Beruflich Dokumente
Kultur Dokumente
1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Vol. 274, No. 11, Issue of March 12, pp. 70827088, 1999
Printed in U.S.A.
Emmanuel Delhaize, Diane M. Hebb, Keith D. Richards, Jian-Ming Lin, Peter R. Ryan, and
Richard C. Gardner
From the Plant Industry, Commonwealth Scientific Industrial and Research Organisation, GPO Box 1600,
Canberra Australian Capital Territory 2601, Australia and Centre for Gene Technology, School of Biological Sciences,
University of Auckland, Private Bag 92019, Auckland, New Zealand
7082
Yeast Strains and Growth MediaA wheat cDNA library was prepared from an aluminum-resistant wheat line and expressed in the
yeast (S. cerevisiae) strain InVSc2 (Invitrogen, MATa his3-D1 ura3-52).
Other yeast strains (FY833: MATa his3-D200 ura3-52 leu2-D1 lys2D202, trp1-D63; FY73 MATa his3-D200 ura3-52; DBY747-a1: MATa
ade2 his3-D1 leu2-3, 112 ura3-52 trp-289a can1 GAL1 CUPr) were also
used to assess whether selected wheat cDNAs conferred aluminum
resistance in different genetic backgrounds. Yeast strains were propagated on YPD medium or on minimal SC medium supplemented with
amino acids (18). Yeast colonies were assessed on plates for resistance
to aluminum as described below, and in some cases aluminum resistance was also tested in liquid medium (19).
DNA Manipulations, Sequence Analysis, and Preparation of cDNA
LibraryNucleic acids were manipulated using standard methods (20)
and sequenced by the dideoxy chain termination method (21).
The aluminum-resistant wheat line, ET3 (22), was grown in solution
culture, and root apices (0 5 mm) were collected from 5-day-old seedlings exposed to 10 mM aluminum for times ranging from 1 to 48 h. Total
RNA was extracted from the combined root apices using a method
described by Chandler et al. (23). Poly(A)1 mRNA was purified by
passage through oligo(dT)-cellulose columns (Amersham Pharmacia
Biotech), and cDNA was synthesized from this RNA template using a
commercial kit (Stratagene). The resulting cDNA was ligated into the
pYES2 yeast expression vector (Invitrogen), and the plasmids were
used to transform Escherichia coli (strain XL1-Blue; Stratagene).
Plasmid DNA was purified from the cDNA library grown in E. coli
and used to transform the InVSc2 strain of S. cerevisiae using a lithium
acetate procedure (24). Transformants were selected on SC minus/
uracil medium, eluted from the plates into sterile water, and screened
for aluminum resistance. About 100,000 ura1 yeast cells were spread
onto modified LPM plates that contained 2% galactose and either 100 or
150 mM aluminum added as Al2(SO4)3. LPM plates have low pH (pH 3.8;
required to maintain the toxic Al31 species), low magnesium concentration, and low phosphorus concentration (19); in this case agar (BBL
granulated agar; Becton Dickinson) was used instead of agarose, and
complete amino acids were provided as described by Rose et al. (18), and
uracil was omitted to provide selection for the pYES2 vector. The plates
were incubated at 30 C and aluminum-resistant colonies were selected
over 3 weeks. Putative aluminum-resistant colonies were retested by
streaking onto aluminum-containing plates in the presence and absence of galactose (cDNA inserts were expressed behind the GAL1
promoter in pYES2) and by introducing the DNA into E. coli and then
back into the yeast strain InVSc2 to confirm their ability to confer
aluminum resistance.
Northern and Southern HybridizationsRNA from root tips of aluminum-sensitive wheat (cv. Warigal) was isolated for Northern blot
analysis using procedures described by Snowden and Gardner (25).
Northern blots were quantitated using a Fuji film BAS 2500 PhosphorImager (Fuji) with MACBAS (version 2.5E) software to normalize expression levels relative to rRNA expression as determined with the
wheat rRNA probe pTA250.2 (26). Genes homologous to the predicted
proteins encoded by the cDNAs were identified using the BLASTX
algorithm (27).
Wheat DNA was purified by the method of Doyle and Doyle (28), and
Southern hybridization at high stringency was performed as described
by Sambrook et al. (20).
Manipulation of the Yeast CHO1 GenePCR-mediated disruption of
the CHO1 gene was carried out using oligonucleotides with 41 nucleotides homologous to the CHO1 gene and 19 nucleotides homologous to
the HIS1 gene. The sequence of the forward primer was CGCACCTCA
AGAATTCCCACACACGGACACAGACGTTATCGGGCCTCCTCTAGTACACTC and the reverse primer was CCCAACACCAAAGCTAGAGTGGTTGGCATAGGCAATCCCTCGGAAAGCGCGCCTCGTTCA. The
PCR product (990 base pairs) was transformed into the yeast strain
FY833, and transformants able to grow in the absence of histidine were
screened for an inability to grow without choline. One line (CH5) was
confirmed as a CHO1 disruption by PCR and Southern hybridization.
Aluminum resistance of CH5 yeast strains was determined by growth
in liquid LPM medium (pH 3.5) that contained histidine, choline, and
galactose (2% w/v).
The yeast CHO1 gene was amplified using the primers GCAAGCTTGGATCCAAAATGGTTGAATCAGATGAAGATTTC and CGTCTAGAGCGGCCGCCCAGGCATGAACAAAAACTACT and cloned behind
the GAL1 promoter in the vector pYES3, a modified version of pYES2
described by Smith et al. (29).
Transgenic PlantsThe TaPSS1 cDNA was ligated to plant expression vectors under the control of the cauliflower mosaic virus promoter.
The Arabidopsis transformation used the pART7/pART27 vector system (30) in Agrobacterium, and transgenic plants were generated by
vacuum infiltration (31). For tobacco (Nicotiana tabacum), TaPSS1 was
cloned into the BamHI/XbaI site of pDH51 (32), and the resulting EcoRI
fragment that contained TaPSS1 with the cauliflower mosaic virus
promoter and terminator was cloned into the EcoRI site of the binary
vector pPLEX201-3 (33). Tobacco was then transformed with this vector
using Agrobacterium and co-cultivation of leaf explants (34). Control
plants were transformed with the vectors alone. For tobacco, seed (T1)
was collected from the primary transgenics (T0) and grown for analysis
of phospholipids and PSS activity. For Arabidopsis, kanamycin-resistant T1 plants were selected and segregating T2 lines were analyzed. In
both cases, TaPSS1 overexpressing lines could be easily identified in
the segregating lines on the basis of their phenotype.
Phospholipid and PSS AssaysYeast cultures (5 ml of LPM-galactose medium) at a starting A600 nm of 1.0 were labeled with KH232PO4
(0.74 MBq; Amersham Pharmacia Biotech) for 1 or 24 h. Phospholipids
were extracted from yeast cells using procedures described by Homann
et al. (35) and were separated by thin layer chromatography using
either a single dimension with chloroform:methanol:acetic acid:water
(32:4:5:1 by volume) as the solvent system or with a two-dimensional
procedure where chloroform:methanol:concentrated NH4OH:water (66:
27:3:0.9 by volume) was used for the first dimension and chloroform:
methanol:acetic acid:water (32:4:5:1 by volume) was used for the second
dimension. The identity of the various phospholipids was determined by
comparison to standard phospholipids (Sigma), and the thin layer chromatography plates were analyzed with a PhosphorImager system (Molecular Dynamics) to quantitate the 32P incorporated into the various
phospholipids. Yeast extracts were prepared and assayed for PSS activity according to Homann et al. (35).
Similar methods were used for the assay of phospholipids and PSS
activity in Arabidopsis seedlings. Seedlings (25-day-old) grown in hydroponic culture using previously described methods (36) were transferred to nutrient solution that contained 10 mM phosphate and 32P
(0.74 MBq; Amersham Pharmacia Biotech). Tissues (approximately 100
mg) were ground in CH3Cl:isopropyl alcohol (6:1) with a hand-held
homogenizer. Subsequent steps for phospholipid extraction were the
7083
7084
same as used for the yeast. Extracts for PSS assay were prepared by
grinding approximately 50 mg of tissue in 100 ml of extraction buffer,
centrifuged, and assayed according to Homann et al. (35).
Statistical analysis of the phospholipid composition in yeast and
Arabidopsis was complicated by the high variability between replicates
for the total 32P incorporated. Therefore the statistical analyses were
performed on the proportion of 32P appearing in each phospholipid
fraction. The data were transformed with the arcsine function to normalize the distribution and to minimize the variance between the
means. For each phospholipid a t test was used to compare the means
of the different genotypes.
RESULTS
GenBankTM accession number P39823), and Helicobacter pylori (22% identity; GenBankTM accession number AE000614).
TaPSS1 also showed 20 23% amino acid identity to putative
PSS proteins predicted from sequences present in the genomes
of Methanococcus jannaschii (GenBankTM accession number
U67562), Mycobacterium tuberculosis (GenBankTM accession
number Z84724), and Chlamydia trachomatis (GenBankTM accession number AE001355). The predicted wheat protein has
eight hydrophobic regions suggesting that it is a membranespanning protein. Unlike yeast PSS, the predicted TaPSS1
protein lacks an acidic N terminus sequence (Fig. 2). The presence of a stop codon 27 bases upstream and in frame with the
predicted translation start site of the TaPSS1 cDNA indicates
that there is not an alternative translation start site that could
account for the absence of the acidic N-terminal sequence and
also suggests that the cDNA is full length.
Northern blot analysis showed that TaPSS1 mRNA was
present at a low level in both wheat roots and shoots and that
its expression in roots increased in response to aluminum toxicity stress (Fig. 3A). Control plants where roots were not
exposed to aluminum for equivalent times did not show any
change in TaPSS1 expression. Southern blot analysis indicated
the presence of a small family of genes (310 bands per lane,
FIG. 2. Alignment of the predicted amino acid sequence encoded by the TaPSS1 open reading frame with the predicted
polypeptides encoded by PSS genes from yeast and bacteria. Sequences of PSS from yeast (S. cerevisiae; GenBankTM accession number
D00171) B. subtilis (GenBankTM accession number P39823) and H. pylori (GenBankTM accession number AE000614) were aligned with the
deduced amino acid sequence of TaPSS1. Identical amino acids are shown with dark shading, and similar amino acids are shown with light
shading.
7085
FIG. 4. The wheat cDNA TaPSS1 complements the choline requirement of a yeast cho1 mutant. The cho1 mutant (cho1) was
derived from strain FY833 (wild type, WT) by PCR-generated disruption of the CHO1 gene. The growth of the cho1 mutant transformed
with either TaPSS1 in the vector (pTaPSS1) or the vector without
insert (pYES3) was assessed in the presence or absence of choline.
7086
PSS activity
nmol PS produced/mg protein/min
Undetectable (n 5 3)
0.99 6 0.15 (n 5 4)
0.28 6 0.06 (n 5 4)
0.14 (n 5 1)
Undetectable (n 5 3)
0.43 6 0.11 (n 5 3)
0.01 6 0.0 (n 5 3)
0.43 6 0.04 (n 5 3)
0.32 6 0.07 (n 5 3)
0.01 6 0.00 (n 5 3)
1.23 6 0.50 (n 5 3)
FIG. 5. Composition of phospholipids labeled with 32P in INVSc2 yeast cells expressing TaPSS1 compared with vector
alone. Cells were labeled with 32P for 1 h (A) or 24 h (B) before they
were analyzed for phospholipid composition. The amount of 32P incorporated into the major phospholipids is expressed as a percent of the
total 32P incorporated into phospholipids. The means from four independent transformants for each plasmid are shown 6 S.E. and statistically significant differences in proportion of phospholipids between
plasmids are shown by * (p , 0.05) or **(p , 0.01). Analysis by
two-dimensional thin layer chromatography showed that phosphatidyldimethylethanolamine (PDE) comprised about 5% of the 32P incorporated into phosphatidyldimethylethanolamine (PDE) 1 PE.
S.E.).
We reasoned that, as in yeast cells, longer term labeling
would more accurately reflect the steady state composition of
plant phospholipids. Longer term 32P labeling (7 days) still
showed a much greater 32P incorporation into PS for the
TaPSS1 transgenic lines compared with control plants (Fig.
7B). As in the 24-h experiment, label incorporated into PI and
PG was reduced, although the effect was less pronounced than
in the short term experiment.
Phosphatidylserine synthase activity was readily detected in
crude homogenates prepared from leaves of Arabidopsis and
tobacco overexpressing TaPSS1 but was either undetectable or
very low for control plants that were transformed with the
vector alone (Table I). The levels of TaPSS1 expression activity
in different transgenic lines were related to the severity of the
phenotypes described above (data not shown).
DISCUSSION
in plants and in a disrupted cho1 mutant of yeast yields measurable PSS activity in both types of organisms; and (iv) overexpression of TaPSS1 in yeast and plants changes the phospholipid composition in both these organisms with an increase
in PS content being the most marked effect. Our cloning of a
functional plant PSS gene provides the first strong evidence for
the existence of PSS in higher eukaryotic cells. The role of PSS
in wheat could be primarily for PS biosynthesis; or alternatively, in some plant species or tissues, it may play a key role in
the biosynthesis of PC, as occurs in yeast.
Complementation of the yeast cho1 mutant provided strong
evidence for TaPSS1 gene function. The fact that there is a
single gene encoding PSS in the yeast genome (39) precludes
the possibility that TaPSS1 is enhancing endogenous PSS in
yeast by transactivation of another gene. A marked difference
between yeast PSS and wheat PSS is the absence of an acidic
N-terminal sequence in the wheat protein (Fig. 2). However,
overexpression of a truncated form of the yeast CHO1 gene that
a
Three to four independent transformants for each plasmid were
assayed.
b
Three plants from each line were assayed. The different numbers
following D244 represent independent transformation events. Seedlings (T1) that showed the same phenotype as the T0 generation were
assayed for PSS.
c
Control denotes plants transformed with vector alone.
FIG. 7. Composition of phospholipids labeled with 32P in Arabidopsis D244-24 expressing TaPSS1 compared with control
plants. Plants were labeled with 32P for 24 h (A) or 7 days (B) before
they were analyzed for phospholipid composition. The amount of 32P
incorporated into the major phospholipids is expressed as a percent of
the total 32P incorporated into phospholipids. The means 6 S.E. of three
plants from line D244-24 and a line with vector alone are shown, and
statistically significant differences in proportion of phospholipids between lines are shown by * (p , 0.05) or **(p , 0.01).
7087
7088
REFERENCES
1. Galliard, T. (1973) in Form and Function of Phospholipids (Ansell, G., Hawthorne, J., and Dawson, R., eds) pp. 253288, Elsevier Scientific Publisher
B.V., Amsterdam
2. Devaux, P. F. (1991) Biochemistry 30, 11631173
3. Schroit, A. J., and Zwaal, R. F. A. (1991) Biochim. Biophys. Acta 1071, 313329
4. Fadok, V. A., Voelker, D. R., Campbell, P. A., Cohen, J. J., Bratton, D. L., and
Henson, P. M. (1992) J. Immunol. 148, 22072216
5. Zhang, G., Gurtu, V., Kain, S. R., and Yan, G. (1997) BioTechniques 23,
525531
6. Nishizuka, Y. (1992) Science 258, 607 614
7. Fadok, V. A., Bratton, D. L., Frasch, S. C., Warner, M. L., and Henson, P. M.
(1998) Cell Death Differ. 5, 551562
8. OBrien, I. E. W., Baguley, B. C., Murray, B. G., Morris, B. A. M., and
Ferguson, I. B. (1998) Plant J. 13, 803 814
9. Carman, G. M., and Zeimetz, G. M. (1996) J. Biol. Chem. 271, 1329313296
10. Kuge, O., and Nishijima, M. (1997) Biochim. Biophys. Acta 1348, 151156
11. Dowhan, W. (1997) Annu. Rev. Biochem. 66, 199 232
12. Moore, T. S., Jr. (1982) Annu. Rev. Plant Physiol. 33, 235259
13. Moore Jr, T. S. (1975) Plant Physiol. (Bethesda) 56, 177180
14. Marshall, M. O., and Kates, M. (1974) Can. J. Biochem. 52, 469 482
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
Datko, A. H., and Mudd, S. H. (1988) Plant Physiol. (Bethesda) 88, 1338 1348
Kinney, A. J., and Moore, T. S., Jr. (1987) Plant Physiol. (Bethesda) 84, 78 81
Yamashita, S., and Nikawa, J. (1997) Biochim. Biophys. Acta 1348, 228 235
Rose, M. D., Winston, F., and Hieter, P. (1990) Methods in Yeast Genetics: A
Laboratory Course Manual, pp. 177180, Cold Spring Harbor Laboratory,
Cold Spring Harbor, NY
MacDiarmid, C. W., and Gardner, R. C. (1996) Plant Physiol. (Bethesda)112,
11011109
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual,2nd Ed., Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY
Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A.
74, 54635467
Delhaize, E., Ryan, P. R., and Randall, P. J. (1993) Plant Physiol. (Bethesda)
103, 695702
Chandler, P. M., Higgins, T. J. V., Randall, P. J., and Spencer, D. (1983) Plant
Physiol. (Bethesda) 71, 4754
Gietz, R. D., Schiestl, R. H., Willems, A. R., and Woods, R. A. (1995) Yeast 11,
355360
Snowden, K. C., and Gardner, R. C. (1993) Plant Physiol. (Bethesda) 103,
855 861
Appels, R., and Dvorak, J. (1982) Theor. Appl. Genet. 63, 361365
Gish, W., and States, D. J. (1993) Nat. Genet. 3, 266 272
Doyle, J. J., and Doyle, J. L. (1990) Focus 12, 1315
Smith, F. W., Ealing, P. M., Hawkesford, M. J., and Clarkson, D. T. (1995)
Proc. Natl. Acad. Sci. U. S. A. 92, 93739377
Gleave, A. P. (1992) Plant Mol. Biol. 20, 12031207
Richardson, K., Fowler, S., Pullen, C., Skelton, C., Morris, B., and Putterill, J.
(1998) Aust. J. Plant Physiol. 25, 125130
Pietrzak, M., Shillito, R. D., Hohn, T., and Potrykus, I. (1986) Nucleic Acids
Res. 14, 58575868
Surin, B., Boevink, P., Keese, P., Chu, P., Larkin, P., Llewellyn, D., Kahn, R.,
Ellacott, G., and Waterhouse, P. (1998) Proceedings of the 4th Asia-Pacific
Conference on Agricultural Bio/Technology (Larkin, P. J., ed) pp. 121122,
Canberra UTC Publishing, Darwin
Horsch, R. B., Fry, J. E., Hoffman, N. L., Eichholtz, D., Rogers, S. G., and
Fraley, R. T. (1985) Science 227, 1229 1231
Homann, M. J., Poole, M. A., Gaynor, P. M., Ho, C.-T., and Carman, G. M.
(1987) J. Bacteriol. 169, 533539
Delhaize, E., and Randall, P. J. (1995) Plant Physiol. (Bethesda) 107, 207213
Atkinson, K. D., Jensen, B., Kolat, A. I., Storm, E. M., Henry, S. A., and Fogel,
S. (1980) J. Bacteriol. 141, 558 564
Atkinson, K., Fogel, S., and Henry, S. A. (1980) J. Biol. Chem. 255, 6653 6661
Letts, V. A., Klig, L. S., Bae-Lee, M., Carman, G. M., and Henry, S. A. (1983)
Proc. Natl. Acad. Sci. U. S. A. 80, 7279 7283
Sperka-Gottlieb, C., Fasch, E.-V., Kuchler, K., Bailis, A. M., Henry, S. A.,
Paltauf, F., and Kohlwein, S. D. (1990) Yeast 6, 331343
Jones, D. L., and Kochian, L. V. (1997) FEBS Lett. 400, 5157
Choi, S. B., Lee, K. W., and Cho, S. H. (1997) Mol. Cell.7, 58 63
Nishida, I., Swinhoe, R., Slabas, A. R., and Murata, N. (1996) Plant Mol. Biol.
31, 205211
Stone, S. J., Cui, Z., and Vance, J. E. (1998) J. Biol. Chem. 273, 72937302
Kuge, O., Hasegawa, K., Saito, K., and Nishijima, M. (1998) Proc. Natl. Acad.
Sci. U. S. A. 95, 4199 4203
Aussel, C., Pelasy, C., and Breittmayer, J. P. (1998) FEBS Lett. 431, 195199
Uchida, K., Emoto, K., Daleke, D. L., Inoue, K., and Umeda, M. (1998)
J. Biochem. (Tokyo) 123, 10731078