Sie sind auf Seite 1von 4

Journal of Asia-Pacic Entomology 19 (2016) 14

Contents lists available at ScienceDirect

Journal of Asia-Pacic Entomology


journal homepage: www.elsevier.com/locate/jape

Azadirachtin ingestion is lethal and inhibits expression of ferritin and


thioredoxin peroxidase genes of the sweetpotato whitey Bemisia tabaci
M. Asaduzzaman a,1, Jae-Kyoung Shim a,c, Sukchan Lee b, Kyeong-Yeoll Lee a,c,d,
a

School of Applied Biosciences, Kyungpook National University, Daegu 702-701, Republic of Korea
Department of Genetic Engineering, Sungkyunkwan University, Suwon 440-746, Republic of Korea
Institute of Plant Medicine, Kyungpook National University, Daegu 702-701, Republic of Korea
d
Sustainable Agriculture Research Center, Kyungpook National University, Gunwi, Republic of Korea
b
c

a r t i c l e

i n f o

Article history:
Received 2 July 2015
Revised 30 September 2015
Accepted 25 October 2015
Available online 12 November 2015
Keywords:
Azadirachtin
Biopesticides
Gene expression
Oral ingestion
Whitey

a b s t r a c t
Azadirachtin is a plant-derived triterpenoid compound, which has adverse effects on growth, feeding, and
reproduction of insects. However, its action is not well understood at the molecular level. The effects of oral
ingestion of azadirachtin in whiteies, Bemisia tabaci, a serious pest of various agriculturally important plants,
were determined by assessing their mortality and changes in gene expression. Whiteies (0-day-old) were
allowed to ingest 20% sugar solution containing 0, 1, 5, or 10 ppm azadirachtin using a two-layered paralm
feeding chamber. Mortality gradually increased with time and increased dosage, with all individuals dead at 72
and 48 h at 5 and 10 ppm, respectively. Furthermore, the mRNA levels of 15 genes, which are associated with
development, metabolism, defenses, and stresses, were compared between whiteies which ingest either 0 or
5 ppm azadirachtin for 12 h by quantitative real-time RT-PCR. Most genes changed mRNA levels at less than 2
folds. However, the expression of thioredoxin peroxidase 1 and two ferritin genes which have protective roles
against oxidative stress was inhibited up to 36 folds more than that in untreated whiteies. These results
suggest that lethal toxicity of azadirachtin may be due to increased cellular oxidative stress of B. tabaci.
2015 Korean Society of Applied Entomology, Taiwan Entomological Society and Malaysian Plant Protection
Society. Published by Elsevier B.V. All rights reserved.

Introduction
Azadirachtin is a triterpenoid compound, which is associated with
the seeds of the neem tree, Azadirachta indica A. Juss (Sapindales:
Meliaceae) (Mordue and Blackwell, 1993; Morgan, 2009). This
compound has pesticidal properties that are active against nearly 550
insects and pest species, including arthropods, nematodes, annelids,
and fungi (Govindachari and Gopalakrishnan, 1998; Veitch et al.,
2008; Hatti et al., 2014). It is a potent antifeedent, repellent, and
growth-regulating compound in a wide variety of phytophagous
insects. Its mode of action is known to inhibit ecdysteroid synthesis
resulting in the inhibition of insect growth and reproduction. Therefore,
the presence of azadirachtin in insects induces hormonal balances
resulting in the failure of molting or dramatic deformation at immature
stages of growth. In addition, azadirachtin has demonstrated cytotoxic,
antiproliferative, and antimitotic effects in insect cell lines (Salehzadeh
et al., 2003; Anuradha et al., 2007; Kumar and Poehling, 2007). For

Corresponding author at: Division of Applied Biosciences, College of Agriculture and


Life Sciences, Kyungpook National University, Daegu 702-701, Republic of Korea.
Tel.: +82 53 950 5759; fax: +82 53 950 6758.
E-mail address: leeky@knu.ac.kr (K.-Y. Lee).
1
Present address: Department of Entomology, Faculty of Agriculture, Patuakhali
Science and Technology University, Patuakhali, Bangladesh.

example, in Spodoptera litura SI-1 cells, it inhibits cell proliferation by


inducing cell cycle arrest and apoptosis (Zhong et al., 2008; Huang
et al., 2011). However, azadirachtin has low levels of toxicity in humans
and it rapidly degrades, thus posing a low risk of development of
resistance and other undesirable effects in non-target organisms
(Raizada et al., 2001; Boeke et al., 2004).
The sweetpotato whitey, Bemisia tabaci (Gennadius) (Homoptera:
Aleyrodidae), represents a cryptic species complex that includes at
least 24 biotypes, which are not morphologically distinguishable,
but instead differ according to various physiological and ecological
characteristics (De Barro et al., 2011). During the past two decades, B
and Q-biotypes have invaded many countries worldwide (De Barro
and Ahmed, 2011; McKenzie et al., 2012). Furthermore, Q-biotype is
known to have developed a remarkable level of resistance to
neonicotinoid pesticides such as imidacloprid (Dennehy et al., 2010).
Therefore, it is necessary to nd alternative control techniques for
whitey management, such as biopesticides produced by naturally
present deterrents, including microbe pathogens and insecticidal plants.
The effects of azadirachtin on B. tabaci have been reported to include
the inhibition of growth regulation and improved control efcacy in
the eld (Flint and Parks, 1989; Kumar and Poehling, 2006, 2007). Our
previous study also indicated that rearing whiteies on tomato leaf
that had been soaked in azadirachtin solution signicantly inhibited
various developmental stages such as egg hatching, adult eclosion, and

http://dx.doi.org/10.1016/j.aspen.2015.10.011
1226-8615/ 2015 Korean Society of Applied Entomology, Taiwan Entomological Society and Malaysian Plant Protection Society. Published by Elsevier B.V. All rights reserved.

M. Asaduzzaman et al. / Journal of Asia-Pacic Entomology 19 (2016) 14

oviposition of adult females (Lynn et al., 2010). In addition, eld application of azadirachtin-A and its stable derivative tetrahydroazadirachtin-A
improved control efcacy against B. tabaci as well as leafhopper (Dhingra
et al., 2008). However, the mechanism of azadirachtin toxicity still
remains unclear at cellular and molecular levels.
Here, we determined the effects of the oral ingestion of azadirachtin
on the mortality of B. tabaci and investigated its effect on genes that
demonstrated early responses and were related to stress, immunity,
metabolism, cytoskeleton development, and reproduction in adult
B. tabaci.
Materials and methods
Insect rearing
A colony of Q-biotype Bemisia tabaci was maintained on tomato plants
(Lycopersicon esculentum Mill.) in insect-proof cages (45 60 90 cm).
The colony was reared in insect-rearing rooms at 25 1 C, with a
relative humidity of 60 5%, and a 16 h light/8 h dark (16 L:8D) photoperiodic cycle. For experiments, tomato leaves infested by mature
nymphs were prepared in Petri dishes with moisture the previous
evening. Adult eclosion was monitored daily, in the morning, and 0day-old adults (less than 12 h post-eclosion) were collected and used
in experiments.

Kit (Applied Biosystems, USA) in a PTC-200 thermal cycler (MJ Research, Watertown, MA, USA). Gene-specic primers were designed
for qRT-PCR according to Mahadav et al. (2009) (Table 2). The cDNA
samples (0.2 l) were run in triplicate in a 7300 Sequence Detection
System (Applied Biosystems, USA) using Power SYBR Green PCR Master
Mix (Applied Biosystems, USA). One cycle consisted of 95 C for 15 min,
followed by 45 cycles (95 C for 10 s, 60 C for 20 s, 72 C for 30 s) followed by a nal cycle for the dissociation stage (95 C for 15 s, 60 C for 30 s,
95 C for 15 s). The expression level of each gene was determined by
comparing the relative quantities of the cDNA to those of the respective
mRNA. The Ct (threshold cycles) values were used to calculate the
mRNA levels. The data were analyzed using the following formula:
2Ct = 2[Ct treatment Ct control] (Livak and Schmittggen, 2001).
The partial nucleotide sequence of the actin gene from B. tabaci
(AF071908) was identied from the Bemisia EST database in the NCBI
GenBank. Actin level was used as a reference to normalize the expression levels of the other genes.
Statistical analysis
Data were analyzed by Sigma Plot 8.0. All data are expressed as the
mean SE (standard error). Statistical data analysis was conducted
with SAS software version 9.0 (2003). The treatment methods were
compared using the least signicant difference (LSD) test at p 0.05.

Preparation of azadirachtin

Results and discussion

Azadirachtin (N 95% purity; SigmaAldrich, St Louis, MO) was


dissolved in 10% isopropanol for a nal stock solution of 100 ppm and
kept at 20 C until further use. Additional dilutions were made with
the 20% sucrose solution for the mortality tests of B. tabaci.

Feeding assays using the two-layered membrane sandwich chamber


demonstrated that the oral ingestion of azadirachtin is highly lethal to
whiteies. Our measurement of ingested amount of sugar solution in
feeding assay showed that whiteies were less ingested sugar solution
containing azadirachtin than the control solution for 12 h (Table 1).
There was no change in ingestion rate of whiteies with or without a
1% isopropanol solution as another control (data not shown). Interestingly, whiteies did not ingest azadirachtin-containing sugar solution
during the initial 6 h. This result indicated that azadirachtin is act as
strong antifeedent on whiteies, as previously known in many other
insects. Further analysis showed that the whitey mortality appeared
from 12 h after allowing ingestion and its rate was increased in a
dose-dependent manner in a range of 110 ppm azadirachtin (Fig. 1).
When using 1 ppm azadirachtin, the mortality was initially observed
at 24 h and gradually increased to be 77.5% at 72 h. With higher concentrations of azadirachtin, a complete mortality was observed after 72 h at
5 ppm, but it reduced to 48 h at 10 ppm. This result suggests that oral
ingestion of azadirachtin is rapid and highly toxic to whiteies.
The mechanism of acute toxicity of ingested azadirachtin, which
leads to death of whiteies, is uncertain at the molecular level.
Azadirachtin ingestion differentially regulated gene expression of
larvae of the Indian meal moth Plodia interpunctella (Lynn et al., 2012).
Recent studies in Drosophila melanogaster larvae demonstrated that
azadirachtin appears to mainly affect posttranscriptional regulation
and proteins involved in cytoskeleton development, transcription and
translation, hormonal regulation, and energy metabolism (Lai et al.,
2014; Wang et al., 2014). Here, we were able to identify genes involved
in the early response to azadirachtin ingestion before whitey mortality
appeared. Mortality was not detected at 12 h after treatment, at which
point we analyzed the levels of transcription. Thus, the inhibition of
gene expression at this time may imply that azadirachtin requires to
negatively affect whiteies. We selected 15 representative genes with
important roles in vital processes, including development (ecdysone
receptor), metabolism (cytochrome P450 oxidase, ferritin 2, ferritin 17,
thioredoxin peroxidase-1), defense (knottin 3, p8 protein), stresses
(hsp40, hsp70, hsp90), and development of the cytoskeleton (myosin,
prolin, myolin, paramyosin, tropomyosin). The transcription levels
were compared between whiteies that ingested sucrose solutions
containing either 0 or 5 ppm azadirachtin after 12 h by real-time RT-

Oral ingestion of the azadirachtin solution


An articial feeding chamber was made using two pieces of paralm
and a glass tube (12 cm length, 3 cm diameter) as described in Jahan
et al. (2014) with some modications. Two pieces of paralm
(2 2 cm2) were stretched out by hand until they were twice the original length. One end of a tube was sealed with two layers of the paralm
membrane containing 100 l of the 20% sucrose solution, which served
as an articial diet for the whiteies. Azadirachtin stock solution was
diluted to 0, 1, 5, and 10 ppm in the 20% sucrose solution. The other
side of the tube was covered with a piece of meshed net after adult
whiteies (0-day-old) (n = 50) were released into the paralm
chamber. The membrane-covered side was positioned on top of the
tube and then incubated at 25 C. Mortality rates were determined by
counting the number of dead whiteies within the tube at 6 h intervals.
Each set of experiments was completed in 3 replicates in similar
environmental conditions.
The amount of sugar solution ingested by each individual whitey
was determined. Paralm feeding chambers were prepared with 10 l
of 20% sugar solution with or without 5 ppm azadirachtin, and the
whiteies (n = 20) were allowed to feed for 6 and 12 h at 25 C. The
amount of ingested sugar solution was determined by capillary action
of the remnant of the solution using 110 l microcapillary calibrated
pipets (Sigma, St. Louis, MO, USA).
Quantitative real-time RT-PCR (qRT-PCR) analysis
Whiteies (less than 12 h post-eclosion) (n = 50) were allowed to
ingest 20% sugar solution with or without 5 ppm azadirachtin for 12 h
at 25 C. Total RNA was isolated from whole bodies using RNeasy mini
kit (Qiagen, USA). All extracts were treated with DNase (RNase free)
and quantied using an IMPLEN Nano Photometer (Implen GmbH,
Munich, Germany). The cDNA synthesis reaction for each total RNA
(2 g) sample was completed using a Reverse Transcriptase System

M. Asaduzzaman et al. / Journal of Asia-Pacic Entomology 19 (2016) 14

Table 1
Comparison of ingested amount of B. tabaci between 20% sucrose solution with or without
5 ppm azadirachtin.
Treatments

20% sucrose only


Azadirachtin (5 ppm)

20
20

Ingested amounts (nl/individual) at


different hours (mean SE)
6h

12 h

9.0 3.5a
0b

41.6 11.5a
15.0 5.1b

Ingested amounts were calculated for 6 h and 12 h feeding durations of a single 0-dayold (less than 12 h post-eclosion) adult female.
Means (SE) followed by the same letter are not signicantly different by DMRT's
test at p 0.05.

PCR (Table 3). Our results showed that whiteies that ingested
azadirachtin did not signicantly change the expression levels of most
genes although their rates were decreased 12 folds than those of
non-treated whiteies. However, 3 genes, including ferritin 2, ferritin
17, and thioredoxin peroxidase 1, decreased by 6.47, 6.73, and 3.23
folds, respectively, revealing signicant differences when compared to
those in untreated whiteies (Table 3). Thus, this suggests that ingested
azadirachtin differentially regulates specic genes at the transcription
levels within cells. Zhao et al. (2014) reported that azadirachtin binds
proteins within the nucleus of the cells. This suggests that azadirachtin
can act as regulators for the transcription of specic genes within the
nucleus.
It is interesting that whiteies that ingested azadirachtin showed
signicantly inhibited transcript levels of two ferritin genes as well as
thioredoxin peroxidase-1, which have protective roles within the cells
against oxidative stress. Ferritin is a complex consisting of 24 subunits
including 12 heavy chain and 12 light chain subunits and has a role in
iron storage and transport within the cells (Pham and Winzerling,
2010). Iron is an essential element present in limited supply in the
Table 2
Gene-specic primer sequences of Bemisia tabaci for real-time RT-PCR, as described in
Mahadav et al. (2009).
Target genes

Sequences (5 3)

GenBank
accession
numbers

hsp40

GCT GTC GAT TCA CGA CCA CA


CCG TCT TCT CGT TCG TCT GC
TCC CTC GAG TCC TAC TGC TTT AA
TCG CTG ATC TTG TCC TTC AGT TT
GCT CCG AGA CTC TTC GAC AAT G
CAG GGT GGT CAG GGT TGA TTT
CAT TCC AAT CCC TCC GAA AA
CGA CCC TAG GCA AGT GTG AAC
CTCCCTCGAAGGCCAGACTA
TGG ACG AAA TGA GAT GAA GTC CT
GCC TTC TTC TCT TGC TGG GTG
AGC AAAATTCAGCGCTAGCC
GCA CGT GAA TAT GGC GTC CT
TCC TCG GTA AGG GAT TCC AGT
CCA CCA GAC CGA AAC CTG TT
CGG TTC AGG AGG CAG CTT ATT
AAC ATT GGA TCC CCT GTC AAA C
TCT TGT GAC GTA CTT GCC GC
TGT TTG CAA CTA ACC AGC CGTATA
AGC AGA TCC TCC ACA GTA TCA CC
GCA ACC TGTCCTTAATCCGC
TGT TGG TGG TGA CGA AGG TG
GAA CAG TTC ATG CAA GTC TCC G
GAG CGC CTTG TCC TTC TCC T
ATT CCG CAA GGC ACA ACA AG
AAG TCG GCT CGT TCT TCA GC
AGC AACCTCATCATCCGCAC
CGC GTG ATT TGA TTG TCG AG
ACG GGC TAA AC TTG GCA AAG
GCT TGG TGT GTT TTC ATG CAG T
GAC GGA CAG GTC ATC ATA ATC G
CAT ACC CAA GAA GGA TGG CTG

AJ509088

hsp70
hsp90
knottin 3
ferritin 2
ferritin 17
thioredoxin peroxidase 1
p8 protein
cytochrome P450 (CYP6CM1)
ecdysone receptor
paramyosin
tropomyosin
myosin H chain
myolin
prolin
actin

Fig. 1. Effect of azadirachtin ingestion on the mortality of Bemisia tabaci. Azadirachtin was
diluted to 0, 1.5, and 10 ppm in a 20% sucrose solution and fed to adult whiteies (n = 50)
in the paralm sandwich chamber. Numbers of dead whiteies were counted every 6 h.
Each point represents mean SE of three replications from different sets of experiments
of identical environmental conditions.

cells (Tang and Zhou, 2013). However, it is also a highly toxic precursor
of reactive oxygen species (ROS), such as superoxide anions (O2),
hydrogen peroxide (H2O2), and hydroxyl radicals (OH), which induce
oxidative stress, disrupting normal cellular processes. Ferritin expression is also essential for resistance against oxidative stresses in the bacterium, Listeria monocytogenes (Dussurget et al., 2005). In addition,
thioredoxin peroxidase, together with thioredoxin and thioredoxin
reductase, is a component of the thioredoxin system, which is an important and conserved system implicated in protection against oxidative
stress since it reduces peroxides such as H2O2 to harmless products.
The expression of genes encoding the components of the thioredoxin
system is essential for protection against damage caused by oxidative
stress. Thus, our results suggest that whiteies that have ingested
azadirachtin may have signicant oxidative stress due to the
disturbance of antioxidative system in their cells. Recently, Dere et al.

DQ093377
DQ093381
EE597369

Table 3
Effect of azadirachtin ingestion (5 ppm) on the expression of various genes of Bemisia
tabaci.
Genes

EE603117
EE597196
EE598240
EE600305
EU344879
EF174329
EE597453
EE601593
EE599189
EE674613
EE597329
AF071908

hsp70
hsp90
cytochrome P450
knottin 3
ferritin 2
ferritin 17
thioredoxin peroxidase 1
p8 protein
myolin
tropomyosin
myosin H chain
prolin
paramyosin
hsp40
ecdysone receptor

mRNA levels
Without
azadirachtin

With
azadirachtin

4.6 0.7 a
4.5 0.85 a
2.7 0.65 a
3.3 0.36 a
3.6 0.68 a
3.2 0.67 a
3.6 0.20 a
2.6 0.81 a
4.6 0.41 a
3.7 1.38 a
2.5 0.70 a
3.0 0.48 a
3.0 0.49 a
2.6 0.4 a
3.0 0.70 a

3.60 0.68 a
3.30 0.6 a
1.96 0.34 a
2.40 0.18 a
0.55 0.05 b
0.48 0.22 b
1.56 0.31 b
1.80 0.36 a
2.42 0.39 a
3.36 0.40 a
1.42 0.06 a
1.96 0.13 a
1.96 0.13 a
2.90 0.5 a
5.03 0.8 a

Fold
differences

1.28
1.37
1.37
1.37
6.47
6.73
3.23
1.44
1.92
1.11
1.79
1.54
1.54
+1.12
+1.65

Adult females (less than 12 h post-eclosion) (n = 50) were allowed to ingest a 20%
sucrose solution with or without 5 ppm azadirachtin for 12 h, then total RNA was extracted for the analysis of quantitative real-time PCR.
Means (SE) followed by the same letter are not signicantly different by DMRT's
test at p 0.05.
+ and indicate upregulation and downregulation of genes, respectively.

M. Asaduzzaman et al. / Journal of Asia-Pacic Entomology 19 (2016) 14

(2015) reported that insecticidal toxicity of azadirachtin is caused


by inhibiting various antioxidative enzymes, such as superoxide
dismutase, in Galleria mellonella. We suppose that oxidative stress by
azadirachtin may be one of the main actions of insecticidal activity at
cellular as well as molecular levels.
In conclusion, we showed that ingestion of azadirachtin is lethal
to whiteies, the effect of which is likely caused by transcriptional
inhibition of specic genes that are critical for maintaining cellular
defense against oxidative stress.
Acknowledgments
This research was supported by the Advanced Production Technology Development Program from the Ministry of Agriculture, Food and
Rural Affairs of Korea.
References
Anuradha, A., Annadurai, R.S., Shashidhara, L.S., 2007. Actin cytoskeleton as a putative
target of the neem limonoid Azadirachtin A. Insect Biochem. Mol. Biol. 37, 627634.
Boeke, S.J., Boersma, M.G., Alink, G.M., van Loon, J.J., van Huis, A., Dicke, M., Rietjens, I.M.,
2004. Safety evaluation of neem (Azadirachta indica) derived pesticides.
J. Ethnopharmacol. 94, 2541.
De Barro, P.J., Ahmed, M.Z., 2011. Genetic networking of the Bemisia tabaci cryptic species
complex reveals pattern of biological invasions. PLoS One 6, e25579.
De Barro, P.J., Liu, S.S., Boykin, L.M., Dinsdale, A.B., 2011. Bemisia tabaci: a statement of
species status. Annu. Rev. Entomol. 56, 119.
Dennehy, T.J., Degain, B.A., Harpold, V.S., Zaborac, M., Morin, S., Fabrick, J.A., Nichols, R.L.,
Brown, J.K., Byrne, F.J., Li, X., 2010. Extraordinary resistance to insecticides reveals exotic Q biotype of Bemisia tabaci in the New World. J. Econ. Entomol. 103, 21742186.
Dere, B., Altunta, H., Nurullaholu, Z.U., 2015. Insecticidal and oxidative effects of
azadirachtin on the model organism Galleria mellonella L. (Lepidoptera: Pyralidae).
Arch. Insect Biochem. Physiol. 89, 138152.
Dhingra, S., Walia, S., Kumar, J., Singh, S., Singh, G., Parmer, B.S., 2008. Field efcacy of
azadirachtin-A, tetrahydroazadirachtin-A, Neem Azal and endosulfan against key
pests of okara (Abelmoschus esculentus). Pest Manag. Sci. 64, 11871194.
Dussurget, O., Dumas, E., Archambaud, C., Chafsey, I., Chambon, C., Hebraud, M., Cossart,
P., 2005. Listeria monocytogenes ferritin protects against multiple stresses and is
required for virulence. FEMS Microbiol. Lett. 250, 253261.
Flint, H.M., Parks, N.J., 1989. Effect of azadirachtin from the neem tree on immature
sweetpotato whitey, Bemisia tabaci, (Homoptera: Aleyrodidae) and other selected
pest species on cotton. J. Agric. Entomol. 6, 211215.
Govindachari, T.R., Gopalakrishnan, G., 1998. Supermolecules for insect control. J. Indian
Chem. Soc. 75, 655661.
Hatti, K.S., Muralitharan, L., Hegde, R., Kush, A., 2014. NeeMDB: convenient database for
neem secondary metabolites. Bioinformation 10, 314315.
Huang, J.F., Shui, K.J., Li, H.Y., Hu, M.Y., Zhong, G.H., 2011. Antiproliferative effect
of azadirachtin A on Spodoptera litura Sl-1 cell line through cell cycle arrest and
apoptosis induced by up-regulation of p53. Pestic. Biochem. Physiol. 99, 1624.

Jahan, S.M.H., Lee, G.S., Lee, S., Lee, K.Y., 2014. Upregulation of probing- and feedingrelated behavioural frequencies in Bemisia tabaci upon acquisition of Tomato yellow
leaf curl virus. Pest Manag. Sci. 70, 14971502.
Kumar, P., Poehling, H.M., 2006. Persistence of soil and foliar azadirachtin treatments to
control sweetpotato whitey Bemisia tabaci Gennadius (Homoptera: Aleyrodidae)
on tomatoes under controlled (laboratory) and eld (netted greenhouse) conditions
in the humid tropics. J. Pest. Sci. 79, 189199.
Kumar, P., Poehling, H.M., 2007. Effects of azadirachtin, abamectin, and spinosad on
sweetpotato whitey (Homoptera: Aleyrodidae) on tomato plants under laboratory
and greenhouse conditions in the humid tropics. J. Econ. Entomol. 100, 411420.
Lai, D., Jin, X., Wang, H., Yuan, M., Xu, H., 2014. Gene expression prole change and
growth inhibition in Drosophila larvae treated with azadirachtin. J. Biotechnol. 185,
5156.
Livak, K.J., Schmittggen, T.D., 2001. Analysis of relative gene expression data using real
time quantitative PCR and the 2-Ct method. Methods 25, 402408.
Lynn, O.M., Song, W.G., Shim, J.K., Kim, J.E., Lee, K.Y., 2010. Effects of azadirachtin and
neem-based formulations for the control of sweetpotato whitey and root-knot
nematode. J. Korean Soc. Appl. Biol. Chem. 53, 598604.
Lynn, O.M., Kim, J.K., Lee, K.Y., 2012. Effects of azadirachtin on the development and gene
expression of fth instar larvae of Indianmeal moth, Plodia interpunctella. J. Asia Pac.
Entomol. 15, 101105.
Mahadav, M., Kontsedalov, S., Czosnek, H., Ghanim, M., 2009. Thermotolerance and gene
expression following heat stress in the whitey Bemisia tabaci B and Q biotypes.
Insect Biochem. Mol. Biol. 39, 668676.
McKenzie, C.L., Bethke, J.A., Byrne, F.J., Chamberlin, J.R., Dennehy, T.J., Dickey, A.M., Gilrein,
D., Hall, P.M., Ludwig, S., Oetting, R.D., Osborne, L.S., Schmale, L., Shatters Jr., R.G.,
2012. Distribution of Bemisia tabaci (Hemiptera: Aleyrodidae) biotypes in North
America after the Q invasion. J. Econ. Entomol. 105, 753766.
Mordue, A.J., Blackwell, A., 1993. Azadirachtin: an update. J. Insect Physiol. 39, 903924.
Morgan, E.D., 2009. Azadirachtin, a scientic goldmine. Bioorg. Med. Chem. 17,
40964105.
Pham, D.Q.D., Winzerling, J.J., 2010. Insect ferritins: typical or atypical? Biochim. Biophys.
Acta 1800, 824833.
Raizada, R.B., Srivastava, M.K., Kaushal, R.A., Singh, R.P., 2001. Azadirachtin, a neem
biopesticide: subchronic toxicity assessment in rats. Food Chem. Toxicol. 39,
477483.
Salehzadeh, A., Akhkha, A., Cushley, W., Adams, R.L., Kusel, J.R., Strang, R.H., 2003. The antimitotic effect of the neem terpenoid azadirachtin on cultured insect cells. Insect
Biochem. Mol. Biol. 33, 681689.
SAS Institute, 2003. SAS Version 9.1. SAS Institute Inc, Cary. NC, USA.
Tang, X., Zhou, B., 2013. Iron homeostasis in insects: insights from Drosophila studies.
IUBMB Life 65, 863872.
Veitch, G.E., Boyer, A., Ley, S.V., 2008. The azadirachtin story. Angew. Chem. Int. Ed. Engl.
47, 94029429.
Wang, H., Lai, D., Yuan, M., Xu, H., 2014. Growth inhibition and differences in protein
proles in azadirachtin-treated Drosophila melanogaster larvae. Electrophoresis 35,
11221129.
Zhao, J., Wu, T., Lio, L., Wang, Y., He, L., 2014. EcR-RNAi and azadirachtin treatments
induced the abnormal proleg development in Spodoptera litura. J. East China Norm.
Univ. 1, 133142.
Zhong, G.H., Shui, K.J., Lu, C.J., Jia, J.W., Ren, T.J., Hu, M.Y., 2008. Induction of apoptosis by
azadirachtin, a botanical insecticidal component, in Spodoptera litura Sl-1 cultured
cell line. Acta Entomol. Sin. 51, 618627.