Sie sind auf Seite 1von 66

II.

Tecnologa del DNA recombinante

Tema 5: Enzimas utilizadas en el manejo del ADN.


ADN

Enzimas comnmente utilizados en biotecnologa


Nucleasas: mellan, cortan o degradan DNA.
g
unen molculas de DNA.
Ligasas:
Enzimas modificadoras: Aaden o eliminan
grupos (T4PNK, CIAP, Transferasas, etc).
Polimerasas: sintetizan DNA o RNA, o bien
completan la sntesis de molculas previas.

Nucleasas
Enzimas que degradan el cido nucleico hidrolizando el
enlace fosfodiester que une un nucletido al siguiente
siguiente.
Pueden actuar en hebra doble hebra sencilla.
Exonucleasas: actan sobre los extremos del DNA,
habitualmente de forma no especfica de secuencia.
Endonucleasas: actan sobre enlaces internos de la
molcula de DNA. Tambin pueden ser especficas de una
secuencia concreta. En este caso, se denominan
endonucleasas de restriccin.

Nucleasas
DNAsa I Endonucleasa que hidroliza DNA de hebra doble
hebra sencilla mediante corte en p
pirimidinas ((C T).
)
Utilizada para experimentos en donde slo debe haber RNA
p.ej.: retrotranscripcin, ensayos de interaccin DNAsProtena (footprinting).
Nucleasa S1 de Aspergillus oryzae degrada DNA de forma
exonucleoltica, procesiva y no especfica de secuencia.
Ribonucleasa A: Endoribonucleasa que acta sobre el RNA
de cadena sencilla degradndolo mediante corte en
pirimidinas (C T). Usada para eliminar RNAs de minipreps.

Nuclease and Source

Exonuclease III
(E. coli)

Substrates, Activity and Uses


Removes mononucleotides from the 3' termini of duplex DNA. The preferred substrates are DNAs with blunt
or 5' protruding ends. It will also extend nicks in duplex DNA to create single-stranded gaps. In works
inefficiently on DNA with 3' protruding ends, and is inactive on single-stranded DNA.
Used most commonly to prepare a set of nested deletions of the termini of linear DNA fragments.

Mung Bean Nuclease


(Mung bean sprouts)

Digests single-stranded DNA to 5'-phosphorylated mono or oligonucleotides. High concentrations of enzyme


will also degrade double-stranded nucleic acids.
Used to remove single-stranded extensions from DNA to produce blunt ends.

Nuclease BAL 31
(Alteromonas)

Functions as an exonuclease to digest both 5' and 3' ends of double-stranded DNA. It also acts as a singlestranded endonuclease that cleaves DNA at nicks, gaps and single stranded regions. Does not cleave internally
in duplex DNA.
Used for shortening fragments of DNA at both ends.

Nuclease S1
(Aspergillus)

The substrate depends on the amount of enzyme used. Low concentrations of S1 nuclease digests singlestranded DNAs or RNAs, while double
double-stranded
stranded nucleic acids (DNA:DNA, DNA:RNA and RNA:RNA) are
degraded by large concentrations of enzyme. Moderate concentrations can be used to digest double-stranded
DNA at nicks or small gaps.
Used commonly to analyze the structure of DNA:RNA hybrids (S1 nuclease mapping), and to remove singlestranded extensions from DNA to produce blunt ends.

Ribonuclease T1
(Aspergillus)

An endonuclease that cleaves RNA at 3' phosphates of guanine residues, producing oligonucleotides terminal
guanosine 3' phosphates.
Used to remove unannealed regions of RNA from DNA:RNA hybrids.

Enzimas de
Restriccin

Corte cohesivo

Corte romo

Eco RI

HaeIII

Enzimas de Restriccin

Vista lateral

Vista Superior

EcoRI con DNA unido

Enzimas de Restriccin
Extremo 5 protuberante

Extremo 3 protuberante

Extremo romo

Enzimas de Restriccin:
Nomenclatura
Gnero
Especie
Cepa
Orden

E RI
EcoRI
Secuencias de reconocimiento palindrmicas

Enzimas de Restriccin: Tipos

Endonucleasas de Restriccin Tipo II


Reconocen una secuencia concreta de nucletidos: La
secuencia frecuentemente es p
palindrmica y de una longitud
g
tpica de 6 nucletidos (variando desde 4 a 20 nucletidos).
Un mismo enzima puede cortar ms de una secuencia
especfica: Hinf1 corta en la secuencia GANTC.
Extremos compatibles y actividad estrella.
Caracterizadas centenares de endonucleasas de restriccin:
Hay disponible software especfico online que permite
determinar las endonucleasas que cortan una secuencia
concreta de ADN.

Endonucleasas de Restriccin Tipo II


Frecuencia de los cortes: Estadsticamente, la frecuencia de
corte
t sera
una vez cada
d 4n nucletidos
l tid ((n= nmero

d
de
nucletidos en la secuencia reconocida). Esto sera 1/256,
1/1024 y 1/4096 para n= 4, 5 y 6.
Se observa que el nmero de sitios de corte es menor: fago
(49Kb) tiene 6 sitios BgII, 5 sitios BamH1 y solo 2 sitios SalI.
Se demuestra que los nucletidos no se distribuyen al azar.
Mapas de Restriccin: mediante digestin con varias
endonucleasas de restriccin se puede caracterizar un ADN.

Organizacin estructural del genoma viral

Bacterifagos, Animales y Vegetales.


DNA y RNA virus
Cadena doble (dos hebras) o sencilla (una hebra).
Molcula lineal o circular.

Anlisis de restriccin del bacterifago : Construccin


de un mapa de restriccin en DNA Lineal
Reproducibilidad de resultados

2 fragmentos (1 corte)
2 fragmentos (1 corte)
3 fragmentos (2 cortes)
3 fragmentos (2 cortes)
4 fragmentos (3 cortes)

Xba1
Xho1
Kpn1
Xba1+Xho1
Xba1+Kpn1

24.0, 24,5 Kb
15.0, 33.5 Kb
1.5, 17.0, 30.0 Kb
9.0, 15.0, 24.5 Kb
1.5, 6.0, 17.0, 24.0 Kb

XhoI XbaI
9.0
XhoI XbaI
15

9.0

24.5

Kb

17

Kb

KpnI
KpnI

15

6.0 1.5

Restriccin
completa

Construccin de un mapa de restriccin en DNA


circular (digestiones completas)

A) Digestiones sencillas

B) Digestiones sencillas
y dobles

Anlisis de restriccin del bacterifago :


Construccin de un mapa de restriccin en DNA lineal

KpnI
KpnI

Kpn1 en condiciones limitantes (restriccin parcial: 0, 1


2 cortes) genera en un ADN lineal 6 fragmentos:
1.5, 17.0, 18.5, 30.0, 31.5 y 48.5 Kb

2 cortes
1 corte
1 corte
1 corte
1 corte
0 cortes

1.5 Kb
17.0 Kb
18.5 Kb
30.0 Kb
31.5 Kb
48.5 Kb

Construccin de un mapa de
restriccin en DNA circular
(digestin parcial de PstI)

DNA Ligasas
En la clula (eucariota y procariota), tienen como funcin
corregir las discontinuidades en la hebra de DNA causadas en
el mecanismo de replicacin de la hebra retardada del DNA,
por la reparacin de errores en la replicacin o bien por
agresiones externas al DNA: qumicas, fsicas, etc.
Su papel en la biotecnologa es el de catalizar la unin de
fragmentos distintos de DNA, tanto si son romos, como si son
cohesivos. Favorecen la formacin del enlace covalente
fosfodister entre 3-OH y 5-fosfato.

Clonaje cohesivo (EcoRI)

10

Accin de las DNA ligasas


Reparacin de mella en la replicacin
(fragmentos de Okazaki)

Accin de las DNA ligasas

Si la T de la reaccin es mayor
que la Tm de los extremos
cohesivos, no hay ligacin: T y
t de reaccin habitual: de 16C
2h a 4 C O/N.

11

Accin de las DNA ligasas

Electroforesis en gel de
agarosa

Fosfatasa alcalina
A) Defosforilacin del vector
OH

OH
OH

OH

OH
OH

B) Ligacin inserto-vector

OH
OH

OH
OH

OH
OH

Inactivacin de CIAP: 75 C durante 10 minutos en presencia de 5 mM EDTA

12

T4 Polinucletido quinasa (DNA y RNA)

Reaccin preferente

Reaccin minoritaria

Propsito:
Fosforilacin de adaptadores.
Marcaje radiactivo de oligonucletidos.

T4 Polinucletido quinasa (DNA y RNA)

13

Transferasa terminal (mamferos)


DNA Polimerasa que cataliza la adicin de nucletidos al extremo 3 de un ADN
(extremo 3 colgante, romo, en DNA lineal o doble).
Propsito: Facilitar los ensayos de clonacin cuando no hay extremos compatibles

Adaptadores Sintetizados Qumicamente


Ejemplo: Adaptadores XbaI-EcoRI.

EcoRI

EcoRI

Siguiente paso: Ligacin en vector previamente linearizado con


EcoRI y defosforilado con Fosfatasa alcalina.

14

RNA Polimerasas de Bacterifagos (Transcripcin in vitro)


1.-Generacin de Ribosondas
marcadas radiactivamente.
2.-Expresin dirigida de protenas
(transcripcin-traduccin
acopladas in vivo/ in vitro).
Sp6, T7 y T3 RNA Polimerasas
slo reconocen sus promotores de
origen viral (incorporados al
vector). RNA Polimerasa de E. coli
no reconoce esos promotores.

Nombre de la RNA Polimerasa

Hospedador del fago

Secuencia del promotor

T7 RNA polimerasa

Escherichia coli

TAATACGACTCACTATAGGG

T3 RNA polimerasa

Escherichia coli

AATTAACCCTCACTAAAGGG

SP6 RNA polimerasa

Salmonella typhimurium

AATTTAGGTGACACTATAGAA

Expresin dirigida de
protenas in vivo (bacteria)

Transcripcin-traduccin
acopladas in vitro (sistema
libre de clulas)

15

DNA Polimerasas: Fragmento Klenow


Subtilisina

1.- Sntesis 5-3 de DNA de doble hebra a partir de DNA de hebra sencilla:
Generacin de sondas marcadas.

DNA Polimerasas: Fragmento Klenow


2.- Rellenado de extremos 3 recesivos para generar extremos romos (sntesis 5-3).

3.- delecin de extremos 3 protuberantes para generar extremos romos (exo 3-5).

Alternativa a Klenow: T4 y T7 DNA Polimerasas.

16

DNA Polimerasas
termoestables

Polimerasa

3'->5'
Exonucleasa

Fuente y Propiedades

Taq

No

De Thermus aquaticus. Su vida media a 95 C es de


1.6 horas. Mayor tasa de error (10-4-10-5)

Pfu

Si

De Pyrococcus furiosus.
furiosus Tiene la menor tasa de error
de todas las DNA polimerasas termoestables
conocidas. Menor tasa de error (10-6).

Vent

Si

De Thermococcus litoralis; Tambin conocida como


Tli polimerasa. Si vida media a 95 C es de
aproximadamente 7 horas. Tasa de error intermedia.

Retrotranscriptasas (DNA Polimerasa RNA dependiente)

1.-Generacin de cDNAs
de doble hebra para
construir genotecas de
expresin.
2.-Generacin de cDNAs
de cadenas sencilla con
los que realizar RT-PCR.

17

II. Tecnologa del DNA recombinante

Tema 6: Tcnicas de anlisis de cidos nucleicos.


nucleicos

Propiedad de
soga rgida
(soluciones
viscosas)

Desnaturalizacin
del dsDNA e hipercromicidad

Desnaturalizacin
reversible

DNA rico
en G+C

DNA rico
en A+T

Integridad de cada cadena e


hipercromicidad a 260 nm

Desnaturalizacin por incremento de


temperatura, o por descenso en la
concentracin de sal

18

Concepto de Hibridacin

Hibridacin In Situ

Estudio de expresin gnica en el desarrollo.


Embrin de pollo, marcado por hibridacin in situ con sondas
cRNA para HNF-17

Estudio de cromosomas

19

Electroforesis en geles de agarosa

20

TRANSFERENCIA

Tcnica Southern:
Transferencia e
hibridacin

21

Interpretacin de
un experimento
de Southern

Northern

22

Electroforesis en geles de acrilamida

Western: Transferencia

23

Western: Resultado

Gel SDS-PAGE

Filtro nitrocelulosa

24

Secuenciacin
enzimtica

Secuenciacin enzimtica
(con nucletido radiactivo)

25

Secuenciacin Automtica
(con cebador marcado con fluorocromo tetrametilrodamina)

Secuenciacin Automtica
(
(con
cuatro fluorocromos
fl
diferentes)
dif
)

26

Cromatograma

Reaccin en cadena de la Polimerasa

27

E
Ecuacin
i del
d l

Componentes de la PCR:
1.
2.
3.
4
4.

DNA molde.
Oligonucletidos.
DNA dep.-DNA polimerasa.
Desoxinucletidos
Desoxinucletidos.

28

Diseo de oligonucletidos

Caractersticas principales de los oligonucletidos usados en PCR:


1.
2.
3.
4.
5.
6.
7.

Tamao entre 15 y 25 nucletidos.


Temperatura de melting entre 50 y 65 C
Contenido en G+C entre un 40% y un 60%
Sin apareamientos internos por autocomplementariedad.
Sin apareamientos 5-3 entre los oligos de la misma pareja por
complementariedad de secuencia en los extremos.
Evitar 3 o ms de 3 purinas o pirimidinas seguidas en el extremo
3 del oligo
Clculo de Tm: 2x(A+T)+4x(G+C) en grados centgrados.

RT-PCR
mRNA completo
(variante larga)

Variante
V
i
de
d splicing
li i
(variante corta)
M C+ C- T1 T2 T3 T4

Completo
Variante 1
Variante 2

Deteccin de variantes de Splicing tejido-especficas

29

II. Tecnologa del DNA recombinante

Tema 7: Vectores de clonacin.


clonacin

Un experimento de DNA recombinante generalmente


presenta el siguiente esquema:
1 El DNA de
1.d un organismo
i
donador
d d se extrae,
t
se corta
t con endonucleasas
d
l
de
d restriccin
t i i y
se liga a otro DNA (vector de clonacin) para formar una nueva molcula de DNA
recombinado (construccin de DNA).
2.- Esta construccin vector de clonacin-DNA insertado se transfiere y mantiene dentro de
una clula hospedadora. La introduccin del DNA en la clula hospedadora se denomina
transformacin.
33.-- Aquellas clulas que han tomado la construccin de DNA (clulas transformadas) se
identifican y seleccionan, separndolas de aquellas que no contienen la construccin.
4.- Si es necesario, la construccin de DNA puede manipularse para asegurarnos que la
protena que es codificada por la secuencia del DNA clonado va a ser producida por la
clula hospedadora.

30

Plsmidos usados en tecnologa del ADN recombinante


Propsito: clonacin general y construccin de genotecas.
1.- Pequeo tamao (3-5 Kb).
2.- Elementos indispensables: ori, MCS, marcadores (resistencia/metablicos) y otros.
3.- Nmero de copias
p ((control de replicacin
p
estricto/relajado).
j
)
4.- Transmisibilidad: Conjugacin (opern traF) y movilidad (oriT).
5.- Compatibilidad de distintos plsmidos en la misma bacteria.

MAPA DE RESTRICCION de pBR322


Nomenclatura: p: plsmido. BR: iniciales
de los investigadores que lo crearon (F.
Bolivar y R. Rodrguez). 322 distingue
este plsmido de otros desarrollados en el
mismo laboratorio (pBR325, 327, 328,
etc).
4361 pb; genes de resistencia a
ampicilina (Ampr) y a tetraciclina (Tetr).
nico sitio de corte BamHI, HindIII y
SalI dentro del gen Tetr; nico sitio de
corte Pst I en el gen Ampr; nico sitio de
corte EcoRI que no est dentro de
ningn DNA codificante.
Origen de replicacin pMB1 (similar al
ColE1) que slo funciona en Escherichia
coli.
Alto nmero de copias.
No puede ser transferido a otra bacteria
(no conjugable ni movilizable).

31

SELECCION NEGATIVA DE CLONES EN pBR322

Filtro de
Nitrocelulosa

Serie pUC
(Universidad de California)

Seleccin Blanco/Azul con X-Gal:


-complementacin

32

-COMPLEMENTACIN
Genoma Bacteriano o bien Plsmido F

Plsmido pUC
RNApol

p
o

Modificacin del Opern lac en plsmido

SELECCION DE CLONES EN pUC POR COMPLEMENTACIN

33

Plsmidos usados en tecnologa del ADN recombinante


Fagmido pBluescript

Seleccin Blanco/
Azul con X
X-Gal
Gal

Clonacin en
extremos cohesivos
(Eco RI)

34

Clonacin en extremos
romos (HaeII)

5 ACGATGGCCACGAT 3
3 TGCTACCGGTGCTA 5
HaeIII

5 ACGATGG
3 TGCTACC

CCACGAT 3
GGTGCTA 5
DNA ligasa

5 ACGATGGCCACGAT 3
3 TGCTACCGGTGCTA 5

Transformacin de Bacterias por Plsmidos

35

Transformacin de Bacterias por Plsmidos

TRANSFORMACION
CON VECTORES DE
EXPRESION
Vectores de expresin
procariticos (T7) y
eucariticos (CMV)

36

Vectores pET de
expresin

Adems de los elementos


indispensables: ori, MCS,
marcadores (resistencia
/metablicos), presenta un
promotor de T7 que promueve
la transcripcin del inserto, y
secuencias RBS que facilitan
su traduccin

Produccin y purificacin de protena


recombinante en E. coli
Protena

Genoma bacteriano
modificado

Protena
Vector

37

Produccin de anticuerpos policlonales

Transcripcin-traduccin acopladas in vitro (sistema libre de clulas)


Produccin de protenas txicas para E.coli

38

Vectores para genotecas: Bacterifago y Csmidos

Vector sin recombinar

Vector recombinante

Stuffer

R: diana de restriccin

Bacterifago : ciclos
ltico y lisognico

39

Bacterifago

20 Kb

9 Kb
Stuffer

Bacterifago como vector de insercin

40

Bacterifago como vector de reemplazamiento

Csmidos

41

Amplificacin del clon via ciclo ltico

Vectores de Clonacin:
Estudio de genes aislados (Lambda, cos) y construccin de mapas fsicos (ACs)
Vector

Tamao
mximo
inserto

N Aprox. de
clones necesarios
en la genoteca

Ventajas

Desventajas

Facilidad p
para construir
genotecas.
Insertos relativamente
estables.

Requiere
R
i muchos
h clones.
l
Dificultad para obtener
DNA de los clones.

lambda

20 kb

5 x 10

csmido

45 kb

2 x 105

Facilidad para construir


genotecas.
Facilidad para obtener
DNA de los clones.

No siempre estable.

YAC

1 Mb

104

Requiere pocos clones


clones.

Muy propenso al
reordenamiento
reordenamiento.
Dificultad para construir.

PAC

~120 kb

105

Se requieren menos clones


que para los csmidos.
Estable.

Origen de replicacin en
copia nica, por lo que es
difcil obtener DNA.

BAC

> 500 kb

5 x 104

Requiere pocos clones.


Muy estable.

Origen de replicacin en
copia nica, por lo que es
difcil obtener DNA.

42

Cromosoma artificial de bacteria (BACs)


Basado en el factor F de E.coli
Seleccin positiva

Seleccin negativa

Resistencia a cloranfenicol
Bajo n de copias

Origen de Replicacin
Bajo n de copias

Replicacin direccional

Cromosoma artificial derivado del bacterifago P1 y del


plsmido pUC (PACs)
pMB1
Inserto

sacB: enzima levanosucrasa


de Bacillus, con actividad
txica para E.coli

Inserto

43

Cromosoma artificial de levadura (YACs)

Cromosoma
artificial de
levadura (YACs)

Seleccin
levadura
CEN: secuencia
centromrica
TEL: secuencia
telomrica

Seleccin
bacteria
Seleccin
levadura

ori
bacteria

Seleccin
levadura

44

II. Tecnologa del DNA recombinante


Tema 8: Estrategias de clonacin y
construccin
t
i de
d genotecas
t

Genoteca de
DNA genmico

1er paso:
construccin de una genoteca
representativa.
2do paso:
aislado de clones de nuestro
inters (screening).

Genoteca de
cDNA

3er paso: subclonacin de


fragmentos seleccionados.

45

Genotecas de Expresin (cDNA):


Representativas cuando respeta el porcentaje de representacin original de
cada mRNA en la clula: ni se pierden los bajamente expresados ni se
sobrerepresentan los muy expresados.

Obtencin de RNA mensajero

46

Obtencin de cDNAss: cebado

Genotecas de Expresin (cDNA)

cDNAds
Ligacin

Amplificacin

Titulacin

cDNAds

47

Amplificacin del clon via ciclo ltico

Genotecas:
Titulacin

48

Ligacin

Genotecas de
DNA genmico
i ( y Cos):
C )

Amplificacin

Representativas cuando poseen un


nmero de clones entre 3 y 10
veces superior al mnimo (tamao
genoma/capacidad vector)

Titulacin

Genotecas de DNA genmico ( y Cos)

Empaquetado preferente de
los recombinantes con
tamao adecuado

49

Genotecas:
Titulacin

50

Bsqueda en Genotecas: Screening (resumen)

Bsqueda en Genotecas: Screening (I)

51

Bsqueda en Genotecas: Screening (II)

Bsqueda en Genotecas: Screening (III)

52

Bsqueda en Genotecas: Screening (IV)

Seleccin de clones positivos


por hibridacin

53

Seleccin de clones positivos


por hibridacin

Seleccin en Genotecas de Expresin (cDNA) por anticuerpos

54

Paseo cromosmico (Genotecas de DNA genmico)

Paseo cromosmico (Genotecas de DNA genmico)

55

Clonacin in silico

Bibliografa
Banco de datos

Previamente
descrita

Secuencia

Generada en el
laboratorio

Genotecas,
Productos de
PCR, Segmentos
aislado por ERs
y clonados, etc

Anlisis
Algoritmos y filtros
Fiabilidad estadstica

Local (software instalado)


Recursos en red (software remoto)

Prediccin
Diseo experimental
Contraste prediccin-resultados
Aplicabilidad

56

II. Tecnologa del DNA recombinante


Tema 9: Mutagnesis y elementos transponibles

57

58

Transposicin
Directa (Simple)
Salta desde un sitio en el
ADN a otro sitio distinto.
Mecanismo de cortar y
pegar

59

Transposones sencillos
Secuencias de insercin o elementos IS
De tamao < 2,000 bp, E. coli contiene 8 copias de IS1 y 5 copias
de IS2.

Repeticiones
terminales cortas
e invertidas

Gen de la Transposasa, genes reguladores

Repeticiones directas
en el ADN husped

Transposones Compuestos
Contienen genes en la regin central, mas dos mdulos del
tipo IS (tanto en la misma orientacin como invertidas)
Los transposones compuestos pueden transportar todo tipo de
secuencias de ADN en su region central

60

Transposones Compuestos

Transposones ms complejos (Tn


Tn))
Transportan genes que no slo estn implicados
en la transposicin (ej. genes de resistencia a
antibiticos)
Tamao > 2,000 pb

61

1. Transposicin Conservativa
(~corta
(~
corta--y-pega
pega))
El e
elemento
e e to se desp
desplaza
a a de u
un ssitio
t o a ot
otro.
o

Transposable Element

Target
Excision & Integration

Donor

Recipient

http://www.public.iastate.edu/~jzhang/Transposition.html

2. Transposicin replicativa
(~copia
(~
copia--y-pega
pega))
El elemento transponible es copiado, de
modo que una copia queda en el lugar de
origen y la otra es desplazada.
Transposable
El
Element
t

Replication

Target
Integration

Donor

Recipient

62

Retrotransposones
1. El DNA del elemento mvil es transcrito para
dar RNA.
2. Este RNA se retro-transcribe para dar cDNA,
que se inserta en el nuevo sitio.
Transcription

Target

RNA
Reverse Transcription
cDNA

Integration

Donor

63

Los efectos de los elementos transponibles


dependen de su localizacin final

PCR

Modificar los extremos de un DNA


(p. ej. Introduciendo dianas de restriccin)

Mutagnesis dirigida

64

65

66