130

Overexpression of the GSH2 gene in Saccharomyces

cerevisiae

Dra. Aparicio Fabre Rosaura, Domnguez Galarza Saira Yumara, Escamilla-Romero Miroslava
(ERMO142185@upemor.edu.mx)
Boulevard Cuauhnhuac #566, Col. Lomas del Texcal, Jiutepec, Morelos. CP 62550
Abstract
Under the presence of oxidative stress; Antioxidants are an axis of protection against the production of reactive species,
these include enzymatic and non-enzymatic types; Glutathione in its reduced form is a type of non-enzymatic defense, and
is one of the first lines of defense against oxidant damage. The biological functions of glutathione involve it is participation
as: antioxidant, neuromodulator, detoxifying, so it is deficiency is important in the pathophysiology of neurodegenerative
diseases. Glutathione peroxidase (GPX) is a type of oxidoreductases that catalyze the reduction of hydrogen peroxide and
organic peroxides using in both cases reduced glutathione as an electron donor. GPX is a selenium dependent enzyme very
specific for reduced glutathione (GSH), but unspecific for hydroperoxides. This, together with the fact that GPX is found in
the mitochondria, the cytosol and the cell membrane, makes it a mechanism of important cellular protection against oxidative
damage produced to proteins, nucleic acids and membrane lipids.

Introduction
Free radicals are unpaired and highly reactive atoms or
molecules, usually oxygen molecules which are capable of
oxidizing many biological molecules such as carbohydrates,
amino acids, fatty acids and nucleic acids.
The microorganisms have developed antioxidant defense
systems to retard or inhibit the oxidation of said substrates.
Glutathione is one of the most important intracellular
antioxidants in the microorganisms that acts against oxidative
damage, in this project we are looking for the overexpression
of the GSH2 gene (glutathione peroxidase) in yeast
saccharomyces cerevisiae for the production of this antioxidant
by means of genetic engineering techniques
Objetive
Overexpressing the GSH2 gene in Saccharomyces cerevisiae
Methodology
DNA extraction from S. cerevisiae was performed by technique
of glass beads and thermal shock with phenol:chloroform
toilets. The PCR relaced with chromosomal DNA of S.
Cerevisiae. The oligonucleotids employed were GSH2_Fw (5
GGTC GAATTC ATGGCACACTATCCACCTTCCAAGG 3)
and
GSH2_Rv
(5ACTGGTACCGTACATGTACACCTAGTAAAGAATAATAC
TGTCC3).
The oligonucleotids have a restriction site EcoRI and KpnI
respectively. The condition were: 95 C denturation for 30
seconds, 60 C alignment for 30 seconds, and 72 C extensin
for 90 seconds. 30 cycles of amplification were run. The
product was run on an agarose gel. Both, PCR fragment and
pPICZ A were digest by means of restriction enzymes EcoRI
and KpnI, and then were linked are using DNA ligase. For
transformation Saccharomyces cerevisiae the lithium method
was used.

Figure 1. Plasmid map pPICZ A

Results
To extratc DNA of S. cerevisiae was observed traslucid pellet
and was run in agarose gel 1% observed genome swept.
GSH2 gene fragment was amplified by PCR from DNA after
run in agarose gel 1% where observed a band 2000 bp. This
gene codified for glutathion syntetase, a protein of 491
aminoacids.
We perform a doble digest with enzymes EcoRI and KpnI,
for both fragment and vector were linked and transformed in
S. cerevisiae. Finally we obteined a construction named
pPiz/GSH2 that is able to express protein recombinant, by
inducible promotor.
Discussion and conclusions
GSH2 gene was cloned in yeast vector pPICZ A containing
regulatory sequences for expressing and secretin the
polypeptide product.
In future steps of this study, will be necesary verify
overexpression of the protein in S. cerevisiae
References
Valdivieso Ugarte Magdalena. Production and characterization of glutathione-producing Saccharomyces cerevisiae
strains.
Martinez-Samano, Torres-Durn, Jurez-Oropeza. Glutathione and its association with neurodegenerative diseases,
schizophrenia, aging and cerebral ischemia. 2011.