchased either from Sigma (USA) and
Fluka (Switzerland).
Methods
Selection the microorganism from the biological fertilizer
Spread the biological fertilizer, serially diluted, on LB agar. The was incubated for 18
hours, 37oC for a culture of bacterial then selected the colonies that grew.
Ammonification test
Microorganisms were cultured in peptone broth medium. The production of ammonia was
detected by adding Nesslers solution as described by Jureerat Leesmidt [9].
Nitrification test
Microorganisms were cultured in ammonium sulfate broth medium and nitrite broth
medium. The production of ammonia, nitrite and nitrate were detected by adding Nesslers
solution, Trommsdorfs solution and Diphenylamine, respectively, as described by Jureerat
Leesmidt[9].
Page 321

July 9-11, 2012
Nitrate reduction and denitrification test
Microorganisms were cultured in nitrate broth which had Durham tube to collect gas. the
production of ammonia, nitrite and nitrate were detected by adding Nesslers solution,
Trommsdorfs solution and Diphenylamine, respectively, as described by Jureerat Leesmidt[9].
Non Symbiotic Nitrogen fixation
Microorganisms were cultured in nitrogen free broth and the microorganisms which have
the nitrogen fixation process can grow on top or surface.
RESULTS
Ammonification test
The six bacterial cultures were examined for their ability to utilized nitrogen sources in
term of amino acid, NH3, NO3, N2 gas. The first pathway which was test was ammonification path
way was tested. This pathway, six bacterial cultures was grown in peptone broth medium. The
production of ammonium was detected by using Nesslers solution. The results showed in fig.2.
Fig. 2 The detection of ammonia (NH3) in ammonification pathway

The fig. 2 showed that EM1, EM3, EM4 and EM6 had the ammonification pathway
because they had deaminase enzyme which could change amino acid into ammonia [10]. Many
bacteria which have this enzyme are Pseudomonas sp.[10], Bacillus cereus[11], Klebsiella sp.[12]
and Escherichia coli [13].
Nitrification test
In nitrification test, six bacterial cultures were grown in ammonium sulfate broth medium
and nitrite broth medium. The production of ammonia, nitrite and nitrate showed in fig.3 and 4.
(a)
(b)
(c)
-
Fig. 3 The detection of) a (ammonia (NH3)) b (nitrite (NO2 ) )c (nitrate (NO3 ) in ammonium
sulfate broth.
Page 322

July 9-11, 2012
(a)
(b)
-
Fig. 4 The detection of )a (nitrite (NO2 )) b (nitrate (NO3 ) in nitrite broth.

The fig. 3 and 4 showed all six cultures which had the nitrification pathway because they
had ammonia monooxygenase enzyme which could change ammonia into nitrite and nitrate[14].
Many bacteria which have this enzyme are Paracoccus denitrficans[14] and Nitrosomonas
europaea[15].
Nitrate reduction and denitrification test
In nitrate reduction and denitrification test, six bacterial cultures were grown in nitrate
broth which had Durham tube to collect gas. The production of ammonia, nitrite and nitrate
showed in fig.5.
(a)
(b)
(c)
) d(
Fig. 5 The detection of) a (ammonia (NH3)) b (nitrite (NO2- )) c (nitrate (NO3-)) d (gas production
in nitrate reduction and denitrification.
Page 323

July 9-11, 2012
The fig. 5 (a-c) showed that EM1, EM3, EM4, EM5 and EM6 had the nitrate reduction
pathway because they had enzyme nitrate reductase[16] and nitrite reductase[17] which could
change nitrate and nitrite into ammonia. Interestingly, EM2 did not change nitrate or nitrite into
ammonia. The results showed that EM2 did not play role in the nitrate reduction pathway.
All six cultures could produce gas (fig 5(d)) and showed that they had the denitrification pathway.
Non Symbiotic nitrogen fixation
In non symbiotic nitrogen fixation test, six bacterial cultures were grown in nitrogen free
broth and the microorganisms which had the nitrogen fixation process could grow on top or
surface shown in fig 6 .
Fig. 6 The detection of bacterial growth in non-symbiotic fixation pathway.

The fig. 6 showed all six cultures had the non-symbiotic fixation pathway because they
had nitrogenase [18] enzyme which could use nitrogen from air to be the nitrogen source of the
growth.
CONCLUSION
Fig. 7 The nitrogen cycle of six bacteria
Page 324

July 9-11, 2012
From fig. 7, a microorganism EM2 was found that had ability to complete reduction of
NO3 to molecular nitrogen. Surprisingly, it only can utilize NO2 and NO3 as sources of nitrogen.
EM2 can be used for many applications such as immobilized cell reactor to reduce the amount of
nitrate in drinking water.
ACKNOWLEDGMENT
This work was supported in part by research grant, contract number 6/2554 and 11/2554,
from Faculty of Engineering, Burapha University.
Page 325

July 9-11, 2012
REFERENCES
1. Rivett M.O., Buss S.R., Morgan P., Smith J.W.N., and Bemment C.D., (2008) Nitrate attenuation
in groundwater: a review of biogeochemical controlling processes. Water Research. 42 4215
4232.
2. Scanlon B. R., Jolly I., Sophocleous M., and Zhang L., (2007) Global impacts of conversions
from natural to agricultural ecosystems on water resources: Quantity versus quality. Water
Resources Research 43: 1-18.
3. Raun W. R., and Johnson G. V., (1999) Improving nitrogen use efficiency for cereal production.
Agronomy Journal. 91: 357-363.
4. Camargo J. A., and A. Alonso., (2006) Ecological and toxicological effects of inorganic nitrogen
pollution in aquatic ecosystems: A global assessment. Environment International 32: 831.
5. Wakida F.T., and Lerner D.N. ,(2005) Non-agricultural sources of groundwater nitrate: a review
and case study. Water Res. 39: 1 316.
6. Dobermann, A., and Cassman, K.G., (2004) Environmental dimensions of fertilizer N: what can be
done to increase nitrogen use efficiency and ensure global food security? In: Mosier, A.R., Syers,
J.K., Freney, J.R. (Eds.), Agriculture and the Nitrogen Cycle: Assessing the Impacts of Fertilizer
use on Food Production and the Environment. SCOPE 65. Island Press, Washington, DC, pp. 261
278.
7. Camargo J. A., and Alonso A., (2006) Ecological and toxicological effects of inorganic nitrogen
pollution in aquatic ecosystems: A global assessment. Environment International. 32: 831.
8. Sadeq M., Moe C. L., Attarassi B., Cherkaoui I., ElAouad R. E., and Idrissi L.,( 2008) Drinking
water nitrate and prevalence of methemoglobinemia among infants and children aged 17 years in
Moroccan areas. International Journal of Hygiene and Environmental Health. 211: 546-554.
9. Shaharoona B. Arshad M., Zahir Z. A., and Khalid A., (2006) Performance of Pseudomonas spp.
containing ACC-deaminase for improving growth and yield of maize (Zea mays L.) in the
presence of nitrogenous fertilizer. Soil Biology and Biochemistry, 38, 9: 2971-2975.
10. Gabellieri E., Bernini S., Piras L., Cioni P., Balestreri E., Cercignani G., and Felicioli R., (1986)
Purification, stability and kinetic properties of highly purified adenosine deaminase from Bacillus
cereus NCIB 8122. Biochimica et Biophysica Acta (BBA) 884, 3: 490-496.
11. Ling F., Inoue Y., and Kimura A.,(1991) Purification and characterization of
adenosine deaminase from Klebsiella sp. LF 1202. Journal of Fermentation and Bioengineering
71, 2: 89-92.
12. Lin J., Liao X., Du G., and Chen J., (2009) Enhancement of glutathione production in a coupled
system of adenosine deaminase-deficient recombinant Escherichia coli and Saccharomyces
cerevisiae. Enzyme and Microbial Technology 44, 5: 269-273.
13. Moir J. W. B., Crossman L. C., Spiro S., and Richardson D. J.,(1996) The purification of ammonia
monooxygenase from Paracoccus denitrficans. FEBS Letters 387, 1 71-74.
14. Zahn J. A., Arciero D. M., Hooper A. B., and DiSpirito A. A.,(1996) Evidence for an iron center
in the ammonia monooxygenase from Nitrosomonas europaea. FEBS Letters 397, 135-38.
15. Barbier G. G., Joshi R. C., Campbell E. R., and Campbell W. H.,(2004) Purification and
biochemical characterization of simplified eukaryotic nitrate reductase expressed in Pichia
pastoris. Protein Expression and Purification 37, 1: 61-71.
16. Silvestrini M. C., Falcinelli S., Ciabatti I., Cutruzzol F., and Brunori M.,(1994) Pseudomonas
aeruginosa nitrite reductase (or cytochrome oxidase): An overview. Biochimie 76, 7: 641-654.
17. Rees D. C., and Howard J. B.,(2000) - Nitrogenase: standing at the crossroads. Current Opinion in
Chemical Biology 4, 5: 559-566.
18. (2548) , .
Page 326

July 9-11, 2012
STO214-5
Improving of Bradyrhizobial inoculant for soybean cultivation

under environmental stress conditions
Jenjira Wongdee, Nantakorn Boonkerd, Neung Teaumroong, and Panlada Tittabutr

School of Biotechnology, Suranaree University of Technology, Nakhon Ratchasima 30000,
Thailand
E-mail: bbg.jane-na@hotmail.com
ABSTRACT
Several adverse environmental conditions are the limiting factors for soybean growth and
symbiosis capability of rhizobia. The process of N2-fixation by symbiont is strongly related to
physiological state development of the host plant. Bradyrhizobium spp. that can tolerate to
environmental stress conditions would increase soybean growth under stress conditions. This study
examined the effect of acid-, drought-, and high temperature-stress conditions on the growth and
survival of Bradyrhizobium spp. in culture media, and the effect on symbiosis with soybean plant
grew in the sand. Twenty isolates of bradyrhizobia were isolated from nodules of soybean grew in
environmental soil stress conditions, and eight isolates were selected according to their tolerant
ability under stress conditions in vitro experiments.
The efficiency of stress tolerant
bradyrhizobia on soybean growth was compared under various stress conditions. Bradyrhizobium
sp. isolate 184, 187, 194, and 197 could promote high level of nitrogenase activity under acid
stress condition, while isolate 187, 188, and 197 provided high nitrogenase activity under drought
stress condition. High level of nitrogen fixation was correlated with increasing of nodule number
and shoot dry weight of soybean plant under these two conditions. Whereas, only two isolates, 188
and 197 could promote soybean growth under high temperature stress condition. Results of this
study suggested that the inoculation of stress tolerant bradyrhizobia could enhance the symbiosis
efficiency and soybean growth under stress conditions.
Keywords: bradyrhizobial inoculant, nitrogen fixation, acid, drought, high temperature, soybean
INTRODUCTION
Soybean production in Thailand has been applied with symbiotic bacteria as biofertilizer
inoculum for over the past decade. Bradyrhizobium is used as soybean seed inoculants, because it
reduced atmospheric dinitrogen gas (N2) into nitrogenous compound that can be utilized directly
for plant. Therefore, the application of Bradyrhizobial inoculant is an essential factor that can
increase the soybean yield and reduce the cost of production, since it is cheap and environmental
friendly fertilizer that can be used instead of chemical fertilizer [14].
Although the effective nitrogen-fixing strain of bradyrhizobia is used as inoculant, the
plants are often nodulated by ineffective nitrogen-fixing strains from indigenous soil populations
and resulting in reduce the soybean yield [1]. The biotic and abiotic factors have been reported in
relating to nodulation competitiveness. Biotic factors, such as the abundance of indigenous
Page 327

July 9-11, 2012
bradyrhizobia, compatibility between soybean varieties and strain of Bradyrhizobium, and the
efficiency of Bradyrhizobium strains [17]. While, abiotic factors including environmental stresses,
such as salinity, unfavorable soil pH, nutrient deficiency, mineral toxicity, extreme temperature,
and soil moisture, cause rapid death of bradyrhizobial inoculum and reduce its capability for
nitrogen fixation and nodulation competition when applied to the field, which usually contain
multi-stresses condition [7]. A competitive and persistent rhizobial strain is not expected to
express its full capacity for nitrogen fixation because of the limiting factors, such as salinity,
unfavorable soil pH, temperature extremes, and nutrient deficiency [8], [9]. Inoculation of stress
tolerant strains of rhizobia may enhance the nodulation and nitrogen fixation ability of plants
under stress conditions.
In this study, we focused on abiotic stress even both of the abiotic and biotic factors can
affect Rhizobium populations [2]. It was documented that acid, drought, and high temperature are
the most important factors potentially limit the Rhizobium-legume symbiosis [15].
The ability of legume hosts to grow and survive in stress conditions is improved when
they are inoculated with stress tolerant strains of rhizobia [5]. Selection of effective, efficient, and
stresses tolerant rhizobial strains could help in ecological rehabilitation (restoration) of degraded
soils and increases soil fertility by improving the growth of associated plants, which also influence
on increasing crop yield [10]. Therefore, the aim of this study is to select the stress tolerant
bradyrhizobial strains that can survive and grow under several environmental stress conditions and
lead to increase the soybean yields.
Isolation and characterization of bradyrhizobia from nodules
Bradyrhizobia from soybean nodules were collected from environmental stress soils. The
nodule were surface sterilized with 95% ethanol for 5-10 seconds, then soaked in 3% Ca(ClO)2 for
5 minutes, and washed in sterilized water several times. Nodule was cut, and nodule suspension
was streaked on the yeast-mannitol (YM) agar plates containing congo red (pH 6.8) [16]. Isolated
bradyrhizobia were grown at 28C for 7 days. All the bradyrhizobial isolates were subjected to
their morphological-, biochemical- , and authentication-test before performing further
experiments.
Screening of bradyrhizobia that could grow under stress conditions (in vitro
experiment)
The cell cultures of 108 cells/ml were washed by normal saline twice, and 10 l cultures
were dropped on YM agar medium at different stress conditions for screening the stress tolerant
strains compared with a commercial strain of B. japonucum USDA110.
Screening under acid condition: YM medium was prepared at pH 4, 5, 6 and 7, then
0.5% bromthymol blue was added as pH indicator. The cell cultures were dropped on YM medium
at different pH conditions. Plates were incubated at 28C and the growth was checked everyday.
Bradyrhizobia that could grow at low pH condition were selected.
Screening under high temperature condition: The cell cultures were dropped on YM
agar medium then incubated at 28, 35, 40, and 45C. The growth of cell at different temperatures
was checked everyday. Strains could grow at high temperature were selected.
Page 328

July 9-11, 2012
Screening under drought condition: The cell cultures were dropped on YM agar
medium. The culture plates were incubated in desiccator chamber, which adjusted to have various
desiccated conditions by using different chemical desiccants, such as silica gel, saturated
CH3COOK.1.5H2O, K2CO3.2H2O, KI, and KCl solutions, to give R.H. values (at 30 C) of 3, 22,
43.6, 67.8, and 83.5%, respectively [11]. The growth of cell was checked every day. Strains could
grow under drought stress condition were selected.
Selection of Bradyrhizobium sp. inoculum by inoculation to soybean under stress
conditions (in vivo experiment)
The experiments were conducted in various stress conditions as acid-, high temperature-,
and drought-stress conditions. Soybean variety (Chiang Mai 60) (Glycine max (L.) Merr.) was
used in this experiment. Seeds were placed into Leonards jars containing sterilized sand and
watered with N-free solution. Then, one ml (108 cells) of bacterial culture was inoculated for a
seed. To conduct acid stress condition, the N-free solution was adjusted with acetic acid or NaOH
to have different acid stress conditions at pH 4, 5, and 7 and plants were grown at 25C. For high
temperature stress condition, plants were incubated under controlled temperature condition at 30,
35, and 40C) in the growth chamber, while drought stress condition was adjusted by adding
polyethylene glycol (PEG) 6000 solution into sand to create drought condition at -3.02, and -5.0
bar [3] and incubated at 25C. B. japonicum USDA110, a commercial strain was used in this study
to compare with isolated strains. The plant growth was observed for 30 days. Nitrogenase activity
of inoculated plants was observed by using Acethylene Reduction Assay (ARA), and the number
of nodule, nodule dry weight, plant dry weight, and root dry weight were collected for plant
growth evaluation.
Evaluation the effectiveness of Bradyrhizobial inoculants under stress conditions by
stress tolerance index (STI)
Stress tolerance indices (STI) of stress tolerant bacterial inoculated and non-inoculated
plants were determined according to Shetty et al. [6] as: STI = DWS or DWH/DWC (where, DWS
= dry weight of plant grown under stress, DWH = dry weight of plant grown under stress with
inoculation of bacteria, and DWC = dry weight of plant grown in control condition (without stress
and inoculation of bacteria).
Page 329

July 9-11, 2012
Fig. 1. Effect of bradyrhizobial inoculation on nitrogenase activity (mol C2H2 h-1 g-1 nodule),
biomass dry weight, and nodule number (No. nodules) of plant grew under (a) pH 4, (b) pH 5, (c)
pH 6, and (d) pH 7. Means and standard deviation are calculated from three replicates, and values
with different letter are significant difference at P 0.05.
RESULTS
Isolation and characterization of bradyrhizobia
A total of 20 isolates were exhibited a gram-negative, rod shape bacteria, and
appeared on positive PHB staining after cultured on YM plate. After authentication and nitrogen
fixation ability test with soybean, seven bradyrhizobial isolates could nodulate with soybean roots
and able to fix nitrogen well (data not shown). These strains were used for further testing under
acid, drought, and high temperature stress conditions.
Bradyrhizobial isolates could grow under stress conditions (in vitro)
Nodulating bradyrhizobia were tested on various stress conditions. The investigation at
acid condition showed five isolates, including isolate187, 188, 193, 194, and 197 grew better than
a commercial strain B. japonicum USDA110 on agar plate at low pH condition. Investigation at
high temperature condition found five isolates consisted of isolate 184, 187, 188, 193, and 194
could grow better than commercial strain. However, there was no difference among all tested
strains under drought condition (data not shown). Thus, bradyrhizobia isolates 184, 187, 188, 193,
194, and 197 were selected for further experiment.
Page 330

July 9-11, 2012
The efficiency of bradyrhizobial inoculants on soybean nodulation and plant growth
under stress conditions
Figure 2 Effect of bradyrhizobial inoculation on nitrogenase activity (mol C2H2 h-1 g-1 nodule),
biomass dry weight, and nodule number (No. nodules) under different levels of drought condition
at (a)-0.5, (b)-1.48, (c)-3.02, and (d)-5.0 bars. Means and standard deviation are calculated from
three replicates, and values with different letter are significant difference at P 0.05.
Page 331

July 9-11, 2012
Figure 3 Effect of bradyrhizobial inoculation on nitrogenase activity (mol C2H2 h-1 g-1 nodule),
biomass dry weight, and nodule number (No. nodules) under different temperature conditions at
(a) 30C,(b) 35C, and (c) 40C. Means and standard deviation are calculated from three
replicates, and values with different letter are significant difference at P 0.05.
To determine the efficiency of selected bradyrhizobial strains as soybean inoculant
compared with commercial strain USDA110, the germinated soybean seeds were inoculated with
tested isolates and grown under different conditions. Our results showed that soybean inoculated
with these strains had no statistical significant difference in nitrogenase activity, nodule number,
and biomass dry weight when grown under normal condition compared to a commercial strain of
USDA110.
Under strong acid condition (pH 4 and 5), the overall nodulation ability, and plant growth
were reduced when compared to mild acid condition (pH 6) and normal condition (pH 7) (Fig.1).
The nitrogenase activity of plants inoculated with isolates 187 and 194 was higher than other
strains under pH 4 (Fig. 1a), while isolates 188 and 194 produced higher nitrogenase activity than
other strains under pH 5 (Fig. 1b). However, the nitrogenase activities as well as biomass dry
weight and number of nodule were not significantly different from that of plants inoculated with
USDA110 under strong acid condition. Interestingly, the nitrogenase activity of plants inoculated
with isolate 197 was highest and significantly different from plants inoculated with USDA110
under mild acid condition (pH 6) (Fig. 1c). However, there was no significant difference of
biomass dry weight and number of nodule among the strains under this condition. Thus,
bradyrhizobia isolate 187, 188, 194, and 197 could be the candidates to be used as inoculant under
acid condition. The extreme pH of acid condition is one limiting factor for symbiotic rhizobia and
legume plant growth. Although bradyrhizobial inoculant could tolerate to acid condition and able
to nodulate and fix nitrogen the plant under acid condition similar to neutral pH condition, soybean
Page 332

July 9-11, 2012
plant needs to improve for its tolerance to acid stress to make the highest efficiency of using
bradyrhizobial inoculants [12].
Under drought stress conditions, the overall results were similar to plants grew under acid
stress condition. Plants inoculated with isolates 187, 188, and 197 promoted high level of
nitrogenase activity (Fig. 2) which correlated to increasing nodule, and shoot dry weight of plant
especially for -3.02 bars. Under the severe drought condition (-5.0 bars), the values of nitrogenase
activity of isolate 197 was not
Table 1 Stress tolerance index (STI) of stressed soybean plant inoculated with and without
bradyrhizobial inoculant grew under different conditions. The value of shoot dye weight in the
same row followed by different letters are significant difference at P 005
Stress
conditions
Stress Tolerance Index (STI)

Uninoculated USDA 110 184
187
188
193
194
197
pH4
0.447b
1.031a
0.881ab
0.731ab
1.063a
0.781ab
0.634ab
1.189a
pH5
0.694b
0.744b
0.853ab
0.947ab
0.863ab
1.056ab
0.919ab
1.428a
pH6
0.778b
1.581a
1.469ab
1.288ab
1.682a
1.295ab
1.750a
1.024ab
pH7
1.000b
1.809a
1.553ab
1.334ab
1.519ab
1.606ab
1.662a
1.727a
-0.5 bars
0.264d
0.324cd
0.510ab
0.380abc 0.276cd
0.337cd
0.551a
0.387ab
c
-1.48 bars
0.355c
0.384bc
0.519abc 0.535abc 0.400bc
0.643a
0.515abc
0.612ab
-3.02 bars
0.201c
0.244bc
0.340ab
0.447a
0.260bc
0.426a
0.420a
0.379ab
-5.0 bars
0.192b
0.357ab
0.364ab
0.473ab
0.438ab
0.966a
0.496ab
0.364ab
30C
0.563bc
0.772ab
0.521c
0.666abc 0.709abc 0.744ab
0.731ab
0.798a
35C
0.216b
0.494a
0.499a
0.553a
0.515a
0.481a
0.513a
0.500a
40C
0.261b
0.425a
0.453a
0.454a
0.434a
0.428a
0.467a
0.446a
Acid
Drought
High temp.
significantly different with USDA 110. However, isolate 188 had highest nitrogenase
activity under -1.48 and -3.02 bars, and also promote highest biomass dry weight under -1.48 bars,
the value at these conditions were significantly different from USDA110. While, isolate 193 gave
highest number of nodule under -0.5 and -1.48 bars. In many research studies indicating that the
osmotic potential generated by PEG decreased the root elongation [19] then lead to reduce the
Page 333

July 9-11, 2012
plant growth and development. Amooaghaie [13] reported that PEG concentrations from -1.0 to 7.0 bars decreased the average of soybean yields, this similar to Priyank et al. [17] described PEG
inhibited the germination and caused wilting in seedlings of moth bean. In this experiment,
isolate 188 and 197 performed better than USDA110 for plant growth under drought stress
condition. Thus, these isolates could be used for soybean inoculant under drought stress condition.
Figure 3 showed the results of plant grew under high temperature condition. The
nitrogenase activities were not much different among high temperature conditions. Isolates 188
and 197 promoted high nitrogenase activity under all condition, but it was not significant
difference from USDA110. Moreover, isolate 197 produced highest number of nodule under 30
and 35C, while isolate 188 gave highest nodule number under 40C, these numbers of nodule
were significant difference from USDA110. However, the nodulation ability and nitrogenase
activity were not correlated with biomass dry weight. There was no different of biomass dry
weight among the bradyrhizobia tested in all temperature experiment. Nevertheless, the biomass
dry weight was obviously reduced when the temperature increased to 40C. These results
indicated the effect of high temperature on biomass production. The same effect of high
temperature on plant biomass was also reported by Lurline et al. [4], which indicated that the plant
dry weight of soybean, pigeon pea, and cowpea inoculated with bradyrhizobia was decreased when
plants were grown 38C, while the temperature of 30C was the optimum temperature for bacteria
growth and increase the plant yields.
Evaluation the effectiveness of Bradyrhizobial inoculants under stress conditions by
stress tolerance index (STI).
Growth of inoculated soybean plant indicates the effectiveness of bradyrhizobial
inoculant. The effectiveness of each inoculant under each condition was considered by using
stress tolerance index or STI in connection with the nitrogenase activity, nodule number and
nodulation ability from pervious results. STI of bradyrhizobial inoculated plants were significant
difference from uninoculated soybean plant (Table 1). It was indicated that soybean plants biomass
could be increased under normal or stress conditions by using bradyrhizobial inoculation. Under
strong acid condition of pH 4 and 5, using isolate 197 gave highest STI value at 1.189 and 1.428,
respectively. The STI of plant inoculated with isolate 197 at pH 5 was significantly different from
USDA110. Differently in drought condition, isolate 187, 193, and 194 had better STI value at
0.447, 0.426 and 0.420, respectively under -3.02 bars indicated high level of drought stress
condition, and these values were significantly different when compared to commercial strain
USDA110 with STI value equal to 0.244. However, there was no significant difference of STI
among all bradyrhizobial isolates under high temperature stress conditions (35 and 40C). These
results indicated the influence of bradyrhizobial strain on overall efficiency of inoculant when
apply under different stress conditions. The commercial bradyrhizobial strain USDA110 may not
provide the best efficiency when apply with legume in all condition. Thus, the variation of various
stresses of soil present in different areas should be considered before using the appropriate
rhizobial inoculant strain for soybean cultivation.
CONCLUSION
Stress tolerant bradyrhizobial inoculant could increase soybean biomass when exposed to
environmental stress conditions, whereas un-inoculated soybean was adversely affected by stress
Page 334

July 9-11, 2012
when compared under the same condition. However, different bradyrhizobial inoculants performed
differently under different stress conditions. Isolate 184, 187, 194, and 197 performed well for acid
stress condition. Isolate 187, 188, and 197 were appropriate for drought stress condition, whereas
two isolates of 188 and 197 promote plant growth better than commercial strain USDA110 under
high temperature stress condition. However, these isolates should be further tested under field
conditions.
ACKNOWLEDGEMENTS
This work was supported by National Research Council of Thailand (NRCT) and
Suranaree University of Technology (SUT).
Page 335

July 9-11, 2012
REFERNCES
[1] A. Embalomatis, D. K. Papacosta, and P. Katinakis, Evaluation of Rhizobium meliloti strains
isolated from indigenous populations northern Greece, J. of Agriculture and Crop Sciences 172,
(1994), pp 73-80.
[2] D. Werner, Symbiosis of plants and microbes, Chapman and Hall, New York, 1992.
[3] E. M. Burlyn, and R. K. Merrill, The osmotic potential of polyethyleneglycol 6000, J. of Plant
Physiology 51, (1973), pp. 914-916.
[4] E. M. Lurline, B. Raymond, B. M. Dyremple, T. David, and J. K. Robert, Temperature effects
on Bradyrhizobium spp. growth and symbiotic effectiveness with pigeon pea and cowpea, J. of
Plant Nutrition 29, (2006), pp. 331346.
[5] G. H. Wei, X. Y. Yang, Z. X. Zhang, Y. Z. Yang, and K. Lindsrm, Strain Mesorhizobium sp.
CCNWGX035: A stress-tolerant isolate from Glycyrrhiza glabra displaying a wide host range of
nodulation, J. of Pedosphere 18, (2007), pp. 102-112.
[6] G. Shetty, D. Hetrick, P. Schwat, Effects of mycorrhizal fertilizers amendments on zinc
tolerance of plants, J. of Environmental and Pollution 88, (1995), pp. 308-314.
[7] H. H. Zahran, Rhizobium-legume symbiosis and nitrogen fixation under severe conditions and
in an arid climate, J. of Microbiology and Molecular Biology 63, (1999), pp. 968989.
[8] J. Brockwell, P. J. Bottomley, and J. E. Thies, Manipulation of rhizobia microflora for
improving legume productivity and soil fertility: a critical assessment. J. of Plant Soil 174, (1995),
pp. 143180.
[9] J. E. Thies, P. W. Singleton, and B. B. Bohlool, Modeling symbiotic performance of
introduced rhizobia in the field based on indices of indigenous population size and nitrogen status
of the soil. J. of Applied and Environemtal Microbiolology 57, (1991), pp. 29-37.
[10] M. Athar, and D. A. Johnson, Influence of drought on competition between selected
Rhizobium meliloti strains and naturalized soil rhizobia in alfalfa, J. of Plant Soil 184, (1996), pp.
231241.
[11] M. Boumahdi, P. Maryand, and J. P. Hornez, Influence of growth phases and desiccation on
the degrees of unsaturation of fatty acids and the survival rates of rhizobia, J. of Applied
Microbiology 87, (1999), pp. 611619.
[12] M. K. Meghvansi, P. Kamal and S.K. Mahna, Identification of pH tolerant Bradyrhizobium
japonicum strains and their symbiotic effectiveness in soybean, African J. of Biotechnology 4,
(2005), pp. 663-666.
[13] R. Amooaghaie, Role of Polyamines in The Tolerance of Soybean to Water Deficit Stress,
World Academy of Science, J. of Engineering and Technology 80. (2011), pp. 498-502.
Page 336

July 9-11, 2012
[14] R. M. N. Kucey, P. Snitwongse, P., Chaiwanakupt, P., Wadisirisuk, P. , Siripaibool C.,
Arayangkool, T., Boonkerd, N. and R. J. Rennie, Nitrogen fixation (15N dilution) with soybeans
under Thai field conditions, J. of Plant and Soil 108. (1988). pp. 33-41.
[15] R. Serraj, T. R. Sinclair and L. C. Purcell Symbiotic N2 fixation response to drought. J. of
Experimental Botany 50. (1999), pp.143155.
[16] S. Padmanabhan, and J. H. Heinz, Handbook for Rhizobia: methods in legume-rhizobium
technology Springer-Verlag, 1994.
[17] S. Priyanka, M. Rizwan, K. V. Bhatt, T. Mohapatra and S. Govind, In-vitro response of Vigna
aconitifolia to drought stress induced by PEG-6000, J. of Stress Physiology & Biochemistry 7,
(2011), pp. 108-121.
[18] V. W. Wasike, D. Lesueur, F. N. Wachira, N. W. Mungai, L. M. Mumera, N. Sanginga,
H. N. Mburu, D. Mugadi, P. Wango, and B. Vanlauwe, Genetic diversity of indigenous
Bradyrhizobium nodulating promiscuous soybean [Glycine max (L) Merr.] varieties in Kenya:
Impact of phosphorus and lime fertilization in two contrasting sites, J. of Plant and Soil 322,
(2009), pp. 151-163.
[19] W.R. Whalley, A.G. Bengough and A.R. Dexter, Water stress induced by PEG decreases the
maximum growth pressure of the roots of pea seedlings, J. of Experimental Botany 49, (1998), pp.
16891694.
Page 337

July 9-11, 2012
STO166-11
Antibacterial, Antioxidant and Toxicity Activities of Methanol

Extract of Xylocarpus granatum Fruit
Asep Awaludin Prihanto*, Muhamad Firdaus, Rahmi Nurdiani
Dept. Fishery Product Technology, Faculty of Fisheries and Marine Science, Brawijaya
University
Veteran st, Malang, 65145, Indonesia
E-mail: asep_awa@ub.ac.id
ABSTRACT
The objectives of this research were to examine antibacterial, antioxidant and toxicity of
methanol extract of Xylocarpus granatum fruit. Antimicrobial assay used disc diffusion method.
Antioxidant activity was done with DPPH method while toxicity was undertaken by brine shrimp
lethal toxicity test. The results showed that fruit extract gave inhibition on S. aureus and E. coli.
The MIC of methanol extract of fruit peel was more effective than fruit husk on both tested
bacteria. The antiradical efficiency (AE) of fruit husk was weaker than peel husk with 8.48 x 10-5
and 6.21 x 10-5, respectively. The LC50 value of fruit husk and peel were 5495 g/ml and 2512
g/ml. This value indicated that extracts of X.granatum fruit were non toxic. Based on these result,
it is clear that methanol extract of X. granatum fruit husk and peel showed antibacterial activities,
low antioxidant and non toxic.
Keywords: Antibacterial, antioxidant, toxicity, X. granatum fruit
INTRODUCTION
The research into biologically active compounds from natural sources has always been of
great interest for scientists looking for new sources of useful drugs against infectious diseases.
Medicinal plants constitute an effective source of both traditional and modern medicine. Herbal
medicine has been shown to have genuine utility and about 80% of rural populations depend on it
as their primary health care. In Indonesia, the use of medicinal plants such as mangrove to cure
several illnesses has been used routinely by coastal native.
The X. granatum belongs to the order Geraniales of the family meliaceae. The genus
Xylocarpus is distributed in the India, southern China, Malaysia, Indonesia, and other parts of
south-east Asia (Hogard, 2007). This mangrove provides a several phytochemical compounds. It
can be used for enormous health therapy. Xylocarpus granatum KOENIG have been traditionally
used for medicine by South East Asia shoreline inhabitants (Shen et al., 2009). Several biological
properties have been attributed to X. granatum: aphrodisiac, fever, malaria, hair preservatives,
astringent, antidiarrhoea, antiemetic and haemostatic properties (Bandaranayake, 1998; Lakshmia
et al., 2011).
Recently, much attention has been paid to Xylocarpus species due to therapy activities of
this plant. Such as antibacterial, antimalaria, eradicating fever and cytotoxic activitiy. The chemical
constituents of Xylocarpus include triterpenoids, alkaloids, phenolic acids, flavanoid, steroids,
monoterpenes, and some others (Shen et al., 2009). The fruits of X. granatum are brownish green in
color and used as a cure for poultice swellings (Lakhsmi and Gupta, 2008). The stem bark of X.
granatum could be used as inducer of sleeping time (Alam et al., 2007).
Page 338

July 9-11, 2012
There is a need to evaluate the extracts of each part of this fruit to provide scientific proof
for its wide application in traditional medicine system. The aim of this investigation was to examine
antibacterial, antioxidant and toxicity activities of methanol extract of X. granatum fruit.
Raw Material
X. granatum fruits were collected from Porongs River estuary, East java, Indonesia in
fresh condition. Fruits were packed in polyethylene plastic and eventually brought to laboratory.
Sample Preparation
The fruit of X. granatum was peeled to separate the peel and husk parts. The peel and husk
were then dried until about 15% water content used for dry extract preparation
Extraction
The X. granatum fruit peel was extracted by maceration method. The 50 g dried fruit peel
and husk were soaked in 200 ml methanol in an Erlenmeyer for 24 hour. The extract was then
separated from the debris by filtration and was concentrated under reduced pressure in a rotary
vacuum evaporator.
MIC Assay
The minimum inhibitory concentration (MIC) of the extracts was determined using various
amounts (0.1, 0.5, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0 and 8.0 mg/ml) of the extract. 5 ml of Mueller
Hinton Agar (MHA, Oxoid) containing Fruit husk and peel extracts were added aseptically to each
Petri dish and swirled carefully. Thus, the bacterial test (Staphylococcus aureus and Escherichia
coli) were streaked onto agar plates and incubating at 35C for 24 h (Lall and Meyer, 2000). One
blank plate (MHA without extract) was used as control. The MIC was regarded as the lowest
concentration of the extracts that did not show visible growth of the microorganism.
Antioxidant Assay
The antioxidant was assayed using DPPH radical-scavenging activity method following
(Brand-Williams, et al., 1995) with slight modification, A methanol solution (50 l) of the fruit
extracts at five different concentrations (ascorbic acid was used as standard) were added to 1.95 ml
of DPPH2 solution (0.2 mM in methanol) as free radical source. The Scavenging activity was
measured using spectrophotometer at 515 nm until the reaction reached the steady state. The
DPPH2 concentration in the reaction medium was calculated from the following calibration curve,
determined by lineal regression:
A515nm = 0.009 (DPPH2)T 0.007
(1)
Where (DPPH2)T was expressed as M, r2 = 0.998, The percentage of remaining DPPH2

(% DPPH2REM) was calculated using:
%DPPH2REM = (DPPH2)T/(DPPH2)T=0
(2)
Where (DPPH2)T was the concentration of DPPH2 at the time of steady state and
(DPPH2)T=0 was the concentration of DPPH2 at zero time. The percentage of remaining DPPH (%
DPPH2REM) against the standard concentration was used to obtain EC50 (the quantity of sample to
decrease 50% DPPH2). The time needed to reach the steady state to EC50 called TEC50. Antiradical
efficiency (AE) is a new concept of antiradical efficiency which combines the factors EC50 and
TEC50 was defined as AE. It was calculated following (Sanchez-Moreno et al., 1998) formula. All
experimental were carried out in triplicate.
Page 339

July 9-11, 2012
AE = 1 / (EC50 TEC50)
(3)
Cytotoxic Assay
Cytotoxicity of methanol extract of fruit peel and husk were assayed using brine shrimp
lethally test (Meyer et al., 1982), The Artemia salina was prepared in which hatched eggs (obtained
from Laboratory of Fish Breeding, Faculty of Fisheries and Marine Science, Brawijaya University)
in 2 day lighted sea water. The assay was prepared with 3 ml of filtered sea water containing 10
free swimming nauplii of Artemia salina in cavity bottle. 1 ml of variably crude extract
concentration was plugged in cavity bottle for 24 hour. The percentage of mortality was determined
by comparing the mean surviving Artemia salina. IC50 was determined using probit analysis
(Wardlaw, 1985). Extracts giving LC50 values greater than 1000 ppm were considered to be
nontoxic.
RESULTS
Antibacterial Activity
Methanol extracts of X. mollucensis fruit husk and peel were active against all tested
bacteria. In general, the ranged of MIC was from 3.0-6.00 mg/ml. However, as shown in Table 1,
the methanol peel extracts showed low in vitro potential of antibacterial activities against S. aureus
and E. coli. The methanol husk extract inhibited the growth of S. aureus at 4.0 mg/ml, which was
the second lowest concentration used in this research. In contrast, the MIC of the extract on E. coli
(7.0 mg/ml) was two times higher than S.aureus.The lowest MIC on both tested bacteria was
shown by peel extract on S. aureus (3.0 mg/ml).
Table 1. antibacterial activity of methanol extracts of the X. granatum
Fruit part
Husk
Peel
Tested Bacterial
MIC
(mg/ml)
Staphylococcus aureus
4.0
Eschericia coli
7.0
Staphylococcus aureus
3.0
Eschericia coli
6.0
Antioxidant Activity
The radical scavenging activity of methanol extract of fruit husk and peel using DPPH
method is shown in Table 2. Lower value of the EC50 illustrated higher antioxidant. The EC50 value
of methanol extract of X. granatum fruit husk and peel were 669618 and 454315g/ml
respectively.
Page 340

July 9-11, 2012
Table 2. antioxidant activity of methanol extracts of the X. granatum fruit
Fruit part and
standard
EC50 (g/ml)
TEC50 (min)
AE
Husk
669618
1.760.3
8.48 x 10-5
Peel
454315
3.540.2
6.21 x 10-5
1123
1.480.1
6.03 x 10-3
Ascorbic acid
AE was used to calculate the effectives scavenging of antiradical. In this calculation

considering the time to reach until steady state. The calculation of AE (Table 2) showed that the
AE of the crude methanol extract of X. granatum of fruit husk and peel were 8.48 x 10-5 and 6.21 x
10-5, respectively. This data showed that The AE of peel was lower that husk.
Cytotoxic Activity
The results of the toxicity assay against brine shrimp of the methanol extract of X.
granatum fruit husk and peel were shown in Table 3. The methanol extracts of X. granatum fruit
husk and peel have no significant toxicity activity against brine shrimp with a LC50 value of 5495
g/ml and of 2512 ppm, respectively.
Table 3. Toxicity of the methanol extract of X. granatum fruit
Regression
equation
LC50 (g/ml)
husk
Y=1.688X-1.248
5495
peel
Y=1.777X-1.042
2512
Samples
DISCUSSION
The weakest antibacterial activity was shown by the husk methanol extract especially
against the E. coli (8.0 mg/ml). Based on this assay, it can be seen that the peel was better on
antibacterial activity than the husk. This fact may be due to the lack of the antibacterial compound
in the X. granatum husk which extracted by methanol. This study confirms the previous report on
antibacterial effect on X. granatum extract (Choudhury et al., 2005). Alam et al. (2006) reported
that the bark of this species was far more powerful to inhibit bacteria. 400 g of methanolic bark
extract resulted 15 and 10 mm on S. aureus and E. coli, respectively.
The antibacterial compounds that exist in X. granatum fruit are probably for natural
defense against microorganism contamination in Xylocarpus sp. seed. Phenolic compounds were
divers spreading in almost all fruits husk, this compound has antibacterial activity (Cosmulescu et
al., 2010). The fuit of Xylocarpus sp. contained cyloccensin and xylocarpin that was known as
antibacterial compound (Zhou et al., 2006; Cui et al., 2007).
In this study was also revealed that gram positive bacteria appeared to be more susceptible
to the inhibitory effect of the extracts than gram negative bacteria. It is because the fact that its
Page 341

July 9-11, 2012
membrane structure is more complex than gram positive bacteria. Furthermore, the peptidoglycan
of gram positive is not protected by outer membrane (Navarre and Schneewind, 1999).
The fruit extract indicated low antioxidant. We assume that low antioxidant activities of X.
granatum fruit husk and peel because they were still in crude extract. However, X. granatum fruit
components could be able to be used as natural antioxidant in foods as well as health-promoting
substances. The antioxidant activity of methanol extract of fruit husk and peel was due to
polyphenol compound. Polyphenol substances were clustered as antioxidant compounds (SanchezMoreno et al., 1998). It was caused their capability for radical scavenging by proton transfer to
free radical.
Polyphenols, as one of phenolic compounds, play the main role in contributing to the
overall antioxidant activity. It has also been recognized for some time that several classes of
flavonoids play a significant role in many physiological processes and show antioxidant and
fungicidal activity (Larson, 1988)
Data on Table 2. showed that methanol extract of fruit peel exhibited more powerful
antioxidant than the extracts from methanol extract of fruit husk. Eventhough, the husk of this
species is more effective one and half times than X. moluccensis (Prihanto, 2011). The
classification order of AE for the tested antioxidants was: methanol extract of fruit peel > methanol
extract of fruit husk. According to the classification of AE by Sanchez-Moreno et al. (1998), the
crude methanolic extract of X. granatum of fruit husk and peel had a low level antiradical
efficiency. We proposed because the fruit husk and peel of X. granatum is not designed to muffle
radical.
Several studies have shown that brine shrimp assay has been an excellent method for
preliminary investigations of toxicity, to screen medicinal plants popularly used for several
purposes and for monitoring the isolation a great variety of biologically active compounds
(Quignard et al., 2003). Based on Ara et al. (1999) and Spavieri et al. (2010), if the LC50 of extract
or pure compounds on brine shrimp or cell line was less than 100 ppm, it was categorized as non
potential cytotoxic. It was therefore not be toxic to human. The same result was exposed by Dai et
al. (2005), that Xylocarpus sp. did not show toxic activity when it is extracted using polar solvent.
In other hand, Uddin et al. (2007) revealed that
The result of this research indicates that methanol extract of X. granatum fruit husk and
peel showed a broad spectrum antibacterial against S. aureus and E. coli, low antioxidant activity
and also showed non toxic activity. Further investigation on purified extract is necessary to obtain
more comprehension result
ACKNOWLEDGEMENTS
This work was financially supported by Directorate of Higher Education, Ministry of
National Education, Republic of Indonesia (DIPA Brawijaya University No. 190/SK/2010)
Page 342

July 9-11, 2012
REFERENCES
Alam M. A., Awal M. A., Subhan N., Daulla K.A. 2007. Sedative, Neuropharmacological and
Antinociceptive Effect Of The Crude Extract Of Xylocarpus Granatum Stem Barks. Nig.
J. Nat. Prod. and Med 11: 53-57
Alam, M.A., M. Sarder, M.A. Awal, M.M.H. Sikder and A. Daulla, 2006. Antibacterial Activity
of the crude ethanolic extract of Xylocarpus granatum stem barks. Bangladesh J.
Veterinary medicine, 4(1): 69-72.
Ara, J., Sultana, V., Ehteshamul-Haque, S., Qasim, R., Uddin, V. 1999. Cytotoxic activity of
marine macro-algae on Artemia salina (Brine shrimp). Phytotherapy Research 13: 304307
Bandaranayake, W. M. 1998. Traditonal and medicinal uses of mangroves. Mangroves and Salt
Marshes 2: 133148.
Brand-Williams, W., Cuvelier, M. E., Berset C., 1995. Use of a free radical method to evaluate
antioxidant activity. Lebensm. Wiss. Techno 28: 25-30
Choudhury, S., Sree, A. Mukherjee, S.C., Pattnaik, P., Bapuji, M. 2005. In Vitro Antibacterial
Activity of Extracts of Selected Marine Algae and Mangroves against Fish Pathogens.
Asian Fisheries Science 18: 285-294
Cosmulescu, S., Trandafir, I., Achim, G., Botu, M., Baciu, A., Gruia, M. 2010. Phenolics of
Green Husk in Mature Walnut Fruits. Notulae Botanicae Horti Agrobotanici Cluj Napoca
38: 53-56.
Cui, J. X. Wu, J. Deng, Z.W. Proksch, P. Lin, W. H. 2007. Xylocarpins AI, Limonoids from the
Chinese Mangrove Plant Xylocarpus granatum. J. Nat. Prod 70: 772-778
Dai, H. F., Mei, W. L., Hong, K., Zeng, Y. B., Zhuang, L. 2005. Screening of the tumor cytotoxic
activity of sixteen species of mangrove plants in Hainan. Chin.J. Mar. Drugs 24: 44-46.
Hogard, P. J. 2007. The biology of mangrove and seagrass. Oxford University Press, Oxford.
Lakshmi, V., and Gupta P. 2008. An Overview of the Genus Xylocarpus, Nat Prod Res.
22: 1197-1224.
Lakshmia, V., Srivastava, M. N. & Raghubir, R. 2011. Antidiarrhoeal activity in fruits of
Xylocarpus granatum. Asian J Pharm Biol Res 1: 62-66
Lall, N., Meyer, J. J. M. 2000. Antibacterial activity of water and acetone extracts of the roots of
Euclea natalensis. Journal of Ethnopharmacology 72: 313316
Larson, R. A. 1988. The antioxidants of higher plants. Phytochemistry 27: 969978
Meyer, B. N., Ferrigni, N.R., Putnam, J. E., Jacobsen, L. B., Nichols, D. E., McLaughlin,
J. L. 1982. Brine shrimp: a convenient general bioassay for active plant constituents.
Planta Med 45: 31-34.
Navarre, W. W., and Schneewind, O. 1999. Surface Proteins of Gram-Positive Bacteria dan
Mechanisms of Their Targeting to the Cell Wall. Microb and Mol Biol Rev 63: 174229.
Prihanto, A.A. Cytotoxic, antioxidant and antibacterial activity of metanol extract of Xylocarpus
moluccensis fruit husk. In: Abstract of the International Conference on Basic Science
(ICBS). 2011 February 17-18: Abstract 48. Malang, East Java, Indonesia: Brawijaya
University.
Quignard, E. L., Pohlit, A. M., Nunomura, S. M., Pinto, A. C., Santos, E. V., Morais, S. K.,
Alecrim, A. M., Pedroso, A. C., Cyrino, B. R., Melo, C. S., Finney, E. K., Gomes, E. O.,
Souza, K. S., Oliveira, L. C., Don, L. C., Silva, L. F., Queiroz, M. M., Henrique, M. C.,
Santos, M., Pinto, P. S., Silva, S. G. 2003. Screening of plants found in Amazonas state for
lethality towards brine shrimp. Acta Amazon 33: 93-104.
Sanchez-Moreno, C., Larrauri, J. A., Calixto, F. S. 1998. A procedure to measure the Antiradical
Efficiency of polyphenols. J Sci Food Agric. 76: 270-276
Shen L.R., Guo, D, Yu, Y.M., Yin, B.W., Zhao, L., Shi, Q.W., Wang, Y.L., Huo, C.H. 2009.
Chemical constituents of plants from the genus Xylocarpus. Chemistry & Biodiversity 6:
1293-1308
Page 343

July 9-11, 2012
Spavieri, J., Allmendinger, A., Kaiser, M., Casey, R., Hingley-Wilson, S., Lalvani, A., Guiry, M.
D., Blunden, G., Tasdemir, D. 2010. Antimycobacterial, Antiprotozoal and Cytotoxic
Potential of Twenty-one Brown Algae (Phaeophyceae) from British and Irish Waters.
Phytotherapy Research 24: 17241729.
Uddin SJ, Nahar L, Shilpi JA, Shoeb M, Borkowski T, Gibbons S, Middleton M, Byres M, Sarker
SD. 2007. Gedunin, a limonoid from Xylocarpus granatum, inhibits the growth of CaCo-2
colon cancer cell line in vitro. Phytother. Res 21:757761
Wardlaw, A. C. 1985. Practical statistics for experimental biologists, John Wiley and
Sons.Chichester.
Zhou, Y. Cheng, F. Wu, J. Zou, K. 2006. Polyhydroxylated Phragmalins from the Fruit of a
Chinese Mangrove,Xylocarpus granatum. J. Nat. Prod 69: 1083-1085
Page 344

July 9-11, 2012
STO35-12
Controlled releasing of urea fertilizer by biodegradable

polymer with conventional encapsulation
Sirima Pinpeangchan, Chokchai Wanapu
School of Biotechnology, Institute of Agricultural Technology, Suranaree University of
Technology,111 University Avenue, Maung, Nakhorn ratchasima 30000, Thailand
E-mail: bowow_ba1@hotmail.com, wanapu@sut.ac.th
ABSTRACT
Polymer-coated fertilizers are currently the most popular controlled-release fertilizers, and
offer great advantages over conventional fertilizers. PVA and PVP as the biodegradable polymer
were desired for studying. Experiments of urea granule based on PVA and PVP coating were
carried out into a rotary drum and polymer solutions were sprayed on the granules. To understand
the releasing of encapsulated urea fertilizer (EUF), a mathematical of Ficks law was obtained to
predict urea release behaviors. The n value from 0.5 to 1.0 is a nutrient release mechanism for nonFickian diffusion or chain relaxation control release. The coating material was conducted PVA and
PVP in various ratio 2:0, 1:0, 1:0.25, 1:0.5, 1:1, and 1:2. The results showed that the predicted n
values between 0.86-0.96 were strong non-Fickian diffusion while urea un-coated was n values of
0.69 which released faster than all EUF. The PVA coating had controlled release properties better
than PVP. Results reveal that PVP concentration has some effects on the controlled release. The
reduction of PVP was found to increase controlled release properties. However, the ability of their
polymer could control both the rate and time pattern of the release through different combinations.
Consequently, EUF could be easily produced with conventional process and had better controlled
release properties. Therefore, the EUF products have widely potential application in agricultural
industry as urea encapsulated fertilizer.
Keywords: controlled-release fertilizer, encapsulated urea fertilizer (EUF), non-Fickian diffusion,
polymer-coated fertilizer, polyvinyl alcohol (PVA), polyvinylpyrrolidone (PVP)
INTRODUCTION
The growth of plant depends on the soil condition, quantity of water, as well as mainly a
function of the quantity of fertilizer. Therefore, it is very important to improve the utilization of
fertilizer nutrients. Fertilizers are the main factors that limit the development of agricultural
production, which is very important to improve the utilization of fertilizer nutrients. Nitrogen is
the most vital nutrient for crops. It has been considered the yield limiting one. Among the nitrogen
fertilizers, urea is the most widely used in the crops as well as its high nitrogen content (46%) and
comparatively low cost of production.
However, consider leaching and vaporization, the utilization efficiency or plant uptake of
urea is generally less than 50%. About 40-70% of nitrogen of the applied fertilizer is escaped to
the environment and cannot be absorbed by crops [1-3]. As a neutral organic molecule, urea
cannot be absorbed easily by the charged soil particles before hydrolyzing, resulting in a great
quantity of urea running off and serious environmental hazards as only a fraction is really absorbed
by plants.
One possible of this problem is the encapsulation of fertilizer by membrane to control the
diffusion of water, leach, and release of the fertilizer. Recently, the use of slow release fertilizers is
new trend to save fertilizer consumption and minimize environmental pollution [4,5].
Page 345

July 9-11, 2012
Controlled releasing fertilizers (CRF) are made to control the rate of nutrient release as
well as control the slow diffusion of nutrient ions through the membrane to the soil [6,7]. The CRF
for urea is made by coating the active soluble component as the membrane that serves as a
diffusion barrier. Then, coating materials used should be inexpensive and exhibit a good coating
property. CRF are made to release their nutrient contents gradually with the nutrient requirement
of plant. These fertilizers can be physically prepared by coating granules of conventional fertilizers
with various materials that reduce their dissolution rate. The release and dissolution rates of watersoluble fertilizers depend on the coating materials. At present, degradability of coating material is
an important focus on the research in this field because of the renewed attention towards
environmental protection issues [8,9].
Polyvinyl alcohol (PVA) is a kind of excellent membrane material for preparation of a
hydrophilic membrane that swells easily and even dissolves in water. PVA is valued for its
solubility and biodegradability, which contributes to its very low environmental impact [10]. PVA
has also been approved for using in controlled releasing of fertilizer.
Polyvinylpyrrolidone (PVP) has been interested as a binder in granules of urea fertilizer
for controlling pore size of coating membrane. PVP polymer as a hydrophobicizer and stabilizer,
can greatly improve membrane oxidative stability and chemical stability [11]. Moreover, PVP is
miscible with hydroxyl-containing polymers, such as PVA. PVP was thus interpenetrated into the
PVA network due to increased cross-linking density. It has been extensively utilize and study in
these form of its alone or mix for observed mixing behaviors and properties of the blends.
Therefore, it seemed worthy of interest to prepare a new type of encapsulated urea
fertilizer (EUF) with their polymer.
Raw Material
Commercial urea fertilizer granules with size in the range 2-3 mm were used in the
experiments, which were produced by the Charoen Pokphand (CP) Company of Thailand. PVA of
molecular weights from 2,000 to 65,000 with a degree of hydrolysis 98% was purchased from
Aldrich chemical. PVP was purchased from Acros Organics. Other chemicals and solvents were
all of analytical grade. Deionized ultrapure water was used throughout the experiment.
Sample Preparation
Urea fertilizer granule was sieved to about 2-3 mm in diameter and was placed into a
rotary drum, and polymer solutions were sprayed on the granules. The adhesive was applied by
spraying at regular time intervals. The process was finished until compact and homogenous
coating formed on the granules. The coated granules were dried to a constant mass at 70C
overnight. Six combinations between PVA and PVP were shown in Table 1. A controlled
experiment without EUF was also carried out.
Table 1 The combinations among PVA/PVP in different ratio
Combination
EUF 1
EUF 2
EUF 3
EUF 4
EUF 5
EUF 6
PVA
2
1
1
1
1
1
PVP
0
0
0.25
0.5
1
2
Controlled-releasing behavior of EUF

To study the slow releasing behavior of EUF, the following experiment was carried out:
Five grams of EUF was kept in a syringe (size 10 ml) and allowed to soak with deionized water
Page 346

July 9-11, 2012
and incubated at 25C. Every one minute of incubation period, the deionized water was continuous
feeding. The release behaviors of EUF in the containers were obtained and keep at 4C to estimate
the content of urea by using spectrophotometer. For triplicate experiments were prepared at the
same time. The release results were analyzed by using an empirical equation to estimate the value
of n and K as follows [12,13]:
log (Mt/M) = log(K) + nlog(t)
(1)
Where Mt/M is the release fraction at time t, n is the release exponent, and K is the release
factor. From the slope and intercept of the plot of log (Mt/M) versus log (t), kinetic parameters n
and K was calculated.
The n value is an empirical parameter characterizing the release mechanism [14]. On the
basis of the diffusion exponent, n value of 0.5 indicates the nutrient release mechanism
approaches to a Fickian diffusion controlled release, whereas n equal to 0.1 indicates the nutrient
release mechanism approaches to zero-order release. The n value from 0.5 to 1.0 is a nutrient
release mechanism for non-Fickian diffusion or chain relaxation control release.
RESULTS
Effect of PVA and PVP on slow releasing behaviors
The releasing process of coated urea in water can be described as the following process.
Water penetrates through the coating shell and dissolves the urea and then the dissolved urea
diffuses into the water medium through the coating shell. Fig. 1 shows the cumulative released
quantity versus time from PVA in different coating quantities. This shows that the coated urea was
released at a constant rate in the first stage (initial state) and then released slowly till the end.
The PVA coated urea particle (EUF1) release was 17%, 56%, 82%, and 88%, while the
EUF2 release was 15%, 47%, 72%, and 80% on the 3, 7, 11, and 14 min, respectively. The urea
un-coated release was 29%, 68%, and 73% on the 3, 7, and 11 min, respectively. Both EUF have
shown strong non-Fickian diffusion behaviors, while urea un-coated was released faster than
EUF1 and EUF2.
Furthermore, the reduction in urea release of granules with a smaller quantity of PVA was
obvious. Probably, PVA increased the hydrophobic and thereby reduced the water-sensitivity of
the PVA coating. Therefore, the uptake of water and as a result the release of urea was decreased.
Besides the hydrophobicity, also the coating quality has a major influence on the release of urea.
100
Urea released (%)
80
60
40
urea
EUF1
20
EUF2
0
1
10
11
12
13
14
15
Time (min)
Fig. 1 Release behaviors of urea, EUF1, and EUF2

From the plot of log (Mt/M) versus log (t) (Fig. 2), the release exponent (n) and release factor
(K) have been calculated. Table 2 summarizes the values for urea release from EUF. Then n value
is in the range from 0.95-0.96. Therefore, the urea release mechanism is strong non-Fickian
diffusion, and is controlled by a polymer coating material.
Page 347

July 9-11, 2012
2.5
log (Mt/M)
2.0
1.5
1.0
urea
EUF1
0.5
EUF2
0.0
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
log (t)
Fig. 2 Plot of release data log (Mt/M) versus log (t) of EUF1, EUF2 and control
Table 2 The release factors (K), release exponents (n), and determination coefficients (r2)
following linear regression of release data of urea from EUF
Sample
urea
EUF1
EUF2
n
0.69
0.95
0.96
K
17.56
9.23
7.67
r
0.9470
0.9827
0.9815
Fig. 3 shows the cumulative released quantity versus time from PVA and PVP in different
ratio. The EUF3 was released 15%, 33%, 47%, and 85%, while the EUF4 was released 16%, 35%,
54%, and 85% on the 3, 5, 7, and 13 min, respectively. The EUF5 was released 19%, 38%, 55%
and 89%. The EUF6 was released 23%, 44%, 63%, and 97%, respectively. Similar trends were
observed for the concentration dependence, where the PVA/PVP mass ratio ranged from 1:0.25 to
1:2. It depended on the PVP content. It can clearly be seen that the trends of releasing of urea was
increased when increasing PVP content. Due to the hydrophilic nature of PVP, the polymer would
be release well in water.
As seem in the Table 3, All the sample were non-Fickian diffusion behaviors and EUF3 is
the best strong non-Fickian diffusion.
100
Urea released (%)
80
60
40
EUF3
EUF4
EUF5
20
EUF6
0
1
Time (min)
Fig.3 Release behaviors of EUF3, EUF4, EUF5, and EUF6
Page 348
10
11
12
13
14
15

July 9-11, 2012
2.5
log (Mt/M)
2.0
1.5
1.0
EUF3
EUF4
EUF5
0.5
EUF6
0.0
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
log (t)
Fig.4 Plot of release data log (Mt/M) versus log (t) of EUF3, EUF4, EUF5 and EUF6
Table 3 The release factors (K), release exponents (n), and determination coefficients (r2)
following linear regression of release data of urea from EUF
Sample
EUF3
EUF4
EUF5
EUF6
n
0.96
0.93
0.88
0.86
K
8.03
8.93
10.44
12.72
r
0.9910
0.9833
0.9858
0.9924
From the plot of log (Mt/M) versus log (t) (Fig. 4), the release exponent (n) and release
factor (K) have been calculated. Table 3 summarizes the values for urea release from EUF. Then n
value is in the range from 0.86-0.96. Therefore, the nutrient release mechanism is non-Fickian
diffusion.
DISCUSSION
Providing the problem of using fertilizer as sufficient N fertilization to crops is critical to
achieve high quality and yields. Encapsulated urea fertilizer is needed to control release, maximize
N uptake efficiency, and minimize environmental hazards. It can be utilized as a management tool
to supply nutrients during an extended period of time while reducing potential nutrient losses to
the environment. Urea granules, being used as fertilizer, were coated in rotary drum with
PVA/PVP polymer based formulations. We have developed a conventional encapsulation
technique on the basis of PVA/PVP blending with spraying polymer solution on the granules, in
which PVP serves as both a plasticizer and stabilizer on granule. High control releasing rate was
obtained at room temperature for PVA/PVP in a mass ratio of 1:0.25. The release of urea through
these coating was measured and compared to urea un-coated granules. When PVA was used, the
urea release decreased drastically. PVA was found more efficient than PVP in reducing the rate of
release. It was also found that mixtures with PVA/PVP induced a non-Fickian release pattern.
However, for industrial applications the releasing product was still not achieved. Probably coating
deficiencies were responsible for faster urea release of coated granules. More research is necessary
to improve the coating process, and thus coating quality.
Page 349

July 9-11, 2012
REFERENCES
[1] M. A. Dave, H. M. Metha, M. T. Aminabhavi, R. A. Kulkarni, and S. K. Soppimath, A review
on controlled release of nitrogen fertilizers through polymeric membrane devices, Polym-Plast
Tech Eng 38, (1999), pp. 675-711.
[2] M. Guo, M. Liu, F. Zhan, and L. Wu, Preparation and properties of a slow-release membraneencapsulated urea fertilizer with superabsorbent and moisture preservation, Ind Eng Chem Res 44,
(2005), pp. 4206-4211.
[3] M. Liu, R. Liang, F. Zhan, Z. Liu, and A. Niu, Preparation and properties of diatomite
composite superabsorbent, PAT 8 (3), (2007), pp. 184-193.
[4] A. Akelah, Novel utilizations of conventional agrochemicals by controlled release
formulations, M Eng 4, (1996), pp. 8398.
[5] A. Jarosiewicz, and M. Tomaszewska, Controlled-release NPK fertilizer encapsulated by
polymeric membranes. J. of Agr Food Chem 51, (2003), pp. 413-417.
[6] I. U. Ahmed, O. J. Attoe, E. L. Engelbert and R. E. Corey, Agron J 55, (1963), pp. 9-495.
[7] R. D. Lunt, and J. J. Orteli, Soil Sci Soc Am Proc 26, (1962), pp. 584-587.
[8] J. J. Ge, R. Wu, H. X. Shi, H. Yu, M. Wang, & J. W. Li, Biodegradable polyurethane materials
from bark and starch. II. Coating materials for controlled-release fertilizer, J Appl Polym Sci 86,
(2002), pp. 2948-2952.
[9] V. Shavit, M. Reiss, & A. Shaviv, Wetting mechanisms of gel based controlled-release
fertilizers. J CRS 88, (2002), pp. 71-83.
[10] Isolyser Company, 1998. Isolyser Company, Inc. 4320 International Boulevard, N.W.,
Norcross, GA.
[11] L. J. Qiao, T. Hamaya, T. Okada, New highly proton-conducing membrane poly
(vinylpyrrolidone) (PVP) modified poly(vinyl alcohol)/2-acrylamido-2-methyl-1-propanesulfonic
acid (PVA-PAMPS) for low temperature direct methanol fuel cells (DMFCs), Polym 46, (2005),
pp. 16-10809.
[12] S. Al-Zahrani, Utilization of polyethylene and paraffin waxes as controlled delivery systems
for different fertilizers, Ind Eng Chem Res 39, (2000), pp. 367-371.
[13] H. X. Peng, N. L. Zhang, and F. J. Kennedy, Release behavior of microspheres from crosslinked N-methylated chitosan encapsulated ofloxacin, Carbohydr Polym 65, (2006), pp. 288-295.
[14] A. Shaviv, Advances in controlled-release fertilizer, Adv Agron 71, (2000), pp. 1-49.
Page 350

July 9-11, 2012
STO42-13
Preparation and evaluation of nanoparticles for sustained

delivery of ampicillin
Dr.S.Ramesh,M.Pharm.,Ph.D.,ARPS(London)
Professor & Head Department of Pharmaceutics
Sri Padmavathi School of Pharmacy, Tirupati-517503 (A.P), India
E-mail: sramesh_ap@yahoo.com
ABSTRACT
The main objective of the present research work is to prepare the nanoparticles for the
sustained delivery of ampicillin. It possess less biological halflife, and frequent administrations is
required when given in conventional dosage forms such as tablets, capsules, etc. Studies have been
carried out on the preparation of nanoparticles with the ink of cuttlefish (sepia) belonging to the
marine mollusk, Sepia officinalis with an objective of designing and developing nanoparticles for
oral administration and sustained release of ampicillin. Nanoparticles were prepared by controlled
gellification method and evaluated. In our study the fifth formulation (AP5) showed better in-vitro
results. The selected nanoparticle formulation i.e. AP5 is subjected to in-vivo pharmacokinetic
parameters. In-vivo drug analysis AP5 showed good release profile in a sustained manner. It
showed a drug release of 88% at the 24th hr. The size of the particle in the formulation was 1000
nm. The release pattern of AP5 formulation a better drug release was observed in the drugpolymer concentration of 1:3.The zeta potential values for all the selected formulations were
positive. More than 60% of the drugs were found to be entrapped in the above said drug
formulation. The prepared formulations were highly stable in nature. The Infrared spectroscopy
studies of physical mixture showed that there was no interaction between the drug and polymer.
The formulation AP5 showed good release characteristics in-vivo. The formulation AP5 was
therefore considered as good oral-controlled release formulation of ampicillin.
Keywords: Nanoparticles, Antibiotics, Drug Delivery systems
INTRODUCTION
A nanoparticle is a particle having a size range of 1-1000 nm.10 Ampicillin is an
antibacterial agent, effective against various types of bacteria. The daily dose is 2-6 g in frequent
intervals. It is a crystalline white substance sparingly soluble in water but insoluble in ethanol,
chloroform and fixed oils; soluble in acids and alkali hydroxides. It should be stored in well closed
containers in a cool and dry place.
Cuttlefishes6,7 are the ink producing marine invertebrates and they belong to the Phylum
Mollusk and Class Cephalopod which include similar ink producing animals such as octopus and
squid. The cuttlefishes are soft bodied swimming animals provided with a large head ringed by
tentacles and an internal cuttle bone made of chiefly calcium carbonate. These animals possess an
ink pouch (sac) in which, a brownish black fluid called sepia secreted by them is stored.
Cuttlefishes are known to display natural camouflage. In order to escape from predators at the
times of emergency, cuttlefishes darken the environment by ejecting a gelatinous and mildly
narcotic dark brown ink to stun attackers and this defensive response gives them time to escape.
Further, the melanin5 particles of sepia are easily miscible in sea water and remain dispersed in
solution for more than 14 days. The crude ink obtained from the ink sac is boiled with caustic
Page 351

July 9-11, 2012
soda, filtering the extract and then adding HCl for precipitating the colouring matter. The liquid
ink may also be dried by combining with lactose and then ground. This ink is used as a carrier6 for
ampicillin. Chitosan 2,3 a co polymer used in this study occurs naturally in fungi, yeasts, marine
invertebrates and arthropods. Chitosan is the principal component of exoskeletons of marine
crustaceans from which supplements are often derived. Chitosan is widely used as an excipient in
oral and other pharmaceutical formulations. It is used as a coating agent, disintegrant, filmforming agent, mucoadhesive, tablet binder and viscosity increasing agent.
Ampicillin is obtained as a gift sample from Pharmafabrikon, Maduai. Chitosan from the
Fisheries College and Research Institute, Thoothukudi, TamilNadu, India. Sepia officinalis
(cuttlefish) ink is procured from fish vendors in Thoothukudi and authenticated by Dr. R.
Santhanam, Professor, Fisheries College and Research Institute, Thoothukudi, India and all the
chemicals used were of analytical grade. Distilled water was used to prepare stock solution
(100ml) and the pH was maintained at 7.4.
The nutrient media was prepared and sterilized. After sterilization, they were cooled at
40C and inoculated with the culture of S.aureus and were poured in a clean sterile Petri dish and
allowed to solidity. After solidification, 10 wells of 3 mm in diameter were cut. The standard
different solutions were poured into the well and incubated. After the incubation, the zone of
inhibition was measured and tabulated.
Preparation of nanoparticles:
The sepia nanoparticles were prepared by controlled gellification process8,9. This method
is already in application for the encapsulation of antibiotics. Initially, the sepia powder was taken
and it was mixed with the ampicillin solution. To this, 1 ml of calcium chloride solution was
added and mixed thoroughly by stirring with the magnetic stirring for about 15 min. Then 1 ml of
chitosan solution was added and the stirring was continued for another 1 hr. Finally, the resultant
solution was sonicated in the organ Sonicator for 30min. Then, this mixture was kept for one day
at 25 30C. The drug-loaded nanoparticles were harvested by centrifugation at 16000 rpm for
one hour. The flakes formed were collected and stored in a suitable container. The concentration of
the drug: polymer ratio were as follows viz 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1.3.5, 1:4 and it has been
named as AP1, AP2, AP3, AP4, AP5, AP6, AP7
In-vitro drug release of ampicillin nanoparticles 8,9
30 mg of drug-loaded nanoparticles were placed in the dissolution rate test apparatus USP
basket type stirring element. The basket was covered with an egg membrane. 900 ml of phosphate
buffer solution (pH 7.4) at 37 C was used as dissolution medium.5ml of sample was withdrawn at
various time intervals of 15 min, 30 min, 1h, 2h, 4h, 8h, 12h, and 24 h with the help of 5 ml pipette
and replaced by 5ml of phosphate buffer solution (pH 7.4), and the drug content was estimated by
UV-Spectrophotometer at 285 nm.
Drug Content Analysis:
Drug content was analyzed by adding 100 ml of 10% hydrochloric acid with 30 mg of
nanoparticles. The latter was kept at a temperature of about 35 C for 24 h. After that, the
nanoparticles were separated by centrifugation at 16000 rpm. The drug concentration was analyzed
in the supernatant liquid by UV-Visible spectrophotometer. The ampicillin nanoparticles were
analyzed at 268 nm. Particle Size distribution was determined by a Scanning Electron Microscope
(SEM). The IR spectral studies were conducted by using the pressed pellet technique. In this
technique the prepared nanoparticles were subjected to IR analysis to find the drug-polymer
Page 352

July 9-11, 2012
interaction. The Differential Scanning Calorimetric studies were also performed for the prepared
formulation.
The Zeta potential of nanoparticles was recorded using Zetasizer. The samples which gave
good In-vitro release were subjected to zeta potential analysis.
Biopharmaceutical evaluation:
The in-vivo evaluation of selected formulations was carried out with a view to assess the
pharmacokinetics of absorption and elimination and bioavailability. Formulation batch AP5 in
which, the drug ampicillin and polymer ratio was 1:3 is used for this study. This experiment is
performed in 4 healthy rabbits. The prepared nanoparticle formulation AP5 is administered orally
to all the animals and all the possible pharmacokinetic parameters were determined.
Stability studies:
The nanoparticle formulation AP5 was subjected to the accelerated stability testing to find
their stability and efficacy. Each formulation was divided into three portions of which, one portion
was kept at room temperature, second at 45C and third at 4 C for a period of one month. At
weekly intervals, samples were analyzed spectrophotometrically.
RESULTS
In-vitro Drug Release Characteristics
The different nanoparticle formulations were prepared using changing the drug and
polymer ratio viz 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:3.5 and 1:4. The prepared formulations were
subjected to dissolution studies. The percentage of drug release with respect to the time was
recorded in all these formulations
Table 1 In vitro drug release studies of prepared sepia nano particle
Time
15
min
30
min
1h
2h
4h
8h
12 h
24 h
CUMULATIVE PERCENTAGE DRUG

RELEASE
AP1 AP2 AP3 AP4 AP6 AP7
36.49 37.16 39.91 42.44 43.07 41.67
3.2 2.9 3.8 3.9
4.2 3.9
39.96 42.12 43.01 49.71 50.12 47.36
3.7 3.6 4.1 4.8
4.9 4.5
46.06 48.11 50.66 53.49 54.60 53.19
4.2 4.3 4.8 5.2 5.2 5.2
51.55 56.61 59.11 61.44 59.96 59.12
4.9 5.3 5.6 6.1 6.1 5.7
57.99 59.19 61.19 63.61 61.39 63.19
5.3 6.1 5.9 6.2 6.2 6.2
65.67 67.91 69.66 70.16 70.12 69.96
6.1 6.5 7.1 6.9
6.9 6.8
72.11 73.02 74.17 75.99 76.47 74.12
6.8 6.9 7.3 7.4
7.3 7.3
77.14 79.49 80.19 84.05 79.01 80.71
7.3 7.6 7.9 8.3
7.6 8.1
In the ampicillin nanoparticles, upon increasing the concentration of the polymer, the
increased drug release was observed in the drug and polymer concentration of 1:3. On the other
Page 353

July 9-11, 2012
hand, the release rate was found slowly decreasing at a drug-polymer concentration of 1:4. Further,
AP5 is considered to be an ideal formulation as 88% drug release was observed in this formulation
at the 24th h
Drug entrapment studies
Table 2 Determination of the drug content of the prepared sepia nanoparticles (ampicillin)
SNO BATCH DRUG
CODE
CONTENT
PERCENTAGE
1.
AP1
58.170.11
2.
AP2
61.730.14
3.
AP3
60.170.09
4.
AP4
58.130.11
5.
AP5
62.130.12
6.
AP6
53.120.11
7.
AP7
59.150.13
In the ampicillin nanoparticle formulation, above 52 % drug got entrapped and the AP5
formulation with the good release profile showed 62.13 % of drug entrapment. The formulation
AP5 was subjected to zeta potential analysis in order to find their surface charge and the obtained
values in this regard was found to be 52 mV.
Biopharmaceutical parameters:
Table 4.Biopharmaceutical parameters of ampicillin-loaded sepia nanoparticles
S.No
1.
2.
3.
4.
5.
6.
7.
Parameters
Absorption Constant (Ka)
Elimination Constant (Ke)
Half life (t)
Tmax
Apparent
volume
of
distribution (Vd)
Cmax
AUC
Values
0.0133
0.0034
15.13h
52.10h
77 l
95mg/ml
18.70mg/ml
For the formulation AP5, an amount of 1.75 g/ml was found to be released when
experimentation was done in the serum blood samples of rabbits1. A maximum drug release was
at a concentration of 3.18 g/ml at the 24th h. After that, the elimination started and at the 72nd h,
and the plasma drug concentration was 0.82g/ml.
Page 354

July 9-11, 2012
Table 3
Serum concentration (g/ml) of ampicillin

time
animal 1
animal 2
animal 3
animal 4
Average
15 Min
1.90 0.06
1.80 0.07
1.72 0.06
1.6 0.07
1.75
30 Min
2.12 0.07
2.09 0.06
1.90 0.07
1.70 0.08
1.95
1h
2.25 0.06
2.22 0.07
2.10 0.08
1.90 0.07
2.12
2h
2.30 0.06
2.40 0.08
2.30 0.09
2.22 0.08
2.30
4h
2.650.06
2.75 0.08
2.60 0.08
2.56 0.07
2.64
8h
2.850.08
2.900.07
2.850.09
2.730.07
2.83
12 h
3.050.07
3.150.09
3.100.1
2.920.08
3.05
24 h
3.200.08
3.300.09
3.200.1
3.050.1
3.18
36 h
2.900.06
3.650.1
3.000.1
2.960.09
2.97
48 h
1.500.09
2.800.09
2.950.09
2.750.09
2.5
72 h
0.550.06
1.000.06
0.900.06
0.83
0.82
The pharmacokinetic parameters evaluated showed that the values of AUC, ka, ke, t1/2 and
Cmax were at 18.7013, 0.0133per hr, 0.0034per hr, 15.13hrs and 95 respectively.
From the In-vitro data obtained, it is clear that the drug release was in sustained manner in
a period of time from 15min to 72h. Hence, the above formulations experimented are considered
as ideal formulations.
Stability testing (ampicillin)
Table 5
Stability testing studies of Ampicillin nanoparticles at room temperature

Week
0
1st Week
2nd Week
3rd Week
4th Week
% of Drug % of Drug % of Drug

Remaining Remaining Remaining
(Room
(4C)
(45C)
Temp.)
100
100
100
99.50
100
100
98.50
99.5
99
95.7
98
97
94.6
97.7
96.1
The stability studies were performed for AP5 as per ICH guidelines. This formulation was
packed in screw capped bottles and was stored at different temperatures viz. room temperature, 45
C and 4 C for one month and the samples were analyzed at weekly intervals.
The accelerated stability studies were also performed for the ampicillin nanoparticles
(AP5) and it was found that there was no change in the concentration of these drugs at room
Page 355

July 9-11, 2012
temperature and at 40C during the first week of storage. But at a storage temperature 45 C, the
degradation was found to start and the values of concentration of the drugs during the first and
second week were 99.50 % and 98.50 % for AP5. The values of concentration of the drug in the
formulation AP5 at the 4th week in room temperature, 4 C and 45 C were 96.1 %, 97.7 % and
94.6% respectively. Further, all the formulation AP5 was found to be stable on prolonged storage.
Size analysis of nanoparticles
The formulations which showed good release profiles were subjected to size analysis
using Scanning Electron Microscope (SEM). The size of the nanoparticles of Ampicillin was
found to be 1000 nm.The nanoparticles prepared and used for the present research work were
within the size range (1-1000 nm) of nanoparticles prepared and experimented in earlier works.
Fig 2 SEM Photograph of ampicillin -loaded sepia nanoparticles

DISCUSSION
Studies have been carried out on the preparation of nanoparticles with ink of cuttlefish
(sepia) belonging to the marine mollusk, Sepia officinalis with an objective of designing and
developing nanoparticles for oral administration for sustained release of ampicillin . For the
present research work, the ink of cuttlefish, Sepia officinalis was selected as a carrier material with
the preparation of the nanoparticles by controlled gellification method and was evaluated for their
size analysis, entrapment efficiency, drug release characteristics, zeta potential and drug polymer
interaction with DSC and FTIR spectra. The stability of drug release from sepia nanoparticles so
developed was studied under varying selected storage conditions viz. room temperature, 45 C and
4 C as per ICH guidelines. The selected nanoparticle formulation AP5 was subjected to in-vivo
pharmacokinetic parameters viz. elimination rate constant, absorption rate constant, AUC, Cmax,
Tmax and biological half-life. In-vivo drug analysis of these formulations generally showed good
release profile in a sustained manner as detailed below. AP5 formulation showed a drug release of
88% at the 24th hr. The size of the particle in the formulation was 1000 nm.
ACKNOWLEDGEMENT:
The constant support and encouragement given by Dr.D.Ranganayakulu,B.Sc.,M.Pharm., Ph.D.,
ARPS(London), Principal, Sri Padmavathi School of Pharmacy, Tiruchanoor, Tirupati are
gratefully acknowledged. I acknowlegdge Smt. P. Sulochana, M.A., B.Ed., B.L., and
Mr.P.Praneeth, B.Tech., Chairperson and Secretary respectively of Sri Padmavathi group of
educational institutions for their support and encouragement. I owe my sincere gratitude to Dr. C.
Madhusudhan Chetty, M.Pharm., Ph.D., MBA, for his valuable guidance, moral support, friendly
approach and constant encouragement throughout this project work.
Page 356

July 9-11, 2012
REFERENCES
1
2
3
4
5
6
Gopalakrishna Moorthy, C. Mayuren and B.S. Reddy, A study of acute pharmacokinetic

interaction of ramipril and glipizide in normal rabbits, Adv.Pharm.Toxi., 10, 175-179.
Kavimani,S., Chitosan as a Pharmaceutical excipient, Eastern Pharmacist, 3, 1998, 4749.
Lower and Edger, Polymers from sea; Chitin and chitosan, Manufacturing Chemist, 9,
1984, 74-75
Mullaicharam, Barish, S. Kuppusamy, S. Humathunissa and R. Uma Maheswari,
Evaluation of nanoparticles containing Clarithromycin and its tissue distribution studies,
Indian Pharm., (2006) 85-89.
Nakato Lewis, Melanin and Bio nanotechnology www.blackherbals.com, (2006).
Nosanchok Joswa.D., Impact of melanin on microbial virulence and clinical resistance to
Antimicrobial compounds, Anti microbial Agents and Chemotherapy, 50 (2006) 35193528.
Potsch.L., G.Skopp and G.Rippin, A comparison of 3H-cocaine binding on melanin
granules and human hair invitro, Int.J.Legal Medi., Vol.110 (1997) 55-62.
Sangeetha, Shanmuga Sundaram, D.Nagasamy Venkatesh, R.Adhiyaman, Santhi and

B.Suresh, Formulation of sodium alginate nanosphere containing Amphotericin-B for the
treatment of systemic-candidess Topical. J.Pharm. Res., 6(1)(2007) 653-659.
9 Sangeetha, K.Santhi, D.Nagasamy Venkatesh, M.K.Samanta, G.N.K.Ganesh,
S.A.Dhanaraj and B.Suresh, Formulation, invitro and in-vivo characterization of sodium
alginate nanospheres containing fluconazole, Adv.Pharmacol.Toxicol., 8(3)(2007) 51-58.
10 Satyakumar and Srinivasa babu, A review on nanotechnology:
A new approach in cancer therapy, PharmaTimes, 38 (4) 2006,17-20.
Page 357

July 9-11, 2012
STO135-15
Luminescence of Beryllium heat treated corundum

Bhuwadol Wanthanachaisaeng 1, Nantharat Bunnag2, Chakkaphan Sutthirat3,4,
Wilawan Atichat4, Papawarin Ounorn4, Tasnara Sripoonjan1,3,
1
Gems Enhancement Research Unit, Faculty of Gems, Burapha University, Chanthaburi Campus,
Chanthaburi, 22170, Thailand
2
Faculty of Gems, Burapha University, Chanthaburi Campus, Chanthaburi, 22170, Thailand
3
Department of Geology, Faculty of Science, Chulalongkorn University, Bangkok, 10300,
Thailand
4
The Gem and Jewelry Institute of Thailand (GIT), Bangkok, 10500, Thailand
Email: bhuwadol@yahoo.com
ABSTRACT
Corundum is a famous gem in jewelry market. The quality of the corundum depends on
clarity and color. There are many heat treatment methods to enhance the color of corundum. A
traditional way is to only treat the gemstones with high temperature to improve. Nowadays,
chemical flux is also used in the heating process. Beryllium (Be) has been mixed with the flux for
the very high temperature treatment. By this method, the enhanced stones appear brighter and
yellowish brown color. Examining the Be heat treated corundum needs the advanced instruments
which requires the gem samples to be destroyed. In this study, the luminescence
spectrophotometer was applied to indicate the contamination of the Be in the heat treated
corundum. Melted area on the surface of the Be treated corundum showed the luminescence
spectra of chromium in the difference structure of corundum. The extra spectrum should be
because of the melting of BeO and Al2O3 mixture. The luminescence method successfully
identified the beryllium heat treated corundum which has the remnant of melted area on the
surface.
Keywords: Corundum, Heat treatment, Beryllium, Luminescence
INTRODUCTION
Nowadays, the corundum (Al2O3) still be an important gems in the jewelry market because
of the durability, hardness, and colorful. In nature, the gem quality with valuable color is rare.
Almost of its have to be heat treated to enhance the color of the stone. A traditional way is to only
treat the gemstones with high temperature to improve. Normally, chemical flux is also used in the
heating process such as borax, lead glass and some light elements. Beryllium (Be) has been mixed
with the flux for the very high temperature treatment. It is also a major element in chrysoberyl
(BeAl2O4) that can be found associate with the sapphire in some origin. The first experiment of the
Be treated corundum was an accident of the mixed of chrysoberyl in corundum crucible in the heat
treatment process. The Be element from chrysoberyl has been diffused in to the corundum lattice
and enhance the color of the corundum. Then, the heaters did the investigation of the Be element
in the heat treatment process until they success. The process of heating is until now undisclosed by
the heaters. In addition, the Be flux in the heating process is a toxic which the heater has to be
careful while operating.
Be element is in the alkaline earth column in the periodic table. It is not easy to be
analyzed by the non-destructive advance instrument such as Raman spectroscopy, FTIR
spectroscopy and UV-Vis NIR spectrophotometer. The Laser Ablation Inductively Coupled
Plasma Mass Spectrometry (LA-ICP-MS) and Laser Induced Breakdown spectroscopy (LIBS) are
Page 358

July 9-11, 2012
usually used to analyze the amount of Be on the surface of the treated corundum. The disadvantage
of these instruments is the destruction of the sample by the laser ablation.
Corundum
1.0
Intensity (a.u.)
0.8
0.6
0.4
0.2
0.0
680
685
690
695
700
705
710
Wavelength (nm)
3+
Fig. 1 Luminescence spectrum of Cr in the corundum structure.

Commonly, the chromium is a major trace element in corundum. When there is much
more enough amount, it is a cause of red color which can be called ruby. The other sapphire can
also be contained a small amount of chromium. It is the cause of luminescence in corundum
structure. The chromium emission lines at around 692.4 and 694.2 nm can be observed in the
luminescence spectrum of the corundum (Nelson and Sturge, 1965; Wanthanachaisaeng et.al,
2006). The intensity depends on the concentration of chromium in the corundum (Fig. 1). The
melting point of corundum is 2050oC. The chromium can be also a trace element in chrysoberyl.
When there is much more enough, it can be showed the color change which can be call
Alexandrite. The melting point of chrysoberyl is 1870oC The luminescence of the chromium
structure shows the difference pattern when comparing to the corundum because of the difference
crystal system (Trindade et al., 2011). These luminescence spectrums have been compared by
Nasdala et al. (2004).
With the Be heat treatment at high temperature, the melted surface of the corundum can be
presented various of mineralizers (Bukin et al., 1981; Alimpiev et al., 2002). Then, the
luminescence spectrophotometer has been used in this study to investigate the phase change at
high temperature of the Be treated corundum.
The corundum (green sapphire) from Bangkacha, Chanthaburi was used in this study.
The stone was polish in to a tablet perpendicular to the optic axis (Fig. 2). It was heated at
high temperature by the heater in Chanthaburi with the mixed Be flux. The sample was heated
in the electric oven with the temperature more than 1600oC for 168 hours (personal
communication with the anonymous heater in Chanthaburi). The Renishaw RM100 Raman
spectrometer equipped with Leica DMLM optical microscope, a grating with 1200 grooves per
mm, and a Peltier-cooled charge-coupled device detector with Ar-ion laser wavelength of 488
nm was used to investigate the luminescence of the heated corundum.
Page 359

July 9-11, 2012
Fig. 2 The Be treated sapphire from Bangkacha, Chanthaburi

RESULTS
The unheated green sapphire from Bangkacha was used to investigate in this study.
Normally, the luminescence of R1 and R2 emission peaks of corundum at the room temperature
are at 694.2 and 692.8 nm (Wanthanachaisaeng, 2007). The luminescence of chromium in
chrysoberyl structure has also presented in figure 3. After the Be heat treated, some part of the
stone turn to yellow color by the influence of Be diffusion (Pisutha-Arnond et al., 2004). With the
high temperature heated, some part at the surface of the stone showed the melted surface which
should be the recrystallization between the Be flux and corundum host at high temperature (Fig.
2). The luminescence spectrophotometer has been applied to investigate this melting part at the
surface of the stone to investigate the phase change after heat treatment. Not only the R1 and R2
emission peaks of corundum structure, but the extra luminescence spectrum emission also showed
the broader peaks at 678.8 and 683.4 nm (Fig. 3).
Chrysoberyl
Be treated corundum
Corundum
1.0
Intensity (a.u.)
0.8
0.6
0.4
0.2
0.0
660
670
680
690
700
710
720
Wavelength (nm)
Fig. 3 Luminescence spectrum of chrysoberyl and corundum compared to the Be heat treated
corundum at the melted surface
DISCUSSION
From the report of Atichat et al. (2008), they reported that the investigation of the
beryllium-treated sapphire from Ilakaka, Madagascar by the Luminescence spectroscopy detected
the three emission peaks at 688.9, 691.2 and 693.2 nm at the recrystallization on the surface which
is not the normal luminescence spectrum from the Cr3+ in the corundum structure. These result is
still under investigation to explain the extra peak after the Be heat treated. Also the Be treated
corundum in this study, emission significant peaks at 678.8 and 683.4 nm have been detected at
the melting surface instead (Fig. 3).
Page 360

July 9-11, 2012
In the Be treated heating process, the beryllium diffused into the surface of Al2O3 structure
at high temperature and at the surface of the host would be gradually transform to the BeO+Al2O3
mixture phase. Because of the reaction at high temperature (more than 1600oC) between Be flux
and the host corundum (Bukin et al., 1981), the BeO-Al2O3 compound melted at the surface of the
stone. The recrystallization of the melting surface was just a short time cooling to room
temperature. Therefore, the Cr3+ trace element was alternated to BeO-Al2O3 compound structure
(orthorhombic structure) at the surface and some part still showed the luminescence peaks of
corundum (Trigonal structure). As it is shown in the figure 3, however, the peaks at 678.8 and
683.4 nm are broader peaks when compared to the luminescence peaks of crystalline chrysoberyl.
This result indicates that melted surface of the BeO-Al2O3 compound at Be heat treated corundum
surface is not yet fully recrystallization because the final process of the heating, the stone must be
taken out of the oven at high temperature immediately. The phase identification of the melted
surface is still under investigation.
CONCLUSION
Because the problem to identify the Be heat treated corundum in the market has to use the
advance instrument that has to destroy the sample, the luminescence technique can be used to
indicate the Be treated corundum if there still has the remnant of the recrystallization at the surface
of the stone without damaging the gemstone.
ACKNOWLEDGEMENTS
We are grateful to L. Nasdala and C. Lenz for their support with the luminescence
spectrophotometer. The work is supported by a grant from the Gem and Jewelry Institute of
Thailand (GIT).
Page 361

July 9-11, 2012
REFERENCES
Alimpiev, A.I., Merkulov, A.A., Solntsev, V.P., Tsvetkov, E.G., Matrosov, V.N., and
Pestryakov, E.V., 2002. Growth and crystal structure of the BeAl6O10 single crystals.
Journal of Crystal
Growth. Vol. 237-239. pp. 884-889.
Atichat, W., Somboon, C., Leelawhatanasuk, T., Pisutha-Arnond, V., Wathanakul, P.,
Sutthirat, C., Sriprasert, B., and Jakkawanviboon, J., 2008. Beryllium-treated lightcolored sapphires from
Ilakaka. The 2nd International Gem and Jewelry Conference (GIT2008), Bangkok.
Bukin, G.V., Matrosov, V.N., Orekhova, V.P., Remigailo, Yu.L., Sevastyanov, B.K.,
Syomin, E.G., Solntsev, V.P., and Tsvetkov, E.G., 1981. Growth of alexandrite crystals
and investigation of
their properties. Journal of Crystal Growth. Vol. 52, pp. 537-541.
Nasdala, L., Gotze, J., Hanchar, J. M., Gaft, M., and Krbetschek, M.R., 2004.
Luminescence techniques in earth sciences. EMU note: Spectroscopic Methods in
Mineralogy. European
Mineralogical Union. Vol. 6. 43-92.
Nelson, D. F. and Sturge M. D., 1965. Relation between absorption and emission in the
region of the R line of ruby. Physical Review. Vol. 137 (4A). 1117-1130.
Pisutha-Arnond, V., Hger, T., Eathanakul, P., Atichat, W., Yellow and brown coloration
in beryllium treated sapphire. Journal of Gemmology, London, Uk. Vol. 29 (2). 77-103.
Trindade, N. M., Tabata, A., Scalvi, R. M. F., and Scalvi, L. V. A., 2011. Temperature
dependent luminescence spectra of synthetic and natural alexandrite (BeAl2O4: Cr3+).
Materials Sciences and Applications. Vol. 2 (4). 284-287.
Wanthanachaisaeng, B., 2007. The influence of heat treatment on the phase relation in
Minerals growth system. Dissertation, University of Mainz. 79 p.
Wanthanachaisaeng, B., Hger, T., Hofmeister, W., and Nasdala, L., 2006. Raman-und
fluoreszenz-spextroskopische Eigenschaften von Zirkon-Einschlssen in chrom-haltigen
Korundum aus Ilakaka und deren Vernderung durch Hitzebehandlung. Zeitschrift der
Deutschen Gemmologischen Gesellschaft. Vol. 55, 119-132.
Page 362

July 9-11, 2012
STO53-16
Dispersion of CuO/SiO2 Nanocomposites by Microwave and

Conventional Drying Processes
Saisamorn Niyomsoana, Sanya Prangsri-aroonb, Pinsuda Viravathanab
a
Faculty of Gems, Burapha University, Chanthaburi 22170
b
Department of Chemistry, Faculty of Science, Kasetsart University, Bangkok 10900
E-mail: saisamor@buu.ac.th
ABSTRACT
Dispersion of CuO/SiO2 nanocomposite powders was studied. The powders were
synthesized by incipient wetness impregnation of CuO onto silica (Aerosil) nanoparticles. The asprepared 20wt% and 50wt% Cu loading samples were dried by three different processes:
conventional drying, sonication prior to conventional drying and microwave drying.
Characteristics of the powders were investigated using XRD, TEM and SEM. XRD patterns
showed an evidence of CuO in all samples. Average grain sizes of CuO crystallites calculated by
Scherrers equation were 23.1 nm and 26.3 nm for 20wt%Cu and 50wt% Cu, respectively. SEM
and TEM results revealed that the microwave drying significantly improved the dispersion of the
CuO/SiO2 nanocomposite powders. Moreover, cylindrical CuO crystallites were observed in the
samples prepared with microwave drying and sonication prior to conventional drying.
Keywords: microwave drying, CuO/SiO2 nanocomposite powder, nanoparticle dispersion,
incipient wetness impregnation
INTRODUCTION
Nanoparticles or nanocomposite powders containing metal oxide supports have been
intensively investigated due to their various interactions among different phases and their wide
range of potential applications, including catalysis, electronics and composites (Wu et al., 2000;
Gonella et al., 2001; Jianga et al., 2005). Development of synthesis methods for precisely
controlling the particle size with high dispersion and narrow size distribution is imperative.
Microwave was recently employed in the many catalyst preparation processes such as Mo
based and Pt based catalysts (Qi et al., 2004; Volanti et al., 2008; Mediavilla et al., 2010). The
microwave-assisted methods enhance catalytic performance. The higher activity is related to the
lower particle size and better dispersion of metal nanoparticles.
The present work studied influences of drying processes on dispersion of CuO/SiO2
nanocomposites. Microwave drying was employed in comparison with conventional drying.
Moreover, effects of sonicaition prior to conventional drying were also studied. XRD, TEM, SEM
equipped with EDX were used to characterize the nanocomposite powders.
CuO/SiO2 nanocomposite powders were synthesized by incipient wetness impregnation. The
aqueous solutions of Cu(NO3)3H2O with 20wt% and 50wt% Cu loadings were prepared by using
silica (Aerosil) nanoparticles as support. The mixtures were stirred for 1 h to obtain homogeneity.
The impregnated samples were subsequently dried with three different methods; (i.) oven drying in
air at 110 oC for 12 h (Conventional drying); (ii.) sonicating followed by oven drying in air at
110 oC for 12 h (sonication prior to conventional drying); (iii.) drying in a microwave oven at 50%
Page 363

July 9-11, 2012
power (800 W) for 120 seconds (microwave drying). All samples were then calcined in air at 400
o
C for 24 h. as Phase composition of the powders was determined by X-ray diffraction using
CuK radiation of 1.5418 (40kV and 30 mA). Powder morphology and dispersion were
observed by transmission electron microscopy and scanning electron microscopy equipped with
energy dispersive X-ray (EDX) facilities. Element mapping was performed to show elements
distribution.
RESULTS
XRD analysis
The XRD patterns of all five samples revealed CuO polycrystalline (Fig.1), which is
attributed to the monoclinic phase of Tenorite (CuO) structure (JCPDS 05-0661). Typically,
copper oxide exhibits two most intense diffraction peaks at 2 = 35.5 and 38.7 corresponding to
the (
) and (111) lattice planes, respectively. The sharp and intense peaks in the XRD patterns
indicate good crystallinity of CuO. No peak of impurity was detected.
The peak intensities of the CuO increased with increasing % Cu loading indicating a high
degree of crystallization and the growth of nanocrystallites. Meanwhile, the average crystallite site
of the CuO nanoparticles was calculated, according to Scherrers formula, from the full width at
half maximum (FWHM) of the major diffraction peaks. The average crystallite sizes of the
samples with 20wt% and 50wt%Cu loading were 23.1 nm and 26.3 nm, respectively (Table 1).
The crystallite sizes of CuO increased with increasing % Cu loading.
Fig. 1 XRD patterns of CuO nanoparticles; (a) 20wt% Cu with conventional drying; (b) 20
wt% Cu with sonication prior to conventional drying; (c) 20wt% Cu with microwave drying;
(d) 50wt%Cu with conventional drying; and (e) 50wt%Cu with microwave drying.
SEM analysis
After calcinations, morphology of CuO crystallites grown on SiO2 support with different
drying methods was revealed in SEM images (Fig. 2).
Page 364

July 9-11, 2012
Table 1 CuO crystallite sizes calculated by the Scherrers equation.
Drying conditions
Crystallite sizes (nm)
Conventional drying
20wt%Cu
50wt%Cu
22.8
26.6
Sonication prior to conventional

drying
23.1
Microwave drying
23.5
25.9
(a)
(b)
Fig. 2 SEM images of CuO/SiO2 nanocomposite powders prepared at 20wt%Cu loading with (a)
conventional drying; (b) sonication prior to conventional drying; and (c) microwave
drying.
Page 365

July 9-11, 2012
With conventional drying process, the morphology of as-calcinated CuO/SiO2
nanocomposite showed no aggregation and the element mapping by SEM-EDX revealed the
uniform distribution of CuO on silica particles. With sonication prior to conventional drying and
microwave drying processes, cylindrical shape of CuO crystallites on silica support was observed
indicating the aggregation of CuO crystallites in the preferred directions.
TEM analysis
Texture and morphology of CuO/SiO2 nanocomposites were also examined by TEM
(Fig.3). With conventional drying process, large cluster of the nanocomposite particles were
observed. Particles dispersion was improved in the samples prepared by sonication and microwave
drying. However, microwave drying induced more uniform dispersion where the cluster size was
smallest.
50wt%Culoading
drying
to Conventional
Sonication prior
Conventional
20wt%Cu
Microwave
100nm
Fig. 3 TEM images (100000X) of CuO/SiO2 nanocomposites prepared with different methods.
DISCUSSION
CuO crystallites deposited on SiO2 particles forming CuO/SiO2 nanocomposites. With
higher %Cu loading, dispersed CuO crystallites gained higher probability of aggregation and
formed larger crystallites.
In the sonication prior to conventional drying and microwave drying process, the CuO
crystallites agglomerated into rod shapes. Moura et al. (2010) revealed that agglomerated CuO has
the preferential growth direction; [001] zone axis. The microwave heating time played an
important role in the structure evolution during the aggregation mechanism, which was described
by a process of self-assembly; many individual primary nanoparticles were attracted to each other
to form the secondary structures, which were stabilized by the steric interaction (Guo et al. , 2012).
The results confirmed the CuO aggregations in the preferred orientation.
Page 366

July 9-11, 2012
Isayev et al., (2009) and Barkade et al. (2011) showed the ultrasonic effects on enhancing
the dispersion ability of nanoparticles in the matrix of nanocomosites. The excellent distribution of
nanoparticles was also observed in the nanocomposite matrix with the microwave assisted
synthesis.(Soto et al., 2011 and Tsai et al., 2012).
In agreement with the literatures, the study showed that the sonication and microwave
heating induced the more uniform distribution of the nanocomposite particles comparing with the
conventional process. The dispersion of Cu/SiO2 nanocomposite powders was more efficient in the
microwave drying process, because of the rapid volumetric heating.
ACKNOWLEDGEMENTS
The authors would like to thank Faculty of Gems, Burapha University for financial
funding. The authors gladly acknowledge Department of Chemistry, Faculty of Science and
Department of Materials Engineering, Faculty of Engineering at Kasetsart University and National
Metal and Materials Technology Center for their support on all facilities used in the study. Also,
the assistance on materials preparation from Pattaraporn Supolthavanitch is gratefully appreciated.
Page 367

July 9-11, 2012
REFERENCES
Barkade, S. S., Naik, J. B., Sonawane, S. H. 2011. Ultrasound assisted miniemulsion synthesis of
polyaniline/Ag nanocomposite and its application for ethanol vapor sensing. Colloids and Surfaces
A: Physicochem. Eng. Aspects 378: 9498
Gonella, F., Cattaruzza, E., Battaglin, G., DAcapito, F., Sada, C., Mazzoldi, P., Maurizio, C., Mattei, G.,
Martorana, A., Longo, A. and Zontone, F. 2001. Double implantation in silica glass for metal
cluster composite formation: a study by synchrotron radiation techniques. Journal of NonCrystalline Solids 280: 241-248.
Guo, L., Tong, F., Liu, H., Yang, H., Li, J. 2012. Shape-controlled synthesis of self-assembly cubic CuO
anostructures by microwave. Materials Letters 71: 3235.
Isayev, A.I., Kumar, R., Lewis, T. M. 2009. Ultrasound assisted twin screw extrusion of polymer
nanocomposites containing carbon nanotubes. Polymer 50: 250260.
Jianga, J.S., Yang, X.L., Gao, L. and Guo, J.K. 2005. Nanastructured CuO- -Fe2O3 solid solution
obtained by high-energy ball milling. Materials Science and Engineering A392: 179-183.
Moura, A.P., Cavalcante, L.S., Sczancoski, J.C., Stroppa , D.G., Paris , E.C., Ramirez , A.J., Varela , J.A.,
Longo, E.. 2010. Structure and growth mechanism of CuO plates obtained by microwave-hydrothermal
without surfactants. Advanced Powder Technology 21: 197202.
Mediavilla, M., Morales, H., Melo, L., Sifontes, A.B., Albornoz, A., Llanos, A., Moronta, D., Solano, R.
and Brito, J.L. 2010. Microwave-assisted polyol synthesis of Pt/H-ZSM5 catalysts. Microporous
and Mesoporous Materials 131: 342-349.
Qi, S. and Yang, B. 2004. Methane aromatization using Mo-based catalysts prepared by microwave
heating. Catalysis Today 98: 639-645.
Soto, G., Tiznado, H., Contreras, O., Prez-Tijerina, E., Cruz-Reyes, J., Del Valle, M., Portillo, A. 2011.
Preparation of a Ag/SiO2 nanocomposite using a fluidized bed microwave plasma reactor, and its
hydrodesulphurization and Escherichia coli bactericidal activities. Powder Technology 213: 5562
Tsai, C.-H., Yang, F.-L., Chang, C.-H., Chen-Yang, Y. W. 2012. Microwave-assisted synthesis of silica
aerogel supported pt nanoparticles for self-humidifying proton exchange membrane fuel cell.
International Journal of Hydrogen Energy 37: 7669-7676
Volanti, D.P., Keyson, D., Cavalcante, L.S., Simoes, A.Z., Joya, M.R., Longo, E., Varela, J.A., Pizani,
P.S. and Souza, A.G. 2008. Synthesis and characterization of CuO flower-nanostructure processing
by a domestic hydrothermal microwave. Journal of Alloys and Compounds 459: 537-542.
Wu. J.M. and Li, Z.Z. 2000. Nanostructured composite obtained by mechanically driven reduction
reaction of CuO and Al powder mixture. Journal of Alloys and Compounds 299: 9-16.
Page 368

July 9-11, 2012
STO122-17
The connection between the quadratic nonlinear Schrdinger and the

Schamel equation via the Madelungs fluid
1
Sarun Phibanchon1 and Michael Allen2

Faculty of Science and Arts, Burapha University 57 M. 1 Thamai, Chanthaburi, 22170, Thailand
2
Physics Department, Mahidol University Rama 6 Road, Bangkok, 10400, Thailand
E-mail: sarunp@buu.ac.th
ABSTRACT
The connection between the quadratic nonlinear Schrdinger equation and the Schamel
equation is made within the context of Madelungs fluid. The time evolution of the envelope solitary
wave and the collision between two envelope solitary waves is investigated numerically via the
spectral method as well as.
Keywords: plasma physics, solitons, spectral methods, Madelungs fluid
INTRODUCTION
The solitary wave is the remarkable phenomena which is observed in various continuous
media such as waters (Infeld et.al. 2000) or plasmas (Washimi et.al. 1966,Schamel, 1973). The wave
travels without changing its amplitude due to the balance of the nonlinear and dispersion effects in the
media. The most well-known solitary wave is described by the Korteweg-de Vries (KdV) equation,
where subscripts t and x denote the partial derivative with respect to temporal and spatial
coordinates, respectively. n represents the deviation from the equilibrium of some physical contexts
such that density or height. The second term on the left hand side represents the nonlinear effect while
the last term is for dispersion. In the case of a cold-ion plasma with free electrons and electrons
trapped by the ion-acoustic waves, Schamel (1973) proposed that these two types of electrons have a
different temperatures and can derived what is now known as the Schamel equation,
(1)
The cubic nonlinear Schrdinger (cNLS) equation is another nonlinear PDE which admits
solitary wave solutions. It is the most useful equation in telecommunications and fibre optics and takes
the form
Page 369

July 9-11, 2012
Also the KdV and cNLS equations are derived from different physical contexts the two are
connected via the Madelungs fluid picture (Fedele et al., 2002). We will apply this technique to obtain
the connection between the Schamel equation and quadratic NLS (qNLS) equation,
(2)
This is done in the next section. The solitary wave solution of the qNLS will be derived in the
third section. In the fourth section, the time evolution of the solitary wave and solitary wave collisions
will be investigated via the spectral method.
Basics equations
The Madelung fluid or Madelung equations are alternative formulations of the Schrdinger
equation. We use this technique to write the qNLS equation in terms of the fluid Euler equations. To
obtain these equations, we start by writing the solution of (2) as
where
is the Madelungs fluid density. After substitute this solution back into (2), the
equations for the real and imaginary parts for the fluid-governing equations can respectively be written
as
(3)
(4)
in which V is the current velocity given by
Transformation from the quadratic NLSE to Schamel equation

To derive the travelling wave Schamel equation from the qNLS equation via the Madelungs
fluid equations, we first multiply (3) by V. This gives
(5)
After multiplying (4) by we have
Page 370

July 9-11, 2012
(6)
The last term on the right hand side of (6) can also be rewritten as
and
Eq. (6) is now rewritten as

(7)
From (5) and (7), we obtain
(8)
To eliminate the last term on the right-hand side of (8), we first integrate (4) with respects to x to give
where c(t) is an arbitrary function. Adding this result multiplied by
to (8) gives
(9)
This is the travelling wave Schamel equation.

Travelling wave solution
The solution of (9) is also the solution of the qNLS. To obtain the result the current velocity is
assumed to be a constant
which implies that
and c(t)=c0. The continuity equation (3) can now be rewritten as
To find the travelling wave solution we introduce
From (9) we have
Page 371
. Then

July 9-11, 2012
We now rewritten this in terms of :

(10)
This is the Schamel equation, (1), for the travelling wave solution. We then obtain the solitary wave
solution of the qNLS equation,
where
is an arbitrary constant. The envelope soliton is now

(11)
Numerical results
We apply the spectral method to study the time evolution of the solitary wave solution, (11).
We first take the Fourier transform of the qNLS equation over the spatial coordinate,
(12)
where F denotes the Fourier transform operator,
in which N is the number of mesh points in the x direction, xl=lLx/N , Lx is the length of the domain in
the x directions, and p=2p/Lx for p=0,,N-1. We introduce the integrating factor, ,
Then (12) becomes
The 4th order Runge-Kutta method (Press et.al. 1992) was used for the time derivative. The
initial conditions used were
where x0 denotes the starting point. The time evolution of this envelope solitary wave is shown in Fig 1
Page 372

July 9-11, 2012
Fig. 1 Time evolution of

envelope soliton with V0=2.0, =0.2: (a) t=0.0, (b) t=8.0, (c) t=12.5, (d)
t=17.5, (e) t=22.5, (f) t=30.0.
in which Lx = 150 , N = 256 , t = 0.0001 and x0 = -20 . We will now investigate the collision between
two envelope solitary waves. The initial condition is now
The
numerical
result
is
shown
in
Fig
where
2=0.35,
V02=5.0
and
x02=-60.
Fig. 2 The collision between two solitary waves: (a) t=0.0, (b) t=8.0, (c) t=12.5, (d) t=17.5, (e) t=22.5,
(f) t=30.0.
Page 373

July 9-11, 2012
CONCLUSION
The connection between two equations which admit solitary wave solutions can be made
via the Madelungs fluid picture. This implies that we can apply this to other generalizations
of the cNLS equation as well.
Page 374

July 9-11, 2012
REFERENCES
Fedele, R., Schamel, H. and Shukla, P.K. 2002. Solitons in the Madelung's Fluid. Phys.Scr. T98: 18-23
Infeld, E. and Rowland, G. 2000. Nonlinear Waves, Solitons and Chaos, 2nd edn. Cambridge University
Press, Cambridge
Press, W.H., Teukolsky, S.A., Vetterling, W.T. and Flannery, B.P. Numerical Recipes in C, 2nd edn.
Cambridge University Press, Cambridge
Schamel, H. 1973. A modified Korteweg-de Vries equation for ion acoustic waves due to
resonant electrons. J. Plasma Phys. 9: 377 -87
Washimi, H. and Taniuti, T. 1966. Propagation of ion-acoustic solitary waves of small
amplitude.Phys. Rev. Lett. 17: 996-8
Page 375

July 9-11, 2012
STO70-18
Increasing the heating value of tar by using catalytic
Borisut Chantrawongphaisal, Arunee Chaisawat, Apichat Junsod, Satta Watanatham,

Pichai Wongharn, Pravit Thapnui, Phongsak Hongcharoensri
Thailand Institute of Scientific and Technological Research, Technopolis, Klong5, Klong Luang,
Pathumthani, 12120, Thailand,
Email: borisut@tistr.or.th
ABSTRACT
This paper mainly presents an increasing the heating value of tar by the distillation process
with different catalytic. Tar is undesirable product from gasification process because of the
various problem associated with condensation of tar aerosols and polymerization to form more
complex structure due to its high viscosity and ignite- retardant but its high heating value about 24
MJ/kg. TISTR has developed the catalyst to reduce viscosity and upgrading of tar. The product of
distillation process have a potential to be used as a fuel oil substitute combustion. The process
was carried out at atmospheric pressure and temperature about 330 oC. Catalytic studied were
Ni, Fe, Co and ZSM-5. These catalysts were prepared on activated alumina supporter except
ZSM-5 was prepared from alumino silicate. The results showed that Co as a catalyst to yield at
about 43 percents while Fe, Ni and ZSM-5 as catalyst to yield a 30 percent however Ni and
ZSM-5 increase the heating value of the fuel oil equal to 6,500 kcal / kg while the fuel oil with
the other catalysts have heating value to 6,000 kcal / kg.
Keywords: tar, distillation, catalyst, high heating value, fuel oil
Introduction
Tars are undesirable products in biomass stills because there reduce its efficiencies.
However, it can be used as fuel for their high heating value. Many kinds of biomass gasification
process have been developed treating various materials for different purposes. Chunshan Li et al
[1] present a tar properties overview, analysis, reforming mechanism and biomass gasification
models. They reported interesting works such as the study of Milne et al about a detailed
description of the operational conditions for tar elimination in biomass gasification and a survey
of the effect of the temperature on the tar formation and conversion. In addition, they completed
some previous studies about tar yields. There are mainly five methods (mechanism methods, seltmodification, thermal cracking, catalytic cracking and plasma methods) used to reduce tar
formation during gasification and pyrolysis of biomass [2]. Each method present obviously both
advantages and disadvantages : Mechanism methods only remove or capture tar from product
gases, while the tar energy is lost ; catalytic and thermal cracking process are generally used to
decompose or to reduce tar. Plasma technology can only remove fly ash, NOx and SO2 but also
sharply decrease the formation of tar during biomass gasification. Takeo K. et al [3] investigated
the performance of Ni/CeO2/ Al2O3 catalysts in the steam gasification of cedar wood biomass. The
catalyst was prepared by impregnation and sequential impregnation methods. Results reveal that
Page 376

July 9-11, 2012
of Ni/CeO2/ Al2O3 catalyst prepared by the co-impregnation method present higher tar and coke
removal in the steam gasification of biomass than Ni/ Al2O3 and Ni/CeO2/ Al2O3 prepared by the
sequential impregnation method. Derick G. B. et al [4] performed a comparative analysis on
eleven coal tars produced by former manufactured gas plant sites in the Eastern United States.
Bulk properties as ash content, viscosity, water content and average molecular weight were
analyzed. Concentrations of monocyclic aromatic hydrocarbon (MAH) polycyclic aromatic
hydrocarbon (PAH), alkylated aromatic and of aliphatic as well as aromatic fractions are reported
herein. Results showed notably that the relative MAHS, PAHS and alkylated aromatics
distributions are closed for all coal tars. L.I. Darvell et al [5] investigated alumina-supported
catalysts for a catalytic oxidation of ammonia in biomass gasification. Catalysts as Ni/ Al2O3 and
Cr/ Al2O3 exhibited the highest selective catalytic oxidation activity for temperatures range of
700-900 oC with an excellent N2 selectivity. M. Faundez et al [6] proposed a kinetic model to
describe the catalytic pyrolysis of tar. The model supposed that tars are constituted of high and
heavy tars that are simultaneously cracked to lumped gaseous products, solids carbon and higher
tar. This model is validated through the experimental pyrolysis of three tars with different
characteristics and origins. The discrepancies between experimental data and numerical results are
inferior to 10 %.
The aim of this study was to experimentally investigate the effect of catalyst on bio-fuel
from eucalyptus wood tar distillation. We determine heating values, tar compositions and
properties of oil extracted from this tar. The most important contribution of this paper to fuel oil
researchers is products characterization.
Material
The samples of tar produced by gasification process of the eucalyptus wood from ceramic
factory were used in this experiments. Tar in this process was produced in temperature gasifier
range between 400 to 600C. The high heating value of tar was measured by using a calorific
calorimeter (Parr 6300 calorimeter) and its composition with GC-MS (Varian 450-GC / Varian220-MS) apparatus. The ultimate analysis was analyzed by using Leco truspec CHN.
Experimental
In order to analyze the effect of the catalyst on the eucalyptus wood tar distillation, the
experiments were effectuated with and without catalyst. The hot vapors produced in its boiling
point are immediately channeled into a condenser (Figure 1). The distillate is analyzed using a
calorific calorimeter (Parr 6300 calorimeter) for high heating value and the ultimate analysis by
using Leco truspec CHN and flash point was measured with APM-7 PENSKY-MARTENS
CLOSED CUP TEST UNIT.
Catalyst preparation
A 5 gram of alumina (Al2O3) were mixed with 20 ml of 1 molar of catalytic metal (
Fe2SO4, NiCl2, CoCl2 ). We used Al2O3 because its function as catalyst and its note that Al2O3
has surface area 350 m2/g. The mixture is dried in an electrical oven at a temperature of 60 oC
for12 hours until its moisture content reaches value of about 10-15 % (dry basis). Then, the
Page 377

July 9-11, 2012
mixture was carbonized in chamber furnace at a temperature of 400 oC for 30 min. ZSM-5 was
prepared with 20.05 SiO2: 0.06 Al2O3: 5.71 Na2O: 2,817H2O : 1 TPABr (tetrapropylammonium
bromide): 0.01 Fe2O3 and the mixture was dried at 105 oC, then calcined at 600 oC for 5 hours
[7].
Distillation process
The tar distillation is carried out with a laboratory scale simple still is often performed in
batch-wise processing. In batch wise distillation, the material initial composition, the vapor and the
distillate components varied during the distillation process as show in table 1 and 2. All the
distillation processes were performed under atmospheric pressure for temperature varying between
30 oC to 330 oC . The experimental set up and the distillation products are show in figure 1 and 2.
Fig. 1 Simple distillation process of biomass tar.
Fig.2 fuel-oil from distillation biomass tar.

Process heat balance
Heat in = 0.300 kWh
heat out = 6500 kcal/kg = 7.58 kWh heat out / heat in = 25.3 (with catalyst)
heat out = 4500 kcal/kg = 5.23 kWh heat out / heat in = 17.4 (without catalyst)
The energy is supplied to the boiling point of tar by an electrical heater (power 300 watt ) during
one hour.
Tar could distillated to fuel-oil which has high heating value of 6500 kcal/kg. Then the
of heat input per heat output is 25.3 by a kilogram of fuel-oil.
Mass balance of the distillation process
Mass in = 100 %
Mass out = fuel-oil 40 %+ vinegar wood 20 % + residue 40 (with catalyst)
= fuel-oil 30 %+ vinegar wood 20 % + residue 50 (without catalyst)
Page 378

July 9-11, 2012
The mass balance presents percent conversion from tar to fuel-oil for a temperature and
pressure prescript. Beside, fuel-oils were obtained from eucalyptus wood tar distillation which are
a vinegar wood other residues for which tar boiling points are different of the distillate one
influence the mass balance of the distillation process.

The properties and composition of tar are reported in tables 1 and 2.
In a simple distillation of tar, usually used to separate fuel - oil for boiling points in
range of 270 C to 330 C at atmosphere pressure, the vapor pressures of the components are
sufficiently different so that Raoult's law may be neglected due to the insignificant contribution of
the less volatile component on the distillation process. The fuel-oil obtained were composed of
Acenaphthalene C12H8, Acenaphene C12H10, Fluorene C13H10 and Phenanthrene C14H10 as it was
shown by Constantin GOSSELIN [8] who investigated the oil composition obtained from
distillation of tar. We note that the oil heating value obtained by the distillation of tar is inferior to
the Diesel one (table 3). This result is due to the difference between the ratio of C/H of the oil tar
formula and the Diesel one. However, the tar oil flash point values show that this oil can be easily
used as a combustible. Figure 3 and figure 4 show the effect of the catalyst on the distillation
process. It is obviously that ZSM-5 and NiCl2 catalysts lead to high heating values than the other
catalyst used in this study.
Page 379

July 9-11, 2012
The point for which ZSM-5 and NiCl2 can reform the formula of oil tar while CoCl2 is the best
catalyst to increase yield from 30% to 43% fuel-oil.
Table 3: Properties of oil from eucalyptus wood tar distillation and Diesel.
Parameter
Flash point (oC)
HHV (kcal/kg)
C/H ratio
Yield (%)
Diesel
52
10800
6.5
-
Non
48
6000
7.25
27
FeSO4
44
6000
7.29
32
NiCl2
42
6400
7.56
30
45
yield(%)
40
35
30
25
Non
FeSO4
NiCl2
CoCl2
ZSM-5
catalyst
Fig. 3: Effect of catalyst on yield.

6600
HHV(kcal/kg)
6500
6400
6300
6200
6100
6000
5900
Non
FeSO4
NiCl2
catalyst
Fig. 4: Effect of catalyst on high heating value.
Page 380
CoCl2
ZSM-5
CoCl2
42
6100
7.42
43
ZSM-5
46
6550
7.72
31

July 9-11, 2012
CONCLUSION
We analyzed the effect of catalysts (NiCl2, FeSO4, CoCl2 and ZSM-5 ) on tar from the
eucalyptus wood by using distillation process at atmosphere pressure and temperature varying
between 250 oC and 330 oC. We obtain that the product from distillation of tar with catalytic are
increase high heating value and reduce the viscosity of tar which tar can be combustible. In
comparison , ZSM-5 and NiCl2 are catalysts to increase high heating value of tar. The high heating
value of tar change from 4500 kcal/kg to 6500 kcal/kg. These catalysts also reduce the viscosity
of the tar and increase the distillate yield from 30 to 43 %. Then distillate tar by using catalysts so
their properties are still far from diesel notably the flash point and C/H ratio but the product from
tar up grading is suitable to blend with diesel for sue with low-cycle engine. .
Page 381

July 9-11, 2012
REFERENCES
1. Chunshan L ,Kenzi S. Tar property, analysis, reforming mechanism and model for
biomass gasification-An overview, Renewable and Sustainable Reviews ,Models
RSER-525; No of Pages 11, 2008.
2. Jun H, Heejoon K. The reduction and control technology of tar during biomass gasification
/ pyrolysis: An overview. Renewable and Sustainable Reviews. Vol.12. pp. 397-416.
2008.
3. Takeo K, Tomohisa M, Jin N, Shigeru K, Kado O, Toshihiro M, Shuichi N, Kimio K,
Keiichi T. Development of Ni catalysts for tar removal by steam gasification of biomass.
Applied Catalysis B: Environmental. Vol. 68. pp.160-170. 2006.
4. Derick G. B, Lovleen G, Tae-Hyung K, H. Keith M-Y, Andrew J. C. Comparative
assessment of coal tars obtained from 10 former manufactured gas plant sites in the
Eastern United States. Chemosphere, vol.65. pp. 1562-1569. 2006.
5. L.I. Daravell, K. Heiskanen, J.M. Jones, A.B. Ross, P. Simell, A. Williams. An
investigation of alumina-supported catalysts for the selective catalytic oxidation of
ammonia in biomass gasification. CATALYSIS TODAY. Vol. 81. PP. 681-692. 2003.
6. Jaime M. Faundez , Ximena A. Garcia , Alfredo L . Gordon. A kinetic approach to
catalytic pyrolysis of tars. FUEL PROCESSING TECHNOLOGY. Vol.69. pp.239-256.
2001.
7. R. Anuwattana, Kenneth J. Balkus Jr. Conventional and microwave hydrothermal synthesis
of zeolite ZSM-5 from the cupola slag. Microporous and Mesopous Materials, Vol.111.
pp.260-266. 15 April 2008.
8.Constantin GOSSELIN. Ingnieur de lEcole nationale suprieure de chimie de Lille
Chef dtablissement de la socit HGD , ( Huiles , Goudrons et Drivs ).
Page 382

July 9-11, 2012
STO183-19
Characterization and Transformation of the Polymorphs of

DL-Methionine Crystals
Lek Wantha
Department of Chemical Engineering, Faculty of Engineering, Burapha University, Chonburi
20131, Thailand.
E-mail: lekw@eng.buu.ac.th
ABSTRACT
The nature and transformation of the polymorphs of DL-met crystals were investigated in
this study. The results showed that -DL-met is the stable polymorph and -DL-met is the
metastable polymorph. These two polymorphs of DL-met are a monotropic system. There was no
phase transformation of -DL-met during grinding. -DL-met and a mixture of -DL-met and DL-met were transformed to -DL-met during grinding. Such transformations are called solid-state
transformation. The transformation of DL-met crystals in solution consists of the transformation of
-DL-met into -DL-met. This transformation is called solution-mediated transformation. The
metastable -DL-met is stable in the solid state at room temperature.
Keywords: polymorph, characterization, transformation, crystal, DL-methionine
INTRODUCTION
Methionine (Fig. 1) is an essential amino acid in the human diet, and is also used as
dietary component in poultry and animal feeds. It is also used in active pharmaceutical ingredients,
and as a precursor to other amino acids. It is usually chemically synthesized in the form DLmethionine (DL-met), a mixture of the two enantiomers. DL-met has previously been shown to
exhibit polymorphism (the same chemical in a different crystal structure) and exists as the -, -,
and -forms (Mathieson, 1952; Matsuoka et al., 1999). In this work the -, and -forms were
studied. These three polymorphs can have different mechanical, thermal, physical, and chemical
properties, which greatly influence their suitability for a wide variety of uses, particularly for
pharmaceutical products, and also affects their suitability for further processing.
Fig. 1 Chemical structure of methionine.

It is commonly observed in crystallization of polymorphic forms that a metastable form
first appears instead of the stable form, a general rule known as Ostwalds Rule of Stages
(Threlfall, 2003). The more stable polymorph will nucleate later in the process, and eventually all
of the crystal will be of the stable polymorphic form.
Page 383

July 9-11, 2012
The metastable polymorph will transform to the stable polymorph via solid-state
transformation (SST) (OBrien et al., 2004; Jiang et al., 2010a) or solution-mediated
transformation (SMT) (Schll et al., 2006; Jiang et al., 2010b). In the case of true SST the crystal
lattice transforms into the different arrangement, for instance when the temperature is raised or the
mechanical force is applied. For the SMT the transformation of the metastable polymorph into the
stable polymorph occurs when a liquid phase surrounds the crystals. SMT consists of the
nucleation and crystal growth of the stable polymorph and the dissolution of the metastable
polymorph. SMT is found in the crystallization of polymorphic compounds in solution.
Wantha and Flood (2012a) studied the SMT of the polymorphs of DL-met crystals in
water at 25C. Crystallization with seeding (which is commonly found in industrial crystallization)
was employed in this study. The results showed that the SMT process consists of the dissolution of
-DL-met and the crystallization (nucleation and growth) of -DL-met, and the transformation is a
dissolution controlled process. The mechanism of each elementary step in this process needs to be
understood to predict and control polymorph formation. This analysis has been already begun in
the current system with results on the crystal growth rates, dissolution rates, and nucleation rates of
-DL-met (Wantha and Flood, 2011; Wantha and Flood, 2012b; Wantha and Flood, 2012c) and the
crystal growth rates of -DL-met (Wantha and Flood, 2012b).
In the present study the effect of grinding on the transformation of DL-met crystals was
used to study the SST process. Moreover, the nature of the polymorphism of DL-met crystals was
also investigated by X-ray powder diffractometry, microscopic observation, and their Gibbs free
energy changes based on the solubility data.
-DL-met crystals were prepared using reaction crystallization of Na-met aqueous
solutions, which has been described in a previous paper (Wantha and Flood, 2012b). -DL-met
crystals were prepared by cooling crystallization of aqueous solutions of DL-met, which has been
described in a previous paper (Wantha and Flood, 2011). The crystals of the pure polymorph of
each form obtained were characterized by X-ray powder diffractometry (XRPD) (Bruker axs,
D5005) and microscopic observation (Olympus, CH30).
SST of the polymorphs of DL-met crystals was carried out by grinding in air in a mortar
under isothermal condition at 251 C (which was controlled by air conditioning), and was studied
by means of XRPD analysis. There are three seeds (dry crystals) for grinding: (1) pure -DL-met,
(2) pure -DL-met, and a mixture of pure -DL-met (50 wt.%) and pure -DL-met (50 wt.%).
After grinding the seeds for 5 min, sample of crystals was characterized by XRPD. Theses three
seeds were also stored in a desiccator for six months to study the transformation of the polymorphs
at room temperature. After six months these samples were characterized by XRPD.
RESULTS
Polymorphism
XRPD patterns for -DL-met and -DL-met are shown in Fig. 2. The XRPD patterns show
clearly that the polymorphs possess different crystal structures. In -DL-met, the characteristic
peaks are observed at 21.7/2, 25.3/2 and 32.8/2, while the characteristic peaks of -DL-met
Page 384

July 9-11, 2012
are observed at 22.3/2, 28.0/2 and 33.8/2. The characteristic peaks of each pure polymorph
do not overlap with each other, and the peaks should be sharp. Therefore the XRPD method is a
good method for clear and fast identification and quantification of the polymorphs or polymorphic
fraction during crystallization. The composition of -DL-met could be estimated using a
calibration curve obtained from the relationship between the mass fraction of -DL-met and the
intensity of characteristic peaks.
The crystal morphologies also show clearly that the polymorphs possess different crystal
structures, as shown in Fig. 3. The crystals of -DL-met are agglomerated and have laminate
structures; the constituent elementary particles are primarily plate-like, whereas the shape of -DLmet crystals is a prism-like hexagon. Therefore, the transformation from -DL-met to -DL-met
during crystallization could also be followed using a microscope.
The polymorphic nature of polymorphs can be described by the Gibbs free energy
diagram. The exact value of the Gibbs free energy (G) cannot be found experimentally, however,
the relative Gibbs free energy of solids can be determined from solubility data and expressed by
the following equations (Grunenberg et al., 1996)
G ( s ) ( l ) = G ( s ) G(l ) = RT ln x
(1)
G ( s ) ( l ) = G ( s ) G( l ) = RT ln x
(2)
x
x
(3)
20.00
25.00
30.00
35.00
40.00
45.00
5.00
10.00
2 (o)
-DL-met
15.00
2 (o)
-DL-met
Fig. 2 PXRD patterns of -DL-met and -DL-met crystals
42.30
32.80
25.30
15.00
21.10
10.00
25.00
45.70
28.00
5.00
20.00
18.30
33.80
5.55
22.15
21.70
22.30
G( s ) ( s ) = G ( s ) G ( s ) = RT ln
Page 385
30.00
35.00
40.00
45.00

July 9-11, 2012
Fig. 3 Photomicrographs of -DL-met and -DL-met crystals.

where
G ( s )
G ( l )
and
G (l )
are the Gibbs free energy of -DL-met and -DL-met in solution (J/mol),
and ( s ) are the Gibbs free energy of the solid of -DL-met and -DL-met (J/mol), and x
and x are the solubility (as mole fractions) of -DL-met and -DL-met in solution.
The solubilities of the polymorphs of DL-met in water, which have been reported by
Wantha and Flood (2011), were used to determined the changes of the Gibbs free energy in
equations (1) and (2) for -DL-met and -DL-met, respectively. The plots of the change of the
Gibbs free energy of the two polymorphs are shown in Fig. 4. The Gibbs free energies of both
polymorphs also confirm that -DL-met (which has a lower Gibbs free energy) is the stable
polymorph and -DL-met (which has a higher Gibbs free energy) is the metastable polymorph.
Moreover, the plots of the Gibbs free energy strongly suggest that the two polymorphs are
monotropic system, since the polymorphs are not interconvertible, and the Gibbs free energy of DL-met is always lower than -DL-met at all temperatures below the melting point.
Transformation of the polymorphs of DL-met crystals
The transformation of the polymorphs can be analyzed by means of XRPD analysis. If
there is no phase transformation, the heights of the characteristic peaks do not change. If there is
transformation (the fraction of the polymorph changes), the heights of the characteristic peaks
change correspondingly. For example, if -DL-met is transformed to -DL-met, the heights of the
characteristic peaks of -DL-met decrease while the heights of the characteristic peaks of -DLmet increase.
The changes in X-ray Diffraction profiles during grinding are shown in Fig. 5. Initially,
the characteristic peaks of pure -DL-met do not overlap. After grinding the characteristic peaks of
-DL-met (22.3/2, 28.0/2 and 33.8/2) do not change, but its intensities become lower than
that of the intact -DL-met. This indicates that -DL-met was not transformed during grinding.
This also confirms that -DL-met is the stable polymorph.
Page 386

July 9-11, 2012
270
-12.4
280
Gibbs free energy (kJ/mol)
-12.6
290
300
310
320
330
340
350
-DL-met
-DL-met
-12.8
-13.0
-13.2
-13.4
-13.6
-13.8
-14.0
Temperature (K)
Fig. 4 Plot of Gibbs free energy of -DL-met and -DL-met.
- Form
- Form ground
for 5 min
+ - Form
+ - Form ground
for 5 min
- Form
- Form ground
for 5 min
2 (o )
Fig. 5 Change in X-ray Diffraction profiles during grinding.

Initially, the characteristic peaks of -DL-met and -DL-met overlapped for the mixture
samples. The X-ray Diffraction profile during grinding of a mixture of -DL-met and -DL-met
suggests the +-mixture was transformed to -DL-met. This is since the characteristic peaks of DL-met (21.7/2, 25.3/2 and 32.8/2) disappear after grinding or the heights of the
characteristic peaks of -DL-met decrease to zero while that of -DL-met increase. Similarly, DL-met was transformed to -DL-met during grinding. This is since the heights of the
Page 387

July 9-11, 2012
characteristic peaks of -DL-met decrease while that of -DL-met increase during grinding. These
also confirm that -DL-met is the metastable polymorph.
At room temperature, pure -DL-met, pure -DL-met, and a mixture of the two
polymorphs crystals were stored in a desiccator for six months. The X-ray Diffraction profiles of
these crystals after six months show the characteristic peaks do not change. These indicate there
were no phase transformations of the polymorphs. These mean that the dry crystals of both -DLmet and -DL-can be stored with no phase transformation at room temperature. Therefore, it can
be concluded that the crystals of the metastable -DL-met is stable at room temperature.
DISCUSSIONS
In the thermodynamics point of view, polymorphs can be classified as either enantiotropic
or monotropic systems (Grunenberg et al., 1996). In enantiotropic system, there is a reversible
transition between polymorphs at the temperature below the melting point, while there is no
reversible transition is observed for the monotropic system. In this work the polymorphic system
of DL-met is a monotropic system. Due to the structural differences in the crystal lattice of the
polymorphs, the polymorphism can also be classified as either packing or conformational
polymorphisms (Vippaganta et al, 2001). In packing polymorphism, the molecular conformations
of each polymorph can be assembled into different crystal structures. In conformational
polymorphism, the molecular conformers of each polymorph can be folded into different
arrangements. Fig. 6 shows the crystal structures of -DL-met and -DL-met. As seen in this
figure, the packing of each molecular conformer in the crystal structure of -DL-met differs from
that of -DL-met. The molecular conformer of -DL-met also differs from that of -DL-met.
These suggest that the polymorphism of DL-met is both packing and conformational
polymorphisms.
(a) -DL-met
(b) -DL-met
Fig. 6 Crystal structures of DL-met: gray = C atom, white = H atom, red = O atom, yellow = S
atom, and violet = N atom. (Matsuoka et al., 1999)
The results of both SMT in water (Wantha and Flood, 2012a) and SST (this work) of the
polymorphs of DL-met showed that -DL-met was transformed to -DL-met. This confirms that DL-met is the stable polymorph and -DL-met is the metastable polymorph. Moreover, the
Page 388

July 9-11, 2012
transformation via SMT in water was slower than SST (effect of grinding). This may be due to
SMT is more complex process than the SST process. The SMT process includes nucleation of DL-met, growths of -DL-met and -DL-met, and dissolution of -DL-met, and these processes
occur in the solution simultaneously. For SST, the mechanical force was directly applied to the
crystals, which directly changes the crystal structure of the polymorph. This is easily occurs by
rearrangement of the hydrogen bonds (dashed lines in Fig. 6) and rotation of the methyl (-CH3)
groups. It is also supposed that the SST occurs by nucleation of the stable -DL-met in the
metastable -DL-met.
Usually, when a compound can crystallize in different polymorphs, the scientist and
engineer have to select a form which best matches the needs of the product. Generally, the stable
polymorph is accepted and should be indentified and chosen for development, since the stable
polymorph does not transform to another polymorph with time. Therefore, the stable -DL-met is
the most form which best matches the needs of the product. However, the metastable polymorph
might have advantageous properties compare to the stable polymorph. For example, in
pharmaceutical products, the metastable polymorph is more required than the stable polymorph
(Yamanobe et al., 2002). This is since the metastable polymorph has higher solubility,
bioavailibity, and activity than the stable polymorph (Jiang, 2009). This indicates that the
metastable -DL-met is the best form which matches the needs of the pharmaceutical products.
Because the metastable polymorph can transform to another form with time via both SMT and
SST, it is difficult to produce (or stored) the metastable polymorph with no phase transformation.
However, as the results of this work the dry crystals of the metastable -DL-met were not
transformed to the stable -DL-met when stored at room temperature with no external force was
applied (e.g. grinding). This means that the dry crystal products of the metastable -DL-met can
be stored at room temperature before used for further applications with no phase transformation.
Moreover, for the use of the metastable polymorph for further processing the scientist and engineer
have to find the optimum conditions to avoid the transformation of the metastable polymorph.
Further work needs to be performed in order to study the thermal effect on the SST of the
polymorphs of DL-met in order to fully describe and optimize the conditions to store the
metastable -DL-met with no phase transformation.
CONCLUSIONS
The research characterized and studied the transformation of the polymorphs of DL-met.
The properties of the two polymorphs strongly suggest that the system is a monotropic system with
-DL-met is the stable polymorph while -DL-met is the metastable polymorph at all temperatures
below the melting point. There was no SST of -DL-met during grinding. -DL-met and a mixture
of -DL-met and -DL-met were transformed to -DL-met during grinding via SST mechanism.
There is only the SMT of -DL-met to -DL-met in water. The mechanism of the SMT was
interpreted to be a two step process, consisting of the dissolution process of -DL-met and the
crystallization process (nucleation and growth) of -DL-met. The dry crystals of both -DL-met
and -DL-met were not transformed at room temperature, which leads to the metastable -DL-met
is stable in the solid state at room temperature
Page 389

July 9-11, 2012
REFERENCES
Grunenberg, A., Henck, J-O., and Siesler, H.W. 1996. Theoretical derivation and practical
application of energy/temperature diagrams as an instrument in preformulation studies of
polymorphic drug substances. International Journal of Pharmaceutics 129: 147-158.
Jiang, S. 2009. Crystallization kinetics in polymorphic organic compounds. Ph.D. thesis,
Delft University of Technology, The Netherlands.
Jiang, S., Jansens, P.J., and ter Horst, J.H. 2010a. Mechanism and kinetics of the
polymorphic transformation of o-aminobenzoic acid. Crystal Growth & Design 10: 21232128.
Jiang, S., Jansens, P.J., and ter Horst, J.H. 2010b. Control over polymorph formation of oaminobenzoic acid. Crystal Growth & Design 10: 2541-2547.
Mathieson, A.M. 1952. The crystal structures of the dimorphs of DL-methionine. Acta
Crystallographica 5: 332-341.
Matsuoka, M., Yamanobe, M., Tezuka, N., Takiyama, H., and Ishii, H. 1999.
Polymorphism, morphologies and bulk densities of DL-methionine agglomerate crystals.
Journal of Crystal Growth 198-199: 1299-1306.
OBrien, L.E., Timmins, P., Williams, A.C., and York, P. 2004. Use of in situ FT-Raman
spectroscopy to study the kinetics of the transformation of carbamazepine polymorphs.
Journal of Pharmaceutical and Biomedical Analysis 36: 335-340.
Schll, J., Bonalumi, D., Vicum, L., and Mazzotti, M. 2006. In situ monitoring and
modeling of the solvent-mediated polymorphic transformation of L-glutamic acid. Crystal
Growth & Design 6: 881-891.
Threlfall, T. 2003. Structural and thermodynamic explanations of Ostwalds rule.
Organic Process Research & Development 7: 1017-1027.
Vippagunta, S.R., Brittain, H.G., and Grant, D.J.W. 2001. Crystalline solids. Advanced
Drug Delivery Reviews 48: 3-26.
Wantha, L. and Flood, A. E. 2011. Crystal growth rates and secondary nucleation
threshold for -DL-methionine. Journal of Crystal Growth 318: 117-121.
Wantha, L. and Flood, A.E. 2012a. Population balance modeling of the solution-mediated
transformation of DL-methionine polymorphs. In: proceeding of the 19th BIWIC
International Workshop on Industrial Crystallization. Tianjin, China, 2012 September 7-9.
(accepted)
Wantha, L. and Flood, A. E. 2012b. Growth and dissolution kinetics of and
polymorphs
of
DL-methionine.
Journal
of
Crystal
Growth
DOI:
10.1016/j.jcrysgro.2011.10.064 (in press).
Wantha, L. and Flood, A. E. 2012c. Nucleation kinetics of the polymorph of DLmethionine. Chemical Engineering & Technology DOI: 10.1002/ceat.201100682 (in
press).
Yamanobe, M., Takiyama, H., and Matsuoka, M. 2002. Kinetic study on polymorphic
solid-state transformation of organic compound: Bisphenol A and DL-methionine. Journal
of Chemical Engineering of Japan 35: 247-254.
Page 390

July 9-11, 2012
STO79-20
Study of Flow Behavior in High-Density Riser and

Downer Reactors
Parinya Khongprom1*, Sunun Limtrakul2,3, Terdthai Vatanatham2,3
1
Department of Industrial Chemistry, Faculty of Applied Science,
King Mongkuts University of Technology North Bangkok, Bangsue, Bangkok 10800, Thailand
2
Department of Chemical Engineering, Faculty of Engineering, Kasetsart University, Jatujak,
3
National Center of Excellence for Petroleum, Petrochemicals and Advanced Materials,
Department of Chemical Engineering, Faculty of Engineering, Kasetsart University, Bangkok
10900, Thailand
E-mail: parinyak@kmutnb.ac.th, Tel. +66 29132500-20 ext. 4811, Fax. +66 2 5878251
ABSTRACT
Hydrodynamics behavior in high-density riser and downer reactors was studied by means
of a numerical approach. A two-fluid model based on kinetic theory of granular flow was
developed to simulate the flow behavior in theses reactors. A k- turbulent model was used for
calculating the turbulent parameters. The simulation results reveal that solid volume fraction in
the downer reactor is much more uniform than that in the riser reactor. In addition, large particle
cluster formation near the wall of the riser can be observed. This large cluster formation leads to
higher RNI(s) in the riser. However, the RNI(vs) both in the riser and downer are almost the same
except near the entrance region where the RNI(vs) in the riser is higher than that in the downer.
Keywords: Simulation, Computational Fluid Dynamics, Hydrodynamic, Riser, Downer
INTRODUCTION
Circulating fluidized bed (CFB) reactors are wildly used in the chemical and
petrochemical industries due to their good mass- and heat- transfer characteristics and continuous
particle handling ability. Two types of CFB have been operated according to the gas-solid flow
direction, which are co-current up-flow CFB (riser) and co-current down-flow CFB (downer). In
the riser, both gas and solid particles are fed to the reactor near the bottom section. Both gas and
solid particles are co-currently flow upward against the gravitational force. The riser reactors have
been used in FCC processes (Chang et al., 2001; Theologos et al., 1997), gasification (Kersten et
al., 2003) and so on. The downer reactor is the new type of CFB which has been developed.
Since both gas and particles are fed to the downer reactor near the top section and flow cocurrently downward along the direction of the gravity, back-mixing of phases is effectively
reduced (Wei and Zhu, 1996; Zhao et al., 2010). Thus this reactor type attracted great attention
from industry, especially for fast reaction with intermediates as desired products. Previous studies
in the CFBs riser and downer are mainly focusing on the hydrodynamics heat and mass transfer in
the low solids fraction regime (Khongprom, 2011; Khongprom et al., 2012; Limtrakul et al. 2008).
Many attempts have been made to operate CFB reactors at high solid concentration regime,
especially in the downer reactors (Cheng and Li, 2004; Liu, 1999). The hydrodynamics, heat and
Page 391

July 9-11, 2012
mass transfer information in these high-density CFB reactors is important for design and scale-up
to the industrial applications. However, this information is rarely found in the open literature.
Recently, Computational Fluid Dynamics (CFD) has become the powerful tool for
studying the flow behavior in the gas-solid flow reactors such as fluidized bed reactors. The
Eulerian-Eulerian model is one approach that was used to describe the flow behavior in these
multiphase flow systems. This model treats each phase as a fully interpenetrating continuum.
This model has been successfully developed to simulate the flow behavior in the fluidized bed
reactors at various operating regimes (Ding and Gidaspow, 1990; Jiradilok et al., 2006;
Khongprom et al., 2012; Khongprom and Gidaspow, 2010).
The objective of this work is to study the flow behavior in the riser and downer reactors at
high solid volume fraction regime using the computational fluid dynamic (CFD).
Reactor Geometries and Simulation Conditions
Fig. 1(a) illustrates the riser reactor geometry used in this study. In the riser, both gas and
solid particle are fed to the reactor at the bottom. These two phases flow upward against the
gravitational force and exit from the reactor at the top. A riser inner diameter (ID) is 0.14 m and
height of 7 m. A downer reactor geometry used in this work was shown in Fig. 1(b). Both gas and
particles are introduced to the downer at the top section. The downer reactor has the same size
with the riser reactor which is 0.14 m ID and 7 m height.
Fig. 1 Reactor geometries used in this study; (a) riser and (b) downer.
Mathematical Model
The Eulerian model used in this study is a two-fluid model based on the kinetic theory of
granular flow. A set of governing equations, continuity, momentum, and solid phase fluctuating
energy conservation equations is shown in Table 1. The constitutive equations were shown in
previous works (Khongprom, 2011; Khongprom et al. 2012). The effect of turbulence was taken
into account via a k- turbulent model. The detail of this turbulent model can be found in
Khongprom et al. (2012). The governing equations and the constitutive equations were solved
Page 392

July 9-11, 2012
numerically using commercial computational fluid dynamics (CFD) software, FLUENT. The
physical properties of particle and simulation conditions are summarized in Table 2.
Table 1 Governing equations
(a) Conservation of mass;
- Gas phase;
g g + g g vg = 0
t
(1)
- Solid phase;
( s s ) + ( s s v s ) = 0
t
(2)
(b) Conservation of momentum;

- Gas phase;
( g g v g ) + ( g g v g v g ) = g P +
t
g + tu , g + g g g gs (v g v s )
(3)
- Solid phase;
( s s v s ) + ( s s v s v s ) = s P +
t
s + tu , s Ps + s s g + gs (v g v s )
(4)
(c) Conservation of solid phase fluctuating energy;
3
( s s ) + ( s s )vs =
2 t
( p I + ) : v
s
(5)
+ ( s ) s
Page 393

July 9-11, 2012
Table 2 Simulation conditions
Properties/Conditions
Value
Particle diameter (m)
54
Particle density (kg/m3)
1545
Inlet conditions
- Superficial gas velocity (m/s)
- Solids circulation rate (kg/m2s)
1
400
Radial Nonuniformity Index (RNI)

Zhu and Manyele (2001) proposed the radial nonuniformity index (RNI) to compare the
lateral nonuniformity of flow behavior between different systems. RNI was defined as the
standard deviations normalized by theses maximum standard deviation. This index has value
between zero and unity. The smaller the value of this index indicates the more uniform in the
radial direction.
The radial nonuniformity index for solid volume fraction, RNI(s) can be determined from
the equation
RNI ( s ) =
( s )
( s )
=
max ( s )
s ( mf s )
(6)
where ( s ) is the standard deviation of the solid volume fraction ( s ), max ( s ) is the
maximum possible standard deviation for the given averaged solid volume fraction ( s ), and
mf is the solid volume fraction at the minimum fluidization condition.

The radial uniformity index for particle velocity, RNI(Vp) is defined as
RNI (V p ) =
=
(Vs )
max (Vs )
(V
(Vs )
Vs ) + (Vs Vs ,min )
2
s , max
(7)
where (Vs ) is the standard deviation of the solid velocity, max (Vs ) is the maximum possible
standard deviation for the averaged solid velocity ( Vs ), and Vs , min and Vs , max are the minimum and
maximum particle velocities, respectively.
Page 394

July 9-11, 2012
Hydrodynamics behavior
Solid volume fraction
Fig. 2 shows the contour plot of solid volume fraction in the riser (a) and in the downer
(b). It can be clearly seen that the solid volume fraction in the downer is much more uniform
distribution than that in the riser. This simulation can also be captured the large particle cluster
formation near the wall of the riser (the red color), which were observed by mean of experimental
study (Wang et al., 2010; Xu and Zhu, 2011).
Figs. 3(a) and (b) exhibit the lateral distributions of solid volume fraction in the riser and
downer, respectively. These reactors show the different profiles. In the riser reactor, the coreannulus flow pattern, very low solid fraction in the core region and relatively high solid fraction
near the wall region, can be obtained. This flow pattern has been reported in the literature
(Chalermsinsuwan et al., 2009; Knowlton et al., 1995). In the downer reactor, the lateral profiles
show a low and uniform solid volume fraction in the center region. Near the inlet of the downer,
most of particles accumulate at the wall. Further down the downer column, the solid volume
fraction shows a high density peak near the wall.
Outlet
Inlet
Outlet
Inlet
0.00
0.03
0.06
0.09
0.13
0.16
0.19
0.22
0.25
0.28
0.32
0.35
0.38
0.41
0.44
0.47
0.50
0.54
0.57
0.60
0.63
(a)Riser(b)Downer
Fig. 2 Contour plot of solid volume fraction in riser (a) and downer (b).
Page 395

July 9-11, 2012
Solid velocity
Fig. 4 illustrates the solid velocity vector plot in the riser (a) and downer (b). Near the
inlet of both riser and downer, the solid velocity vector shows an almost uniform in the radial
direction. Thereafter, the velocity in the riser is high in the center and very low near the wall
region. The reason is that the large particle cluster near the wall reduced the upward flow of the
particle in this region. In the downer reactor, the particle velocity vector further developed to form
a low velocity near the center with high velocity near the wall. The explanation is that the high
solids density near the wall region drags the particles in this zone to flow downward with
relatively high velocity.
Fig. 5 shows the radial distribution of the solid velocity in the riser (a) and downer (b) at
various heights. The parabolic profiles were obtained in the riser reactor. Near the inlet section of
the downer reactor (H = 0.05-0.2 m), the flat profile of solid velocity was observed which can also
be seen from the velocity vector plot. Further down the downer column, the solid velocity shows a
low value near the center region and high velocity peak near the wall region because of the effect
of high particle density peak in this region.
Fig. 3 Radial distributions of solid volume fraction in the riser (a) and the downer (b).
Radial flow nonuniformity (RNI)
Solid volume fraction
Fig. 6 shows the RNI(s) in the riser and downer along the reactor height. It can be seen
that the RNI(s) in the riser is higher than that in the downer. This indicates that the radial
distribution of the solid volume fraction in the downer is more uniform than that in the riser
reactor. The reason is that the large particle cluster formation near the wall of the riser reactor
causes a high particle concentration near the wall with very low solids fraction in the core region
leading to less lateral uniformity.
Page 396

July 9-11, 2012
Outlet
Inlet
Inlet
Outlet
0.02
0.12
0.24
0.35
0.47
0.59
0.70
0.82
0.94
1.05
1.17
1.29
1.40
1.52
1.64
1.76
1.87
1.99
2.11
2.22
(a)Riser (b)Downer
m/s
Fig. 4 Solid velocity vector plot in riser (a) and downer (b)
Page 397

July 9-11, 2012
2.5
(a)
H(m)
2.0
0.05
1.5
SolidVelocity(m/s)
1.0
0.2
0.5
0.0
00.20.40.60.81.0
r/R()
Fig. 5 Radial distributions of solid velocity in the riser (a) and the downer (b).
0.6
RNI(s)
0.4
0.2
Riser
Downer
01234567
AxialPositionfromInlet(m)
Fig. 6 Variation of the radial nonuniformity index of solids volume fraction in the riser and
downer.
Solid velocity
Fig. 7 shows the RNI(Vp) in the riser and the downer at various heights. Near the inlet
section (0-2 m), the RNI(Vp) in the riser is higher than that in the downer reactor. This is because
of the more uniform of solid velocity in this region of downer reactor (see Figs. 4(a) and 5). After
2 m, the RNI(Vp) of both riser and the downer reactors is almost the same. This implies that the
cluster formation at the wall of the riser and the high density peak of particle concentration near
the wall of the downer reactor induce the same level of particle velocity nonuniformity in these
reactors.
Page 398

July 9-11, 2012
0.6
RNI(vs)
0.4
Riser
0.2
Downer
01234567
AxialPositionfromInlet(m)
Fig. 7 Variation of the radial nonuniformity index of solid velocity in the riser and downer.
CONCLUSION
The hydrodynamics behavior and the radial flow nonuniformity in high-density riser and
downer reactors were studied by mean of numerical simulation. The solids volume fraction
distribution in the downer is much more uniform than that in the riser reactor. This leads to lower
RNI(s) in downer reactor. Near the inlet section, the RNI(Vs) in the downer is lower than that in
the riser due to more uniform particle velocity in the system. However, the RNI(Vs) both in the
riser and downer reactors are almost the same after the inlet section.
ACKNOWLEDGEMENTS
This work was financially supported by King Mongkuts University of Technology North
Bangkok.
Page 399

July 9-11, 2012
REFERENCES
Chalermsinsuwan, B., Kuchonthara, P. and Piumsomboon, P. 2009. Effect of circulating
fluidized bed reactor riser geometries on chemical reaction rates by using CFD simulations.
Chemical Engineering and Processing: Process Intensification 48: 165-177.
Chang, S.L., Lottes, S.A., Zhou, C.Q., Bowman, B.J. and Petrick, M. 2001. Numerical study of spray
injection effects on the heat transfer and product yields of FCC riser reactors. Journal of Heat
Transfer 123: 544-555.
Chen, H. and Li, H. 2004. Characterization of a high-density downer reactor. Powder Technology
146: 84-92.
Ding, J. and Gidaspow, D. 1990. A bubbling fluidization model using kinetic theory of granular flow.
AIChE Journal 36: 523-538.
Jiradilok, V., Gidaspow, D., Damronglerd, S., Koves, W.J. and Mostofi, R. 2006. Kinetic theory
based CFD simulation of turbulent fluidization of FCC particles in a riser. Chemical Engineering
Science 61: 5544-5559.
Kersten, R.A., Prins, W., van der Drift, B. And van Swaaij, W.P.M. 2003. Principles of a novel
multistage circulating fluidized bed reactor for biomass gasification. Chemical Engineering
Science 58: 725-731.
Khongprom, P. 2011. Modeling and simulation of hydrodynamics, and heat and mass transfer in a
down-flow circulating fluidized bed reactor. D.Eng. Thesis. Kasetsart University, Bangkok,
Thailand.
Khongprom, P., Aimdilokwong, A., Limtrakul, S., Vatanatham, T. and Ramachandran, P.A. 2012.
Axial gas and solids mixing in a down flow circulating fluidized bed reactor based on CFD
simulation. Chemical Engineering Science 73: 8-19.
Khongprom, P. and Gidaspow, D. 2010. Compact fluidized bed sorber for CO2 capture. Particuology
8: 531-535.
Knowlton, T., Geldart, D., Masten, J. And King, D. 1995. Comparison of CFB hydrodynamic
models, in: PSRI challenge problem presented at the Eighth International Fluidization
Conference, Tour, France.
Limtrakul. S., Thanomboom, N., Vatanatham, T. and Khongprom, P. 2008. DEM modeling and
simulation of a down-flow circulating fluidized bed. Chemical Engineering Communication 195:
1328-1344.
Liu, W. 1999. High density solids downflow gas-solids reactors. M. Eng. Sci. Thesis. The University
of Western Ontario, London, Ontario, Canada.
Theologos, K.N., Nikou, I.D., Lygeros, A.I. and Markatos, N.C. 1997. Simulation and design of fluid
catalytic-cracking riser type reactors. AIChE Journal 43: 486-494.
Wang, X.Y., Jiang, F., Xu, X., Fan, B.G., Lei, J. and Xiao, Y.H. 2010. Experiment and CFD
simulation of gas-solid flow in the riser of dense fluidized bed at high gas velocity. Powder
Technology 199: 203-212.
Wei, F. and Zhu, J.X. 1996. Effect of flow direction on axial solid dispersion in gas-solids cocurrent
upflow and downflow systems. Chemical Engineering Journal and the Biochemical Engineering
Journal 64: 345-352.
Xu, J. and Zhu, J.X. 2011. Visualization of particle aggregation and effects of particle properties on
cluster characteristics in a CFB riser. Chemical Engineering Journal 168: 376-389.
Zhao, Y., Ding, Y., Wu, Y. And Cheng, C. 2010. Numerical simulation of hydrodynamics in
downers using a CFD-DEM coupled approach. Powder Technology 199: 2-12.
Zhu, J.X. and Manyele, S.V. 2001. Radial nonuniformity index (RNI) in fluidized beds and other
multiphase flow system. The Canadian Journal of Chemical Engineering 79: 203-213.
Page 400

July 9-11, 2012
STO88-21
Application of PSCAD/EMTDC Program

in High Voltage Engineering Education
Preecha Sakarung
Section of Electrical Engineering, Rajamangala University of Technology Suvarnabhumi,
Supanburi, Thailand
E-mail: preecha_s@rmutsb.ac.th
ABSTRACT
One of the major advantages of using computer programs as a part of the instruction on
high voltage engineering is that they can help with simulation and demonstration in class. The
simulation enhances students to better understand the subject rather than teaching the theory alone.
For this paper, with the use of the PSCAD/EMTDC, EMTP-like simulation program, three
examples of high voltage generating circuits, where relationship between any variables and
waveform (wave-front and wave-tail) is considered, are simulated; 1) an impulse generator (buildin function), 2) an impulse generator (a typical circuit) and 3) a voltage multiplier. The research
result shows the interdependence between the output voltage and ripple varying as one part and the
load resistance and output capacitance as the other.
Keywords: high voltage, engineering education, PSCAD/EMTDC, impulse generator
INTRODUCTION
Based on the regulation by the Council of Engineers, any Thai universities or institutes
offering a degree in electrical engineering must include High Voltage (HV) theory in their
curriculum. Similar to other subjects that aim to develop professional skills such as Electric Circuit
and Electrical Machine, they should not be taught in theory alone but along with laboratory
experiments. However, only a few universities or institutes own a high voltage laboratory due to
the fact that not only the actual HV test equipment is rather expensive, but the set-up process is
time-consuming, the laboratory activities are somehow dangerous, and a team of skilled HV
technicians is not easy to form. Even though an actual HV laboratory seems impractical, using a
computer program to simulate high voltage circuits and demonstrate them in class is therefore an
advisable solution.
In using a computer program as the simulation tool, this allows both students and teachers
to make the best use of the program as they can do the simulation at their convenience (before,
during and after class). Moreover, by means of simulation, different output responses can be
monitored by changing parameters. Transient phenomena (including steady-state phenomena) of
each circuit component are clearly shown in windows for convenient view and each variable can
be selected and monitored via different means and it can be recorded in high quality graphics.
Page 401

July 9-11, 2012
In previous papers [1, 2], SPICE (a computer program) was used to simulate high voltage
circuits for an engineering class. But SPICE is not advisable for modern electrical power
engineering as it cannot function with all electrical power tools but actually suitable for
electronics. However, in power engineering field, the computer software that is widely used to
simulate in transient phenomena is Electro-Magnetic Transients Program (EMTP).
PSCAD/EMTDC, which is developed from EMTP, is a time domain digital simulation using the
trapezoidal rule of variable integration. EMTDC simulation tool can simulate the time response of
the transient phenomena in the power system with a very high degree of accuracy. Individual
physical component can be modeled and there is no need to simplify the system to accommodate
the analytical expression. EMTDC thus allows more realistic representation of a system through its
physical components. This simulation program also allows variables of the systems i.e. voltages
and currents to be easily monitored in the same way as one would use oscilloscope to monitor
voltage and current signals in the real system.
In this paper, three illustrations of HV generating circuits supported by the
PSCAD/EMTDC in evaluation version 4.2.1 are shown. The first two circuits are impulse
generators: build-in function and a typical circuit, and the last one is a voltage multiplier.
Impulse Voltage Generator
Regarding the impulse generation, two types of impulse representing natural lightning
strokes can be simulated. One is the impulse voltage which is used in various standard techniques
to study or test whether or which level the electric equipments can withstand lightning strokes and
switching operations. The other is the impulse current which is used not only to test surge arrester
but to study the electric-arc and electric-plasma. According to [3], the general impulse waveform
shown in Fig. 1 can be represented as a double exponential equation (1). The definition of impulse
waveform must be done according to the IEC standard [3]. In general, lightning impulse voltage is
represented as 1.2/50 sec (T1 / T2 ) where T1 is the front duration (or 1.67 times the interval T) and
T2 is the time to half peak and that acceptable tolerance can be changed up to 30% for T1 and
20% for T2 . One of the standard switching impulse voltages is represented as 250/2500
sec (Tp / T2 ) where Tp is the time to peak and T2 is the time to half peak and that acceptable
tolerance can be changed up to 20% for Tp and 60% for T2 .
Fig. 1 definition of impulse waveform (a) lightning and (b) switching according to [3]
Page 402

July 9-11, 2012
The basic circuit of a single-stage impulse generator is shown in Fig. 2 and the double
exponential equation which depends on values of R and C variables is shown in equation (2).
spark gap
C1
spark gap R F
RF
RT
C1
C2
RT
C2
(b)
(a )
Fig. 2 basic circuit of a single-stage impulse generator (a) and (b).
V = V0 et et
(1)
t
t
RT C1
RF C2
e
V = V0 e
(2)
Referring to Fig. 2, the circuit consists of two capacitors in which the first capacitor C1 will be
charged directly from a d.c. voltage to the point of required voltage until the spark gap breaks
down. The energy stored in capacitor C1 is then discharged through the other capacitor, C2 which
is the test object. The impulse voltage (front and tail waves) is controlled by changing RF and
RT respectively, V is the output impulse voltage and V0 is the required voltage stored across
capacitor C1 .
Different impulse voltage waveforms, which are created following the IEC standard in
both generating and testing guidelines [3, 4], can be adjusted for any particular test objects and
studying topics. In addition, some practical techniques can be found in [5]. The values of the
following variables; V0 , and can be determined by using the three different relationship
curves for build-in function impulse generator [3].
Multi-stage Impulse Generator
The corona discharge is the problem of a single-stage impulse circuit. In 1923, Marx
therefore proposed a multi-stage impulse circuit. The modified three-stage circuit is presented in
Fig. 3,
Page 403

July 9-11, 2012
RS
RS n
RS n
G1 nC1
d.c. supply nC1
R 2 n R1 n
G3
G 2 nC1
R2 n
R1 n
R2 n
R1 n
R1 n
C2
Fig. 3 three-stage impulse generator with distributed discharge

where Rs : charging resistor, G : spark gap, C1 : discharge capacitor, R1 : front resistor, R2 :
discharge
resistor, n : number of stage, C2 : load capacitor. The calculation of R1 and R2 uses equation (3)
and (4) respectively when the impulse waveform type (T1 / T2 ) is required.
CC
t1 = 3.0 R1 1 2
C1 + C2
(3)
t2 = 0.7 ( R1 + R2 )( C1 + C2 )
(4)
For example, the value of R1 and R2 where an impulse generator has three stages with the capacitor
of 1.5 F each, the load capacitor at 0.0125 F producing 1.2/50 sec wave is 32.8 and
106.57 respectively.
Voltage Multiplier
The high direct voltages can be generated from the rectification of an alternate voltage.
The Cockcroft-Walton circuit is one of the voltage multipliers as shown in Fig. 4 [3]. For the
circuit of resistor, diode and capacitor produce an output voltage of double voltage as presented in
Fig. 4a) and 6 times of V (2*n*V) for three-stage circuit in Fig. 4b) with open circuit only, where
Resistor Rs functions as the current limiter.
Referring to Fig. 4a), the voltage ripple output depends on each load resistor RL and
output capacitor C2 .
Page 404

July 9-11, 2012
RL
C1
D
V
C
C2
RL
(a )
RS
( b)
Fig. 4 voltage multipliers (a) single-stage multiplier (b) three-stage multiplier

RESULTS
Basic Impulse Voltage
The simulated basic circuit of a single-stage impulse generator in PSCAD style is shown
in Fig 5. The 1.2/50 sec waveform is carried out to simulate a general lightning impulse. Initial
voltage condition of the capacitor is used in representing capacitor C1 charge and in triggering
spark gaps, the switch is used. The initial charge voltage value is 100 kV. The output waveform
shows that peak voltage is 94.64 kV, front time is 1.3 sec and tail time is 50 sec . Regarding the
value of C1 , C2 , RT and RF in equation (2) and Fig. 5b), it can be assured that the simulation result
shows no significant differences.
Fig. 5 impulse voltage (a) single-stage impulse generator (b) equation (2)
Multi-stage Impulse Generator
The three-stage impulse generator simulated in PSCAD style is shown in Fig 6. The initial
charge voltage value is 100 kV. The output waveform shows that the peak voltage is
approximately 3 times (281.9 kV), front time is 1.5 sec and tail time is 40 sec .
Page 405

July 9-11, 2012
Voltage Multiplier
All capacitors are 100 nF in each simulation case. The double circuit shown in Fig. 7 is
charged up to double of the input voltage. The output voltage will reach a maximum voltage of
2*n* Vmax with no load, where Vmax is the peak input voltage and n is the number of stages in the
voltage multiplier circuit. The three-stage circuit is shown in Fig. 8.
Fig. 6 the output of a three-stage impulse generator
Fig. 7 double voltage circuit with simulation result
Page 406

July 9-11, 2012
Fig. 8 voltage multiplier circuit (three-stage) with simulation result

The alternate current source of 50 Hz and 10 V peak is supplying to the voltage multiplier
circuit that produces 15.57 1.25 V with load resistor (Fig. 7) and 60 V with no load resistor (Fig.
8).
DISCUSSION
The computer software like PSCAD/EMTDC is an important tool for high voltage
engineering education in Thailand. It is certain that both students and teachers will gain more
experience in designing and testing the simulations in dynamic practice. For classroom benefits,
the application of this program can simulate and present phenomena that are difficult or impossible
to see even in a real HV laboratory. Moreover, for laboratory benefits, the preparation for
laboratory activities can be done prior to the actual laboratory sessions by using the program for
simulations and this results in better time management as it allows no wasting time for setting up.
For further research, the application of this software on different topics regarding High Voltage
theory should be taken into account.
Page 407

July 9-11, 2012
REFERENCES
[1] J.L.Suthar ,J.R.Laghari and T.J.Saluzzo, Usefulness Of Spice In High Voltage Engineering
Education,IEEE Transactions on Power System,Vol. 6,No.3, August 1991
[2] M.S. Kamarudin et al., Impulse generator and lightning characteristic simulation using Orcad
PSpice software, EnCon2008, dec. 18-19, 2008,Malaysia.
[3] E. Kuffel, W.S. Zaengl and J. Kuffel, 2000. High Voltage Engineering. Newness.
[4] M.S. Naidu, and V. Kamaraju, 2004. High Voltage Engineering. Tata McGraw-Hill.
[5] Manitoba HVDC Research Centre Inc., PSCAD User Guide, 2004.
Page 408

July 9-11, 2012
STO75-22
Push and Pull System Simulation Based for Flow Shop

Tuspol Khaimarn
Department of Production Engineering
The Sirindhorn international Thai-German Graduate School of Engineering (TGGS)
King Mongkuts University of Technology North Bangkok (KMUTNB), Bangsue, Bangkok
E-mail: Tuspol_K@hotmail.com
ABSTRACT
This paper presents models of Push and Pull system on continuous production line based
simulation program. This identifies bottleneck in operation line and studies effect of batch size on
each production control strategies. In order to achieve higher throughput rate and station blocking
reduction, buffer allocation and kanban approach are experimented in these models. Finding
appropriated solution for production flow of automotive part industry, economic analysis of each
approach is applied to fit condition and characteristics of this plant.
Keywords: Push and Pull system, Kanban, Flow shop, Bottleneck, Simulation
INTRODUCTION
There are various papers of serial production line behavior studies. Analytical and
simulation methods are applied to predict mechanism and propose optimal solution for increasing
performance of manufacturing. The significant characteristics of serial production line consist of
many types of machines; moreover, the capacity limit and different cycle time of each machine in
manufacturing are vital factors that impede continuous flow achievement. Starving and blocking
occurs in unbalance operation line, this is namely bottleneck. Buffer space is one approach to
reduce starving and blocking severity in flow shop. As a consequently, many researches provide a
wide variety of papers that determine optimal amount of buffer for flow shop improvement.
There are typically two types of production strategy; Push and Pull system (Chiadamrong
et al., 2006). Push system bases on forecasted demand according with production plan. Produced
part is shipped to downstream whether the next station requests or not. On the other hand, pull
system is communication visual signal for work replacing. Item is transferred to next process when
a preceding station receives requisition from a successor.
This paper applies Tecnomatix simulation program to detect bottleneck and propose
solutions based production control strategies; push and pull system, on automotive part flow shop.
This production line produces the same product type and process sequence. However, some
stations are shared and occupied by different items from another operation line. Since this line has
10 stations and each station has differentiated cycle time, bottleneck is included in this flow line.
The bottleneck station is the critical constrain of production rate. The more severe bottleneck is,
the fewer throughputs are in production line (Chaidamrong et al., 2006). The objective of this
study is determination of suitable solutions for specific conditions of this plant through indicators;
throughput rate, reduce life-span and bottleneck.
Furthermore, this observes effects on
production line when batch size variation, buffer allocation system and kanban system are applied.
BACKGROUND
There are various researches related to productivity improvement of continuous
production line. The prediction methods can be divided into two groups as analytical and
simulation. Believed key success factors of flow shop operation was identification and elimination
Page 409

July 9-11, 2012
of bottleneck (Kuo et al, 1996). Kuo and Leporis et al (2010) analyzed bottleneck in serial
production through analytic model. Kuo identified bottleneck on automotive plant and Leporis
analyzed bottleneck detection methods through different algorithm with explicit criterion by
WITNESS program. Lutz (1996), Huang et al (2002) and Tempelmeier (2002) applied
mathematical model to investigate buffer size and buffer effects based on operation research
principle. Lutz applied Tabu search method to balance line through WIP level for higher
throughput. Tempelmeier studied the effect on processing time. Huang et al aimed to minimize the
work-in-process, cycle time, blocking probability and maximum throughput in flow shop through
queuing theory.
Wang (2005) also determined optimal batch size in supply chain through mathematics model
in order to minimize the total cost of supply chain. Moreover, then he used Promodel simulation
system to arrange variable closely to real situation. Applying simulation program was able to solve
the mathematics model limitation.
Chiadamrong et al (2005) and Savsar (2009) compared push and pull material control
mechanism on flow shop. Analytical approach was used to model benefit of production control
mechanism. These determined optimal number of kanban in pull strategy and the effect of buffer
size in push system. Moreover, Chiadamrong et al. still considered economic analysis. As a result,
pull system was cheaper than push system and inter arrival time was shorter than that.
Alternatively, Kattan (2006) and Peng (2010) applied computer program to identify and
propose solutions for bottleneck. Kattan applied Arena program simulation to determine queuing
and machine utilization in flow shop. Otherwise, Peng used Flexsim program to model supply
chain of steel pipe industry for suppliers assorting. Furthermore, Roser et al. (2005) studied
behavior of bottleneck and buffer effect through TOPQ software since complex system was
difficult to optimize by analytical model.
Shim (2011) studied time reduction of construction project by varied batch size through
Monte-Carlo approach. This paper suggested that there was no benefit for using small batch size in
one activity; furthermore, reducing batch size might cause more investment. Usano et al. (1995)
observed throughput and inventory level of push and pull system through three-experiment model;
assembly line, unbalance line and scrap. Spieckemann et al. (2000) simulated the optimization in
automotive industry through simulation model and meta heuristics to plan serial production layout
in condition of different of machine capacity.
Both analytical method and simulation are able to detect bottleneck and propose solutions.
Banks J. (1999) described the advantages of computer simulation as
1. Testing your designs without committing resources to acquisition
2. Investigating causes and effect of phenomena in compressed time simulation
3. Easier applying than analytic method
4. Better understanding interactions of parameters in complex system
5. Lower investment of experiments in modeling than modifying in real-world system
As literature reviews, the factors that affect to output production system are accordance
with batch size, buffer level and production control strategy.
Widely applications are used to balance production line such as set up time reduction or
SMED, cycle time reduction at bottleneck station, system management, etc.
This study focuses on operating line management. This investigates impacts of batch size,
buffer allocation and kanban system on flow shop in order to achieve minimum bottleneck ratio.
This research is divided into three cases: first finding the batch size which is appropriated to real
situation, second case is varied batch size in push system; buffer allocation, and final case is pull
approach; kanban, with different batch size. Finally economic analysis is applied in alternative
solutions for decision making.
Page 410

July 9-11, 2012
Characteristics of production line
This production line is a continuous line for housing producing. It consists of 10 stations
with different cycle time on each station. There are mixed types of parallel machine and series
machine as Fig 1. Furthermore, there are other product types; steering plate, cylinder and injector
shares some stations in this line.
The sequence of Housing flow starts at housing source through the OP10, OP20, OP30,
Demagnetize, Washing, Deburring, ECM, Inspection, Laser, Pressing and Fine Boring orderly.
The another type, steering plates entry the production line at laser station after that flow to
Pressing station, Fine Boring station and Washing station respectively. Cylinders are produced
only at Laser station. Additional, at Washing station is occupied by injector.
Fig. 1 Continuous production line of simulated model

Simulation
Technomatix Plant Simulation is the material flow program which simulates the
production line model for planning, implementing and operating in complex manufacturing system
(Bangsow, 2010).
The models are emulated as sequence of process. For this system modeling, it is important
to create an entity standing for raw material for each part with the corresponding volume. This
model defines the source, buffer, station drain and material flow direction. At source provides
parts all time as the OP10s needs. Buffer space is defines as maximum level that it can store. A
station is determined as processing time, which is cycle time of each machine. A drain is a
destination of flow. The entities are processed as cycle time setting on each machine and released
to downstream. As an inflow of the parts, materials start flowing from the source to downstream
until they reach a drain by cart. Each station is modeled the processing time from average cycle
time and then releasing parts to an adjacent station. Furthermore, this program also provides
kanban functions to investigate the operating line behaviors. These functions pull entities from
upstream when the number of kanban at stage of downstream reaches the minimum volume. The
results of a simulation show measurable output; throughput rate, life-span, station blocking, etc.
Three experiments are set as below assumption.
1. Neglect transportation time between stations
2. Weekly demand is 5,500pcs/week
3. Available time is 336 hrs./week
4. Neglect machine interruption
5. Batch size varied as washing container (24 pieces/washing time)
Page 411

July 9-11, 2012
6.
upstream line
Interval entrance of steering plate and cylinder at laser station depends on
6.1 Every 1hr: 30min steering plate entries

6.2 Every 1hr: 50min cylinder entries
7. First-In-First-Out service
8. Outside items occupied washing machine every 45 min and occupy for 2 min
From model validation by comparing with machine utilization in real-world, little
deviation value of machine utilization occurs in model. The percentage of deviation is less than
3.00 percents.
Experiment of batch size varied in real world situation condition
This production line is finite buffer space at each station. This experiment studies batch
size effect on flow shop in push strategy. Batch size is varied as limitation of washing station
capacity per time. Thus, batch size is 24, 48, 60, 72, 84, 96, 108 and 120.
Experiment of relation of batch size variation and buffer allocation
This case simulates buffer allocation system; representing for push system, with varied
batch size. First buffer level of housing is calculated through distinguish capacity between two
processes in at initial stage as equation (1). After buffer space was created between stations, model
is run through Tecnomatix to monitor the blockage and starvation. Adjusting buffer space reduces
the blocking station in system until reach steady state of throughput and minimum bottleneck ratio.
Buffer = Downstream part consumedUpstream part consumed
(1)
Experiment of relation of batch size variation and number of Kanban

This model examines effects of batch size in kanban system on serial production line. The
Tecnomatix supports the kanban functions for simulation, thus the required parameter in the model
is number of kanban at each front stage. The number of kanban is calculated as equation (2). The
kanban system is applied only on housing production, meanwhile, the steering plate, injector and
cylinder is in pull system.
Number of kanban =
Parts consumed during one Kanban cycle
(2)
Number of parts per container

Measurement Indicator
Selecting solution for implementation, measurement indicator is an important tool for
comparing and choosing appropriated alternative solutions. Roser et al. (2005) mentioned in their
study that optimization should trade-off between throughput, make-span and the work-in-process.
Little's Law principle is the fundamental relationship between work-in-process, throughput
and flow time of a production system in steady state. As Littles law mentioned, there are three
indicators; throughput rate, inventory level and life-span of items; that should be concerned in
production line performance measurement. Moreover, bottleneck ratio is a measurement indicator
that determines the amount of blocking station
Bottleneck Ratio (BN Ratio)
Bottleneck ratio determines the amount of station that blocks material flow in process. BN
ratio is calculated as equation (3)
BN Ratio
BN machine
(3)
Total machine
Economic Analysis
Economic analysis is a vital factor for decision making. Cost is significant in business
competitiveness. Thus, cost analysis is an important evaluation to be concerned. For debottleneck,
Page 412

July 9-11, 2012
inventory cost is arranged from buffer setting at each station. In additional, buffer at each process
has different value added; the more station item passes, the more value added is. Estimating cost
structure as Table 1.
Table 1. Estimating cost of each process
Valueadded/Unit
Station
Baht
OP10MC1
20.00
OP10MC2
20.00
OP20MC1
20.00
OP20MC2
20.00
OP30MC1
40.00
OP30MC2
40.00
OP30MC3
40.00
OP30MC4
40.00
Costtype
RawMaterial
Holdingareacost
Facilitycost
LatePenaltycost
Valueadded/Unit
Station
Baht
Demagnetize
5.00
Washing
30.00
Deburring
10.00
ECM
20.00
Inspection
10.00
laser
5.00
Pressing
10.00
FineBoring
15.00
Baht
250.00
2
4,000Baht/m
100,000Baht/Shift
1,000,000Baht/Lot
RESULTS
From simulation in real world situation, the bottleneck station of this production line
incurs at OP30, Washing of ECM, Inspection and Laser station.
Solutions of all three cases show the behavior of production line. Batch size and
production strategies dramatically impact to continuous production in different criteria. (In case
of buffer allocation, their outputs of each batch size compared in graph are the best outputs from
buffer space adjusting.)
Fig. 2 Comparison of throughput graph for BA, kanban and Base case
As Fig. 2, this compares the throughputs of each method. The large batch size strongly
impacts on throughput rate of this manufacturing. The highest throughput rate is at 72pieces/batch for all cases. When batch size is larger than 72-piece/batch, throughput rate suddenly
decrease.
Page 413

July 9-11, 2012
Considering throughput rate of all approaches at small batch size, the throughput rate of
base case and buffer allocation have higher rate than kanban because push system has exceed
buffer for next process demand. Meanwhile productions speed of kanban system is limited by the
lowest station requisition.
Throughput graph fluctuates at batch size 60, 84 and 108. This phenomenon is caused by
washing station. These batch sizes have to wait another production batch to fulfill the washing
tray; 24 pieces/time, there is a fraction which equals to 12 pieces of items, as table2. Moreover,
the parallel line has distinguished cycle time. Thus, the waiting time results in volume dwindle, as
Table 2.
Table 2. Waiting time at washing station and different throughput effect
As Fig 3 displays, this compares Life-span trends of all approaches. They continuously
increase when batch size grows up. Kanban system has lower make span than the others. In fact
life-span graph is fluctuated because limitation of washing capacity. Therefore, batch size as 60,
84 and 108 pieces have to wait another batch to fulfill washing tray, as Table 2.
Fig. 3 Comparison graph of life span for BA, kanban and Base case
In kanban system, at 24-batch size has higher throughput rate than 48-batch size because
24-batch size flows to downstream more frequently than 48-batch size. However, 24-batch size has
higher average life-span, as Fig 3, since at the washing station until fine boring station; it has to
wait for the
available machines. For example, calculating the average life-span of 24-batch size is
compared with 48-batch size. 48-batch size has double size of 24-batch size. At laser station, both
24-batch size and 48-batch size have to wait a queue on machine 46.65 minutes. The output of 48batch size is two times of 24-batch size. Hence, the average waiting time of 48-batch size is an half
of 24-batch size. The larger volume compensates the stalled time. This results in 24-batch size has
average operating time per item is more than 48-batch size. For example at laser station
Page 414

July 9-11, 2012
Different
Avearge
BatchWaitingtime
Different
Batchsize OP30Line1 OP30Line2
amount/batch batch/day
Throughput
atWashing
amount/shift
waiting
437
24
49.00
45.33
0
437
48
98.00
90.66
0
422
60
122.00
113.33
8.68
2.00
7.00
14.00
437
72
147.00
135.99
0
430
84
173.00
166.21
6.79
2.00
5.00
10.00
430
96
196.00
181.32
0
414
108
219.00
203.99
15.02
4.00
4.00
16.00
422
120
245.00
226.65
0
Fig 4 shows bottleneck ratio of each method. At base case, BN ratio is highest in the all of
methods. Kanban approach is the best solution following by buffer allocation when
concerning bottleneck ratio perspective.
Fig. 4 Comparison of BN ratio for BA, kanban and Base case

In case of push strategy, batch size is extended, that means there is more space for item
storing. As a result, the severity of bottleneck is reduced. Even though buffer is able to relieve
blocking severity, it can relieve in short term.
Fig. 5 Graph of WIP comparison for Push, Pull and Base case
Page 415

July 9-11, 2012
Fig. 5 compares buffer level of all solutions. WIP of base case significantly increases
when batch size is extended. This effect is from buffer storing at front of each stage. Buffer
allocation and kanban arrange buffer space as requirement. This results in having fewer buffers
than that.
Economic analysis shows that the small batch size in kanban system is lower production
cost than the push system.The batch sizeof 84 is economical for base case. It reaches the demand
target and gains medium life-span. 72-piece/batch is suitable for implementation in buffer
allocation. This causes highest demand target, lowest cost and BN ratio in any batch sizes. Finally,
kanban is compatible with 24-piece/batch. However, its throughput rate is lower than another
solution, it still achieves demand target and causes lowest production expense in any cases, as
shown Fig 6.
Fig 6 Graph of operation cost comparison for Push, Pull and Base case
CONCLUSION AND DISCUSSION
This paper presents not only computer simulation to detect bottleneck and propose
debottleneck solutions but also observes characteristics of serial production line by varied
conditions. Referring to three experiments, each solution is able to reduce severity of bottleneck in
different specific conditions. The batch size is avital important factor that influences behavior of
this line. In fact, the batch size is larger than 72-piece/batch resulting in their throughput rate of
any approaches decrease and having similar rate. Furthermore, the batch size significantly affects
to a life-span of works. Their trends are continuous increment while the batch size enlarges.
Each production controlling strategy makes a different work-in-process level. The push
system has higher WIP level than the pull system. Considering cost analysis selects the appropriate
solution. Consequently, push system gains low cost when the batch size is large. Alternatively,
pull system has lowest cost in solutions as the small batch size.
These management methods are difficult to eradicate all bottlenecks. At ECM station has
four substations inside and there is no area to keep buffer between substations. Hence, in order to
achieve better performance, the way of bottleneck reduction could be cycle time reduction by
increasing machine or splitting this process.
ACKNOWLEDGEMENTS
I would like to be thankful Continental Automotive (Thailand) Company Limited for
information, study case model and suggestion during dissertation implementation.
Page 416

July 9-11, 2012
REFERENCES
Chiadamrong N., Kohly P., 2005, A Comparison of the Push and Pull Production Systems at
their Optimal Designs under the Economic Consideration, AJSTD Vol.22 Issue 4, 313-330
Huang M-G., Chang P-L., Chou Y-L., 2000, Buffer Allocation in Floe-shop-type Production
Systems with General Arrival and Service Patterns, Elsevier Science, Computer and Operation
Research 29(2002) 103-121
Kattan I. A., Nunu A A., 2006, Resource Optimization on Flow Shop Scheduling for
Industrial Case Using Simulation, Emerging Trends and challenges in Information Technology
Management Volume1,2
Kuo C., Lim J., Meerkov S. M., 1996, Bottlenecks in Serial Production Lines: a System
Approach, Proceeding of the 35th Conference on Decision and Control Kobe Japan.
Leporis M. and Kralova Z.,2010, A Simulation Approach to Production Line Bottleneck
Analysis, International Conference Cybernetics and Informatics, February 10-13.
Lutz C. M., Davis K. R., Sun M., 1996, Determining Buffer Allocation and Size in
production Lines Using Tabu Search , European Journal of Operational Research
Peng J., 2010, Identification and Solution to Bottleneck of Supply Chain Based on Flexsim,
International Conference on Intelligent Computation Technology and Automation.
Rose C., Nakano M., Tanaka N., 2005, Single Simulation Buffer optimization, JSME
International Journal Vol. 48 No.4, 763-768
Savsar M., 2009, Modeling and Simulation of a Serial production Line with Constant Workin-Process, World Academic of Sciences, Engineering and Technology 2009, 1195-1203
Shim E., Impacts of Matched Batch Sizes on Time Reduction Construction projects, Illinous
State University, USA
Soni A., Nicholas J., 2005,The portal to Lean Principles and Practices for doing More with
Less, Averbach Publication, 89-112
Spiechermann S., Gutenschwager K., Heinzel H., Voss S., Simulation-based Optimization in
the Automotive Industry-A Case Study on Body Shop design, Simulation 75:5, 725-286.
Tempelmeier H., 2003, Practical Consideration in the Optimization of Flow Production
System, International Journal of Production Research,Vol.41 No.1, 149-170
Usano R. R., Marquez A. C., Torres J. M. f., 1995, Advanced Manufacturing System
Dynamics: The Lean Production Approach, System Dynamic95 vol.2, 888-896
Wang H-C.,Chen Y-S., Mathematical Model with Simulation to Find the Optimal Batch size
for a Supply Chain System, Journal of the Chinese Institute of Industrial Engineers,
Vol.22,No.3,262-271
Page 417

July 9-11, 2012
STO157-23
Rapid Wall Building Construction and Conventional Building

Construction-A Case Study
1
Prakash Rao B., 2 Nitin Antony Francis

Associate Professor(Senior Scale),Dept. of Civil Engineering, Manipal Institute of Technology,
Manipal University, Manipal,India
2
II Year M.Tech(CEM) Student, Dept. of Civil Engineering, Manipal Institute of Technology,
Manipal University, Manipal,India
Email: nitinaf@gmail.com, bpkarant@yahoo.co.in
ABSTRACT
In todays World one of the most precious things are Time and Resources. The main factor
in the construction is the utilization of time and resources efficiently. To save both, todays world is
open to innovative ideas for the same. The present paper deals with the comparative study of a two
storey building made with Rapid wall (Gypsum panels) and Conventional Building. The building
used for comparison is a two storey structure constructed with gypsum panels as an initiative by
Fertilizers and Chemicals of Travancore, Kochi called as Rapid House. The structure is located in
Kochi, Kerala and these Gypsum panels were made using Australian Technology. The
conventional building used for comparison has walls made of bricks and slab cast in concrete. The
method of construction, the quantity of raw materials used, the time taken for the construction and
the economy of construction is discussed in this paper
Keywords: resources, innovative ideas, rapid wall, gypsum panels, conventional
INTRODUCTION
There is a huge growing requirement of building materials in India due to the existing
housingshortage of 24.7 million units mainly for the low income groups in urban India. To meet
this challenge, India requires innovative, energy efficient building materials for strong and durable
housing with fast track method of construction at affordable cost concern. The need of the
21stcentury is for energy efficient and eco-friendly products. Rapid wall panel (Glass Fiber
Reinforced Gypsum panel, GFRG) provides rapid or faster construction and contributes to
environmental protection, providing a solution to many of the above issues and concerns. Rapid
wall, also called Gypcrete panel is an energy efficient green building material with huge
potential for use as load bearing and non-load bearing wall panels. Rapid wall is manufactured in a
moulding process using glass-fibre reinforced, water-resistant gypsum plaster and water proofing
additives. All panels are up to 12 meters long and 3 meters high. The panels are cellular in form
and 124 millimeters thick. The formed cells can be used to accommodate building services such as
plumbing and electrical conduits or they can be filled with insulation, for increased thermal
performance, or with concrete for increased load bearing structural capacity .Rapid wall can also
be used as intermediary floor slab/roof slab in combination with Reinforced Cement Concrete
(RCC) as a composite material. Since the advent of innovative rapid wall panel in 1990 in
Australia, it has been used for buildings ranging from single storey to medium - high rise
buildings. It has very high level of resistance to fire, heat, water, termites, rot and corrosion.
Concrete infill with vertical reinforcement rods enhances its vertical and lateral load capabilities.
Rapid wall buildings are resistant to earthquakes, cyclones and fire (5). Axial and shear load tests
have been conducted by Wu and Dare (2004).
Page 418

July 9-11, 2012
CONSTRUCTION METHODOLOGY
As per the building plan, each wall panel will be cut at the factory with millimeter
precision using an automated cutting saw. Door/window /ventilator, openings for AC unit etc will
also be cut and panels for every floor is marked relating to building drawing. Panels are vertically
loaded at the factory for transport to the construction sites on trucks.
a. Conventional building foundation with RCC plinth beams provided with mild
steel rods as startup rods for erection of panels as superstructure of the building.
b. Panel is placed over plinth beam; corner joints up to required height will be infilled with concrete.
c. Cutting of panel is done to provide RCC lintel cum sunshade.
d. Roof panels are embedded with RCC micro beams 100mm*100mm, 10 gauge
weld mesh provided for 50mm thick RCC screed. Embedded RCC micro beams act as T beams.
e. Electrical, plumbing works are carried out and finishing is applied using cement mortar
The panels can be used as load bearing wall, or filler walls for framed structure and as roof slab.
Fig. 1 Detailed cross-section of standard GFRG panel (9)

Wall Erection
Table 1 Types of cavities in panels

No: of Storeys
Type of Cavity of rapid wall
1-2
Unfilled panels
5-6
Filled panels
More than 6
Reinforced concrete filled panels
Note: In case of heavy wind load / Earth quake loads reinforced concrete filled panels are
preferred.
Unfilled panels: The cavities in the Rapid wall also referred to as cells remain unfilled
except for the starter bars provided for the positioning of wall and the joints occurring.
Page 419

July 9-11, 2012
Filled panels: All the cells are filled with concrete but no reinforcements expect for the
reinforcement for joints and starter bars.
Reinforced filled panels: Reinforcements are provided by structural design as per the load
acting on the walls and is filled with concrete.
Filler walls: In case of rapid wall use in framed structure, dowels are provided from the
framed structure and it is concreted at those points.
Fig. 2 Various ways of infilling RCC to increase load capability (8)
Joints
The Joints can be divided into Horizontal joints and Vertical joints
Horizontal Joint:
Foundation joint: The connection of wall and foundation is the plinth beam and starter
bars are placed in position as per the cavity. The starter bars are to be provided for 40cm high and
after the wall panels are erected, the starter bars are concreted to a height of 45cm. In case of
panels starting from existing walls, starter bars are to be inserted into holes drilled and epoxy
grouted.
Top floor wall joint: The starter bars start from the slab level, the concrete is placed in the
wall in case of unfilled panels after placing plywood strip by cutting the web to support the
concrete. The reinforcements at joints continue as it is.
Vertical Joint:
L joint: 3 starter bars are used, one in corner and other in adjacent cell. The horizontal bars
of 6dia are placed at 30cm c/c and the adjacent web is cut to place the steel cage in position, The
concrete is filled after proper alignment of the panel.
T joint: This type of joint occur in two cases, one a continuous panel and a perpendicular
panel. Second, all three panels are discontinuous at the joint. In the first case, inner flange of
continuous panel is cut and adjacent web of perpendicular panel is cut and the starter bars are
provided and is concreted. And in the second case all the adjacent web of the panels is cut and the
starter bars are provided and concreted.
Page 420

July 9-11, 2012
Star Joint: The procedures are similar to the T- Joint
Obtuse angle joint: The web in the adjoining panels are cut, 3 vertical tie rods are provided
and horizontal ties together form a mesh and the cavities are filled with concrete.
Straight Joint: In this case 3 starter bars are provided, one in the Joint and other in the
adjacent cells. The web of adjacent cells is cut in order to accommodate the horizontal tie rods and
the concrete is filled in the cavities.
Note: M20 concrete with 10mm size aggregates are used for concreting.
Filler walls: In case of rapid wall use in framed structure, dowels are provided from the framed
structure and it is concreted at those points.
Fig. 3 Various construction joints used for connecting panels (8)

Slab Casting
The wall panels can support both Reinforced concrete slab and Rapid wall slab. In Rapid
wall slab the Gypsum panels are used for roofing. The procedure for roof slab with panels is as
follows.
The panels are placed with a minimum bearing of 25mm. Micro beams are provided with
reinforcement as per structural design and they are placed by cutting the top of the panel cavity.
The micro beam reinforcement and welded mesh is laid over the panel, and a filled with concrete,
a screed of 5cm of concrete is laid all over the panels. The props are supported below the micro
beams. The panels at joint are placed over tie beams running all over the panels. The
reinforcement of tie beams is as per the structural design. Tie beams are placed in the top of panels
by cutting the webs, and it is located right below the slab. In case of unfilled panels the plywood is
placed over the cut web to place the concrete.
In case of span more than 2800mm, additional panel has to be joined with it. So in such
cases both the slabs are placed abutting each other and webs aligned in the same direction. And
props are supported in the joints.
Fig. 4 Rapid wall slab detail
Page 421

July 9-11, 2012
CASE STUDY
The case considered for comparison is a two storey structure
Rapid House:
Foundation Rubble masonry and plinth beam, wall are unfilled panels and slab is of rapid
wall itself. The joineries are wooden and the sunshades provided are of concrete. The unfilled
cavities were filled with sand for safety purpose which is not considered in this case study.
Conventional Building:
Area same as that of Rapid house, the foundation is rubble masonry with plinth beam.
Walls are of Bricks and slab is Reinforced concrete slab.
Page 422

July 9-11, 2012
Table 4 Comparison based on Additional Quantity of materials used
Item
Rapid
House
Conventional Villa
Bricks
NIL
38000 nos of bricks

used
Gypsum
Panels
362 m2
NIL
Cement
180 bags of additional cement is

to be used for Conventional villa
compared to rapid house ( Brick
masonry and Plastering )
River Sand
NIL
Quarry Sand
17.9 m3 of additional quarry sand

is to be used for conventional
villa compared to rapid house
25mm /
12.5mm stone
aggregates
6.4 m3 of additional stone

aggregate is to be used for
conventional villa compared to
rapid house
Steel
380kg of additional steel were

used in Rapid house compared to
conventional villa
14.5 m3
Table 5 Construction duration

Rapid House
21 days
Conventional Villa
More than 125 days

Advantages of rapid house over conventional villa
Rapid wall construction is very time saving. So the variation in the project cost due to
variation occurred in delay or price escalation is avoided.
The resources used become minimum due to less duration which in turn reduce the manpower
cost in construction.
Cement, Brick and sand used in construction is very less which turns out to be an ecofriendly
technique, thereby saves these resources of nature. Gypsum itself is a byproduct in fertilizer
Page 423

July 9-11, 2012
manufacturing companies, so converting it into panels gives the opportunity of eliminating the
damage to environment.
In the case of unfilled panel usage the cavities in the panel gives a cooling effect inside the
room which in turn reduce the energy consumption.
The wall chasing for laying conduits for plumbing and electrical wiring can be avoided as the
pipes can be laid through the cavities.
The putty or paint used is less as the coverage will be more due to the finished surface of the
panels.
The scaffolding and formwork used is less, Props are mainly used so the rent charge which
comes into the construction cost is reduced.
No lintels required up to an opening of 1.8m for rapid house.
The quantity of water used is also less when it comes to curing and plastering purpose. So it
saves water also.
As it is a clean construction, owing to its manufacture from natural gypsum or by-product,
chemical waste gypsum, it reduces potential damage to the environment (3) being 100%
Recyclable and water, rot & termite resistant.
It is also corrosion free.
It is one of the lowest energy embodied building product in the world today and is eligible for
Carbon Credit (1). In case of low-rise buildings a substantial energy saving of approximately
66% can be made compared to timber frame, clay brick construction.
It is an ideal building material, which requires fire, cyclone, hurricane and earthquake
resistance (6). When have to be used for commercial or industrial construction (over two
storeys)
Disadvantages of rapid house over conventional villa in Indian Context
Use of crane is necessary so the site in which the villa has to be constructed has to have
adequate working space compared to conventional villa.
Security is less when the panels are left unfilled as it easy to drill or cut the gypsum panels.
Skilled supervision is required.
Waterproofing coating for walls of toilets is necessary as the absorption of water compared to
plastered surface is more. And joint sealant has to be provided at every joint.
The width of sunshade that can be provided is limited in rapid house as the lintel size has
limitations in unfilled panels.
Special props are to be fabricated for keeping the wall aligned during the erection process.
CONCLUSION
If we look the construction of rapid houses in a cost wise view point, the quantity of
materials used in construction is less only in the case of unfilled panels. The exact cost variation
cannot be estimated as Fertilizers and Chemicals of Travancore, Kochi hasnt yet launched the
product in the market.When it comes to construction of mass houses for low income segments, it
will be more economic. The main advantage is the eco friendliness of the product and the saving
of resources. The use of scarce natural resources like river sand, water and agricultural land is
significantly reduced. Rapid wall panels have reduced embodied energy and require less energy
for thermo-regulation of interiors. And the most important feature is drastic reduction in time of
construction. Time saved is money saved. It is very suitable for immediate rehabilitation of people
after an environmental disaster. Fast delivery of mass dwelling/ housing is very critical for
reducing huge urban housing shortage in India.
Page 424

July 9-11, 2012
ACKNOWLEDGEMENT
The first author would like to thank Manipal University,Manipal,India for extending
financial support to present the paper in Pattaya, Thailand. The authors would like to express their
utmost gratitude to Mr. M.P. Davis, Manager of civil Maintenance, Fertilizers and Chemicals of
Travancore, Kochi (FACT), who was in charge of the construction of rapid house project that took
place under FACT. Also we express our thanks to Department of FACT training center for
providing us with the data regarding the rapid house.
Page 425

July 9-11, 2012
REFERENCE
(1) Glass fiber reinforced gypsum load bearing (GFRG)Panels for affordable housing in fast
track & Environmental protection, FRBL, http://frbl.co.in.
(2) Dinaker P. and P.K. Aravindan (2004) The Construction manual on Rapid wall/ Gypcrete
construction, IIT madras.
(3) Greg Rice(2009) How an emerging glass-fiber gypsum plaster walling system profit gypsum
industry. Global gypsum Magazine:22-27.
(4) Gypcrete Building India Ltd http://www.gypcreteindia.com/Index.html
(5) http://www.rapidwall.com.au/index.php?
(6) Kang liu+Yu Fei Wu(2008) The effect of longitudinal reinforcement on the cyclic shear
behavior of glass fiber reinforced gypsum wall panels: tests. Mat & Structures 41:649-662.
(7) Wu, Y.F. and Dare, M. P., 2004. Axial and Shear Behavior of Glass Fiber Reinforced
Gypsum Wall Panels: Tests. Journal of Composites for Construction, ASCE, 8 (6): 569-578.
(8) www.scribd.com/doc/72569239/Rapid-Walls
(9) Y.-F. Wu/ Construction and Building Materials 23 (2009) 29052913, The structural behavior
and design methodology for a new building system consisting of glass fiber reinforced gypsum
panels.
Page 426

July 9-11, 2012
STO191-24
Improvement of Aerodynamics Characteristic of Heavy Trucks

Dr. Imad Shukri Ali, Aws Akram Mahmood
College of Eng./Mech, Eng.Dept Babylon University- Hilla / Iraq.
Email: emad.Ali6@gmail.com, aoss.akram@hotmail.com
ABSTRACT
The present work study experimentally and theoretically the effect of changing the
aerodynamic shape of a tractor trailer scaled model on its aerodynamic drag and improving its
aerodynamic characteristic by using modification added on the trailer body .The experiment work
was executed by using wind tunnel with Reynolds No. equals to 106 based on the truck length on
model of 1/30th scale of (Mercedes - Benz 1844 ACTROS Container- Trailer) .The modifications
added to rear was base flap and base flap with splitter, using four inclined angle
(0,10,20and30).The experimental results shows that there is a good reduction on aerodynamic
drag by approximately equals to 18% when the inclined angle equals 10.The splitter addition
produced an improve in aerodynamic reduction on the behavior of the base flap at =20 with 21%
drag reduction. The theoretical study was executed by using CFD package which is ANSYS
FLOTRAN 12.1 by using CAD preparation of two dimensional model with zero yaw angle .The
results obtained for x-component velocity , velocity vectors and stream lines shows good
agreements between the experiment and theoretical work.
Keywords: Drag reduction, CFD , Turbulent flow , Tractor trailer

NOMENCLATURE:
Symbl
Yaw angle
Meaning
Base flap modification inclined angle
Pressure coefficient percentage change
Density
Drag coefficient percentage change
Shear wall
Fuel saving on the drag coefficient change
deg.
deg
-kg/m3
--- 2
N/m
Litter
drag coefficient depending on velocity of vehicle
---
Drag coefficient % change depending on velocity of vehicle
---
Water reading head from manometer
velocity of vehicle
Pfb
Average fore-body pressure
N/m2
Pb
Average base pressure
N/m2
Pn
Local (tap) pressure
N/m2
Free stream pressure
N/m2
Dynamic pressure
N/m2
Reynolds number
--
Re
Page 427
Units

July 9-11, 2012
1. Introduction
One of the most important aim of the aerodynamic drag reduction researches is to save
energy and to protect the global environment, fuel consumption reduction is primary concern of
automotive development. In vehicle body development, reduction of drag is essential for improving
fuel consumption and driving performance, and also the aerodynamically refined body is
aesthetically attractive, it will contribute much to increase the vehicles capacity.
The aerodynamic drag of heavy road vehicles participates significantly on the overall
energy of vehicles efficiency and thus represents a challenge for its optimization. Although the
aerodynamic development of passenger and sport cars has seen much growth, it can be same for
commercial heavy vehicle. The aerodynamic design of heavy vehicle tractor-trailer still needs more
development for minimum fuel consumption.
Heavy vehicle are aerodynamically inefficient compared to other ground vehicle due to
their larger frontal area and bluff bodies shape. It is estimated that a 40-tons articulated truck
travelling at 60 mph consumes about 34 Litters of fuel to overcome drag across a 100-mile high
way stripe ; an average car would consume four time less under similar condition (Zulffaa,K.
et.al,2012).. More energy is consumed in overcoming aerodynamic drag as the vehicle speed up.
Reducing fuel consumption for heavy vehicles can be achieved by altering truck shapes to decrease
the aerodynamic resistance (drag). It is conceivable that present-day truck drag coefficients might
be reduced by as much as 50%,this reduction in drag would represent approximately a
25%reduction in fuel use at highway speeds,an estimated total savings of $1.5 billion per year can
be recognized in the United States alone for just a 6% reduction in fuel use .This reduction
represents 1% of all fuel use in the united state (Fred Browand , et.al ,2004)
Heavy tractor trailer geometry may have many aspects geometrical configuration that
contributes to drag force and can be articulated as source of drag. These drag source can present as
follows (Nabeh N.,2010 ):
1-Tractor geometry.
2-Gap between the tractor and trailer.
3- Under body drag.
4- Wheel aerodynamic.
5- Rear base of trailer.
6- Side mirror.
The schematic of fig(1) depict the dominant percentage drag regions on a tractor-trailer
truck which are the tractor front face ,tractor trailer gap, undercarriage/wheels, and trailerbase.
Fig(1) Graphic depicting the distribution of aerodynamic drag for a heavy vehicle tractor-trailer
truck
The data show that under representative operational conditions a crosswind is present and
the distribution of aerodynamic drag between the tractor and trailer is 35% tractor and 65% trailer
(Drollinger, 1987 ).
Page 428

July 9-11, 2012
2. Aerodynamic Technologies
Numerous aerodynamic devices development are available for tractor-trailer, including roof
fairings (an integrated air deflector mounted on the top of the cab (tractor)), cab extenders
(sometimes called gap seals), which help to close the gap between the tractor and the trailer), side
fairings, and a front bumper air dam(which reduces air flow underneath the truck). These
modification on models can improve fuel economy by over15%, particularly when compared to a
classic profile tractor. To reduce the fore body drag, regions of flow separation need to be
minimized, this might be done by increasing the corner radii and by enhancing the mixing in the
separated shear layer to encourage earlier reattachment. The more difficult problem is to reduce the
base drag because the practical constraints are much more severe here. (J.D. Coon et.al,20104).
All the studied modifications of the general shape of the vehicle improved the aerodynamic
efficiency in a positive way. In the past several aerodynamic devices were developed for the front
and top of the tractor, the back of the trailer and for the gap between the tractor and trailer. Several
aerodynamic aids for the underside of the trailer were investigated and tested in the wind
tunnel.(Storms et.al 2004) studied experimentally the 1/8-scale Generic Conventional Model by
using 12-Feet Wind Tunnel. The addition of side and roof extenders to the back of the cab reducing
the drag at higher yaw angles by up to 35%. The extenders yielded a wind drag reduction of 27%.(
Jason M. Ortega et al. 2004) Studied by using Low speed wind tunnel on a 1/16th scale generic
tractor-trailer model at a width-based Reynolds number of 325,000. The model changeable yaw
angle to be varied between 14o in 2o increments. The devices remounted to the model underbody
and base. The most effective add on drag reduction device for the trailer underbody is a wedgeshaped skirt, which reduces the wind drag coefficient by 2%. For the trailer base the most effective
add-on drag reduction device is a set of curved base flaps having a radius of curvature of 0.91 times
the trailer width. These curved base flaps reduce the wind drag coefficient by 18.8%. ( Kevin
Ihlein et al., 2007) [9]Studied experimentally three different design modifications in order to
observe and calculate the total drag force reduction. On 1:43th scale model .Testing showed that a
trapezoidal fin design on a blunt body model proved to reduce the drag coefficient by 16.8 %.
(Gandert M.R. et al.2008 )Study experimentally on a 1/14th scaled model The experiment shows a
straight side skirts with leading edge profile reduced the drag up to 14%which results in a reduction
of fuel consumption of 7%.
3.Objective of present work
The present study focused on the modifications that can be used to reduces the
aerodynamic drag concentrated by the most important source of drag (i.e. trailer base ) by using
base flaps modification. This type of technologies added on the back base of trailer to study the
effects of changing its inclined angle and also increasing the length of it on the performance.
(Mason, W.T. et al.1999)suggested the splitter device as technology that can be added to the base
of trailer .In present work a combination between the base flap and splitter studied to make the base
flap more efficient than that without splitter. The benefit of this to delay the separation behind the
trailer.
The theoretical part in present study solved by using ANSYS package with FLOTRAN
CFD analysis on two dimensional solid model was constructed semitrailer with Turbulence model
of two equation model
. The output data from the solution was pressure contour, velocity
contour and stream line and velocity vectors on the tractor trailer with and without modification
at =0 only .
4.Experimental Work
In the present investigation the experimental procedure adopted to determine drag
reduction due to different types of modification and to study the change in
aerodynamic
characteristic of the tractor-trailer due to this modification. The experiment was done for scaled
Page 429

July 9-11, 2012
wooden model and tested in low speed wind tunnel with speed of 29 m/s and having a dimension
of(0.45mx0.45m x1.2m)test section fig.2 .The measurement are done with yaw angles from 0 to
15 step 5.
Test model which is used in this study is a 1:30th scaled truck model (Mercedes - Benz
1844 ACTROS Container- Trailer) to permit that the blockage area ratio . fig.3 shows the test
model in the test section of wind tunnel.
Fig.(2) photo of wind tunnel
Fig.(3) photo of test section
All the dimension like width, height and the length of truck model is shown in fig(4).
L6
L2
L11
L5
L12
L3
L1 L7
L8
L4
L10
L9
All dimension in cm
Fig.(4)Test model dimension

5.TractorTrailer design parameters
Throughout the present work non-dimensional parameters are used to characterize
aerodynamically relevant geometry in the tractor-trailer system. For example Trailer Fineness
Ratio, L2/d which is defined as the ratio of trailer length divided by effective diameter .Effective
diameter can be calculated by the following equation, given in (Mason, W.T. et al. 1978)
...(1)
where A is the projected frontal area of the trailer, the value of (d) in present study equals
to 0.13446 m. The baseline trailer had an L2/d = 3.25, Trailer after Body Length Ratio, K/L2:
Trailer after body length ratio is defined as the length of an aft body treatment device divided by
Page 430

July 9-11, 2012
trailer length (K/L2). The baseline trailer had a K/L2 = 0 because no after body device was
installed.
6.Trailer Base Treatment
At the base of a trailer(trailer rear) flows separate from the roof and side edges and circle
inward to produce rotating vortices forming a trailing wake. The after body length
ratio(k/L2=0.065 when =0 fig.(5) . However, length limitations, safety issues, and operational
difficulty made the use of a base flap less practical and unattractive to a vehicle operator .
Also the effect of the value of K/L2 that on trailer base where considered four value of
K/L2(0.23,0.457,0.065and 0.09) in which the later value in present scale of the test model
considered as 4cm and equal to 120cm for full scale model , Such an increase in the length of the
tractor unit could potentially also be used to improve the trucks safety through improvements of
the pedestrian protection, field of view, improved under run protection and truck protection
(Aprosys,2008)
K
L11
L3
Fig.(5) Trailer base treatment technology

7.Calculations of Experimental Work
Three factors has been calculated from experimental data which are pressure coefficient
(Cp), drag coefficient ( ) and fuel saving due to aerodynamic modification.
Pressure Coefficient Pressure value can be measure from the reading of manometer.
The pressure coefficients which is the ratio of static pressure to the dynamic pressure
....(2)
Where
:local pressure
Cp
..(3)
Pressure coefficient change

(4)
Page 431

July 9-11, 2012
Drag Coefficient The factor that represents the drag due to pressure force is which can be
calculated the flowing equation:
=
...
(5)
The drag force in pervious law measured from the drag measurement device from experiment .
Drag Coefficient Reduction
(6)
8.Results and Discussion
8.1-Base Flap Modification Results
Figures(6)to(9)shows the pressure coefficient with yaw angle for different value of the
base flaps inclined angle () from (0to 30) step 10.It is clear from these figures that the base flap
has a positive impact on pressure coefficients for all values for , however it can been seen from
the figures that the best results can be achieved from this modification is happened to occurs
when =10 for which =0 .The solid line curve represent the Cp distribution without
modification, from this figure the efficient value of is 10 in which maximum value of Cp=-0.91
at Y/L3=0.25.
8.2-After Body Additional Length Results
Figures(10,11,12,13) at equals(0,5,10) show that optimum length ratio when
K/L2=0.09for maximum allowable length (4cm) for model and (120cm) for full scale, the value of
CP at Y/L3=1 is (-0.94) . But in different value of Cp and there is a difference between them in the
curves at K/L2=0.045and K/L2=0.022 it was noticed that the previous curve advanced than the
curve of k/L2=0.045 this means the separation is advance with this after body additional length.
8.3-Pressure Coefficient Percentage Improvement
Figures from (14) to (16) shows the conditions of the pressure coefficient depending on the
location of the modification. In which on trailer rear there was increasing in Cp( positive value of
Cp)while on the trailer face there was reduction in Cp (negative value of Cp%).
Fig.(14) shows the pressure coefficient increasing on the rear of trailer with base flap
modification with four yaw angle at different value of . It is shown that the maximum increase in
Cp was happens with a base flap inclined by an angle () equals to 10 with increases in pressure
equals to 9.7%. While for =0,=20,30 the increased in pressure was not to exceeded 6%.
Fig.(15) shows the Cp increase with yaw angle at each value of K/L2(after body length
ratio)modification. It is noted that the maximum increasing in pressure when the after body length
ratio K/L2=0.09with maximum increase in Cp% equals to 9% at =15 and then followed by
curve of K/L2=0.06, 0.045 and 0.022 respectively.
Fig.(16) shows the pressure coefficient increasing by using base flap modified with splitter
for each value of . In this figure the Cp change represent the ratio of the difference between the
Page 432

July 9-11, 2012
modified base flap with splitter and without modification. From the figure we can noted that there
is an improvement when =20.The two curves for both =10,20 gives good results for which
the maximum value of increasing equals to 12% at =5.
8.4-Drag Force Results
Fig.(17) shows the drag coefficient of the base flap modification for each value of with
changing yaw angle. This figure shows a comparison between the case of without modification
(solid line) at four yaw angle and with changing the base flap inclined angle (dashed line). It is
noted that when =10
has a lower value than the other curve excepted when =0. All the
dashed curve lying under the solid curve which means that there is a reduction of the drag
coefficient with all modification.
However from this curve that all the value of
curve have a good reduction of
with modification.
increase as yaw angle increase and all the
Fig.(18) illustrate the drag coefficient improvement of modified base flap with splitter at
each value of , it is noticed that as the splitter added there is an improvement in value of
when
=0 ,this mean that a reduction in
as the splitter added. It is noted that all the curves lying
under the solid curve (without modification) this means there was benefit of the use of this
modification.
,it is clear
Fig.(19) shows the percentage change in value of pressure coefficient as
from this figure that the maximum reduction of
at =10 with =0,5,10 with maximum
at equals to 22.5% =10.While for the curve when =5 have maximum
improvement of
reduction when =5 with value of
=13%,all the curve have the same behavior in which there
is an improvement in drag coefficient value which mean that there is a reduction occurs.
Fig.(20) show the percentage drag coefficient change with yaw angle at each value of
with modified base flap (by adding splitter) . It is noted from this figure there was a reduction in
value of
equals to approximately 21% at =20,knowing that this ratio represent the ratio of
the different between the
with base flap with splitter and
with base flap without splitter.
Fig.(21) shows the drag coefficient of the after body additional length . The solid curve
represent the drag coefficient without modification and the other dashed curve show the drag
coefficient with modification with different length ratio of base flaps(K/L2).From the figure the
lower drag coefficient was at K/L2=0.099 at =0 and at =15 and follows with K/L2=0.066, this
shows that as the base flap length increase the pressure at trailer base increase.
Fig(22)Represent the percentage drag coefficient reduction with yaw angle at increasing
the base flap length ratio modification . It is noted that the maximum reduction at K/L2=0.09 with
=19this due to the fact that as the length increase after body increase the pressure
value of
increases.
Fig.(23) shows the bar-chart of the drag force improvement by changing the base flap
inclined angle() this figure show that the best value of is 10 with drag reduction of 19%.
Fig.(24)represent the drag reduction when the base flap modified by splitter. It is clear the
maximum effect of the splitter on the base flap when =20 with drag reduction of 25%.
Page 433

July 9-11, 2012
Fig.(25) Show the drag reduction of the drag by changing the after body additional length
in which that there is an include in the value of the drag reduction from K/L2=0.022 to reaches the
maximum reduction at K/L2=0.099 with value of 13%.
8.6 Theoretical Results
The theoretical results discussed in this section represents the pressure coefficients
distribution of the tractor trailer with and without modification on the nodes that located on tractor
trailer surface where the velocity component specified to be zero. The data taken when the yaw
angle equals to zero .
Fig.(26) Shows a comparison between the experimental results and theoretical results over
the roof of the trailer. From the figure it is noted from the pressure coefficient there is a good
agreement between the experiment and the theoretical work and also have the same behavior.
Fig.(27)Show the base flap modification with different value of . It is noted there is a
good increase in pressure with =10 and this agree with experimental work with small different in
value this due to the two dimensional solution.
Fig.(28) Show the effect of the increasing the length of the base flap on the pressure
coefficient on the trailer base theoretically. The data shows that there is appositive impact on the
pressure value as the length increase and this also agree with experiment data.
The figures from (29)to(37) show the theoretical results by using ANSYS package. The
data presented the pressure and x-component velocity and the stream line of the summation of the
velocity data presented with each modification and compared the modified results and without
modifications to show the behavior of the flow around the tractortrailer after these modification.
The figures from (29) to(31) show the pressure and velocity and stream line of flow around
the truck without modification .At fig.(29) noted that the maximum pressure region concerted on
the front face of the tractor and then there is awake region in the zone between tractor and trailer.
The downstream region have equally pressure gradient until reach the outlet of the wind tunnel
boundaries. Fig.(30) show velocity in the X-direction which was selected because it is in the
direction of the flow .It can be noted that the velocity approach zero on the tractor trailer surface
and due to the boundary layer effect and the sharpening edge of the tractor face there is
disturbances in the velocity flow above the tractor and in the region between the tractor trailer.
Figure from(32) to(37) shows the contour plot and vectors on particles flow of adding the base flap
for different inclined angle. It is noted that there is a difference in the wake region behind the
trailer. From these figurer the distance of the wake bubble from the trailer rear is longer than that
without modification.
9.Conclusions and Recommendations
1- The best results that could be achieved using the base flap modification was =10.
2- The best effect of splitter addition to the base flap is at =20.
3- As the length of the straight base flap increases there is appositive pressure impact
pressure on the trailer rear due to delaying the wake bubble of separation.
4- The best value of the after body length ratio (K/L2) is 0.099.
5- There is a good agreement between the experimental and theoretical results in the
phenomena of the flow .The theoretical results can be used to show the effect each modification on
the aerodynamic characteristic for full future work.
Page 434

July 9-11, 2012
REFRENCES
Aprosys.," Guidelines for Integrated Design and Evaluation of Advanced Vulnerable Road
User Protection Systems", Integrated Project on Advanced Protection Systems: Project
no. FP6-PLT-506503,[online] Available from:
B. Storms, D. Satran, J. Heineck and S. Walker, "A Study of Reynolds Number Effects and
Drag-Reduction Concepts on a Generic Tractor- Trailer ", 34th AIAA Fluid Dynamics
Conference and Exhibit ,Paper No.AIAA-2004-2251, 34th AIAA Fluid Dynamics
Conference, June 28-1, 2004.
Barlow, J. B. Rae, W. H. Pope, " Low Speed Wind Tunnel Testing", Third Edition, John
Wiley and Sons, Inc., (1999).
Christian Navid Nayeri, Johannes Haff, David Greenblatt, Lennart Loefdahl and
Christian Oliver Paschereit "Drag Reduction on a Generic Tractor-Trailer using Active Flow
Control in Combination with Solid Flaps" The Aerodynamics of heavy vehicles II:
Trucks, Buses and Trains, pp. 179-191. Springer, Heidelberg,(2009).
Drollinger, R.A. ," Heavy Duty Truck Aerodynamics", SAE 870001,(1987).
Fred Browand , Scott Johnston, " DOE Project on Heavy Vehicle Aerodynamic Drag ",
Heavy Vehicle Systems Optimization Program ,PP(4-8),2004.
Gandert M.R. Van Raemdonck and Michel J.L. van Tooren., " Design Of an Aerodynamic
Aid for Colloquium on:Bluff Bodies Aerodynamics & Applications Milano, Italy, July,
2024 2008the Under body Of A Trailer within A Tractor-Trailer Combination",
BBAA VI International
J.D. Coon and K.V. Visser, "Drag reduction of Tractor-trailer using
planner boat tail plates" The Aerodynamics of heavy vehicles: Trucks, Buses and
Trains",pp249-266 Springer,(2004).
Jason Ortega ., Kambiz Salari., "Investigation of a Trailer Underbody Fairing for Heavy
Vehicle Aerodynamic D-Reduction", SAE International, Document Number: 2008-012601, October, (2008).
Kevin Ihlein ., Kurt Toro Ryan Bam and White., "Truckin' on Drag Coefficients of Tractor
Trailer Trucks", ME 241 Professor Roger Gans, May,2007.
Kambiz Salari,"DOEs Effort to Reduce Truck Aerodynamic Dragthrough Joint Experiments
and Computations", Lawrence LivermoreNational Laboratory, DOE Annual Merit
Review, Project ID #vss_14_salari, May 19, 2009.
Mason, W.T. and Beebe, P.S. ,"The Drag Related Flow Field Characteristics of Trucks and
Buses", Aerodynamic Drag Mechanisms of Bluff Bodies & Vehicles, Plenum Press,
New York, pp. (45-91).
Nabeh N., " Computational and Experimental Investigation of Drag Reduction for TractorTrailer Geometry Using Active Flow Control", Phd. thesis, Mech. Eng. Dept.,
University of Tech, 2010.
Zulffaa,K. , Antonio,F, " Fuel Saving on a heavy Vehicle via Aerodynamic Drag Reduction",
Elsevier Journal ,UK,PP(275-287),2010.
Page 435

July 9-11, 2012
1
0.8
wi th out modi fi cati on
Y/ L3
=0
=10deg
=20deg
0.6
=30deg
0.4
0.2
-1.04
-1
-0.96
-0.92
-0.88
CP
Fig (6) pressure coefficient distribution Trailer rear with base flaps modification at =0
0.8
with out modification

=0
3
L
/
Y
=10
=20
0.6
=30
0.4
0.2
-1.04
P
C
-1.08
-1
-0.96
-0.92
Fig (7) pressure coefficient distribution Trailer rear with modification at = 5
Page 436

July 9-11, 2012
1
0.8
3
L
/
Y
0.6
WITH OUT MODIFICATION
=0
=10
=20
=30
0.4
0.2
-1.12
-1.08
P
C
-1.16
-1.04
-1
-0.96
Fig(8) pressure coefficient distribution on Trailer rear with modification at =10
0.8

=0
3
L
/
Y
=10
=20
0.6
=30
0.4
0.2
-1.04
P
C
-1.08
-1
-0.96
-0.92
Fig(9) pressure coefficient distribution Trailer rear with modification at =15
Page 437

July 9-11, 2012
1

K/L2=0.022
K/L2=0.045
K/L2=0.066
K/L2=0.09
Y/L2
0.8
0.6
0.4
0.2
-1.08
-1.04
-1
-0.96
-0.92
CP
Fig (10) pressure coefficient distribution Trailer rear with after body length modification at =0
Y/L3
0.8
WITH OUT MODIFICATOIN

K/L2=0.022
K/L2=0.045
K/L2=0.06
K/L2=0.09
0.6
0.4
0.2
-1.12
-1.08
-1.04
-1
CP
-0.96
-0.92
Fig (11) pressure coefficient distribution on Trailer rear with =5
Page 438

July 9-11, 2012
1
WIITHOUT MODIFICATION
K/L2=0.022
K/L2=0.045
K/L2=0.066
K/L2=0.09
Y/L3
0.8
0.6
0.4
0.2
-1.16
-1.12
-1.08
-1.04
-1
CP
Fig (12) pressure coefficient distribution trailer rear with different of K/L2 at =10

K/L2=0.022
0.8
Y/L3
K/L2=0.045
K/L2=0.066
K/L2=0.09
0.6
0.4
0.2
-1.2
-1.16
-1.12
-1.08
CP
-1.04
-1
Fig(13) pressure coefficient distribution on Trailer rear with K/L2at =15
Page 439

July 9-11, 2012
10
8
=0deg
=10deg
=20deg
%
p
C
=30deg
0
0
12
16
yaw angle(deg)
Fig(14) pressure coefficient distribution increasing on trailer rear with yaw angle of base flaps
modification
12
K/L2=0.0228
K/L2=0.0457
K/L2=0.0686
K/L2=0.09
8
%
e
v
a
P
C
-4
-8
0
yaw angle(deg)
12
16
Fig(15) pressure coefficient increasing on trailer rear with after body length ratio
Page 440

July 9-11, 2012
14
12
10
%
v
a
P
C
= 0deg
= 10deg
= 20deg
= 30deg
6
2
0
12
16
yaw angle(deg)
Fig(16) pressure coefficient distribution increasing on trailer rear with yaw angle with splitter
2.4

= 0deg
= 10deg
2
= 20deg
CD
= 30deg
1.6
1.2
0.8
YAW ANGLE
12
16
Fig(17) drag coefficient of base flap modification with yaw angle
Page 441

July 9-11, 2012
2.4
without modification
=0deg
=10deg
=20deg
CD
=30deg
1.6
1.2
0.8
0
12
16
yaw angle(deg)
Fig(18) drag coefficient of base flap modification with splitter
25
20
15
%
D
C
10
=0deg
=10deg
=20deg
=30deg
0
0
yaw angle(deg)
12
16
Fig(19) The change in drag coefficients with yaw angle at each value of
Page 442

July 9-11, 2012
30
20
10
0
0
12
16
yaw angle(deg)
Fig(20) drag coefficient decreasing on trailer rear with base flap inclined angle modified
splitter
2.4
CD
1.6

K/L2=0.022
K/L2=0.045
K/L2=0.06
K/L2=0.09
1.2
0.8
0
yaw angle(deg)
12
16
Fig(21) Drag coefficient on trailer rear with after body length ratio
Page 443
with

July 9-11, 2012
25
20
%
D
C
K/L2=0.022
K/L2=0.045
K/L2=0.06
K/L2=0.09
15
10
0
0
12
yaw angle(deg)
16
Fig(22) drag coefficient decreasing on trailer rear with base flap additional length
Fig(23) drag reduction with different value of
Fig(24) drag reduction with different value of
Page 444

July 9-11, 2012
Fig(25) drag reduction with different value of K/L2
-0.88
pressure coefficinet
-0.92
-0.96
-1
Experimental
Theortical
-1.04
-1.08
-1.12
0
0.2
0.4
0.6
X/L2
0.8
Fig. (26)Comparison between the experimental results and theoretical results over the roof of the
trailer
Page 445

July 9-11, 2012
1
0.8

0.6
= 0deg
Y/L3
= 10deg
= 20deg
= 30deg
0.4
0.2
0
-0.98
-0.96
-0.94
pressure coefficient
-0.92
-0.9
Fig. (27)pressure coefficient distribution trailer rear with each value of
0.8

K/L2=0.022
K/L2=0.045
K/L2=0.066
K/L2=0.099
0.6
0.4
0.2
0
-0.98
-0.96
-0.94
-0.92
-0.9
Fig. (28)pressure coefficient distribution trailer rear with each value of K/L2
Page 446

July 9-11, 2012
Fig. (29)Pressure distribution contuor without modification
Fig.(30)Vx contuor without modification
Fig.(31) Particle trace around the vehicle model velocity contour without modification
Page 447

July 9-11, 2012
Fig.(32) Vx velocity component countour with =0
Fig.(33) Particle trace around the vehicle model velocity contour at =0
Fig.(34)Vx velocity component countour at =10
Page 448

July 9-11, 2012
Fig(36)Vx velocity component contour at =20
Page 449

July 9-11, 2012
STP6-2
Using Scanning Electron Microscope to study the effects of

different photoperiods on panicle initiation of KDML 105 rice
during and off cropping season
Nuntiya Kumboonreanga, Hatsachai Boonjunga,Sodchol Wonprasaida
And Yuvadee Manakasema
a
School of Crop Production Technology, Suranaree University of Technology, Nakhon
Ratchasima 30000, Thailand.
E-mail:boonjung@sut.ac.th
ABSTRACT
SEM was used to examine effects of photoperiod on PI of KDML 105 rice. The
experiments were done on cropping season (May August) and off cropping season (November
February). In cropping season, the photoperiod of 10, 11, 11.30 hrs. gave the PI at 37 DAS
whereas there are no sign for PI at 150 DAS for the treatment of photoperiod at 12 hrs and control
(12.4 hrs.). For off cropping season, the rice was cultivated in the field. There were three planting
date, 20th November, 20th December and 20th January. The result shown all three planting dates
gave the same value of PI at 36 DAS (the average photoperiod in November - February is 11.29
hrs.). As it had no significant different for PI at 37 DAS (short photoperiod in cropping season),
KDML 105 could cultivate in both seasons.
Keywords:PI, KDML105, SEM, photoperiod, off cropping season.
INTRODUCTION
KDML 105 has a premium cooking and eating quality and is the most popular cultivar
among domestic and oversea consumer. It is well known as Thai aromatic rice or Jasmine rice.
KDML 105 is photoperiod sensitive variety and normally grows once a year (Tongdeetae, 1998).
The panicle initiation (PI) in rice plants depends on the critical day length refers to the length of
photoperiod in excess of which no panicle initiation can occur. Critical day length differs between
species and among varieties within species (Vergara, 1970). Panitchapatet al. (1986) reported that
critical day length of KDML 105 is 11.52 hrs. and the PI occurs when the rice plants receive 15
photo inductive cycles. Stereo microscope has been used to identify PI when the morphology of
shoot apex changes to primary rachis branch stage (Vegara, B.S. and Chang, T.T., 1985;
Thongsima, Y., 2001).
However Promratrak, K. (2004) used SEM (scanning electron
microscope) to investigate PI when the shoot apex of KDML 105 changed to neck node
differentiation stage. According to this finding, it acquired 3 days to develop from neck node
differentiation stage to primary rachis branch stage.
The objective of this study was to use SEM to inspect PI of KDML 105 rice during
cropping season and off cropping season.
Page 450

July 9-11, 2012
Cropping Season Experiment
This experiment was conducted in the green house at Suranaree University of Technology
(SUT), Nakhon Ratchasima. KDML 105 seeds were soaked for 24 hrs. and incubated for 48 hrs.
before sown on 1st May 2010 with 6 distributed seedlings in a 12 inches diameter of black plastic
pot at the total of 300 pots. Water level of 3 cm was maintaining throughout the experiment period.
Each of 60 pots was arranged for 5 photoperiod 10, 11, 11.30, 12 hrs.d-1and control (growing
under natural light with an average of 12.40 hrs.d-1). Black cloth was employed to manipulate
photoperiod treatments.
Off Cropping Season Experiment
Rice was cultivated in the field at SUT. Fifteen day old seedlings were transplanted 1 plant
per hill at the spacing of 25x25 cm.. There were 3 planting dates; 1) 20th November 2010 2) 20th
December 2010 and 3) 20 January 2011 with 4 replications laid out in RCBD. Monthly average of
photoperiod of November, December, January and February were 11.24, 11.18, 11.26 and 11.48
hrs.d-1respectively. Average temperatures between November to February were 22-23 c. as shown
in Fig.1.
Fig.1 Monthly average of photoperiod (-) and temperature (--) from January 2010 to
February 2011.
Data Collection
Both experiments were collected daily day length, daily maximum and minimum
temperature, DAS to PI, flowering, maturity and yield.
Sample Preparation
Both experiments were randomly selected 4 main culms from different hill for PI
investigation and repeated every 3 days until PI was accomplished. Stereo microscope was used to
examine spikelet primordial stage prior to SEM sample preparation. Stop sampling if the spikelet
primordial stage was determined. SEM sample preparation followed the procedure of Moncur
(1988).
SEM Image for PI Identification
The morphological change of the shoot apex in the rice plant from vegetative to PI and
primary rachis branch primordial were reported in Matsuo, T. and Hoshikawa, K. (1993).
Page 451

July 9-11, 2012
Vegetative Stage
Fig.2 The vegetative stage image of KDML 105 (SA - shoot apex, LP- leaf primordial).
Panicle initiation (PI) stage
Fig.3 The PI image of KDML 105 (am apical meristem, LP-leaf primordial, NN neck
node primordial).
Primary rachis branch stage
Fig.4 The primary rachis branch image ofKDML 105 (H- hair, LP - leaf primordial, PR- primary
rachis branch primordial).
RESULTS
Cropping Season
Using SEM, rice shoot apex of KDML 105 was investigated under 5 different
photoperiods to identify DAS to PI. The results showed that photoperiod of 10, 11 and 11.30 hrs.
for 12 cycles could induce PI with the neck node primordial stage (Fig.3) and acquired 3 days to
attain primary branch primordial stage (Fig.4). At 150 DAS, under 12 hrs. photoperiod and longer,
Page 452

July 9-11, 2012
the shoot apex still remained developed leaf primordial (vegetative stage) as shown in Fig.2. This
work confirmed the finding of Panitchapat, V. et al. (1986), Thongsima; Y. (2001) and
Promratrak, K. et al. (2005) where they used the primary rachis branch primordialstage (Fig 4) as
PI of KDML 105. Photoperiod equal and less than 11.30 hrs. instigated KDML 105 about 37 days
from sowing to PI whereas rice under longer photoperiod nevertheless developed vegetative stage
at 150 DAS.
Off Cropping Season
KDML 105 were cultivated in the field at three planting dates (November, December and
January) under short photoperiod as shown in Fig.1. It was found that shoot apex of all sowing
dates took 36 days from sowing to PI. All sowing dates were harvested at 116 DAS and yields
were 4.06, 5.31 and 3.62 t. ha-1 for November, December and January, respectively.
CONCLUSIONS
SEM gave more precisely on days to PI (36-37 days) caused by the effects of short
photoperiod in both cropping seasons.
The effects of short photoperiod on rice could be studied outside the growth chamber.
KDML 105 could cultivate in both cropping seasons.
ACKNOWLEDGEMENTS
The authors wish to thank Suranaree University of Technology for all supports.
Page 453

July 9-11, 2012
REFERENCES
Matsuo, T. and Hoshikawa, K. 1993. Scince of the Rice Plant Volume One Morphology, Food and
Agriculture Policy Research Center, Tokyo.
Moncur,M.W. 1988. Floral development of
tropical and subtropical fruit and nut species: an atlas of scanning electron micrograph,
CSIRO, Melbourne.
Panitchapat,V., Limptongkun, S. and
Nuthchawat, S. 1986. Rainfed Rice. Training Division, Rice Research Institute,
Department of Agriculture, Ministry of Agriculture and Cooperatives, Bangkok.
Promratrak, K. 2004. Effects of Photoperiods on Morphological Changes in Rice Shoot Apex,
Master Thesis, Kasetsart University, Bangkok.
Tongdeetae, S. 1988. KDML 105 production technology, Department of Agriculture, Ministry of
Agriculture and Cooperatives, Bangkok.
Tongsima, Y. 2001. Variability of development and growth of rice, Master Thesis, Kasetsart
University, Bangkok.
Vergara, B.S. 1970. Rice Production Manual, IRRI, Philippines.
Vergara, B.S. and Chang, T.T. 1985. The Flowering Response of the Rice Plant to Photoperiod,
Forth Edition, A Review of The Literature, The International Rice Research Institute,
Laguna, Philippines.
Page 454

July 9-11, 2012
STP29-5
Spore forming of Bacillus cereus in pasteurized school milk of

small diary plant (Northeast of Thailand)
Jindawan Wibuloutaia, Thidarat Somdeea, Prachumporn Laupraserta and Jirapa Phetsomb

Faculty of Public Health, Mahasarakham University, Kantharawichai District, Maha Sarakham
44150, Thailand.
b
Biology Department, Faculty of Science, Mahasarakham University, Kantharawichai District,
Maha Sarakham 44150, Thailand.
E-mail: Jindawan.w@msu.ac.th
ABSTRACT
The Bacillus cereus contamination in milk is critical affected in human health and safety.
In order to determine the number of B. cereus, a total of 50 milk samples from various sampling
points along milk processing lines were collected in dairy plants between October and December,
2011. These samples included raw milk from the holding tank in front of dairy factory (M1), the
balance tanks (M2), and the mixed tanks (M3). The pasteurized milk was collected from the
holding tank (M4) and the packaging machine (M5). The swab sampling points along the dairy
milk tanks were determined and found as positive results. The highest B. cereus number was found
in M2 and M3 that resulted from inadequate sanitizing. In contrast, the raw milk had the low B.
cereus number among sampling points. There was implied to concern the sanitization of milk
processing because of spore forming in equipment. However, the contamination may occur with
several sources such as raw milk, animal feed, soil, faeces, or climate that was the beginning of
microbial contamination.
Keywords: Bacillus cereus, contamination, school milk

INTRODUCTION
Pasteurized milk is enriching food for children in many ages. Most of the Asian countries
encourage people to supply milk to their childs. The Thai government has established the plan to
provide the free-pasteurized milk to the elementary schools by using the dairy farm near by the
local school. The raw milk was delivered to the small diary factory that may contain the
pathogenic bacteria in theirs conveys. The pasteurized milk is transported from the storage room in
dairy plant to local school every day. However, the fresh pasteurized milk has the spoilage
problems. The contaminated B. cereus in pasteurized milk had major concerns for the dairy
industry since the organism causes outbreak of food poisoning (Overcast and Atmaram, 1974;
Johnson, 1984; Christiansson et al., 1989). The microbial contamination was primary cause of
food borne illness through the production of toxins. The B. cereus was considered as food
poisoning that was first reported in contaminated vanilla sauce with various symptoms such as
diarrhea, nausea and abdominal pain (Hauge, 1950). Most of foodborne bacterial toxins were
often caused acute gastroenteritis. B. cereus was widely recognized as a foodborne pathogen that
caused acute gastroenteritis in mild symptoms (Terranova and Blake, 1978; Kramer and Gilbert,
1989; Fermanmian et al., 1993). The contaminated B. cereus in pasteurized milk may originate
from spores that present in raw milk or farm environment (Coghill, 1982; Crielly et al., 1994;
Davies, 1975; Griffiths and Phillips, 1990). The spore-forming ability of Bacillus spp. is easily to
survive during food processing treatments such as milk or juice pasteurization (Christiansson et al.,
Page 455

July 9-11, 2012
1999). However, the milk processing should be prevented in bacterial contamination that lead to
spoilage problems in pasteurized milk and cause human disease.
The purposes of this study were: (1) to investigate the presence of vegetative cells and
spores of B. cereus in milk processing line; (2) to confirm and determine the spores of B. cereus in
milk processing tanks by swab technique.
Sample collection and preparation
Fifty milk samples were collected from a dairy plant in Northeast of Thailand during
October to December, 2011. The samples were classified into two groups: (1) raw milk included
the holding tank (M1), the balance tanks (M2), and the mixed tanks (M3), and (2) the pasteurized
milk collected from holding tank (M4) and the packaging machine (M5) (Figure 1). Each milk
sample was divided into two bottles and kept in 8 oC before enumerated vegetative cells and spores
of B. cereus. The milk samples for the spore testing had been heat-treated at 75 oC for 20 min in a
water-bath before added in the media culture. The swab samples were aseptically collected from
stainless surface of milk tanks (M1-M5). Each swab sample was resuspended in 10 ml of brain
heart infusion (BHI) broth (Difco Laboratories) and kept at 8 oC for 14 days.
Enumeration of B. cereus isolated from milk samples and swabs
B. cereus vegetative cells were determined after samples had incubated at 8 oC for 2 days.
Counts of B. cereus vegetative cells were performed by surface-plated of 0.1 ml milk on culture
media. The media contained polymyxin, egg yolk, mannitol, bromothymol blue (PEMBA) agar
(Oxoid-Unipath). The presence of spores was determined after incubated milk samples at 8 oC for
14 days. The B. cereus spores were counted by using 0.1 ml of milk sample to grow on surfaceplated PEMBA agar. The vegetative cells were counted on the PEMBA plate after it had been
incubated at 30 oC for 24 to 48 h. Then B. cereus colonies were enumerated.
The swab samples were suspended in BHI broth and kept in 8 oC for 14 days that were
used for numbering the B. cereus. The mixed swab sample and media were carried out as
described previously.
RESULTS
The distribution of B. cereus in milk samples
The results showed the average number of B. cereus vegetative cells in milk samples (M1M5) after enrichment at 8 oC for 2 days (Table 1). The milk sample from the holding tank (M1)
had the low number of B. cereus (41-48 cfu ml-1). The average number of vegetative cell was high
when determined at M2, M3, M4 and M5. Interestingly, on December, milk samples from M2,
M3, M4 and M5, showed higher number of B. cereus vegetative cells than October and November.
The environmental temperature during October to December was slightly decreased then there
were the present of Bacillus species in the milk processing. These species were indicated in
preference to grow in low temperature. Nevertheless, the growth of Bacillus species were also
affected by the seasonal changes that classified as psychrotrophic and thermophilic bacterial
species. The previous report determined the number of B. cereus isolates in summer season that
indicated the seasonal changes influence to the bacterial population in milk (Lin et al., 1998). The
raw milk samples (M2 and M3) showed 2.68.1x105 cfu ml-1 which was higher than M4 and M5
(1.62.3x105 cfu ml-1). The previous report showed the B. cereus vegetative cells in milk samples
which came from raw milk. The previous report supported our result which M1 was the main
source of contamination (Griffiths and Phillips, 1990).
Page 456

July 9-11, 2012
Fig. 1 The scheme of milk processing line and sampling points.

The presence of B. cereus spores in milk samples
The B. cereus spores were determined in milk samples (M1-M5) after enriched at 8 oC for
14 days. The results showed in table 2. None of the milk samples (M1) contained B. cereus
vegetative cells. Counts of B. cereus in milk samples (M2 and M3) were low with 2.4-5.1x105 cfu
ml-1. The comparison of vegetative cells and spores number in samples M2, M3, M4 and M5
found that the spore number was slightly lower than vegetative cells for all sampling points.
However, the pasteurized milk had low B. cereus vegetative cell when compared with raw milk.
The average count of B. cereus in pasteurized milk was less than 1.1x105 cfu ml-1.
Table 1 The average number of B. cereus isolates from the milk samples in a dairy plant during
October to December, 2011.
Sampling
point
Number of B. cereus (cfu ml-1)

October November December
M1
45
41
48
M2
5.6x105
2.6x105
6.7x105
M3
7.1x105
6.4x105
8.1x105
M4
2.3x105
1.7x105
1.8x105
M5
1.2x105
1.5x105
2.1x105
*enrichment at 8 oC for 2 days
Page 457

July 9-11, 2012
Table 2 The average number of B. cereus spore from the milk samples in a dairy plant during
October to December, 2011.
Sampling
point

October November December
M1
ND
ND
ND
M2
2.4x105
2.6x105
3.7x105
M3
5.1x105
3.2x105
2.8x105
M4
5.9x104
7.2x104
1.1x105
M5
1.8x104
1.2x104
1.5x104
*enrichment at 8 oC for 14 days

ND = not detected at the sensitivity of 5 cfu ml-1
The confirmation of B. cereus in swab samples
The swab samples were tested to confirm the spore forming in surface stainless milk
tanks (M1-M5). The results were shown in table 3 and figure 2. The average B. cereus
vegetative cells count from M1 was less than 15 cfu ml-1. The swab samples from M2 and
M3 had the vegetative number reached to 39 cfu ml-1. However, the swab samples from
pasteurized tank (M4 and M5) also found the B. cereus vegetative cells with 12-16 cfu ml-1.
The presence of B. cereus vegetative cells in swab samples indicated that the milk
processing was possible to be source of B. cereus in the pasteurized milk. The B. cereus
spore could form biofilm in the milk tank that was a major source in milk contamination.
Comparison of B. cereus spores adhering to stainless steel surface was better than vegetative
cells in milk media (Peng et al., 2001; Ronner et al., 1990). The adhesion capability was
different in milk-borne microorganisms to stainless steel when contained milk. Especially,
the whey protein indicated the increasing of adhesion of microorganism to stainless steel,
rubber and glass surfaces (Speers and Gilmour, 1985). In addition to the differences of
season guided to ability and species of Bacillus to survive in the milk process. That is
depended on the Bacillus spp.
Page 458

July 9-11, 2012
Table 3 The average number of B. cereus isolates from swab milk samples of each sampling point
in a dairy plant during October to December, 2011.
Sampling point
October
November December
M1
121
131
151
M2
304
353
384
M3
324
393
343
M4
152
131
132
M5
121
122
161
SD = standard deviation
DISCUSSION
The contaminated B. cereus in pasteurized milk was possible due to obtain from
environment and milk process. The raw milk was also the primary source of B. cereus
contamination. Thus, the sample should be collected from farm areas in different periods of
time. However, the finding of B. cereus on the surface of milk tank leaded to the
contamination along the milk processing consequence to short-shelf life and human diseases.
This finding may help to concern the hygienic system of cleaning in milk process.
Fig. 2 The average number of B. cereus isolates from swab milk samples of each sampling point in
dairy plant during October to December, 2011. (M1: front of dairy plant; M2: balanced tank; M3:
mixed tank; M4: holding tank; M5: packaging machine)
ACKNOWLEDGEMENTS
The authors would like to acknowledge the Mahasarakham University for financial. We
are gratefully for help from the Biology Department, Faculty of Science and the Protein and
Enzyme Technology Research Unit in Mahasarakham University.
Page 459

July 9-11, 2012
REFERENCES
[1] A. Christiansson, A. S. Naidu, I. Nilsson, T. Wadstrom, and H. E. Pettersson, Toxin production by
Bacillus cereus dairy isolates in milk at low temperatures, Appl. Environ. Microbiol. 55, (1989), pp.
2595-2600.
[2] A. Christiansson, J. Bertilsson, and B. Svensson, Bacillus cereus spores in raw milk: factors
affecting the contamination of milk during the grazing period, J. Dairy. Sci. 82, (1999), pp. 305-314.
[3] C. Fermanmian, J. M. Fremy, and C. Lahallec, Bacillus cereus pathogenicity:a review, J Rapid
Methods Autom Microbiol. 2, (1993), pp. 83-134.
[4] D. Coghill, Studies on thermoduric psychrotrophic bacteria in South East Queensland dairy
products, Aust. J. Dairy Technol. 37, (1982), pp. 147148
[5] E. M. Crielly, N. A. Logan, and A. Anderton, Studies on the Bacillus flora of milk and milk
products, J. Appl. Bacteriol. 77, (1994), pp. 256263.
[6] F. L. Davies, Discussion of papers presented at symposium on bitty cream and related problems, J.
Soc. Dairy Technol. 28, (1975), pp. 8590.
[7] J. G. S. Speers, and A. Gilmour, The influence of milk and milk components on the attachment of
bacteria to farm dairy equipment surfaces, J. Appl. Bacteriol. 59, (1985), pp. 325-332.
[8] J. M. Kramer, and R. J. Gilbert, Bacillus cereus and other Bacillus species. In:Doyle MP.
Foodborne bacterial pathogens, New York: Marcel Dekker, 1989.
[9] J. S. Peng, W. C. Tsai, and C. C. Chou, Surface characteristics of Bacillus cereus and its adhesion
to stainless steel, Int. J. Food. Microbiol. 65, (2001), pp. 105-111.
[10] K.M. Johnson, Bacillus cereus foodborne illness: an Update, J. Food Prot. 47, (1984), pp. 145
153.
[11] M. W. Griffiths, and J. D. Phillips, Incidence, source and some properties of psychrotrophic
Bacillus found in raw and pasteurized milk, J. Soc. Dairy Technol. 43, (1990), pp. 6266.
[12] S. Hauge, Matforgiftninger framkalt av Bacillus cereus, Nord. Hyg. Tidskr. 31, (1950), pp.189206.
[13] U. Ronner, U. Husmark, A. Henriksson, Adhesion of Bacillus spores in relation to
hydrophobicity, J. Appl. Bacteriol. 69, (1990), pp. 550-556.
[14] W. Terranova, and P. A. Blake, Bacillus cereus food poisoning, N Engl. J. Med. 298, (1978), pp.
143-144.
[15] W. W. Overcast, and K. Atmaram, The role of Bacillus cereus in sweet curdling of fluid milk, J.
Milk Food Technol. 37, (1974), pp. 233236.
Page 460

July 9-11, 2012
STP49-9
Laccase production by Lentinus polychrous from

agricultural wastes
Jirapa Phetsoma and Karnika Ratanaponglekab

Biology Department, Faculty of Science, Mahasarakham University, Kantharawichai District, Maha
Sarakham 44150, Thailand.
b
Chemical Engineering Department, Faculty of Engineering, Ubon Ratchathani University,
Ubonratchathani 34190, Thailand.
E-mail: phetsom2000@yahoo.com
ABSTRACT
Laccase a major enzyme of white-rot fungi involved in lignocellulose degradation. It is important
in biotechnological and environmental applications. The production of extracellular laccase by the
white-rot fungus Lentinus polychrous was investigated using agricultural wastes as culture media for
the growth of fungal mycelium. The agricultural wastes included peanut shells (PS) and rice husk
(RH), supplemented with rice bran (RB). The combination of PS and RB at the ratio 8:1 showed the
highest enzyme production, which was 1,628 U/L after 16 days of incubation. The 2:1 ratio of RH and
RB mixture had laccase activity of 1,000-1,600 U/L for 20 day-cultivation. The optimum pH and
temperature for laccase activity were found to be 4.5 and 30 oC, respectively. Comparison of different
production periods and the mix of PS with RB were found to be appropriate substrates for laccase
production. The results indicated that PS can reduce cultivation time and RB can enhance laccase
production.
Keywords: Laccase, Lentinus polychrous, Peanut shells, Rice husk, Rice bran
INTRODUCTION
Laccases are multi-copper containing enzymes that normally catalyze the oxidation of phenolic and
non-phenolic compounds in the presence of a mediator. The enzyme has been received much attention
and many potential applications in industry including pulp delignification (Lund and Felby, 2001), dye
detoxification and decolorization (Couto, 2007), denim bleaching (PazarlIog et al., 2005), food
industry (Selinheimo et al., 2006; Minussi et al., 2002) and organic synthesis (Mustafa et al., 2005)
have been identified. However, production costs for the enzyme are very high as there are many
fermentation factors such as, medium composition, temperature, system pH and mode of operation
which influence laccase production. Optimization of the medium for fungal cultivation is one of the
most important ways to increase activity and reduce cost in laccase production. More recent
approaches have focused on utilizing agricultural waste as an inexpensive carbon source that strongly
Page 461

July 9-11, 2012
induces enzyme production, for example, sugarcane bagasse, banana peel, rice barn and rice husk.
Solid-state fermentation (SSF) has become more popular for fungal enzyme production than
submerged fermentation since it provides high volumetric productivity, high concentration of
products, with low investment and operating expenses (Ng et al., 2010). The use of SSF can also
improve production economics.
The capability of many microorganisms to produce laccase has been reported from fungi
(Eggert et al., 1997) insects (Thomas et al., 1989), bacteria (Alexandre and Zhulin, 2000; Sanchez et
al., 2001; Martins et al., 2002) and wasp venom (Parkinson et al., 2001). Recent studies indicated that
most fungi, especially white rot fungi, produce high yields of extracellular laccase (Kahraman and
Gurdal, 2002). Because of the extensive cultivation of Lentinus polychrous in Thailand, this white-rot
fungus group was employed in this work.
The present study was performed to investigate the potential utilization of two agricultural
wastes, peanut shells and rice husk, supplemented with rice bran as culture media for laccase
production. The pH and temperature for crude laccase enzyme activity were also optimized.
Raw materials
Peanut shells, rice bran and rice husk were used as substrates. They were sterilized by autoclaving
at 121 oC for 15 min. The ratios of peanut shells to rice bran were 2:1, 4:1 and 8:1. The ratios of rice
husk and rice bran were the same. A total of 30 g, dry weight, of each individual formula was added
into an Erlenmeyer flask and the moisture content was then brought up to 65% (w/w).
Fungi and culture conditions
The fungal strain was obtained from Rujira Farm, Kalasin Province, Thailand. The strain was kept
on potato dextrose agar (PDA) plates at 4 oC and sub-cultured at least every 3 months. The inoculum
was prepared by cutting several agar plugs from the PDA plates and putting them into cultivation
media. The fungi were cultivated in 500 ml Erlenmeyer flasks containing 200 ml malt extract (2%
w/v) for 7 days at 28 C with continuous agitation (150 rpm).
L. polychrous was cultured on PDA and incubated at 25 0C. The mixed substrates were autoclaved
and packed in Erlenmeyer flasks at with different ratios. Each flask contained 30 g of moist substrate
(65% (w/w)). The starter for L. polychrous was derived from the culture media agar and inoculated
using 5 plugs per flask. The cultivation temperature condition was set up at 25 0C.
Laccase activity and protein assay
Crude laccase enzyme was prepared using water extraction. A 2:1 ratio of water and media was
used for extraction. The mixed media and water was stirred and kept at 4 oC. Then, the mixed solution
was filtered through miracloth and centrifuged at 4,000g for 10 minutes. The supernatant was kept at 4
o
C for further study. The quantity of crude protein was determined according to the Bradford method
(Bradford, 1976).
Page 462

July 9-11, 2012
Laccase activity was assayed at 30 oC using 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonate (ABTS)
as the substrate. The oxidation of ABTS (1 mM) was measured at 420 nm ( = 36,000 M cm) in 0.1 M
citrate-phosphate buffer (pH 4) (Martin et al., 2002). Enzyme activity measurements were performed
on a GENESYS 20 spectrophotometer (USA). One unit of enzyme activity was defined as the
amount of enzyme required to oxidize 1 mol of substrate per minute. All assays were carried out in
triplicate. The crude laccase enzyme was collected after 16 days of cultivation in each media
combination.
The pH and temperature were then optimized. The pH range (3-8) was tested for laccase
activity with a constant temperature of 30oC. The temperature range of 25-60 oC was also tested for
laccase activity with the constant pH 4.5.
Table 1. Microbial production of laccase enzyme using agricultural wastes as culture substrates
Production
yield
Agricultural waste
Microorganism
Peanut shells
Pleurotus
sapidus
Trametes sp.
AH28-2
2.10 106
U/kg
Wheat straw
L. edodes
250 U/g
20%Rice bran
L. edodes
528.9 U/kg
Rice husk
and rice bran (1:2)
L. polychrous
1,425 U/L
20% Peanut shells
500 U/L
Reference
Linke et al.,
2005
Sun et al.,
2009
Mata and
Savoie, 1998
Silva et al.,
2005
Sarnthima
et al., 2009
RESULTS
Laccase production on agricultural wastes
L. polychrous was cultivated in two natural agricultural residues, peanut shells and rice husk,
supplemented with rice bran in different ratios. The total amount of culture medium for each flask was
controlled at 30 g. Laccase activities were determined after 4, 8, 12, 16 and 20 days of cultivation.
Laccase production from wastes of agricultural industries has been reported in many microorganisms
(Table 1). The materials are rich in lignocelluloses, which served as suitable carbon sources. Peanut
shells were used as an immobilized substrate for Pleurotus sapidus in fed-batch culture where laccase
activity reached to 500 U/L in the fifth cycle (57 days) (Linke et al., 2005). In addition, 20% peanut
shells were used for the cultivation of the Trametes sp. AH28-2 which obtained at maximum yield at
2.10 106 U/kg (Sun et al., 2009). Furthermore, wheat straw (Mata and Savoie, 1998), mixed with
eucalyptus residues and 20% rice bran (Silva et al., 2005) were reported to be materials for laccase
production in L. edodes with production of 250 U/g and 528.9 U/kg, respectively.
The combination of rice husk and rice bran in the ratio of 1:2 was used for laccase production
in L. polychrous. The laccase activity was achieved at 1,425 U/L (Sarnthima et al., 2009). Comparing
Page 463

July 9-11, 2012
the laccase production in this study with previous reports, we found that from our study the
combination of peanut shells and rice bran (8:1) contributed to production at 1,628 U/L. The
maximum laccase production was achieved after 16 days of fermentation, after then decreased
activities were observed (figure 1). This could be due to the depletion of nutrient concentrations
resulting in cell death and consequently to a decrease in laccase activity. Laccase activity reached
peaks of 3.1, 3.5 and 3.6 U/ml in the combine peanut shells and rice bran in the ratios of 2:1, 4:1 and
8:1, respectively. The 8:1 and 4:1 ratios of peanut shells and rice bran showed similar laccase yields.
The addition of rice bran enhanced the production of laccase so it was higher than when just using
peanut shells. The peanut shells were used as culture media for laccase production that showed at
maximum yield of 0.16 U/ml after 8 days of cultivation (data not shown). The peanut shells contained
considerable components in terms of carbohydrates, proteins, cellulose and minerals at different ratios.
However, the vital nutrients contained in peanut shells might not be enough for fungal growth
and enzyme production. Laccase production in peanut shells supplemented with rice bran might be
attributed to the presence of some essential vitamins and minerals including phenolic compounds in
rice bran. Phenolic compounds are potent inducers of ligninolytic enzymes (Kahraman and Gurda,
2002).
4.0
3.5
Laccase activity (U/ml)
3.0
2.5
2.0
1.5
PS:RB 2:1
1.0
PS:RB 4:1
0.5
PS:RB 8:1
0.0
4
Time (Days)
12
16
20
Figure 1. Time course of laccase activity from L. polychrous grown on a mixture of peanut shells (PS)
and rice bran (RB) at different ratios. The growth temperature was 25oC.
Rice husk is a lignocellulosic material obtained from rice milling. This is produced in
Thailand in large amounts every year. So it is very abundant and has a low price. Rice husk has been
tested as a fungal media in many studies (Sarnthima et al., 2009; Suwannawong et al., 2010). In this
work, the cultivation of L. polychrous was determined in rice husk supplemented with rice bran.
Figure 2 shows the different media ratios and laccase activities. The results revealed that laccase
activity was increased at the same rate as cultivation time. Maximum laccase activity was obtained
after 20 days of cultivation. Enzyme activities for the mixture of rice husk and rice bran were observed
at 1.7, 1.6 and 1.1 U/ml when cultured in the ratios of 2:1, 4:1 and 8:1, respectively. The consequence
of low enzyme activity was low enzyme production. The laccase production is due to the composition
of the media. However, rice husk contains silica which is a desiccant and increasing the rice husk
Page 464

July 9-11, 2012
component results in the amount of silica increasing. This means the moisture content in the medium
is reduced and this affects fungal cultivation.
Our results indicated that peanut shells supplemented with rice bran gave higher laccase
production than rice husk supplemented with rice bran. A shorter cultivation time was also observed in
the mixture of peanut shells and rice bran. The difference in laccase production was possibly due to
the fact that peanut shells contain more nutrients required for fungal growth than rice husk. The results
indicated that the laccase yields are depended on the components of medium. Furthermore, rice husk is
difficult to degrade due to a complex structure and large molecule (Sarnthima et al., 2009).
Figure 2. Time course of laccase activity from L. polychrous grown on a mixture of rice husk (RH)
and rice bran (RB) at different ratios. The growth temperature was 25oC.
Optimum pH and temperature for laccase activity
Crude laccase enzyme activity was investigated at different pH and temperatures. The
combination of peanut shells and rice bran for all ratios had optimum pH and temperatures of 4.5 and
30 oC, respectively. The highest specific laccase activity in the peanut shells and rice bran ratio of 8:1
(by wt) was 5.6 U/mg. A previous report has shown optimum laccase activity at pH 6.0 and 40 oC
when L. polychrous was cultured on sorghum seeds (Sarnthima and Khammuang, 2008). Purified
laccase was investigated by Murugesan et al. (2006), who reported the optimum pH at 5.0 and
temperature at 40 oC. The recombinant P. sajor-caju (Psc lac4) showed the optimums to be at pH 3.5
and 35 oC (Soden et al., 2002). By comparison, our study showed slightly different optimum pH and
temperature for laccase activity from the previous reports. There were different components in the
media involved in either catalytic mechanism or substrate interaction. The rice bran was composed of
20.9% total dietary fiber, 1.9% soluble dietary fiber, 2.4% nitrogen and, 22.4% fat (Kahlon et al.,
1990). Moreover, the different optimum pH and temperature could due to different isozymes which
are produced in different media.
Page 465

July 9-11, 2012
Figure 3. The optimum pH of laccase activity from L. polychrous grown on a mixture of rice husk
(RH) and rice bran (RB) for 16 days. The growth temperature was 25oC for the different media ratios.
Figure 4. The optimum temperature from laccase activity of L. polychrous grown on a mixture of rice
husk (RH) and rice bran (RB) for 16 days. The growth temperature was 25oC for the different media
ratios.
DISCUSSION
The combination of peanut shells and rice bran was more suitable for laccase production than
the combination of rice husk and rice bran. The 8:1 ratio of peanut shells and rice bran contributed
toward laccase activity of 1,000-1,600 U/L after 20 days of cultivation. The results indicate that the
combination of peanut shells and rice bran are more suitable than rice husk and rice bran for laccase
production. Both combinations had the same optimum pH and temperature for crude laccase activity
after 16 days of cultivation at 4.5 and 30 oC, respectively. These results are interesting in further
characterizing the biochemical properties of laccase and their potential in environment treatment.
Page 466

July 9-11, 2012
ACKNOWLEDGEMNTS
The authors would like to acknowledge Mahasarakham University and Ubonratchathani
University for financial. We are gratefully for help from the Biology Department, Faculty of Science
and the Protein and Enzyme Technology Research Unit in Mahasarakham University.
Page 467

July 9-11, 2012
REFERENCES
[1] A. Sanchez-Amat, P. Lucas-Elo, E. Fernndez, J.C. Garca-Borrn, and F. Solano, Molecular
cloning and functional characterisation of a unique multipotent polyphenol oxidase from
Marinomonas mediterranea, Biochem. Biophys. Acta. 1547, (2001), pp. 104-116.
[2] B. R. Thomas, M. Yonekura, T. D. Morgan, T. H. Czapla, T.L. Hopkins, and K.J. Kramer, A
trypsin solubilised laccase from phrate pupal integument of the tobacco hornworm, Manduca sexta,
Insect Biochem. 19, (1989), pp. 611-622.
[3] C. Eggert, U. Temp,and K.E. Eriksson, Laccase is essential for lignin degradation by the white rot
fungus Pycnoporus cinnabarinus, FEBS Lett. 407, (1997), pp. 89-92.
[4] D. Linke, B. Henning, P. Thilo, N. Manfred, B.G. Ralf, and Z. Holger, Laccase of Pleurotus
sapidus: Characterization and cloning, J. Agr. Food Chem. 53, (2005), pp. 9498-9505.
[5] D. Linke, B. Henning, P. Thilo, N. Manfred, B.G. Ralf, and Z. Holger, Laccase of Pleurotus
sapidus: Characterization and cloning, J. Agr. Food Chem. 53, (2005), pp. 9498-9505.
[6] D.M. Soden, J. O'Callaghan, and A.D. Dobson, Molecular cloning of a laccase isozyme gene from
Pleurotus sajor-caju and expression in the heterologous Pichia pastoris host. Microbiology 148,
(2002), pp. 4003-4014.
[7] E. Selinheimo, K. Kruus, J. Buchert, A. Hopia, and K. Autio, Effects of laccase, xylanase and their
combination on the rheological properties of wheat doughs, J. Cereal Sci. 43, (2006), pp. 152-159.
[8] E.M. Silva, A. Machuca, and A.M.F. Milagres, Evaluating the growth and enzyme production
from Lentinula edodes strains, Proc. Biochem. 40, (2005), pp. 161-164.
[9] G. Alexandre, and I.B. Zhulin, Laccases are widespread in bacteria, Trends Biotechnol. 18, (2000),
pp. 41-42.
[10] G. Mata, and J.M. Savoie, Extracellular enzyme activities in six Lentinula edodes strains during
cultivation in wheat straw, World J. Microb. Biot. 14, (1998), pp. 513-519.
[11] I.S. Ng, C.-W. Li, S.-P. Chan, J.-L. Chir, P.T. Chen, C.-G. Tong, S.-M. Yu, and T.-H.D. Ho,
High-level production of a thermoacidophilic [beta]-glucosidase from Penicillium citrinum YS40-5 by
solid-state fermentation with rice bran, Bioresource Technol. 101, (2010), pp. 1310-1317.
[12] K. Murugesan, M. Arulmani, I.H. Nam, Y.M. Kim, Y.S. Chang, and P.T. Kalaichelvan,
Purification and characterization of laccase produced by a white rot fungus Pleurotus sajor-caju under
submerged culture condition and its potential in decolorization of azo dyes, Appl. Microbiol. Biot. 72,
(2006), pp. 939-946.
[13] L.O. Martins, C. Soares, M. Pereira, M. Teixeira, T. Costa, G.H. Jones, and A.O. Henriques,
Molecular and biochemical characterization of a highly stable bacterial laccase that occurs as a
structural component of the Bacillus subtilis endospore coat, J. Biol. Chem. 277, (2002), pp. 1884918859.
Page 468

July 9-11, 2012
[14] M. Bradford, A rapid and sensitive method for the quantification of microgram quantities of
protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, (1976), pp. 248-254.
[15] M. Lund, and C. Felby, Wet strength improvement of unbleached kraft pulp through laccase
catalyzed oxidation, Enzyme Microb. Tech. 28, (2001), pp. 760-765.
[16] N. Parkinson, I. Smith, R. Weaver, and J.P. Edwards, A new form of arthropod phenoloxidase is
abundant in venom of the parasitoid wasp Pimpla hypochondrica, Insect Biochem. Molecbiol. 31,
(2001), pp. 57-63.
[17] N.K. lu-PazarlIog, M. Sariisik, and A. Telefoncu, Laccase: production by Trametes versicolor
and application to denim washing, Process Biochem. 40, (2005), pp. 1673-1678.
[18] P. Suwannawong, S. Khammuang, R. Sarnthima, Decolorization of rhodamine B and congo red
by partial purified laccase from Lentinus polychrous Lev, J. Biochem. Tech. 3, (2010), pp. 182-186.
[19] Q.Y. Sun, Y.Z. Hong, Y.Z. Xiao, W. Fang, and J. Fang, Decolorization of textile reactive dyes by
the crude laccase produced from solid-state fermentation of agro-byproducts, World. J. Microb. Biot.
25, (2009), pp. 1153-1160.
[20] R. Mustafa, L. Muniglia, B. Rovel, and M. Girardin, Phenolic colorants obtained by enzymatic
synthesis using a fungal laccase in a hydro-organic biphasic system, Food Res. Int. 38, (2005), pp.
995-1000.
[22] R. Sarnthima, and S. Khammuang, Evaluation of Dyes Decolorization by the Crude Enzyme from
Pleurotus sajor-caju Grown on Sorghum Seed Media, Pakistan J. Biol. Sci. 11 (1), (2008), pp. 62-67.
[23] R. Sarnthima, S. Khammuang, and J. Svasti, Extracellular ligninolytic enzymes by Lentinus
polychrous Lv. under solid-state fermentation of potential agro-industrial wastes and their
effectiveness in decolorization of synthetic dyes, Biotechnol. Bioproc. Eng. 14, (2009), pp. 513-522.
[24] R.C. Minussi, G.M. Pastore, and N. Durn, Potential applications of laccase in the food industry,
Trends Food Sci.Tech. 13, (2002), pp. 205-216.
[25] S.R. Couto, Decolouration of industrial azo dyes by crude laccase from Trametes hirsuta, J.
Hazard. Mater. 148, (2007) , pp. 768-770.
[25] S.S. Kahraman, and I.H. Gurdal, Effect of synthetic and natural culture media on laccase
production by white rot fungi, Bioresource Technol. 82, (2002), pp. 215-217.
[26] T. S. Kahlon, R.M. Saunders, F.I. Chow, M.M. Chiu, A.A. Betschart, Influence of rice bran, oat
bran and wheat bran on cholesterol and triglycerides in hamsters. Cereal Chem. 67 (5), (1990), pp.
439-443.
Page 469

July 9-11, 2012
STP51-10
COMPARATIVE GLOBAL PROTEOMIC PROFILE OF

ERYTHOID PROGENITOR CELL IN THALASSEMIA/HEMOGLOBIN E
LALIDA UMBUA1 , SARUNYOO PONNIKORN1, TASSANEE PANICHAKUL2
SUMALEE TUNGPRADUBKUL1*
1
BIOCHEMISTRY DEPARTMENT, Mahidol University
2
BIOTECHNOLOGY DEPARTMENT,Suan dusit University
E-mail: scstk@mahidol.ac.th
ABSTRACT
Beta-Thalassemia/hemoglobin E is a hereditary hemolytic disease that occurs when
production of the beta chain of hemoglobin is reduced resulting in an imbalance between and
globin. It has been proposed that the excess of the -globin chain can lead to damage to the membrane
of developing red blood cells resulting in ineffective erythropoiesis. However, the mechanism of
ineffective erythropoiesis in -thalassemia is not well understood. One possible cause of the reduction
in red cell formation is enhanced apoptosis during the production of erythrocytes. proteomic approach
used to investigate whether apoptosis was enhanced during erythrocyte production in -thalassemia
patients compared to normal controls. Hematopoietic stem cells collected from human bone marrow
were subjected to 1D-proteomic analysis to identify proteins that had differential abundance in thalassemia patients compared to normal controls. In comparison, numerous changes in protein levels
in -thalassemia cells and identified several proteins involved in apoptosis, including TRAF2, CUL4,
APC, SDK1, PAOX and DCC that were present at higher levels in -thalassemia cells and we strongly
emphasize with TRAF2 protein. Moreover, we found proteins that involve in oxidative stress, PRDX2,
PRDX6, CAT and SOD1. A key finding of our study was the observation that proteins associated with
apoptosis were present earlier in developing erythrocytes from -thalassemia patients than normal
controls. The earlier expression of proteins involved in apoptosis may trigger activation of apoptosis in
developing erythrocytes from -thalassemia patients. Our results suggest that enhanced apoptosis
during erythropoiesis may be a contributing factor in the development of -thalassemia.
Keywords: -THALASSEMIA, PROTEOMIC, OXIDATIVE STRESS, TRAF2, APOPTOSIS
INTRODUCTION
Thalassemias are heterogeneous groups of autosomal recessive anemia resulting from reduced
or absent synthesis of globin chains.-thalassemia/hemoglobin E (-thal/HbE) is the most common
form of -thalassemia found in Thailand (1,2) .Hb E/-thalassemia has variable symptoms including
mild to severe anemia (3,4). The excess of insoluble chains accumulates in erythroid precursors
Page 470

July 9-11, 2012
forming inclusion bodies in the bone marrow as well as in the peripheral red blood cells. Erythroid
progenitor cells isolated from -thalassemia major patients exhibited an ineffective erythropoiesis via
apoptosis at the polychromatophilic normoblast stage (6).It has been proposed that the precipitation of
excess -globin chains in marrow erythroid precursors as well as an excess of free iron could lead to
oxidative stress and potentially to ineffective erythropoiesis (7,8). However, the mechanism
responsible for induction of apoptosis and the relevant pathways in hematopoietic stem cells are still
poorly understood. Here, we described the proteomic analysis of HSCs from Hb E/-thalassemic
patients that isolated directly coupled with LC MS/MS analysis. Compared to Normal donors, HSCs
from HbE/-thalassemic bone marrow patients expressed high levels of several proteins involve in
apoptosis pathway, suggesting a role for these proteins in disease. These proteins were identified and
categorized with regard to extrinsic pathway apoptotic pathways. Our results suggest that the TRAF2
proteins might play a role in regulating apoptosis of HSCs in HbE/-thalassemia.
Sample of bone marrow
Bone marrow samples were obtained from three HbE/-thalassemic patients admitted to
Ramathibodi Hospital, Bangkok, Thailand and two normal donors. All patients were children 312 years-old and had symptoms of severe anemia and hepatosplenomegaly. Hemoglobin
analysis showed no expression of the -hemoglobin band with the Hb-E trait. Marrow collection
was approved by the Ethical Committee of Research on Human beings at Ramathibodi Hospital,
Faculty of Medicine, Mahidol University, Bangkok, Thailand
Isolate and culturehematopoietic stem cells (HSCs)
Bone marrow samples (BM) from Hb E/-thalassemic patients and healthy donors were
collected for HSCs isolation. Briefly, mononuclear cells (MNCs) from BM were separated by
using Isoprep solution (Lexis, Sweden). The MNCs were used to isolate the HSCs with a CD
34 isolation kit with magnetic microbead selection (Mini-MACS columns, Miltenyi Biotech,
Germany). The method of isolation was performed as described in the manufacturer's protocol.
One-dimension gel electrophoresis (1-DE)
Proteins were separated using the discontinuous SDS-PAGE after Laemmli (Laemmli,
1970). A 10 % separating gel was made. The gel was placed in a SDS-PAGE apparatus
containing SDSPAGE running buffer and was run with 120 V for 1.5 hours. The separated
proteins were analyzed by silver staining.
Ingel Gel Tryptic Digestion for LC-MS
The protein band whose intensity levels significantly differed between patients and
normal donors were excised from 1-DE gels. The samples were injected into a Ultimate 3000
LC System(Dionex,USA) coupled to ESI-ION Trap MS (HCT Ultra PTM Disovery System,
Bruker,Germany) with electrospray at a flow rate of 300 nl/min to a nanocolumn The resolution
in MS step is 0.6 and the mass accuracy is 0.15 u (m/z).
Protein qualitation and identification
Protein pieces were manually excised from the gels, and in-gel tryptic digestion was
performed. LC-MS/ MS were performed on a reflectron mass spectrometer (Reflex IV;
BrukerDaltonics; Leipzig, Germany). Peptide mass fingerprinting were performed to match
resulting masses to theoretical peptide masses using the MASCOT search tool.
Page 471

July 9-11, 2012
RESULTS
HSCs/CD34+ cells were isolated from 4 bone marrow samples belonging to 2 Hb E/thalassemic patients and 2 normal healthy donors. The growth rate of thalassemic cells was reduced
compared to normal cells data not shown. Giemsa staining revealed that CD34+ cells from patients
and donors had similar morphological characteristics to blast cells.The characteristics of apoptotic
cells, including membrane blebbling and nuclear fragmentation, were only found in thalassemic cells
at days 4 and 7 shown in Figure 1. In this study we reported the first time detailed characterization of
protein contents in -thalasemia/Hb E patients which are significantly different from those in normal
donors. To survey the proteome, proteins were separated by 1-DE and analyzed using mass
spectrometry. By using this approach, Proteins derived from CD 34+ HSCs cells from freshly prepare
and cultivation system and day 7 .The gel images were obtained as shown in figure 2.After LCMS/MS analysis, all MS/MS spectra were searched against human protein database. As expected in an
investigation of the proteome, these proteins were categorized by PANTHER cellular pathway
classification together with Uniprot gene ontology to match with apoptosis pathways by various
relationships such as protein interactions, modifications and regulation of expressions. Eight selected
proteins which involved in apoptosis were represented in Table 1 .These proteins were categorized as
hematopoietic related proteins (data not shown).The proteins were characterized as common in the
apoptotic pathway; TRAF2, AIFM1, SDK1, CUL4, Nectrin and NEDD. Moreover, SDK1 also involve
in some part of autophagy too. Previous evidence suggests that the pathology and disease progression
of -thalassemia relates to the accumulation of reactive oxygen species (ROS), which can generate
DNA adducts in the nucleus and induce the DNA damage pathway. In this study also found proteins
that were had relationship with oxidative stress, peroxiredoxin 6, peroxiredoxin 2 and catalase.(data
not shown)
Fig. 1 cultures of HSC/CD34+ from HbE/-thalassemic patients (A) and normal donors (B).After 7
days,HbE/-thalassemic cell developed to erythroblasts and showed characteristic cell morphology of
cells undergoing apoptosis including cell membrane blebbing and nuclear fragmentation.morphology
of cells undergoing apoptosis including cell membrane blebbing and nuclear fragmentation.
Page 472

July 9-11, 2012
Fig. 2 SDS-PAGE was stained with silver stain of -thalassemia/Hb E and normal controls in day 0
(fresh sample) (A). And of -thalassemia/Hb E and normal controls in day 7 (B). BM 4 is CD 34+thalassemia cells at protein concentration 8 g/l BM 5 is CD 34+normal cells at protein concentration 8 g/l
Table 1 The different expressed proteins, whose compared from normal donor and -thalassemia/Hb E
patients. These proteins were then identified by MS/MS analyses.
no.of
match
Intensity Day 0
Intensity Day 7
E
Normal patient Ratio
Epati
Normal ent
Protein name
NCBI ID
Ident
score
MAP4 protein
gi|29387211
51.77
10
0.00
21.00
11.52
24.12
2.09
Cullin-4A cullin-4A
gi|62122550
47.02
10
0.00
20.53
0.00
11.21
25.72
2.29
Polyamine oxidase
splice variant
gi|45439850
44.44
0.00
11.13
0.00
9.34
15.42
1.65
NEDD8-activating
enzyme E1
gi|4502169
42.70
13
14.97
18.73
1.25
15.93
18.60
1.17
Netrin receptor DCC

precursor
gi|453210
37.74
12
9.22
10.62
1.15
12.38
19.66
1.59
A-kinase anchor protein

13
gi|15207794
35.08
12
11.66
17.05
1.46
12.02
25.35
2.11
SDK1
gi|119607757
24.29
14
14.14
13.98
0.99
11.13
14.13
1.27
The Traf Domain Of

Traf2
gi|5822333
34.6
11
0.00
11.50
16.55
29.24
1.77
peptide
Page 473
Ratio

July 9-11, 2012
DISCUSSION
Ineffective erythropoiesis is one important complication in thalassemic disease that
contributes to the abnormal erythroid cell expansion and differentiation in bone marrow (10,11).
Apoptotic cell death has been described as the major contributor as seen in -thalassemic bone marrow
(5) and even in peripheral blood stem cells in vitro (12). The acceleration of apoptosis has been
characterized in erythroid cells at the polychromatophilic and orthochromic normoblast stages during
erythroid differentiation (6) However, using a thalassemic mouse model of -thalassemia major and
thalassemia intermediate, it was suggested that apoptosis and hemolysis were not the major causes for
the ineffective erythropoiesis. However, it remains unclear whether the expansion of erythroid cells
but not cell differentiation can directly or indirectly contribute to the acceleration of apoptosis in thalassemia. Our study in HbE/-thalassemic HSCs has shown that the growth reduction of erythroid
cells derived from HbE/-thalassemic HSCs was substantially due to induction of apoptosisThis was
supported by the observation of characteristic apoptotic cell morphology and phosphoproteomic
analysis of HbE/-thalassemia. Our study in HbE/-thalassemic HSCs has shown that the growth
reduction of erythroid cells derived from HbE/-thalassemic HSCs was substantially due to induction
of apoptosis. This was supported by the observation of characteristic apoptotic cell morphology and
phosphoproteomic analysis of HbE/-thalassemia. Our proteome data has identified specific apoptotic
related proteins from HSCs/CD34+ cells in HbE/-thalassemia as shown in Table 1. In addition, a
death receptor mediated pathway seems to be implicated in apoptosis during erythropoiesis with FasFas ligand interactions (12, 13). We have identified additional factors in the death receptor mediated
pathway; TRAF2, they may possess some effector functions as yet to be revealed, or work as adapter
proteins to recruit different downstream signal transducers to the receptor complex. Although many
aspects of TRAF-mediated effector functions leading to cellular activation have been defined.TRAF2
overexpression which may antagonize the formation of TRAF2 homooligomer in cells, impairs the
activation-induced cell death of mature CD81 T, which is partly mediated by the TNFR2 signaling
complex (Figure 3) .TNAF2 is involved in FAS mediated apoptosis or death receptor mediated
apoptosis (14,15),Up to now, the research in finding novel knowledge about TRAF protein is still
unclear. So it has to be study further to identified (16).Nevertheless, the upstream signaling events in
the progression of -thalassemia have not been identified.
Figure 3 A model of interrelationship of TRAFs for mediated apoptosis (16)
Page 474

July 9-11, 2012
CONCLUSION
We have observed the over-expression of TRAF2 protein in HbE/-thalassemic stem cells.
The protein may be a critical mediator of the apoptosis pathway that regulates between cell survival
and death due to ineffective erythropoiesis in -thalassemic patients. Finally, this study has shown that
a significant amount of common apoptotic proteins are found in the patients with HbE/-thalassemia
and these proteins correspond to the disease complications in apoptosis of HSCs in patients. These
experiments used a novel method to understand the proteins that influence a particular pathway in a
given disease or physiological condition. Ultimately, our results demonstrate that proteome profiling
in HbE/-thalassemic stem cells is an effective technique to investigate the cell death mechanism of
ineffective erythropoiesis in -thalassemia.
ACKNOWLEDGEME NTS
This work was supported by the Research Matching Fund from Faculty of Science and Faculty
of Medicine Ramathibodi Hospital, Mahidol University. The authors acknowledge Narumon
Phaonakrop, BIOTEC, NSTDA for MS data interpretation and Decyder program tutorial.
Page 475

July 9-11, 2012
REFERENCES
1. Abetz L, Baladi JF, Jones P, Rofail D: The impact of iron overload and its treatment on quality of
life: results from a literature review. Health Qual Life Outcomes 2006, 4:73.
2. Thai Thalassemia Foundation: Diagnosis of thalassemia carrier (in Thai language).
[http://www.thalassemia.or.th/thaiversion/diag-carrier-th.htm].
3.Ponnikorn S, Panichakul T, Sresanga K, Wongborisuth C, Roytrakul S, Hongeng S, et al.
Phosphoproteomic analysis of apoptotic hematopoietic stem cells from hemoglobin E/betathalassemia. J Transl Med. 2011;9:96.
4. Winichagoon P, Fucharoen S, Chen P, Wasi P: Genetic factors affecting clinical severity in betathalassemia syndromes. J PediatrHematolOncol 2000, 22:573-580.
5. Yuan J, Angelucci E, Lucarelli G, Aljurf M, Snyder LM, Kiefer CR, Ma L, Schrier SL: Accelerated
programmed cell death (apoptosis) in erythroid precursors of patients with severe beta-thalassemia
(Cooleys anemia). Blood 1993, 82(2):374-377.
6. Mathias LA, Fisher TC, Zeng L, Meiselman HJ, Weinberg KI, Hiti AL, Malik P: Ineffective
erythropoiesis in beta-thalassemia major is due to apoptosis at the polychromatophilic normoblast
stage. ExpHematol 2000,28(12):1343-1353.
7. Pootrakul P, Sirankapracha P, Hemsorach S, Moungsub W, Kumbunlue R, Piangitjagum A, Wasi P,
Ma L, Schrier SL: A correlation of erythrokinetics, ineffective erythropoiesis, and erythroid precursor
apoptosis in thai patients with thalassemia. Blood 2000, 96(7):2606-2612.
8. Libani I, Guy E, Melchiori L, Schiro R, Ramos P, Breda L, Scholzen T, Chadburn A, Liu Y,
Kernbach M, Baron-Luhr B, Porotto M, Sousa M, Rachmilewitz EA, Hood JD, Cappellini D, Giardina
PJ, Grady RW, Gerdes J, Rivella S: Decreased differentiation of erythroid cells exacerbates ineffective
erythropoiesis in beta-thalassemia. Blood 2008, 112(3):875-885.
9.Wannatung T, Lithanatudom P, Leecharoenkiat A, Svasti S, Fucharoen S, Smith DR: Increased
erythropoiesis of -thalassaemia/Hb E proerythroblasts is mediated by high basal levels of ERK1/2
activation. British Journal of Haematology 2009, 146(5):557-568.
10. Rivella S: Ineffective erythropoiesis and thalassemias. CurrOpinHematol 2009, 16(3):187-194.
11. Rund D, Rachmilewitz E: Beta-thalassemia. N Engl J Med 2005, 353(11):1135-1146.
12. De Maria R, Testa U, Luchetti L, Zeuner A, Stassi G, Pelosi E, Riccioni R, Felli N, Samoggia P,
Peschle C: Apoptotic role of Fas/Fas ligand system in the regulation of erythropoiesis. Blood 1999,
93(3):796-803.
13. Schrier SL, Centis F, Verneris M, Ma L, Angelucci E: The role of oxidant injury in the
pathophysiology of human thalassemias. Redox report: communications in free radical research 2003,
8(5):241-245.
Page 476

July 9-11, 2012
14. Wiley SR, Winkles JA: TWEAK, a member of the TNF superfamily, is a multifunctional cytokine
that binds the TweakR/Fn14 receptor. Cytokine Growth Factor Rev 2003, 14(3-4):241-249.
15. Han S, Yoon K, Lee K, Kim K, Jang H, Lee NK, Hwang K, Young Lee S: TNF related weak
inducer of apoptosis receptor, a TNF receptor superfamily member, activates NF-kappa B through
TNF receptor-associated factors. Biochemical and biophysical research communications 2003,
305(4):789-796.
16. Lee SY, Choi Y. TRAF-interacting protein (TRIP): a novel component of the tumor necrosis factor
receptor (TNFR)- and CD30-TRAF signaling complexes that inhibits TRAF2-mediated NF-kappaB
activation. J Exp Med. 1997 Apr 7;185(7):1275-85.
Page 477

July 9-11, 2012
STP55-12
Determination of Volatile Organic Compounds (VOCs) in Water

by Purge and Trap-Gas Chromatography-Mass Spectrometry
(PT-GC-MS)
Apinya Navakhun1,2 , Chartchai Malaphong1*

Department of Chemistry and Center of Excellence for Innovation in Chemistry,
Faculty of science, Burapha University, Chonburi, THAILAND
2
Center of Excellence on Environmental Health and Toxicology, CHE,
Ministry of Education, THAILAND
Email : 53910001@live.buu.ac.th
ABSTRACT
Trace analysis method of 9 volatile organic compounds (VOCs), which are 1,3-butadiene,
vinyl chloride, dichloromethane, chloroform, 1,2-dicholoethane, benzene, 1,2-dichloropropane,
trichloro-ethylene and tetrachloroethylene in water has been studied using a purge and trap techniques
with a VOCARB 3000 trap and separated by gas chromatography-mass spectrometry (GC-MS). The
optimum conditions are 50C, 15 min, 180C and 260C for the sample temperature, purge time,
desorption temperature and bake temperature, respectively. These conditions were used to evaluate
their limit of detection, limit of quantitation, repeatability and accuracy. Drinking water and ground
water from Map Ta Phut area were analyzed volatile organic compounds contamination using this
method.
Keywords: Volatile organic compounds, Purge and trap, GC-MS
INTRODUCTION
Volatile organic compounds (VOCs) are common contaminants in environmental (air, soil,
water and food). VOCs are causes of air toxic, precursors of photochemical smog and acid deposition.
They are also causes of stratospheric ozone depletion and effect to human such as acute effect (taken
VOCs more than 1 mg/L) [1]. Notification of National Environmental Board No. 30 (2007) identifies
that there are nine volatile organic compounds in the air which are 1,3-butadiene, vinyl chloride,
dichloromethane, chloroform, 1,2-dichloroethane, benzene, 1,2-dichloropropane, trichloroethylene and
tetra-chloroethylene. The determination of VOCs has been analyzed using gas chromatography mass
spectrometry (GC-MS) because it is suitable for trace analysis. In addition, the purge and trap (PT)
technique which is the non-complicated solvent-free extraction technique has been used to extract the
volatile and semi-volatile compounds in aqueous samples [2-3]. This technique is more sensitive than
Page 478

July 9-11, 2012
the other techniques such as liquid-liquid extraction (LLE), direct aqueous injection (DAI), head space
(HS) and solid phase micro extraction (SPME) [4-5].
In this work, the method for extraction of nine VOCs especially very volatile compounds such
as 1,3-butadiene and vinyl chloride has been investigated. The parameter optimizations of purge and
trap which are type of trapped, temperature, purge time, dry purge time, desorption temperature,
desorption time and transfer line temperature have been studied. Finally, this method has been used to
analysis the trace level of VOCs (ng/L) contaminated in water samples collected from industrial area.
Reagent and materials
Nine volatile organic compounds standards, 1,3-butadiene, vinyl-chloride, dichloromethane,
chloroform, 1,2-dicholoethane, benzene, 1,2-dichloropropane, trichloroethylene and tetrachloroethylene, and internal standard (Toluene-d8) were purchased from Supelco (USA). The 250
g/mL of the standard solutions were prepared in methanol and stored in refrigerator at -2C. Working
solutions were prepared by mixing standard solutions in deionized water before analysis. Ultra high
purity (UHP) helium gas (purity 99.999%) was supplied from Lab solution & engineering (Thailand).
Water samples were stored at temperature below -20C before analysis.
Instrumentation
Purge and trap system (Stratum, Teledyne Tekmar, USA) coupled with Gas chromatography
5890 series II plus couple with 5972 series mass spectrometer (Hawlett Packard, USA) was used in
this study.
Purge and trap operating process consists of three main steps. The first step is the purge step.
An inert gas is flowed to the aqueous sample (15 mL), and the compounds are transferred to the trap
with a helium flow rate 40 mL/min and trapped on an absorbent material. The second step is the
desorption step. In this step, the compounds are removed by heating the trap (180C) and flushed of
the trap with desorption gas to release and transfer the analytes to the GC instrument. In the final step,
bake is clean up the trapping material prior to next run (10 min at 260C). The transfer line of the
purge-and-trap is directly coupled to the injection of the gas chromatography system.
The separation was performed using a DB-5MS capillary column with 60 m x 0.32 mm, 1 m
film thickness (Agilent, USA). The GC injection temperature was set at 200C. The injection was
operated in splitless mode with splitless time of 2 min. Helium carrier gas was set at 1.80 ml/min. The
MS condition was set detector temperature at 250C. The MS was operated in the electron ionization
mode (EI) at 70 eV. The selected ion-monitoring (SIM) mode was used in analysis were listed in
Table 1.
Page 479

July 9-11, 2012
Table 1 SIM ion
Analyte
SIM ion (m/z)
1,3 -butadiene
54
Vinylchloride
62
Dichloromethane
84, 86
Chloroform
83, 85
1,2-dicholoethane
62, 64
Benzene
78, 77
1,2-dichloropropane
63, 62
Trichloroethylene
130, 132
Tetrachloroethylene
164, 166
Toluene D-8
98, 100
RESULTS
Optimization of GC-MS
Firstly, the HP-5MS capillary column with 30m x 0.25 mm, 0.25 m film thickness (Agilent,
USA) was used for separation of nine VOCs. Unfortunately, this column cannot be separated 1,3butadiene-vinylchloride and dichloropropane-trichloroethylene peaks. The longer column of 60 m
with 1 m film thickness DB-5MS column was chosen in order to improve its separation
performance. The optimum conditions of GC-MS were listed in Table 2. The chromatogram under
optimum conditions was presented in Figure 1.
Fig. 1Chromatogram of VOCs under optimum conditions. 1) 1,3-butadiene 2) Vinyl chloride 3) dichloromethane 4) Chloroform 5) 1,2-dicholoethane 6) benzene 7) 1,2-dichlopropropane 8)
Trichloro-ethylene 9) toluene d-8 (I.S.) and 10) tetrachloro-ethylene.
Page 480

July 9-11, 2012
Optimization of the purge and trap conditions.
In the purge and trap optimization studies, the mixture standard solution of 1,3-butadiene
(4 ppb), vinyl chloride (2 ppb), dichloromethane (0.04 ppb), chloroform (0.04 ppb), 1,2-dicholoethane (0.4 ppb), benzene (0.04 ppb), 1,2-dichloropropane (0.6 ppb), trichloroethylene (0.6 ppb),
tetrachloroethylene (0.4 ppb) and toluene-d8 (I.S) (0.5 ppb) were used as the working standard
solutions. The peak areas of VOCs were compared. All experiments were carried out in triplicate.
He flow rate was set at 40 mL/min in accordance with the manufacturers recommen-dation [6, 7].
Type of trap
VOCARB 3000 and VOCARB 4000 were compared in this study. The higher peak areas
were obtained from VOCARB 3000. Thus, VOCARB 3000 trap was chosen. The VOCARB 3000
trap was more stable thermally because of it allows high desorption temperature. Moreover,
VOCARB 3000 was the recommendation trap for determination of VOCs by the environmental
protection agency (EPA) [8].
Effect of sample temperature
The sample temperature of 30-70C was varied. The effect of sample temperature has
been shown in figure 2. The increasing in peak area was observed when sample temperature
increased from 30C to 50C. In addition, sample temperature of 30C, 1,3-butadiene and vinyl
chloride could not be determined. However, sample temperature of 70C, decreasing in peak areas
was found due to the loss of VOCs. Therefore, the sample temperature of 50C was chosen as the
optimum condition.
Fig. 2 Effect of sample temperature

Effect of purge time
The purge time was varied between 5-20 min. Effect of purge time has been shown in
figure 3. The increasing of the peak area was found when the purge time increased from 5 to 11
min. However, the purge time more than 15 min led to a slightly decreasing of the peak area in
almost of the compounds. The longer purge time decreased the peak area because the helium itself
causes stripping of the trapped analytes [2], therefore, 15 min was chosen as the optimum
condition.
Page 481

July 9-11, 2012
Fig. 3 Effect of purge time

Effect of dry purge time
Dry purge time was varied between 1-5 min. The effect of dry purge time has been shown
in figure 4. When the dry purge time more than 1 min, the peak areas of almost of the compounds
have decreased. Due to the VOCs compounds were removed from trapped together with moisture
to waste. Therefore, 1 min was the optimum condition of the dry purge time.
Fig. 4 Effect of dry purge time

Effect of desorption temperature
The compounds were desorbed and transfer to GC-MS instrument. Desorption temperature
was varied from 180 to 250C. The effect of desorption temperature (figure 5) shows that the
highest peak area was achieved at 180C. When the temperature was more than 200C, the
decreasing in peak area was found. Therefore, desorption temperature at 180C was set for the
next studies.
Page 482

July 9-11, 2012
Fig. 5 Effect of desorption temperature

Effect of desorption time
Desorption time was varied between 0.5-4 min. The highest peak areas were obtained at
desorption time between 0.5-1 min. The decreasing in peak area was found when desorption time
was more than 1 min. Finally, the optimum desorption time was 0.5 min, which provided the high
peak area for almost of the compound.
Fig. 6 Effect of desorption time

Effect of transfer line temperature
Transfer line temperature was controlled vaporization of VOCs and prevents the
condensation of VOCs in the injection port. The transfer line temperatures were varied between
180-240C. The effect of transfer line temperature has been shown in figure 7. The decreasing in
peak areas of VOCs was found when the temperature was increased. It was found that 180C was
the optimum transfer line temperature.
Fig. 7 Effect of transfer line temperature
Page 483

July 9-11, 2012
The optimum conditions for the purge and trap and GC-MS system were summarized Table 2.
Method validation
Limit of detection, limit of quantitation, accuracy and precision of the proposed method
were evaluated. Limit of detection and limit of quantitation were calculated as three times and ten
times, respectively of the deviation of a batch of blank sample divided by the calibration curve.
The limit of detection was 0.0003-1.60 g/L for nine VOCs. Limit of quantitation was 0.0009-4.71
g/L for nine VOCs. The accuracy was performed by spike of VOCs standard into the water
sample. The recoveries of VOCs were 86-103% for nine VOCs. The repeatability was calculated
as the % RSD for 10 successive analyses of VOCs standard solution (0.04-0.6 g/L). The
repeatability in the range of 1.8-12.6% was obtained. The analytical characteristics of nine VOCs
were presented in Table 3.
Page 484

July 9-11, 2012
Analysis of water sample
The method was applied for determination of nine VOCs in drinking water and
ground water collected from Map Ta Phut area in Rayong province. Two drinking water
samples were manufactured in Map Ta Phut. A1 sample was polyethylene terephthalate
(PET) container and A2 sample was polyethylene (PE) container. Two ground water samples
were collected from near Map Ta Phut industrial Estate. The samples were collected on
March 2011. B1 was collected from canal, Map Ta Phut village, Rayong and B2 was
collected from shallow well, Islamic community, Map Ta Phut, Rayong, Thailand
The samples were kept in dry ice during transportation and stored at -20C before
analysis. For drinking water samples, dichloromethane, chloroform, 1,2-dichloroethane,
benzene, tri-chloroethylene, and tetrachloroethylene were found in low concentration (ng/L
level). In addition, VOCs in drinking water were found in both PET and PE containers.
However, higher amount of benzene was found in PET container sample. For ground water
samples, dichloro-methane, chloroform and benzene were found in the range of n.d.-0.16
g/L. The VOCs found in water samples was listed in Table 4. However, the amount of
VOCs found in drinking water and ground water samples was acceptable comparing water
quality standard by pollution control department [9].
Table 4 Concentration of VOCs in water
* n.d.= not detected, A1 = drinking water in PET, A2 = drinking water in PE
CONCLUSION
The method for the determination of nine VOCs in water by PT-GC-MS techniques was
developed. The VOCs were stripped from 15 mL aqueous sample by helium gas at flow rate of 40
mL/min and pre-concentrated in VOCARB 3000 trap. The method was successfully applied for
the analysis the ng/L level of nine VOCs in drinking water and ground water from Map Ta Phut
area.
ACKNOWLEDGEMENTS
Faculty of Science, Burapha Universiry and The Center of Excellence for Innovation in
Chemistry (PERCH-CIC), and Office of Higher Education Research Promotion and National
Research University Development (Project No. 2554A10862028), Office of the Higher Education
Commission, Ministry of Education are gratefully acknowledged for their financial support. This
research work is also supported in part by the grant from Center of Excellence on Environmental
Health and Toxicology, Science and Technology Postgraduate Education and Research
Development Office (PERDO), Ministry of Education.
Page 485

July 9-11, 2012
REFERENCES
[1] H.J. Bloemen and J. Burn, Chemistry and analysis of volatile organic compounds in
environment, Blackie Academic, Suffolk, 1993.
[2] N. Campillo, P.Vinas, I. L. Garcia, N. Aguinaga and M. H. Cordoba, Purge-and-trap capillary
gas chromatography with atomic emission detection for volatile halogenated organic compounds
determi-nation in water and beverages, Journal of Chromatography A 1035 (2004), pp. 1-8.
[3] K. Demeestere, J. Dewulf, B. D. witte and H. V. Lagenhove, Sample preparation fot the
analysis of volatile organic compounds in air and water matrices, Journal of Chromatography A
1153 (2007), pp. 130-144.
[4] S. K. Golfinopoulos, T. D. Lekkas and A. D. Nikolaou, Comparison of methods for
determination of volatile organic compounds in drinking water, Chemosphere 45(2001), pp.275284.
[5] L. G. Azucena, S.U. Jose Enrique, S.G. Eva and S.M. Alfredo, Critical comparison of
automated purge and trap and solid-phase microextraction for routine determination of volatile
organic compounds in drinking waters by GC-MS, Talanta74(2008), pp.1455-1462.
[6] C.E. Meloan, Chemical separation: Principle, tech-niques and experiment, Wilay, Canada,
1999.
[7] Teledyne Tekmar, Stratum the next generation of purge and trap, Teledyne Tekmar, U.S.A,
2009.
[8] http://www.epa.gov/osw/hazard/testmethods/
sw846/pdfs/5035.pdf.
[9] http://www.pcd.go.th/info_serv/reg_std_water03.html.
Page 486

July 9-11, 2012
STP60-13
Synthesis of Micrometer-Sized Gold Nanoplate for

Jewelry Application
Pimthong Thongnopkun*, Aumaparn Phlayrahan

Gems and Jewelry Research Unit, Faculty of Gems, Burapha University Chanthaburi Campus,
Chanthaburi 22170, Thailand
E-mail: pimthong@buu.ac.th
ABSTRACT
Micrometer-sized gold nanoparticles exhibit novel optical properties and attract
considerable interests in a range of applications. This article presented the chemical synthesis of
micrometer-sized gold nanoplates in order to apply this product of gold nanotechnology synthesis
for further jewelry applications. This article focused on the effect of concentration of gold solution
(Gold (III) Chloride Hydrate, HAuCl4) that related to growth controlling of micrometer-sized gold
nanoplates. Polyvinylpyrrolidone (PVP) and Ethylene glycol, (EG) were employed as stabilizer
and reducing agent, respectively. The morphology of synthesized mirco-sized gold nanoplates was
determined by Scanning Electron Microscope (SEM). The SEM images showed various shapes of
synthesized micrometer-sized gold particles including circular, triangular, truncated triangular and
hexagonal shapes. The UV-Vis NIR spectrum revealed the formation of gold nanoplates. The
experimental results indicate that the prediction of sizes and shapes of micrometer-sized gold
nanoplates can be performed by controlling the concentration ratio of gold precursor.
Keywords: gold, gold microplate, micrometer-size gold nanoplate, gold synthesis, jewelry
INTRODUCTION
Nanostructured gold has been of great interest because of their unique physical and
chemical properties. The applications of the gold nanoparticles are derived from such properties
and morphology of them. The important applications were use in catalysis, photography,
photoelectronic devices, imaging, sensing, and biomedicines [1-3]. In our research, we focus on
the study of mass synthesis of gold plate in order to use in application of jewelry product such as
gold clay, gold paste and gold decoration. We choose the polyol process for synthesis of
micrometer sized-gold nanoplate. The process has proved to be a convenient and low-cost route
for synthesis of metal particles at low temperature [3-6]. In previous study, the concentration of
reactants, ratio of gold salt to reducing agent, type of reducing agent and surfactant, and
temperature play a critical role to the size and shape of the nanoparticle [3-7]. Herein, this paper
presents a preliminary study related to effect of gold salt precursors for micrometer-sized gold
nanoplate synthesis and introduced a simple method for synthesizing gold nanoplates by thermal
reduction of gold (III) chloride trihydrate (HAuCl4) in ethylene glycol at the presence of
poly(vinylpyrrolidone) (PVP). The morphology of synthesized gold nanoplate was characterized
by SEM analysis and the optical properties were determined by UV-Vis NIR spectrophotometer.
Page 487

July 9-11, 2012
Preparation of Au Microplates
In our experiment, gold metal (15.244 gram) was dissolved by aqua regia to prepare
chloroauric acid (HAuCl4) for stock solution (0.7 M). A typical procedure to synthesize gold plates
is as follow: 1 mL of HAuCl4 (0.2 M) solution was added to 6 mL ethylene glycol that was stirred
slowly and then 3 mL EG solution of poly(vinylpyrrolidone) (PVP, Mw = 40000) was injected
dropwise. The reaction mixture was continuously stirred at 120oC for 3 hours. After ~ 20 min, the
solution color changed gradually from yellow to pale and then shining products appeared in the
mixture, resulting in a gold micro/nano-plate suspension and increased progressively with the
reaction time. The products were rinsed with deionized water and centrifuged repeatedly to
remove the possible contamination. The water from washing process was also collected to
determine the remaining gold ion in solution by using UV-VIS-NIR Spectrophotometer. This
experimental method was donated as Exp.A in Table 1. In order to study the effect of gold solution
in typical synthesis, higher concentration of HAuCL4 was employed in Exp. B and C as shown in
Table 1.
Characterization.
The resulting gold plates were characterized by scanning electron microscopy (SEM)
JEOL JSM-6150A at the Microscopic Center, Faculty of Science, Burapha University. The
samples were deposited on glass substrates and the SEM images were recorded with an
accelerating voltage of 10.0 kV. The optical absorption spectra of the synthesized gold plates were
measured by Hitachi U-4100 UV-VIS-NIR Spectrophotometer with wavelength ranging from 3001200 nm. The size of gold plate was determined by using Image J software.
Table 1 The products obtained under the different synthesis conditions.
Temperature
Average size
Yield
(oC)
(side length)
(%)
3h
120
50 m
56
3h
120
30 m
62
3h
120
10 m
82
HAuCl4
(conc.)
Molar ratio
HAuCl4 : PVP
Time
0.2
0.5
0.4
0.7
Exp.
Yield: the percentage of plates in the products
Page 488

July 9-11, 2012
RESULTS
Fig. 1 SEM images of resulting micro-sized gold nanoplate synthesized with different
concentrations of gold salt (HAuCl4): (a) 0.2 M; (b) 0.4 M; and (c) 0.7 M.
Table 1 summarizes the products obtained under different experimental conditions,
including concentration of gold salt (HAuCl4), concentration of PVP, reaction temperature,
reaction time, and yield of plate in the product. Under PVP and EGs concentration constant, the
condition with 0.7 M HAuCl4 gives highest percentage of yield which can be implying this molar
ratio suitable for our synthesis condition. However, in our experiment, the water in washing
process of all experiments was recollected in order to determine the remaining gold ion in the
solution by UV-Vis NIR spectrophotometer. The water in washing process of experiment A and B
presented red color solution while that of Exp. C displayed transparent solution. Moreover, the
optical spectra of the remaining solution in Exp A and B exhibited broad band at 560 nm which is
corresponding to the nano-gold particle. It indicates that there is the gold nano-particle remaining
in the obtained solution from Exp A and B which provides the low percentage yield of gold
nanoplates.
Fig. 1 shows typical SEM images of the resulting micrometer-sized gold nanoplates
obtained at different initial golds concentration. The lower magnification image indicates that the
precipitates consist of mass of plates, including hexagonal, truncated triangular and triangular
shapes. As seen in higher magnification, the images distinctly revealed these plates are in
micrometer-sized up to 10 m in all experimental conditions. When the gold concentration is 0.2
M, the triangular shape has the side length of ~10-20 m was obtained, together with a few
hexagonal Au sheets (Fig 2A). On increasing HAuCl4 concentration to 0.4 M, more Au truncated
triangular and hexagonal shapes are formed. The higher concentration (0.7 M) leads to the
appearance of hexagonal Au plates (~50 m), together with a few Au spherical and triangular (Fig
2C). It can be imply that the seed growth is developed to yield shape-controlled gold nanocrystals
Page 489

July 9-11, 2012
as well as trigonal, truncated trigonal and then hexagonal, which were consistent with the reports
in previous studies [6-7].
Average side length (m)
60
40
20
0.1
0.2
0.3
0.4
0.5
0.6
Concentra tion of HAuCl4 (M)
0.7
0.8
Fig. 2 Average particle sized of micrometer size gold nanoplate with different concentrations of
HAuCl4.
Considering to the size of gold nanoplate, the average size of all Au nanoplates decreased
when increasing the concentration of gold salt, as shown in Fig. 2. Accordingly, an increase of the
HAuCl4 concentration affected the morphology of the products. It was well known that the
nanoparticle growth can happen under the role of thermodynamically control and kinetically
control [3]. The key factor of the size and shaped controlled synthesis is to control the relative
rates of nucleation and cluster growth [6-7]. Under the specific condition, the increasing of metal
concentration plays an important role to increase the amount of seed particle and rate of formation
which affected to reduce the size of obtained nanoparticle [1-3,8].
Since the optical properties of metal nanoparticle depended on their sizes and shapes, the
UV-Vis NIR spectra were also performed and the optical spectra of synthesized micro-sized gold
nanoplates were shown in Fig. 3. In all experimental conditions, these synthesized gold plates
displayed yellow color and exhibited distinct bands at about 760, 970 and 1170 nm which showed
remarkable red shift in agreement with micrometer-sized gold nanoplates (with different shapes)
reported previously [5-8]. The bands corresponded to the in-plane dipole resonance of flat shapes
in anisotropy of Au nanoplates [6-7]. As seen in Fig 1, the Au products in our synthesis consist of
micro-sized gold nanoplates with different sizes and shapes which are difficult to separate them by
size and shape, thus the optical spectra in this study show the same spectral features.
Page 490

July 9-11, 2012
0.2 M
0.4 M
Absorbance(a.u.)
0.7 M
_
700
_
800
_
_
900
1000
Wavelength(nm)
_
1100
_
_
1200
Fig. 3 The spectra of resulting micro-sized gold nanoplate synthesized with different
concentrations of gold salt (HAuCl4): (a) 0.2 M; (b) 0.4 M; and (c) 0.7 M.
In summary, we have successfully synthesized micro-sized gold nanoplates with different
shapes including truncated triangular, triangular, spherical and hexagonal plates. The obtained size
and shapes of synthesized gold plate depended on the concentration of initial gold salt. In this
study, the optimal condition of gold salt (at PVP and EG constant) were found 0.7 M because of
the highest percent yield and uniform Au shape. To demonstrate the utility of obtained gold plates
in jewelry application, the micro-sized gold nanoplates were repeatedly synthesized for producing
mass product and then were preformed as gold paste product. The prototype of jewelry using our
gold paste was shown in Fig. 4.
(a)
(b)
Fig.4 (a) synthesized micro-sized gold nanoplates; (b) prototype jewelry made from our microsized gold nanoplate.
ACKNOWLEDGEMENTS
The authors gratefully acknowledge for financial support from the National Research
Council of Thailand (NRCT) via Burapha University and the instrument supports from
Microscopic Center, Faculty of Science for SEM analysis.
Page 491

July 9-11, 2012
REFERENCES
[1] Tabrizi, A., Ayhan, F., and Ayhan, H. 2009. Gold nanoparticle synthesis and characterization.
Hacettepe Journal of Biology and Chemistry 37(3): 217-226.
[2] Fars, K.A., Awwad, A.R., and Ibrahim, A.A. 2010. Biopharmaceutical applications of
nanogold. Saudi Pharmaceutical Journal 18: 179-183.
[3]
Panikkanvalappil, R.S., Theruvakkattil, S.S., Akshaya, K.A., and Thalappil, P. 2011

Anisotropic nanomaterials: structure, growth, assembly, and functions. Nano Reviews 2:
5883.
[4] Tang, T. and Hamley, Ian W. 2009 Multiple morphologies of gold nano-plates by hightemperature polyol syntheses. Colloids and Surfaces A: Physicochemical and Engineering
Aspects 336: 1-7.
[5] Ying, C., Xin, G., Cha-Geng, N., Zhi-Yuan, J., Zhao-Xiong, X., and Chang-Jian, L. 2005
Shape controlled growth of gold nanoparticles by a solution synthesis. Chemical
Communications 33: 41814183.
[6] Caixia, K., Changshun, W., Jiejun, Z., and Hongchen, L. 2010 Formation of gold and silver
nanostructures within polyvinylpyrollidone (PVP) gel. Journal of Solid State Chemistry 183:
858865.
[7] Hong, Y., Ru Xiu, C., and Dai, W.P. 2003 A Simple Approach to Control the Growth of Nonspherical Gold Nanoparticles. Chinese Chemical Letters 14(11): 1163-1166.
[8] Yujie, X., Isao, W., Jingyi, C., Honggang, C., Zhi-Yuan, L., and Younan, X. 2006 Poly (vinyl
pyrrolidone): A Dual Functional Reductant and Stabilizer for the Facile Synthesis of Noble
Metal Nanoplates in Aqueous Solution. Langmuir 22: 8563-8570.
Page 492

July 9-11, 2012
STP68-4
Potential of Golden Shower (Leguminosae Mimosoideae)

extracts using as bio-insecticide in paddy field
Khobkul Nongnutch a, Jakkaphun Nanuam b, Pichet Tebumroong a

a
Faculty of Industrial and Technology,
Rajamangala University of Technology Isan Sakon Nakhon Campus, Sakon Nakhon, 47160
Thailand
b
Faculty of Science and Social Science, Burapha University, Sakaeo Campus,
Sakaeo Province, 27160 Thailand
E-mail: Khopkul25@gmail.com
ABSTRACT
The extracts of Golden Shower (Leguminosae Mimosoideae) have been used in Thai
tradition as bio-insecticide in paddy field with inadequate supporting scientific evidence. Its
potential effect is acetylcholinesterase (AChE) inhibition. The aim of this study was to investigate
the AChE inhibitory capability of the extracts in Golden apple snail (Pomacea canaliculata) for
using instead of endosulfan. The results indicated that AChE inhibitory activity of both plant
extracts and endosulfan was time-response relationship and irreversible mechanism. AChE activity
in endosulfan treatment was lower than that of plant extracts treatment in both exposure and
recovery period. Although the AChE inhibitory capability of ethanolic extracts from golden
shower was lower than that of endosulfan, it can be used as a potential alternative bio-insecticide
to control golden apple snail in paddy field.
Keywords: Golden Shower (Leguminosae Mimosoideae), Ethanolic plant extracts, Endosulfan,
AChE inhibitor, Golden apple snail (Pomacea canaliculata)
INTRODUCTION
The rising in world population pushes food demand to increase. There is 11% of global
surface or 1.5 billion ha used as agricultural area, and around 54.48% of this area is in the
developing country (Bruinsma, 2003), many of these countries is in the tropical zone such as
Thailand, Vietnam, and Cambodia. The economic plants mostly grown in this area consists of
wheat, barley, and especially rice. Periodically, these grains have been threatened by diseases,
insects, and invertibrates causing the production to decrease. In Thailand, an invertibrate, golden
apple snail (Pomacea canaliculata) is high concerned because it damages rice production by
eating stems and leaves. Present, the agriculturist uses endosulfan (an organochlorine pesticide)
which has acetylcholinesterase (AChE) inhibition capability (Ballesteros et al., 2009; Dutta &
Arends, 2003; Mukherjee et al., 2007) for controlling. However, the effect of this pesticide is no
specific target causing the other organism to suffer (Ballesteros et al., 2009; Dutta & Arends,
2003). AChE is an enzyme controlling the level of acetylcholine (ACh) which is the primary
neurotransmitter in the sensory and neuromuscular systems. The level of Ach is controlled by
AChE, which degrades ACh to choline and acetic acid. As AChE activity is inhibited, a
Page 493

July 9-11, 2012
continuous and excessive stimulation of the nerve/fibers occur without control until paralysis,
convulsion and death (Ezemonye & Ikpesu, 2011).
Thus, it has been looking for the alternative agent with pest controlling ability and less
toxic onto other organism. Form apprehensive reviewed, it was found that the extracts from
Golden Shower (Leguminosae Mimosoideae) had an ability to inhibit AChE activity at cholinergic
synapses (Mukherjee et al., 2007) and, in Thailand; it has been used to control and eliminate the
golden apple snail in many parts. For its application, fresh and dried pods were pounded, dissolved
in the water, and sprayed in the paddy field. Moreover, it was found that the extracts had other
useful application such as symptomatic treatment of Alzheimers disease and rejuvenating or
neurotonic remedies (Ingkaninan et al., 2003) and antibacterial and antifungal activities
(Duraipandiyan et al., 2007). However, the supporting scientific evidence of this extracts
application still is inadequate.
The aim of this study was to investigate the AChE inhibition capability of golden shower
(Leguminosae Mimosoideae) extracts in golden apple snail (Pomacea canaliculata) for using
instead of endosulfan.
Plant materials used in this study was golden shower (Leguminosae Mimosoideae)
collected from the demonstrated field of Rajamangala University of Technology, Isan Sakon
Nakhon Campus in December 2011- February 2012. After collection, plant materials were washed
to remove all the external and dirt and unwanted materials, mature pods were separated and then
shade dried for 72 h and then crushed into coarse powder. After that, 100 g of dried powder was
extracted with ethyl alcohol following the method described by Ingkaninan et al. (2003). In brief,
dried powder were macerated in 250 ml of 95% ethyl alcohol for 3 days and then filtered. The
filtrate was evaporated under reduced pressure until dryness. The residue from the filtration was
maccereted again in ethyl alcohol followed the same procedure and combined with the first
extract. Then, the extract was dissolved in ethyl alcohol and then kept in room temperature until
further perform.
Golden apple snail (Pomacea canaliculata) was collected from the demonstrated field of
Rajamangala University of Technology, Isan Sakon Nakhon Campus in January-February 2012
and then acclimatized in the plastic box (14x40x48 cm) filled with aerated clean water for 3 days.
After that, 5 snails were placed in the 20 L of treatment box (simulate as real paddy field
consisting of rice stalk and clay soil). The treatment was divided to 3 groups; (1) adding with the
extracts of golden shower (50% v/v), (2) adding with 1.0 mg/L of endosulfan (98% technical grade
from Micro Flo Co., Sparks,GA), and (3) adding with 95% ethyl alcohol (50% v/v) as control
group. The concentration of endosulfan used was selected from 96 h LD50 which is 1.5 mg/L, thus
we performed at 1.0 mg/L at which mortality was not found. The exposure time performed was 0,
10, and 20 min., and 1, 6, 12, 24, 48, 72, and 96 h and then the snail was taken to measure AChE
activity following the method described by Ellman et al. (1961).
For the AChE activity recovery study, the snail from 3 treatments (after 96 h of exposure)
was placed in the treatment box filled with clean water. After that, the snail was taken at 5, 30 min,
and 3, 12, 48, 96 h, and 15 and 20 d for further measure AChE activity.
Page 494

July 9-11, 2012
One way analysis of variance (ANOVA) was used to test differences between measured
AchE activities from each treatment.
RESULTS
AChE activity inhibition in male and female of golden apple snail
The results indicate that there is no significant difference (p>0.05) in AChE activity
inhibition between male and female in all treatment group (Fig 1).
Fig. 1 AChE activities in both sex after exposed to endosulfan and plant extracts for 96 h.
AChE activity in endosulfan treatment after 96 h of exposure is lower than that in plant
extracts treatment. AChE activity (male/female) of the plant extracts and endosulfan is 12.27
1.14 / 12.01 0.44 and 10.32 2.12 / 9.88 0.35 nmoles ACTC/min/mg protein, respectively.
Effect of exposure time on AChE activity inhibition
From Fig. 2, the results indicate that AChE activity decreases with exposure time. The
statistical analysis by One-Way ANOVA reveals that the exposure time has significant affect
(p<0.05) on AChE activity comparing to the control group. For golden shower extracts treatment,
AChE activity is decreased rapidly in first hour from 46.8614.00 to 14.337.02 nmoles
ACTC/min/mg protein. However, the more rapid decrease (p<0.05) is found in endosulfan
treatment. AChE activity decreases from 46.8614.00 to 4.012.14 nmoles ACTC/min/mg protein
in the first hour. In both case, the lowest AChE activity is measured at 96 h after exposure.
Page 495

July 9-11, 2012
Fig. 2 AChE activities after exposed to endosulfan and plant extracts against time
Recovery of AChE activity
After 96 h of exposure, the snail was removed and placed in the treatment box filled with
clean water for AChE activity recovery study and the results shown in Fig. 3.
Fig. 3 AChE activities of endosulfan and plant extracts in recovery period against time
AChE activity from both treatments in recovery period remains quite low comparing to the
control; 5.381.99 to 19.447.07 nmoles ACTC/min/mg protein for plant extracts and 2.712.53
to 8.798.71 nmoles ACTC/min/mg protein for endosulfan.
DISCUSSIONS
AChE activity inhibition in male and female of golden apple snail
This result collaborates with the study of Kopecka et al. (2004) which found that AChE
activity inhibition in fish was not affected by the difference of sex. Moreover, Yi et al. (2006) also
reported that AChE level in brain of goldfish (Carassius auratus) in both male and female was not
different after exposed to carbamate.
Page 496

July 9-11, 2012
The effect of exposure time on AChE activity inhibition
For plant extracts, the result is in agreement with the study of Ingkaninan et al. (2003)
which tested AChE inhibitory activity in many plants used in Thai traditional including
Leguminosae Mimosoideae by using Ellmans colorimetric method in 96-welled microplates. The
percent AChE inhibitory activity of this plant was 21.40 6.68.
For endosulfan, the AChE inhibitory activity found in this study confirms many previous
studies. Dutta & Arends (2003) found that endosulfan could inhibit brain AChE activity of
juvenile bluegill sunfish; 23.11% inhibition was found after 96 h of exposure. Ezemonye & Ikpesu
(2011) also found that endosulfan inhibitory activity in freshwater fish, Clarias gariepinus.
Mukherjee et al. (2007) gave an explanation on endosulfan AChE inhibitory that it is the potential
structure-activity relationship. The hydrophobic active site of AChE is attached by hydrophobic
ligand such as endosulfan which has quite low water solubility; 0.32 mg/l at 22oC (WHO, 1988),
causing enzyme deactivation. And, the results indicate that AChE inhibitory activity of endosulfan
and ethanolic extracts of Leguminosae Mimosoideae are irreversible.
CONCLUSIONS
Although the AchE inhibitory activity of ethanolic extract of Leguminosae Mimosoideae
expressed in this study was lower than that of endosulfan, it can be used as controlling bioinsecticide onto the threatening insect, golden apple snail, instead of endosulfan in the paddy field.
However, the effective constituent for AChE inhibitory in Leguminosae Mimosoideae should be
studied and identified for improving its effectiveness.
ACKNOWLEDGEMENTS
The authors would like to acknowledge Inland Fisheries Research and Development
Center, Sakhon Nakhon and Rice Research Center, Rajamangala University of Technology Isan,
Sakon Nakhon campus for their useful support.
Page 497

July 9-11, 2012
REFERENCES
Ballesteros, M.L., Durando, P.E., Nores, M.L., Daz, M.P., Bistoni, M.A., & Wunderlin, D.A.
(2009). Endosulfan induces changes in spontaneous swimming activity and
acetylchloinesterase activity of Jenynsia multidentata (Anablepidae Cyprinodontiformes).
Environmental Pollution, 157, 1573-1580.
Bruinsma, J. (2003). World Agriculture: towards 2015/2030 an FAO perspective. Earthscan
Publication Ltd., London.
Ellman, G.L., Courtney, K.D., Andrea, V., & Featherstone, R.M.(1961). A New and Rapid
Colorimetric Determination of Acethylcholinesterase Activity. Biochemical
Pharmacology, 7, 88-95.
Duraipandiyan, V., Ignacimuthu, S., & Paulraj, M.G. (2011). Antifeedant and larvicidal activities of
Rhein isolated from the flowers of Cassia fistula L.. Saudi Journal of Biological Sciences,
18, 129-133.
Dutta, H.M. & Arends, D.A. (2003). Effects of endosulfan on brain acetylchloinesterase activity in
juvenile bluegill sunfish. Environmental Research, 91, 157-162.
Ezemonye, L.I.N. & Ikpesu, T.O. (2011). Evaluation of sub-lethal effects of endosulfan on cortisol
secretion, glutathione S-transferase and acetylchloinesterase activity in Clarias
gariepinnus. Food and Chemical Toxicology, 49, 1898-1903.
Kopecka,J.,Rybakowas,A.,Barien.J.,&Pempkowiaw,J.(2004). AChE Levels in Mussel and Fish
collected off Lithumia and Poland (Southern Baltic).Oceanology, 43(3), 405-418.
Ingkaninan, K., Temkitthawon, P., Chuenchom, K., Yuyaem, Y. & Thongnoi, W. (2003). Screening
for acetylchloinesterase inhibitory activity in plants used in Thai traditional rejuvenating
and neurotonic remedies. Journal of Ethnopharmacology, 89, 261-264.
Mukherjee, P.K., Kumar, V., Mal, M., & Houghton, P.J. (2007). Acetylchlolonesterase inhibitors
from plants. Phytomedicine, 14, 289-300.
World Health Organization (WHO). (1988). International Programme on Chemical Safety,
Health and Safety Guide No. 17, Geneva.
Yi, M.Q., Liu,H.X.,Shi,X.Y., Liang, P.,& Gao,X.W.(2006). Inhibitory Effect of Four Carbamate
Insecticides on Acethylcholinesterase of Male and Female Carassiua auratus in
Vitro.Comparitive Biochemistry and Physiology, 143, 113-116.
Page 498

July 9-11, 2012
STP74-15
PROLINE CONTENT OF RICE SEEDLINGS: DIFFERING

RESPONSES OF TWO CULTIVARS TO SALT STRESS
Wichuda Jankangrama and Piyada Theerakulpisutb
Faculty of Science and Social Sciences, Burapha University Sakaeo campus, Sakaeo, Thailand.
b
a Genomics and Proteomics Research Group for Improvement of Salt-tolerant Rice, Department
of Biology, Faculty of Science, Khon Kaen University, Khon Kaen, 40002, Thailand.
Tel: +66-37-261560; Fax: +66-2-261801
E-mail: wichudajan@buu.ac.th
a
ABSTRACT
Two rice seedling cultivars of differing salt tolerancewere used to investigate differential
responses to salinity, in leaf and root. Growth parameters, including fresh weight, dry weight,
relative water content and proline content, were measured to assess the comparative responses of
the cultivars. The leaf and root dry weights of rice seedlings decreased in response to stresses
induced by salinity.
Salinity markedly increased the proline content in the shoots of both
cultivars, but in roots there was no significant difference between the proline content in controls
and salt-stressed plants of either cultivar. The increased proline accumulation in both tissues
appears to correlate with adaptation to salinity.
Keywords: relative water content, proline, salt stress
INTRODUCTION
Saline stress negatively impacts agricultural yield throughout the world, whether for
subsistence or economic gain. In north-eastern Thailand, 35% of the land area faces salinity
problems of varying degrees, especially for growing rice, which is considered to be moderately
sensitive to salinity (Akbar et al., 1974). Grain yields of most rice varieties are reduced by half
when the electrical conductivity of the irrigating water reaches 6 dS m-1 (Lu, Z. and Neumann,
P.M.1976; Yoshida, 1981). The response of rice plants to salinity consists of numerous processes
that must be coordinated to alleviate both cellular hyperosmolarity and ion disequilibrium. Several
studies have shown that the Na-K selectivity of plant roots, which minimizes the entry of Na+ into
plants and maintains effective K+ uptake, and also the low rate of salt transport to expanding
shoots, are very important mechanisms and are directly correlated with salt tolerance (Flowers et
al., 1991 and Munns, 2002). The effects of NaCl on rice growing parameters vary depending on
the concentration of salt, the duration of treatment and the age of the shoots (Faustino et al., 1996).
Comparative response studies could provide insights into the mechanisms of salt tolerance in rice.
In the current study, seedlings of two cultivars that differ in salt tolerance, Pokkali (salt-tolerant)
and Khao Dawk Mali 105 (KDML 105,salt-sensitive), were used to compare differential responses
to salinity, in leaves and roots. Growth parameters, such as fresh weight, dry weight, water content
and proline content, were measured to assess the a comparative responses of both rice cultivars to
NaCl stress
Page 499

July 9-11, 2012
Plant material
Seeds of rice (Oryza sativa L.) cvs. Pokkali (salt-tolerant) and KDML 105 (saltsensitive), obtained from the Pathumthani Rice Research center (Rice Research institute,
Department of Agriculture, Ministry of Agriculture and Cooperative, Thailand), were used in
this study. The methods of growing plants and salinization of the nutrient solution were
modified from Gregorio et. al (1997). Rice seeds were surface-sterilized with 1.5% (w/v)
calcium hypochlorite for 30 min, thoroughly washed and germinated in distilled water. The
uniformly germinated seeds were transferred to a plastic grid placed over a 6-liter container
filled with distilled water. After 5 days, when seedlings were well-established, the distilled
water was replaced by Yoshidas nutrient solution. The nutrient solution was adjusted to pH
5.0 with 1 N KOH or 1 N HCl and renewed every week. When the seedlings were 21 days old,
the culture solution was replaced by Yoshidas solution containing NaCl, either 60 mM or 120
mM, with an electrical conductivity of 6 or 12 dS m-1, respectively. After the seedlings had
been treated with NaCl for 7 days, the shoots and roots were harvested, frozen in liquid
nitrogen and stored at -80C until further use. The experiments were performed in six
replicates to obtain six independent samples of rice seedlings for determination of the fresh
weight, dry weight, relative water content and proline content.
Measurement of fresh and dry weight of leaves and roots
9 days after salinization, plants were randomly sampled and separated into shoots and
roots. The fresh weight of each sample was taken, then the samples were oven-dried at 60C
for 72 h for the determination of dry weight.
Measurement of relative water content
The relative water contents (RWC) of the stressed shoots and roots were measured.
About 0.1 g of samples were cut into small pieces, and the fresh weights (FW) of the samples
recorded. After that, the samples were floated in de-ionised water and left for 4 hours in the
refrigerator to allow the tissue to take up water, then re-weighed (turgid weight, TW). After
floating, samples were then dried for 48 hours at 60 C and dry weights (DW) were measured.
RWC was calculated as:
RWC (%) = (FW-DW) / (TW-DW) X 100
Measurement of proline content
Proline content was analyzed according to the procedure of Bates et al. (1973).
Approximately 0.1 g of fresh weight of shoots and roots were homogenized with 5 ml of 3%
aqueous sulfosalicylic acid and the homogenate was filtrated through Whatman No.2 filter
paper. Two ml of filtrate was reacted with 2 ml of acid ninhydrin and 2 ml of glacial acetic
acid in a test tube which was covered with a plastic cap and placed in a water bath maintained
at the constant temperature of 100C for 1 h, then placed on ice. The reaction mixture was
extracted with 5 ml of toluene, mixed vigorously with a vortex mixer for 15 sec. The toluene
phase containing the chromophores was aspirated, warmed to room temperature, and the
absorbance measured at 520 nm with a UV-VIS spectrophotometer, using toluene as a blank.
Pure proline was employed to standardize the procedure for quantifying sample values. The
proline content was determined from a standard curve and the concentration was expressed as
g g-1 FW.
RESULTS
Effects of salinity on fresh and dry weight
The effects of salinity on leaf growth in seedlings of rice cultivars were compared over a
period of 9 days (Figs1 and 2). Under control conditions there was a steady increase in the fresh
weights of leaves in both cultivars, whereas under saline condition, both cultivars showed a
decrease in leaf weight. Compared with the control plants, Pokkali plants grown under saline
conditions showed 72%, 47% and 54% reduction in leaf fresh weight on saline treatment for 5,
Page 500

July 9-11, 2012
7 and 9 days, respectively. Among the salt-sensitive cultivars, KDML105 suffered only 66%,
23% and 49% reduction, in comparison with the control plants (Fig1).
The effect of NaCl on dry weights of leaves in control plants followed a similar pattern
to fresh weights. Relative to controls, shoot dry weights of PK treated with saline decreased
slightly after 3 and 5 days of salt treatment, and were greatly decreased after 7 and 9 day of salt
stress (Fig 2A). In the case of KDML105, compared with the control plants, here was a 20-35%
reduction in leaf dry weight. Dry weights of shoots of KDML105 at 5 and 7 days of salt stress
were not significantly different from those of control plants (Fig 2B), and this strain had the
highest dry weight of shoots under both control and saline conditions.
Depression of leaf growth and stimulation of root growth resulted in lower leaf: root
ratios in saline-treated plants of KDML105, whereas in Pokkali there was a small increase in
leaf: root ratio due to a larger increase in leaf dry weights than in root dry weights (Fig 6).
Effect of salinity on water content
Changes in the relative water content (RWC) of plant tissues can reflect the effects of
water stress on plants (Havaux, M., 1986). In both cultivars tested it tended to decrease at 5 day
of growth, then increase again at 7 and 9 days of growth, irrespective of salt-stress. In rice
cultivar PK, there was no significant difference between control and salt-stressed plants
(Fig.3A), whereas the relative water content of KDML 105 was significantly different in control
and salt-stressed plants (Fig 3B).
Apparently the relative water content in rice cultivar PK was unaffected by salt stress,
and the reduction was more severe in the salt-sensitive than the salt-tolerant cultivars.
Effect of salinity on proline content
Leaves of salt-tolerant and salt-sensitive tolerant cultivars under non-stressed conditions
accumulated a relatively small amount of free proline (Fig 4). However, in response to NaCl
treatment, rice shoots accumulated a significant amount of free proline. The cultivar KDML105
accumulated the greatest amount of free proline, the highest amount being at 5 and 7 days of salt
treatment. The highest concentration was 197 g/g fresh weight of rice seedling at 5 days of salt
treatment, decreasing to 121 g/g at 9 days of salt treatment, at which time the rice seedlings
displayed yellow and brown leaves. In the case of Pokkali, the amount of free proline was
significantly lower than in KDML 105. The proline content of roots under non-stressed
condition was not different in two cultivars. Root tissues of Pokkali responsed to salinity by
accumulating lower levels of proline than the salt-sensitive KDML105 cultivar (Fig 8). The
highest proline content detected was 78 g/g fresh weight of rice seedling, and this was not
significantly different in the two levels of salinity stress that were tested. The amount of proline
in both shoots and roots tends to be positively correlated with the level of salinity tolerance.
Salinity markedly increased the proline content of different salt-sensitive and salttolerant genotypes of maize cultivars, with more proline accumulation observed in salt-tolerant
strains (Mansour, 2005), in contrast to the results reported here with rice. Our results imply that
NaCl stress increases proline accumulation in the leaves of the two cultivars, strongly in KDML
105, unlike proline accumulation in the roots of the two cultivars, where there is no significant
difference between controls and salt-stressed plants of either cultivar. The proline content of all
rice cultivars increased in response to salt-induced stress. The increased proline accumulation in
both tissues appears to correlate with adaptation to salinity.
DISCUSSION
Salinity affects plants through osmotic effects, ion specific effects and oxidative stress
(Munns,, 2008). Osmotic effects are due to salt-induced decrease in the soil water potential.
Salinity results in a reduced K+ and Ca2+ content and an increased level of Na+ and Cl -. Osmotic
adjustment of rice is achieved through the accumulation of organic and inorganic solutes such as
proline (Yeo, 1998). Therefore, a greater decrease in cell solute potential than in the external salt
concentration may indicate an osmotic adjustment. Organic solutes are accumulated in the cytosol
Page 501

July 9-11, 2012
to balance the solute potential of vacuole, which is dominated by ions (Greenway and Munns,
1980). A large number of plant species accumulate proline in response to salinity stress and this
accumulation may play a role in combating salinity stress (Mansour, 2000; Ashraf and Harris,
2004). Although published data do not always indicate a positive correlation between the osmolyte
accumulation and adaptation to stress, our results do suggest a correlation between the level of
osmotic adjustment and the salt tolerance of rice cultivars.
0.3
Lea f fresh w eig ht (g lpla nt)
0.25
0.2
0.15
0.1
0.05
0
0
days
A
0.3
Lea f fresh weig ht (g /pla nt)
0.25
0.2
0.15
0.1
0.05
0
0
days
B
Fig. 1 Effect of NaCl on fresh weights of leaves of rice seedlings of Pokkali (A) and KDML105
(B) under salt stress conditions for nine days. Each point represents the mean of six observations
SEM. White bars represent control conditions, grey bars represent moderate salt stress (60 mM
NaCl) and black bars represent severe salt stress (120 mM NaCl).
Page 502

July 9-11, 2012
0.045
0.04
Leaf dry weight (g)
0.035
0.03
0.025
0.02
0.015
0.01
0.005
0
0
day
A
0.045
0.04
Leaf dry weight (g)
0.035
0.03
0.025
0.02
0.015
0.01
0.005
0
0
5
days
B
Fig. 2 Effect of NaCl on dry weights of leaves of rice seedlings of Pokkali (A) and KDML105 (B)
under salt stress conditions for nine days. Each point represents the mean of six observations
Page 503

July 9-11, 2012
100
% Relative water content
80
60
40
20
0
0
days
100
80
60
40
20
0
0
5
days
B
Fig. 3 Effect of NaCl on relative water content (RW) of shoots of rice seedlings of Pokkali (A) and
KDML105 (B) under salt stress conditions for nine days. Each point represents the mean of six
observations SEM. White bars represent control conditions, grey bars represent moderate salt
stress (60 mM NaCl) and black bars represent severe salt stress (120 mM NaCl).
Page 504

July 9-11, 2012
Lea f pro line co ntent (ug /g fresh weig ht)
200
160
120
80
40
days
Lea f pro line co ntent (ug /g fresh w eig ht)
200
160
120
80
40
0
0
5
days
B
Fig. 4 Effect of NaCl on proline content of leaves of rice seedlings of Pokkali (A) and KDML105
Page 505

July 9-11, 2012
Rootfreshweight(g)
0.05
0.04
0.03
0.02
0.01
0
0
days
0.05
Root fresh weight (g)
0.04
0.03
0.02
0.01
0
0
5
days
B
Fig. 5 Effect of NaCl on fresh weights of roots of rice seedlings of Pokkali (A) and KDML105 (B)
Page 506

July 9-11, 2012
0.006
Ro ot dry weight (g)
0.005
0.004
0.003
0.002
0.001
0
0
days
0.006
Root dry weight (g)
0.005
0.004
0.003
0.002
0.001
0
0
days
B
Fig. 6 Effect of NaCl on dry weights of roots of rice seedlings of Pokkali (A) and KDML105 (B)
Page 507

July 9-11, 2012
100
80
60
40
20
0
0
days
% Relative watre content
100
80
60
40
20
0
0
days
B
Fig. 7 Effect of NaCl on relative water content (RW) of roots of rice seedlings of Pokkali (A) and
KDML105 (B) under salt stress conditions for nine days. Each point represents the mean of six
observations SEM. White bars represent control conditions, grey bars represent moderate salt
stress (60 mM NaCl) and black bars represent severe salt stress (120 mM NaCl).
Page 508

July 9-11, 2012
Ro o t pro line co ntent (ug/g fresh weig ht)
100
80
60
40
20
0
0
days
Root proline content (ug/g fresh weight)
100
80
60
40
20
0
0
days
B
Fig. 8 Effect of NaCl on proline contents of roots of rice seedlings of Pokkali (A) and KDML105
ACKNOWLEDGEMENTS
This work was supported by funds from the Thailand Commission on Higher Education
and by a Science and Social Science, Burapha University Sakaeo Campus Research Grant to the
corresponding author.
Page 509

July 9-11, 2012
REFERENCES
Akbar, M., Yabuno, Y. and Nakao, S. 1974. Breeding for saline resistant varieties
of rice. I.
Variability for salt tolerance among some rice varieties. Japanese Journal of Breeding
22: 277-284.
Ashraf, M. and Harris. P.J.C. 2004. Potential biochemical indicators of salinity tolerance in
plants. Plant Science 166: 3-16.
Bates, L. S., Waldren, R. P. and Teare, I. D. 1973. Rapid determination of free proline for
water stress studies. Plant Soil 39:205-207.
Faustino, F.C., Lips, H.S. and Pacardo, E.P. 1996. Physiological and biochemical mechanism
of salt tolerance in rice: I. Sensitivity thresholds to salinity of some physiological
processes in rice (Oryza sativa L.). Journal of Crop Science 21: 40-50.
Flowers, T.J., Hajibagheri, M.A. and Yeo, A.R. 1991. Ion accumulation in cell
walls of rice plants growing in saline condition: evidence for the Oertli
hypothesis. Plant Cell Environment 14: 319-325.
Gregorio, G.B., Dharmawansa, S. and Mendoza, RD. 1997. Screening rice for
salinity tolerance. IRRI. Discussion Paper Series No. 22. International
Rice Research Institute, Manila, the Philippines: 1-30.
Greenway, H., and Munns, R. 1980. Mechanisms of salt tolerance in nonhalophytes.
Ann. Rev. Plant Physiology 31:149-190.
Havaux, M., Canaani, O. and Malkin, S. 1986. Photosynthetic responses of leaves to
water stress, expressed by photoacoustics and related methods: I. probing the
photoacoustics method as an indicator for water stress in vivo. Plant
Physiology 82: 827-833.
Lu, Z. and Neumann, P.M. 1998. Water stress maize, barley and rice seedlings
show species diversity in mechanisms of leaf growth inhibition. Journal of Experimental
Botany 49(329): 1945-1952.
Mansour, M.M.F., Salama, K.H.A., Mutawa M.M., Abou Hadid, A.F. 2002.
Effect of NaCl and polyamines on plasma membrane lipids of wheat
roots. Biological Plant 145: 235-239.
Page 510

July 9-11, 2012
Mansour, M.M.F., Salama, K.H.A., Mutawa M.M., Abou Hadid, A.F. 2005.
Cell and plant responses to NaCl in Zea May L. cultivars differing in salt tolerance.
General Apply Plant physiology 31: 29-41.
Munns, R. 2002. Comparative physiology of salt and water stress. Plant Cell
Enviromenl 25: 239-250.
Munns, R. and Tester, M. 2008. Mechanisms of salinity tolerance. Annual Review
Plant Biology 59: 651-681.
Yeo, A. 1998. Molecular biology of salt tolerance in the context of whole-plant
physiology. Journal of Experimental Botanical 49: 915-929.
Yoshida, S. 1981. Fundamental of rice crop science. Internation Rice Research
Institute. Los Banos.
Page 511

July 9-11, 2012
STP78-17
Habitat partitioning of genetically distinct zooxanthellae

inhabiting soft corals in the genus Sinularia
Thadsin Panithanarak
Institute of Marine Science, Burapha University, Chonburi, 20131, Thailand
E-mail: thadsin@hotmail.com
ABSTRACT
Zooxanthellae are unicellular dinoflagellates of the genus Symbiodinium. The genus is
classified into 9 distinct phylogenetic clades (clades A to I) based on nuclear ribosomal DNA
(rDNA) and partial chloroplast large subunit rDNA. Six of these clades are associated with coral
hosts. Various clades may differ in their physiology which influences ecological distribution and
resilience of coral hosts to environmental stresses. Symbiodinium is an important feature of coral
reef ecology and evolution, therefore understanding types and diversity of Symbiodinium correlating
to environmental difference in coral reef habitats is required for coral reef conservation and
management from current and future disturbances. In the Gulf of Thailand, there was no record on
the study of presence, identity and diversity of Symbiodinium. This study was the first to identify the
Symbiodinium of the Gulf of Thailand to the level of phylogenetic clades. Thirty four soft corals in
the genus Sinularia were collected every two month during November 2008-January 2010 from two
different coral reef habitats, inshore coral reefs of Jorake Island (n = 14) and offshore coral reefs of
Juang and Jan Islands (n = 20). Genetic analyses of Symbiodinium were based on partial sequences
of large subunit (LSU) rDNA. The results showed that there were at least two clades of
Symbiodinium from Jorake, Juang and Jan Islands. Most of clade D was detected from inshore site
of Jorake Island while all of clade C was unique to offshore sites of Juang and Jan Islands. The data
from this study suggest that for some soft coral species, different environments could influence the
dominance and evolutionary success among different groups of Symbiodinium.
Keywords: zooxanthellae, Symbiodinium, soft corals, Sinularia, rDNA, the Gulf of Thailand
INTRODUCTION
Zooxanthellae are unicellular dinoflagellates of the genus Symbiodinium forming
mutualistic symbiosis with a wide range of marine invertebrates including sponges, cnidarians and
mollusks (reviewed in Pochon et al., 2006). In coral reef ecosystem, the symbiosis between
Symbiodinium and coral is important to the productivity, survival and success of coral hosts
(Muscatine and Porter 1977). In the past, zooxanthellae were considered as groups of a single
pandemic species, Symbiodinium microadriaticum (Freudenthal, 1962; Taylor, 1974) as they
showed simple and almost featureless morphology. Although, advanced molecular studies reveal
that Symbiodinium is a genetically diverse group of dinoflagelllates and each species possess unique
Page 512

July 9-11, 2012
environmental, ecological and geographic variations. This influences the resilience of coral hosts to
elevated temperatures and bleaching.
Dinoflagellates of the genus Symbiodinium are classified into 9 genetically distinct clades
(Clade A to I; Pochon and Gates, 2010) based on nuclear ribosomal DNA (rDNA) and later
confirmed by partial chloroplast large subunit rDNA sequence variations (Santos et al., 2002). Coral
hosts can form association with six of the nine clades. Various clades may differ in their physiology
which influences ecological distribution and resilience of coral hosts to environmental stresses.
Numbers of studies showed differences in the composition of coral symbiotic communities among
locations or with ontogeny of the host (Baker, 2003; van Oppen et al., 2005; LaJuenesse et al.,
2010; Oliver and Palumbi, 2011). These variations are not clearly understood but they could explain
by some combination of local adaptation of the coral host to abiotic conditions and genetic variation
by both the host and Symbiodinium (van Oppen
et al., 2005; Oliver and Palumbi, 2011).
Symbiodinium is an important feature of coral reef ecology and evolution, therefore understanding
types and diversity of Symbiodinium correlating to environmental difference in coral reef habitats is
required for coral reef conservation and management from current and future disturbances such as
coral bleaching. In Thailand, Symbiodinium types and diversity have never been reported until
recently LaJeunesse et al. (2010) observed the dominance and genetic diversification of
Symbiodinium influenced by environmental conditions, geographic isolation and host-symbiont
specificity. The results showed that thermally resistant clade D Symbiodinium was the most common
type of the Andaman Sea. For some coral species, clade D Symbiodinium was detected at higher
frequencies among inshore reefs while for other species, environmental factors had no influence on
the distribution of clade D Symbiodinium (LaJeunesse et al., 2010).
This study was the first to examine symbiotic zooxanthellae in a particular soft coral host within
the Gulf of Thailand. Types and genetic diversity of Symbiodinium in the most diverse soft corals in
the genus Sinularia (Family Alcyoniidae) were examined from different coral reef habitats, inshore
site of Jorake Island and offshore sites of Juang and Jan Islands, by the analysis of rDNA sequence
variations. Symbiodinium community assemblages were compared between the two collection sites.
This was to verify that for some soft coral species different environments could influence the
dominance and evolutionary success among different groups of Symbiodinium.
Soft Coral Samples
Ethanol-preserved tissue samples of soft corals in the genus Sinularia (34 samples in total)
were obtained from the study of "Morphological and genetic variations of soft coral, Sinularia
May, 1898 (Octocorallia: Alcyonacea) along Nang-Rong Beach, Jorake Island and Juang Islands,
Amphur Sattahip, Chonburi Province" by Panithanarak et al. (2011). The samples used in this
study were collected every two month during November 2008-January 2010 by scuba diving at 2
locations from inshore coral reefs of Jorake Island (n = 14) and offshore coral reefs of Juang and
Jan Islands (n = 20) (Fig. 1).
Page 513

July 9-11, 2012
Fig. 1 A map showing Symbiodinium collection sites in the Gulf of Thailand comprising inshore
site (Jorake Island) and offshore sites (Juang and Jan Islands). This map was modified from a map
of Amphur Sattahip by the Royal Thai Survey Department, Bangkok, Thailand.
DNA Extraction, Amplification and
Sequencing
DNA was extracted from absolute ethanol-preserved tissue samples using QIAamp DNA
Minikit (Qiagen, Hilden, Germany). PCR amplification of partial large subunit (LSU) rDNA was
modified from the protocols in Pochon et al. (2001) using the specific Symbiodinium primer ITSDINO (5'-GTGAATTGCAGAACTCC-3') situated in the ITS region and the universal primer L_O
[5'-GCTATCCTGAG(AG)GAAACTTCG-3'] situated about 900 nucleotides downstream of the
5'-end of the LSU rDNA. The PCR products amplified with ITS-DINO and L_O included the 3'end of the 5.8 S region, the whole ITS2 region and the 5'-end of the LSU rDNA. The PCR
products were further purified using QIAquick PCR purification kit (Qiagen). DNA sequencing
was carried out by the sequencing service, Macrogen (Seoul, Korea) using both primers (ITSDINO and L_O).
Data Analyses
Nucleotide sequences of partial LSU rDNA were manually checked for accuracy. In each
sample, two sequences (forward and reverse) were obtained. The forward and reverse sequences
were assembled by CAP3 program (Huang and Madan, 1999; http://pbil.univ-lyon1.fr/cap3.php).
Page 514

July 9-11, 2012
All sequences were compared to existing databases of LSU rDNA of Symbiodinium deposited in
GenBank using BLASTN program (http://blast.ncbi.nlm.nih.gov) and then aligned using Clustal X
1.81.msw (Thompson et al., 1997). They were assigned to major clade identities C or D on the
basis of showing highest identity with the sequences in the databases.
Genetic diversity of Symbiodinium sampled from inshore and offshore sites were estimated
with number of haplotypes (H), haplotype diversity (h) and nucleotide diversity () using DnaSP
v.5.10.01 (Librado and Rozas, 2009). Haplotype frequencies of clades C and D Symbiodinium
from inshore and offshore sites were calculated and compared using Arlequin 3.5 (Excoffier et al.,
2005). To see whether the frequencies of clades C and D between inshore and offshore sites
showed statistically differences, an exact test of sample differentiation based on haplotype
frequencies (Raymond and Rousset, 1995) as implemented in Arlequin 3.5 was performed. A level
of genetic differentiation between inshore and offshore Symbiodinium was also estimated with FST
(molecular distance: pairwise difference) using Arlequin 3.5.
Phylogenetic Analyses
Phylogenetic reconstructions based on partial LSU rDNA sequences were conducted using
maximum parsimony (MP) method with heuristic search and random addition of sequences as
implemented in PAUP* 4.0b10 (Swofford, 2002). No model of molecular evolution was assumed.
Starting trees were obtained by stepwise addition and branches swapped using the tree-bisectionreconnection (TBR) algorithm. Trees were rooted using midpoint method. To assess the statistical
significance of internal branching, a thousand bootstrap replicates were performed. Posterior
probabilities were also calculated using MrBayes v.3.1 (Huelsenbeck and Ronquist, 2001;
Ronquist and Huelsenbeck, 2003). Eight hundreds and fifty thousands generations were analyzed
under the TrNef model (Tamura and Nei, 1993) of sequence evolution, as the likelihood ratio test
(as implemented in MODELTEST 3.7; Posada and Crandall, 1998) revealed that this model had
the best fit to the data set. No prior probability was defined. The posterior probabilities were
calculated after removing 212,500 generations (burn-in).
RESULTS
Symbiodinium Clade Identity
Partial sequences of LSU rDNA were used to identify phylogenetic clades of Symbiodinium in
soft coral hosts (genus Sinularia). In this study, two clades of Symbiodinium, clades C and D, were
detected on the basis of showing highest identity (99%) with the sequences in the Genbank
databases. Among 34 rDNA sequences (916 nucleotides in length), 13 haplotypes were defined
with 7 and 6 haplotypes belonging to clade D (D1 to D7) and clade C (C1 to C6), respectively
(Table 1). Most of clade D haplotypes (D1 to D5, Table 1 and Fig. 2) were found in inshore site of
Jorake Island while a small number (relative frequencies D1 = 0.10, D4 = D5 = D6 = D7 = 0.05,
Table 1) was detected in offshore sites of Juang and Jan Islands. In contrast, all of clade C
haplotypes (C1 to C6, Table 1 and Fig. 2) were found in offshore islands and none of them was
detected from inshore island. The dominant haplotype within inshore site was haplotype D1
(relative frequency = 0.50) while in offshore sites was haplotype C6 (relative frequency = 0.25)
(see Table 1).
Page 515

July 9-11, 2012
Overall genetic diversity of Symbiodinium populations from offshore sites was relatively higher
than inshore site (offshore sites n = 20, H = 11, h = 0.91 0.04, = 0.11 0.02; inshore site n =
14, H = 5, h = 0.70 0.10, = 0.002 0.0007). The haplotype frequencies of clades C and D
Symbiodinium between inshore and offshore islands showed statistically significant differences
(Exact
P-value < 0.00001, 30,000 Markov steps done). In addition, the Symbiodinium
populaltion of inshore island was genetically different from the population of offshore islands (FST
= 0.64, P < 0.00001, no. of permutations = 110).
Table 1 Relative frequencies of Symbiodinium haplotypes from inshore site (Jorake Island) and
offshore sites (Juang and Jan Islands). Clade D haplotypes were defined as D1 to D7 and clade C
haplotypes were defined as C1 to C6.
Haplotype
Jorake Island
Juang and Jan Islands
(n = 14)
(n = 20)
D1
0.50
0.10
D2
0.07
D3
0.07
D4
0.07
0.05
D5
0.29
0.05
D6
0.05
D7
0.05
C1
0.20
C2
0.05
C3
0.05
C4
0.05
C5
0.10
C6
0.25
Page 516

July 9-11, 2012
Jorake Island
Juang&Jan Islands
Frequencies
7
6
5
4
3
2
1
0
D1
D2
D3
D4
D5
D6
D7
C1
C2
C3
C4
C5
C6
Haplotype
Fig. 2 Symbiodinium haplotype frequencies showing numbers of samples that were associated with
each particular haplotype based on analysis of the samples from inshore site (Jorake Island) and
offshore sites (Juang and Jan Islands).
Phylogenetic relationships
Phylogenetic reconstructions based on 34 partial LSU rDNA sequences of Symbiodinium found
12 best maximum parsimony trees using heuristic search. A 50% majority-rule consensus of the 12
trees was shown in Fig. 3. Phylogenetic analysis revealed differentiation of 2 genetically distinct
groups of clades C and D Symbiodinium. This separation was well supported by bootstrap values
and posterior probabilities (Fig. 3). The cluster of clade C was strongly supported by both
bootstrap values (100%) and posterior probabilities (1.00, Fig. 3). It was clear that host habitats
(inshore and offshore sites) associated with evolutionary success of clades C and D Symbiodinium
inhabiting a specific soft coral host in the genus Sinularia.
Page 517

July 9-11, 2012
C1 Sinularia sp. H14 Juang
C1 Sinularia sp. H13 Jan
100/1.00

- /0.82
C3 Sinularia sp. Juang

- /0.83
- /0.59

C6 Sinularia sp. H11 Jan
C6 Sinularia sp. H1Juang
D2 Sinularia sp. H11 Jorake
D5 Sinularia sp. H16 Juang
52/0.92

54/0.92

Fig. 3 A 50% majority-rule consensus of 12 maximum parsimony trees showing phylogenetic

relationships of clades C and D Symbiodinium haplotypes (C1 to C6 and D1 to D7) based on
partial large subunit (LSU) rDNA sequence data. Trees were rooted using midpoint method.
Numbers separated by a forward slash mark to the left of the phylogeny are bootstrap values based
on 1,000 replicates (first number) and posterior probabilities (second number) for internal branch
support. The corresponding host genus, haplotypes (according to Panithanarak et al., 2011) and
collection sites are provided to the right of the phylogeny.
Page 518

July 9-11, 2012
DISCUSSION
The data collected in this study show a clear pattern of host habitat partitioning (inshore and
offshore coral reef sites) of Symbiodinium communities in a particular soft coral of the genus
Sinularia (Fig. 3) in that clade D Symbiodinium dominated inshore site of Jorake Island while
clade C Symbiodinium was prevail to offshore sites of Juang and Jan Islands and has not been
observed in inshore site (Table 1 and Fig. 2). The reason why the proportions of clade D and clade
C were differed significantly across sampled habitats is mostly due to physiological characteristics
of Symbiodinium clades and local environmental factors (inshore and offshore sites) influencing
Symbiodinium distribution. Previous studies suggest that members of clade D may show high
proportions in more stressful environments for corals. For instance, in scleractinian corals
Montastraea annularis (sensu lato), Acropora palifera, A. valida and A. hyacinthus proportions of
clade D tend to be higher in higher-temperature sites and more turbid areas (Garren et al., 2006;
van Oppen and Gates, 2006; Oliver and Palumbi, 2009). In studies of a variety of species hosts,
clade D is common among turbid rock islands of Palau in the Pacific Ocean (Fabricius et al., 2004)
and the north-east Indian Ocean and Persian Gulf (Baker et al., 2004; LaJeunesse et al., 2010) but
uncommon on the cooler, southern and central Great Barrier Reef (LaJeunesse et al., 2003; 2004)
as well as in the Red Sea and Mauritius (Baker et al., 2004; LaJeunesse et al., 2010). In this study,
inshore site of Jorake Island is close to Nang-Rong Beach, one of the leisure places in the Gulf of
Sattahip (Chonburi Province, Thailand) while offshore sites of Juang and Jan Islands are farther
approximately 30 miles from the coast and thus they are exposed to clearer outer shelf waters. This
partly explains why members of clade D were more common in inshore site compared to offshore
sites and also why clade C is unique to the offshore reef sites.
The influences of different environments on the presence of various Symbiodinium clades were
also observed in the Andaman Sea (LaJeunesse et al., 2010). For some scleractinian coral species,
(e.g. Favites, Platygyra and Symphyllia) members of clade D were found at higher frequencies
among inshore reefs (Cape Panwa and Koh Hae) compared to offshore reefs (Koh Phi Phi Don,
Koh Phi Phi Lae, Koh Racha and the Similan Islands). In contrast, among other species (e.g.
Acropora and Porites), environmental factors could not influence the distribution of clade D
Symbiodinium. LaJeunesse et al. (2010) suggested that some coral species could change their
symbionts community across different habitats because those species display horizontal modes of
symbiont acquisition (i.e. acquire symbionts from the environment during early development
rather than from the parent). This suggestion was supported by the record that approximately 8090% of Indo-Pacific corals broadcast spawn to produce aposymbiotic larvae that depend on
horizontal symbiont acquisition (Richmond and Hunter, 1990). Many studies consistently agree
that not all coral species' Symbiodinium communities change with their habitat such as in
hydrocoral Millepora divaricata which is common in the high-temperature back-reef pool
(southern coast of Ofu Island, American Samoa) but it hosts a single Symbiodinium type even in
different environments (Oliver and Palumbi, 2011) and regions such as in the Indo-Pacific
(LaJeunesse et al., 2009). This is analogous to the genus Porites which is generally related to a
single Symbiodinium type (Baker, 2003; LaJeunesse et al., 2003; Fitt et al., 2009). In soft corals,
other symbiotic hosts in the Family Alcyoniidae (e.g. Cladiella) did not show any correlation
between local environmental factors and prevalence of Symbiodinium clades resembling the genus
Sinularia in this study (Thadsin Panithanarak, unpublished data). Mode of symbiont acquisition of
Sinularia is not well understood but it is possible that Sinularia obtained Symbiodinium from
surrounding environments as coral-algal specificity did not investigated in this study. All data at
Page 519

July 9-11, 2012
this point suggest that the correlation between Symbiodinium types and environmental factors may
play an important role in thermal adaptation of many coral species but not for all species.
To conclude, the prevalence of genetically distinct Symbiodinium communities in this study
varied across different habitats. Clade D Symbiodinium was dominant in more turbid inshore reef,
while clade C Symbiodinium was unique to offshore reefs which are exposed to cleaner-water
environments. Host species also play an important role in ecological adaptation and evolutionary
success of Symbiodinium community. This fundamental knowledge is crucial for coral reef
conservation and management in Thailand. For a better understanding of how different
environments influence the presence of host-symbiont combinations, further information from
broader sampling in a wide range of coral species is required.
ACKNOWLEDGEMENTS
The author would like to acknowledge the assistance of Sarawut Siriwong and Saharat
Dheerakamporn for their help in sample collections under the research project Morphological and
genetic variations of soft coral, Sinularia May, 1898 (Octocorallia: Alcyonacea) along NangRong Beach, Jorake Island and Juang Islands, Amphur Sattahip, Chonburi Province (under the
Plant Genetic Conservation Project under the Royal initiative of Her Royal Highness Princess
Maha Chakri Sirindhorn) funding by NRCT (National Research Council of Thailand) during 20092010. I would also like to thank the Institute of Marine Science, Burapha University for facility
support.
Page 520

July 9-11, 2012
REFERENCES
Baker, A. C. 2003. Flexibility and specificity of coral-algal symbiosis: diversity, ecology, and
biogeography of Symbiodinium. Annual Reviews of Ecology and Systematics 34: 661-689.
Baker, A. C., Starger, C. J., McClanahan, T. R. and Glynn, P. W. 2004. Corals adaptive response
to climate change. Nature 430: 741.
Excoffier, L. G. Laval and Schneider, S. 2005. Arlequin ver. 3.0: An integrated software package
for population genetics data analysis. Evolutionary Bioinformatics Online 1: 47-50.
Fabricius, K. E., Mieog, J. C., Colin, P. L., Idip, D. and van Oppen, M. J. H. 2004. Identity and
diversity of coral endosymbionts (zooxanthellae) from three Palauan reefs with contrasting
bleaching, temperature and shading histories. Molecular Ecology 13: 2445-2458.
Fitt, W., Gates, R., Hoegh-Guldberg, O., Bythell, J., Jatkar, A., Grottoli, A., Gomez, M., Fisher, P.,
LaJeunesse, T. C. and Pantos, O. 2009. Response of two species of Indo-Pacific corals,
Porites cylindrica and Stylopora pistillata, to short-term thermal stress: The host does matter
in determining the tolerance of corals to bleaching. Journal of Experimental Marine Biology
and Ecology 373: 102-110.
Freudenthal, H. D. 1962. Symbiodinium gen. nov. and Symbiodinium microadriaticum sp. nov., a
zooxanthellae: taxonomy, life cycle, and morphology. Journal of Protozoology 9: 45-52.
Garren, M., Walsh, S. M., Caccone, A. and Knowlton, N. 2006. Patterns of association between
Symbiodinium and members of the Montastraea annularis species complex on spatial scales
ranging from within colonies to between geographic regions. Coral Reefs 25: 503-512.
Huang, X. and Madan, A. 1999. CAP3: A DNA sequence assembly program. Genome Research 9:
868-877.
Huelsenbeck, J. P. and Ronquist, F. 2001. MRBAYES: Bayesian inference of phylogeny.
Bioinformatics 17: 754-755.
LaJeunesse, T. C., Bhagooli, R., Hidaka, M., deVantier, L., Done, T., Schmidt, G. W., Fitt, W. K.
and Hoegh-Guldberg, O. 2004. Closely related Symbiodinium spp. differ in relative
dominance in coral reef host communities across environmental, latitudinal and
biogeographic gradients. Marine Ecology Progress Series 284: 147-161.
LaJeunesse, T. C., Loh, W. K. W., van Woesik, R., Hoegh-Guldberg, O., Schmidt, G. W. and Fitt,
W. K. 2003. Low symbiont diversity in southern Great Barrier Reef corals, relative to those
of the Caribbean. Limnology and Oceanography 48: 2046-2054.
LaJeunesse, T. C., Pettay, D. T., Sampayo, E. M., Phongsuwan, N., Brown, B., Obura, D. O.,
Hoegh-Guldberg, O. and Fitt, W. K. 2010. Long-standing environmental conditions,
geographic isolation and host-symbiont specificity influence the relative ecological
dominance and genetic diversification of coral endosymbionts in the genus Symbiodinium.
Journal of Biogeography 37: 785-800.
Page 521

July 9-11, 2012
LaJeunesse, T. C., Smith, R. T., Finney, J. and Oxenford, H. 2009. Outbreak and persistence of
opportunistic symbiotic dinoflagellates during the 2005 Carribean mass coral 'bleaching'
event. Proceedings of the Royal Society B: Biological Sciences 276: 4139-4148.
Librado, P. and Rozas, J. 2009. DnaSP v5: software for comprehensive analysis of DNA
polymorphism data. Bioinformatics 25: 1451-1452.
Muscatine, L. and Porter, J. W. 1977. Reef corals: mutualistic symbioses adapted to nutrient-poor
environments. BioScience 27: 454-460.
Oliver, T. A. and Palumbi, S. R. 2009. Distributions of stress-resistant coral symbionts match
environmental patterns at local but not regional scales. Marine Ecology Progress Series 378,
93-103.
Oliver, T. A. and Palumbi, S. R. 2011. Many corals host thermally resistant symbionts in hightemperature habitat. Coral Reefs 30: 241-250.
Panithanarak, T., Siriwong, S., Putchakarn, S. and Dheerakamporn, S. 2011. Morphological and
genetic variations of soft coral, Sinularia May, 1898 (Octocorallia: Alcyonacea) along
Nang-Rong Beach, Jorake Island and Juang Islands, Amphur Sattahip, Chonburi Province.
Final Report. Supported by National Research Council of Thailand. 86 p. (in Thai)
Pochon, W. and Gates, R. D. 2010. A new Symbiodinium clade (Dinophyceae) from soritid
foraminifera in Hawaii. Molecular Phylogenetics and Evolution 56(1): 492-497.
Pochon, X., Montoya-burgos, J. I., Stadelmann, B. and Pawlowski, J. 2006. Molecular phylogeny,
evolutionary rates and divergence timing of the symbiotic dinoflagellate genus
Symbiodinium. Molecular Phylogenetics and Evolution 38: 20-30.
Pochon, X., Pawlowski, J., Zaninetti, L., Rowan, R. 2001. High genetic diversity and relative
specificity among Symbiodinium-like endosymbiotic dinoflagellates in soritid
foraminiferans. Marine Biology 139: 1069-1078.
Posada, D. and Crandall, K. A. 1998. MODELTEST: testing the model of DNA substitution.
Bioinformatics 14: 817-818.
Raymond, M. and Rousset, F. 1995. An exact test for population differentiation. Evolution 49:
1280-1283.
Richmond, R. H. and Hunter, C. L. 1990. Reproduction and recruitment of corals: comparisons
among the Caribbean, the tropical Pacific and the Red Sea. Marine Ecology Progress Series
60: 185-203.
Ronquist, F. and Huelsenbeck, J. P. 2003. MRBAYES 3: Bayesian phylogenetic inference under
mixed models. Bioinformatics 19: 1572-1574.
Santos, S. R., Taylor, D. J., Kinzie, R. A. III, Hidaka, M., Sakai, K. and Coffroth, M. A. 2002.
Molecular phylogeny of symbiotic dinoflagellates inferred from partial chloroplast large
subunit (23S)-rDNA sequences. Molecular Phylogenetics and Evolution 23, 97-111.
Swofford, D. L. 2002. PAUP*-phylogenetic analysis using parsimony (*and other methods),
Version 4.0b10. Sinauer Associates, Sunderland, MA.
Page 522

July 9-11, 2012
Tamura, K. and Nei, M. 1993. Estimation of the number of nucleotide substitutions in the control
region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and
Evolution 10: 512-526.
Taylor, D. L. 1974. Symbiotic marine algae: taxonomy and biological fitness, pp. 245-262.
W. B. Vernberg (ed.). Symbiosis in the Sea, Columbia University Press, New York.
In:
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G. 1997. The Clustal
X windows interface: flexible strategies for multiple sequence alignment aided by quality
analysis tools. Nucleic Acids Research 24: 4876-4882.
van Oppen, M. J. H. and Gates, R. D. 2006. Conservation genetics and the resilience of reefbuilding corals. Molecular Ecology 15: 3863-3883.
van Oppen, M. J. H., Mieog, J. C., Snchez, A. and Fabricius, K. E. 2005. Diversity of algal
endosymbionts (zooxanthellae) in octocorals: the roles of geography and host relationships.
Molecular Ecology 14: 2403-2417.
Page 523

July 9-11, 2012
STP81-18
Gene identification and structural modeling of a novel organic

solvent stable and thermophilic lipase from Acinetobacter baylyi
Phraewphan Sawasdee a and Jittima Charoenpanich b,c,*

a
Biological Science Program and Center of Excellence for Innovation in Chemistry (PERCH-CIC),
b
Laboratory of Environmental Biochemistry and Bioremediation, Department of Biochemistry,
c
Environmental Science Program and Center of Excellence on Environmental Health and
Toxicology, Faculty of Science, Burapha University, Bangsaen, Chonburi 20131, Thailand.
E-mail: jittima@buu.ac.th
ABSTRACT
A novel thermophilic-solvent stable lipase from Acinetobacter baylyi has been recently
purified and biochemically characterized. The enzyme expressed maximum activity at 60C and
pH 8.0 with p-nitrophenyl palmitate as a substrate and found to be stable in pH and temperature
ranging from 6.0-9.0 and 60-80C, respectively. A study on solvent stability revealed that the
enzyme was highly resisted to many organic solvents especially benzene and short-chain alcohols.
In this study, lipase gene was isolated directly from the genomic DNA of this bacterium with the
PCR-cloning method. The gene has an ORF of 972 bp encoding a protein of 323 amino acid
residues. The predicted amino acid sequence of this lipase showed maximum identity (79%) to
lipase of Acinetobacter sp. ADP1. Three-dimensional structure of A. baylyi lipase was predicted
based on homology modeling. The enzyme was a / globular protein comprising a central sixstranded sheets connected by six helices and showed 98% identity with Pseudomonas
aeruginosa lipase.
Keywords: Acinetobacter baylyi, solvent-stable lipase, thermophilic lipase, homology modeling
INTRODUCTION
Lipases (triacylglycerol acylhydrolases, EC 3.1.1.3) are some of the most important enzymes
used as industrial biocatalysts for a variety of biotechnological applications (Hansan et al., 2006).
Although their preferential catalytic reaction is hydrolysis of triglycerides at the water-lipid
interface, organic solvents or organic-aqueous two phase media are favorable for some reactions,
especially the prospective fields as pharmaceutical industry and biodiesel production (Fang et al.,
2006; Hansan et al., 2006). Lipases which organic solvents tolerance and thermostability are
capable of catalyzing a variety of important reactions, thereby presenting a fascinating field for
future research and causing tremendous interest among scientists and industrialists (Dordick, 1989;
Haki and Rakshit, 2003). The lipase produced by extremophilic bacteria was one of the important
lipases investigated, and many reports on its production, isolation, activity and solvent-stability
were published in recent decades (Gupta and Khare, 2009; Klibanov, 2001; Ogino and Ishikawa,
2001; Sardessai and Bhosle, 2002; Sellek and Chaudhuri, 1999). In our previous study, we isolated
a new benzene tolerant bacterium, Acinetobacter baylyi from marine sludge in Angsila, Thailand.
A. baylyi could secrete lipase and the enzyme was successfully purified with a relative molecular
Page 524

July 9-11, 2012
mass as 30 kDa. Maximum activity has been observed at 60C and pH 8.0 with p-nitrophenyl
palmitate as a substrate and the enzyme was stable in pH 6.0-9.0 and at temperature between 60
and 80C. The enzyme was highly resisted to many organic solvents especially benzene and shortchain alcohols and hydrolyzed preferentially medium length acyl chain and many natural oils.
Transesterification activity of palm oil to fatty acid methyl esters of A. baylyi lipase has been
drawn tremendous attention (Uttatree et al., 2010).
Recently, the genus Acinetobacter is well represented among fermentable bacteria for the
production of a number of extra- and intracellular economic products including lipases (Snellman
and Colwell, 2004; Young et al., 2005). Contribution of this genus to biotechnology seems to be
equally robust and versatile as Pseudomonas sp. However, it is safer because the genome of this
organism contains very few traits that might be associated with pathogenesis (Young et al., 2005).
Most of the lipases produced by Acinetobacter sp. have biochemical properties similar to those
produced by Pseudomonas sp. and Burkholderia sp., and show stability and maximum activity
under alkaline conditions at high temperature (Bornscheuer et al., 2002; Snellman and Colwell,
2004). Therefore, prospecting for novel lipase gene is of interest for both academic and industrial
reasons. Generally lipase genes of bacteria were isolated from genomic library. However, novel
lipase genes can be difficult to isolate due to several factors, including toxicity of expression to
heterologous hosts and lipase-specific oligonucleotide probes are required (Oh et al., 1999;
Rahman et al., 2003). In this study, a lipase gene was isolated with the PCR-cloning method
directly from genomic DNA of A. baylyi. We reported here the nucleotide sequencing, conserve
amino acid residues and structural modeling of this novel gene.
strains and culture condition
The wild-type A. baylyi (Uttatree et al., 2010) was routinely subcultured on nutrient broth
(Atlas, 1995) and cultivated at 25 C for 15 h, 150 rpm in 0.2 Luria-Bertani (LB) medium
(Sambrook et al., 1989) containing 0.8% (v/v) of Tween80 as inducer (Uttatree and
Charoenpanich, 2011). For routine cloning purposes, Escherichia coli DH5 was grown in LB
medium at 37 C for 1215 h as a host. When necessary, cultures were supplemented with 50
g/ml ampicillin, 1 mM IPTG and 1 mM X-Gal.
DNA manipulations, PCR and nucleotide sequence analysis
Transformations of E. coli, restrictions and ligations were carried out using standard procedures
(Sambrook et al., 1989). Total DNA of A. baylyi was extracted by GF-1 nucleic acid extraction kit
(Vivantis, Malaysia). Restriction enzymes and DNA ligase were purchased from Vivantis or
Fermentas and used as specified by the manufacturers. Plasmid DNA from E. coli was prepared
with a GF-1 Plasmid DNA extraction kit (Vivantis) and PCR products were purified from agarose
by using a GF-1 Gel DNA recovery kit (Vivantis). PCR mixtures (25 l) contained 0.4 pmol/ml of
each primer, 2 mM MgCl2, 0.25 mM of each deoxynucleotide, 1 Taq DNA polymerase buffer,
and 0.5 U Taq DNA polymerase (Vivantis). All PCR fragments were cloned into pTG19-T vector
(vivantis), except those obtained from degenerate primers, pUC118 was used. The nucleotide
sequences were checked by sequencing with the dideoxy chain-termination method (1stBase
Laboratories, Malaysia). Primers used for PCRs and sequencing reactions are listed in Table 1.
Page 525

July 9-11, 2012
PCR amplification, cloning, and sequencing of partial sequence of lipase gene
By comparing the amino acid sequences of 5 lipases from Acinetobacter, fives highly
conserved regions (Y-A-Q-T-K-Y-P, K-V-N-L-I-G-H, G-M-P-T-T-S-C, L-T-N-P-L-D-P, and NH-L-D-E-V-N) were selected to design 7 degenerate primers (Table 1). The genomic DNA of A.
baylyi was digested with 10 individual restriction enzymes (ApaI, BamHI, BglII, ClaI, HindIII,
NdeI, PstI, SalI, SpeI, and XhoI) and used as the template for amplification of the partial sequence.
PCR was performed as following: 95C for 10 min, followed by 30 cycles of amplification (95C
for 1 min, 60C for 45 sec, and 72C for 45 sec) and 72C for 5 min. After that, the purified PCR
product was digested with EcoRI and HindIII, cloned into pUC118, and sequenced with M13
primer.
Cloning of upstream and downstream sequences by nested-inverse PCR
Homology analysis using BLAST (National Center for Biotechnology Information Databases)
confirmed that the partial sequence obtained was a fragment of a novel lipase gene. To obtain the
upstream and downstream sequences flanking the fragment, new set of primers (Table 1) were
designed according to the known sequence and used for nested-inverse PCR. The genomic DNA
was self-ligated after digested with restriction enzymes, Bsp19II, FauNDI, and BshVI, and the
inverse PCR was performed. The two-step cycle PCR and nested PCR were used to elevate the
specificity. The first PCR with primers Lip-N1 and Lip-C1 was performed as following: 95C for
10 min, followed by 30 cycles of amplification (95C for 1 min, 60C for 45 sec, and 72C for 1
min) and 72C for 7 min. One microliter of the self-ligation product was used as the template in
the first PCR. Then, the nested PCR was done with the same condition with the primers Lip-N2 (or
Lip-N3) and Lip-C2, but 1 l of product of the first PCR was used as the template. The purified
product of the nested PCR was cloned into pTG19-T and sequenced with M13 primers from both
strands.
Primer name
Sequence (53)*
Purpose
Lip1
GGGGAATTCTACGCTMAAACAAAATACCCT
Partial gene amplification
Lip2
CCCAAGCTTTGASCAATWARATTTACTTT
Lip3
GGGGAATTCAAAGTAAATYTWATTGSTCA
Lip4
CCCAAGCTTACCACAAGMTGTTGTAGGYA
Lip5
GGGGAATTCATGCCTACAACAKCTTGTGG
Lip6
CCCAAGCTTAGGATCTAGWRBATTTGTTA
Lip7
CCCAAGCTTATTTACTTCATCWRSATGATT
Lip-N1
ACTGGCGCCACTCCATGAATAATA
Nested-inverse PCR
Lip-N2
GCCCTGTCCACAAGCTGTTGT
Nested-inverse PCR
Lip-N3
AGTACCCCTGCCACATAGCG
Nested-inverse PCR
Lip-C1
AATAATGATGGGCTGGTACCG
Nested-inverse PCR
Lip-C2
GGTACAGTCATACGCGACAATTAC
Nested-inverse PCR
Table 1 Primers used in this study
Page 526

July 9-11, 2012
* Restriction enzyme recognition sites are underlined. M = A+C, S= G+C, W= A+T, R= A+G,
Y= C+T, K=G+T, B= G+T+C
Multiple sequence alignment and homology modeling

Sequence analyses, homology modeling and molecular mechanics calculation were performed
on the Discovery Studio 2.5 package (Accelrys Inc., CA, USA). The amino acid sequence of the
lipase genes were obtained from the NCBI database (www.ncbi.nlm.nih.gov), covering 324
deduced amino acid residues of the A.baylyi lipase (accession number JQ316542). The entire
template coordinates used for homology modeling was retrieved from the protein data bank
(www.pdb.org). All of the template sequences were multiple-aligned according to their structural
superimposition of the C-alpha atoms on the Align and Superimpose Proteins protocol. The A.
baylyi lipase sequence was then automatically aligned to a set of aligned template sequences on the
Align Multiple Sequences protocol of which the pairwise alignment algorithm is modified from
the ClustalW 1.8 (Altschul et al., 1990). This alignment protocol allows keeping the existing
aligned sequences of the templates as a rigid element and thus the pre-aligned target sequence
could be mobile. Sequence identities and similarities between the target and template sequences
were calculated on the GeneDoc v2.7 (Krieger et al., 2003). The structural model of the lipase was
constructed based on the unconventional sequence alignment between the target and template
profile using the Modeller 9v4 (Bates and Sternberg, 1999) implemented in the Build Homology
Models protocol. Insertion and deletions in the target sequence with respect to the templates were
defined as loops and further refined within this protocol. The best quality model with highest
DOPE (discrete optimized protein energy) score was subsequently subjected to the
Minimization protocol based on the charmm22 force field (Buck et al., 2005) to remove
unreasonable atomic contacts (steepest descent and conjugate gradient methods until the model
reaching 0.1 kcal/mol convergence). The stereochemical qualities of the energy-minimized
model were assessed by the Procheck v3.5 (Zheng et al., 2005) via submitting the coordinates to
the JCSG structure validation server (www.jcsg.org).
An 231-nucleotide sequence was directly obtained with primers Lip5 and Lip7 from the
genomic DNA of A. baylyi. Sequence alignment by BLAST showed that the nucleotide sequence
was 74% identical to the partial sequence of lipase genes from Acinetobacter sp. ADP1 (accession
no. CR543861.1), A. calcoaceticus (accession no. X80800.1), and A. schindleri strain DYL129
(accession no. EU048343.1). These confirmed that the obtained PCR fragment was an internal part
of A. baylyi lipase gene. Using known nucleotide sequence, new set of primers was designed for
nested-inverse PCR. The upstream and downstream fragments flanking from the known region
were amplified. After nucleotide analysis, whole gene of A. baylyi lipase was successfully
identified and the sequence data has been submitted to the GenBank database under accession no
JQ316542. The ORF of lipase showed 972 bp encoding a protein of 323 amino acid residues (Fig.
1). Deduced amino acid sequence gave maximum identity (79%) to lipase of Acinetobacter sp.
ADP1 (accession no. YP_047804.1). More than 55% identical was matched with lipases from
other species including A. calcoaceticus (accession no. CAA56780.1), Acinetobacter sp. DR1
(accession no. YP_003730607.1), A. baumannii ATCC 17978 (accession no. AB013557.2), and A.
radioresistens SK82 (accession no. ZP_05361376.1).
Page 527

July 9-11, 2012
Fig. 1 Nucleotide sequence and deduced amino acid of the complete lipase of A. baylyi
The catalytic triad (Ser120, Asp249, His289 residues) were found at perfectly conserved positions
(Snellman and Colwell, 2004). Also, the gene sequence contained two potential calcium binding
site (Asp249 and Asp291) and two Cys residues (-Cys223~Cys273-) involving in disulfide bridge
formation. Moreover, an H-G dipeptide of the oxyanion loop of Acinetobacter lipases was detected
as shown in Fig. 2. According to these conserved amino acid sequences, it can be noted here that
the gene encoding for a novel thermophilic-solvent stable lipase from A. baylyi has been
successfully identified.
Three-dimensional structure of A. baylyi lipase shows the homology with 1EX9. The sequence
was 98% identical with E-value 0.0001 of 1,2-dioctylcarbamoyl-glycero-3-o-octylphosphonate
of Pseudomonas aeruginosa lipase complexed. The positives of amino acid of lipase were similar
with 52.9%. A central six-stranded sheets connected by six helices were observed in the 3-D
structure of lipase (Fig. 3). The evaluation of the 3-D structure on the basis of total free energy was
-13,200.87 kJ/mol. The torsion angles of 49.1% amino acid residue were in most favored region
and only 1.68% amino acid residue in disallowed region. The overall G-factors were 0.5 at
resolution of 2.54 . These results matched well with the characteristic /-folding pattern of
microbial lipase (Jaeger and Reetz, 1998).
Page 528

July 9-11, 2012
Fig. 3 The 3D-structural modeling of A. baylyi lipase. A central six-stranded sheets (green)
connected by six helices (blue) and the N- (yellow) and C-terminal (pink) are shown.
Fig. 2 Multiple sequence alignment of the complete lipase of A. baylyi against other related
complete lipases. Symbols: Catalytic triad residues, Cys residues involved in disulfide bridge
formation, Ca2+ Asp residues involved in calcium binding, H-G dipeptide of the oxyanion loop.
CONCLUSION
A lipase gene of the solvent stable A. baylyi was successfully identified with the genomewalking PCR method. The gene has an ORF of 972 bp encoding a protein of 323 amino acid
Page 529

July 9-11, 2012
residues and showed maximum identity (79%) to lipase of Acinetobacter sp. ADP1.The catalytic
triad, calcium binding site, residues involving in disulfide bridge formation and the oxyanion loop
of Acinetobacter lipases were found at perfectly conserved positions. Structural modeling of A.
baylyi lipase as a central six-stranded sheets connected by six helices matched well with the
characteristic /-folding pattern of microbial lipase.
ACKNOWLEDGEMENTS
This work was supported to J.C. by the PERDO Research Programme on Biofuel Development
for Thailand. We are grateful for a financial support to P.S. from the Center of Excellence for
Innovation in Chemistry (PERCH-CIC), the Commission on Higher Education, Ministry of
Education.
We
thank
Dr. A. Ausili for his technical assistance and Dr. K. Choowongkomon for his helps in structural
modeling.
Page 530

July 9-11, 2012
REFERENCES
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. 1990. Basic local alignment
search tool. Journal of Molecular Biology 215: 10403.
Atlas, R. M. 1995. Handbook of Microbiological Media for Environmental Microbiology, Boca
Raton, FL: CRC Press.
Bates, P. A. and Sternberg, M. J. E. 1999. Model building by comparison at CASP3: using expert
knowledge and computer automation. Proteins 3: 47-54.
Bornscheuer, U. T., Bessler, C., Srinivas, R., and Krishna, S. H. 2002. Optimizing lipase and
related enzymes for efficient application. Trend in Biotechnology 20: 433-437.
Dordick, J. S. 1989. Enzymatic catalysis in monophasic organic solvents. Enzyme and Microbial
Fang, Y., Lu, Z., Lv, F., Bie, X., Liu, S., Ding, Z., and Xu, W. 2006. A newly isolated organic
solvent tolerant Staphylococcus saprophyticus M36 produced organic solvent-stable
lipase. Current Microbiology 53: 510-515.
Gupta, A. and Khare, S. K. 2009. Enzymes from solvent-tolerant microbes: useful biocatalysts for
non-aqueous enzymology. Current Review in Biotechnology 29: 44-54.
Haki, G. D. and Rakshit, S. K. 2003. Development in industrially important thermostable enzyme:
a review. Bioresource Technology 89: 17-34.
Hansan, F., Shah, A. A., and Hameed, A. 2006. Industrial applications of microbial lipases.
Enzyme and Microbial Technology 39: 235-251.
Jaeger, K. E. and Reetz, M. T. 1998. Microbial lipases from versatile tools for biotechnology.
Trends in Biotechnology 16: 396-403.
Klibanov, A.M. 2001. Improving enzymes by using them in organic solvent. Nature 409: 241-246.
Krieger, E., Nabuurs, S. B., and Vriend, G. 2003. Homology modeling. Structural Bioinformatics.
ISBN 0-471-20199-5.
Ogino, H. and Ishikawa, H. 2001. Enzymes which are stable in the presence of organic solvent.
Journal of Bioscience and Bioengineering 91: 109-116.
Oh, B., Kim, H., Lee, J., Kang, S., and Oh, T. 1999. Staphylococcus haemolyticus lipase:
biochemical properties, substrate specificity and gene cloning. FEMS Microbiology
Letters 179: 385-392.Rahman, R. N. Z. A., Chin, J. H., and Salleh, A. B. 2003. Cloning
and expression of a novel lipase
gene from Bacillus sphaericus 205y. Molecular Genetics and Genomics 269: 252-260.
Page 531

July 9-11, 2012
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular Cloning: a Laboratory Manual, 2nd
edn, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sardessai, Y. and Bhosle, S. 2002. Tolerance of bacteria to organic solvent. Reseach in
Microbiology 153: 263-268.
Sellek, G. A. and Chaudhuri, J. B. 1999. Biocatalysis in organic media using enzymes from
extremophiles. Enzyme and Microbial Technology 25: 471-482.
Snellman, E. A. and Colwell, R. R. 2004. Acinetobacter lipases: molecular biology, biochemical
properties and biotechnological potential. Journal of Industrial Microbiology and
Biotechnology 31: 391-400.
Uttatree, S. and Charoenpanich J. 2011. Nutritional requirements and physical factors affecting the
production of organic solvent-stable lipase by Acinetobacter baylyi. Chiangmai University
Journal of Natural Sciences 10: 115-131.
Uttatree, S., Winayanuwattikun, P., and Charoenpanich, J. 2010. Isolation and characterization of
a novel thermophilic-organic solvent stable lipase from Acinetobacter baylyi. Applied
Biochemistry and Biotechnology 162: 1362-1376.
Young, D. M., Parke, D., and Ornston, L. N. 2005. Opportunities for genetic investigationafforded
by Acinetobacter baylyi, a nutritionally versatile bacterial species that is highly competent
for natural transformation. Annual Review in Microbiology 59: 519-551.
Zheng, Z. L., Zuoa, Z. Y., Liua, Z. G., Tsaib, K. C., Liua, A. F., and Zoua, G. L. 2005.
nstruction of a 3D model of nattokinase, a novel fibrinolytic enzyme from Bacillus natto a
novel nucleophilic catalytic mechanism for nattokinase. Journal of Molecular Graphics
and M
Page 532

July 9-11, 2012
STP86-20
Gene identification and structural modeling of an amidase

from a novel acrylamide-degrading bacterium
Enterobacter aerogenes
Sureeporn Suktanarag a, Oratai Mangkalad b, and Jittima Charoenpanich b,c,*

a
Biological Science Program and Center of Excellence for Innovation in Chemistry (PERCH-CIC),
b
Laboratory of Environmental Biochemistry and Bioremediation, Department of Biochemistry,
c
Environmental Science Program and Center of Excellence on Environmental Health and
Toxicology, Faculty of Science, Burapha University, Bangsaen, Chonburi 20131, Thailand.
E-mail: jittima@buu.ac.th
ABSTRACT
A widespread use and indiscriminate discharge of acrylamide, a neurotoxicant and
probably human carcinogen has led to their presence in environment. In spite of its general
toxicity, some microorganisms can derive energy from acrylamide for growth. In its catabolism,
acrylamide is deaminated to ammonia and acrylic acid, a process catalyzed by amidase or
amidohydrolase (EC 3.5.1.4). In this study, an attempt has been tried to identify an aliphatic
amidase gene from Enterobacter aerogenes, a novel acrylamide-degrading bacterium isolated
from domestic wastewater in Chonburi. The amidase gene from this bacterium was initially
identified by PCR using degenerate primers designed from conserved amino acid sequences of
amidohydrolase genes of Enterobacter spp. Amino- and carboxy-terminal fragment of the gene
consisted of 297 and 354 nucleotides, respectively were successfully amplified and cloned into
pUC118. The ligation products were transformed into Escherichia coli DH5 and nucleotide
sequencing of the gene was carried out. Then, new sets of primer were designed according to the
obtained sequences. The internal fragment and the unknown 3-franking region of the gene were
amplified with nested-inverse PCR method. After that, the obtained PCR products were cloned
into pTG19-T. The open reading frame of the gene consisted of 726 nucleotides (241 deduced
amino acids) were obtained. BLAST analysis showed more than 80% similarity to that of several
amidase and nitrilase/cyanide hydrolase genes from Enterobacteriaceae submitted to Genbank. The
deduced amino acid sequences revealed more than 88% homology to other amidases in the same
family. The three-dimensional structure of E. aerogenes amidase was predicted based on
homology modeling. The enzyme was a / globular protein comprising mainly six helices and
two six-stranded sheets and showed 45% identity with nitrilase, a nonpeptide C-N hydrolyzing
enzyme, from Xanthomonas camprestis. These results highlight the potential of PCR technique to
identify the amidase gene from E. aerogenes. The obtained gene has been expected to use for
further cloning and high-level expression of amidase in prokaryotic system.
Keywords: Enterobacter aerogenes, acrylamide biodegradation, amidase, homology modeling
Page 533

July 9-11, 2012
INTRODUCTION
Amidase or amidohydrolase (EC 3.5.1.4), catalyze the hydrolysis of amides into the
corresponding carboxylic acids and amines are turned out to be versatile biocatalyst in white and
green chemistry (Lorenz and Eck, 2004; Sharma et al., 2009). They are widely investigated by
researchers due to their enantio/stereoselective properties (Suzuki and Ohta, 2006). In industries
they are employed in combination with nitrile hydratase for the production of commercially
important organic acids through biotransformation of nitriles (Banerjee et al., 2002). They are also
utilized as industrial catalyst in effluent treatment (Madhavan et al., 2005; Nawaz et al., 1996) and
their acyl transferase activity is exploited mainly for the synthesis of pharmaceutically active
hydroxamic acids (Fournand et al., 1998; Ramakrishna and Desai, 1993). In recent decades, many
microbial amide-utilizing bacteria have already been screened and suggested to be an alternative
source of amidase production (Buranasilp and Charoenpanich, 2011; Nawaz et al., 1994; Nawaz et
al., 1998; Shanker et al., 1990).
In our previous study, a novel acrylamide-degrading bacterium, Enterobacter aerogenes
was isolated and characterized from domestic wastewater in Chonburi, Thailand. The strain grew
well in the presence of acrylamide as 0.5% (w/v), at pH 6.0 to 9.0 and 25C. Degradation of
acrylamide to acrylic acid started in the late logarithmic growth phase as a biomass-dependent
pattern. The cell-free supernatant had activity to completely degrade butyramide and urea, and to
convert other aliphatic amides (Buranasilp and Charoenpanich, 2011). Generally bacterial gene
was isolated from genomic library but it is difficult due to several factors, including toxicity of
expression to heterologous hosts and specific oligonucleotide probes are required (Oh et al., 1999;
Rahman et al., 2003). In this study, an attempt has been applied to isolate the amidase gene
directly from genomic DNA of E. aerogenes using the PCR-cloning method. We reported here the
nucleotide sequencing and structural modeling of this identified novel gene.
Bacterial strains and culture condition
The wild-type of acrylamide-degrading bacterium, E. aerogenes was routinely subcultured
on W-minimum medium, pH 7.0 (Kimbara et al., 1989) containing 0.5% (w/v) of acrylamide and
cultivated at 25 C for 24 h, 250 rpm in the same medium (Buranasilp and Charoenpanich, 2011).
For routine cloning purposes, Escherichia coli DH5 was grown in LB medium at 37 C for 12
15 h as a host. When necessary, cultures were supplemented with 50 g/ml ampicillin, 1 mM
IPTG and 1 mM X-Gal.
DNA manipulations, PCR and nucleotide sequence analysis
Transformations of E. coli, restrictions and ligations were carried out using standard
procedures (Sambrook et al., 1989). Total DNA of E. aerogenes was extracted by GF-1 nucleic
acid extraction kit (Vivantis, Malaysia). Restriction enzymes and DNA ligase were purchased
from Vivantis or Fermentas and used as specified by the manufacturers. Plasmid DNA from E. coli
was prepared with a GF-1 Plasmid DNA extraction kit (Vivantis) and PCR products were purified
from agarose by using a GF-1 Gel DNA recovery kit (Vivantis). PCR mixtures (25 l) contained
0.4 pmol/ml of each primer, 2 mM MgCl2, 0.25 mM of each deoxynucleotide, 1 Taq DNA
polymerase buffer, and 0.5 U Taq DNA polymerase (Vivantis). All PCR fragments were cloned
into pTG19-T vector (vivantis), except those obtained from degenerate primers, pUC118 was used.
Page 534

July 9-11, 2012
The nucleotide sequences were checked by sequencing with the dideoxy chain-termination method
(1stBase Laboratories, Malaysia). Primers used for PCRs and sequencing reactions are listed in
Table 1.
PCR amplification, cloning, and sequencing of partial sequence of lipase gene
By comparing the amino acid sequences of 5 amidohydrolases from Enterobacter, four
highly conserved regions (W-M-D-G-P-A-N, K-R-H-L-F-R-N, W-R-G-W-R-I-L, and E-K-F-P-AW-Q) were selected to design 4 degenerate primers (Table 1). The genomic DNA of E. aerogenes
was digested with 12 individual restriction enzymes (AhaI, ClaI, EcoRI, HindIII, KpnI, NdeI, NotI,
PstI, SalI, SpeI, XbaI, and XhoI) and used as the template for amplification of the partial sequence.
PCR was performed as following: 95C for 10 min, followed by 30 cycles of amplification (95C
for 1 min, 60C for 45 sec, and 72C for 45 sec) and 72C for 5 min. After that, the purified PCR
product was digested with EcoRI and HindIII, cloned into pUC118, and sequenced with M13
primer.
Cloning of upstream and downstream sequences by nested-inverse PCR
Homology analysis using BLAST (National Center for Biotechnology Information
Databases) confirmed that the partial sequence obtained was a fragment of the amidase gene. To
obtain the upstream and downstream sequences flanking the fragment, new set of primers (Table
1) were designed according to the known sequence and used for nested-inverse PCR. The genomic
DNA was self-ligated after digested with restriction enzymes, AhaI, EcoRI, NdeI, PstI, SalI, and
XhoI, and the inverse PCR was performed. The two-step cycle PCR and nested PCR were used to
elevate the specificity. The first PCR was done with primers NI-EnAmi3 and CI-EnAmi3 for the
amplification of upstream region and primers NI-EnAmi1 (or NI-EnAmi3) and CI-EnAmi1 for
downstream amplification. PCR was performed as following: 95C for 10 min, followed by 30
cycles of amplification (95C for 1 min, 60C for 45 sec, and 72C for 1 min) and 72C for 7 min.
One microliter of the self-ligation product was used as the template in the first PCR. Then, the
nested PCR was done with the same condition with the primers NI-EnAmi4 and CI-EnAmi4 (for
amplification of the upstream region), but 1 l of product of the first PCR was used as the
template. For downstream amplification, the primers NI-EnAmi2 (or NI-EnAmi4) and CI-EnAmi2
were used. The purified product of the nested PCR was cloned into pTG19-T and sequenced with
M13 primers from both strands.
Page 535

July 9-11, 2012
Table 1 Primers used in this study
Primer name
Sequence (53)*
Purpose
EnAmi1
GGGGAATTCTGGATGGAYGGCCCGGCSAA
EnAmi2
CCCAAGCTTCATRCGRAASAGRTGRCGTT
EnAmi3
GGGGAATTCTGGCGYGGCTGGCGYATYCT
EnAmi4
CCCAAGCTTGCCASGCCGGRAATTTYTC
NI-EnAmi3
TGCGGCATCGACTGCTTCGC
Nested-inverse PCR
NI-EnAmi4
TTGGCCGGGCCGTCCATCCA
Nested-inverse PCR
CI-EnAmi1
ACAGGGAGAGATTATCGCTA
Nested-inverse PCR
CI-EnAmi2
AGGAGTATCGCGAAAAATTC
Nested-inverse PCR
CI-EnAmi3
GGATGCTGGCGAAAGCGGAG
Nested-inverse PCR
CI-EnAmi4
ACTTTTACGATAAACGTCAC
Nested-inverse PCR
* Restriction enzyme recognition sites are underlined. S= G+C, R= A+G, Y= C+T

Multiple sequence alignment and homology modeling
Sequence analyses, homology modeling and molecular mechanics calculation were
performed on the Discovery Studio 2.5 package (Accelrys Inc., CA, USA). The amino acid
sequence of the amidase genes were obtained from the NCBI database (www.ncbi.nlm.nih.gov),
covering 242 deduced amino acid residues of the E. aerogenes amidase (accession number
JN402381). The entire template coordinates used for homology modeling was retrieved from the
protein data bank (www.pdb.org). All of the template sequences were multiple-aligned according
to their structural superimposition of the C-alpha atoms on the Align and Superimpose Proteins
protocol. The E. aerogenes amidase sequence was then automatically aligned to a set of aligned
template sequences on the Align Multiple Sequences protocol of which the pairwise alignment
algorithm is modified from the ClustalW 1.8 (Altschul et al., 1990). This alignment protocol
allows keeping the existing aligned sequences of the templates as a rigid element and thus the prealigned target sequence could be mobile. Sequence identities and similarities between the target
and template sequences were calculated on the GeneDoc v2.7 (Krieger et al., 2003). The structural
model of the amidase was constructed based on the unconventional sequence alignment between
the target and template profile using the Modeller 9v4 (Bates and Sternberg, 1999) implemented in
the Build Homology Models protocol. Insertion and deletions in the target sequence with respect
to the templates were defined as loops and further refined within this protocol. The best quality
model with highest DOPE (discrete optimized protein energy) score was subsequently subjected to
the Minimization protocol based on the charmm22 force field (Buck et al., 2005) to remove
unreasonable atomic contacts (steepest descent and conjugate gradient methods until the model
reaching 0.1 kcal/mol convergence). The stereochemical qualities of the energy-minimized
Page 536

July 9-11, 2012
model were assessed by the Procheck v3.5 (Zheng et al., 2005) via submitting the coordinates to
the JCSG structure validation server (www.jcsg.org).
The 297-and 354-nucleotide sequences covering N- and C-terminal part of amidase were
directly obtained from the genomic DNA of E. aerogenes when a pair of primer EnAmi1+EnAmi2
and EnAmi3+EnAmi4, respectively was used. Sequence alignment by BLAST showed that the
nucleotide sequences were more than 80% identical to the partial sequence of amidase genes from
Enterobacter cloacae subsp. cloacae NCTC9394 (accession no. FP929040.1), Klebsiella
pneumonia subsp. pneumonia NTUH-K2044 (accession no. AP006725.1) and K. pneumonia
subsp. pneumonia MGH78578 (accession no. CP000647.1) and nitrilase/cyanide hydratase genes
from E. cloacae SCF1 (accession no. CP002272.1), Enterobacter sp. 638 (accession no.
CP000653.1), and K. variicola At-22 (accession no. CP001891.1). These confirmed that the
obtained PCR fragment was the N- and C-terminal part of E. aerogenes amidase gene. Using
known nucleotide sequence, new set of primers was designed for nested-inverse PCR. The internal
part of the gene as well as the upstream and downstream fragments flanking from the known
region were amplified. After nucleotide analysis, 819 bp encoding 272 amino acid residues was
obtained (Fig. 1). Three start codons have been suggested. Then each start codon was used for
primer designing of amidase gene amplification and cloned into expression vector pET23d. The
third methione was suggested as the start codon of the gene according to the amidase activity
expressed in E. coli BL21 (DE3) (Mangkalad and Charoenpanich, unpublished data). Hence, the
ORF of E. aerogenes amidase comprising 726 bp (241 amino acid residues) was concluded
(yellow highlight in Fig. 2) and the sequence data has been submitted to the GenBank database
under accession no JN402381. Deduced amino acid sequence gave maximum identity (99%) to
amidase of E. aerogenes KCTC2190 (accession no. AEG97287.1). More than 87% identical was
matched with amidase from other species including E. cancerogenus ATCC35316 (accession no.
EFC55728.1), E. cloacae subsp. cloacae NCTC9394 (accession no. CBK85994.1), and E.
hormaechei ATCC49162 (accession no. EGK61946.1).
The catalytic triad of amidase in nitrilase superfamily (Glu27, Lys92, Cys126 residues) was
found at perfectly conserved positions (Sharma et al., 2009). The potential active site (Asp191 and
Ser196) of enantioselective amidase has been detected as shown in Fig. 2. According to these
conserved amino acid sequences, it can be noted here that the gene encoding for an amidase from
the novel acrylamide degrading E. aerogenes has been successfully identified.
Three-dimensional structure of E. aerogenes amidase shows the homology with 2e11D.
The sequence was 45.02% identical with E-value 0.0001 of nitrilase, a nonpeptide C-N
hydrolyzing enzyme, from Xanthomonas camprestis. A / globular protein comprising mainly
six helices and two six-stranded sheets were observed in the 3-D structure of amidase (Fig. 3).
The evaluation of the 3-D structure on the basis of total free energy was -11,867.154 kJ/mol. The
torsion angles of 55.9% amino acid residue were in most favored region and only 0.72% amino
acid residue in disallowed region. The overall G-factors were 0.67 at resolution of 1.73 . These
results matched well with the characteristic /-folding pattern of microbial aliphatic amidase
(Sharma et al., 2009).
Page 537

July 9-11, 2012
Fig. 1 Nucleotide sequence and deduced amino acid sequence of the putative amidase gene
sequence of E. aerogenes. Bold alphabets reveal the suggested start con
Page 538

July 9-11, 2012
.
Fig. 2 Multiple sequence alignment of the ORF of amidase from E. aerogenes (yellow highlight)
against other related complete amidase from the same genera. Symbols: Catalytic triad
residues, Suggested residues involved in the active site.
Page 539

July 9-11, 2012
Fig. 3 The 3D-structural modeling of E. aerogenes amidase. A / globular protein comprising

mainly six helices (blue) and two six-stranded sheets (green) are shown.
CONCLUSION
An amidase gene of the acrylamide-degrading E. aerogenes was successfully identified
with the genome-walking PCR method. The gene has an ORF of 726 bp encoding a protein of 241
amino acid residues and showed maximum identity (99%) to amidase of E. aerogenes KCTC2190.
The catalytic triad and residues involving in active site of enantioselective amidase were found at
perfectly conserved positions. Structural modeling of E. aerogenes amidase as a / globular
protein comprising mainly six helices and two six-stranded sheets matched well with the
characteristic /-folding pattern of aliphatic amidase.
ACKNOWLEDGEMENTS
This work was supported to J.C. by the National Research Council of Thailand through
Burapha University. We are grateful for a financial support to S.S. from the Center of Excellence
for Innovation in Chemistry (PERCH-CIC), the Commission on Higher Education, Ministry of
Education. We thank Dr. K. Choowongkomon for his helps in structural modeling.
Page 540

July 9-11, 2012
REFERENCES
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. 1990. Basic local alignment
search tool. Journal of Molecular Biology 215: 10403.
Banerjee, A., Sharma, R., and Banerjee, U. C. 2002. The nitrile-degrading enzymes: current status
and future prospects. Applied Microbiology and Biotechnology 60: 33-44.
Bates, P. A. and Sternberg, M. J. E. 1999. Model building by comparison at CASP3: using expert
knowledge and computer automation. Proteins 3: 47-54.
Buck, M., Bouguet-Bonnet, S., Pastor, R.W., and MacKerell, A. D. Jr. 2005. Importance of the
CMAP Correction to the CHARMM22 Protein Force Field: Dynamics of Hen Lysozyme.
Biophysical Journal: Biophysical Letters: 36-38.
Buranasilp, K., and Charoenpanich, J. 2011. Biodegradation of acrylamide by Enterobacter
aerogenes isolated from wastewater in Thailand. Journal of Environmental Sciences 23(3):
396-403.
Fournand, D., Bigey, F., and Arnaud, A. 1998. Acyl transfer activity of an amidase from
Rhodococcus sp. strain R312: formation of a wide range of hydroxamic acids. Applied
Environmental and Microbiology 64: 2844-2852.
Kimbara, K., Hashimoto, T., Fukuda, M., Koana, T., Takagi, M., Oishi, M., and Yano, K. 1989.
Cloning and sequencing of two tandem genes involved in degradation of 2,3dihydroxybiphenyl to benzoic acid in the polychlorinated biphenyl-degrading soil
bacterium Pseudomonas sp. strain KKS102. Journal of Bacteriology 171(5): 2740-2747.
Krieger, E., Nabuurs, S. B., and Vriend, G. 2003. Homology modeling. Structural Bioinformatics.
ISBN 0-471-20199-5.
Lorenz, P., and Eck, J. 2004. Screening for novel industrial biocatalysts. Engineering and Life
Sciences 4: 501-504.
Madhavan, N. K., Roopesh, K., Chacko, S., and Pandey, A. 2005. Comparative study of amidase
production by free and immobilized Escherichia coli cells. Applied Biochemistry and
Biotechnology 120: 97-108.
Nawaz, M. S., Billedeau, S. M., and Cerniglia, C. E. 1998. Influence of selected physical
parameteron the biodegradation of acrylamide by immobilized cells of Rhodococcus sp.
Biodegradation 9: 381-387.
Nawaz, M. S., Khan, A. A., Seng, J. E., Leakey, J. E., Siitonen, P. H., and Cerniglia, C. E. 1994.
Purification and characterization of an amidase from an acrylamide-degrading
Rhodococcus sp. Applied and Environmental Microbiology 60(9): 33433348.
Nawaz, M. S., Khan, A. A., Bhattacharayya, D., Siitonen, P. H., and Cerniglia, C. E. 1996.
Physical, biochemical and immunological characterization of a thermostable amidase from
Klebsiella pneumoniae NCTR1. Journal of Bacteriology 178: 2397-2401.
Oh, B., Kim, H., Lee, J., Kang, S., and Oh, T. 1999. Staphylococcus haemolyticus lipase:
biochemical
properties, substrate specificity and gene cloning. FEMS Microbiology
Letters 179: 385-392.
Rahman, R. N. Z. A., Chin, J. H., and Salleh, A. B. 2003. Cloning and expression of a novel lipase
gene from Bacillus sphaericus 205y. Molecular Genetics and Genomics 269: 252-260.
Ramakrishna, C. and Desai, J. D. 1993. Bioconversion of acrylonitrile to acrylamide by
Arthrobacter sp. IPCB-3. Indian Journal of Experimental in Biology 31: 173-177.
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular Cloning: a Laboratory Manual, 2nd
edn, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Shanker, R., Ramakrishna, C., and Seth, P. K. 1990. Microbial degradation of acrylamide
monomer. Archives of Microbiology 154: 192-198.
Sharma, M., Sharma, N. N., and Bhalla, T. C. 2009. Amidases: versatile enzymes in nature.
Reviews in Environmental Science and Biotechnology 8: 343-366.
Suzuki, Y., and Ohta, H. 2006. Identification of a thermostable and enantionselective amidase
from the thermoacidophilc archaeon Sulfolobus tokodaii strain 7. Protein Expression and
Purification 45: 368-373.
Page 541

July 9-11, 2012
Zheng, Z. L., Zuoa, Z. Y., Liua, Z. G., Tsaib, K. C., Liua, A. F., and Zoua, G. L. 2005.
Construction of a 3D model of nattokinase, a novel fibrinolytic enzyme from Bacillus
natto a novel nucleophilic catalytic mechanism for nattokinase. Journal of Molecular
Graphics and 23: 373380.
Page 542

July 9-11, 2012
STP95-22
The in vitro effect of Andrographis paniculata extracts on the

innate immune response of hybrid catfish (Clarias
macrocephalus x Clarias garipienus) and Nile tilapia
(Oreochromis niloticus)
Budiantoab, Praparsiri Kachanopas-Barnette ad, Rungnapha Saeengc, and

Sukanda Tubmecad
a
Department of Aquatic Science, Faculty of Science, Burapha University, Chon Buri, 20131
Thailand.
b
Department of Aquaculture, Faculty of Fisheries and Marine Science, University of Brawijaya,
Malang, 65145 Indonesia.
c
Department of Chemistry, Faculty of Science, Burapha University, Chon Buri, 20131 Thailand.
d
Center of Excellence on Environmental Health and Toxicology, Bangkok, Thailand.
E-mail: praparsi@buu.ac.th
ABSTRACT
Andrographolide and 14-deoxy-11,12-didehydroandrographolide were extracted from
Andrographis paniculata (AP) plants with methanol and then ethyl acetate, and was found to be an
active compound that can enhance the immune systems of hybrid catfish (Clarias macrocephalus
x Clarias garipienus) and Nile tilapia (Oreochromis niloticus). Active compounds in the crude AP
extracts were identified using Thin Layer Chromatography (TLC) analysis. However, the water
fraction of AP extract did not contain active compounds. The AP extracts were used for in vitro
immunity tests with head kidney macrophage cells of hybrid catfish and Nile tilapia. Macrophage
cells were incubated with crude AP extracts with concentrations of 0, 50, 250, 500, 750, and 1000
g mL-1 for 12 hours. Incubated macrophage cells were used for evaluating percentage of
phagocytosis, phagocytic index and respiratory burst activity. For hybrid catfish, crude methanol
extract and the ethyl acetate fraction significantly increased respiratory burst activity (p < 0.05).
Only concentrations of 50 and 750 g mL-1 of ethyl acetate fraction were not different from the
control group (0 g mL-1). Whereas, Nile tilapia macrophage cells incubated with ethyl acetate
fraction, at concentrations of 50, 250, 500 and 750 g mL-1, are statistically significant at higher
value than crude methanol extract and control group (0 g mL-1) on respiratory burst activity (p <
0.05). After incubation with crude methanol extract and the ethyl acetate fraction at all doses, the
percentage of phagocytosis and phagocytic index of hybrid catfish and Nile tilapia were not
different from the control group (p > 0.05). From the results, the AP has the potential to enhance
the immune system of hybrid catfish and Nile tilapia. Crude extracts containing Andrographolide
and 14-deoxy-11,12-didehydroandrographolide from the AP can be used as an immunostimulant
with appropriate concentrations to control fish diseases in hybrid catfish and Nile tilapia.
Keywords: Andrographis paniculata (AP) extracts, Hybrid catfish, Nile tilapia, Macrophage cells,
Immunostimulant, Respiratory burst activity, Phagocytic activity.
Page 543

July 9-11, 2012
INTRODUCTION
Recently, the use of antibiotics and chemotherapy has negative impacts to aquatic
environments and has led to drug-resistant bacteria (Costanzo et al., 2005; Tendencia and de la
Pena, 2001). Natural products from plant extraction have proved to be an alternative chemotherapy
to control fish disease (Galina et al., 2009). Some plants are rich sources of compounds such as
volatile oils, saponins, phenolic compounds, tannins, alkaloids, polypeptides, and polysaccharides.
These natural plant products have been used for various activities: appetizers, antimicrobials and
immunostimulants (Citarasu et al., 2002).
A number of immunostimulants from plant extraction have been investigated in a variety
of fish species such as Greasy grouper (Epinephelus tauvina) (Punitha et al., 2008), Nile tilapia
(Oreochromis niloticus) (Yin et al., 2008), common carp (Cyprinus carpio) (Mohamad and
Abasali, 2010), and Olive flounder (Paralichthys olivaceus) (Harikrishnan et al., 2010).
Experience demonstrates that some of these have enormous therapeutic potential. Moreover, they
are biodegradable, biocompatible and friendly for the environment (Ortuno et al., 2002).
Andrographis paniculata (AP), also known as Kalmegh, is well-known as a medicinal
plant has a wide range of pharmacological effects, such as antibacterial, antiviral, and antiinflammatory properties (Mishra et al., 2007). The AP is also known to enhance human and
mammalian immune systems. Kumar et al. (2004) had observed that the dichloromethane fractions
of AP crude extract enhances human immune response by increasing proliferation of human
peripheral blood lymphocytes. Puri et al. (1993) reported that the ethanol extract of AP and
purified diterpene andrographolides stimulated both antigen specific and non-specific immune
responses in mice. Rattanachaikunsopon and Phumkhachorn (2009) found AP aqueous extractsupplemented feed can reduce mortality of Nile tilapia infected by Streptococcus agalactiae.
These findings suggest that AP could be used as an alternative chemotherapy and is safe to
use in fish food. However, few studies have addressed the immunostimulatory activity of AP
extract in fish immune cells. Compared with in vivo experiments, in vitro experiments are cheaper
and take less time to obtain results. Also, fewer fish are used in experiments. This present study
was undertaken to determine the presence of andrographolide compounds in the crude extract of
AP after being extracted from methanol and the ethyl acetate fraction of the extract. These extracts
were used as immunostimulants for in vitro study to give an understanding of their effect on the
enhancement of innate immune response of hybrid catfish (Clarias macrocephalus x Clarias
garipienus) and Nile tilapia which are common cultured fish in Asia, including Thailand.
Bioactive compounds of potential interest from AP may be considered for aquaculture as
immunostimulants.
Plant Material
Aerial parts of AP plant (leaves, stems, and roots) were purchased from a local farm in Paktho,
Ratchaburi Province, Thailand. The AP was oven-dried at 40oC for 72 h.
Preparation of AP extracts
The extraction was conducted following the modified methods of Matsuda et al. (1994) and
Kumar et al. (2004) with slight modification. Briefly, four kg of dry AP was extracted with 40 L
Methanol and soaked for 96 h at room temperature. The extract was evaporated to dryness by
using a rotary evaporator at 40oC. The crude extract was separated into two parts. The first part
was concentrated to a dry powder in vacuum desiccators and stored at -4oC in glass vials for use in
in vitro immune tests and Thin Layer Chromatography (TLC) analysis. The second part was mixed
Page 544

July 9-11, 2012
with distilled water and placed in a separating funnel. An equal volume of ethyl acetate was added
and mixed carefully by intermittent release of pressure inside the separating funnel. The content
was allowed to stand without any disturbance until two distinct layers (lower water-soluble and
upper ethyl acetate-soluble) were seen. The fractions were collected separately. This process was
repeated until a colorless ethyl acetate fraction was obtained, which indicated the completion of
ethyl acetate fractionation. The ethyl acetate fraction was concentrated in a vacuum rotary
evaporator. Then, the ethyl acetate fraction was concentrated to a dry powder in vacuum
desiccators and stored in glass vials for use in in vitro immune tests and TLC analysis.
Analysis of active compounds on the AP extracts
Thin Layer Chromatography analysis was used to examine the AP extracts for detection of
bioactive compounds. The AP extracts were dissolved as per their preparation details above and 5
L were used for each spot. The purified standard compounds (Andrographolide and 14-deoxy11,12-didehydroandrographolide) were dissolved in Ethanol (5 mg mL-1) and 5 L were used to
compare with extracted samples. A pre-coated plate of silica gel 60F254 (MERCK) and mobile
phase (Ethyl acetate: Hexane at ratio of 7: 3) were used. All sample extracts and standard
compounds which were applied on the plate were detected by UV radiation (Electronic UV
Transimulator, Quantum Scientific).
Fish
Healthy adult hybrid catfish and Nile tilapia weighing about 624.33 172 g and 612.67 72 g,
respectively, were obtained from a local fish farm in Thailand. The fish were kept in 600 L tanks
with water changed once a day at room temperature for 2 weeks and fed commercial diets twice
daily.
Isolation of macrophage cells
The head kidney macrophage cells of the fish were isolated according to the method described
by Tassakka and Sakai (2003). Briefly, the kidney were removed and pushed through a nylon
mesh in Hanks Balanced Salts Solution (HBSS). The cell suspension was placed in L-15 Medium
containing 0.5% Fetal Bovine Serum (FBS), then centrifuged at 400 x g for 40 min at 4oC. The
pellets were re-suspended in L-15 medium and centrifuged at 400 x g for 30 min and washed three
times with the medium. Viable macrophage cells were counted in eight squares of haemocytometer
after staining by Trypan blue exclusion. Viable macrophage cells were calculated as below:
Viable cells (Cell mL-1) =
Number of viable cells x dilution factor x 104
Number of square counted
(1)
Respiratory burst activity

The respiratory burst activity of macrophage cells was evaluated by using the reduction of
nitroblue tetrazolium (NBT) following the method of Tassakka and Sakai (2003) with slight
modification. The viable cells were adjusted to 107 cells mL-1 in L-15 medium. The amount of 100
l of this suspension was added to each well of flat-bottom 96-well microplates. 30 L heatinactivated FBS solution was added and incubated in a moisture chamber at 20oC for 2 h. The unadhered cells were washed off with HBSS. The monolayer cells were incubated with 0.09 mL L15 medium and 0.01 mL of AP extract dissolved by 10% DMSO in L-15 medium with
concentration at 0, 50, 250, 500, 750, and 1000 g mL-1, then incubated for 12 h at 20oC.
The monolayer cells were washed two times with HBSS. Then, 100 L of NBT solution (1 mg
mL-1 in HBSS) that included 30 L of phorbol myristate acetate (1 mg mL-1) was added to each
Page 545

July 9-11, 2012
wells and incubated for 60 min at 20oC. The reduction was stopped by the addition of 70%
methanol, after removal of the medium from the cells. The formazan in each well was dissolved in
120 L of 2 M KOH and 140 L of DMSO and the optical density (OD) values were measured by
using a microplate reader (Versa max, Molecular Devices) at 620 nm.
Phagocytic activity
Phagocytosis of activated macrophage cells was studied based on methods of Tassakka and
Sakai (2003). The number of cells was adjusted to 107 cells mL-1 in L-15. The macrophage cells
were allowed to react with 0.01 mL AP extract dissolved by 10% DMSO in L-15 medium (0, 50,
250, 500, 750, and 1000 g mL-1) for 12 h at 20oC.
After incubation, 107 cells of heat-killed yeast (Saccharomyces sp.) was suspended in L-15
medium and added to the tube containing macrophage cells. The suspension was incubated for 1 h
in a moisture chamber. Then, 30 L of the cells was added on a slide and incubated for 1 h. After
incubation with glutaraldehyde on cell-coated slide for 5 minutes, the slide was washed two times
with HBSS. The cells were fixed with methyl alcohol, air-dried, and stained with MayGrunwalds
Giemsa. The macrophage cells and phagocytosed yeast were counted. Percentage of phagocytosis
and phagocytic index (PI) were determined by enumerating 200 phagocytes per slide under a
microscope. The average of three slides was calculated as below:
Percentage of Phagocytosis (%) =
Number of macrophage cells that engulf yeast x 100
(2)
Number of macrophage cells
Phagocytic Index (PI) =

Number of engulfed yeast cells
Number of macrophage cells
(3)
Statistical analysis
Data obtained were first tested for normality and equal variance. If the data were normally
distributed, two-way analysis of variance (ANOVA) was used to compare means at p < 0.05.
Mean values were expressed as average + S.D.
RESULTS
Active compounds on the AP extracts
The Thin Layer Chromatography (TLC) of the AP extracts is shown in Fig. 1. The color dot
bands representing Andrographolide (Rf value = 0.19 which was compared to the lane B) and 14deoxy-11,12-didehydroandrographolide (Rf value = 0.48 which was compared to the lane A) was
present in the crude methanol extract (Lane C) and ethyl acetate fraction (Lane D), while no band
presented on water fraction (Lane E).
Effect of AP extracts on the innate immune response of hybrid catfish and Nile tilapia
Respiratory burst activity
The crude methanol extract and ethyl acetate fraction of AP modulated the respiratory burst
activity of hybrid catfish as shown in Fig. 2a. Only concentrations of 50 and 750 g mL-1 of ethyl
acetate fraction were not different from the control group (0 g mL-1). As illustrated in Fig. 2b,
Nile tilapia macrophage cells incubated with concentration of 50, 250, 500 and 750 g mL-1 of
ethyl acetate fraction are statistically significant at higher value than crude methanol extract and
Page 546

July 9-11, 2012
control group on respiratory burst activity (p < 0.05). The Nile tilapia macrophage cells incubated
with crude methanol extract did not show a significant increase in the respiratory burst activity.
Phagocytic activity
On the both hybrid catfish and Nile tilapia, AP extracts (crude methanol extract and ethyl
acetate fraction) had no significant influence (p>0.05) on the percentage of phagocytosis or
phagocytic index compared with the control group (0 g mL-1) (Data are not shown).
DISCUSSION
Enhancement of the immune system seems to be the most promising method of preventing
fish diseases. The non-specific or innate immune system of fish is considered to be the first line of
defense against invading pathogens. The ability of macrophage cells to kill pathogenic microbes is
probably one of the most important mechanisms of protection from infectious diseases of animals.
Therefore we focused our investigation on the effect of AP extracts on the fish innate immune
system by in vitro methods.
In the present study, Thin Layer Chromatography (TLC) analysis was performed to determine
active compounds from the AP extracts. After observing the TLC plate under UV light, both crude
methanol extract and the ethyl acetate fraction presented bands corresponding to both
andrographolide and 14-deoxy-11,12-didehydroandrographolide, and also revealed that the water
fraction did not present bands indicating either of these two andrographolide compounds. This
result is similar to work by Xu et al. (2006). They had successfully confirmed the presence of
andrographolide in AP extract by using TLC analysis. TLC plate showed bands with the same Rf
value as the purify andrographolide and 14-deoxy-11,12-didehydroandrographolide as the control.
Matsuda et al. (1994) also reported that andrographolide (as a major compound of AP plant) and
14-deoxy-11,12-didehydroandrographolide could be isolated from crude methanol extract and the
ethyl acetate fraction. In addition, Saxena et al. (2000) found methanol was the most appropriate
solvent for the extraction of andrographolide and its derivatives.
Fig. 1 The Thin Layer Chromatography (TLC) of AP extracts. From left to right, A; 14-deoxy11,12-didehydroandrographide (Control), B; Andrographolide (Control), C; Crude methanol
extract, D; Ethyl acetate fraction, and E; Water fraction of AP.
In this study, we found that AP extracts enhanced immune functions of hybrid catfish and Nile
tilapia by increasing the respiratory burst activity. In hybrid catfish, the respiratory burst activity of
cells treated with both extracts (crude methanol extract and the ethyl acetate fraction) was
significantly higher than for the control group (0 g mL-1) (p < 0.05). However, only
concentrations of 50 and 750 g mL-1 of ethyl acetate fraction were not different from the control
Page 547

July 9-11, 2012
group. Nile tilapia macrophage cells incubated with the ethyl acetate fraction had significantly
higher respiratory burst activity than the crude methanol extract and control group (p < 0.05).
These results are similar to other paper using other bioactive compounds. Castro et al. (2004)
investigated the effect of the water soluble extract of seaweed on the respiratory burst activity of
turbot (Psetta maxima L.) phagocytes, using an in vitro study. They found that water-soluble
extracts from Urva rigida, Enteromorpha sp., and Chondrus crispus increased respiratory burst
activity of turbot with increasing concentration of extracts. Other plant extracts have been used for
in vivo study. Divyagnaneswari et al. (2008) reported that water-soluble and hexane-soluble
fractions of Solanum trilobatum enhanced ROS (Reactive Oxygen Species) production in
Mozambicue tilapia (Oreochromis mossambicus). Furthermore, other chinese herbal medicine
(Astragalus radix and Ganoderma lucidum) stimulated respiratory burst activity in carp (Cyprinus
carpio) (Yin et al., 2009).
In the other hand, this study shown both AP extracts concentrations had no effect on phagocytic
activity and phagocytic index (p > 0.05) of hybrid catfish and Nile tilapia cells compared with the
control 0 g mL-1. Even though AP extracts alone could not stimulate phagocytic activity in hybrid
catfish and Nile tilapia macrophage cells, several studies have reported that phagocytic activity of
some fish species can be stimulated by a combination of extracts from AP and other herb plant
extracts in vivo. Wu et al. (2007) studied carp fed with Qompsell containing several herbs
(Astragalus membranaceus, Portulaca oleracea, Flavescent sophora and AP). Carp that were fed
with a diet containing 0.03% Qompsell significantly increased both specific and non-specific
immunity by increasing macrophage phagocytic activity, macrophage ROS, lysozyme, globulin
content in the serum. Furthermore, goldfish (Carassius auratus gibelio) fed by four species of
herbs (Rheum officinale, AP, Isatis indigotica, and Lonicera japonica) for 28 days had significant
increases in phagocytic activitiy of WBCs (White Blood Cells) and phagocytic percentage on the
fourth, seventh, and tenth days after immunostimulant treatment (Chen et al., 2003).
Page 548

July 9-11, 2012
Fig. 2 Respiratory burst activity of hybrid catfish macrophage cells (a) and Nile tilapia
macrophage cells (b) incubated with different concentration of AP extracts (g mL-1). Data
are expressed as mean O.D. at 620 nm + S.D. (n = 18). Significant different (p < 0.05) from
the control group are indicated by asterisks
Though AP extracts enhanced the innate immune system by increasing the respiratory burst
activity of hybrid catfish and Nile tilapia, more insight experiment is needed to optimize the in
vitro method. The enhancement in the innate immune response of fish by crude methanol extract
and the ethyl acetate fraction was due to the mount presence of andrographolide compounds, as in
the study by Matsuda et al. (1994). Puri et al. (1993) reported that purified diterpene
andrographolides are able to stimulate both antigen-specific and non-specific immune responses in
mice. Naik et al. (2009) also investigated mice and reported that andrographolides increased total
WBCs count and phagocytic activity of mice. In this study, another active compound of AP was
presented, namely 14-deoxy-11,12-didehydroandrographolide. The study need to prove which
active components of AP are responsible for enhancement or interaction to each other and that is
influence to innate immune system response on the studied fish species. However, the present
study together with other previous studies suggests that AP has the potential to enhance the
immune system of hybrid catfish and Nile tilapia. Also, crude extracts from AP can be used as an
immunostimulant in appropriate concentration to control fish diseases in hybrid catfish and Nile
tilapia.
ACKNOWLEDGEMENTS
This research was supported by National Education Ministry of Republic of Indonesia
(Beasiswa Unggulan BPKLN DIKNAS) and University of Brawijaya, Indonesia which have join
program with Burapha University, Thailand. In addition, the authors thank to the National
Research Council of Thailand which had given financial support for this research (fiscal year
2010) in the title of Epidermiology and treatment of parasitic flatworm infestation in marketed
green mussel (Perna viridis Linnaeus) from sea-farms in Chonburi Province. Also, the authors
thank for financial support from Burapha University Annual Grant and partial scholarship from the
Faculty of Science, Burapha University.
Page 549

July 9-11, 2012
REFERENCES
Castro, R., Zarra, I., and Lamas, J. 2004. Water-soluble seaweed extracts modulate the respiratory
burst activity of turbot phagocytes. Aquaculture 229: 6778.
Chen, X., Wu, Z., Yin, J., and Li, L. 2003. Effects of four species of herbs on immune function of
Carassius auratus gibelio. Journal fish science of China 10: 36-40.
Citarasu, T., Babu, M.M., Sekar, R.J.R., and Marian, P.M. 2002. Developing Artemia enriched
herbal diet for producing quality larvae in Penaeus monodon, Fabricus. Asian Fisheries
Science 15: 21-32.
Costanzo, S.D., Murby, J., and Bates, J. 2005. Ecosystem response to antibiotics entering the
aquatic environment. Marine Pollution Bulletin 51: 218223.
Divyagnaneswari, M., Christybapita, D., and Dinakaran, R.M. 2007. Enhancement of nonspecific
immunity and disease resistance in Oreochromis mossambicus by Solanum trilobatum leaf
fractions. Fish and Shellfish Immunology 23: 249-259.
Galina, J., Yin, G., Ardo, L., and Jeney., Z. 2009. The use of immunostimulating herbs in fish. An
overview of research. Fish Physiology and Biochemistry 35: 669-676.
Harikrishnan, R., Balasundaram, C., Kim, M.C., Kim, J.S., Han, Y.J., and Heo, M.S. 2009. Innate
immune response and disease resistance in Carassius auratus by triherbal solvent extracts.
Fish and Shellfish Immunology 27: 508515.
Kumar, R.A., Sridevi, K., Kumar, N.V., Nanduri, S., and Rajagopal, S. 2004. Anticancer and
immunostimulatory compounds from Andrographis paniculata. Journal of
Ethnopharmacology 92: 291295.
Matsuda, T., Kuroyanagi, M., Sugiyama, S., Umehara, K., Ueno, A., and Nishu, K. 1994. Cell
differentiation-inducing diterpens from Andrographis paniculata Nees. Chemical and
Pharmaceutical Bulletin 42(6): 1216-1225.
Mishra, S.K., Sangwan, N.S., and Sangwan, R.S. 2007. Andrographis paniculata (Kalmegh): A
Review. Pharmacognosy Reviews 1(2): 283-298.
Mohamad, S. and Abasali, H. 2010. Effect of plant extracts supplemented diets on immunity and
resistance to Aeromonas hydrophila in common carp (Cyprinus carpio). Agricultural
Journal 5(2): 119-127.
Naik, S.R. & Hule, A. 2009. Evaluation of immunomodulatory activity of an extract of
Andrographolides from Andographis paniculata. Planta Medica 75(8): 785-791
Ortuno, J., Cuesta, A., Rodriguez, A., Esteban, M.A., and Meseguer, J. 2002. Oral administration
of yeast, Saccharomuces cerevisiae, enhances the cellular innate immune response of
gilthead seabream (Sparus aurata L.). Veterinary immunology and Immunophatology 85:
41-50.
Punitha, S.M.J., Babu, M.M., Sivaram, V., Shankar, V.S., Dhas, S.A., Mahesh, T.C., Immanuel,
G., and Citarasu, T. 2008. Immunostimulating influence of herbal biomedicines on
nonspecific immunity in Grouper Epinephelus tauvina juvenile against Vibrio harveyi
infection. Aquaculture International, 16, 511523.
Puri, A., Saxena, R., Saxena, R.P., and Saxena, K.C. 1993. Immunostimulant agents from
Andrographis paniculata. Journal of natural products 56 (7): 995-999.
Rattanachaikunsopon, P. and Phumkhachorn P. 2009. Prophylactic effect of Andrographis
paniculata extracts against Streptococcus agalactiae infection in Nile tilapia (Oreochromis
niloticus). Journal of Bioscience and Bioengineering 107(5): 579582.
Page 550

July 9-11, 2012
Saxena, S., Jain, D.C., Gupta, M.M., Bhakuni, R.S., Mishra, H.O., & R.P. Sharma. 2000. HighPerformance Thin-Layer Chromatographic analysis of hepatoprotective diterpenoids from
Andrographis paniculata. Phytochemical Analysis 11: 3436.
Tassakka, A.C.M.A.R. and Sakai, M. 2003. The in vitro effect of CpG-ODNs on the innate
immune response of common carp, Cyprinus carpio L. Aquaculture 220: 2736.
Tendencia, E.A. & de la Pena, L.D. 2001. Antibiotic resistance of bacteria from shrimp ponds.
Aquaculture 195: 193204.
Wu, G., Yuan, C., Shen, M., Tang, J., Gong, Y., Li, D., Sun, F., Huang, C., and Han, X. 2007.
Immunological and biochemical parameters in carp (Cyprinus carpio) after Qompsell feed
ingredients for long-term administration. Aquaculture Research 38: 246-255.
Xu, Y., Marshall, R.L., and Mukkur, T.K.S. 2006. An Investigation on the Antimicrobial Activity
of Andrographis paniculata Extracts and Andrographolide in vitro. Asian Journal of Plant
Sciences 5 (3): 527 530.
Yin, G., Ard, L., Jeney, Z., Xu, P., and Jeney, G. 2008. Chinese herbs (Lonicera japonica and
Ganoderma lucidum) enhance non-specific immune response of tilapia, Oreochromis
niloticus, and protection against Aeromonas hydrophila. Diseases in Asian aquaculture 6:
269-281.
Yin, G., Ardo, L., Thompson, K.D., Adams, A., Jeney, Z., Jeney, G. 2009. Chinese herbs
(Astragalus radix and Ganoderma lucidum) enhance immune response of carp, Cyprinus
carpio, and protection against Aeromonas hydrophila. Fish and Shellfish Immunology 26:
140145.
Page 551

July 9-11, 2012
STP111-28
Responses of physic nut seed and oil to storage

temperature and duration
Phornphimon Janchai*1, Rungsarid Kaveeta1, Sukuntaros Tadakittisarn2 and

Chalermpol Phumichai1
1 Department of Agronomy, Faculty of Agriculture, Kasetsart University, Bangkok 10900,
Thailand
2 Kasetsart Agricutural and Agro-Industrial Product Improvement Institute, Kasetsart University,
E-mail: phornphimonjanchai@yahoo.com
ABSTRACT
Four physic nut lines differing in some agronomic characteristics and harvest date were
evaluated in RCB with 3 replications. The results revealed significant in harvest date and some
agronomic characteristics. The genetic evaluation using AFLP were not significantly differed
indicating the 16 primers used were not able to detect the genetic differences among the selected
lines. Then, the 2 lines that performed clearly different in harvest date were selected to study for
the response of genotypes and storage environments of seed and oil. The split-split-split plot with
3 replications comprised main-plot of 3 storage temperatures, 2 lines sub-plot, 3 harvest dates subsub plot, and 8 storage durations sub-sub-sub plot. The results on storage quality of seed and oil
based on moisture content, free fatty acid content the results showed that KUBP 78-9 was better
than KUBP 16-1. Storage temperature at 20C and 37C were better than at 50C. Yellow fruit had
better storage quality than black fruit. The longer storage duration, the decreasing of seed and oil
storage quality was observed. The interactions of lines storage temperature, lines storage
duration, and lines storage temperature storage duration were significant for seed but not for
oil storage quality.
Key words: Physic nut, genotype and environment interaction, storage duration, free fatty acid
INTRODUCTION
Currently, Thailand has focused on alternative energy. Might be better for biodiesel and non
edible oil production. Production of this crop, however, has some problems and two of those are
about the storage condition and duration. Under long time storage condition of physic nut seed,
increasing of more than 1% Free fatty acid (FFA) was noticed and causing the change of oil
quality. Effect of storage duration, the FFA formation in seed of J. curcas black fruit stored at 4,
37 and 50C increased more than that in yellow fruit seed within 2 month (Tadakittisarn et al.,
2011). Genetic diversity of physic nut has several indicators such as phenotype, morphology and
agronomic characters. Knowledge on the amount and distribution of genetic variability within a
species was vital to plant breeder (Breeting and Wilrlechner, 1995). Significant variation in seed
morphology and seedling growth parameters like seedling height, collar diameter, and leaves/plant
Page 552

July 9-11, 2012
in 10 accessions of J. curcas were observed (Ginwal et al., 2005). The genetic evaluation by using
the amplified fragment length polymorphism (AFLP) because mapping, tagging and genotype
successfully adated in genetic diversity. Environmental factors in combination with genetic and
physiological factors play important role in determination of plant potential for seed quality (Roy
et al., 2004). The effect of genotype, environment and their interactions were reported on seed
size, oil and protein content of seed (Gunasekera et al., 2006).
The objectives of the present study were to investigate the genetic difference among physic nut
genotypes by using AFLP, the genotype and environment interaction as affected by storage
condition (GE) on FFA of physic nut seed and oil.
Material
Seed samples of 4 lines of physic nut KUBP 80-3, KUBP 78-9, KUBP 33-1 and KUBP 16-1
collected from Thailand were obtained from the National Corn and Sorghum Research Center.
These lines were differed maturity in their harvest date and some agronomic characteristics such as
plant height, canopy diameter and fruit size. Seed and oil samples of 2 lines selected of physic nut
KUBP 78-9 and KUBP 16-1 were prepared. The seed samples obtained were in 2 different of
maturity involving physiological maturity (yellow fruit) and harvest maturity (black fruit).
Methods
Growth and development and seed yield production of 4 lines of physic nut including the
agronomic characters were recorded as follows: day to first flower and male and female flower
number.
Amplified fragment length polymorphism analysis was performed based on the techniques of
Vos et al. (1995) with some modifications to detect polymorphism of restriction DNA fragment
generated by isoschizomers. Two set of digestion reactions were carried out simultaneously. In the
first reaction, approximately 250 ng of genomic DNA was digested for 1 h at 37C with 10 U
EcoRI/MseI. The digested DNA fragments from the two reactions were ligated separately with an
equal volume of the adapter/ligation solution overnight. The ligation mixture was performed in a
1:10 dilution with PCR.
The interaction or the responses of the 2 selected lines were investigated through the change of
physic nut seed and oil under different storage conditions and durations. In the third experiment, a
split-split-split plot in CRD with 3 replication employed main plot the level of 3 storage
temperature conditions, namely room temperature at 20, 37 and 50C. Sub-plot was the 2 physic
nut lines, KUBP 78-9 and KUBP 16-1. Sub-sub plot was the fruit harvest periods, yellow fruit and
black fruit. Sub-sub-sub plot was the storage duration 0, 1, 2, 7, 14, 30, 60, 90, 120 day.
Sample preparation: The samples were separated into 2 groups; the seed was divided into 200g
portions, and the oil samples was directly transferred to amber glass bottles (15 ml) and stored
conditions as the seed.
Determination of chemical composition: Proximate analysis of physic nut seed for the moisture,
fat, protein, fiber and ash contents was performed according to AOAC (2000).
Page 553

July 9-11, 2012
Determination of FFA in seed and oil: Seed extraction of the FFA from the physic nut seed was
performed using iso-propanol and hexane (Lam et al., 2001) The dehulled physic nut seed were
ground with a blender for 2 min. The weighed ground sample (10g) was placed into a 250 mL
Erlenmeyer flask. Iso-propanol (37.5 mL) and hexane (7.5 mL) were introduced to the flask and
the mixture was mixed thoroughly in a fume hood. The extraction was performed by shaking at
220 rpm for 30 min. The filtrate was collected through a filter membrane (no.4). The extraction
was repeated three times. The pooled filtrate was titrated with 0.05 M NaOH as described in
AOCS (1995).
Samples of oil (5 g) weighed and extracted for FFA using iso-propanol: hexane (75:15) in an
Erlenmeyer flask, thoroughly mixed and then titrated with 0.05 M NaOH by the same method used
for the seed FFA extraction.
Data analysis
The data was analyzed by using analysis of variance and Duncans new multiple range test
(DMRT) for the means comparison.
Mean Difference and Coefficient of Variability of Agronomic Characters
Phenotypic evaluation of the 4 physic nut lines were phasic development including days
from cutting or pruning to days to first flowering and days to the development of green fruit,
yellow fruit and black fruit (Table 1). The results showed the phases to first flowering at about 94103 days by which KUBP 80-3, KUBP 33-1 and KUBP 16-1 had about the same durations and
were relatively faster than KUBP 78-9. These results were similar to the report of Anna et al.
(2007) on the preliminary yield trial of 31 physic nut accessions that days to first flowering were
about 93-123 days after transplanting.
Table 1 Day from cutting to different developmental phases of 4 physic nut lines.
Day
Lines
DFF
Green fruit
Yellow fruit
Black fruit
80-3
94b
107b
118b
125b
78-9
103a
111a
123a
129a
33-1
95b
106b
119b
125b
16-1
96b
107b
117b
123b
F-test
CV (%)
3.74
2.81
3.02
3.01
*= Significant at P< 0.05
1/
DFF = Day to first flowering
Number of female flowers per inflorescence of the studied lines ranged from 3 to 6. Whilst, the
male flower number was from 105 to 168. KUBP 80-3 and KUBP 78-9 were the 2 lines that
having number of male flowers per inflorescence between 138 to 143. When considered the ratio
Page 554

July 9-11, 2012
of female to male flower, KUBP 78-9 showed higher fruit setting potential than the others because
of the lower ratio value (Table 2). This was similar to the finding of Auttapon et al. (2010) in that
the physic nut genotypes with higher number of female flowers would perform better fruit setting.
Table 2 Number of female flowers per inflorescence of 4 selected physic nut lines.
Number of flower/inflorescence
Ratio
Lines
Male flower
Female flower
male: female
80-3
138ab
4b
34.5:1
78-9
143ab
6a
23.8:1
33-1
168a
5a
33.6:1
16-1
105c
3b
35:1
Mean
139ab
5a
27.8:1
F-test
CV (%)
37.92
35.43
*= Significant at P< 0.05
Polymorphism and primer informativeness

In this study, sixteen primer combinations from four EcoRI primers and four MseI primers were
used to generate AFLP profiles of the 4 physic nut lines. Fig. 1 revealed the most of the DNA
pattern that showed no differences at the same band among the samples. It was concluded that the
4 lines were less different and other DNA marker that could be able to detect high genetic diversity
such as microsatterile was suggested.
Fig. 1 DNA patterns of 4 physic nut lines.

The evaluation of the interaction between genotype and storage environment on the seed
chemical components of the 2 lines with yellow and black fruit showed that moisture content, ash,
fiber and lipase activity were significant different. The higher contents were observed in black fruit
Page 555

July 9-11, 2012
than in yellow fruits. Whereas, fat, fiber, protein content and free fatty acid content of the 2 lines
were not differ (Table 3).
Table 3 Seed composition of 2 selected physic nut lines (KUBP 78-9 and KUBP 16-1 yellow fruit
and black fruit).
1/ Means within the same column followed by the same letters are not significantly different at P0.05 level by DMRT
Moisture
content (%)
Line
KUBP 78-9
yellow fruit
KUBP 78-9
black fruit
KUBP 16-1
yellow fruit
KUBP 16-1
black fruit
Lipid (%)
Ash (%)
Fiber (%)
7.28 0.16c
41.13 1.65a
1/
3.77 0.10c
37.84 0.00a
7.53 0.04b
41.44 1.54a
4.12 0.12ab
35.89 0.00a
7.37 0.05bc
37.94 0.44a
3.85 0.11bc
38.91 0.00a
7.82 0.03a
36.12 3.22a
4.22 0.07a
40.57 0.00a
Protein
content (%)
23.270.00a
21.662.58a
22.570.07a
25.262.50a
FFA (%)
Lipase
activity
(U/g)
0.24 0.01a
1.46 0.11b
0.25 0.01a
1.56 0.01b
0.24 0.01a
1.10 0.15c
0.26 0.01a
1.91 0.05a
Seed moisture content of the 2 lines were significant differ. Also significant interaction of
genotype storage temperature and the interaction of genotype harvest period storage duration
were detected. KUBP 78-9 showed rapid decreasing of % moisture content especially at 20C and
37C storage temperature. Whereas at 50C storage temperature, KUBP 16-1 showed more rapid
decreasing of % moisture content than KUBP 78-9 (Fig. 2).
8.5
8.0
7.5
37 KUBP 78-9 B
37 KUBP 16-1 B
37 KUBP 78-9 Y
37 KUBP 16-1 Y
7.0
6.5
7.0
MC (%)
MC (%)
7.5
20 KUBP 78-9 B
20 KUBP 16-1 B
20 KUBP 78-9 Y
20 KUBP 16-1 Y
8.0
6.5
6.0
5.5
6.0
5.0
5.5
4.5
5.0
4.0
01
14
30
01
14
Storage duration (days)
30
8
50 KUBP 78-9 B
50 KUBP 16-1 B
50 KUBP 78-9 Y
50 KUBP 16-1 Y
MC (%)
2
01
14
30
Fig. 2 Seed moisture content of 2 selected physic nut lines harvested at yellow fruit and black fruit
stage after storage at 20, 37 and 50C for 1 month.
Page 556

July 9-11, 2012
Significant interactions of genotype storage temperature and genotype harvest period
storage duration, on free fatty acid contents, were observed in seed and also in oil. KUBP 78-9
decreased in free fatty acid more faster than KUBP 16-1 in both yellow and black fruit, but the
respond patterns of
the 2 lines were differed clearly (Fig. 3).
.40
.40
20 KUBP 78-9 B
20 KUBP 16-1 B
20 KUBP 78-9 Y
20 KUBP 16-1 Y
37 KUBP 78-9 B
37 KUBP 16-1 B
37 KUBP 78-9 Y
37 KUBP 16-1 Y
.35
.30
FFA (%)
FFA (%)
.35
.25
.30
.25
.20
.20
.15
01
14
.15
30
01
14
30
.40
50KUBP 78-9 B
50KUBP 16-1 B
50KUBP 78-9 Y
50KUBP 16-1 Y
FFA (%)
.35
.30
.25
.20
.15
01
14
30
Fig. 3 Seed free fatty acid content of 2 selected physic nut lines harvested at yellow fruit and black
fruit stage after storage at 20, 37 and 50C for 1 month.
CONCLUSION
The results revealed significant difference among the 4 physic nut lines in some phenotypic
characteristics i.e., harvest date and male and female flowers.
The genetic evaluation using AFLP were not significantly differed indicating that the 16
primers used in the study were not able to detect the genetic differences among the 4 lines.
The interaction of genotype by storage temperature and storage duration was significant for
moisture content and free fatty acid content. In addition, it was found that yellow fruit had better
Page 557

July 9-11, 2012
storage quality than black fruit. Moreover, the longer storage duration, the decreasing of seed and
oil storage quality were observed.
ACKNOWLEDGEMENTS
The author thank Anna Saimaneerat for supplying the J. curcas seed, National Corn and
Sorghum Research center and Kasetsart Agriculture and agro-Industrail Production Improvement
Institute.
Page 558

July 9-11, 2012
REFERENCES
Abigor, R.D., Uadia, P.O., Foglia, T.A., Haas, M.J., Scott, K., and Savary, B.J. 2002. Partial
purification and properties of lipase from germinating seed of Jatropha curcas L. Joural of
the American Oil Chemists Society. 79: 1123-1126.
A.O.A.C. International. 2000. Official Methods of Analysis of A.O.A.C. International. 17th ed.
A.O.A.C. International, Arlington, Virginia.
AOCS. 1995. Official Methods Ca 5a-40. Sampling and analysis of commercial fats and oils. In
Official and tentative methods of the Oil Chemists Society 4th ed. American Oil
Chemists Society, Champaign, IL.
Bretting, P.K., and Widrlechner, M.P. 1995. Genetic marker and plant genetic resource
management.Plant Breed. Review. 13: 11-86.
Ginwal, H.S., Phartyal, S.S., Rawat, P.S. and Srivastava, R.L., 2005. Seed source variation in
morphology, germination and seedling growth of Jatropha curcas L. in central India.
Silvae Genetica 54: 76-80.
Gunaseker, C.P., Martin, L.D., Siddique, K.H.M., and Walton, G.H. 2006. Genotype by
environment interaction of Lndian mustand (Bassica juncea L.) and canola (Brassica
napus L.) in Mediterranean-type environment II Oil and protein concentrations in seed.
European Journal of Agronomy 25: 13-21.
Goodrum, J.W. 2002. Volatility and boiling points of biodiesel from vegetable oils and tallow.
Biomass and Bioenergy 22: 205-211.
Heller, J. 1996. Promoting the conservation and Use of Underutilized and Neglected Crop Physic
Nut, Jatropha curcas L. International Plant Genetic Resources Institute 13: 11-86.
Iqbal, M., Akhtar, N., Zafar, S., and Ali, I. 2008. Genotypic responses of yield and seed oil quality
of two Bassica species under semi-arid environment conditions. South Afirican Journal of
Botany 74: 567-571.
Kaushik, N., Kumar, K., Kumar, S., Kaushik, N., and Roy, S. 2007. Genetic variability and
divergencestudies in seed trairs and oil content of Jatropha (Jatropha curcas L.)
accessions. Biomass and Bioenergy 31: 497-502.
Page 559

July 9-11, 2012
Sana, N.K., Hossin, I., Haque, E.M., and Shaha, R.K. 2004. Identification, Purification and
Characterization of Lipase from Germinating Oil Seeds (Brassica napus L.). Pakistan
Journal of Biological Sciences. 7(2): 246-252.
Tadakittisarn S., Janchai, P. Vaithanomsat, P. and Apiwatanapiwat, W. 2010. Effect of Ripening
Stageand Temperature on Free Fatty Acid Content of Jatropha curcas Oil During Storage.
The Proceedings of the 48th Kasetsart University Annual Conference, Bangkok, Thailand.
Vos, P., Hogers, R., Bleeker, M., Reijans, M., Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J.,
Kuiper, M., and Zabeau, M. 1995. AFLP: a new technique for DNA fingerprinting.
Nucleic Acids Research. 23: 4407-4414.
Page 560

July 9-11, 2012
STP116-29
Preliminary screening of lignin-degrading enzymes from

selected Corticiaceae
Amornsri Singnam .1, Thitiya Boonpratuang.2, Rattaket Choeyklin.3, Torpong

Kreetachat.4, Sawitri Chuntranuluck.1 and Pilanee Vaithanomsat.*3
1Department of Biotechnology, Faculty of Agro-Industry, Kasetsart University, Thailand
2Mycology Laboratory, Bioresources Technology Unit, National Center for Genetic Engineering
and Biotechnology, Thailand Science Park, Pathumthani, Thailand
3Nanotechnology and Biotechnology Division, Kasetsart Agricultural and Agro-Industrial
Product Improvement Institute (KAPI), Kasetsart University, Bangkok, Thailand
4School of Energy and Environment, University of Phayao, Muang, Phayao, Thailand.
E-mail: aappln@ku.ac.th
ABSTRACT
This is the first time to report the detection of ligninolytic enzymes in Corticiaceae in Thailand.
A survey for enzymes involved in lignin degradation was carried out on 97 strains of different
groups of basidiomycetes. The production of laccase (Lac), manganese peroxidase (MnP) and
lignin peroxidase (LiP) was screened in vitro. Only three of the selected Corticiaceae fungi,
RCK783S, RCK783W and RCK793S-E, produced Lac reaching the maximum activity at 4217.50,
2109.72 and 790.83 U/L, respectively. RCK783S, RCK783W and RCK793S-E produced MnP
reaching the maximum activity at 227.85, 132.30 and 110.71 U/L, respectively. LiP activity was
detected at low level as 25.56, 19.77 and 13.75 U/L, respectively, from RCK248T, RCK576W and
RCK261T.
Keywords: Basidiomycota, Lignin-degrading enzyme, Corticiaceae fungi
INTRODUCTION
Biodegradation resistance of wood and other lignified materials is directly related to the
presence of lignin. In general, it is considered that an average lignin content over 20% confers
effective protection against biodegradation. Lower lignin contents permit polysaccharide attack by
hydrolases from a variety of organisms. Several strains of wood and other lignified materialdegrading fungi have been reported, including various species of Pleurotus, Coriolus, Trametes,
Polyporus, Lentinus and Pycnoporus (Sani et al., 1998; Kahraman and Yesilada, 1999; Das et al.,
2000; Leonowicz et al., 2001; Zilly et al., 2002). However, the ability to remove lignin from
highly-lignified materials, a key process for carbon recycling in forest ecosystems, is mainly found
in basidiomycetous fungi. Some species of basidiomycetes designated as white-rot fungi are able
to breakdown all components of lignocellulose, including lignin, the more refractory polymer to
microbial attack. White-rot fungi such as Trametes versicolor (Jnsson et al., 1989), Ganoderma
spp. (Silva et al. 2005), Phanerochaete chrysosporium (Kersten and Cullen, 2007), Pleurotus
ostreatus (Santoyo et al., 2008), Dichomitus squalens (Eichlerov et al., 2006), Coriolus
Page 561

July 9-11, 2012
versicolor and Phlebia radiata (Martinez et al., 2005) are the most active ligninolytic organisms
described to date. Their ability to degrade lignin and a wide variety of aromatic compounds is due
to a non-specific extracellular enzyme system. This white-rot fungus produces three major enzyme
types: lignin peroxidase (LiP), manganese peroxidase (MnP) and laccase (Lac), all of which are
responsible for the biodegradation of lignin (Vicuna, 2000). The major enzymes associated with
the lignin-degrading ability of white-rot fungi are LiP (Young and Yu, 1997), MnP (Heinfling et
al., 1998) and Lac (Vicuna, 2000). Some white-rot fungi produce all these enzymes while others
produce only one or two of them (Zilly et al., 2002).
The mechanisms of lignin biodegradation have not been completely elucidated in spite of
recent progress, motivated by biotechnological applications in pulp and paper industries (Eriksson,
1990). The enzymes LiP and MnP, have been described in Phanerochaete chrysosporium Burds.,
and a vast amount of information on these enzymes has accumulated during the last 10 years (Kirk
and Farrell, 1987; Shimada and Higuchi, 1991; Odier and Artaud, 1992). However, Lac is also
presumed to be involved in lignin degradation. Moreover, an expanded role of Lac in lignin
degradation has been proposed (Bourbomais and Paice, 1990). White-rot fungi are known as lignin
degraders in nature. Studies on lignin biodegradation are restricted to several dozens of fungi, and
most of the knowledge on the enzymatic mechanisms of lignin degradation focuses on P.
chysosporium. Previous screening of basidiomycetes for the presence of ligninolytic enzymes has
been reported (Esposito et al., 1991; de Jong et al., 1992).
Recently, many researchers have been attempting to screen for new and alternative ligninolytic
enzymes-producing fungal strains, mainly in Basidiomycetes. This is due to that the ligninolytic
enzymes have been widely researched in a number of applications. These include the
detoxification of effluents from textile, petrochemical (Nilsson et al., 2006; Zhao and Hardin,
2007) and pulp and paper (Archibald and Bourbonnais, 1997) industries. Moreover, it was
reported to be applied for the removal of phenolic compounds from beer and wine in food industry
(Minussi and Duran, 2002) With this purpose in mind, a large number of cultures, obtained from
Corticiaceae in Basidiomycetes collected in the north region of Thailand, were grown in liquid
medium and assayed for the production of enzymes associated with lignin degradation.
Fungal species
The 97 cultures studied, Basidiomycetes were obtained from mycelium aseptically removed
from collected fungi.
Culture conditions
Because of the large number of strains studied, only a single set of growth conditions was used
for preliminary screening, 250 mL Erlenmeyer flask with 100 mL of Potato Dextrose Broth (PDB)
(200 g/L potato, 20 g/L dextrose) was inoculated with 10 agar plugs ( 0.75 cm) cut out from a
colony grown on PDA. Incubation was carried out at room temperature (25-30 C) under shaking
condition. After 7 days, the culture supernatants were used as enzyme sources for the activities
assay.
Page 562

July 9-11, 2012
Enzyme assays
Lac activity was measured with 2,2-azino bis(3-ethylbenzthiazole-6-sulphonic acid) (ABTS)
in 1.0 M sodium acetate buffer (pH 4.5). Oxidation of ABTS was determined by the increase in
A420 (420 = 36,000 M/ L.CM)(Eggert et al. 1996). All measurements were performed in triplicates.
The average value of one unit of Lac activity was defined as the amount of enzyme that oxidizes
one 1 mol ABTS per minute under the certain condition.
MnP activity was measured with 3-methyl-2-benzothiazolinone hydrazone (MBTH) in 1.0 mL
sodium acetate buffer (pH 4.5) with 4.95 mM DMAB and 0.25 mM hydrogen peroxide. Oxidation
of MBTH was determined by the increase in A590 (590 = 53,000 M/ L.CM)(Castello et al. 1994).
All measurements were performed in triplicates. The average value of one unit of MnP activity
was defined as the amount of enzyme catalyzing the production of 1 mol of green or purple
product per minute under the certain condition.
LiP activity was measured with veratryl alcohol (Tein and Kirk 1984) in 200 mM succinate
buffer (pH 3.0) with 2 mM hydrogen peroxide. Oxidation of LiP was determined by increase in
A310 (310 = 9,300 M/ L.CM). All measurements were performed in triplicates. The average value
of one unit of MnP activity was defined as the amount of enzyme catalyzing the formation of 1
mol of verataldehyde per minute under the certain condition.
The present study represents the broadest screening for ligninolytic enzymes. Most of the
fungal strains studied showed abundant growth under the culture conditions used. The enzyme
levels in the species showing Lac, MnP and LiP activities, estimated after 7 day incubation, are
shown in Fig. 1. The activities of Lac, MnP and LiP were determined from the culture filtrates of
fungal strains. Figs. 1a, b and c show detected activities of Lac, MnP and LiP, respectively, in the
culture filtrates of the observed strains. The result demonstrated highest Lac activity at 4217.50,
2109.72 and 790.83 U/L on day 7 from RCK783S, RCK783W and RCK793S-E, respectively,
whereas MnP and LiP activities were detected at very low levels. Maximum MnP activities were
at 227.85, 132.30 and 110.71 U/L on day 7 from RCK783S, RCK783W and RCK793S-E,
respectively. Maximum LiP activities were at 25.56, 19.77 and 13.75 U/L on day 7 from
RCK248T, RCK756W and RCK261T, respectively.
Lignin-degrading enzymes have been widely researched in aphyllophoraceous fungi
(Basidiomycetes). The comparison of lignin-degrading enzymes from fungal strains in this study
with previous reported enzymes in white-rot fungi shows that both white-rot fungi and our fungal
strains are good Lac producers. MnP and LiP activities were detected in fewer fungal strains than
Lac activity, and the activity levels estimated were also comparatively lower. The identification
according to morphology represented in the Family of Corticiaceae
Page 563

July 9-11, 2012
a)
b)
c)
Average Enzyme Activity (U/L)

Fig. 1 The production of ligninolytic enzymes; a) Lac b) MnP and c) LiP; from 97
Basidiomycetes grown in PDB at room temperature under shaking condition for 7 days.
Page 564

July 9-11, 2012
CONCLUSION
The results obtained in this paper showed that the secretion of ligninolytic enzymed by
the white- rot fungus RCK783S was found to be an efficient Lac producer and MnP producer. Lac
activities and MnP activities achieved are very high as compared to most of the reported strains
under similar conditions. Therefore this strain could be an attractive source as a Lac producer and
MnP producer. This must be taken into consideration in biotechnological applications of white-rot
fungi. The conditions must be optimized for each strain, with regard to the aim of the application:
the production of biomass, or enzymes, or the degradation of environmental pollutants.
ACKNOWLEDGEMENTS
This work was supported by grant from Discovery based Development Grant (DD) P1011172 under National Science and Technology for Development Agency (NSTDA). We also
thanks for BIOTEC Culture Collection (BCC) for culture preservation and BIOTEC Bangkok
Herbarium (BBH) for fungal specimen collection. We appreciate master teacher and teachers from
Ban Muang Chum, Wiang Chai, Chiang Rai Province for working together on survey and
collecting fungi from their community forest. We thank head of village and people from Hui Nah
Poi Reservoir, Muang, Payao Province for introduce and lead us to their community forest.
Page 565

July 9-11, 2012
REFERENCES
Archibald, F.S.; Bourbonnais, R. 1997. Kraft pulp bleaching and delignication by Trametes
versicolor. J. Biotechnol. 53: 215-236.
Bourbonnais, R. and Paice, M. G. 1990. Oxidation of non-phenolic substrates. An expanded role
for laccase in lignin biodegradation. FEBS Letters 267: 99-102.
Castillo, M.P., Stenstrom, J., and Ander, P. 1994. Determination of manganese peroxidase activity
with 3-methyl-2-benzothiazolinone hydrazone and 3-(dimethylamino)benzoic acid.
Analytical Biochemistry 218: 399-404.
Das, N., Chakraborty, T.K., and Mukherjee, M. 2000. Purification and characterization of laccase
from Pleurotus florida. Folia Microbiologica. 45: 447451.
de Jong, E., de Vries, F.P., Field, J.A., van der Zwan, R.P., and de Bont, J.A.M. 1992. Isolation
and screening of basidiomycetes with high peroxidative activity. Mycological Research 96:
1098-1104.
Eggert, C., Temp, U., and Eriksson, K.E.L. 1996. Laccase-producing white-rot fungus lacking
lignin peroxidase and manganese peroxidase: role of laccase in lignin biodegradation,
pp.130-150. In T.W. Jeffries and L. Viikari (eds). Enzymes for Pulp and Paper Processing,
American Chemical Society, Washington, D.C.
Eichlerov, I., Homolka, L., and Nerud, F. 2006. Synthetic dye decolorization capacity of white rot
fungus Dichomitus squalens. Bioresource Technology 9: 2153-2159.
Eriksson, K.E.L. 1990. Biotechnology in the pulp and paper industry. Wood Science and
Esposito, E., Canhos, V.P. and Durh, N. 1991. Screening of lignin-degrading fungi for removal of
color from Kraft mill wastewater with no additional extra carbon-source. Biotechnology
Letters 13: 571-576.
Heinfling, A., Martinez, M.J., Martinez, A.T., Bergbauer, M., Szewzyl, U. 1998. Transformation
of industrial dyes by manganese peroxidases from Bjerkandera adusta and Pleurotus eryngii
in a manganese-independent reaction. Applied and Environmental Microbiology 64: 2788-2793.
Jnsson, L., Karlsson, O., Lundquist, K., and Nyman, P.O. 1989. Trametes versicolor ligninase:
Isozyme sequence homology and substrate specificity. FEBS Letters 247: 143-146.
Kahraman, S. and Yesilada, O. 1999. Effect of spent cotton stalks on color removal and chemical
oxygen demand lowering in olive oil mill wastewater by white-rot fungi. Folia
Microbiologica 44: 673676.
Kersten, P. and Cullen, D. 2007. Extracellular oxidative systems of the lignin-degrading
Basidiomycete Phanerochaete chrysosporium. Fungal Genetics and Biology 44: 77-87.
Kirk, T.K. and Farrell, R. 1987. Enzymatic combustion: the microbial degradation of lignin.
Annual Review of Microbiology 41: 465505.
Page 566

July 9-11, 2012
Leonowicz, A., Cho, N.S., Luterek, J., Wilkolazka, A., Wojtas-Wasilewska, M., Matuszewska, A.,
Hofrichter, M., Wesenberg, D., and Rogalski, J. 2001. Fungal laccase: properties and
activity on lignin. Journal of Basic Microbiology 41: 185227.
Martinez, A.T., Speranza, M., Ruiz-Duenas, F.J., Ferreira, P., Camarero, S., Guillen, F., Martinea,
M.J., Gutierrez, A., and Del Rio, J.C. 2005. Biodegradation of lignocellulosics: microbial,
chemical and enzymatic aspects of fungal attack to lignin. International Microbiology 8:
195-204.
Minussi, R.C.; Pastore, G.M.; Duran, N. 2002. Potential applications of laccase in the food
ndustry. Trends Food Sci. Technol. 13: 205-216.
Nilsson, I.; Mller, A.; Mattiassoon, B.; Rubindamayugi, M.S.T.; Welander, U. 2006.
Decolorization of synthetic and real textile wastewater by the use of white rot fungi. Enzyme
Microb. Technol. 38: 94-100.
Odier, E. and Artaud, I. 1992. Degradation of Lignin. pp. 161-191. In G. Winkelmann (ed.).
Microbial Degradation of Natural Products. VCH , Weinheim, Germany.
Sani, R.K., Azmi, W., and Banerjee, U.C. 1998. Comparison of static and shake culture in the
decolorization of textile dyes and dye effluents by Phanerochaete chrysosporium. Folia
Microbiologica 43: 8588.
Santoyo, F., Gonzlez, A.E., Terrn, M.C., Ramrez, L., and Pisabarro, A.C. 2008. Quantitative
linkage mapping of lignin-degrading enzymatic activities in Pleurotus ostreatus. Enzyme
and Microbial Technology 43: 137-143.
Shimada, M. and Higuchi, T. 1991. Microbial, enzymatic and biomimetic degradation of lignin,
pp. 557-619. In D.N. Hon, and Shiraiski N. (eds.). Wood and Cellulosic Chemistry Marcel
Dekker, N.Y.
Silva, C.M.M.S., Melo, I.S., and Oliveira, P.R. 2005. Ligninolytic enzyme
Ganoderma spp. Enzyme and Microbial Technology 37: 324-329.
production by
Tien, M., Kirk, T.K. 1984. Lignin degrading from Phanerochaete chrysosporium: purifcation,
characterization and catalytic properties of unique H2O2-requiring oxygenase. Proceedings
of the National Academy of Sciences of the United States of America 81: 22802284.
Vicuna, R. 2000. Ligninolysis. A very peculiar microbial process. Molecular Biotechnology 14:
173176.
Young, L., Yu, L. 1997. Ligninase-catalyzed decolorization of synthetic dyes. Water Research 5:
11871193.
Zhao, X.; Hardin, I.R. 2007. HPLC and spectrophotometric analysis of biodegradation of azo dyes
by Pleurotus ostreatus. Dyes and Pigmets. 73: 322-325.
Zilly, A., Souza, C.G.M., BarbosaTessmann, I.P., Peralta, R.M. 2002. Decolorization of industrial
dyes by a Brazilian strain of Pleurotus pilmonarius producing laccase as the sole phenol
oxidizingenzyme.FoliaMicrobiologica47:273277.
Page 567

July 9-11, 2012
STP119-31
Influence of TiO2/PLA Biocomposite Supporter on

Photocatalytic Oxidation Activity of the TiO2
Nantavat Tangchantra1, Waranya Pompan1, Kasinee Nacmool1, Kanisorn Jai-eau1,

Pannawit Amornpanpokin1, Jittiporn Kruenate1*, Kowit Suwannahong2
1National Metal and Materials Technology Center, 114 Thailand Science Park, Paholyothin Rd.,
Klong 1, Klong Luang, Pathumthani 12120 Thailand
2Faculty of Science & Technology, Suan Sunandha Rajabhat Univesity,1 U-Thong Nok
Road,Wachira ,Dusit, Bangkok 1030,Thailand
E-mail: jittipk@mtec.or.th
ABSTRACT
Poly(lactic acid) (PLA) has been challenging as one of the most recognizable
biopolymer for more than a decade since it has been readily fabricated as bio-composite
film. In this work, the bio-composite film which was composed of PLA and nanosized
TiO2 particles was used as the carrier for investigating the efficiency of the photocatalytic
activity of the TiO2 embedding throughout the PLA matrix. The photocatalytic activity
efficiency of the TiO2 for degradation of Dichloromethane (DCM) in photoreactor can be
performed by nano-TiO2/PLA biocomposite film. Since the amount of the nano-TiO2
affected the efficiency of the photocatalytic activity, this work was mainly concentrated on
the effort to embed the high amount of nano-TiO2 in the PLA matrix. The developed
photocatalyst bio-composite films were characterized by XRD, UV-Vis near-IR
spectrophotometer and SEM. The SEM images revealed the presence of high homogeneity
of the deposition of nano-TiO2 on the PLA matrix. The XRD patterns interpreted that the
nano-TiO2 embedded in the PLA matrix exhibited mainly in anatase form. In addition, the
photocatalytic results show that the DCM removal efficiencies of 23 %, 41%, 63% and 49
% were obtained when using the catalyst loading at 0%, , 5%, 10% and 15% (wt. cat./wt.
film), respectively.
Keywords: Photocatalytic oxidation, dichloromethane, nano-TiO2/PLA bio-composite film.
INTRODUCTION
In the last decade, TiO2 has been recognized to be one of the most interesting metal oxides used
in photocatalysis process. It has been found to be rather effective material of photocatalytic
activity during both oxidation and reduction reactions. Photocatalytic oxidation (PCO) commonly
uses TiO2 and ultraviolet (UV) light as semiconductor catalysts. Under optimal reaction condition,
organic pollutions can be completely oxidized to form carbon dioxide, water , etc., as final
Page 568

July 9-11, 2012
product. Recently, interest of its application is to remove Volatile Organic Compounds (VOCs).
An electron in an electron-tilled valence band (VB) is excited by photo irradiation to vacant
conduction band (CB), leaving a positive hole in the VB. These electrons and their positive holes
drive reduction and oxidation, respectively, at compounds adsorbed on the surface of a
photocatalyst.
The equation can be written as:
(1)
In this reaction, h+ and e- are powerful oxidizing and reducing agent, respectively . The
oxidation and reduction reaction can be expressed as:
(2)
(3)
When organic compounds are chemically transformed by a PCO device, It is the hydroxyl
radical (OH-) derived from the oxidation of adsorbed water or adsorbed OH- , that is the dominant
strong oxidant. It is net reaction with a VOC can be expressed as:
(4)
The activity of TiO2 as photocattalyst depends strongly upon the method of preparation.
There have been investigated widely on the techniques for incorporating of the TiO2 into the
polymer matrix. Those are polyeurethane composite coating, foamed polyethylene sheet and
synthetic fabrics. However, suitable thin film supports show the reasonable properties: withstand
reactive oxidative radicals attack during light, maintain long term catalytic stability, precluded
TiO2 leaching during the light irradiation, and allow photocatalytic oxidation to process with
acceptable kinetics.
Generally, polymer filled TiO2 technique has been successfully used as photocatalyst with
different types of petroleum polymer matrixes such as polyethylene, poly propylene, poly vinyl
chloride. This is because they are low cost materials with good mechanical properties and light
weight. Unfortunately, the durable property of the petroleum polymer materials can cause of
growing problem of waste disposal of the petroleum plastics in the land fill (Grommen et al., 2006
and Avella et al., 2001).
Therefore, an alternative way that can overcome such serious environmental problem due to
non-decomposable plastic is to be replaced by new developed environmental friendly
biodegradable polymers (Saha et al., 2003)
In this work, a plant-based biodegradable polymer as Poly(lactic acid) or PLA was used as biosupporter for TiO2 catalyst. Because this plant based biopolymer possess superior properties with
relatively high melting point, crystallinity and stiffness compared to other biopolymer (Plackett et
al., 2003 and Barkoula et al., 2010)
Page 569

July 9-11, 2012
Dichloromethane (DCM) is a major indoor and industrial air pollutant, and it was
recommended as one of representative indoor VOCs. In the present paper, DCM was selected as
the model VOCs to investigate to capability with nano-TiO2/PLA composite film
This work was aimed for exerting of developing the nano-TiO2 incorporating in polyethylene
(TiO2/PLA) modified with maleic anhydride copolymer for use as photocatalyst material. The
nano-TiO2 /PLA composite film was recognized as economic and efficient technique for indoor air
treatment application. The characterizations of the nano-TiO2/PLA composite films were
examined by the X-ray diffraction (XRD), the UV VIS near-IR spectrophotometer, and the
scanning electron microscope (SEM) to observe the dispersability and mixing efficiency of nanoTiO2 in the PLA matrix. In addition, removal efficiency of dichloromethane (DCM) in gas phase
was also investigated.
Materials
Titanium dioxide (TiO2) was purchased from the willson company. The commercial grade of
PLA (4042D) used in this study was supplied by the NatureWorks LLC.
Nano-TiO2/PLA composite film Preparation
The TiO2 powder, A220, with varying contents, e.g. 0, 5, 10, and 15 wt.%, were incorporated in
molten PLA resins using the twin screw extruder. The nano-TiO2/PLA composite films with the
thickness of 30 micrometers were obtained from the blown film extrusion technique using the
operation temperature in a range of 100C-160C. All of photocatalyst films are shown in Table 1.
Photocatalyst Characterization Morphology
The microstructure of the nano-TiO2/PLA composite film was examined by using the Scanning
Electron Microscope (SEM, Model Jx A-840, JEOL). In order to prevent the charge build-up
during SEM observation, samples were coated with gold which was used for ion sputter target.
The sputter rate and time were set for 10 nm min-1 and 3 min, respectively. The gold film thickness
was approximately30n
Table 1. Properties of the nano-TiO2/PLA film at various nano-TiO2 contents.
Nano-TiO2
Average
Contents
Particle size
Nano-TiO2/PLA
composite film thickness
(wt.%)
(m)
(m)
30
45
30
10
45
30
15
45
30
Sample
Page 570

July 9-11, 2012
Optical properties
The Ultraviolet-visible spectra of the photocatalysts were recorded by the UV-VIS-NIR
spectrophotometer (Lamda 950, Perkin Elmer instrument) that equipped with an integrating
sphere. The scan ranges from 200 to 800 nm. All spectra was monitored in the transmission mode
and acquired under ambient conditions.
X-ray Diffraction (XRD)
The crystalline structures of photocatalysts were determined by X-Ray Diffraction (XRD)
technique. XRD patterns were obtained on the X-Ray Diffraction (TTRAXIII, Rigaku) using Cu
K and radiation (=1.5404 ). The current and voltage applied were 300 mA and 50 KV,
respectively. The scan ranges from 20 to 60 with a scan rate of 5 min-1 (Shifu et al., 2009).
Table 2. Operating conditions for DCM photocatalytic degradation.
Operating conditions
Representative value
Initial Relative Humidity, %
45-55%
Temperature, C
26-42
Air Flow rate, L min-1
Reactor residence time, s
60
Initial DCM concentration, ppm
20( 5)
UV light source
9-W, UV-C light
UV light intensity, mW cm-2
Reactor material
stainless steel
Dosages of catalyst film, (wt.%.cat/wt. film)
0, 5,10,15
Reaction time, min
300
Photocatalytic Oxidation Reactor

The photocatalytic oxidation reactor used in this study is an annular closed-system. The reactor
is composed of an UV-C lamp with 254 nm wavelength. The UV light intensity was recorded
using a digital radiometer equipped with a UV-C sensor. The nano-TiO2/PLA composite film was
inserted inside the chamber. The humidity and temperature were monitored continuously using the
thermo-hygrometer (DT-2 Kingtill). The reactor was connected with the air compressor pump
which can be adjusted air flow rate from 0 to 5 litres per minute. The gas sample was pumped
through the annular region. The reactor was designed to direct flow of incoming air toward the
nano-TiO2/PLA composite film thereby, enhancing the distribution of the air pollutant onto the
catalytic surface of the film.
Page 571

July 9-11, 2012
The photocatalytic degradation of DCM using the nano-TiO2/PLA composite film was conducted
in the continuous flow reactor at operating conditions as shown in Table 2. The gas sample applied
for all experiments was from a compressed air tube. After the DCM initial concentration was at
steady state, the UV lamp was turned on. This step is necessary for the DCM in order to reach the
adsorption equilibrium. The quantitative analysis of pollutant was made with the Gas
Chromatograph (GC) equipped with a Flam Ionization Detector (FID, model 5890, Hewlett
Packard). The gas sample with the volume of 1 ml was collected from the reactor using a gas
syringe and was then injected into the GC-FID with a capillary column CP sil 8. The injector
temperature was set at about 250oC and the initial column temperature was set at about 50oC and
was increased to 110oC at a rate of 40oC/min (Hung et al., 2007).
RESULTS
Characterization of the Nano-TiO2/PLA composite film SEM characterization
Surface morphology of TiO2 is one of the most important factors which can affect the
efficiency of photocatalyst. In Fig.1, it was clearly observed that TiO2 was totally deposited and
dispersed in the PLAmatrix.
In Fig. 1(a) SEM micrograph shows spherical shape of the particles. The diameter of the
particles is less than 0.5 m. The SEM images also reveal that the higher the amount of TiO2, the
more the agglomeration of the TiO2 was found. That is to say as the amount of the nano-TiO2
content increases the dispersion ability of the TiO2 decreases affecting the efficiency of
photocatalytic activity. In order to overcome such drawback in this work, the compatibilizer was
necessarily cooperated into the nano-TiO2/PLA composite matrix.
Optical properties of the nano-TiO2/PLA composite films
UV-Vis absorbance spectra of the nano-TiO2/PLA composite film at various amounts of nanoTiO2 are shown in Fig. 2. As can be seen from the spectra, the virgin PLA film transmits UV-VIS
light in range of 800-250 nm, while the 5, 10 and 15 wt.% nano-TiO2/PLA composite films exhibit
absorb UV light with wavelength lower than 400 nm. The absorption spectra can determine band
gap energy (Eg) of nano-TiO2/PLA composite films in Table 3.
Table 3. Calculated results of energy band gap nano-TiO2/PLA composite films via the UV VIS
near-IR spectrophotometer.
Sample
Energy band gap

(eV)
5%nano-TiO2/PLA
3.26
10%nano-TiO2/PLA
3.21
15%nano-TiO2/PLA
3.15
Page 572

July 9-11, 2012
(a)
(b)
(c)
(d)
Fig. 1 SEM micrographs (a) PLA film (b-d) 5, 10, 15 wt.% nano-TiO2/PLA composite film,
respectively
100
90
%Transmission
PLA film
80
5%TiO2/PLA film
70
10%TiO2/PLA film
15%TiO2/PLA film
60
50
40
30
20
10
0
250
300
350
400
450
500
550
600
650
700
750
800
wavelength (nm)
Fig. 2 UV-VIS transmission spectra of the nano-TiO2/PLA composite films at various dosages
of TiO2.
Page 573

July 9-11, 2012
2500
[TiO2.raw] BB 0.02 5d_m+Fix - IH

2T=25.360
65-5714> TiO2 - Titanium Oxide
Intensity(Counts)
2000
1500
1000
2T=48.081
2T=37.857
500
2T=53.938
2T=55.118
2T=38.620
2T=36.999
0
20
25
30
35
40
45
50
55
2-Theta(?)
Fig. 3 X-ray diffraction patterns of Nano-TiO2 powder
X-ray diffraction patterns of the nano-TiO2/PLA composite films

Figure 3 displays the XRD pattern of unmodified and modified TiO2 particles, which appear
peak 2 at 25.36, 36.9, 37.86, 38.62, 48.08, 53.94 and 55.12, which matched with plane as (101),
(103), (004), (112), (200), (105),
and (211), respectively. These XRD data corresponds to the anatase phase of TiO2 (JCPDS 655714). Typical diffraction peaks representing rutile or brookite are not presented in the pattern.
Photocatalytic activity at different of nano-TiO2/PLA composite films loading
For DCM photocatalytic degradation using the PLA-nano TiO2 composite film, the dosages of
TiO2 were varied from 0, 5, 10and 15% (wt cat./wt film). The photocatalytic activity catalyst not
only depends on loading quality, but also on the amount of compound loaded. We investigated the
photocatlytic activity of different concentrations of TiO2 on PLA composite film. Table 3 shows
that the conversion rate of DCM increases and then rapidly drops as the TiO2 loading further
increases. The highest photodegradation efficiency of 63% was obtained when the TiO2 loading
was 10% wt., then the photodegradation efficiency drop slightly to 50 % as shown in Fig 4. It was
suggested that lower content of TiO2 unable to provide enough TiO2 photocatalyst, while higher
amount of TiO2 may lead to a drop in the conversion of DCM due to the nucleation of TiO2 on the
support which decreasing of the amount of TiO2 surface. The data of surface area of different
dosages of TiO2 loading is in line with photocatalytic activity of different concentrations of TiO2
incorporating in PLA composite film.
Page 574
60

July 9-11, 2012
Table 4. DCM conversion and TiO2 loading of the nano-TiO2/PLA film after reaction 300 min..
Nano-TiO2
Average
Contents
Particle size
Nano-TiO2/PLA
composite film thickness
(wt.%)
(m)
(m)
30
45
30
10
45
30
15
45
30
Sample
DISCUSSION
In summary, the nano-TiO2 incorporating in polyethylene (TiO2/PLA) modified with maleic
anhydride copolymer for use as photocatalyst material were highly promising photocatalyst for
degradation of volatile organic compound as dichloromethane at very low concentration.
ACKNOWLEDGEMENTS
The authors would like to express gratitude to Faculty of Science & Technology, Suan
Sunandha Rajabhat Univesity, 1 U-Thong Nok Road, Wachira, Dusit, Bangkok . The special thank
is extend to the National Metal and Materials Technology Centre for their financial support and for
providing me with an opportunity to carry out this project.
Page 575

July 9-11, 2012
REFERENCES
Andronic, L. and Duta, A. 2007. TiO2 thin films for dyes photodegradation. Thin solid films
515: 6294-6297.
Avella, M., Bonadies, E., Martuscelli, E., and Rimedio, R. 2001. European current
standardization for plastic packaging recoverable through composting and biodegradation.
Polymer Testing 20: 517-521.
Barkoula, N. M., Garkhail, S. K., and Peijs, T. 2010. Biodegradable composites based on
flax/polyhydroxybutyrate and its copolymer with hydroxyvalerate. Industial Crops and Products
31: 34-42.
Grommen, R. and Verstraete, W. 2002. Environmental biotechnology: the ongoing quest.
Journal of Biotechnology 98: 113-123.
Hung W.C., Fu, S.-H., Tseng, J.-J., Chu, H., and Ko, T.-H. 2007. Study on photocatalytic
degradation of gaseous dichloromethane using pure and iron iondoped TiO2 prepared by the solgel method. Chemosphere 66: 2142-2151.
Ibhadon, A. O., Arabatzis, I. M., Falaras, P., and Tsoukleris, D. 2007. The design and
photoreaction kinetic modeling of a gas-phase titanium foam pack bed reactor. Chemical
engineering Journal 133: 317-323.
Plackett, D., Andersen, T. L., Pedersen, W. B., and Nielsen, L. 2003. Biodegradable
composites based on L-polylactide and jute fibres. Composites Science and Technology 63: 12871296.
Saha, N., Zatloukal, M., and Saha, P. 2003. Modification of polymers by protein hydrolysateA way to biodegradable materials. Polymers for Advanced Technologies 14: 854-860.
Shifu, C.,Wei, Z., Sujuan, Z., and Wei, L. 2009. Preparation, characterization and
photocatalytic activity of N-containing ZnO power. Chemical Engineering Journal 148: 263-269.
Page 576

July 9-11, 2012
STP123-32
The effect of modified TiO2 embedded in the biopolymer matrix

on the efficacy of Dichloromethane degradation
Praewpan Katrun1, Suchart Supattanapalapol1, Nantavat Tangchantra1, Kasinee Nacmool1,

Jittiporn Kruenate1, Kowit Suwannahong2*
1
National Metal and Materials Technology Center, 114 Thailand Science Park, Paholyothin Rd.,
2
Faculty of Science & Technology, Suan Sunandha Rajabhat Univesity,1 U-Thong Nok
Road,Wachira ,Dusit, Bangkok 1030,Thailand
*E-mail: kowit007@gmail.com
ABSTRACT
Since petroleum base polymers have been classified as global pollutions, the biopolymer
materials have great recognition via their renewable and biodegradable characteristic. In addition,
the green composite has also been new challenge to replace traditional polymer composite. In this
work, TiO2/PBS biocomposite film was developed to be used as a supporter for determining the
photocatalytic oxidation activity of the TiO2 on the dichloromethane degradation. Poly (butylene
succinate) (PBS) is a synthetic biopolymer which has a reasonable mechanical strength. The
modified-TiO2/PBS biocomposite films were investigated to evaluate the degradation of
dichloromethane (DCM). In this work, the concentration of the nano-TiO2 was constant at 10%wt.
In order to improve the dispersability of the developed photocatalyst, the nano-TiO2 powders were
modified by 0.05 %mole of ethyl triethoxysilane (ETES) and stearic acid (SA), respectively. The
10%wt. nano-TiO2/PBS biocomposite films with thickness of 30 m were prepared by blown film
technique. To evaluate the dispersion efficacy, the modified-TiO2/PBS biocomposite films were
characterized by Scanning Electron microscopy (SEM). Photocatalytic degradation of DCM in gas
phase was determined using an annular closed system photoreactor. The obtained result which was
corresponding to the absorption of nano-TiO2/PBS biocomposites film were investigated in a range
of 300-800 nm via UV/VIS/NIR spectrophotometry. The energy band gap of unmodified, ETESand SA-TiO2 biocomposite film were found to be 3.18, 3.26, and 3.26 eV, respectively. The SEM
shows that the modified-TiO2 with both ETES and SA exhibit uniform dispersion, while the
unmodified-TiO2 shows an evidence of agglomeration in the PBS matrix. For photocatalyst
efficiency, the photocatalytic activity of modified-TiO2/PBS biocomposite film increased
comparing to that of the unmodified-TiO2/PBS biocomposite film. Moreover, the photocatalytic
degradation of ETES-TiO2/PBS biocomposite film yielded degradation efficiency of 57 %DCM,
whereas SA-TiO2/PBS biocomposite film yielded the removal efficiency of 23 %DCM, for
treatment time of 200 min.
Keywords: film, modified TiO2, biopolymer supporter
Page 577

July 9-11, 2012
INTRODUCTION
Heterogeneous photocatalysis has emerged as an efficient technology to purify air and water.
This technique is based upon the used theory of UV irradiated semiconductors, generally titanium
dioxide (TiO2) which is the most promising semiconductor photocatalyst, to destroy various
organic pollutants. Different forms of TiO2 such as thin and thick film coating, powder, membrane,
and sol-gel have been utilized to make this photo catalyst more efficient and more applicable (Ao
et al., 2008). The method of TiO2 photo catalyst production and its physical form are among the
most determining parameters influencing the overall photo catalytic efficiency. However, a
number of practical problem that arising from the use of TiO2 powder during the photo catalytic
oxidation process has been reported. For example, separation of insoluble catalyst from suspension
is difficult. Also, the suspended particle tends to aggregate especially at high concentration.
Moreover, suspension is difficult to apply for continuous flow systems.
Titanium dioxide has been extensively studied for environmental purification applications, due
to its good characteristics of powerful oxidation strength, chemical stability, nontoxicity and
inexpensiveness. However, because the fine TiO2 which represents high photo-activity and a
significant quantum effect is commonly in nanometer size, the problem of separation and recovery
of photocatalyst from the reaction medium exists. An alternative method is immobilization of TiO2
powder on an inert and suitable supporting matrix.
Therefore, several preparation methods used to obtain TiO2 thin film including doctor blade,
spray coating, spin coating, chemical vapors deposition and spray vapors deposit have been
investigated (Suwannahong et al., 2010). It has been reviewed by number of investigators that
different forms of TiO2 such as thin and thick film coating, powder, membrane, and sol-gel have
been utilized to make this photo catalyst more efficient and more applicable (Hung et al., 2007).
Previous studies have indicated that the method of organic pollutants photo catalyst production and
its physical form are among the most determining parameters influencing the overall
photocatalytic efficiency.
Ethyl triethoxysilane (ETES) and stearic acid (SA) are widely used as a support in gas and
water remediation because of its good ability to form a durable bond between organic and
inorganic materials. Encounters between dissimilar materials often involve at least one member
thats siliceous or has surface chemistry with siliceous properties; silicates, aluminates, borates,
etc., are the principal components of the earths crust. Interfaces involving such materials have
become a dynamic area of chemistry in which surfaces have been modified in order to generate
desired heterogeneous environments or to incorporate the bulk properties of different phases into a
uniform composite structure.
Previous work, we investigated the effect of TiO2 on degradation of dichloromethane by using
Petroleum-based synthetic polymer as a supporter which is a significant environmental problem.
Furthermore, these polymer wastes are a pollutant in soil, rivers and marine because they resist
microbial attack. In this work, Polybutylene succinate (PBS) which is one of commercially
biodegradable polymers with good mechanical properties, melt processing, biodegradability and
compostability was used to solve the problem.
In this paper, the property of TiO2 coupling with ETES and SA were investigated with
Scanning Electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR) and
Page 578

July 9-11, 2012
Thermogravimetric Analysis (TGA). SA-TiO2/PBS film and ETES-TiO2/PBS film were
investigated in Photocatalytic Oxidation (PCO) method. Chlorinated Volatile Organic Compounds
(VOCs) have been used as a toxic model for determination the ability of photocatalytic method to
purify an indoor air. Dichloromethane was used as the representative species of Volatile Organic
Compound (VOCs.)
Titanium dioxide (TiO2) powder was purchased from the willson company. The commercial
grade of Polybutylene succinate (PBS) (Grade: FZ91PD) used in this study was supplied by the
Mitsubishi chemical corporation. Certain Melt Flow Index, MFI (2.16 Kg. at 190C) of the resin,
provides by the manufacturer are 5.5 g/10min. Ethyl triethoxysilane (ETES) with purity 96%
(Aldrich) and stearic acid (SA) with purity 98% (Fluka) were used as coupling agent.
Photocatalyst nano-TiO2/PBS Biocomposite Film Preparation
The TiO2 powder with 10 %wt contents was incorporated in molten PBS resins using twin
screw extruder. Certain TiO2 powder was modified with ETES and stearic acid (SA) to improve
the dispersibility of the nano-TiO2 and enhance the compatibility between TiO2 and PBS matrix.
The nano-TiO2/PBS biocomposite films with the thickness of 30 micrometers were obtained from
blown film technique using the operation temperature in a range of 110C-140C. All of
photocatalyst films as shown in Table 1.
Table 1. Chemical constituents of the nano-TiO2/PBS film.
Sample
Coupling agent
Nano-TiO2 contents (%wt)
TiO2/PBS
10
Film thickness (m)

30
ETES-TiO2/PBS
Ethyl triethoxysilane
10
30
SA-TiO2/PBS
Stearic acid
10
30
Materials Characterization
Morphology
The microstructure of the Nano-TiO2/PBS biocomposite film was examined using the Scanning
Electron Microscope (SEM, Hitachi S-3400N). In order to prevent the charge build-up during
SEM observation, samples were coated with gold which was used for ion sputter target. The
sputter rate and time were set for 10 nm min-1 and 3 min, respectively. The gold film thickness was
approximately 30 nm (Shinde et al., 2008
Optical property
Ultraviolet-visible spectra of the photocatalysts were recorded using the UV-VIS
spectrophotometer (Lamda 950, Perkin Elmer instrument) equipped with an integrating sphere. A
BaSO4 dye was used as a reference. The scan ranges from 300 to 800 nm. All spectra were
monitored in the absorbance mode and acquired under ambient conditions. The band gap energy of
TiO2 thin film can be calculated from absorbance results (Shinde et al .,2008). The optical
absorbance spectra, the adsorption coefficient and the band gap of TiO2 film were evaluated.
Briefly, the absorption coefficient () was calculated using the following correlation, = ln (1/d)/t,
where t is the transmittance and d is the thickness of the film. The thickness of the film was also
evaluated from the UV spectrum and the average value corresponding to 30 m. The band-gap
energy was obtained by plotting the optical absorption (h)2 and the photon energy (h). Then the
extrapolation of the linear portion of the curve must be performed to receive the band gap energy
(Andronic and Duta., 2007).
Page 579

July 9-11, 2012
Fourier Transform Infrared (FTIR) Spectroscopy
Adsorption of the unmodified and modified TiO2 nanoparticles was studied by Fourier
transform infrared (FTIR) spectroscopy. FTIR spectra were obtained using a Model Perkin Elmer
System 2000. The unmodified and modified TiO2 nanoparticles were dried in an oven at 120 C
for 6 h, and then KBr pellets were prepared with the dried TiO2 nanoparticles. The spectra were
collected in the range from 4000 to 400 cm-1(Nakayama and Hayashi,2008).
Thermogravimetric analysis (TGDTA)
Thermogravimetric analysis (TGA) for the air-dried sample was performed on Model
TGA/SDTA851e from 50 to 800 C at a heating rate of 10 C min1 under nitrogen gas flow
(Nakayama and Hayashi, 2008).
technique. XRD patterns were obtained on the X-Ray Diffraction (JEOL JDX-353) using Cu K
and radiation (=1.5418 A). The scan ranges from 20 to 60 with a scan rate of 2 min -1 (Shifu
et al.,2009).
The photocatalytic oxidation reactor used in this study was an annular closed-system. The
reactor is composed of an UVC lamp with 254 nm wavelength. The UV light intensity was
recorded using a digital radiometer equipped with a UVC sensor. The nano-TiO2/PBS
biocomposite film was inserted inside the chamber. The humidity and temperature were monitored
continuously using the thermo-hygrometer (DT-2 Kingtill). The reactor was connected with the air
compressor pump which can be adjusted air flow rate from 0 to 5 L min-1. The gas sample was
pumped through the annular region. The reactor was designed to direct flow of incoming air
toward the thin film thereby, enhancing the distribution of the air pollutant onto the catalytic
surface of the film. (Suwannahong et al., 2010).
The photocatalytic degradation of DCM using the nano-TiO2/PBS film was conducted in the
continuous flow reactor at certain operating conditions that were shown in the representative
value. The initial relative humidity was 45-55%. The temperature was 26-42 C. Flow rate was set
at 2 L min-1. The reactor residence time was set at 60 s. The initial DCM concentration was 255
ppm. The UVC light have been chosen for UV light source at 6 W and at the intensity 1.2 mW cm2
. Stainless steel has been used as reactor material and the dosages of catalyst unmodified and
modified TiO2 composite film. The Reaction time was set at 300 min. (Suwannahong et al., 2010).
The gas sample applied for all experiments was from a compressed air tube. After the DCM
initial concentration was at steady state, the UV lamp was turned on. This step is necessary in
order for the DCM to reach the adsorption equilibrium. The quantitative analysis of pollutant was
made with the Gas Chromatograph (GC) equipped with a Flame Ionization Detector (model 5890,
Hewlett Packard). The gas sample with the volume of 1 ml was collected from the reactor using a
gas syringe and was then injected into the GC-FID with a capillary column CP sil 8. The injector
temperature was set at about 250 C and the initial column temperature was set at about 50 C and
was increased to 110 C at a rate of 40 C min-1 (Hung et al., 2007).
RESULTS
The morphological structure of nano-TiO2 particles was studied using scanning electron
microscope (SEM). Scanning micrograph of the unmodified TiO2 powder was shown in Fig. 1.
SEM micrograph shows the agglomeration of the spherical-shaped particles with less than 0.2 m
of primary particle size.
Page 580

July 9-11, 2012
Fig. 1 SEM image of the nano-TiO2 powder

Fig. 2 shows the XRD pattern of unmodified TiO2 particles, which appear peak 2 as 25.36,
36.9, 37.86, 38.62, 48.08, 53.94 and 55.12, which matched with plane as (101), (103), (004),
(112), (200), (105), and (211), respectively. These XRD data corresponds to the anatase phase of
TiO2 (JCPDS 65-5714). Typical diffraction peaks representing rutile or brookite are not presented
in the pattern (Cao et. Al, 2010).
Figure 2. XRD pattern of nano-TiO2 powder
Figure3. FTIRspectra of unmodified and modified TiO2 powder.
Page 581

July 9-11, 2012
In Fig. 3 shows FTIR spectra of unmodified and modified TiO2. The broad band at around
3400 cm1 was assigned to stretching vibrations of Ti-OH groups. A broad band between 400 cm1
and 900 cm1 should be due to the envelope of the phonon bands of Ti-O-Ti bond.
The assignments for the main FTIR band of coupling agents modified TiO2 are listed in Table
2. In the spectrum of TiO2 modified with stearic acid, the bands at 2920, and 2850 cm-1 assigned to
alkyl group appeared. The peak of C=O stretching mode at 1720 cm1 of stearic acid (Fig. 3) splits
to the asymmetric vibration of (COO) and symmetric vibration of (COO) bands, 1505 and 1410
cm1, respectively (Nakayama and Hayashi, 2008). Whereas TiO2 modified with ETES is not
clearly seen in the Fig. 1.
Table 2. Characteristic peak obtained from FTIR unmodified and modified TiO2 powder
Wave number (cm-1)
Functionality
400-900
Stretch vibration band of Ti-O-Ti (Tong et al., 2008)
960-910
Stretch vibration band of TiOSi (Tong et al., 2008)
2850, 2920
C-H symmetrical and a symmetrical stretching vibration (Sabzi et al.

2009; Simi and Abraham. 2009)
3400
Stretch vibration band of Ti-OH groups (Tong et al., 2008)
Fig. 4 shows the results of TGA of unmodified and modified TiO2 powder. There are three
decreasing regions of weight loss, below 100C, between 100 C and 300 C and continues
gradually till 800 C. In the first region, the weight loss is due to evaporation of physically
adsorbed water from TiO2 networks void (Mohammadi et al., 2008). In the second stage, the
weight loss is due to dehydroxylation. After that the modified TiO2 can be attributed to large scale
oxidative thermal decomposition of alkyl chains. The weight loss contributes to amount of
different weight of silane coupling agents which used grafting on surface of TiO2. Moreover, this
result shows that degradation of SA-TiO2 particles more than of ETES-TiO2 particles. The Organic
contents of SA as modifier have longer chain than ETES.
Figure 4. TGA of unmodified and modified TiO2 powder
Page 582

July 9-11, 2012
In Fig. 5 shows morphology of unmodified and modified TiO2/PBS biocomposite films. These
images indicated dispersion and interfacial adhesion of nano-TiO2 particles in PBS matrix. In case
of unmodified TiO2/PBS biocomposite films, the poor interfacial interaction between TiO2 particle
and PBS matrix is appeared on the cross section of the film. Both two cases of modified TiO2/PBS
biocomposite films, the good dispersion of TiO2 particle on the PBS matrix is appeared and the
interfacial interaction between TiO2 particle and PBS matrix is good.
It indicates the coupling agent can improve dispersibility of TiO2 particle on the PBS matrix
and compatibility between TiO2 particle and PBS matrix. The surface modification of TiO2 particle
is successfully prepared.
a) TiO2/ PBS biocomposite film
b) ETES-TiO2/PBS biocomposite film
c) SA-TiO2/PBS biocomposite film

Figure 5. SEM image of unmodified and modified TiO2/PBS biocomposite films
Page 583

July 9-11, 2012
Figure 6. UVvisible absorption spectra of unmodified and modified TiO2 biocomposite films
The results from the UV-Vis spectroscopy in Fig. 6 show that both the unmodified and
modified TiO2/PBS biocomposite film absorbs in the range of UV region. The energy band gap
(Eg) of these TiO2/PBS biocomposite films is calculated from this result which is expressed in
Table 3. The energy band gap (Eg) of unmodified, ETES- and SA-modified TiO2/PBS
biocomposite films are 3.18, 3.26 and 3.26 eV, respectively. It found that surface modification
strongly effect to the energy band gap of TiO2 powder. In addition, the maximum absorption
wavelengths of unmodified, ETES- and SA-modified TiO2/PBS biocomposite films are 360, 350
and 330 nm, respectively.
Photocatalytic activity of the unmodified and modified TiO2/PBS biocomposite film for
removal of DCM in dry air was investigated. For all experiments, the initial concentration of
dichloromethane, the air flow rate, and the UV light intensity were set to be about 5.07 mg/m3, 4
L/min, and 1.2 mW/cm2, respectively for the treatment time of 200 min. While, modification
effect of nano-TiO2 in PBS film on photocatalytic activity was investigated. As seen from Fig. 7,
the DCM removal efficiency of modified TiO2/PBS biocomposite films is higher than unmodified
TiO2/PBS biocomposite film at treatment time of 200 min. The photocatalytic degradation of
ETES-TiO2/PBS and SA-TiO2/PBS film yielded degradation efficiency of DCM 57% and 23%,
whereas unmodified-TiO2/PBS film yielded degradation efficiency of DCM 18% with the
removal efficiency for treatment time of 200 min.
Because of energy band gap and dispersion of modified TiO2/PBS biocomposite films
enhanced, which was shown in Table 3 and Fig. 5, respectively.
Table 3. Calculated results of energy band gap of unmodified- and modified-TiO2/PBS
biocomposite films from the UV-Vis spectroscopy.
Sample
Energy band gap (eV)
10TiO2/PBS
3.18
10SA-TiO2/PBS
3.26
10ETES-TiO2/PBS
3.26
Page 584

July 9-11, 2012
DISCUSSION
Ethyl triethoxysilane and stearic acid-modified TiO2/PBS biocomposite films were successfully
prepared by blown film process to evaluate the degradation of dichloromethane (DCM). The
modification of TiO2 with Ethyl triethoxysilane and stearic acid strongly effect to the dispersion of
such particle in PBS matrix and the energy band gap of biocomposite film. Both ETES- and SATiO2 particle exhibit uniform dispersion while unmodified TiO2 show evidence of agglomeration
in PBS matrix. Modification of TiO2 with stearic acid provides the best of compatibility between
TiO2 particle and PBS matrix. Photocatalytic activity, the degradation efficiency strongly depends
on the energy band gap. The photocatalytic degradation of ETES-TiO2/PBS film yielded
degradation efficiency of DCM 57%, whereas SA-TiO2/PBS film with the removal efficiency
23%, for treatment time of 300 min. The photocatalytic activity of 10wt% modified-TiO2/PBS
biocomposite film increased as compared with 10wt% unmodified-TiO2/PBS film.
ACKACKNOWLEDGEMENTS
I would like to express my gratitude to the Faculty of Science & Technology, Suan Sunandha
Rajabhat Univesity,1 U-Thong Nok Road,Wachira ,Dusit, Bangkok 10300,Thailand
The special thank is extend to the National Metal and Materials Technology Centre for
their financial support and for providing me with an opportunity to carry out this project.
Page 585

July 9-11, 2012
REFERENCES
Andronic, L. and Duta, A. 2007. TiO2 thin films for dyes photodegradation.Thin solid films
515: 6294-6297.
Hung, W.C., Fu, S.H., Tseng, J.J., Chu, H. and Ko, T.H. 2007. Study on photocatalytic
degradation of gaseous dichloromethane using pure and iron ion-doped TiO2 prepared by the solgel method. Chemosphere 66: 2142-2151.
Mohammadi, M.R., Fray, D.J. and Mohammadi, A. 2008. Solgel nanostructured titanium
dioxide: Controlling the crystal structure, crystallite size, phase transformation, packing and
ordering. Microporous and Mesoporous Materials 112: 392402.
Nakayama, E. and Hayashi. T. 2008. Preparation of TiO2 nanoparticles surface-modified by
both carboxylic acid and amine: Dispersibility and stabilization in organic solvents. Colloids and
Surfaces A: Physicochemical and Engineering Aspects 317: 543550.
Suwannahong, K., Liengcharoensit, W. and Sanongraj, W. 2010. Characterization and
photocatalytic activity of the PE-nano TiO2 composite film prepared by the blown film extrusion
technique. In: The 8th Asian-Pacific Regional Conference on Practical Environmental
Technologies; Ubonratchathani, Thailand; 2010 March 24-27.
Tong, T., Zhang, J., Tian, B., Chen, F. and He, D. 2008. Preparation and characterization of
anatase TiO2 microspheres with porous frameworks via controlled hydrolysis of titanium alkoxide
followed by hydrothermal treatment 62: 29702972.
Ao, Y., Xu, J., Fu, D., Shen, X. and Yuan, C. 2008. Low temperature preparation of anatase
TiO2-coated activated carbon. Colloids and Surfaces A: Physicochem. Eng. Aspects 312: 125130.
Sabzi, M., Mirabedini, S.M., Zohuriaan-Mehr, J. and Atai. M. 2009. Surface modification of
TiO2 nano-particles with silane coupling agent and investigation of its effect on the properties of
polyurethane composite coating. Progress in Organic Coatings 65: 222228.
Simi, C.K. and Abraham, T.E. 2009. Nanocomposite based on modified TiO2BSA for
functional applications. Colloids and Surfaces B: Biointerfaces 71: 319-324.
Shife, C., Wei, Z., Sujuan, Z. and Wei, L. 2009. Preparation, characterization and
photocatalytic activity of N-containing ZnO powder. Chemical Engineer Journal 148: 263-269.
Cao, B., Yao, W., Wang, C., Ma, X., Feng, X. and Lu, X.2010. Simple fabrication of rutile
titanium dioxide whiskers. Materials Letters, 64: 1819-1821.
Page 586

July 9-11, 2012
STP124-33
The Adsorption of Direct Dyes by Zeolite
Pannawit Amornpanpokin1, Suchart Supattanapalapol1, Praewpan Katrun1, Tammarak

Sooksomsong1, Kanisorn Jai-eau1, Jittiporn Kruenate1*, Kowit Suwannahong2
1
2
Science Center Faculty of Science & Technology, Suan Sunandha Rajabhat Univesity,1 UThong Nok Road,Wachira ,Dusit, Bangkok 10300,Thailand
E-mail: kowit007@gmail.com
ABSTRACT
This research was aimed to study the possibility of direct dye removal by using zeolite .
The adsorption capacities of Direct dye was considered. The characterization of the
zeolites was carried out by zeta potential analysis, Fourier transform infrared (FTIR), and
Scanning electron microscopy (SEM). The results from zeta potential analysis of zeolite
exhibited negative charge at - 24 mV . The increasing of surface charge of zeolite arose
from the presence of hydroxyl functional group at its surface. The adsorption behavior of
dyes on zeolites was tested using a UV Vis near-IRspectrophotometric technique. The
adsorption isotherm were fitted to the Lanngmuir and Freundlich model. The hightest
adsorption capacities of the dyes removal were in a range of 50 to 80 %. This study clearly
indicated that the zeolites exhibited a great potential on textile dyes removal.
Keywords: zeolites, Direct dye, Adsorption, Lanngmuir, Freundlich.
INTRODUCTION
A dye can generally be described as a colored substance that has an affinity to the substrate to
which it is being applied. The dye is usually used as an aqueous solution, and may require a
mordant to improve the fastness of the dye on the fiber. In contrast, a pigment generally has no
affinity for the substrate, and is insoluble. Color removal from textile effluents has been the subject
of great attention in the recently years. The presence of low concentrations of dyes in effluent
streams is highly visible and undesirable, which causes a reducing of light penetration and
potentially inhibiting of photosynthesis. Color removal due to the water-soluble reactive dyes is
problematic: current methods relying on activated sludge systems are not adequate, neither on site
nor after dilution with domestic wastewater at sewage works. They are a very important class of
textile dyes, whose losses through processing are particularly significant due to their high
hydrolyzing tendency. Thus, in the case of cellulose fibers dyed, nearly 50% maybe lost to the
effluent (Grgorio et al, 2006).
Direct or substantive dyeing is normally carried out in a neutral or slightly alkaline dye bath, at
or near boiling point, with the addition of either sodium chloride (NaCl) or sodium sulfate
(Na2SO4). Direct dyes are used on cotton, paper, leather, wool, silk and nylon. They are also used
as pH indicators and as biological stains. Substantive dye is a dye used in a process in which dye
molecules are attracted by physical forces at the molecular level to the textile. The amount of this
Page 587

July 9-11, 2012
attraction is known as "substantivity": the higher the substantivity the greater the attraction of the
dye for the fiber. Substansive dyes work best on textiles with high contents of fibrous cellulose and
are set in a slightly basic or neutral environment at high temperatures close to boiling point.
Substansive dyes are set by hydrogen bonding.
The adsorption process is widely used in wastewater treatments. Adsorption of dye from textile
effluents has been investigated using a variety of materials such aspect, activated carbon, natural
zeolite, and flyash .Zeolites are microporous, aluminosilicate minerals commonly used as
commercial adsorbents
Zeolites have a porous structure that can accommodate a wide variety of cations, such as Na+,
K+, Ca2+, Mg2+ and others . Sorption of dyes from aqueous solutions on zeolites has been studied
by numerous researchers . Its popularity as a treatment process results from the usefulness of the
process in treating both waters and wastes coming from different industries.
A preliminary study by the authors established the feasibility of using zeolite as a low-cost
material for treating textile wastewater containing Direct dyes (Al-Ghouti et al., 2003). The studies
also demonstrated the importance of the various functional groups, available on the surface of
diatomaceous earth, on the mechanism of adsorption. zeolite surface is terminated by OH groups
and oxygen bridges, which act as adsorption sites. In adsorption processes, it is important to know
the characteristics of these different adsorption sites.
The application of zeolites for dye removal from wastewater has rarely been previously
reported. Balkose et al. reported a investigation using poly(vinyl chloride)-zeolite composites for
methylene blue adsorption and found that the adsorption capacity of zeolite decreased when it was
embedded in composites. Meshko et al. studied the adsorption of basic dyes from aqueous
solutions onto granular activated carbon and natural zeolite. The equilibrium studies have shown
that the granular activated carbon has a higher adsorption capacity than the natural zeolite. The
results from tested a natural zeolite for dye removal from aqueous solution, shows the natural
zeolite exhibits a higher adsorption capacity than fly ash but still lower than unburned carbon
in fly ash (Wang et al., 2006).
In this study, Zeolite was attempted and the effect on dye removal from solution was
investigated. An adsorption mechanism of direct dye was investigated. Moreover, the
effect of silanol groups on the adsorption process was evaluated. Different analytical
methods such as Fourier transform infrared were used to identify the structure of Zeolite
and to elucidate the proper mechanism of dye adsorption. Zeta potential also carried out.
Natural Zeolite MHZ was obtained. The crystalline silica was 35-50 %. The samples were then
washed with deionized water, dried at 100 C, desiccated and stored in tightly stoppered glass
bottles. Fourier transform infrared (FTIR-Perkin-Elmer Spectrophotometer RX I) of Zeolite was
studied.
The spectra of the solid were then recorded. FTIR Perkin-Elmer Spectrophotometer RXI was
used in all investigations. Scanning electron microscope of Zeolite was carried out using JEOLJSM 6400 scanning microscope. In order to identify the structure, the zeta potential of the Zeolite
and dyes were measured using a Zetasizer Nano ZS (Malvern Instruments) equipped with a 633nm
He-Ne laser.
Page 588

July 9-11, 2012
Adsorption isotherms Experimental
The Direct dye was used to study the adsorption isotherms. The Zeolite varied from 10 to 30
grams was obtained fifty milliners in Erlenmeyer flasks with 50 mg/L of initial concentrations.
The experiments showed that equilibrium was reached after a contact time of 3 h. The mixtures
were mixed by a thermostatic shaker at room temperature and the samples were withdrawn and
filtered through a Whatman membrane filter (pore size 2.7 mm). The filtrate was analyzed by UV
spectrophotometer (Perkin Elmer) Adsorption coverage over the surface of Zeolite was studied
using the two well-known isotherm models: Langmuirs and Freundlichs. The result of
experiment have been fitted to both model (Emin Erdem. et al, 2005) The equilibrium data for
textile dyes was over the Emin Erdem ration ranges content of 50 mg/L (at 30 C) and can be
correlated with the Langmuir isotherm:
Ce / Cads = 1 / Qb + Ce / Q
(1)
Where Ce is the equilibrium concentration textile dyes in solution (M) and Cads is the amount
of textile dyes were sorbed onto Zeolite, Q and b are Langmuir constants related to sorption
capacity and sorption energy, respectively. A linear plot is obtained when Ce/Cads is plotted against
Ce over the entire concentration range of dyes investigated The Freundlich sorption isotherm, one
of the most widely used mathematical descriptions, usually fits the experimental data over a wide
range of concentrations. This isotherm gives an expression encompassing the surface
heterogeneity and the exponential distribution of active sites and their energies. The Freundlich
adsorption isotherms were also applied for the removal of textile dyes on Zeolite (Emin Erdem et
al., 2005):
log Cads = log k + 1 / n log Ce
(2)
The Freundlich constants of n and K were calculated by the slope and interception of the
Freundlich plots as show in equation 2 and 3, where Ce is the equilibrium concentration in mg/L
and Cads shows that the adsorption seems to follow the Freundlich isotherm model as well as the
Langmuir isotherm,
K = RTnbe H / RT
(3)
Where K roughly represents the adsorption capacity and can be related to the surface energy as
well as the adsorption intensity. The value of n is usually greater than 1 when the surface is fully
covered.
Physical Characterization
Scanning electron microscopy (SEM) was a primary tool for characterizing the fundamental
physical properties of the adsorbent. It shows an effective potential to determine the particle shape
and appropriate size distribution of the adsorbent. The modification potential of Zeolite provided
by micrographs was shown in Fig. 1. When the solid structure of Zeolite is considered, their
frustules are divided into two main categories: centric (discoid) and pinnate. In Fig. 1, modified
Zeolite has notable pores as discs or cylindrical shapes which express an advantage possibility for
dyes adsorption.
Page 589

July 9-11, 2012
Dusan et al. (2010) performed the SEM analysis of colloidal amorphous silica. It was shown
that the sphere size of the colloidal amorphous silica shrunk due to the internal chemical changes
and volume reduction as demonstrated by SEM observation.
Fig. 1 Scanning electron microscope (magnification 20000) of Zeolite.

The dye adsorptions mechanisms of Zeolite were further investigated by FTIR technique. The
Zeolite surface contains silanol groups that spread over the matrix of the silica. As
aforementioned, the silanol group is considered as high active group, which can react rapidly with
many polarity organic compounds and various other functional groups. FT-IR can indicate the
ability of dyes reacting with silanol groups that spread over the surface of Zeolite.
The vibration of the SiOH bond assigned to band at 3400 cm-1, together with a doublet due to
OH deformation at approximately 1000 cm-1 (Socrates, 1980). When the spectrum shifts or
changes from these peaks, it can be indicated a presence of interactions between the dyes and
silanol groups, and further can be interpreted as adsorption on neutral sites (Dusan et al., 2010).
Fig. 2 shows the FT-IR spectrum of Zeolite adsorbed with dyes. It exhibits two sharp peaks at
1030 and 1114 cm-1 of OH vibration and when the dyes adsorbed on Zeolite the peak shifts from
1114 to 3458 cm-1. Moreover, Zeolite had negative zeta potential values in the range pH 8-11. The
zeta potential of modified Zeolite was equal to -24. A negative zeta Potential was certainly stable
due to the electrostatic repulsion.
Fig. 2 FT-IR spectra of: a Zeolite and Adsorbed Zeolite

FTIR wavenumber 3458, 1114, 796, 694 and 562 cm
Si-O stretch, Si-O-Al stretch, Al-O stretch
Page 590
-1
peak is Al-O-H stretch, Si-O-Si bend,

July 9-11, 2012
Adsorption Isotherm
The dependence of direct dye adsorption on Zeolite was studied at 25 C by varying amount of
the adsorbent in a range from 10 to 30 g., while keeping the volume at 50 ml of the dye solution
constant (50 mg/L). The results, as shown in Fig. 3, indicated that the percentage of adsorption
increasing in accordance with the amount of zeolite .The increasing of percentage was due to the
greater availability of the exchangeable adsorption sites at the higher concentrations of the
adsorbent.
Fig. 3 Direct dyes adsorption on Zeolite versus percentage adsorption.

The variable mass of zeolite is an important for the efficacy of dyes adsorption on the
adsorbents. The experiments conditions were kept at constant of pH 8 and the equilibrium
isotherm at 25 C. The results were fitted using Langmuir and Freundlich models and compared
with the proposed correlation. The data at the solute concentrations were shown in Figs. 4. The
quadratic fitting showed that all the constants can be obtained by both Langmuir and Freundlich
models that were listed in Table 1 with a high correlation coefficient (r2 > 0.90).
Fig. 4 Dye adsorption Langmuir Isotherms of Zeolite.
Page 591

July 9-11, 2012
Table 1 Isotherm parameter of textile dye adsorption on Zeolite sample.
Dye
sample
Direct
Freundlich
parameters
Langmuir parameters
Q
(mg/ml)
0.030
b
(l/g)
R2
1/n
K
(mg/g)
R2
0.014 0.928 0.984 0.0335 0.899
For the Langmuir model, the linearity was well maintained in the considered concentration
range and can be indicated that in the range of concentration for this study showed the effective
dye removal. It is important to notify that the mechanism of dye adsorption on Zeolite cannot be
determined directly from the Langmuir or Freundlich fitting. However, from Table1, it can be
concluded that the adsorption isotherms of Direct dye exhibit Langmuir behavior, which indicates
monolayer adsorption. As showed in Fig.5, it can be concluded that Freundlich model can be
indicated the trend of adsorption efficacy of the direct dye.
Fig. 5 Dye adsorption Freundlich isotherms to Zeolite.

ACKNOWLEDGMENT
I would like to thank National Metal and Materials Technology Centre for their financial
support and for providing me with an opportunity to carry out this project.
Page 592

July 9-11, 2012
REFERENCES
Al-Ghouti M.A., M.A.M. Khraisheh, S.J. Allen, M.N. Ahmad. 2003. The removal of dyes from
textile wastewater: a study of the physical characteristics and adsorption mechanisms of
Diatomaceous earth . Journal of Environmental Management 69: 229238.
Dusan Losic, Yang Yu, Moom Sin Aw, Spomenka Simovic, Benjamin Tierry, Jonas AddaiMensah. 2010. Surface Functionalisation of Diatomaceous earth with Dopamine Modified Iron
Oxide Nanoparticles: Toward Magneticaly Guided Drug Microcarriers with Biologically Derived
Morphologies. The Royal Society of Chemistry pp. 1-12.
Emin Erdem , Glay lgeen, Ramazan Donat. 2005. The removal of textile dyes by
Diatomaceous earth. Journal of Colloid and Interface Science 282: 314319.
Er Li, Xiangying Zeng, Yuehua Fan. 2009. Removal of chromium ion (III) from aqueous
solution by manganese oxide and microemulsion modified Diatomaceous earth. Desalination 238:
158165.
Gamal A. M., S. A. Abo Farha, H. B. Sallam, G. E. A. Mahmoud and L. F. M. Ismail. 2010.
Kinetic Study and Equilibrium Isotherm Analysis of Reactive Dyes Adsorption onto Cotton Fiber.
Nature and Science 8 (11): 95-110.
Grgorio Crini. 2006. Non-conventional low-cost adsorbents for dye removal: A review.
Bioresource Technology 97: 10611085.
Kannan N. and S. Murugavel. 2008. Comparative study on the removal of acid violet by
adsorption on various low cost adsorbents. Global NEST Journal, 10 (3): 395-403.
Kaufhold S., R. Dohrmann, Ch. Ulrichs. 2008. Shelf life stability of Diatomaceous earth.
Applied Clay Science 41: 158164.
Khraisheha M.A.M., M.A. Al-Ghoutib, S.J. Allenb, M.N. Ahmadb. 2005. Effect of OH and
silanol groups in the removal of dyes from aqueous solution using Diatomaceous earth . Water
Research 39: 922932.
Mohammad A. Al-Ghouti, Majed A.M. Khraisheh, Mohammad N.M. Ahmad, Stephen Allen.
2009. Adsorption behaviour of methylene blue onto Jordanian Diatomaceous earth: A kinetic
study. Journal of Hazardous Materials 165: 589598.
Reza Shokoohi, Vahid Vatanpoor, Mansuor Zarrabi and Akram Vatani. 2010. Adsorption of
Acid Red 18 (AR18) by Activated Carbon from Poplar Wood A Kinetic and Equilibrium Study.
E-Journal of Chemistry 7 (1): 65-72.
Tsai W.T., K.J. Hsien, Y.M. Chang, C.C. Lo. 2005. Removal of herbicide paraquat from an
aqueous solution by adsorption onto spent and treated Diatomaceous earth (Dia) tomaceous earth.
Bioresource Technology 96: 657663.
Zawani Z., Luqman Chuah A., and Thomas S. Y. Choong. 2009. Equilibrium, Kinetics and
Thermodynamic Studies: Adsorption of Remazol Black 5 on the Palm Kernel Shell Activated
Carbon (PKS-AC). European Journal of Scientific Research 37 (1): .67-76
Page 593

July 9-11, 2012
Evina Katsou, Simos Malamis, Myrto Tzanoudaki, Katherine J. Haralambous, Maria Loizidou
(2011) Regeneration of natural zeolite polluted by lead and zinc in wastewatertreatment systems
P(773786)
Jun Lua, Ning Liub, Liangxiong Li b, Robert Leeb (2010) Organic fouling and regeneration
of zeolite membrane in wastewater treatment P(203207)
Page 594

July 9-11, 2012
STP127-35
Lead Contaminations in the Chanthaburi River and

Vicinity Area
Kamolthip Mahavonga, Sopa Chinwetkitvanicha, Poranee Pataranawata c
Department of Sanitary Engineering, Faculty of Public Health, Mahidol University, Bangkok 10400
Email: pat_poranee@yahoo.com
ABSTRACT
This research was conducted to investigate lead (Pb) contaminations in surface soil, water and
sediment in the Chanthaburi River and vicinity area along the river. The samples were collected to
estimate Pb contaminated concentrations and also potential environmental risks by Hazard
Quotient Equation (HQ). The results revealed that the distribution of Pb in surface soils of the
orchards located on the bank along the river in dry and wet seasons were in the ranges of 4.06 4.67 and 4.60 - 4.80 mg/kg, dry weight (dw.), respectively and the potential environmental risks of
surface soil are not at risks (HQ < 0.1). The Pb concentrations in water of the Chanthaburi River
from upstream down to estuaries in dry and wet seasons were ranged from not detectable (ND) 0.002 and ND - 0.005 mg/l, respectively and did not exceed the standard for surface water (0.05
mg/l). Likewise, the potential environmental risks of water are not at risks (HQ < 0.1). Also, in
sediment, the concentrations of Pb in dry and wet seasons were very low in the ranges of 2.20 4.24 and 2.46 - 4.34 mg/kg, dw., respectively and the potential environmental risks of sediment are
not at risks (HQ < 0.1), as well. It can be concluded that, at present, this project area is not at risks
in spite of Pb-containing pesticide applications had been performed for many years ago. Regards
to the Water Quality Index (WQI) obtained from 8 parameters of dissolved oxygen (DO), fecal
coliform bacteria (FCB), pH, biochemical oxygen demand (BOD), total phosphate (TP), nitrates
(NO3), turbidity and total solid (TS), the water quality in most study area are classified to be good.
Keywords: lead, environmental risks, Hazard Quotient, Water Quality Index, Chanthaburi River
INTRODUCTION
The Chanthaburi River, located in Chantaburi Province, starts from Soi-Dao Mountain and
flows through Ma-Kham District which is the first community area and flows through orchard
plantation area, the major activities. Then, it runs through Muang District, high density
communities, and down to Lam-Sing District which connected to the Gulf of Thailand. The major
geology of this province consists of the mountains, forests and highlands with the height of 30-190
meters above sea level.
Most agricultural areas are located along the river and the rainfall washes away the pesticides
into river and estuaries. Most factories in this province are medium and small. There are
transportation and food production. The others are non-ferrous industry, timber industry and wood
products and industrial agriculture (Ministry of Industry Thailand, 2007).
Page 595

July 9-11, 2012
In the previous days, the popular and effective pesticides were the pesticides that Pb was of as
active part. Lead arsenate, which had been used for many decades, was banned in Thailand on 1
December 2001 by Ministry of Industry Thailand (Ministry of Industry Thailand, 2001). At
present, the Pb contamination in this area mostly comes from domestic and industrial sources such
as batteries, gasoline, paint products, bullet and etc. Pb, one of the most toxic heavy metals, is
stable and persistent environmental contaminant because it cannot be degraded or destroyed.
Therefore, it tends to accumulate in different various environmental media such as soil, water and
sediment. It can affect infants and young children in developing brain and nervous system.
Moreover, high levels of lead can adversely affect kidneys of adults and children (CDC, 2000).
Currently, information of Pb contaminations in this province has not been available.
Sampling procedure
The sampling was conducted in both dry season (March 2011) and wet season (May 2011) in
locations shown in Fig. 1. Surface soil samples were collected using a spade at the three depths of
0-5, 6-10 and 11-15 cm. of the open pits in orchard near the sampling locations for aquatic track in
the Chanthaburi River. Three grab samples of surface soil were collected in each sampling
station/plot. Each composite soil sample was collected for 1 kg and kept in plastic bags. Water
samples were collected using Kemmerer sampler at mid depth of mid stream and kept in HDPE
bottles. Water samples for Pb detection must be preserved with conc. HNO3 acid (pH < 2).
Sediment samples were collected 2 grabs for each station from the bottom of the river at the same
locations as did for water samples using Ekman dredge (size 2020 cm2).
All samples were kept in an ice box at 4 C and then transported to the laboratory for analyse.
The quality control of laboratory
The accuracy of analytical procedure was calibrated using 3 replicated samples of standard
reference materials (SRM 1646a for sediment) from U.S. Department of Commerce, National
Institute of Standard and Technology (NIST) and 4 samples of blank. The Method detection limit
(MDL) was calculated (by 3.143 multiplies the standard deviation of the seven reagent blank
samples in the sample batch) and used as a tool for verification of all Pb analyses.
Sample Analyses
Water: The physical and chemical characteristics of water were measured both in the field and
in the laboratory (APHA, 1998). Determination of Water Quality Index (WQI) consists of eight
parameters as follows: dissolved oxygen (DO), fecal coliform bacteria (FCB), pH, biochemical
oxygen demand (BOD),
Page 596

July 9-11, 2012
Fig. 1 Map of sampling stations in the Chathaburi River and vicinity area (modified from Region
of Environmental office 13, 2010).
total phosphate (TP), nitrates (NO3), turbidity and total solid (TS). The WQI is calculated using
the following equation:
(1)
n = number of parameters
wi = unit weight of parameter
qi = the quality of parameter (PCD, 2010).
Surface soil/Sediment: Samples preparation of surface soil and sediment were air dried under
shade around 2 days, crushed by using a porcelain pestle and mortar and sieved to remove the
particles greater than 2 mm, using stainless sieve. The physical and chemical analyses of surface
soil and sediment were measured in the laboratory as follows: pH, organic matter (Walkley and
Black, 1934), texture (Sheldrick and Wang, 1993) and cation exchange capacity (Chapman, 1965).
Total lead contents of water samples will be investigated using method of nitric acid digestion
(APHA, 1998). Likewise, total lead contents of surface soil and sediment samples were
investigated using method of nitric acid digestion (USEPA, 1996). All surface soil and sediment
samples will be dried at 103 C for 24 hours prior to digestion. Pb contents of samples were
determined by Varian SpectrAA-600 Atomic Absorption Spectrophotometer (The lower limit of
detection was <1.0 g/L.).
Page 597

July 9-11, 2012
Evaluation of the potential environmental risks can be estimated numerically using the Hazard
Quotient (HQ). The HQ is a ratio, which can be used to estimate if risk to harmful effects is likely
or not due to the contamination in site. The HQ is calculated using the following equation:
HQ = EEC/Screening Benchmark
(2)
EEC = estimated (maximum) environmental contaminant concentration in the soil, sediment, or
water at site (e.g. mg contaminant/kg soil).
Screening Benchmark = maximum allowable of lead concentration; if the contamination
concentration is below this level, the contaminant is not likely to cause harmful effects.
If: HQ < 0.1,
no hazard exists
HQ = 0.1-1.0, hazard is low

HQ = 1.1-10,
HQ > 10,
hazard is moderate
hazard is high (Lemly, 1996).
Statistical analysis of data was carried out with the SPSS statistical program for Window
(version 18.0). Comparisons of mean values lead between seasons by the significance level was of
p < 0.05.
RESULTS
The accuracy of the analytical procedure for Pb determination calibrated against standard
reference material by the percentage recovery was at 98.29. Whereas method detection limit
(MDL) was at 0.0012 mg/l.
The physical and chemical characteristics of surface soil are shown in Table 1. The
concentrations of Pb in surface soils in dry and wet seasons were in the ranges of 4.06 to 4.67 and
4.60 to 4.80 mg/kg, dw., respectively (Fig. 2). The Pb in surface soil mainly showed high
concentration in only the depth of 11-15 cm. regards to agricultural and industrial activities related
to Pb which was banned in Thailand for many years ago. The Pb was previously added to gasoline
used for gasoline-powered machines which have been employed in agricultural operations for
cultivation, water pumping and harvesting )Wenzhong et al., 2010) which is the main activity of
this province. The result of statistical analysis for comparisons of Pb concentrations between
seasons in surface soil was significant difference.
The characteristics of water were shown in Table 2. The concentrations of Pb in water in dry
and wet seasons were in the ranges of ND to 0.002 and ND to 0.005 mg/l, respectively (Fig. 2).
The concentration of lead decreased as increasing the period of time based on annual water quality
report during the year 2004-2010 in the Chanthaburi River (Region of Environmental office 13,
2010). The Pb in water mainly showed high concentrations in dry season. In addition, Pb in wet
season showed high concentrations at stations S5 and S6 because those stations were receiving
estuaries of rain runoff from contaminated tributaries. The result of statistical analysis for
comparisons of Pb in water between seasons showed no significant difference. Most of the water
qualities of the river are classified to be good as calculated Water Quality Index (WQI) of the
Chanthaburi River shown in Table 3. The bad
Page 598

July 9-11, 2012
Table 1 The physical and chemical characteristics of surface soil
Stations
Sand (%)
Silt
(%)
Clay
(%)
Texture
pH
OM
(%)
CEC
(cmol/kg)
Dry Season
SS1
SS2
SS3
SS4
(cm)
22.8
52.9
24.3
Silt Loam
5.7
5.67
14.69
6-10 (cm)
21.3
52.8
25.9
Silt Loam
5.6
4.90
14.31
11-15 (cm)
23.3
51.4
25.3
Silt Loam
5.1
3.48
12.16
(cm)
28.7
48.2
23.1
Loam
5.7
5.45
14.67
6-10 (cm)
24.9
50.7
24.4
Silt Loam
5.6
3.51
12.22
11-15 (cm)
25.0
49.8
25.2
Loam
5.2
2.50
9.84
(cm)
43.5
39.3
17.2
Loam
5.4
3.77
9.58
6-10 (cm)
38.6
42.5
18.9
Loam
4.8
2.31
7.86
11-15 (cm)
41.3
39.3
19.4
Loam
4.8
2.07
7.78
(cm)
27.6
45.7
26.7
Loam
5.1
4.63
14.69
6-10 (cm)
29.1
44.4
26.5
Loam
4.3
3.51
11.38
11-15 (cm)
28.8
45.3
25.9
Loam
4.4
2.95
11.06
(cm)
24.2
50.5
25.3
Silt Loam
5.0
4.96
13.83
6-10 (cm)
24.8
48.3
26.9
Loam
4.9
3.05
12.65
11-15 (cm)
25.0
48.2
26.8
Loam
4.9
2.14
10.42
(cm)
25.3
49.5
25.2
Loam
5.6
4.78
13.98
6-10 (cm)
26.2
48.9
24.9
Loam
5.2
2.92
11.17
11-15 (cm)
26.9
47.4
25.7
Loam
5.0
2.27
10.10
(cm)
47.8
35.2
17.0
Loam
4.7
2.51
8.21
6-10 (cm)
41.9
35.8
22.3
Loam
4.6
3.70
10.52
11-15 (cm)
43.2
38.4
18.4
Loam
4.6
1.76
7.28
(cm)
43.8
37.0
19.2
Loam
5.9
4.13
17.25
6-10 (cm)
43.6
37.5
18.9
Loam
4.8
5.52
7.63
11-15 (cm)
35.9
41.1
23.0
Loam
5.2
3.70
3.18
0-5
0-5
0-5
0-5
Wet Season
SS1
SS2
SS3
SS4
0-5
0-5
0-5
0-5
Page 599

July 9-11, 2012
Table 2 The physical and chemical characteristics of water
Turbidity
TS
Stations
DO
BOD
TP
NO3
FCB
(mg/l)
(mg/l)
(mgP/l)
(mgNO3/l)
(MPN/100ml)
pH
(NTU)
(mg/l)
Dry Season
S1
2.56
26.00
6.78
0.0108
0.74
40
S2
3.89
28.00
7.5
5.54
0.0038
0.82
70
S3
3.26
32.00
7.1
4.29
0.0073
0.31
40
S4
5.59
21152.00
6.9
3.16
0.0231
0.31
150
S5
4.57
35397.33
7.5
5.69
0.0038
0.34
<300
S6
3.78
37225.33
4.60
0.0021
0.46
<300
S1
4.60
188.00
7.5
7.28
0.0401
1.72
2670
S2
4.56
205.33
7.5
6.39
0.0821
1.19
24000
S3
5.52
222.67
7.5
5.50
0.0576
1.05
1650
S4
9.65
12078.67
7.2
6.33
0.0471
0.74
930
S5
14.50
34657.33
7.8
5.44
0.1468
3.23
24000
S6
3.85
25268.00
7.5
7.85
0.0725
0.57
2100
Thai Surface
Water Quality
Standard
(PCD, 1994)
5-9
2.0-6.0
1.5-4.0
5.0
Wet Season
1000-4000
quality of water at station 5 might be according to the activities from aquaculture in this
area. This consistent with the annual water quality reports during from the year 2008 to 2010,
which revealed that the water quality tend to decreased gradually. (Region of Environmental
office 13, 2010).
The physical and chemical characteristics of sediment are shown in Table 4. The
concentrations of Pb in sediment in dry and wet
Page 600

July 9-11, 2012
Table 3 Water Quality Index (WQI) of the Chanthaburi River
Stations
Stations
WQI
Criteria
Class
Dry season
WQI
Criteria
Class
Wet season
S1
84
Good
S1
76
Good
S2
81
Good
S2
66
Fairly
S3
78
Good
S3
75
Good
S4
63
Fairly
S4
72
Good
S5
71
Good
S5
53
Bad
S6
67
Fairly
S6
74
Good
Water quality criteria (based on WQI)
71-100
61-70
31-60
0-30
(PCD, 2010).
Good
Fairly
Bad
Very Bad
pH
OM
(%)
Table 4 The physical and chemical characteristics of sediment

CEC
Sand
(%)
Silt
(%)
Clay
(%)
S1
99.3
0.2
0.5
Sand
6.2
0.11
1.25
S2
46.9
31
22
Loam
5.3
1.58
7.75
S3
14.5
61
24
Silt Loam
5.1
4.26
12.87
S4
98.8
0.2
Sand
5.5
0.07
2.75
S5
22.9
53
24
Silt Loam
6.4
5.89
20.75
S6
78.3
11
11
Sandy Loam
7.0
1.78
7.11
S1
97.9
1.1
Sand
7.0
0.13
1.57
S2
27.7
49
24
Loam
5.5
4.50
12.11
S3
64.8
17
19
Sandy Loam
5.4
3.47
10.95
S4
22.4
50
28
Clay Loam
5.5
1.85
7.35
S5
33.3
36
30
Clay Loam
6.7
5.16
17.81
S6
74.3
15
11
Sandy Loam
7.2
1.73
Stations
Texture
(cmol/kg)
Dry Season
Wet Season
Page 601

July 9-11, 2012
Fig. 2 The concentrations of Pb in soil, water and sediment

seasons were in the ranges of 2.20 to 4.24 and 2.46 to 4.34 mg/kg, dw., respectively (Fig 2).
The Pb concentrations increased as increasing clay content. In addition, the increasing levels of
organic compounds, nutrients, phosphate, organic matter and decreasing salinity during the
monsoon period enhanced the formation and deposition of metals in sediment and correspond with
the report of Seralathan et al. (2008). However, there was no significant difference in sediment
between seasons.
Hazard Quotient (HQ) of surface soil, using the screening benchmark base on the Thai Soil
Quality Standards for residential and agriculture established by the Pollution Control Department
)PCD, 2004), showed that the soils in this area are not at risks )HQ = 0.01 (and no hazard exists
)HQ < 0.1( in both seasons. In water, the screening benchmark base on the Thai Surface Water
Quality Standard established by the Pollution Control Department )PCD, 1994) was used to
calculate HQ and the result revealed that there is no hazard (HQ < 0.1) in the upstream.
Nevertheless, the hazard exists in downstream but it is low (HQ = 0.1-1.0). Likewise, Hazard
Quotient of sediment, using the screening benchmark base on the Draft Interim Thai Sediment
Quality Standard established by the Pollution Control Department )PCD, 2009) showed that the
potential environmental risks were almost the same as those for water.
It can be concluded that the environmental compartments in these areas, the Chanthaburi
River and vicinity area, that had been exposed to Pb containing pesticide application for many
years ago are not at risks.
ACKNOWLEDGEMENTS
This research work is supported by scholarship from the Center of Excellence on
Environmental Health and Toxicology (EHT) under Science and Technology Postgraduate
Education and Research Development Office (PERDO) of Ministry of Education.
Page 602

July 9-11, 2012
REFERENCES
APHA. 1998. Standard Methods for the Examination of Water
Edition. APHA Inc. New York.
CDC. Lead Poisoning. 2000 [cited
http://www.cdc.gov/nceh/lead/publications.
2011
May
24];
and Wastewater. Twentieth

Available
from:
URL:
Chapman, H. 1965. Cation exchange capacity, pp. 891-901. In C.A. Black, Evan D.D., Ensminger
L.E., White J.L. and Clark F.E. (Eds.). Method of soil Analysis. American Society of Agronomy.
Madison, Wisconsin.
Lemly, A. 1996. Evaluation of the Hazard Quotient method for risk assessment of selenium.
Journal of Ecotoxicology and Environmental Safety 35: 156-162.
Ministry of Industry Thailand. 2001. Hazardous substances prohibited the production, import,
export or possession (hazardous materials 4). Government Gazette on 2001 Nov 30. Bangkok.
Ministry of Industry Thailand. Industrial in Chanthaburi Province. 2007 [cited 2011 Jul 22];
Available from: URL: http://www.industry.go.th.
PCD. 1994. Thai Surface Water Quality Standard. Polution Control Department. Gazette on 1994
Feb 24. Bangkok.
PCD. 2004. Thai Soil Quality Standards for residential and agriculture. Polution Control
Department. Government Gazette on 2004 Oct 20. Bangkok.
PCD. 2009. Draft Interim Thai Sediment Quality Standard. Polution Control Department. Bangkok.
PCD. Water Quality Index. 2010 [cited 2011 Jul 22];
http://wqm.pcd.go.th/water/index.php/2010-04.../427--5---wqi.
Available
from:
URL:
Region of Environmental office 13. 2010. Report monitoring surface water quality of the East in
Thailand. Ministry of Natural Resources and Environment. Chonburi.
Seralathan, K., Prabhu, D., Kui, J., Kannan, N., Krishnamoorthy, R., Shanthi K. and Jayaprakash
M. 2008. Assessment of heavy metals (Cd, Cr and Pb) in water, sediment and seaweed (Ulva
lactuca) in the Pulicat Lake, South East India. Journal of Chemosphere 71:1233-1240.
Sheldrick, B., and Wang, C. 1993. Particle size distribution, pp. 499-511. In M.R. Carter (Ed.). Soil
Sampling and Methods of Analysis. Canadian Society of Soil Science. Lewis Publishers. Ann Arbor.
USEPA. Method 3050B. Acid digestion of sediments, sludges and soils. 1996 [cited 2011 Mar 5];
Available from: URL:
http://www.epa.gov/wastes/hazard/testmethods/sw846/online/3_series.htm.
Walkley, A. and Black. I. 1934. An Examination of Degtjareff Method for Determining Soil
Organic Matter and a Proposed Modification of the Chromic Acid Titration Method. Journal of
Soil Sci 37:29-37.
Page 603

July 9-11, 2012
Wenzhong, T., Baoqing, S., Hong Z. and Zhanpo, M. 2010. Heavy metal sources and associated
risk in response to agricultural intensification in the estuarine sediments of Chaohu Lake
Valley, East China. Journal of Hazardous Materials 176:945-951.
Page 604

July 9-11, 2012
STP128-36
Photocatalytic oxidation activity of carbon supported

TiO2/HDPE nanocomposite film
Waranya Phompan1, Thammarak Sooksomsong1, Pannawit Amornpanpokin1,
Jittiporn Kruenate1*, Nantavat Tangchantra1, Kanisorn Jai-eau1, Kowit Suwannahong2
1
2
Department of Environmental Engineer, Faculty of Engineer, Kasetsart University, Bangkok,

10900
*E-mail: kowit007@gmail.com
ABSTRACT
There have been various methodologies to enhance the efficacy of the TiO2 as photocatalyst for
dichloromethane treatment. Among those, activated carbon has been recently recognized as high
quality supporter for nano -TiO2 photocatalyst. The preparation of carbon-supported nano TiO2HDPE film (TiO2-Ac/HDPE) was achieved by blown film process. The characterization of
composite films was done by UV-Vis near IR spectrophotometry, Scanning Electron microscopy
(SEM), and BET surface area analysis. The photocatalytic oxidation activity of TiO2-Ac/HDPE
composite film was examined using an annular closed system reactor equipped with a UV C
lamp as energy source. Dichloromethane (DCM) in gas phase was introduced for photo catalytic
oxidation activity tests. The result from the SEM reveals the well define dispersion of carbonsupported nano TiO2 on the composite film surface with 3 and 5%wt. activated carbon while
10%wt activated carbon shows the agglomeration phenomenon on the composite film. The
calculation of energy band gap of TiO2-Ac/HDPE film were 3.18 eV, 3.27 eV and 3.27 eV,
respectively with varying the quantity of activated carbon support at 3, 5 and 10 % (wt.cat/wt.
film). The photocatalytic degradation test show the DCM removal efficiencies of 58%, 47% and
36% with using 3, 5 and 10 % (wt.cat/wt. film) activated carbon support at 350 minutes treatment
period.
Keywords: Photo Catalytic Oxidation, Activated Carbon Support, and Dichloromethane
INTRODUCTION
Chlorinated Volatile Organic Compounds (VOCs) in indoor air environments have received
significant attention mainly due to their toxicity and carcinogenicity (Chen et al., 1998).
Application of traditional method for indoor VOCs treatment seems impractical at low
concentration. For instant, adsorption, which has been the most commonly used method to treat
indoor air contaminants, is practical but ineffective for some types of organic compounds (Jo et
al., 2004). Recently, Photocatalytic Oxidation (PCO) has been gaining attention as a possible
alternative method for indoor air purification because it promises to clean air more efficiently and
effectively (Jacoby et al., 1996). PCO uses UV light to activate the catalyst to generate hydroxyl
Page 605

July 9-11, 2012
radicals (OH*) which then react with organic contaminants. The contaminants are then degraded
or transformed into less harmful substances. The photocatalyst mainly used in the PCO is titanium
dioxide (TiO2) because of its physical and chemical stability, non-toxicity, lowest cost, and
resistance to corrosive. In order to activate Titanium dioxide (TiO2), it is necessary to supply the
light intensity with energy higher than the TiO2 band gap energy (Ebg).
It has been reviewed by number of researchers that different forms of TiO2 such as thin and
thick film coating, powder, membrane, and sol-gel have been utilized to make this photocatalyst
more efficient and more applicable (Hung et al., 2007). Previous studies have indicated that the
method of photocatalyst production and its physical form are among the most determining
parameters influencing the overall photocatalytic efficiency. Recently, TiO2 film prepared via solgel processing (Ao et al.,2008) and the degradation of organic compounds under uv light by TiO2
fixed on foam polyethylene sheet have been reported (Chen et al.;1999). In this study, the nanoTiO2 incorporating High density polyethylene plastic film (TiO2/HDPE) has been newly
introduced as photocatalyst material. The nano-TiO2 composite HDPE film was economic and
efficient technique for indoor air treatment application.
A methodology to increase the photocatalytic activity of the semiconductor consists in adding a
co-adsorbent, as activated carbon (Ac). Ac powder has been proposed as catalyst support due to its
high adsorption ability related to its high specific surface area. Binary materials constituted by
TiO2 and Ac have already been proposed as photocatalysts in solidsolid regime to photooxidize
organic
gas
pollutants
such
as
Chloromethane,dichloromethane,
Formaldehyde
andTrichloromethane.
A remarkable increase in the activity of TiO2 has been attributed not only to the high surface
area of the composite photocatalyst but also to the low-strength of adsorption that allows the
diffusion of the pollutants from the adsorbent, Ac, to theTiO2 phase. Juan et al., (2010) suggest
that there is no significant change in the band-gap energy of TiO2 as a consequence of the
interaction AcTiO2. In fact the enhanced photocatalytic activity of the binary AcTiO2 materials
in solidsolid or liquidsolid systems has been attributed to the interaction between Ac and TiO2
bonds.
The removal efficiency of dichloromethane (DCM) in gas phase using TiO2-Ac/HDPE polymer
as photocatalyst material was investigated in this work. In addition, the characterizations of the
TiO2-Ac/HDPE films were identified by the UV VIS near-IR spectrophoto meter and the Scanning
electron microscope (SEM) to obtain more information about the efficiency of homogenized and
well mixed nano-TiO2 supported on Activated carbon in the HDPE polymer on photocatalytic
activities of TiO2-Ac/HDPE composite film.
In this paper, Dichloromethane was used as the representative species of VOCs and titanium
dioxide (TiO2) supported with the activated carbon (AC), in corresponding to an increase in the
photocatalytic activity of the semiconductor, were used in Photocatalytic Oxidation (PCO)
process.
Materials
Titanium dioxide (TiO2) with anatase structure form was purchased from the willson Company.
Activated carbon was purchased from fluka. The commercial grade of HDPE (Innoplus 6000F)
used in this study was supplied by the PTT Co, Ltd.
Photocatalyst TiO2-Ac/HDPE composite film Preparation
The TiO2 powder were mixed with activated carbon by varying activated carbon (Ac) contents,
e.g. 3, 5, and 10 %wt. Then incorporated in HDPE resin using twin screw extruder. The TiO2Ac/HDPE composite films with the thickness of 50 micrometers were obtained from the blown
film extrusion technique using the operation temperature in a range of 150-180C
All photocatalyst composite films with various amount of Ac contents are shown in Table 1.
Page 606

July 9-11, 2012
Table 1. The quantity of substances filled in the HDPE/nano-TiO2-Ac composite films at various
amount of Activated carbon contents.
Thickness of TiO2Activated carbon contents
Sample
TiO2 contents (%wt)
Ac/HDPE composite film
(%wt)
(um)
1
10
50
10
50
10
10
50
Materials Characterization
Morphology
The microstructure of the TiO2-Ac/HDPE composite film was examined using the Scanning
Electron Microscope (SEM, Model Hitachi S-3400N and EDAX). In order to prevent the charge
build-up during SEM observation, samples were coated with gold which was used for ion sputter
target. The sputter rate and time were set for 10 nm min-1 and 3 min, respectively. The gold film
thickness was approximately 30 nm (Jiang et al., 2009).
Optical property
Ultraviolet-visible spectra of the photocatalysts were recorded using the UV-VIS
spectrophotometer (Lamda 35, Perkin Elmer instrument) equipped with an integrating sphere. The
scan ranged from 200 to 800 nm. All spectra were monitored in the absorbance mode and acquired
under ambient conditions. The band gap energy of TiO2-Ac/HDPE film can be calculated from
absorbance results (Jiang et al.,2009). The optical absorbance spectra, the adsorption coefficient
and the band gap of TiO2-Ac/HDPE composite film were evaluated. Briefly, the absorption
coefficient was calculated using the following correlation, = ln (1/d)/t, where t is the
transmittance and d is the thickness of the film.
The thickness of the film was also evaluated from the UV spectrum and the average value
corresponding to 360 nm. The band-gap energy was obtained by plotting the optical absorption
(h)2 and the photon energy (h). Then the extrapolation of the linear portion of the curve must be
performed to receive the band gap energy.
BET-surface analysis
Pore size distribution for TiO2-Ac samples was determined at 77 K using an Autosorb-1 surface
area analyzer (Quantachrome, Science Engineering). The samples were dried at 100oC for 8 h prior
to the measurement.
technique. XRD patterns were obtained on the X-Ray Diffraction (TTRAXIII,Rigaku) using Cu
K and radiation (=1.5404 ). The current and voltage applied were 300 mA and 50 KV,
respectively. The scan ranges from 20 to 60 with a scan rate of 5 min-1 (Shifu et al., 2009).
The photocatalytic oxidation reactor used in this study was an annular closed-system. The
reactor is composed of an UVC lamp with 254 nanometer wavelength. The UV light intensity was
recorded using a digital radiometer equipped with a UV-C sensor. The TiO2-Ac/HDPE composite
Page 607

July 9-11, 2012
film was inserted inside the chamber. The humidity and temperature were monitored continuously
using the thermo-hygrometer (DT-2 Kingtill). The reactor was connected with the air compressor
pump which can be adjusted air flow rate from 0 to 5 L min-1. The gas sample was pumped
through the annular region. The reactor was designed to direct flow of incoming air toward the
TiO2-Ac/HDPE composite film thereby, enhancing the distribution of the air pollutant onto the
catalytic surface of the film.
The photocatalytic degradation of DCM of TiO2-Ac/HDPE composite film were conducted in
the continuous flow reactor at operating conditions as shown in Table 2. The gas sample applied
for all experiments was collected from a compressed air tube. After the DCM initial concentration
was at steady state, the UV lamp was turned on. This step is necessary in order for the DCM to
reach the adsorption equilibrium.
The quantitative analysis of pollutant was made with the Gas Chromatograph (GC) equipped
with a Flam Ionization Detector (model 5890, Hewlett Packard). The gas sample with the volume
of 1 ml was collected from the reactor using a gas syringe and was then injected into the GC-FID
with a capillary column CP sil 8. The injector temperature was set to 250oC and the initial column
temperature was set at about 50oC and was increased to 110oC at a rate of 40oC /min (Hung et
al.,2007).
Table. 2 Operating conditions for DCM photocatalytic degradation.
Parameter
Representative value
RH, %
45-55%
Temperature, C
26-42
Flow rate , L min-1
Reactor residence time, s
30
Initial Contaminant
concentration DCM, ppm
25 (5)
UV light source
9-W ,UV light
UV light intensity, m W
cm-2
Dosages of catalyst film,

3-10
(%wt.cat/wt. film)
Reaction time, min
350
Page 608

July 9-11, 2012
(a)
(b)
(c)
(d)
Fig. 1 SEM micrographs of PE TiO2-Ac/HDPE (a) with 3%wt Ac (b), 5%wt Ac (c), and 10%wt Ac (d).
RESULTS
Morphology
SEM micrographs (Fig.1) show surface morphology of TiO2-Ac/HDPE composite film. The
dispersion of nano-TiO2-Ac in HDPE matrix reveals uniformed dispersion of carbon-supported
nano-TiO2 on the film surface with using 3%wt. activated carbon. Even the efficiency of
dispersability of carbon-supported nano-TiO2 on the films was reduced with activated carbon
contents, the photo catalytic efficiency of the composite film still improved. For the reason that
nano-TiO2 supported on activated carbon showed the advantage of increasing the active site on
nano-TiO2 surface.
Pore size distribution
Fig. 2 shows pore size distributions of Ac and TiO2-Ac with varying the amount of Ac content.
It can be clearly seen that the presence of TiO2 in pores caused the reduction in peak areas.
Noticeably, the characteristics of activated carbon, i.e. mesopore (20-500 Ao) and macropore (5001000 Ao) are occurred in activated carbon particles.
Page 609

July 9-11, 2012
Fig. 2 Pore size distribution for TiO2/Ac with varying the amount of Ac content.
For the entire pore diameter range, the pore size distribution, in Fig.2, for nano-TiO2 supported
with activated carbon lies beneath that of pure Activated carbon. A decrease in the amount of Ac
contents with constant amount of TiO2 may decrease the volume of pore which confirming the
presence of TiO2 in pore. With no TiO2 content, the pore volume show the highest pore volume
and decrease with lowering amount of Ac.
As a consequence, the BET surface area of activated carbon supported nano-TiO2 (Table 3)
increased with increasing Ac content, high active area of Ac can be supported TiO2 particles.
Table 3. Specific surface area Activated carbon before and after loading by nano-TiO2.
Sample
TiO2
contents
(%wt)
Activated
carbon
contents
(%wt)
BET surface
area
(m2/g)
10
48.41
10
51.65
10
10
53.67
100
79.43
X-ray diffraction patterns of the nano-TiO2/HDPE composite films

Figure 3 displays the XRD pattern of TiO2 particle, which appear peak 2 at 25.36, 36.9, 37.86,
38.62, 48.08, 53.94 and 55.12, which matched with plane as (101), (103), (004), (112), (200),
(105), and (211), respectively. These XRD data corresponds to the anatase phase of TiO2 (JCPDS
65-5714). Typical diffraction peaks representing rutile or brookite are not presented in the pattern.
Page 610

July 9-11, 2012
Fig.3 X-ray diffraction patterns of Nano-TiO2 powder.

UV-Vis absorbance spectra of TiO2-Ac/HDPE composite film
The results from the UV Vis near-IR spectrophotometry indicated that the TiO2-Ac/HDPE
composite film absorbed appreciably at wavelength less than 360 nm (Fig.4)
Fig. 4 UV-Vis absorbance spectra of HDPE/ nano-TiO2-Ac composite films.

The optical band gap energy (Eg) of the TiO2-Ac/HDPE composite film at each dosage of Ac is
reported in Table 4. The result showed that the band-gap energy of nano-TiO2 is not significant
change with 3% activated carbon content and increased with 5 and 10% activated carbon contents
as a consequence of the interaction between the nano-TiO2 and the Activated carbon.
Even though, the energy band gap of 5 and 10% Ac content was higher than 3%Ac, the
efficiency of DCM removal was lowest. It can be explain by the agglomeration of Ac and TiO2
itself hindered the active site of TiO2 catalyst. Therefore, lowering the DCM removal efficiency.
Page 611

July 9-11, 2012
Table 4. The effect of various amount of TiO2-Ac contents filled HDPE film on the energy band
gaps.
TiO2
contents
Activated
carbon
Energy
band gaps
(%wt)
contents
(%wt)
(Eg eV)
10
No adding
3.18
10
3.18
10
3.27
10
10
3.27
Sample
Photocatalytic Activity
Photocatalytic activity of the TiO2-Ac/HDPE composite film for removal of DCM in dry air
was investigated. For all experiments, the initial concentration of dichloromethane, the air flow
rate and the UV light intensity were set at 25 ppm, 2 L min-1 and 4 mW/cm2, respectively. At the
duration of
treatment time of 350 minute showed constant decrease in decomposition
As seen in Fig. 5, the TiO2-Ac/HDPE composite film with the activated carbon of 3, 5, and 10
% (wt cat./wt film) showed an increase in the removal efficiency corresponding to variation of
content of the Activated carbon. The TiO2-Ac/HDPE composite film with 3%wt activated carbon
showed the highest removal efficiency (58% removal efficiency), followed by 5%wt. (47%
removal efficiency) and 10%wt. activated carbon (36% removal efficiency), respectively.
Fig. 5 Photocatalytic Oxidation of dichloromethane at different dosages of TiO2-Ac.
Page 612

July 9-11, 2012
DISCUSSION
In conclusion, the activated carbon supported the nano-TiO2 enable to improve the photo
catalytic oxidation by providing higher specific surface and effective site which can be contacted
directly to UV light and caused the completed effect of photo catalytic oxidation reaction.
However, the concentration of activated carbon can improve the ability of nano-TiO2 toward the
photo catalytic oxidation efficiency and were found only in a specific range.
ACKNOWLEDGEMENTS
I would like to express my gratitude to the Faculty of Science & Technology, Suan
Sunandha Rajabhat Univesity,1 U-Thong Nok Road,Wachira ,Dusit, Bangkok.
The special thank is extend to the National Metal and Materials Technology Centre for
their financial support and for providing me with an opportunity to carry out this project.
Page 613

July 9-11, 2012
REFERENCES
Ao, Y., Xu, J., Fu, D., Shen, X., and Yuan, C. 2008. Low temperature preparation of anatase
TiO2-coated activated carbon. Colloids and Surfaces A: Physicochemical and Engineering
Aspects, 312: 125130.
Chen, J., Ollis, D., Rulkens, W., and Bruing, H. 1999. Kinetic processes of photocatalytic
mineralization of alcohol on metalized Titanium dioxide. Water Research, 33: 1173-1180.
Chen, P.H. and Jenq,C.H. 1998. Kinetics of photocatalytic oxidation of trace organic compounds
over Titanium Dioxide. Environment International 24: 871-879.
Hung, W., Fu, S., Tseng, J., Chu, H., and Ko, T. 2007. Study on photocatalytic degradation of gas
dichloromethane using pure and iron ion-doped TiO2 prepared by the sol-gel method.
Chemosphere, 66: 2142-2151.
Jacoby, W. A., Blake, D. M., Fennell, J. A., Boulter, J. E., Vargo, L. M., George, M. C. and
Dolberg S.K. 1996. Heterogeneous photocatalysis for control of volatile organic compounds in
indoor air. Journal of Air and Waste Management Association, 46: 891-898.
Jiang, F., Zhen, Z., Xu, Z., and Zgeng, S. 2009. Preparation and characterization of SiO2-pillared
H2Ti4O9 and its photocatalytic activity for methylene blue degradation. Journal of Hazardous
Material, 164: 1250-1256.
Jo, W.K. and Park, K.H. 2004. Heterogeous photocatalysis of aromatic and chlorinated volatile
organic compounds (VOCs) for non-occupational indoor air application. Chemosphere, 57:
555-565.
Matos, J., Lopez, E.G., Palmisano, L., Garca, A., Marc, G. 2010. Influence of activated carbon
in TiO2 and ZnO mediated photo-assisted degradation of 2-propanolingassolidregime
degradation of 2-propanol in gassolid regime. Applied Catalysis B : Environmental, 99: 1-11.
Shifu, C., Wei, Z., Sujuan, Z., and Wei, L. 2009. Preparation, characterization and photocatalytic
activity of N-containing ZnO power. Chemical Engineering journal, 148: 263-269.
Page 614

July 9-11, 2012
STP136-38
Paraquat Contaminations in the Chanthaburi River

and Vicinity Area
Kankanit Suppaudom, Duangta Kitkaew, Poranee Pataranawat*
Department of Sanitary Engineering, Faculty of Public Health, Mahidol University, Bangkok
10400
Email: pat_poranee@yahoo.com
ABSTRACT
This research was conducted to investigate the paraquat contaminations in surface soil and
water in the Chanthaburi River and vicinity area along the river. The samples were collected to
estimate paraquat contaminated concentrations and also potential environmental risks by Hazard
Quotient Equation (HQ). The results revealed that the distribution of paraquat in both dry and wet
season in surface soils of the orchard located on the river bank were in the ranges of 3.33 - 8.28
and 1.30 - 9.15 mg/kg, dry weight (dw.), respectively and the potential environmental risks of
surface soil in both seasons are not at risks (HQ < 0.1) with low hazard (HQ 0.1- 1.0). The
paraquat concentrations in the Chanthaburi River from upstream down to estuaries in dry and wet
season were ranged from 0.13 - 7.13 and 0.07 - 13.05 g/l, respectively and did not exceed the
standard for water criteria and protection of freshwater aquatic life established in Canada (16
g/L). Likewise, the potential environmental risks of water in both seasons are not at risks (HQ <
0.1). It can be concluded that, at present, this area are not at risks with low hazard in spite of
herbicide applications have been performed for many decades. Regards to the water quality index
(WQI) calculated from 8 parameters of dissolved oxygen (DO), fecal coliform bacteria (FCB),
pH, biological oxygen demand (BOD), total phosphate (TP), nitrate (NO3), turbidity and total
solid (TS), the water quality in most study areas is clarified to be good (WQI = 71 -100).
Keywords: paraquat, environmental risks, Hazard Quotient (HQ), Water Quality Index,
Chanthaburi River
INTRODUCTION
Paraquat is one of the most widely used herbicides. It was first synthesized commercially in
1961 and in 1962 paraquat was used in agriculture for the first time. Products of paraquat was
produced are sold both in liquid and granular form. Gramoxone, manufactured by Syngenta, is the
most common trade name for paraquat (Watts, M., 2001). Paraquat is a non-selective contact
herbicide. It is a chemical use to prevent and eliminate moisture absorption weed and classified to
be a chemical group of bipyridyl compounds. (IPCS, 1984).
The report of the import of hazardous chemicals in agricultural in 2011 (January - March)
illustrated that there were up to 36,434 ton of paraquat and expected to rise up every year. In
Thailand, the trend of agrochemical usages increases after organochlorine pesticides (OCPs) such
as DDT, aldrin, dieldrin and endrin were banned in 1980-2004 (Keithmaleesatti, S et al., 2007).
Page 615

July 9-11, 2012
According to Chanthaburi Province land use report, farmers have turned to use paraquat instead
and make it become one of the most favorite herbicide. The US EPA has classified paraquat as a
possible human carcinogen. It is very toxic to aquatic organisms and may cause long-term adverse
effects on human and ecological health which leads to serious environmental problems. Paraquat
has been used to eliminate weed in this area for many decades. Therefore, it is likely to distribute
and accumulate in environment widely, in air, water, soil, plants and animals. WHO (2010)
classifies paraquat as class II (moderately toxic). The exposure of paraquat in farmers and
agricultural workers are at risk both acute and chronic toxic effects on their health. Chronic
exposure can affect lung, nerve system or brain, skin and reproduction with possible birth defects
(PAN, 1996).
Chanthaburi Province is located in the East of Thailand. Land use in this province is mainly for
agriculture (fruit orchard 70.46%) (Provincial Agriculture Extension Office Chanthaburi,
2009). The Chanthaburi River, one of the main rivers in the East, is used for agriculture and other
activities. It is around 120 km long (Jayakody, 2007 and Leadprathom, 2009) and located parallel
with the fruit orchard. The usage of paraquat herbicides may affect farmlands and contaminate in
environment. Paraquat may be residues in soil, releases into the river and accumulates in sediment
of the river by leaching of runoff in rainy season and finally affect aquatic system of estuary.
The Water Quality Index (WQI) is an assessment of general water quality calculated from the
various measured parameters of water quality. The values of WQI can be indicated for the level of
water quality of water body.
Assessment of potential environmental risks can be estimated numerically using the Hazard
Quotient (HQ) approach (US EPA, 2006). The HQ is a ratio, which can be used to estimate if risk
to harmful effect is likely or not due to the contamination in area.
Sample Preparation
The sampling was conducted in the study area in dry season (11-13 March 2011) and wet
season (7-9 May 2011, early wet season in this area and also the harvesting period with the
application of large amount of pesticides in orchards). Water samples were collected using
Kemmerer sampler at the mid depth of mid stream for water quality and paraquat concentration
analyses. Those for fecal coliform bacteria (FCB) analysis were collected at the depth of 30 cm.
Surface soil samples were collected using a spade at the depth of 0-15 cm in the orchard located
along the Chanthaburi River. Three grabs samples of surface soil were collected in each sampling
location. Each composite soil samples was collected for 1 kg and kept in plastic bag and then
transported to the laboratory. Soil samples were air-dried, under shade, crushed and sieved to
remove the particles greater than 2 mm, as more than 90% of contaminates are present in soil, the
particles that smaller than 2 mm (Dennis and Zupko, 1995). Those samples were kept in plastic
bags for paraquat analysis.
Page 616

July 9-11, 2012
The quality control of laboratory
The accuracy of analytical process was calibrated using 3 replicated of standard reference
material for Residue Analysis (Paraquat dichloride) obtained from Dr.Ehrenstorfer GmbH,
Germany (www. http:// www. analytical-standards.com).
Sample Analysi
The physical and chemical characteristics of water were measured both in the field and in the
laboratory (APHA, 1998). Determination of water quality index (WQI) consists of eight
parameters as follows: DO, BOD, FCB, pH, TP, NO3, turbidity and TS. The WQI can be
calculated using equation obtained from the National Sanitation Foundation as the followings:
WQI
i =1
w iq i
(1)
n=Numberofparameters
wi=Unitweightofparameter
The physical and chemical analyses of surface soil were measured in laboratory as
followings: pH, organic matter (Walkey and Black, 1984), texture (Sheldrick and Wang, 1993)
and cation exchange capacity (Chapman, 1965). Paraquat contamination of surface soil and water
sample were investigated using method of spectrophotometer (Tatong, K. 2010).
Actual or potential threat of adverse effects on living organisms and environment (HQ) is
caused by effluents, emissions, wastes, resource depletion, etc., arising out of organization's
activities. The HQ can be obtained by calculation using the following equation:
locationsbyGPSposition
No.
surfacesoil
(SS)
watercolumn
(S)
N12o41.498
N12o41.482
E102o10.382
E102o10.400
N12o40.081
N12o40.247
E102o10.006
E102o09.951
N12o38.401
N12o38.381
E 102o08 385
E 102o08 394
Fig.1 Sampling locations for surface soil (SS ) and water column (S ) in the Chanthaburi River
and vicinity area (modified from Region of Environmental office 13, 2010).
Page 617

July 9-11, 2012
HQ =
EEC
Screening Benchmark
(2)
EEC = estimated (maximum) environmental contaminant concentration in the soil or water at area.
(e.g. mg contaminant/kg soil)
Screening Benchmark = maximum allowable of
paraquat concentration; if the contamination concentration is below this level, the contaminant is
not likely to cause harmful effects.
If HQ < 0.1
no hazard exists.
If HQ 0.1- 1.0
hazard is low.
If HQ 1.1 - 10
hazard is moderate.
If HQ >10
hazard is high.
(Lemly, 1996).
All data were processed and adjusted to obtain the 95% of confidence interval (P < 0.05) using
SPSS statistical program for window (version 18.0).
RESULTS, DISSCUSSION AND CONCLUSIONS
Physical and chemical characteristics of surface soil are shown in Table 1. The concentrations
of paraquat in surface soil were in the ranges of 3.33 to 8.28 and 1.30 to 9.15 mg/Kg dw.,
respectively (Fig. 2). The highest concentration of paraquat was found at station 1 in both seasons.
However, there was no significant different between paraquat concentrations in each season.
Hazard Quotient (HQ) of surface soil, using the screening benchmark base on the lethal
ingestion dose of paraquat in human (Nation Library of Medicine, 1992), showed that the potential
environmental risks in dry season are not at risks with low hazard. (HQ < 0.1).
In water, Hazard Quotient assessment using screening benchmark base on the water criteria and
protection of freshwater aquatic life (established by Canada) showed that the potential
environmental risks in both seasons are not at risks (no hazard exists, HQ < 0.1) with low hazard
(HQ 0.1-1.0).
With respect of WQI, most of water qualities in the Chanthaburi River are classified to be good
(WQI = 71 -100) as shown in Table 3. However, there were some parameters that exceeded the
quality standard (PCD, 1992), such as BOD in station 4 and station 6 (dry season) and FCB in
station 2 and station 5 (wet season).
The low quality of water at station 5 in wet season might be due to the activities from
aquaculture as well as runoff.
Page 618

July 9-11, 2012
Table 1 Physical and chemical characteristics of surface soil of the Chanthaburi River
seasons
stations
sand
(%)
silt
clay
(%)
(%)
texture
pH
OM*
CEC*
(%)
(cmol/Kg)
dryseason
SS1
22.5
52.4
25.2
siltloam
5.47
4.68
13.72
SS2
26.2
49.6
24.2
loam
5.50
3.82
12.24
SS3
41.1
40.4
18.5
loam
5.00
2.72
8.41
SS4
28.5
45.1
26.4
loam
4.60
3.7
12.38
wetseason
SS1
24.7
49.0
26.3
loam
4.93
3.38
12.30
SS2
26.1
48.6
25.3
loam
5.27
3.32
11.75
SS3
44.3
36.5
19.2
loam
4.63
2.66
8.67
SS4
41.1
38.5
20.4
loam
5.30
4.45
9.35
*OM=OrganicmatterCEC=CationExchangeCapacity
Fig.2 Paraquat contaminations in the Chanthaburi River and surface soil in vicinity area
Page 619

July 9-11, 2012
The paraquat contaminations in soil were less than those in water because contaminated
paraquat in soil resulting from pesticide application in the orchard could be leached out by runoff.
Most of soils in this area are loam. With respect of properties of loam that cation exchange
capacity (CEC) is less than clay (Osotspa et al., 1998), adsorption of paraquat in this kind of soil is
poor, particularly in wet season with high runoff. Also, paraquat in soil can be degraded by a
process of photo oxidation (HSBD, 2000) resulting in its short half life (1.5 days to 23 weeks).
Consequently, paraquat contamination in water in this study area was found to be higher. Also, it
might be due to the large amount of paraquat that applied prior to sample collection in early wet
season before fruit harvesting. However, paraquat
Table 2 Physical and chemical characteristics of water of the Chanthaburi River

stations
turbidity
(NTU)
pH
DO*a
BOD*a
TP*
NO3 *
TS*
a
FCB*
(mg/l)
(mg/l)
(mgP/l)
(mgNO3 /l)
(mg/l)
(MPN/100ml)
dryseason
S1
2.56
8.0
6.78
0.0108
0.74
36.00
40
S2
3.89
7.5
5.54
0.0038
0.82
28.00
70
S3
3.26
7.1
4.29
0.0073
0.31
32.00
40
S4
5.59
6.9
3.16
0.0231
0.31
21152.00
150
S5
4.57
7.5
5.69
0.0038
0.34
35397.33
<300
S6
3.78
8.0
4.60
0.0021
0.46
37225.33
<300
Wetseason
S1
4.60
7.5
7.28
0.0401
1.72
188.00
2670
S2
4.56
7.5
6.39
0.0821
1.19
205.33
24000
S3
5.52
7.5
5.50
0.0576
1.05
222.67
1650
S4
9.65
7.2
6.33
0.0471
0.74
12078.67
930
S5
14.50
7.8
5.44
0.1468
3.23
34657.33
24000
S6
3.85
7.5
7.85
0.0725
0.57
25268.00
2100
1,0004,000
Standardswaterqualityofsurfacewater
59
26
14
*DO=DissolveOxygenBOD=BiologicalOxygenDemandTP=TotalPhosphateNO3 =Nitrate
Page 620

July 9-11, 2012
Table 3 Water Quality Index (WQI) of the Chanthaburi River
water quality
cl
criteria
ass*
1
dry season
stat
ions
QI
very good
W
QI
S1
water quality
criteria
good
S2
1-100
3
fairly good
bad
very bad
0-
S4
good
fairly good
30
good
fairly good
good
good
bad
good
2
7
good
1
S6
5
6
S5
criteria
1-60
5
good
1-70
QI
water quality
6
8
S3
good
4
2
wet season
3
6
fairly good
4
* Type of surface water )PCD, 1992(

class1 Water resources, no waste water from all activities.
class2 Water resources for consumption by must sterile, aquatic animals conservation, aquaculture, swimming and
water sports.
contamination in soil and water did not exceed the quality standard. Thus, the human health of
local people might be not posed to the risks (water criteria and protection of freshwater aquatic life
by Canada suggested at concentration of 16 g / L and the lethal ingestion dose of paraquat in
human is 35 mg / Kg (HSBD, 1992)). Even though the risks are very low and even no
environmental risks occur in this area, the paraquat application should be done carefully and
correctly for the safe ecology and also the next generation.
ACKNOWLEDGEMENTS
This research work is supported by scholarship from the Center of Excellence on
Environmental Health and Toxicology (EHT) under Science and Technology Postgraduate
Education and Research Development Office (PERDO) of Ministry of Education.
Page 621

July 9-11, 2012
REFERENCES
American Public Health Association (APHA). 1998. Standard methods for the
examination of water and wastewater. Twentieth Edition. APHA Inc., New York.
Chapman, H. 1965. Cation
Exchange
Capacity. In Black C.A., Even D.D., Ensminger
L.E., White J.L., Clark F.E. and Dinauer R.C. (Eds). Method of soil analysis. Part 2 Chemical and
Microbiological Properties.
Colinvaux,P.A. 1973. Introduction to Ecology. John Wiley & Sons, Inc. NewYork.
Dennis, D.M.D., and Zupko, A.J. 1995. Soil- Washinh Process for Site Remediation, pp.
745 777. In D.L. Wise & D.J. Trantolo (Eds.). Remediation of Hazardous Waste Contaminated
Solid, Marcell Dekker, Inc. New York.
Hazardous Substances Databank (HSDB). Paraquat. National Library of Medicine. [serial
online] 1992. [cited 2011, Jan 15]; Available: URL: http://pmep.cce.cornell.edu/profiles/
extoxnet/metiram-propoxur/paraquat-ext.html.
Hazardous Substances Databank (HSDB). Paraquat. National Library of Medicine,
Bethesda, MD. [serial online] 2000 [cited 2011, Jan 11]; Available from: URL:
http://www.panap.net/uploads/media/paraquat_
monograph_PAN_AP.pdf.
International Programmed on Chemical Safety (IPCS). Paraquat and diquat.
Environmental Health Criteria 39, [serial online] 2010 [cited 2010, March 17]; Available from:
URL: http://www. inchem. org/ documents/
ehc/ ehc/ ehc39.htm.
Jayakody, A.S. 2007. Assessment of dredging influenced sediment toxicity of
endosulfan toxicity and lindane on Black tiger shrimp (Penaeus monodon) in Chanthaburi river
estuary in Thailand. M.Sc. thesis. University of Asian Institute of Technology, Bangkok, Thailand.
Keithmaleesatti, S., Thirakhupt, K. Pradatsudarasar, A. Varanusupakul, P. Kitana, N and
Robson, M. 2007. Concentration of organochlorine in egg yolk and reproductive success of
Egretta garzetta (Linnaeus, 1758) at Wat Tan-en Non-hunting Area, Phra Nakhorn Si Ayuthaya
Province, Thailand. Journal of Ecotox Environ Safe 68: 79-83.
Lemly, A. D. 1996. Selenium in Aquatic
wildlife: Interpreting Tissue Concentration
Norwood, pp.427-446.eds., SETAC Series, Lewin Press, Boca Roton F.L.
PAN. Paraquat. [serial online] 1996 [cited 2010, March 17]; Available from: URL:
http: // www. panuk.org / pestnews / Actives/
paraquat.htm.
Pollution Control Department (PCD). [serial online] 2010 [cited 2011, Jan 11];
Available from: URL: wqn.pcd.go.th/water/
index.php/2010-04//427--5---wqi.
Provincial Agriculture Extension Office Chanthaburi. Land use for agriculture
[serial Online] 2009 [cited 2010 May 20]. Available from: URL: http://www.chanthaburi.
doae.go.th/data1/database_ chan.htm.
Osotspa, Y., Panitsakpatana,S., Wongmanee - rote, A. and Tongju, C. 1998. Soil Colloid, pp. 182 185. Basic Agronomy, Kasetsart University Press, Bangkok.
Sheldrick, B.H. and Wang, C. 1993. Particle size distribution- Soil Sampling and Methods
of Analysis. pp. 449-511.In M.R. Carter (Ed.). Canadian Society of Soil Science. Boca Raton:
Lewis Press, Canada.
Tatong, K. 2010. Ecokinetics of herbicides from Farmland and to the river: A case study
of Chathabuti estuary in Thailand. M.Sc. thesis. University of Asian Institute of Technology,
Bangkok, Thailand.
United States Environmental Protection Agency (US EPA). 2006. Ecological Risk
Assessment Guigance for Superfund Step 2: Screening level Exposure Estimate and Risk
Calulation. USA: States Environmental Protection Agency.
Page 622

July 9-11, 2012
Walkley, A. and Black, C.A. 1984. Chromic acid titration method of determination of soil
organic matter. Journal of Soil Science, 63, 257.
Watts, M. (2001). Pesticide Action Network Asia & the Pacific: PANAP. Paraquat. [serial
online] 2010 [cited 2010, May 17]; Available from: URL: http://www.pananz.net/resources/
Div_Load_Files/ Documents/ Paraquat/ Para quat% 20 monograph% 20final% 202011.pdf.
World Health Organisation (WHO). The WHO Recommended Classification of Pesticides
by Hazard and Guidelines to Classification 2009. Geneva. [serial online] 2010 [cited 2011, Aug
15]; Available from: URL: http://www.fijitimes.com.fj/story
.aspx?id=141776.
Page 623

July 9-11, 2012
STP144-40
Effect of activators solution on frozen sperm quality of striped

catfish, Pangasianodon hypophthalmus
Samorn Ponchunchoovong,a* Augkana Jaikuda, Tunyaluk Ratsuwana, Sunai Plimeb

a
School of Animal Production Technology, Institute of Agricultural Technology
Suranaree University of Technology, Nakhon Ratchasima 30000, Thailand
b
University farm, Suranaree University of Technology, Nakhon Ratchasima 30000, Thailand
a*
Corresponding author, E-mail: samorn@sut.ac.th (Samorn Ponchunchoovong)
ABSTRACT
Artificial insemination with frozen semen has the potential for various applications in
aquaculture, such as the increase of population size, the maintenance of genetic diversity,
hybridization between species and overcoming problems caused by the non-synchronized
spawning of eggs and spermatozoa in some fish species. In most fresh water teleost fish, the sperm
is immotile in the male genital tract and in the semen and is activated after release into fresh water.
The initiation of motility is triggered by changes in physical or chemical factors such as a decrease
or increase in osmolatity for freshwater and marine spawners, respectively. Six activators solution
(1% NaHCO3, 0.3% NaCl+0.4% Urea, 50 mM KCl+1 mM MgSO4, 17 mM NaCl+5 mM TrisHCl, 45 mM NaCl+5 mM KCl+Tris-HCl 30 mM and Tap water) were used to examine the
feasibility of activator media on frozen semen of striped catfish, P. hypophthalmus. The highest
percentage of motility (52.071.27%) and fertilization (55.371.39%) was resulting from 17 mM
NaCl+5 mM Tris-HCl, which has a lower osmotic pressure (37 mOsm kg-1) than that of sperm of
striped catfish (256 mOsm kg-1). The frozen sperm motility of striped catfish was mainly initiated
by a decrease in osmotic pressure rather than pH. It found that 17 mM NaCl+5 mM Tris-HCl
resulted in a longer time period (162 s) of sperm motility compared to the other activators media.
Six activated solutions did not affect the velocity parameters.
Keywords: Striped catfish spermatozoa, Cryopreservation, Activator solution, Motility,
Fertilization
INTRODUCTION
Artificial insemination with frozen semen has the potential for various applications in
aquaculture, such as the increase of population size, the maintenance of genetic diversity,
hybridization between species and overcoming problems caused by the non- synchronized
spawning of eggs and spermatozoa in some fish species (Rana, 1995; Ritar, 1999). Spermatozoa of
fish are generally immotile in the testis and in the seminal plasma, but exhibit a burst of motility
immediately following ejaculation into the surrounding water at spawning. Sperm motility is an
important criterion for sperm quality, and is usually expressed as percentage and duration of motile
sperm after activation. The initiation of motility is triggered by changes in physical or chemical
factors such as a decrease or increase in osmolality for freshwater and marine spawners. Water has
been used as fertilization medium in common carp, Cyprinus carpio (Linhart et al., 2000 and
Magyary et al., 1996) although it is not the optimal medium for activation of sperm motility. Cell
Page 624

July 9-11, 2012
lesions originating during freezing and thawing may be better compensated in saline solution.
Lahnsteiner et al. (2003) reported that the type of activators solution (fertilization media)
influenced the sperm motility of bleak, Chalcalburnus chalcalburnus and found that water was the
worst activation medium as the motility rate and motility duration. The suitability of activated
solution for cryopreservation of Pangasiid semen has not been tested. The objective of this study
was to identify the best activators solution of frozen semen of striped catfish, P. hypophthalmus.
Experimental broodfish and gamete collection
Mature striped catfish, P. hypophthalmus (20 males and 10 females) were held in an earthen
pond at the university farm (Suranaree University of Technology) Nakhon Ratchasima, Thailand.
They were fed once a day with 35% protein commercial catfish pellets at 1% body weight.
Selection of mature males and females for breeding was based on well-developed secondary
sexual characteristics (spermeating males, well-developed papilla and swollen-soft belly of
females). Broodfish were not fed for 12-24 h prior to sperm and egg collection. Luteinizing
hormone releasing hormone analogue (LHRHa; Suprefact, Hoechst AG, Main, Germany) and
domperidone (Motilium, Olic, Bangkok, Thailand) were used to induce spermiation and ovulation.
Males were injected with 30 g kg-1 body weight of LHRHa and 5 mg kg-1 body weight of
domperidone. Sperm was collected 6-8 h after injection using plastic syringes to avoid
contamination. Only sperm samples with motility higher than 75% were used in the experiment.
Two injections of LHRHa and domperidone were administered to induce ovulation. The initial
dose (10 g kg-1 of LHRHa and 5 mg kg-1 of domperidone was administered intramuscularly. The
second dose (30 g kg-1 of LHRHa and 5 mg kg-1 of domperidone) was administered after 8 h at 20
g kg-1 body weight of LHRHa and 10 mg kg-1 body weight of domperidone) was delivered after
10 h. Eggs were stripped into a plastic bowls 6-8 h after the second injection. Only good quality
eggs were selected for fertilization trails.
Cryopreservation method
The present study was proposed to examine the feasibility of activator media on frozen semen
of striped catfish, P. hypophthalmus. Since 10% dimethyl sulfoxide (DMSO) and 0.9% NaCl
yielded the excellent result from the previous studied on cryopreservation of P. hypophthalmus
spermatozoa (Kwantong and Bart, 2009). It was chosen to investigate the effect of activators
solution on frozen sperm quality of striped catfish, P. hypophthalmus. A freezer controlled (CL
3300) and programmable Cryogenesis, version 4 for windows were used to conduct the freezing
trails (Cryologic, Pty Ltd., Australia 1998 and 1999). The cryopreservation method and freezing
procedure were similar to that described by Kwantong and Bart (2003). The samples were stored
in liquid nitrogen for 24 h, the frozen sperm samples were air thawed at 30 C for 40 s, and the
percentage motility, velocity parameters or fertilization of frozen sperm were recorded.
Activation of sperm for analysis
The motility and velocity parameters of frozen sperm, P. hypophthalmus were investigated in
different types of activators solution (1% NaHCO3, 0.3% NaCl+0.4% Urea, 50 mM KCl+1 mM
MgSO4, 17 mM NaCl+5 mM Tris-HCl, 45 mM NaCl+5 mM KCl+Tris-HCl 30 mM and Tap
water, Table 1). For each assessment of motility, the frozen sperm (1 L) was activated by
Page 625

July 9-11, 2012
addition of 5 L of each activator solution and then placing the mixtures on a haemacytometer
slide that was already set up on the microscope stage. The motility and velocity parameters of
frozen sperm were investigated using a light microscopy at 32x LD A-plan phase objective (Carl
Zeiss, Axioskop 40, Germany) using imageJ program. Images were recorded using the Movie
studio EZCODER 3.0 program on a computer and a Sony CCD Exwave model SFC-E458P. For
each analysis, 30 frames representing 1 s of motion were imported into ImageJ and analyzed. The
motility for each activated solution was recorded in triplicate.
Fertilization trials
Approximately 6-8 h after the second injection, eggs were stripped into a plastic bowls for
fertilization trials. Good quality eggs (translucent, yellow in color) were chosen for fertilization
trials. Approximately 198 eggs batches-1 were divided into 60 batches. Each batch was placed in a
glass Petri dish with 10 replications for each treatment. The frozen sperm 240 L was dropped on
the eggs and mixed well, the desired amount of activated solution (1 mL) was poured into the Petri
dish to activate the sperm and eggs. Fertilization procedures used in this study were similar to the
previous study described by Kwantong & Bart (2009). The treated eggs were moved to hapas in
the flow through tank and incubated at temperature 28-30 C. Continuous gentle agitation with
aeration was applied. The numbers of fertilized eggs were counted at the gastrula stage (7 h after
fertilization).
Statistical analysis
All data were expressed as means standard error. The motility and fertilization percentages
among six activated solutions were subjected to arcsine transformed prior to analyses. Data were
analyzed by one-way analysis of variance (ANOVA) with subsequent of Duncans New Multiple
Range Test, at a probability level of P<0.05.
Effect of activators solution on frozen sperm quality of striped catfish, P. hypophthalmus
The highest percentage of motility (52.071.27%), a long time motile spermatozoa 162 s (Table
2) and the highest percentage of fertilization (55.371.39%, Fig. 1) was resulting from the
activated solution of 17 mM NaCl+5 mM Tris-HCl. This activated solution has an osmotic
pressure of 37.331.00 mOsm kg-1, which was lower than those of the osmolality of 1% NaHCO3
(208.001.00 mOsm kg-1), 50 mM KCl+1 mM MgSO4 (190.331.53 mOsm kg-1, 0.3%
NaCl+0.4% Urea (159.670.58 mOsm kg-1) and 45 mM NaCl+5 mM KCl+30 mM Tris-HCl
(141.670.58 mOsm kg-1), Table 1). Perhaps the low osmolality of activated solution used (17 mM
NaCl+5 mM Tris-HCl) in this study has a potential to activate the frozen sperm of striped catfish.
This result was similar to Tan-Fermin et al. (1999), who reported that sperm motility in Clarias
macrocephalus was mainly initiated by a decrease in osmotic pressure, rather than pH. Across
treatment, the activators solution did not affect the velocity parameters (VSL, VCL and VAP) of
frozen sperm, P. hypophthalmus (Table 2).
The activated solutions which have the highest osmolality of 208.001.00 mOsm kg-1 for 1%
NaHCO3, treatment 2 and the lowest osmolality of 6.670.58 mOsm kg-1 for Tap water, treatment
1 yielded lower fertilization percentages. However, in the case of tap water is commonly used to
activate spermatozoa in artificial propagation, has the lowest osmotic pressure of 6.670.58
Page 626

July 9-11, 2012
mOsm kg-1, while the seminal fluid spermatozoa of striped catfish has an osmotic pressure of
about 256 mOsm kg-1). It is a hypo-osmotic solution compared to the seminal fluid of P.
hypophthalmus spermatozoa. Tap water as an activator solution yielded a lowest motility rate
(5.173.18%, table 2) and low fertilization rate (29.191.74%, Fig.1). The reason for these poor
results may be resulting from osmotic shock (low osmotic pressure). These results were similar to
Dreanno et al. (1999); Tan-Fermin et al. (1999) and Lahnsteiner et al. (2003), they found that
osmotic pressure in fish species is the main factor implicated in the reaction to the inactivation and
activation of motility. Besides, the pH and the ion composition of the solution also play an
important role in the activation of motility in some fish species (Linhart et al., 1999 and TanFermin et al., 1999). A decrease or increase in osmolatity of activated solutions was resulted in a
low fertilization percentage. Based on the result of this study demonstrated that the using of 17
mM NaCl+5 mM Tris-HCl as an activated solution is optimal for the activation of frozen P.
hypophthalmus spermatozoa.
Table 1 Osmolality and pH of activated solutions used in the experiment.
Activation solution
Osmolality
(mOsm.kg-1)
pH
Tap water
6.670.58
7.8
1% NaHCO3
208.001.00
8.4
0.3% NaCl+0.4% Urea
159.670.58
7.5
50 mM KCl+1 mM MgSO4
190.331.53
8.5
17 mM NaCl+5 mM Tris-HCl
37.331.00
7.0
45 mM NaCl+ 5 mM KCl+30 mM TrisHCl
141.670.58
8.0
Seminal fluid of striped catfish sperm
256.331.53
7.44
Page 627

July 9-11, 2012
Table 2 Mean percent (SE) motility, velocity parameters and duration time of motility
dropping to zero percent of frozen striped catfish, P. hypophthalmus spermatozoa at six
different activated solutions using 10% dimethyl sulphoxide (DMSO) and 0.9% NaCl at 10 C
min-1 freezing rate.
Activation solution
Motility*
(%)
VSL (um/s)
VCL* (um/s)
VAP (um/s)
Duration time*
(S)
Tap water
5.173.18b
8.071.76
18.213.12ab
10.651.61
11.00 0.58de
1% NaHCO3
13.730.08b
12.516.92
19.466.92ab
14.136.93
22.67 0.88d
0.3%NaCl+0.4%Urea
14.923.96b
25.4710.11
34.099.25ab
28.4410.25
8.00 0.58e
50 mM KCl+1 mM
MgSO4
11.010.68b
21.347.36
29.533.83ab
23.387.23
44.50 1.50c
17 mM NaCl+5 mM
Tris-HCl
52.071.27a
23.587.53
33.153.72a
26.556.81
162.00 10.00a
45 mM NaCl+5 mM
KCl+30 mM Tris-HCl
14.590.01b
8.223.09
14.742.13b
9.642.71
80.50 9.50b
* Different letters in each column indicate significantly different at P<0.05 (ANOVA, Duncans test).
a
Fertilization (%)
60
ab
b
50
40
c
cd
30
20
10
0
Tr1
Tr2
Tr3
Tr4
Tr5
Tr6
Activation solution
Tr1= Tap water, Tr2= 1% NaHCO3, Tr3= 0.3% NaCl+0.4% Urea, Tr4= 50 mM KCl+1 mM MgSO4, Tr5=
17 mM NaCl+5 mM Tris-HCl, Tr6= 45 mM NaCl+ 5 mM KCl+30 mM Tris-HCl
Fig. 1 Mean percent (SE) fertilization of frozen P. hypophthalmus spermatozoa in six different
activated solutions using 10% dimethyl sulphoxide (DMSO) and 0.9% NaCl at 10 C min-1
freezing rate. Different superscript letters over the bars indicate significant difference among
activated solutions at P<0.05 (ANOVA, Duncans test).
Page 628

July 9-11, 2012
ACKNOWLEDGEMENTS
This study was supported by the Suranaree University of Technology and National
Research Council of Thailand (NRCT). The authors acknowledge Mr. Sunai Plime for helping in
the laboratory and the university farm (SUT) for broodstock supporting.
Page 629

July 9-11, 2012
REFERENCES
Dreanno, C., Cosson, J., Suquet, M., Cibert, C., Fauvel, C., Dorange, G., and Billard, R.
1999. Effects of osmolality, morphology perturbations and intracellular nucleotide content
during the movement of sea bass (Dicentrarchus labrax) spermatozoa. J. Reprod. Fertil.
116: 113-125.
Kwantong, S. and Bart, A. N. 2003. Effect of cryoprotectants, extenders and freezing rates on the
fertilization rates of frozen striped catfish, Pangasius hypophthalmus (Sauvage), sperm.
Aquaculture research 34: 887-893.
Kwantong, S. and Bart, A. N. 2009. Fertilization efficiency of cryopreserved sperm from
striped catfish, Pangasius hypophthalmus (Sauvage). Aquaculture Research 40: 292297.
Lahnsteiner, F., Berger, B., and Weismann, T. 2003. Effects of media, fertilization technique,
extender, straw volume, and sperm to egg ratio on hatchability of cyprinid embryos,
using cryopreserved semen. Theriogenology 60: 829-841.
Linhart, O., Walford, J., Sivaloganathan, B., and Lam, T. J. 1999. Effects of osmolality and
Ions on the motility of stripped and testicular sperm of fershwater-and seawateracclimated tilapia, Oreochromis mossambicus. J. Fish. Biol. 55: 1344-1358.
Linhart, O., Rodina, M., and Cosson, J. 2000. Cryopreservation of sperm of common carp,
Cyprinus carpio: sperm motility and hatching success of embryos. Cryobiology 41: 241250.
Magyary, I., Urbanyi, B., and Horvath, L. 1996. Cryopreservation of common carp
(C.carpio
L.) sperm. II. Optimal conditions for fertilization. J. Appl. Ichthyol. 12: 117-119.
Tan-Fermin, J. Miura, D. T., Adachi. S., and Yamauchi, K. 1999. Seminal plasma composition,
sperm motility, and milt dilution in the Asian catfish, Clarias macrocephalus (Gunther).
Aquaculture 171: 323-338.
Rana, K.J. 1995. Cryopreservation of fish spermatozoa. In: Cryopreservation and
Freezing-Drying protocols. Day, J.G., and McLellan, M.R. (Eds.). New Jersey: Humana
press. 254 pp.
Ritar, A.J., 1999. Artificial insemination with cryopreserved semen from striped trumpeter (Latris
Lineata). Aquaculture 180: 177-187.
Page 630

July 9-11, 2012
STP150-41
Hydrogen Production from Food Waste by Dark Fermentation

in Anaerobic Semi Complete Mixed Reactor
Patthanant Natpinit1, Rewadee Anuwattana1 and Sarunpit Supanit1

Thailand Institute of Scientific and Technological Research (TISTR)
35 Moo 3 Technopolis, Khlong 5, Khlong Luang, Pathum Thani 12120, Thailand.
E-mail: patthanant_n@tistr.or.th
ABSTRACT
A lab-scale anaerobic semi complete mixed reactor was carried out in this investigation. The
objective of this research is to develop the technology of hydrogen production from food waste in
anaerobic process. The average Chemical Oxygen Demand (COD), Biochemical Oxygen Demand
(BOD), Suspensioned Solid (SS) and Oil and Grease (O&G) of food waste were 111,551 mg/l,
55,776 mg/l, 12,355 mg/l and 2,312 mg/l as hexane respectively. The started seed sludge was
anaerobe which was heated at 90oC for 15 mins. The digester is as semi complete mixed reactor
(SCM) which has 3 stages of operation as feeding, stirring and settling. This study focused on the
diluted wastewater that has the maximum influent COD as 57,075 mg/l. The hydrogen system was
started gradually COD loading rate from 5.68-55.10 kgCOD/m3.d at HRT 1 days and kept pH in
4.3-4.5. The average of gas production rate demonstrated 0.12 L-H2/gCODr.d as 45% H2. In
addition to, the average efficiency of COD and BOD removal were 25% and 21% respectively.
The ratio of Volatile Fatty Acid (VFA) effluent/influent from hydrogen production showed at least
1.78 which indicated the performance of hydrogen production.
Keywords: hydrogen, anaerobic, food waste, semi complete mixed, dark fermentation
INTRODUCTION
Generally, anaerobic process for methane production is well known that has 3 stages for
decomposing the organic waste to methane gas such as hydrolysis, acidogenesis and
methanogenesis. It has been studied by many researchers that volatile fatty acid as acetic acid is
converted to methane gas and carbon dioxide gas in anaerobic condition as followed. (HulshoffPol et al., 1983; Lettinga et al., 1980)
CH3COOH =
CH4 + CO2
(1)
However, the complex organic compound has been solubilized to volatile fatty acid (VFA) in
acidogenesis process that hydrogen gas is produced by Clostridium spp. (Das and Veziroglu, 2001)
At present, there are many researchers to study the hydrogen production from high strength
wastewater. Actually, acidogenesis process or dark fermentation, it determined that the organic
compound can be decomposed to hydrogen gas under anaerobic condition and non-photosynthesis.
Page 631

July 9-11, 2012
Theoretical, one mole of glucose produced 12 moles of hydrogen gas as equation. (Vavilin et
al., 1995)
C6H12O6 + 6H2O = 12H2 + 6CO2
(2)
For instance, thermodynamics mechanism, 4 moles of hydrogen gas and 2 moles acetic acid
are produced from one mole glucose as follow. (Fang et al., 2002)
C6H12O6 + 2H2O = 2CH3COOH + 4H2 + 2CO2
(3)
Experiments from many researches showed that hydrogen gas 2-3 moles are produced from
glucose 1 mole because of butyric acid forming, propionic acid forming and methane gas
occurring (Vavilin et al., 1995) as these equation:
C6H12O6 = CH3CH2CH2COOH + 2H2 + 2CO2
(4)
C6H12O6 +2H2 = 2CH3CH2COOH + 2H2O
(5)
4H2 + CO2 = CH4 + 2H2O
(6)
As previous equations, there are many reactions for hydrogenation and dehydrogenation.
Therefore, the high yield of hydrogenation will be conducted by controlling either butyric acid or
acetic acid formation. The propionic acid and methane gas will be inhibited in the system.
Lay et al. (1998) researched on hydrogen production by the heated anaerobic sludge 15 mins.
The results showed that the heated sludge can produce hydrogen gas the same as Clostridium spp.
For example, the hydrogen yield from heated sludge was 140 ml-H2/gVSS as 60%H2 at pH 5.6.
The biogas rarely found methane gas and volatile fatty acid was butyric acid.
However, Kim et al. (2004) studied on hydrogen production from food waste by increasing
fermented domestic sludge that heated 90oC for 10 mins to inhibit the methane forming bacteria.
The experiment was conducted in batch system at 35oC and adjusted pH 5-6 with hydrochloric
acid and potassium hydroxide. Therefore, the hydrogen production rate determined 122.9 ml-H2/g
carbohydrate or 0.123 m3-H2/kg COD. The hydrogen forming bacteria was found as Clostridium
spp.
Horiuchi et al. (2002) concluded that the favorite condition for hydrogen production was pH
that depending on producing volatile fatty acid. Especially, butyric acid was found at pH 6-7 and
either acetic acid or propionic acid was discovered at pH 8. In addition to, hydrogen yield
correlated with butyric acid produced. Moreover, Hawkes et al. (2002) had reviewed the literatures
of hydrogen production to evaluate the suitable condition for operating in anaerobic system. It
concluded that pH should be 5.5-6.0 at 30oC in HRT 8-12 hrs.
A Lab-Scale for Hydrogen Production.
A fermenter is as semi complete mixed reacter which has stirrer controlled by timer. There are
3 stages for operating as feeding, stirring and settling. The flow diagram of a lab-scale shows in
Figure 1.
Page 632

July 9-11, 2012
Seal
pot
Gas
counte
H2inf
tank
H2
reactor
tank
Gas
holde
H2eff
tank
Fig. 1 The flow chat of a lab scale.

Food waste
The wastewater is carried out in this research that is diluted to COD 20,000 mg/l at beginning
and increasing gradually to 50,000 mg/l as well as adjusting pH equal or more than 5.5.
The operation manual
The adjusted wastewater is filled in hydrogen influent tank and fed to hydrogen reactor by
controlling flow rate and COD volume loading rate. After that, fermented wastewater overflows to
hydrogen effluent tank. On the other hand, biogas passes through to gas counter, seal pot and gas
holder.
Analytical method
Biogas is analyzed %Hydrogen, %Methane and %Carbon dioxide by Gas Chromatography.
Wastewater is analyzed pH, COD, BOD, SS, TKN, PO43--P and O&G etc.
Mix culture of H2 producing bacteria
MLSS 50,000 mg/l 10 liters is heated at 90oC 15 mins.
RESULTS
The characteristic of food wastewater was shown in Table 1. It is high strength wastewater that
COD is more than 100,000 mg/l. The ratio of BOD:N:P (100:4:0.3) of food waste is higher than
the ratio in anaerobic condition (100:1:0.2). Therefore, it is not necessary to add more N and P
source for hydrogen production. In this research, the diluted wastewater was conducted at COD
20,000 mg/l and increased gradually to 50,000 mg/l. The result of hydrogen production was shown
in Table 2.
The detail designs of hydrogen production are that flow rate 16 L/d, HRT 1 day and COD
40,000 mg/l or COD volume loading rate 40 kg/m3-d. The COD of diluted wastewater is
conducted firstly at 20,000 mg/l and increases gradually to 57,075 mg/l or COD volume loading
rate 55.1 kg/m3-d. The dilution rate is between 1.5 to 2.5 times depending on COD of food waste.
From Table 2, the reactor can load wastewater at COD 57,075 mg/l which is more than COD
designed at 40,000 mg/l. In addition to, the efficiency of COD and BOD are 24.97% and 21.24%
respectively. The average of volatile fatty acid influent and effluent were 3,029 and 5,765 mg/l as
CH3COOH that increasing rate was 90.34% and the ratio of VFA effluent/Influent was 1.78.
Page 633

July 9-11, 2012
Normally, hydrogen production occurs in acidnogenesis process. It meant that the organic
compound was decomposed to volatile fatty acid so that the COD and BOD were slightly removed
but VFA production was highly increased. Moreover, the hydrogen production rate was 0.12
L/gaCODr-d at 44.83%H2. It was nearly the theoretical ratio of hydrogen production as 0.16
L/gCODr-d. The ratio of food and microbial (F/M) was 1.65 g COD/gVSS.
Table 1. The characteristic of food waste.
Parameter
Unit
COD
mg/l
BOD
VFA
SS
O&G
TKN
PO43--P
Min-Max Average
44,410 - 111,551
184,310
mg/l
22,205 55,776
92,155
mg/l as
318 7,694
CH3COOH 16,973
mg/l
3,430 12,355
32,685
mg/l as
418 2,312
hexane
5,578
mg/l
56 - 3,530 2,184
mg/l
17 - 296
176
After hydrogen production, pH effluent had inverse correlation with volatile fatty acid
significantly at confidence interval 95%. Consequently, volatile fatty acid increasing caused pH
decreasing when COD volume loading increasing as shown in Figure 2 and Table 3. Correspond
with Fang et al. (2002) in hydrogen production, organic compound converted to organic acid that
pH decreased or acidity increased. Likewise, volatile fatty acid and hydrogen yield increased when
pH effluent decreased. (Chang and Lin, 2003)
From Figure 2, pH effluent will be kept in 4.3-4.5 because methane gas was produced at pH
more than 4.5. In conformity with Fang et al. (2002); Yu et al. (2002), Yu and Fang (2003) and
Hawkes et al. (2002) the suitable pH of hydrogen production should be 5.0-5.5. Methane gas will
be produced at pH more than 5.5. (Han and Shin, 2004 and Morimoto et al., 2004)
According to Morimoto et al. (2004) the hydrogen yield will be decreased when pH effluent
was less than 4.5. Therefore, methane gas is invisible but carbon dioxide gas accelerated
significantly. Owing to pH decreasing, the solubilization of carbon dioxide gas will be dropped
away. Hence, acid buffer will be reduced when pH has changed so the biochemical hydrogen
activity is below. The hydrogen yield decreases.
Page 634

July 9-11, 2012
Table 2. The characteristic of influent and effluent of hydrogen production.
Parameter
pH
COD
(mg/l)
BOD
(mg/l)
VFA
(mg/l)*
COD
loading
H2
production
H2
Influent
Min-Max
3.0-6.4
19,430 57,075
8,750 41,000
1,086 6,200
Effluent Efficiency
Min-Max
3.4 - 4.8
11,944 24.97%
51,265
5,250 21.24%
33,000
2,314 90.34%**
7,257
3
5.68-55.10
(kg/m -d)
(L/gCODr-d)
0.12
(%)
25.90-63.56
NaOH
(g/gCOD-d)
0.002-0.029
F/M
(gCOD/gVSS)
1.65
1.78
VFAeff/inf
Remark: * mg/l as CH3COOH ** increasing

Table 3. The changes of pH and VFA of hydrogen production.
Parameter
pH
VFA*
Influent
Effluent
Min-Max Average Min-Max Average
4.6 - 6.78
5.73
3.95 4.43
4.73
326 1,236
1,129 2,830
3,158
5,343
Remark: * mg/l as CH3COOH
Page 635

July 9-11, 2012
Fig. 2. The changes of pH and VFA of hydrogen production.

However, the VFA influent had increased that followed with COD volume loading increasing.
Therefore, the ratio of VFA effluent and influent (VFAeff/inf) had decreased whereas COD
volume loading increased as shown in Figure 2. Consequently, the VFA influent became high that
pH effluent could not be kept in 4.3-4.5. Therefore, the VFA and hydrogen production had
decreased.
Furthermore, the hydrogen production rate depended on type of VFAs especially acetic acid
and butyric acid. (Lay, 2001 and Chen et al., 2001) For acidogenesis, the COD removal efficiency
was less than 10-30%. Therefore, the hydrogen yield had decreased when COD removal
efficiency became high. (Ueno et al., 1996)
Besides, the VFA effluent directly correlated with the hydrogen production rate significantly at
confidence interval 95%. Correspond with Yu and Fang (2001); Ginkel et al. (2004); Lay (2001);
Chen et al. (2001), the VFA effluent increasing affected to hydrogen production rate had
increased. The result showed in Table 4 and Figure 3.
Page 636

July 9-11, 2012
Fig. 3. The changes of COD decrease, VFA increase and H2 production rate
From Figure 3, the COD decreasing and VFA increasing had increased when COD volume
loading increased. It meant that the organic compound was decomposed to volatile fatty acid more
and more. On the other hand, H2 production rate (L/gCODr) had decreased when COD volume
loading increased. It showed that the higher COD could not be decomposed to H2 in HRT 1 day.
From Figure 3, it indicated that the hydrogen production rate was the hightest at COD volume
loading 14.40 g/L.d.
From Table 4, the hydrogen production operated at COD between 10,000 and 30,000 mg/l. The
average of hydrogen production rate was 6.49 mmole/gCODr-d or 0.11 L-H2/gCODr-d that was
nearly to experiments of Kim et.al. (2004). The hydrogen yield was 52.62% (maximum 70.20%).
For that matter, COD volume loading and hydrogen yield had increased when hydraulic retention
time (HRT) decreased.
Besides, HRT had inverse correlation with hydrogen production rate significantly at confidence
interval 95%. According to Fang and Chang (2003) and Fang et al. (2002), the highest hydrogen
production rate was at HRT 8 hrs. In addition to, Hawke et al. (2002) found that the hydrogen
yield was carried out at HRT was at 8-12 hrs. Including Yu and Fang (2001) concluded that HRT
was 12 hrs. conducted to the highest hydrogen production. Furthermore, Ueno et.al. (1996)
discovered that HRT had correlated with COD while HRT was 0.5-3 days.
Page 637

July 9-11, 2012
Table 4. The changes of VFA and hydrogen production rate.
Parameter
VFA
COD
Unit
Influent Effluent
Min-Max Min-Max
326 1,129 mg/l as
3,158
5,343
CH3COOH
mg/l
11,981 7,802
33,870
28,401
H2
3.2 9.65
mmoleH2/g
production
CODr.d
rate
0.07 0.15
L H2/g
CODr.d
H2
29.00 70.20
%
Moreover, HRT of hydrogen production affected to volume of hydrogen reactor. Size of reactor
was small when HRT became less than. (Chang and Lin, 2005 and Lin and Lee, 2003) Then HRT
decreased, VFA and hydrogen yield had increased. Bai et al. (2003) studied that butyric acid was
produced at HRT 6 hr so that hydrogen production became maximum.
From designing system at, COD influent 40,000 mg/l, the hydrogen gas was produced
maximum 63.56% at pH 4.3. The average of hydrogen yield was 52.2 L/d or biogas 82.1 L/d at
53%H2.
In case of F/M of hydrogen production was 1.65 gCOD/gVSS. At the steady condition, COD
influent was 800 g/d and MLSS and MLVSS were 634 g and 486 g. It showed that hydrogen
producing bacteria needed high concentration of COD in order to compose to volatile fatty acid,
H2 and CO2 that COD removal efficiency was between 10% and 30%.
DISCUSSION
In this investigation, a lab-scale anaerobic semi complete mixed reactor was operated to
develop the technology of hydrogen production from food waste. This study focused on the diluted
wastewater that has the maximum COD influent as 57,075 mg/l. The hydrogen system was started
gradually COD volume loading rate from 5.68-55.10 kgCOD/m3.d at HRT 1 days and kept still pH
in 4.3-4.5. The hydrogen yield was 0.12 L-H2/gCODr.d at 45%H2. The average efficiency of COD
and BOD removal were 25% and 21% respectively. The conditions of hydrogen production as
VFAeff/inf and F/M were 1.78 and 1.65 respectively.
ACKNOWLEDGEMENTS
The authors gratefully to acknowledge the financial support by the grant from Thailand
Institute of Scientific and Technological Research.(In-house project of TISTR) As well as, the
authors wish to acknowledge Huay Khawng domestic wastewater treatment plant for their support
of the fermented sludge and TISTRS canteen for support the food waste. .
Page 638

July 9-11, 2012
REFERENCES
Bai, M.D., Cheng, S. S., Wang, Y. F., Hsiao, C. J. 2003. Effects of hydraulic retention time on
hydrogen fermentation of multiple substrates. Proc. of Asian Waterqual 2003, IWA-Asia Pacific
Regional Conference. Bangkok, Thailand.
Chang, F. Y. and Lin, C. Y. 2003. Reactor configuration effect on biohydrogen in an upflow
anaerobic sludge blanket system. Proc. of Asian Waterqual 2003, IWA-Asia Pacific Regional
Conference. Bangkok, Thailand.
Chen, C. C., Lin, C. Y. and Chang, J. S. 2001. Kinetic of hydrogen production with continuous
anaerobic cultures utilizing sucrose as the limiting substrate. Appl. Microbiol. Biotechnol. 57: 5664.
Das, D. and Veziroglu, T. N. 2001. Hydrogen production by biological process: A survey of
literature. International Journal of hydrogen energy. 26: 13-28.
Fang, K. S. and Chang, Y. H. 2003. Kinetic analysis of anaerobic hydrogenesis methanogenesis
process for high strength brewery wastewater. Proc. of Asian Waterqual 2003, IWA-Asia Pacific
Fang , H. H. P., Zhang, T. and Liu, H. 2002. Microbial diversity of a mesophilic hydrogen
producing sludge. Applied Microbiology and Biotechnology. 58: 112-128.
Ginkel, S. V., Oh, S. and Logan, B. E. 2004. Biohydrogen gas production from food processing
and domestic wastewaters. International Journal of hydrogen energy. (inpress)
Han, S. and Shin, H. 2004. Biohydrogen Production by Anaerobic Fermentation of Food Waste.
International Journal of Hydrogen Energy. 29: 569-577.
Hawkes, F.R., Dinsdale, R., Hawkes, D.L. and Hussy, I. 2002. Sustainable Fermentative Hydrogen
Production : Challenges for Process Optimization. International Journal of Hydrogen Energy. 27:
1339-1347.
Horiuchi, J.I., Shimizu, T., Tada, K., Kanna, T. and Kobayashi, M. 2002. Selective Production of
Organic Acids in Anaerobic Acid Reactor by pH Control. Bioresource Technology. 82: 209-213.
Hulshoff-Pol, L.W., Velzeboer, C.T.M. and Lettinga, G. 1983. Granulation in UASB reactor. Wat.
Sci. Tech. 15: 291-304.
Kim, S., Han, S. and Shin, H. 2004. Feasibiloty of Biohydrogen Production by Anaerobic CoDogestion of Food Waste and Sewage Sludge. International Journal of Hydrogen Energy. 29:
1607-1616.
Lay, J. J. 2001. Biohydrogen generation by mesophilic anaerobic fermentation of microcrystalline
cellulose. Biotech. and Bioeng. 74(4): 280-287.
Lay, J., Lee Y. and Noike, T. 1998. Feasibility of biological hydrogen production from organic
fraction of municipal solid waste. Water Research. 33(11): 2579-2586.
Page 639

July 9-11, 2012
Lettinga G, van Velsen, A.F.M., Hobma, S.W., de Zeeuw, W. and Klapwijk. A. 1980. Use Upflow
Anaerobic Sludge Blanket reactor concept for biological wastewater treatment especially for
anaerobic treatment. Biotechnology and Bioengineering. 22: 699-705.
Lin, C. Y. and Lee, C. Y. 2003. Characteristics of fermentative hydrogen production using
anaerobic sewage sludge microflora. Abstract. Proc. of Asian Waterqual 2003, IWA-Asia Pacific
Morimoto, M., Atsuko, M., Atif, A.A.Y., Ngan, M.A., Fakral-Razi, A., Iyuke, S.E. and Bukir,
A.M. 2004. Biological Production of Hydrogen from Glucose by Natural Anaerobic Microflora.
International Journal of Hydrogen Energy. 29: 709-713.
Ueno, Y., Otsuka, S., and Morimoto, M. 1996. Hydrogen Production from Industrial Wastewater
by Anaerobic Microflora in Chemostat Culture. Journal of Fermentation and Bioengineering.
82(2): 194-197.
Vavilin, V.A. Rytox, S.V. and Lokshina, L.Y. 1995. Modelling Hydrogen Partial Pressure Chang
as a Result of Competition between the Butyic Acid and Propionic Groups of Acidogenic Bacteria.
Bioresource Technology. 54: 171-177.
Yu, H.Q. and Fang, H.H.P. 2001. Acidification of Mid- and high-strength Dairy Wastewaters.
Water Research. 35(15): 3657-3705.
Yu, H.Q. and Fang, H.H.P. 2003. Acidogenesis of Gelatin Rich Wastewater in an Upflow
Anaerobic Reactor : Influence of pH and Temperature. Water Research. 37: 55-66.
Yu, H., Zhu, Z., Hu, W. and Zhang, H. 2002. Hydrogen Production from Rice Winery Wastewater
in an Upflow Anaerobic Reaction by Using Mixed Anaerobic Cultures. International Journal of
Hydrogen Energy. 27: 1359-1365.
Page 640

July 9-11, 2012
STP159-45
The mosquito NADPH-Cytochrome P450 Oxidoreductase

(CYPOR): Structure and implement for safety insecticidal
synergistic application.
Songklod Sarapusit1* and Sarinya Thongjam1

Department of Biochemistry, Faculty of Science, Burapha University, Chonburi, Thailand, 20131
E-mail: songklod@buu.ac.th
ABSTRACT
The insect cytochrome P450 (P450s) have been report to play an imrtant role in pyrethroid
insecticides detoxification in many Anopheles mosquitoes, including Anopheles minimus
mosquito, one of primary malaria vector in Thailand. In order to fulfill the catalytic activity, the
P450s- enzymatic reaction requires electrons transfer from NADPH through FAD and FMN
cofactors, one by one, from its redox partner, the cytochrome P450 oxidoreductase (CYPOR)
enzyme. Interestingly, the An. minimus CYPOR enzyme (AnCYPOR) properties is clearly
difference from mammalian CYPOR enzymes and play an importance role in An. minimus P450mediated pyrethroid insecticides activity in vitro. In this study, based on amino acid sequence
alignment and computational analysis, the computational modeling of the AnCYPOR was
constructed. The predictive three-dimensional model structure of AnCYPOR is difference from
previously characterized mammalian CYPOR. As CYPOR is crucial for various P450-mediated
reactions in mosquito, specifically inhibit of CYPOR activity may decrease many P450-catalytic
reactions in vivo. In addition, Clove extract (Syzygium aromaticum) could selectively inhibited
AnCYPOR enzyme compared to rat CYPOR enzyme. Therefore, the difference in properties and
structure as well as selective inhibition of AnCYPOR by Clove extract would be beneficial for a
malaria vector control program for safety synergistic insecticide.
Keywords: NADPH-Cytochrome P450 ocidoreductase, Anopheles minimus, Thai herbals,
inhibition
INTRODUCTION
The reemergence of many vector-borne diseases such as malaria, caused by resistance of insect
vectors to chemical insecticides, mediated by cytochrome P450 enzyme in family 6 (CYP6), is an
obstacle for vector control programs in many tropical countries (Rivero et al, 2010; Rongnoparut
et al., 2012). Long-term continued uses of pyrethroids have led to pyrethroid insecticide resistance
in various mosquito species, including Anopheles minimus, one of a primary malaria vector in
Thailand (Chareonviriyaphap et al., 1999). The mosquito Anopheles minimus, one of the primary
malaria vectors in Thailand, had increased levels of CYP6AA3 and CYP6P7 transcripts during
deltamethrin resistant selection (Rongnoparut et al., 2003; Rodpradit et al., 2005). Both CYP6AA3
and CYP6P7 are belonging to family 6 of the cytochrome P450 monooxygenase (P450)
superfamily of enzymes. However, the P450 reaction requires electron supplementation from
Page 641

July 9-11, 2012
NADPH one by one through NADPH-cytochrome P450 oxidoreductase (CYPOR) enzyme (Wang
et al., 1997). Thus, the full-length Anopheles minimus CYPOR (flAnCYPOR) cDNA has been
isolated and expressed in E. coli (Kaewpa et al., 2007). Upon heterologously expressed in bacteria
system, the purified flAnCYPOR enzyme could supported the metabolism of both type I and type II
pyrethroids when reconstituted with membrane fractions of recombinant CYP6AA3 and CYP6P7
enzymes in vitro (Kaewpa et al., 2007; Boonsuepsakul et al., 2008; Duangkaew et al., 2011).
Because of the essential role of flAnCYPOR in CYP6AA3 and CYP6P7-mediated pyrethroids
metabolism, detail studies enzymatic properties of the AnCYPOR may provide crucial information
for malaria vector control program.
Thus, the membrane-bound flAnCYPOR and soluble 55AnCYPOR were heterologously
expressed and purified. The purified enzymes were functionally active, possessed NADPHdependent cytochrome c reduction activity. However, the purified AnCYPOR readily lost their
flavin co-factors and is as unstable comparing to CYPORs from other organisms. The activity and
stability of the enzyme, nevertheless, could be improved by supplementation of FAD and FMN
cofactors. Furthermore, the replacement of the leucine residues at positions 86 and 219 by
phenylalanine, L86F/L219F-AnCYPOR, result in an improved cofactor binding, protein stability,
and high cytochrome c reduction activity. This mutant enzyme show similar kinetic mechanism
and substrates binding constant compared to the wild-type enzyme. The high turnover number in
the mutant enzyme indicate a more efficient electron transfer of AnCYPOR to P450 resulting in
higher CYP6AA3-mediated insecticide metabolism, compared to the wild-type flAnCYPOR
enzyme (Sarapusit et al., 2008, 2010). These results suggested unique properties of the malaria
vector AnCYPOR enzyme compared to previously report mammalian CYPOR enzymes. In this
study, the structural modeling of this mosquito CYPOR was generated. Surprisingly, threedimensional structure of the generated mosquito AnCYPOR enzyme showed strikingly difference
from previously characterized rat CYPOR enzyme structure. As the AnCYPOR is crucial of all
P450 mediated-insecticide resistance, theoretically, decreasing in AnCYPOR electron transfer
activity by natural-derived compound could terminated all P450-mediated insecticide resistance
and could be a beneficial application for malaria vector control in near future.
Prediction of protein structure
Amino acid sequences from CYPOR homologs of human (NCBI NP_000932.3), rat
(NP_113764.1), house fly (M. domestica, L19897), fruit fly (D. melanogaster, NP_477158.1), and
An. gambiae (AAO24765.1) were aligned with An. minimus CYPOR (ABL75156.1) and displayed
by ClustalW. Molecular modeling of the AnCYPOR was performed with MODELLER (Eswar et
al., 2006; 2008) using the crystalline rat CYPOR structure (PDB: 1AMO) chain A as a template.
The AnCYPOR protein shares 52% identity with the rat CYPOR (Keawpa et al., 2007). Models
were visualized and displayed using PyMOL program.
Expression and purification of AnCYPOR and rat CYPOR enzymes
For AnCYPOR, the L86F/L219F- 55AnCYPOR was expressed and purified as previously
described (Sarapusit et al., 2008). Protein expression and purification of rat CYPOR enzyme was
performed as previously described by Shen et al. (1989). Purification of the purified
55AnCYPOR and rat CYPOR proteins were monitored by analysis of fractions by SDSPAGE.
Pure fractions were pooled, concentrated and stored at 80 C until use. The purity of protein was
Page 642

July 9-11, 2012
assessed by SDSPAGE. Protein concentration was determined by the Bio-rad protein assay using
Bovine Serum Albumin (BSA) as a standard.
Measurement of flavin contents
Flavin mono-nucleotide (FMN) and flavin-adenosine di-nucleotide (FAD) contents of each
sample were measured by using a fluorometric method as described previously (Aliverti et al.,
1999). Commercial FMN and FAD were further purified by the HPLC method and used for the
standard curve and for cofactor supplementation experiments. The Bio-rad protein assay was
utilized to determine the concentration of protein using BSA as standard. The concentrations of
standard FAD and FMN solutions were determined spectrophotometrically at 450 nm using
extinction coefficients of 11.3 and 12.2 mM1cm1, respectively (Aliverti et al., 1999).
Spectrophotometric methods and activity assays
The oxidized CYPOR enzyme was diluted in 300 mM potassium phosphate buffer, pH 7.7 to a
final concentration of 1015 M and the spectrum was recorded. Another spectrum was obtained
after addition of nicotinamide adenosine diphosphate reduced form: NADPH (100 M final
concentration) under aerobic conditions.
The CYPOR-mediated cytochrome c reduction was carried out in 300 mM potassium phosphate
buffer, pH 7.7 as previously described (Shen et al., 1989) with minor modifications. After 1 min
pre-incubation of enzyme in buffer with 40 M cytochrome c at 25 C, the reaction was initiated
by addition of 50 M NADPH. NADPH-dependent cytochrome c reduction was followed by a
change in the absorbance at 550 nm. Velocities are expressed as mol/min/mg protein. The
reaction was started by addition of the enzyme and the initial velocity data were analyzed by nonlinear regression by using the GraphPad prism 5.0 software package.
Inhibition assay
Purchased plants were dired and ground into small pieces. Each dried plant was macerated with
ethanol (100 for each extract) for 3 times. Solutions were filtered, removed solvents in vacuum
and ultimately yielded crude extracts. Dried powder of ethanolic extracts were dissolved in
dimethyl sulfoxide (DMSO), and subsequently passed through a 0.22 M sterile filter.
Measurements inhibition of CYPOR activity was assayed by measuring the rate of cytochrome c
reduction at 550nm as described above with slightly modification. Reaction was carried out at
room temperature (2425 C). The assay mixture contained 300 mM potassium phosphate buffer,
pH 7.7 containing 40 M cytochrome c at 25 C and pre-incubated with plant extract for 1 minute.
After 1 min pre-incubation of enzyme in buffer with 40 M cytochrome c at 25 C, the reaction
was initiated by addition of 50 M NADPH and followed a change in the absorbance at 550 nm
for 5 min. The unit of enzyme was calculated as described for control activity. The inhibition
activity was calculated as a remaining activity compared to the control reaction and analyzed by
the GraphPad prism 5.0 software package.
RESULTS
Prediction of AnCYPOR protein structure
Fig. 1 shows an oval-shaped bowl-like 3D structure of the AnCYPOR homolog. The overall
AnCYPOR homology structure having four structural domains including FMN-binding domain,
connecting domain, FAD-binding domain, and NADP-binding domain with the FMN, FAD and
NADP(H) cofactors lying in the middle of the structure as previously characterized rat CYPOR
structure (Wang et al., 1997). However, detailed secondary structure of the mosquito CYPOR is
different. As displayed in figure 1, the FMN binding domain of wild-type AnCYPOR comprises
five-stranded parallel -sheet, flanked by five -helices similar to rat CYPOR (Wang et al.,
1997). However in AnCYPOR, there is large random coil region at the end of helix A (76LQSS),
helix B (102AKEGIRYQ), helix C (127MLKD) and helix E (194RLEEL) with slightly longer -sheet
4 (169LNYAVF) and additional -sheet 5 (199GANR). Such differences, although located distant
away from FMN binding, they may affect FMN binding properties of AnCYPOR as the enzyme is
Page 643

July 9-11, 2012
proned to lose FMN cofactor and could not be reconstituted with exogenous FMN in vitro
(Sarapusit et al., 2008, 2010). The phenylalnine replacement in the two hydrophobic cores (one
formed by F72, L86, F138, and F155; the other by F97, F174, F204, L219 andW222) could result
in slight change in the three-dimensional structure of the FMN domain therefore affect FMN
cofactor binding and AnCYPOR enzymatic activity in vitro (Fig. 2) (Sarapusit et al., 2008; 2010).
While the connecting domain which function to bringing the two flavins together and thus
modulating electron transfer between the two flavins (Wang et al., 1997; Hamdane et al., 2009) is
well superimposed with the crystallized rat CYPOR structure. Therefore, the low activity of
AnCYPOR is mainly caused by the loose binding of the FMN cofactor not the difference in
electron transfer between FAD and FMN cofactors.
The FAD-binding domain of AnCYPOR is different from the anti-parallel flattened -barrel
feature of rat CYPOR FAD-binding domain. The structure surrounding FAD-binding domain of
AnCYPOR is deviated from rat CYPOR, possibly making mosquito CYPOR less stable and
loosely bind its FAD cofactors. The deviations are the following. A hinge between the -7 strand
(caused by K290,290KVN) and -8 strand (caused by S302,302SCH) appeared in AnCYPOR
which is slightly deviated from C in -14 strand (472VHVTAVLVKYET) lying beside FAD
cofactor of rat CYPOR structure and -16 strand (509PRVPIFIRKS). Without interference on
NADP(H) binding, the -18 strand (563TLYFG), P helix (580ELEDYS) and -19 strand
(591NLRVAF) of AnCYPOR showed structure not conformed to that of rat CYPOR. The
difference in FAD domain topology may lead to an open conformation of the AnCYPOR enzyme
compared to rat CYPOR enzyme. Consequently, the open structure of AnCYPOR is susceptible
for trypsin digestion and is loosely bound flavin cofactors compared to rat CYPOR. In addition,
the open structure of AnCYPOR could explain an observation that AnCYPOR could be
reconstituted with exogenous FMN and FAD in vitro. (Sarapusit et al., 2008; 2010). Although
there is no significant difference in the NAD(P)H binding motif, the NAD(P)H Km is
comparatively higher in the mosquito CYPOR compared with house fly and mammalian CYPOR
enzymes (Shen al., 1989).Recently, the loosely binding of FAD and FMN cofactors, un-stability
and higher NAD(P)H binding constant has also been report in the Anopheles gambiae CYPOR
(AgCYPOR), a primary malaria vector in Africa (Lian et al., 2011). Although the basis of unique
property of the Anopheles CYPOR, in two different areas, remains unknown, a huge difference in
enzymatic properties of these malaria vector CYPOR from previously report enzymes could
provide an advantage for malaria control program. By using specific compound that could specific
inhibit or decrease the AnCYPOR or AgCYPOR enzyme, the entire P450-mediated insecticide
metabolism could be abrupt and limited the widespread of the malarial disease without an effect on
other organism.
Page 644

July 9-11, 2012
Fig. 1. Predictive model structure of Anopheles minmus CYPOR (AnCYPOR). MODELLER

predicted 3D structure of AnCYPOR using rat CYPOR (PDB: 1AMO chain A) as a template and
displayed by PyMOL. Functional domains are distinguished by coloration. The FMN-binding
domain is in pink, the flexible hinge domain is in white, the FAD-binding domain is green, and the
NADPH-binding domain is blue. FAD, FMN, and NADPH cofactors are cyan, yellow, and red,
respectively.
Fig. 2. The predicted FMN domain of Anopheles minmus CYPOR (AnCYPOR).

The predicted FMN domain structure of AnCYPOR (pink) align with the FMN domain of rat
CYPOR (green) shows the locations of two leucine residues (L86 and L219). The vicinities of the
two leucine residuces (square) are enlarged to illustrate the stacking of the hydrophobic residues.
Residue L86 of AnCYPOR is packed against the aromatic rings of F72, F138, and F 155; and
Page 645

July 9-11, 2012
L219 of AnCYPOR is stacked against F97, F174, and W 222. The cofactors are represented as
stick models: FMN (yellow), FAD (cyan), and NADP+( red).
Expression, purification and enzymatic activity of 55AnCYPOR and rat CYPOR
Because of the high yield and non-significance difference in enzymatic properties, the soluble
55AnCYPOR was select as a candidate for further characterization. In addition, the high flavin
(FAD and FMN) content, high stability with an optimal enzymatic activity of the double mutant
(L86F/L219F) with out any significant difference in substrate binding affinity (cytochrome c Km
and NADPH Km) and kinetic mechanism compared to the wild-type enzyme suggested an
advantageous of using the L86F/L219F- 55AnCYPOR for further inhibition screening and
structural analysis (Rongnoparut et al., 2012). Thus, the double mutant 55AnCYPOR and rat
CYPOR, which is comparatively similar to the human CYPOR, were expressed in E. coli. Both
CYPOR enzymes were purified by Ni-agarose affinity chromatography into homogeneous protein
bands with the molecular size of 73 kDa as anticipated from their deduced amino acid sequences
(data not shown). The specific activity of the purified 55AnCYPOR and rat CYPOR are 24.64
1.66 and 18,554.56 mol cytochrome c reduce/min/ug proteins, respectively. These values are
comparable to previously report values (Shen et al., 1989, Sarapusit et al., 2008; 2010).
Inhibition of CYPOR activity by selected Thai herbs
With an aims to reduced the chemical usage that may cause environmental contamination, our
research goal is to using Thai local plant extract that could selectively inhibit AnCYPOR, not
mammalian CYPOR. Ten local plants that have been report for using for insecticidal activity
nearby Chonburi province were selected and mercerized. The effect of each plant extract,
dissolved in DMSO solution, on the cytochrome c reduction activity of 55AnCYPOR and rat
CYPOR were analyzed (Fig. 3). Comparing with the standard CYPOR inhibition, 2AMP (2Adenosine monophosphate), selected Thai herbs differentially affected the cytochrome c reduction
activity. While there is no inhibitory activity on CYPOR activity, Black pepper (Piper nigrum)
extract at 1 ug/ml concentration slightly decrease rat CYPOR activity (Fig 3A). In addition, most
selected plant extracts could selectively increase rat CYPOR activity especially Neem
(Azadirachta indica), Clove (Syzygium aromaticum), and Thong-pan-chang (Rhinacanthus
nasutus) (p value = 0.05). The inhibition effect of Thai herb extracted has shown when increasing
plant extracts concentration (Fig 3B and 3C). There is no statically difference in inhibition among
tested plant extracts toward AnCYPOR and rat CYPOR at 10 ug/ml concentration. Interestingly, at
100 ug/ml concentration, the clove (Syzygium aromaticum) extract could abolish all AnCYPOR
activity compared to rat CYPOR (p value = 0.05) (Fig. 3C). The inhibiting activity of Clove
extract is significantly difference from other plant extracts (p value = 0.05). These results
indicated that Clove extract could selectively inhibit electron transfer activity of the AnCYPOR
compared to rat CYPOR. To our knowledge, this is the first inhibition study of natural derived
extract on CYPOR enzymes and there is no information of chemical compounds that could
specifically inhibit CYPOR activity. Although the Clove contain high amount of phenolic
compounds (Heinrich et al., 2004) , further detail investigation is a crucial need.
Taken altogether, we assume that the difference in enzymatic properties and three-dimensional
structure between the malaria vector CYPOR (AnCYPOR) and mammalian CYPOR (rat CYPOR)
might play an important role in the selectivity of inhibition by Clove extract in AnCYPOR. As
CYPOR transfer electrons for P450-mediated insecticide metabolism in vitro, thus, decreasing in
CYPOR activity could increase insectivity sensitivity and increasing rate of mosquito mortality.
However, the applicable of this safety natural-derived Clove extract for further area-based malaria
vector control program would require additional studies including searching for a specific
inhibition- molecule, inhibition mechanism and bio-safety which could be a beneficial application
for malaria vector control in near future.
Page 646

July 9-11, 2012
ACKNOWLEDGMENTS
We thank Kanyarat Kattikul, Panida Rattanachon, Sirada keawdee, Keratika Thichan,
Kwanruethai Chayyingcheaw, Lalita Klinpuang, and Hathairud Chuasriwong for their hard work
through out the entire manuscript. This work is financial supported by Faculty of Science, Burapha
University (S.S).
Page 647

July 9-11, 2012
REFERENCES
1. Aliverti, A., Curti, B., and Varoni, MA. 1999. Identifying and Quantitating FAD and FMN in
simple and Iron-sulfer-containing flavoprotein, pp. 9-23. In Chapman SK, Reid GA (ed.).
Flavoprotein Protocols, 2nded., Humana Press, Totowa, NJ, USA.
2. Boonsuepsakul, S., Luepromchai, E. and Rongnoparut, P. 2008. Characterization of Anopheles
minimus CYP6AA3 expressed in recombinant baculovirus system. Archives of Insect Biochemistry
and Physiology 69: 13-21.
3. Chareonviriyaphap, T., Aum-aung, B., and Ratanatham, S. 1999. Current insecticide resistance
patterns in mosquito vectors in Thailand. Southeast Asian Journal of Tropical Medicine and
Public Health. 30: 184-194.
4. Duangkaew, P., Pethuan, S., Kaewpa, D., Boonsuepsakul, S., Sarapusit, S., Rongnoparut, P.
2011. Characterization of mosquito CYP6P7 and CYP6AA3: Differences in substrate preference
and kinetic properties. Archives of Insect Biochemistry and Physiology 76: 1-13
5. Eswar, N., Marti-Renom, M. A., Webb, B., Madhusudhan, M. S., Eramian, D., Shen, M.,
Pieper, U., Sali A. 2006. Comparative protein structure modeling using Modeller pp. 5.6.1-5.6.30.
In Current Protocols in Bioinformatics, Supplement 15, NY, USA: John Wiley & Sons, Inc.
6. Eswar, N., Eramian, D., Webb, B., Shen, M.Y., Sali. A. 2008. Protein structure modeling with
MODELLER. Methods in Molecular Biology 426: 145-159.
7. Hamdane, D., Xia, C., Im, SC, Zhang, H., Kim, J.J.P, and Waskell, L. 2009. Structure and
Function of a NADPH-Cytochrome P450 Oxidoreductase in an Open Conformation Capable of
Reducing Cytochrome P450. Journal of Biological Chemistry. 284: 11374-84
8. Heinrich, M. and Barnes, J., 2004. Clove, Syzygium aromaticum (L.) pp. 275-276. In LM. Perry
(ed) Fundamentals of Pharmacognosy and Phytotherapy, Churchill Livingstone, EdinburghLondon, UK
9. Kaewpa D., Boonsuepsakul, S., and Rongnoparut P. 2007. Functional Expression of Mosquito
NADPH-Cytochrome P450 Reductase in Escherichia coli. Journal of Economic Entomology. 100:
946953.
10. Lian, L-Y., Widdowson, P., McLaughlin, LA., Paine, MJI. 2011. Biochemical comparison of
Anopheles gambiae and Human NADPH P450 reductases reveals different 2-5-ADP and FMN
binding traits. PLoS ONE 6(5): e20574. doi:10.1371/journal.pone.0020574
11. Rivero, A., Vzilier, J., Weill, M., Read, AF., Gandon, S. 2010. Insecticide Control of VectorBorne Diseases: When Is Insecticide Resistance a Problem?PLoS Pathogen. 6(8): ppe1001000.
12. Rodpradit, P., Boonsuepsakul, S., Chareonviriyaphap, T., Bangs, M.J. and Rongnoparut, P.
2005. Cytochrome P450 genes: molecular cloning and overexpression in a pyrethroid-resistant
strain of Anopheles minimus mosquito. Journal of the American Mosquito. Control Association.
21: 7179.
13. Rongnoparut, P., Boonsuepsakul, S., Chareonviriyaphap, T. and Thanomsing, N. 2003.
Cloning of cytochrome P450, CYP6P5, and CYP6AA2 from Anopheles minimus resistant to
deltamethrin. Journal of Vector Ecology. 2: 150158.
14. Rongnoparut, P., Pethuan, S., Sarapusit, S., and Lertkeitmongkol, P. 2012. Metabolism of
Pyrethroids by mosquito Cytochrome P450 enzymes: Impact on vector control in insecticides. pp
265- 284. In Perveen F (ed.) Pest Engineering (1st ed), InTech Open Access Publisher, Croatia,
Page 648

July 9-11, 2012
15. Sarapusit, S., Xia, C.W., Misra, I., Rongnoparut, P., Kim, J.J.P. 2008. NADPH-cytochrome
P450 oxidoreductase from the mosquito Anopheles minimus: kinetic studies and the influence of
Leu86 and Leu219 on cofactor binding and protein stability. Archives in Biochemistry and.
Biophysic. 277: 53-58.
16. Sarapusit, S., Pethuan, S., Rongnoparut, P. 2010. Mosquito NADPH-Cytochrome P450Oxidoreductase Mutation: Kinetic and Role in CYP6AA3-mediated Deltamethrin metabolism
Archives of Insect Biochemistry and Physiology 73: 232-244.
17. Shen, AL., Porter, TD., Wilson, TE. and Kasper, CB. 1989. Structural analysis of the FMN
binding domain of NADPH-cytochrome P-450 oxidoreductase by site-directed mutagenesis.
Journal of Biological Chemistry. 254: 75847589.
18. Wang, M., Roberts, D.L., Paschke, R., Shea, T.M., Masters, B.S.S. and Kim J.J.P. 1997.
Three-dimensional structure of NADPH-cytochrome P450 reductase: prototype for FMN- and
FAD-containing enzymes. Proceedings of the National Academy of Sciences of the United States
of America
94: 84118416.
Page 649

July 9-11, 2012
*
*
Fig 3. Effect of selected Thai plant on CYPOR enzymes. The selected plant extracts were incubated with rat CYPOR (dot bar) or AnCYPOR (horizontal bar) enzymes
and measuring for the remaining activity compared to the control reaction (enz). The specific inhibitor for rat CYPOR (2AMP) was used as positive control.
The effects of tested plant extracts were measured in three concentration 1 ug/ml (A), 10 ug/ml (B) and 100 ug/ml. All tested were perform in triplicate and
analyzed the difference between AnCYPOR and rat CYPOR remaining activity by t-test (p < 0.05).
Page 650

July 9-11, 2012
STP184-50
Competitive Sorption of Phenol in the presence of Lead by

Organoclays
Thitirat Ditkaew a, Sutha Khaodhiarb*

Thailand Institute of Scientific and Technological Research, Pathumthani, 12120, THAILAND
b*
Department of Environmental Engineering, Chulalongkorn University, Bangkok, 10330, THAILAND
E-mail: sutha.k@eng.chula.ac.th
a
ABSTRACT
Organoclays were produced from sodium-rich bentonite and organic surfactant or quaternary
ammonium cation (QAC). Two C-12 alkyl chain length cationic surfactants with different
molecular structure, Dodecylpyridinium chloride (DPC) and Dodecyltrimethylammonium bromide
(DTAB), were added to bentonites at 0.5-2.0 times the cation exchange capacity (CEC). This study
was performed to determine the feasibility of using organoclays to remove phenol and lead
contaminants. The role of competition between phenol and lead was observed. The result was
found that no direct competition was noticed between phenol and lead contaminants. That is, the
sorption of phenol was not affected by lead sorption. The reason for this may come from phenol
and lead having different sorption sites and mechanisms, namely, phenol adsorption was chemical
mechanism for DPC-organoclay and partitioning mechanism into the organic phase of interlayer
space, which modified by DTAB, while lead adsorption was chemisorbed to silanol, aluminal, and
other edge sites.
Keywords: Organoclay, Cationic Surfactant, Phenol, Lead, Sorption
INTRODUCTION
Toxic organic and inorganic contaminations, such as phenolic compounds and heavy metals are
commonly found in the industrial wastewater. Water quality would be affected by the mixed
contaminants released into water environment which leaded to pollution problems. Especially, the
heavy metal ions have already endangered the sustainable development of human society (Jin et
al., 2011; Li et al., 2009; Popat et al., 1994; and Liu et al., 2010) Contaminants of phenolic
compounds from petroleum and petrochemical, coal conversion, pesticide, paint, pharmaceutical,
plastic, paper and phenol producing industries are considered one of the priority pollutants in
wastewater, because its toxicity to organisms even at low concentrations (Liu et al., 2010; Santos
and Linardi, 2001; Sheikheldin et al., 2000; and Veeresh et al., 2003). As a result, Environmental
Protection Agency (EPA) regulations call for lowering phenol content in wastewater to less than 1
ppm (Dutta et al., 1998).
Adsorption is widely used technique for removing phenol and heavy metals in which various
type of adsorbents such as pine cone, palm shell, chitosan, organoclay, and so on (Issabayeva et
al., 2008; Meng et al., 2008; Momilovi et al., 2011; and Wan Ngah et al., 2011) Previous studies
Page 651

July 9-11, 2012
have examined the efficiency of organoclay which prepared by a different structure of exchange
cationic surfactants to remove phenol, and found that organoclay was very effective for removing
phenol from wastewater (Froehner et al., 2009; Shen, 2002; Shen, 2004; and Sprynskyy et al.,
2009) The other reports indicated that organoclays can successfully sorb heavy metals, even
though the adsorption was not as effective as bentonite (Oyanedel-Craver and Smith, 2006; Yuan,
2004). In our previous research, we studied the phenol sorption characteristics by organoclays
which placing two cationic surfactants or quaternaryammonium cations (QACs) containing C-12
alkyl chain length cationic surfactants with different molecular structure, namely Dodecylpyridinium
chloride (DPC) and Dodecyltrimethylammonium bromide (DTAB), to bentonite at 0.5-2.0 times the
cation exchange capacity (CEC). The results indicated that the structure of surfactants and
organics are the vital parameters for organic removal, mechanism and capacity, by organoclays
(Ditkaew and Khaodhiar, 2010). Therefore, this research studies the sorption of mixed
contaminants, phenol and (Pb2+), onto DPC-organoclays and DTAB-organoclays. The effect of
lead sorption mechanism on phenol sorption were also be evaluated.
Materials
Bentonite with cation exchenge capacity (CEC) of 90 meq/100 g was obtained from Thai Nippon
Chemical Industrial Co., Ltd. The chemical composition of the clay mineral was as follows: 46.052.0% SiO2, 15.0-17.0% Al2O3, 6.0-8.0% Fe2O3, 2.2-2.8% Na2O, 1.4-1.6% TiO2. The cationic
surfactants, Dodecylpyridinium Chloride (DPC) and Dodecyltrimethylammonium bromide (DTAB),
Phenol and Lead were selected as the contaminants. All of the compounds were obtained from Merck..
Table 1 Physical and chemical properties of DPC, DTAB and Lead
Formular
Structure
Molecular
weight
(g/mol)
C17H30NCl
283.90
(DPC)
C15H34NCl
308.35
(DTAB)
94.12
Phenol
(C6H5OH)
Lead
(Pb2)+
207.19
Sample Preparation
The organoclays prepared with the amount of DPC and DTAB equivalent to X times the CEC was
named XDPC and/or XDTAB with X=0.50, 1.00, 1.50, and 2.00.The sodium-rich bentonite was
washed several time with deionized water in order to remove soluble inorganic salts and any adhering
Page 652

July 9-11, 2012
materials. The bentonite was then separated by centrifugation at 6000 rpm for 20 min, dried at 55oC for
24 h and grounded to pass through a number 40 sieve (Changchaivong and Khaodhiar, 2009). The
desired amount of DPC and DTAB at equivalent 0.50 to 2.00 time the CEC (Eq.(1)) was dissolved in
200 ml of deionized water and 10 g of the bentonite were added. The samples were shaken at 150 rpm
for 18 h at room temperature (232oC). The organoclays were separated by filtration through filter
paper (No.1) at atmospheric pressure and washed with deionized water repeatedly until none of
chloride and bromide ions were found in the solution indicated by AgNO3. Then the organoclays were
air dried and grounded to pass through a number 40 sieve.
Data modeling
The amount of cationic surfactant added to bentonite for organoclays preparation was
calculated as follow.
f = Mcation(CECMclayGMWcationZ)-1 ,
(1)
where f is fraction of CEC satisfied by organic cation, Mcation is mass of organic cation required to
achieve the desired fraction of CEC (mass), Mclay is mass of the base clay (mass), GMWcation is gram
molecular weight of organic cation (mass/mol), Z is moles of charge per equivalent, mol/equivalent
(Bartelt-Hunt et al., 2003).
Sorption of Phenol and Lead
Batch sorption experiments were performed by containing 25 ml glass vials, 0.05 g of the 9 sorbents,
namely bentonite, the 4 ration of DPC-organoclays, the 4 ration of DTAB-organoclays and synthetic
wastewater with phenol concentration 10 mg/l and various ration of lead concentration range from 5 to 20
mg/l. The mixed solution was adjusted pH to be 7.00.5 using HCL and NaOH. All samples were shaken
at 150 rpm for 30 min at room temperature (232oC) to reach the equilibrium state. The supernatant was
filtered through 0.45 m Nylon membrane syringe filter, and the phenol solution was analyzed by UVspectrophotometer with the absorbance wavelength 270 nm (Xu and Zhu, 2007). All experiments were
conducted in triplicates to ensure reproducibility.
RESULT
Sorption of phenol in the presence of lead: Fig 1 and 2 shows the sorption of phenol onto DPCand DTAB-organoclays of lead at phenol concentration: lead concentration = 10:5, 10:10 and
10:20.
Amount phenol sorbed (mg/g)
1.4
Phenol
10:05
1.2
10:10
10:20
1.0
0.8
0.6
0.4
0.2
0.0
0.5 DPC
1.0 DPC
1.5 DPC
Fig. 1 Eeffect of lead on phenol sorption onto DPC-organoclays.
Page 653
2.0 DPC

July 9-11, 2012
Amount phenol sorbed (mg/g)
1.2
Phenol
10:05
1.0
10:10
10:20
0.8
0.6
0.4
0.2
0.0
0.5 DTAB
1.0 DTAB
1.5 DTAB
2.0 DTAB
Fig. 2 Eeffect of lead on phenol sorption onto DTAB-organoclays.

As shown in Fig 1 and 2, the result of DPC-organoclay in removing phenol with lead
contaminating was similar to the result of DTAB-organoclay. Moreover, bentonite without
modification could not removed phenol from the solution.
DISCUSSION
According to the result, the sorption of lead and phenol negatively responded to each other. Due to
sorption of phenol by DPC-organoclay may be chemically bounded. While phenol is partitioned
into the organic phase of interlayer space, which is modified by DTAB (Ditkaew and Khaodhiar,
2010). The removal of lead was chemisorbed to silanol, aluminol, and other edge sites of organoclay
(Lee et al., 2002; Oyanedel-Craver and Smith, 2007; Sheng et al., 1999; and Yoo et al., 2004).
Therefore, the competition in sorption between phenol and lead was not expected since the
sorption of phenol and lead were different mechanism.
ACKNOWLEDGMENT
This research was financially supported by a thesis grant from the Graduate School of
Chulalongkorn University. The authors would like to thank Miss Suratchana Changchaivong from
Sirindhon College of Public Health Suphanburi for her great support. Our appreciation is also
extended to the National Center of Excellence for Environmental and Hazardous Waste
Management, Chulalongkorn University for its provision of the experimental facilities and
instruments and Thai Nippon Chemical Industrial Co., Ltd. for providing the bentonite.
Page 654

July 9-11, 2012
REFERENCE
Jin, X., Yu, C., Li, Y., Qi, Y., Yang, L., Zhao, G., and Hu, H. 2011. Preparation of novel nanoadsorbent based on organic-inorganic hybrid and their adsorption for heavy metals and organic
pollutants presented in water environment. Journal of Hazardous Materials 186: 1672-1680.
Li, X. G., Ma, X. L., Sun, J., and Huang, M. R. 2009. Powerful reactive sorption of silver(I) and
mercury (II) onto poly (o-phenylenediamine) microparticles. Langmuir 25: 1675-1684.
Popat, K. M., Anand, P. S., and Dasare, B. D. 1994. Selective removal of fluoride ions from water
by aluminum from of the aminomethylphosphonic acid type ion exchanger. Reactive Polymer 23:
23-32.
Unlu, N., and Ersoz, M. 2006. Adsorption characteristics of heavy metal ions onto a low cost
biopolymeric sorbents from aqueous solution. Journal of Hazardous Materials 136: 272-280.
Liu, Q. S., Zheng, T., Wang, P., Jiang, J. P., and Li, N. 2010. Adsorption isotherm, kinetic and
mechanism studies of some substituted phenols on activated carbon fibers. Chemical Engineering
Journal 157: 348-356.
Santos, V. L., and Linardi, V. R. 2001. Phenol degradation by yeasts isolated from industrial
effluents. The Journal of General and Applied Microbiology 47: 213-221.
Sheikheldin, S. Y., Cardwell, T. J., Cattrall, R. W., Castro, M. D. L., and Koler, S. D. 2000.
Determination of phenol in water by prevaporation-flow injection analysis. Analytica Chimica
Acta 419: 9-16.
Veeresh Gali, S., Pradeep, K., and Indu, M. 2005. Treatment of phenol and cresols in up flow
anaerobic sludge blanket (UASB) process: a review. Water Research 39: 154-170.
Dutta, N. N., Brothakur, S., and Baruah, R. 1998. A novel process for recovery of phenol from
alkaline wastewater: laboratory study and predesign cost estimate. 1998. Water Envirionment
Research 70: 4-9.
Issabayeva, G., Aroua, M. K., and Sulaiman, N. M. 2008. Continuous adsorption of lead ions in a
column packed with palm shell activated carbon. Journal of Hazardous Materials 155: 109-113.
Meng, Z., Zhang, Y., and Zhang, Z. 2008. Simultaneous adsorption of phenol and cadmium on
amphoteric modified soil. Journal of Hazardous Materials 159: 492-498.
Momilovi, M., Purenovi, M., Boji A., Zarubica, A., and Ranelovi, M. 2011. Removal of lead
(II) ions from aqueous solutions by adsorption onto pine cone activated carbon. Desalination 276:
53-59.
Wan Ngah, W. S., Teong, L. C., and Hanafiah, M. A. K. M. 2011. Adsorption of dyes and heavy
metal ions by chitosan composites: A review. Carbohydrate Polymers 83: 1446-1456.
Froehner, S., Martins, R. F., Furukawa, W., and Errera, M. R. 2009. Water remediation by
adsorption of phenol onto hydrophobic modified clay. Water, Air, and Soil Pollution 199: 107113.
Page 655

July 9-11, 2012
Shen, Y. H. 2002. Removal of phenol from water by adsorption-flocculation using organobentonite.
Water Research 36: 1107-1114.
Shen, Y. H. 2004. Phenol sorption by organoclays having different charge characteristics. Colloids
and Surfaces A: Physicochemical and Engineering Aspects 232: 143-149.
Sprynskyy, M., Ligor, T., Lebedynets, M., and Buszewski, B. 2009. Kinetic and equilibrium
studies of phenol adsorption by natural and modified forms of the clinoptilolite. Journal of
Hazardous Materials 169: 847-854.
Oyanedel-Craver, V. A., and Smith, J. A. 2006. Effect of quaternary ammonium cation loading
and pH on heavy metal sorption to Ca bentonite and two organobentonites. Jounal of Hazardous
Materials 137: 1102-1114.
Yuan, G. 2004. Natural and modified nanomaterials as sorbents of environmental contaminants.
Journal of Environmental Science Health. Part A, Toxic/Hazardous Substance and Environmental
Engineering 39: 2661-2670.
Ditkaew, T., and Khodhiar, S., 2010. Phenol Adsorption by Surfactants Modified Bentonites,
Proceedings of 4th International Congress of Chemistry and Environment. Special Issue of
Research Journal of Chemistry and Environment.
Chanchaivong, S., and Khaodhiar, S. 2009. Adsorption of naphthalene and phenanthrene on
dodecylpyridinium-modified bentonite. Applied Clay Science 43: 317-321.
Bartelt-Hunt, S. L., Burns, S. E., and Smith, J. A. 2003. Nonionic organic solute sorption onto two
organobentonites as a function of organic-carbon content. Journal of Colloid and Interface Science
266: 251-258.
Xu, L., and Zhu, L. 2007. Structures of hexamethonium exchanged bentonite and the sorption
characteristics for phenol. Colloids and Surfaces A: Physicochemical and Engineering Aspects
307: 1-6.
Lee, J., Choi, J., and Park, J. 2002. Simultaneous sorption of lead and chlorobenzene by
organobentonite. Chemosphere 49: 1309-1315.
Oyanedel-Craver, V. A., and Smith, J. A. 2007. Simultaneous sorption of benzene and heavy
metals onto two organoclays. Jounal of Colloid and Interface Science 309: 485-492.
Sheng, G., Xu, S., and Boyd, S. A. 1999. A dual function organoclay sorbent for lead and
chlorobenzene. Soil Science Society of America 63: 73-78.
Yoo, J., Choi, J., Lee, T., and Park, J. 2004. Organobentonite for sorption and degradation of
phenol in the presence of heavy metals. Water, Air, and Soil Pollution 154: 225-237.
Page 656

July 9-11, 2012
STP189-52
Sound-field Distribute and Measuring in Electrical-Acoustics

Designing for Multi-media room and Conference Hall in
University
Xu Wen Yi 1 Xu Guang Ze 2 Shi Yi Jin 2
(1Yunnan Radio and Television University, Kunming, 650223 ,China ; 2. Torisum and Culture
College,Yunnan University,Lijiang,674100,China)
E-mail : 1 Xwy1978@sohu.com
2 Xu1948@sohu.com
2 Shiyijin1985@sina.com
Abstract
Multi-media room and conference hall are usually used in university today. How to construct a
better acoustic effect in above room and hall as well as better performance price ratio are an
important problem for an university.In authors view, designing and measuring for sound-field
distribution are necessary and useful before constructing acoustic environment of multi-media
room or conference hall in university, which are used in large quantities. In this paper author has
researched main sound resources and the sound-field distribute coming from the multi-media room
and conference hall in university, and gives out a simple and useful method on designing and
measuring.
Keywords: multi-media room, performance price ratio, sound-field distribute; measuring,
electrical-acoustics designing.
1 Sound Resources in Multimedia room and Conference hall
Sound Resources includes music sound and speech sound, and usually speech sound is used
in above the room and hall. The speech sound filling the space in the room and hall usually comes
from a speaker system, that is dual track stereo system controlled by a power amplifier which will
consume some power. (watt) [4]The total power needed for in the room or hall can be simply
calculated as follow:
P = V 0.3W / m 3 (see [1]) There Ptotal power (w) of speaker(needed sound power) ; V
total volume of room or hall , To avoid amplifier works in ultimate limit, the actual power
should is P30%.
We have known human ear is more sensitive to the sound frequency from1000Hz to 5000 Hz
,So we should consider main power of speaker is distributed in above frequency range when
choosing speaker system. Sound coming from microphone is a non line input ,so microphone is an
usually used sound resource in the room and hall. Speaker system is often researched as sound
resources which amplified microphone sound signal. The sound-field coming from speaker system
constructs sound-field of room and hall.
Page 657

July 9-11, 2012
The speech system is cheaper when the designing of sound-field faces mainly speech and the
system includes amplifier, speaker group, absorption material,etc.
2 Sound-Field Distribute and Reverberation Time
For getting an uniform distribution of sound power (sound-field) in the multi-media room and
conference hall, how to confirm the position of speaker is very important. For speaker hanged in
height off the ground it should be nearly human ear height off ground when humans seating in a
seat . The listening effect is better on the theory under this condition. In practice, Main speaker
usually set more height off ground and must be set in front the microphone to prevent sound
payment and the angle is 120(its not line input) between two speakers and microphone so that
sound-field distribute is more uniform. If the space is more big of room or hall, two groups of
speakers will be set and there is space between one group and another group.(picture 1)
Microphone
Left1
120
Right1
Right2
Left2
Fig. 1 angle and relative position among speakers and microphone
Reverberation time is an important parameter for sound definition of any acoustic

environments especially for speech sound.
Because the construction price of acoustic environments, designing and constructing are based
on common classroom for multi-media room and conference hall of university . If speaker system
is set reasonable and we can construction an uniform sound-field ,we only need ordinarily
absorption material on the wall, example pp, pps ,gypsum board etc. Of course, its able not to use
any absorption material .The performance price ratio will be satisfying at all. The reverberation
time can be calculated as traditional method.
For multi-media room when the material of interface (wall surface) is same, reverberation time
can be calculated as follow[1]:
Page 658

July 9-11, 2012
When
0 .2
> 0 .2
T
T
60
60
= 0.161
V
( s)
S
0.161
(s)
ln(1 ) + 4mV
(1)
(2)
Where average absorption factor in interface (wall surface); Vvolume in the room (m 3 )
Sinterface square in the room (m 2 ) ; mair absorption factor
For conference hall, Perhaps the materials of three group walls are not same, reverberation time
can be calculated as fallow[1]:
T60 =
X
Y
Z
0.16V
0.16V
0.16V
] (s)
]+ [
]+ [
[
S S ln(1 x ) S S ln(1 y ) S S ln(1 z )
(3)
Where X, Y, Z surface area of three group wall( (m 2 ) ; x y z average absorption

factor to X,Y,Z
S total surface area of the conference hall (m 2 ) ; Vvolume of hall
Usually ,the volume of a small multi-media room is about 300 (m 3 ) the reverberation time
is about 0.60.8 s (for speech) ,for a big multi-media room (about 10002000 (m 3 ) ) is about
0.81.0 s(for speech)
But at same time the sound absorption effect of man body in the room and hall also is considered
So the real reverberation time is less than about calculated reverberation time.
3 Measuring of Sound-field Distribution
After calculating the power of sound resource of room or hall we must measure sound-field
distribution for confirming if the sound-field distribution is uniform ( speakers position is correct )or
not.
Sound-field measuring is easy to be done. We use sound meter measuring sound intensity level
of some points (dB). How to choose the points position ? We usually choose 12 measuring points
in plan (picture 2) and sound meter should be set in height of human ear of seating on a seat.
Measuring signal is an unchangeable power signal (frequency 2000hz )[5] in the row. The speech
definition can be measured if its needed.
Page 659

July 9-11, 2012
Microphone
1
2
1200
Left1
Right1
7
6
X1
Right2
Left2
9 X2
Y2
10
Y1
8
11
13
12
Fig. 2 sound-field distribution measurement

In the picture 2,for every point sound intensity level can be measured by sound meter .The total
sound intensity level of some point is[1]
P = L p1 + 10 lg n (dB)
(4)
when n sound resources work at same time. Where Ptotal sound intensity level in some point in
the room or hall; L p1 sound intensity level of a sound resource.
When n=2 and sound resource power is same, then L p = L p1 + 3 dB
So we can check the sound intensity level of point 6 (when left 1 and right 1 works at same
time) is equal to L p1 +3 ( when only left 1 or right 1 works sound intensity level is L p1 ) . In
position X1 Y1,X2 Y2 where we have found there are the best listening effect by
actually experiment .The sound intensity level where X1Y1X2Y2 can be as a relative
standard so that we can adjust appropriately the speakers position of the left 1 right 1 Left 2
and right 2 for sound intensity level of every point in picture 2 is close to X1 Y1,X2 Y2 as
soon as possible.
We will draw a distribution graph of sound-field after measuring all points(113)which
will is useful to listing design of multi-media room or conference hall.
Page 660

July 9-11, 2012
When n different sound resources work at the same time the total sound intensity level of some
point is[1]
n
L p = 10 log(
L p1
/ 10) (dB)
(5)
i =1
CONCLUSION
In order to get clear and more uniform sound-distribute for audiences in multi-media room and
conference hall ,we have to calculatedesign and measure the acoustic environment above room
and hall. Above the methods of calculating designing and measuring are more simple and
convenient, the result is match for practical effect.
Page 661

July 9-11, 2012
REFERENCES
[1] Xu Guang Ze. Electrical-acoustic principle and Technology(Book), Electrical Industry Press,
Beijing 2007;
[2]Morten Jorgensen, Speaker System Measurement, Electrical acoustic Technology 2005.11
China
[3] Wang Xi Cheng . Acoustics Technology (book)Dian Zi Science and Technology University
Press, Xi An ,2005;
[4] Cheng Xiao Ping, Speakers Principle and application, Broadcasting Press, China, Beijing
2005;
[5] Xu Guang Ze, Experiment on Electrical Frequency Demultiplication in acoustics system,
Electrical acoustic Technology,2002.1China
[6] Che Shi Guang, Building Acoustic Design , Building Industry Press ,China,1992
Page 662

July 9-11, 2012
STP204-58
Removal of Mohom Dye from Wastewater Using zeolite from Slag

Rewadee Anuwattana1, Tawee Sappinant1 Pawanee Tantuan1 Worapong Pattayawan1
1
Environment and Resources Department, Thailand Institute of Scientific and Technological
Research (TISTR), Pathum Thani 12120
E-mail: rewadee_a@tistr.or.th
ABSTRACT
Slag, generated during the iron foundry, is an industrial by-product which is recognized as an
environmental pollutant. It was converted into a low-cost adsorbent, characterizated and used for
the removal of Mohom dye from wastewater. Slag was modified by hydrothermal treatment using
NaOH solution under various conditions for zeolite synthesis. It was found that NaA zeolite would
be formed under the condition of 3M NaOH at 105C for 3 h. In batch experiments, parameters
studied include the effect of the sorbent dosage, and contact time. The optimum contact time for
Mohom dye has been found to be 2 h, while the maximum adsorption was observed at pH 9. The
adsorbent dose has been optimized as 5 g/L. The percentage of removal of Mohom wastewater on
the NaA commercial grade zeolite and NaA zeolite from slag were 99.8 and 99.6, respectively.
The equilibrium data were well fitted by the Langmuir model with the maximum sorption
capacities was 55.1 mg/g of NaA zeolite from slag.
Keywords: Zeolite, Dye Removal, Slag, Adsorption
INTRODUCTION
The Mohom textile industries spend large amounts of water and chemicals for dyeing
processes. Dye wastewaters usually consist of a number of contaminants including acids, bases,
dissolved solids, and color. Mohom dyes are toxic to some microorganisms and may causes direct
destruction or inhibition of their catalytic capabilities. They, therefore, need to be decolorized
before the wastewater can be discharged [1-3]. Mohom dyes are very soluble and are hardly
biodegraded under biological treatment processes. Membrane processes also can be used for the
decolorization of the wastewater streams [4-6].
Adsorption has been extensively used in industrial processes for separation or purification.
Most adsorption plants use activated carbon, which is an expensive material. Besides, there is
growing interest in using commercially available low-cost materials for the adsorption of dye
including fly ash [7-8], wood [9], activated sludge [10], bagasse fly ash [11] and diatomaceous
silica [12] were
investigated as low cost alternatives to activated carbon.
Slag is the industrial waste generated from ferrous foundry processing. It is composed of lime,
a substantial amount of amorphous silica as well as other impurities in the iron. It is composed of
SiO2 (4.57 wt.%), CaO (36.14 wt.%), Al2O3(8.49 wt.%), Fe2O3 (5.1 wt.%) and other compounds
such as Na2O, K2O and MnO in trace amounts. The world production of iron amounted to 82
Page 663

July 9-11, 2012
million tons in 2002 resulting in 23.5 million tons of the slag [13]. Utilization of the slag as a
supplemental material for cement and road-base consumes a small amount of slag. Another
possible method to manage the slag problem is to use the slag as a silicon source for the synthesis
of zeolite.
Zeolites can be synthesized from many different industrial wastes such as the coal fly ash [14],
paper sludge [15], and oil shale ash [16]. The most common method involves a hydrothermal
process, whereby the slag is mixed with an alkali solution at different conditions of temperature,
pressure and time. The type of zeolite formed is a function of temperature, pressure, concentration,
pH, and cation sources used during preparation.
In this paper, we reported our investigation using hydrothermal treatment of slag to
convert it to zeolite and the application in adsorption of Mohom dye in wastewater and found that
slag could be a cheaper adsorbent while still having higher adsorption capacity.
Adsorbent materials and chemicals
Slag was obtained from Ti-Heng foundry factory in Samutprakarn Province, Thailand. It was
ground using a Los-angeles miller and sieved to obtain a powder having a particle size about 50
m, and then magnetized to eliminate magnetic particles and used for hydrothermal treatment.
The chemical compositions of the slag are SiO2 (43.57 wt.%), Al2O3 (8.49 wt.%), Fe2O3 (5.11
wt.%), CaO (36.14 wt.%) and MgO (1.5wt%). The powder was then stirred with acid solution (1:1
v/v) to remove Ca and Fe content at room temperature for 1 h in which their presence will compete
with aluminum for the zeolite framework during synthesis. Typically, 10 g. of the slag mixed with
12 g of NaOH in weight and heated in the crucible in air at 550 C for 1 h. After fusion, 12 g of
powder was mixed with 72 mL of 3M NaOH and 300 mL of distilled water at 105 3 C for 3 h.
After that, the products were washed with distilled water and dried at 110 C overnight.
Characterisation of adsorbents
The crystalline phase identification and % crystallinity were determined by X-ray diffraction
(D5005, Bruker) The % crystallinity was calculated by eq.(1). A commercial zeolite NaA was used
as the standard
%Crystallinity=total peak area of sample x100
(1)
total peak area of standard
The SEM images were collected using a JSM 5800, JEOL was used to investigated the
morphology of the product.
Sorption Test
Dye adsorption
Sorption studies were performed in batch experiments. Batch sorption studies were
performed at adsorbent doses and contact time to obtain the equilibrium isotherm. The adsorption
of Mohom dye was performed by shaking 0.5 g of solid in 100 mL of dye solution of 20 mg/l at
100 rpm for 2 h. The determination of Mohom dyes was done spectrophotometrically on Lagarge
by measuring absorbance at max of 605 nm. To investigate the effect of adsorbent doses (0.14%) and contact time on adsorption.
Page 664

July 9-11, 2012
A known amount of adsorbent was added to each flask, and the contact time was
selected on the basis of preliminary experiments. The bottles were placed on a shaker at 400 rpm
at room temperature for 10-450 min followed by centrifugation for 10 min to remove the
adsorbent from the solution. The solution was then spectroscopically analyzed at the
corresponding max for the concentration of the dye remaining in the solution. The dye
concentration retained in the adsorbent phase was calculated using equation (2)
qe
[Co-Ce]V/W
(2)
Where Co and Ce are the initial and equilibrium concentrations (M), respectively, of the dye in
solution, V is the volume (L), and W is the weight (g) of the adsorbent. To determine the sorption
effeiciency of the system (%Rem) was indicating the percentage of removed dyes.
%Rem
Co-Ce x 100
(3)
Co
where Co and Ce are, respectively, the initial concentration and concentration at the equilibrium
of concentration (mol/l)
RESULTS
Characterization of the Adsorbent material
The chemical composition of the slag, acid treated slag and zeolite product are show in Table 1.
The Si/ Al ratio of the slag is about 8.72, indicating that this type of slag is favorable for use as a
raw material for low Si zeolite synthesis. Furthermore, the slag has lower Fe and Ca. Among them,
Fe associates to the presence of Magnetite, which can behave as an inert material for zeolite
synthesis while Ca could act as an inhibitor through the formation of calcium silicate. After
pretreatment by acid digestion by 3M HCl, the Si/ Al ratio of the acid slag is about 301.27. To
obtain a lower Si/Al ratio zeolite such as zeolite A will requires the addition of aluminium.
Aluminium hydroxide was added into the acid treated slag for control the Si/Al molar ratio of 1.
Table 1 Chemical composition of slag and zeolite.
Sample
Constituent (%)
Raw Slag
Slag 700
Zeolite from slag
Na2O
0.35
<0.01
9.34
MgO
1.5
<0.01
<0.01
Al2O3,
8.49
0.19
29.43
SiO2
43.57
32.54
55.67
CaO
36.14
22.33
0.11
Fe2O3
5.11
0.13
0.07
Si/Al
8.72
301.27
3.21
Page 665

July 9-11, 2012
NaAzeolitestandard
Zeolitesamplefromslag
Fig. 1 XRD patterns NaA zeolite of standard and zeolite sample from slag activated by 3M NaOH
at 105 C for 3 h by conventional heating.
The overall gel of slag starting raw material as 13.75Na2OAl2O32.46 SiO21433.2 H2O. The
zeolites synthesized were Na-A zeolite after 3M NaOH activation at 105oC for 3 h. The Na-A
zeolite appeared and have the cubic shape of Na-A zeolite with a size of about 3-4 m was
observed clearly as shown in Fig.1 and Fig.2.
Fig. 2 XRD patterns of NaA zeolite standard (A) and zeolite sample from slag activated by 3M
NaOH at 105 C for 3h by conventional heating.
Sorption Studies
Effect of the Adsorbent Dosage.
It has been observed that the color removal of Mohom dye increases with increasing adsorbent
dosage.
Page 666

July 9-11, 2012
Fig. 3 Effect of adsorbent doze on the percentage color removal of Mohom dye into zeolite.
Fig.3 shows that the percentage color remove of Mohom dye increases with increasing
adsorbent doze (zeolite sample from slag), and remain almost constant after 0.5 g of adsorbent in
100 mL of dye solution. Adding more NaA zeolite results in a little further adsorption. As a result,
the optimum adsorbent doze has been chosen as 0.5 g of adsorbent in 100 mL of dye solution (5
g/L) and this value has been kept constant for all the experiments.
Effect of the contact time
This experiments were carried out to find the optimum time to reach equilibrium. The
experiments were performed against time (2, 6, 10, 20, 30, 40, 50, 60, 70, 80, 90, 120, 150, 180,
240, 300, 360 and 420 min) at a constant Mohom dye concentration of 20 mg/L and a solid/ liquid
ratio of 0.5% (5 g/L).
Fig. 4 Effect of contact time on the adsorption of Mohom dye into zeolite.
A
Fig 4. shows that the conditioning time increases, the amount of adsorption of Mohom dye into
zeolite increase, and remain almost constant after 120 min of contact time. As a result, the
optimum contact time has been chosen as 120 min. and this value has been kept constant for all the
experiments. Mohom dye has been quickly adsorbed into the porous of zeolite, and slow
adsorption because of the decreasing porous.
Page 667

July 9-11, 2012
Adsorption Models.
To determine the mechanistic parameters associated with studied dyes, the results obtained by
the adsorption experiments were analyzed by the Langmuir and Freundlich models.
Langmuir Isotherm
The Langmuir model assumes uniform energies of the adsorption onto the surface and no
transmigration of the adsorbate in the plane of the surface.
1
1 +
Qo
qe
(4)
bQ0Ce
where qe is the amount adsorbate (mg/g), Ce is the equilibrium concentration of the adsorbent
(mg/L), and Q0 and b are the Langmuir constant related to the maximum adsorption capacity and
energy change in adsorption, respectively.
The feasibility of the process is calculated by the dimension less constant separation
factor: R
R
(5)
1
1+ bC0
Where b is the Langmuir constant, Co is the initial concentration. The magnitude of the R valves,
ie, 0<R<1, indicates the favorable adsorption.
Freundlich Isotherm
The adsorption data for Mohom dye is also analyzed by the Freundlich model.
log qe =
log Kf
+ (1/n) log Ce (6)
where qe is the amount adsorbed (mg/g), Ce is the equilibrium concentration of the adsorbate
(mg/L), and Kf and n are Freundlich constant, related to the adsorption capacity and adsorption
intensity, respectively.
Table 2. Constant of the Langmuir and Freundlich.
Langmuir
Freundlich
qe
Adsorbents
(mg/g)
b (L/mg)
R2
Kf
R2
Zeolite product from

slag
55.1
5.55
0.97
8.47
1.4
0.87
Zeolite A Standard
60.1
5.56
0.97
9.93
1.5
0.86
Page 668

July 9-11, 2012
The adsorption isotherm fitted well with Langmuir equation with the maximum sorption
capacities was 55.1 and 60.1 mg/g of zeolite for standard zeolite A product form slag and zeolite
A standard, respectively as shown in Table 2.
DISCUSSION
C
Slag generated in a foundry industry was used as a low-cost adsorbent for the removal of
Mohom dye. Slag was modified by hydrothermal treatment using NaOH solution under various
conditions for zeolite synthesis. The overall gel of slag starting raw material as The overall gel of
slag starting raw material as 13.75 Na2OAl2O32.46 SiO21433.2 H2O. In batch experiments,
parameters studied include the effect of the adsorbent doze and contact time on the color
adsorption. The result showed that the optimum condition of zeolite from slag was 0.5 g of
adsorbent in 100 mL of dye solution and the contact time reached to equilibrium within 120
minute in synthetic wastewater at 20 mg/l by adjust pH of 9. The percentage of basic dyes
removal 99.8%. The adsorption isotherm fitted well with Langmuir equation with the maximum
sorption capacities was 55.1 mg/g of zeolite. These studies reveal that slag can be used for the
effective, efficient and reproducible removal of the reported Mohom dye form wastewater.
ACKNOWLEDGEMENTS
The authors are thankful to the Thailand Institute of Scientific and Technological Research
(TISTR),Thailand, for consistent encouragement and financial support.
Page 669

July 9-11, 2012
REFERENCES
[1] Abraham, R. 1993. Dye Environmental Chemistry: Encyclopedia of Chemical Technology
vol. 8, Wiley, New York.
[2] McKay, G. 1995. Use of Adsorbents for the Removal of Pollutants from wastewaters; CRC
Press; Boca Raton, Florida, USA.
[3] Asfour, H.M Nassar, and Fadali M.M. 1985. A. Color removal from textile effluents using
Hardwood as an adsorbent. Journal of Chemistry Technology and Biothechnology. 35A: 28-36.
[4] El-Geundi, M.S. 1991. Color Removal from textile effluents by adsorption techniques. Water
Research 24 : 97-104.
[5] Grau, P. 1991. Textile industry wastewater treatment. Water Science and Technology. 24: 97104.
[6] Armagan, B and . Ozdemir O, M. Turan, 2003. The removal of reactive azo dyes by natural
and modified zeolites Biotechnol. 78, 725-732.
[7] Haggerty G.M.and Bowman R.S. 1994.
[8 Al-Qodah, Z. 1998. Journal of
Environmental and Technology. 1998: 128- 137.
[9] Asfour, H.M.; Nassar, M. M.; Fadali, O.A. 1985 Color Removal from textile effluents using
Hardwood . Journal chemistry.. Technological. Biotechnology. 35A: 28-36.
[10] Ganesh, R., Boardman, G.D. Michelsen, D. 1994. Fate of azo dyes in sludges. Water
Research. 28: 1367-1379.
[11] Gupta, V.K., Sharma, S. and Sharma, M. 2000. Removal of basic dyes from aqueous using
Baggase Fly ash. Separation Science Technology 35: 2097-2120.
[12] Yoshiyuki, S, . Ryouji S, M, Taichi, N. Takayuki, 2005. Hydrothermal synthesis of zeolite A
using blast furnace slag, ISIJ. Int. 45: 937-945.
[13] Morayama, N., Yamamoto, H., Shibata, J. 2002. Mechanism of zeolite synthesis from coal
fly ash by alkali hydrothermal reaction, Int. J. Mineral. Process. 64: 1-17.
[14] Wajima, T., Haga, H., Kuzaa, , K. Ishimoto, K.and Tamada, O., K. Ito, T. Nishiyama, R.T.
Downs, J. F. Rakovan, Zeolite synthesis from paper sludge ash at low temperature with addition
of diatomite, J. Hazard. Material. B132 (2006) 244-252.
[15] Fernandes N.R.C. -Machado, D.M.M.Miotto. 2005. Synthesis of NaA zeolitew and Xzeolite from oil shale ash, Fuel 84:2289-2294.
[16] Ong, S.T. 2009. The removal of basic and reactive dyes using Quartenised sugar cane
bagasse. Journal of Physical Science 20 (1) 59-74.
Page 670

July 9-11, 2012
STP217-62
L-Alanine production from glycerol by Escherichia coli alanine

racemase-deficient mutant expressing alanine
dehydrogenase gene
Chanapa Onpana,b, Rujirut Hatrongjitb, Kanoktip Packdibamrungb

Program in Biotechnology, Faculty of Science, Chulalongkorn University,
Pathumwan, Bangkok, 10330, Thailand
b
Department of Biochemistry, Faculty of Science, Chulalongkorn University,
Pathumwan, Bangkok, 10330, Thailand
E-mail: kanoktip.p@chula.ac.th
a
ABSTRACT
L-Alanine is used as a sweetener agent. To produce L-alanine from glycerol, alanine
dehydrogenase gene (aladh) from Aeromonas hydrophila was cloned into pET-22b vector, namely
pET-22bAlaDH. The recombinant plasmid was expressed in Escherichia coli KR, an E. coli
MB2795 alanine racemase deficiency mutant containing T7 RNA polymerase on its chromosome.
The enzyme specific activity was about 20.8 U/mg protein. The clone produced the maximum Lalanine of 0.027 g/l when it was cultured in minimum medium containing 3 % (v/v) glycerol at 37
C, 250 rpm, for 144 h without IPTG induction. Surprisingly, L-alanine production using glycerol
was 1.4 fold higher than that cultured in 3 % (w/v) glucose at the same condition.
Keywords: L-alanine production, L-alanine dehydrogenase, Escherichia coli, glycerol
INTRODUCTION
L-Alanine is an amino acid which used for food additive as a sweetener agent and
pharmaceutical applications. It can be synthesized from pyruvate by alanine dehydrogenase
(AlaDH, EC 1.4.1.1) (Suye et al., 1992).
Generally, glucose is used as a sole carbon source for L-alanine production. Other carbon
sources have not been reported so far. Glycerol tends to be an alternative carbon source for amino
acid production by E. coli because it is a huge by-product from biodiesel process.
The aim of this study was investigation of L-alanine production using glycerol as a carbon
source by a recombinant E. coli. Previously AlaDH from Aeromonas hydrophila was screened in
our laboratory. The resting cell of recombinant E. coli BL21(DE3) expressing AlaDH of A.
hydrophila could produce L-alanine from pyruvate but the mixture of DL-alanine in a ratio of 3:2
was observed. The mixture of D-alanine caused by the activity of alanine racemase (AlaR) which
isomerized L-alanine to D-alanine, an essential component of peptidoglycan layer in cell wall
(Matsushashi, 1994). AlaR encodes by alr and dadX genes (Galkin et al., 1997). Therefore, E. coli
MB2795, an alanine racemase-deficincy mutant (alr-, dadX-) was selected to use as a host cell in
order to improve high purity of L-alanine.
Page 671

July 9-11, 2012
Plasmid and bacterial strain
A pET-22b vector containing T7lac promoter was used for cloning and expression of aladh.
A pAlaDH, a pRSFDuet-1 vector containing aladh of A. hydrophila (NC 008570) was used as
a template.
E. coli MB2795 alanine racemase-deficincy mutant (genotype: F- - ilvG- rfb-50 rph-1
alr::frt dadX::frt), kindly gift from Dr. Michael J. Benedik, University of Houston, U.S.A., was
used as a host cell.
Medium
LB medium (Sambrook et al., 1989) was used for routine bacterial growth and seed cultured.
LB medium consisted of (per liter): 10 g peptone from casein, 5 g NaCl and 5 g yeast extract.
Solid medium, 1.5 % (w/v) of agar was added.
Minimum medium (Khamduang, 2009) was used to study L-alanine production. One L of
minimum medium consisted of 3 % (v/v) of glycerol or 3 % (w/v) of glucose, 50 g (NH4)2SO4,
0.81 g MgCl2, 2.43 g KH2PO4, 2.43 g K2HPO4, 0.085 g yeast extract, 0.0085 g thiamine-HCl,
0.002 g FeSO4, 0.002 g MnSO4, 0.05 g CaCl2, and 0.01 g ZnSO4. The MgCl2 and thiamine-HCl
were prepared and steriled separately.
The pH of medium was adjusted to 7.4 with NaOH. Medium was steriled by autoclaving at
121 C for 15 min and supplemented with 100 g/ml ampicillin and 0.5 mM of D-alanine.
Construction of recombinant E. coli clone
The host cell, E. coli MB2795 was improved, by insertion of T7 RNA polymerase gene (T7
gene 1) into its chromosome in order to use as a host cell for expression of aladh gene under T7
promoter. Briefly, E. coli MB2795 was cultured in LB medium supplemented with 0.2 % maltose,
10 mM MgSO4 and 0.5 mM D-alanine at 37 C with shaking at 250 rpm until the OD600 reached
0.5 and then kept at 4 C. T7 gene 1 was inserted into chromosome of E. coli MB2795 using DE3
lysogenization kit (Novagen). Insertion of T7 RNA polymerase was proved by PCR amplification.
The whole aladh gene with T7lac promoter was amplified using T7pro2_EcoRI (CCGGAA
TTCACGGCCGCATAATCGAAATTAATAG) and R_AlaDH_HindIII (CCCAAGCTTCAGTT
CAGCAGGGTCAGGG) as forward and reverse primers, respectively. The whole aladh gene was
digested with EcoRI and HindIII and ligated into pET-22b. The pET-22bAlaDH was then
transformed into E. coli KR by electroporation.
Expression of recombinant E. coli clone
Cell harboring the recombinant plasmid was cultured in LB medium at 37 C, 250 rpm until
the optical density reached 0.6 and then 0.4 mM IPTG was added. The cell was cultured for 4 h
and harvested by centrifugation at 8,000 xg for 15 min. The cell pellet was resuspended in 5 ml of
cold
Page 672

July 9-11, 2012
extraction buffer (0.1 M potassium phosphate buffer, pH 7.4 containing 0.1 mM PMSF, 0.01 mercaptoethanol and 1.0 mM EDTA) and then broken by discontinuously sonication on ice. The
supernatant was stored at 4 C for enzyme and protein assays.
AlaDH activity was assayed by spectrophotometric method. One ml of reaction mixture
consisted of 200 mol glycine-potassium chloride-potassium hydroxide buffer, pH 10.5, 20 mol
L-alanine, 1 mol NAD+, and enzyme. In a blank tube, L-alanine was replaced by water.
Incubation was carried out at 30 C for 5 min. The reaction was started by addition of NAD+ and
was monitored by measuring the initial change in absorbance of NADH at 340 nm. One unit of the
enzyme is defined as the amount of enzyme that catalyzes the formation of 1 mol of NADH in 1
min. Specific activity is expressed as units per milligram of protein. Protein was determined by the
method of Lowry et al. (1951).
Study of L-alanine production by the recombinant E. coli clone
A single fresh colony was cultured in 100 ml LB medium supplemented with 100 g/ml
ampicillin with shaking at 250 rpm, 37 C for overnight. A 2.5 % of seed culture was inoculated
into 200 ml of minimum medium contained each 3 % (v/v) glycerol or 3 % (w/v) glucose. The
cells were cultured until the optical density at 600 nm reached 0.5-0.6 and then the 0.25, 0.5 and
1.0 mM IPTG was added.
The L-alanine concentration was analyzed by HPLC (Shimadzu class 10ADVP Japan) after
pre-column derivatized with 1-fluor-2-4-dinitrophenyl-5-L-alanine amide (FDAA, Marfeys
reagent) according to Marfeys methods (Bhushan and Bruckner, 2004). Briefly, 100 l of sample
and 40 l of 0.1 M NaHCO3 were mixed with 200 l of 1 mg/ml of FDAA in acetone and
incubated at 40 C for 1 h. Sixty l of 1 M HCl was added to stop the reaction. Sample was applied
to C18 reversed phase column (4.6 250 mm) and eluted with 65:35 of 0.05 M triethylamine
phosphate buffer, pH 3.2 and acetonitrile at 25 C with flow rate 1.0 ml/min. Peaks were detected
by UV detector at 340 nm. Cell growth was determined by measuring the optical density at 600
nm.
RESULTS
Construction of recombinant E. coli clone
T7 RNA polymerase gene (T7 gene 1) was successfully integrated into chromosome of E. coli
MB2795 (alr-, dadX-). The insertion of T7 RNA polymerase gene (2.7 kb) on the chromosome of
E. coli MB2795 was confirmed by PCR amplification. The results showed the band of PCR
product of 2.7 kb as expected. The constructed E. coli clone containing T7 RNA polymerase was
named E. coli KR.
The amplified PCR product of aladh showed only single sharp band of expected gene
fragment of 1.1 kb. The pET-22bAlaDH (6.6 kb) was successfully constructed. The pET22bAlaDH was transformed into E. coli KR. Eight of recombinant clones were randomly picked
for plasmid extraction. The inserted gene was preliminary checked by double digestion at the
cloning sites (Figure 1). The recombinant plasmids that gave two strong bands of linear plasmid
vector (5.5 kb) and inserted gene fragment (1.1 kb) were chosen for the next experiments.
Page 673

July 9-11, 2012
M1 2
Bp
10,000
3,000
1,000
500
Figure 1 Restriction pattern of pET-22bAlaDH Lane m: 100 bp DNA ladder, Lane 1: pET22bAlaDH digested with EcoRI-HindIII, and Lane 2: PCR product of aladh
Expression of alanine dehydrogenase
Eight transformants of E. coli KR harboring pET-22bAlaDH were randomly picked for
AlaDH activity assay. The results are shown in Table 1. The transformants gave various levels of
AlaDH total activity and specific activity from 816-1,910 U and 12.8-20.8 U/mg protein,
respectively. The protein patterns detected by 12.5 % SDS-PAGE are shown in Figure 2. A
subunit of AlaDH has molecular weight about 38 kDa. The transformant No. 3 which showed the
highest specific activity of 20.8 U/mg protein was chosen for nucleotide sequencing. It displayed
100 % identity with its parent clone.
Table 1 AlaDH activity from crude extract of E. coli KR harboring pET-22bAlaDH
Clone
E. coli BL21(DE3)
harboring pAlaDH
E. coli KR
E. coli KR
harboring pET-22b
Transformant No. 1
Transformant No. 2
Transformant No. 3
Transformant No. 4
Transformant No. 5
Transformant No. 6
Transformant No. 7
Transformant No. 8
Total
Cell wet AlaDH
total activity protein
weight
(mg)
(g)
(U)
AlaDH
specific
activity
(U/mg
protein)
0.88
2300
66.1
34.8
0.92
0.0
77.3
0.0
0.97
0.0
50.4
0.0
0.80
0.73
0.90
0.83
0.77
0.96
0.63
0.69
1180
1250
1910
1570
1150
1590
1250
816
69.5
65.9
91.9
80.1
59.5
91.4
71.4
64.0
17.0
19.0
20.8
19.6
19.3
17.4
17.5
12.8
Page 674

July 9-11, 2012
Figure 2 Protein pattern of recombinant E. coli KR harboring pET22bAlaDH induced with 0.4
mM IPTG for 4 h detected by SDS-PAGE Lane M: Protein marker, Lane C: E. coli KR harboring
pET-22b vector, Lane 1-8: E. coli KR harboring pET-22bAlaDH No.1-8
L-Alanine production of E. coli KR harboring pET-22bAlaDH
The effect of IPTG concentration on L-alanine production by E. coli KR harboring pET22bAlaDH in glycerol medium is shown in Figure 3. Without IPTG induction, concentration of Lalanine reached the maximum of 0.027 g/l at 144 h after that it kept constantly. When 0.25, 0.5 and
1.0 mM IPTG was induced, the clone produced 0.024 g/l of L-alanine at 120 h. Cells growth
reached the stationary phase at 120 h at all conditions of IPTG induction and then slightly
decreased. The result showed that E. coli KR harboring pET-22bAlaDH produced the highest
amount of L-alanine (0.027 g/l) when the clone was cultured without IPTG induction for 144 h.
Figure 3 L-Alanine production (solid symbols) and cell growth (open symbols) of E. coli KR
harboring pET-22bAlaDH. Cell was cultured in 200 ml of minimum medium contained 3 % (v/v)
glycerol at 37 C, 250 rpm without IPTG induction (diamonds), induced with 0.25 mM IPTG
(squares), 0.5 mM IPTG (triangles), and 1.0 mM IPTG (circles).
The results of the optimization of IPTG concentration for L-alanine production by E. coli KR
harboring pET-22bAlaDH in glucose medium are shown in Figure 4. The clone produced the
Page 675

July 9-11, 2012
highest L-alanine concentration when it was induced with 0.5 mM IPTG. Induction with 0.5 mM
IPTG, the clone produced 0.019 g/l of L-alanine at 72 h after that L-alanine concentration was
slightly constant. Cell growth at various IPTG concentrations did not significantly different. OD600
reached the maximum approximately 0.6 at 36 h and then slightly decreased.
DISCUSSION
The T7 RNA polymerase gene was successfully introduced into chromosome of E. coli
MB2795 to use as an expression host cell for pET vector system. The constructed host was
Figure 4 L-Alanine production (solid symbols) and cell growth (open symbols) of E. coli KR
harboring pET-22bAlaDH. Cell was cultured in 200 ml of minimum medium contained 3 % (w/w)
glycerol at 37 C, 250 rpm without IPTG induction (asterisks), induced with 0.25 mM IPTG
(squares), 0.5 mM IPTG (triangles), and 1.0 mM IPTG (circles).
named E. coli KR. As the results, AlaDH activity of E. coli KR harboring pETAlaDH (20.8
U/mg protein) was lower than E. coli BL21(DE3) harboring pAlaDH (34. 8 U/mg protein) about
1.7 fold. The pET-22b is a high expression vector (copy number>100) which contained the T7lac
promoter similarly with pRSFDuet-1 vector. The expression levels of E. coli KR harboring pET22b was lower than E. coli BL21(DE3) harboring pAlaDH. That might be caused from the
difference host used. E. coli KR harboring pET-22bAlaDH could produce L-alanine when the
clone was grown in minimum medium containing glycerol or glucose as carbon sources. The clone
growing in glycerol medium produced 1.4 fold of L-alanine higher than that growing in glucose
medium. Cost of glycerol is lower than glucose about 2 fold. Therefore, using glycerol will be an
advantage in industrial scale. Moreover, the results also showed that the clone produced the
maximum of L-alanine when it was cultured without IPTG induction. It will be useful for Lalanine production in a large scale because it did not require any expensive supplement of IPTG.
While using glucose, the clone produced the maximum of L-alanine when it was induced with 0.5
mM IPTG.
Page 676

July 9-11, 2012
This is the first report described on L-alanine production from glycerol. However, the L-alanine
production was still low. For further improvement, appropriate medium components should be
investigated such as the concentration of glycerol and ammonium sulfate.
ACKNOWLEDGEMENTS
This study was partially support from Chulalongkorn University graduate scholarship to
commemorate the 72nd anniversary of His Majesty King Bhumibol Adulyadej.
Page 677

July 9-11, 2012
REFERENCES
Bhushan. R., and Bruckner, H. 2004. Marfeys reagent for chiral amino acid analysis. Amino
Acids 27: 231-247.
Galkin, A., Kulakova, L., Yoshimura, T., Soda, K., and Esaki, N. 1997. Synthesis of optically
active amino acids from -keto acids with Escherichia coli cells expressing heterogouse genes.
Applied and Environmental Microbiology 63: 4651-4656.
Khamduang, M., Packdibamrung, K., Chutmanop, J., Chisti, Y., and Srinophakun, P. 2009.
Production of L-phenylalanine from glycerol by recombinant Escherichia coli. Journal of
Industrial Microbiology and Biotechnology 36: 1267-1274.
Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. 1951. Protein measurement with
the Folin phenol reagent. Journal of Biological Chemistry 193: 265-275.
Matsushashi, M. 1994. Utilization of the liquid linked precursors and the formation of the
peptidoglycan in the process of all cell growth and division: Membrane enzymes involved in
the final step of peptidoglycan synthesis and the mechanism of their regulation. The
Netherlands: Elsevior Science B.V. New York.
Suye, S. I., Kawagoe, M., and Inuta, S. 1992. Enzymatic production of L-alanine malic acid with
malic enzyme and alanine dehydrogenase with coenzyme regeneration. Canadian Journal
Biochemical Engineering 34: 306-312.
Page 678

July 9-11, 2012
STP218-63
High Selenium-Enriched Yeast Production
Prakaidoy Ditsayabut1, Pakanit Kupittayanant2, Chokchai Wanapu1

1
School of Biotechnology, 2School of Animal Production Technology,
Institute of Agricultural Technology,
Suranaree University of Technology, 111 University Avenue, Maung,
Nakhon Ratchasima 30000, Thailand
E-mail: prakaidoy_sut@hotmail.com, pakanit@sut.ac.th, wanapu@sut.ac.th
ABSTRACT
This paper describes a fermentation protocol for production of selenium-enriched yeast.
Saccharomyces bayanus was selected because of its high Se accumulation. S. bayanus was tested
and 1.075 mg/mL dry cell weight was obtained after 42 h. The organic Se was obtained 1 mg
DWC by optimal Na2SeO3 addition for 20 mg/L. The organic Se was accumulated gradually with
increasing DCW (6.4310-3 mg/mg DCW) and the Se uptake level achieved 2.2910-10 mg/cell
yeast was achieved in a 5 L fermentor for 42 h cultivation.
Keywords: Fermentation, Saccharomyces bayanus, selenium-enriched yeast, sodium-selenite
INTRODUCTIONI
At high concentration, selenium (Se) is toxic and affects the central nervous system [1].
However, at low concentration, Se is an essential element for animal and human diets [2]. Se has
structural and enzymatic roles as antioxidant and catalyst for the production of the active thyroid
hormone; Se is needed for the proper functioning of the immune system and appears to be a key
nutrient in inhibiting HIV progression to AIDS [3]. An elevated Se intake may be associated with
reduced cancer risk. Se showed cancer protective effect and inhibition of the tumour cell invasion
[4, 5]. It is generally believed that the ingestion of the organic Se compounds is better and safe
than that of the inorganic Se. Some microorganisms produce biomass with high protein content
and meanwhile transform inorganic Se (a low bio-availability, potentially toxic) into organic form
(safe and highly bioactive). Organic Se complexes and Se containing amino acids are considered
to be the most bio-available for human and animal [6]. Under appropriate conditions, yeasts are
capable of accumulating large amounts of trace elements such as Se and incorporating them into
organic compounds [7]. This mineral is absorbed during the yeast growth process. The ability of
Saccharomyces cerevisiae to transform inorganic Se into organo-selenium compounds (especially
selenomethionine) is known and it is dependent on growth conditions. Yeast is able to accumulate
high concentrations of Se (3 mg/g) [8] and transform inorganic Se mainly into selenomethionine
[9, 10]. Continuous fermentations in optimum medium of sodium selenite (Na2SeO3) demonstrated
higher biomass and selenium content compared to the fermentation with sodium selenate
(Na2SeO4) [11]. Yeast is known for its high protein content and therefore, more Se can be
incorporated by replacement of sulphur in proteins compared with Se from plant sources. Also, the
Page 679

July 9-11, 2012
industrial production of yeast is more manageable than the industrial production of Se enriched
plants. The Saccharomyces clade is composed of seven
species: S. bayanus, S. cariocanus, S. cerev isiae, S. kudriavzevii, S. mikatae, S. paradoxus and S.
pastorianus. Among these species,
S. cerevisiae and S. bayanus are known for
their role in
alcoholic fermentation. S. bayanus has some specific properties: cryotolerance, production of
smaller amounts of acetic acid and ethanol, but higher amounts of glycerol and succinic acid [12].
The primary object in this work is to construct a simple and robust control strategy for Se
enriched yeast production using single dose addition of sodium selenite.
Raw Material
Fourteen yeast strains from different genera and species were tested to identify a strain with
high biomass and high enrichment of Se. Cells of strains for selection were inoculated on YM
medium (yeast extract, 3 g/L; malt extract, 3 g/L; peptone, 5 g/L; glucose, 10 g/L) containing Se
concentrations of 10 mg/L (Na2SeO3) at 300.5 C and 200 rpm.
Sample Preparation
S.bayanus was pre-grown aerobically for 24 h in YM medium. Fermentative medium was
inoculated with 10% (v/v) seed liquid and then cultivated for 48 h on a rotary shaker. The starter
fermentative conditions of volume, temperature and shaking speed were fixed at 10% [v/v]
inoculums, 300.5 C and 200 rpm, respectively. Inorganic Se was added to the sterile medium
before the start of yeast cultivation as a solution of Na2SeO3, at a concentration of 10, 20, 30,
40, 50, 60 mg/L Na2SeO3. Initial Na2SeO3 concentrations in the medium were 0 mg/L in control.
Fermentation
The culture medium was sterilized for 20 min at 121 C. The first pre-culture (50 mL seed
medium in 250 mL shake flask) was inoculated with a single colony, cultivated on a rotary shaker
at 30 C for 24 h. To ensure all yeast preparations started with the same amount of cells, aliquots
containing 1107 cell/mL and then inoculated in a 5 L fermentor (Sartorius Biostra, Germany)
with initial working volume of 4 L. The agitation speed were set at 200 rpm. Culture temperature
was kept at 300.5 C. Aeration was maintained at 1 air working volume per minute (vvm).
Inorganic Se was added to the sterile medium before the start of yeast cultivation as a solution of
Na2SeO3, at a concentration of 20 mg/L Na2SeO3 [13].
Analytical Methods
Ten milliliters of the culture medium was centrifuged at 4,000 rpm for 10 min and washed
twice with the deionized water. The cell was dried at 70 C with a drying oven for 48 h to obtain
dry cell for the estimation of dry cell weight (DCW, mg/ml). At the same time the samples
optical density (OD) was measured spectrophotometrically at 660 nm. Measurements of total Se
accumulation were performed by Inductively Coupled Plasma Mass Spectrometry (ICP-MS
method). Cells were harvested by centrifuging for 5 min at 4,000 rpm and then washed three times
in deionized water to remove surface - bound Se. The digestion of the samples (10 mL) was
performed with 10 L HCl (30%) and 50 L H 2 O 2 (30%) at 90 C for 1 h. This solution was then
filtered through a 0.25 m nylon membrane filter and the total Se concentration was determined
Page 680

July 9-11, 2012
using ICP-MS using conditions in Table 1. The number of yeast cells/mL was determined by
counting under a microscope. The assays are performed in triplicate.
Table 1 Operating condition for total Se determination.
Parameter
ICP-MS conditions
Reflected power
1550 W
Sampling depth
8 mm
Carrier gas
0.85 L/min
Makeup gas
0.34 L/min
Nebulizer pump
0.08 rps
Spray chamber time
2 C
RESULTS
Effect of Na2SeO3 Single Addition on Se Accumulation
S. bayanus showed the highest to Se (10 mg/L Na2SeO3) accumulation potential after repeating
the procedure 3 times. Organic Se content was calculated by Se concentration against DCW and
the number of yeast cell/mL (Fig. 1, 2).
Fig. 1 Yeast strains were cultured in 20 mg/L Na2SeO3 and analyzed the incorporated Se
concentration against DCW.
Page 681

July 9-11, 2012
Fig. 2 Yeast strains were cultured in 20 mg/L Na2SeO3 and analyzed the incorporated Se
concentration against the number of yeast cell.
S. bayanus cultivated in the media with different concentrations of Se (10, 20, 30, 40, 50 and
60 mg/L). Growth of yeast was inhibited by the presence of Se in medium and
this
inhibition correlated with Se concentration. Increase of Se concentration from 10 to 60 mg/L
diminished specific growth rate from 0.180 to 0.055 h-1 (Fig. 3). Na2SeO3 was added to the liquid
medium immediately after the inoculation of the yeast. The final concentration of Na2SeO3 in each
medium was 10, 20, 30, 40, 50 and
60 mg/L. All experiments were performed in duplicate.
After 48 h, the yeast was harvested and then digested to determine the total Se in the yeast. The
different concentrations of Se added to the yeast were summarized in Fig. 4. The more Se added to
the yeast, the yeast growth was inhibited (Se in cell smaller when increasing the amount of Se
added to the yeast from 10 to 60 mg/L). S. bayanus showed the highest to Se (20 mg/L Na2SeO3)
accumulation potential at 48 h.
Fig. 3 Growth of yeast in the media with different concentrations of Se, mg/L.
Page 682

July 9-11, 2012
Fig. 4 Enrichment of S. bayanus with various concentration of Se.

We conclude that S. bayanus showed the highest to Se (20 mg/L Na2SeO3) accumulation
potential. The scale up experiments were carried out in a 5 L fermentor. Na2SeO3 was added to the
liquid medium immediately after the inoculation of the yeast. The final concentration of Na2SeO3
in was 20 mg/L. As indicated in Fig. 5, Se was accumulated gradually with the increase of DCW
and of the number of cells. Over 36 h of fermentation, the increase of pH indicated autolysis of the
cells. The final biomass reached 0.955 mg/mL and the Se uptake level achieved 2.2310-10
mg/cell. However, S. bayanus showed the highest to Se accumulation potential at 42 h. The Se was
accumulated gradually with the increase of DCW (6.43 g/mg DCW) and the Se uptake level
achieved 2.29 pg/cell. High concentration of sodium selenite in the culture medium had a strong
inhibitory effect on the growth of yeast [14]. It seemed that Se accumulation depended on the
biomass density, the phase of growth, treatment time and sodium selenite concentration. The
decrease in cell growth can be attributed to selenium's role as a toxic and growth inhibiting
element by formation of selenium binding proteins (SBP), modulating properties of growth
regulatory protein. Many Se compounds have dramatic affects upon the viability of the cells, on
the cell cycle, on protein synthesis and DNA integrity when studied in cell culture [15]. Selenite
changes the glutathione, phases of cell division and protein synthesis, selenite can cause DNA
damage and induce apoptosis. Thus, enhanced anti-oxidative defense status seems to be beneficial
for the growth and survival of yeast cells.
Fig. 5 The effect of Na2SeO3 single addition on Se accumulation in a 5 L fermentor.
Page 683

July 9-11, 2012
CONCLUSION
Organically bound Se yeast was produced with high cell density fermentation. S. bayanus was
tested and 1.075 mg/mL dry cell weight was obtained after 42 h cultivation in a 5 L fermentor.
Then the optimal pattern of Na2SeO3 addition was 20 mg/L Na2SeO3 against 1 mg DCW. To
balance the Se incorporation and optimum growth of the yeast, the fermentation was conversion of
organic Se by the single dose addition of Na2SeO3. The Se was accumulated gradually with the
increase of DCW (6.43 g/mg DCW) and the Se uptake level achieved 2.29 pg/cell, which
exhibited a potential for industrial application. Future work, Organic Se and inorganic Se will be
tested efficiency of reproductive in boar.
Page 684

July 9-11, 2012
REFERENCES
[1] J. P. Diaz-Alarcon, M. Navarro-Alarcon, L. G. D. L. Serrana and M. C. Lopez-Martinez,
Determination of Selenium levels in vegetables and fruits by hydride generation atomic
absorption spectrophotometry, J. Agric. Food Chem 42, pp. 2848-2851.
[2] P. Kiffney and A. Knight, The toxicity
and bioaccumulation of selenate, selenite,
and seleno-L-methionine in cyanobacterium Anabaena flos-aquae. Arch Environ Contam Toxicol
19, (1990), pp. 488-494.
[3] M.P. Rayman, The importance of selenium to human health, The National Center for
Biotechnology Information, The Lancet 356 (9225), (2000), pp. 233-241.
[4] H. Yin, Z. Chen, Z. Gu, Y. Han, Optimization of natural fermentative medium for seleniumenriched yeast by D-optimal mixture design, LWT-Food Sci. and Tech 42, (2009), pp. 327-331.
[5] H. Zeng and G. F. Combs, Selenium as an anticancer nutrient: roles in cell proliferation and
tumor cell invasion, J Nutr Biochem 19 (1), (2008), pp. 17.
[6] X. Zhou, Y. Wang, Q. Gu and L. Weifen, Effects of different dietary selenium sources
(selenium nanoparticle and selenomethionine) on growth performance, muscle composition and
glutathione peroxidase enzyme activity of crucian carp (Carassius auratus gibelio), Aquaculture
291, (2009), pp. 7881.
[7] A. Suhajda, J. Hegoczki, B. Janzso, I. Pais and G. Vereczkey, Preparation of selenium yeasts I.
Preparation of selenium enriched Saccharomyces cerevisiae, J Trace Elem Med Biol 14 (1),
(2000), pp. 4347.
[8] M. Korhola, A. Vainio and K. Edelman, Selenium yeast. Ann Clin Res 18, (1986), p. 65.
[9] C. A. Ponce de Len, M. M. Bayn, C. Paquin and A. Caruso, Selenium incorporation into
Saccharomyces cerevisiae cells: A study of different incorporation methods. J. Appl. Microbiol 92,
(2002), p. 602.
[10] L. H. Reyes, F. Moreno Sanz, P. Herrero Espilez, J.M. Machante-Gayn, J. I. Garca Alonso
and A. Sanz-Medel, Biosynthesis
of isotopically enriched selenomethionine application to its
accurate determination in seleniumenriched yeast by isotope dilution analysis HPLC-ICP-MS. J.
Anal. At. Spectrom 19, (2004), p. 1230.
[11] Ali Demirci, L. Anthony, Pometto III, Production of Organically Bound Selenium Yeast by
Continuous Fermentation, J. Agric. Food Chem 47, (1999), pp. 2491-2495.
[12] Christine Le Jeune, Marc Lollier, Cat herine Demuyter, Claude Erny, Jean-Luc
Le gras,
Michel Aigle and Isabelle Masneuf Pomare`de, Characterization of natural
hybrids of
Saccharomyces cerevisiae and Saccharomyces bayanus var. uvarum, FEMS Yeast Res 7, (2007),
pp. 540-549.
[13] Zheng Wang, Liyang Zhang and Tianwei Tan, High cell density fermentation of
Saccharomyces cerevisiae GS2 for selenium-enriched yeast production, Korean J. Chem. Eng
27(6), (2010), pp. 1836-1840.
Page 685

July 9-11, 2012
[14] A. Demirci, A. L. Pometto and D. J. Cox, Enhanced organically bound selenium yeast
production by fed-batch fermentation, J. Agric. Food Chem 47, (1999), p. 2496.
[15] A. Suhajda, J. Hegoczki, B. Janzso, I. Pais and G. Vereczkey, Preparation of selenium yeasts
I. Preparation of selenium-enriched Saccharomyces cerevisiae. J. Trace Elem. Med. Bio 14,
(2000), p. 43.
Page 686

Proceedings of BUU Conference 2012

Hochgeladen von

Dokumentinformationen

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

Proceedings of BUU Conference 2012

Hochgeladen von

Copyright:

Verfügbare Formate

PROCEEDINGS OF THE BURAPHA

9-11 JULY 2012

JOMTIEN PALM BEACH

The Effect of Music Therapeutic and Exercise on the Quality of Life in

The Effect of Language Handbook Guideline for Developing English and

Isolation of the cellulose degrading microorganisms from three earthworm

Using Scanning Electron Microscope to study the effects of different

Influence of TiO2/PLA Biocomposite Supporter on Photocatalytic

Burapha University International Conference 2012

The Effect of Music Therapeutic and Exercise on the

Cancer is a disease associated with mental health. Spiritual discipline and

Burapha University International Conference 2012

Burapha University International Conference 2012

The quality of life is used to evaluate the general well-being of individuals,

Burapha University International Conference 2012

Comparison of level quality of life

Burapha University International Conference 2012

* p value < .05

Burapha University International Conference 2012

* p value < .05

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Barefoot Running: Systemic Review

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Factors Predicting the Physical Activity Participation

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Walking mile without

Climb 10 steps without

Stand 2 hours without

Reach over head

Use fingers to grasp

Lift or carry 10 pounds

Push or pull large

Burapha University International Conference 2012

Table 3 presents the frequency and percent distribution of psychological issues in

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

Burapha University International Conference 2012

MOTIVATIONS OF STUDENTS TO PARTICIPATE IN

Tri Thien Huynh1 and Kim Ngan Huynh Nguyen2

Burapha University International Conference 2012