SIRT3 gene expression but not subcellular localization is altered in response to fasting

and exercise in human skeletal muscle

Brittany A. Edgett1, Meghan C. Hughes2, Jennifer B. L. Matusiak1, Christopher G. R. Perry2

Craig A. Simpson3, Brendon J. Gurd1

School of Kinesiology and Health Studies, Queens University, Kingston, Ontario, K7L

3N6, Canada; 2School of Kinesiology and Health Science, Muscle Health Research Centre,
York University, Toronto, Ontario, M3J 1P3, Canada; 3Department of Emergency Medicine,
Queens University, Kingston, Ontario, K7L 3N6, Canada

RUNNING HEAD: SIRT3 Expression and Localization in Response to Fasting and Exercise
Total number of words (excluding references and figure legends): 5462
Total number of references: 50

CORRESPONDING AUTHOR:
Brendon J. Gurd, PhD
Telephone: 613-533-6000 ext.79023
Fax: 613-533-6000
e-mail: gurdb@queensu.ca

This is an Accepted Article that has been peer-reviewed and approved for publication in the
Experimental Physiology, but has yet to undergo copy-editing and proof correction. Please cite this
article as an Accepted Article; doi: 10.1113/EP085744.
This article is protected by copyright. All rights reserved.

NEW FINDINGS
What is the central question of this study?
Evidence from cellular and animal models suggests that SIRT3 is involved in
regulating aerobic ATP production. Thus, we investigated whether changes in fatty
acid and oxidative metabolism known to accompany fasting and exercise occur in
association with changes in SIRT3 mitochondrial localization and expression in
human skeletal muscle.
What is the main finding and its importance?
We find that 48 hours of fasting and acute endurance exercise decrease SIRT3 mRNA
expression, but do not alter SIRT3 mitochondrial localization despite marked
increases in fatty acid oxidation. This suggests that SIRT3 activity is not regulated by
changes in mitochondrial localization in response to cellular energy stress in human
skeletal muscle.

ABSTRACT
The present study examined SIRT3 expression and mitochondrial localization in
response to acute exercise and short-term fasting in human skeletal muscle. Experiment 1
involved 8 healthy men (age, 21.4 2.8 years; VO2peak, 47.1 11.8 mLmin-1kg-1) who
performed a single bout of exercise at ~55% of peak aerobic work rate for 1 hour. Muscle
biopsies were obtained at rest (Rest), immediately after exercise (EX-0), and 3 hours postexercise (EX-3). Experiment 2 involved 10 healthy men (age, 22.0 1.5 years; VO2peak,
47.2 6.7 mLmin-1kg-1) who underwent a 48-hour fast, with muscle biopsies collected 1
hour postprandial (Fed) and following 48 hours of fasting (Fast). Mitochondrial respiration
was measured using high-resolution respirometry in permeabilized muscle fibre bundles to
assess substrate oxidation. Whole body fat oxidation increased after both exercise (Rest: 0.96
This article is protected by copyright. All rights reserved.

 0.32, Exercise: 5.66 1.97, p < 0.001) and fasting (Fed: 0.87 0.51, Fast: 1.30 0.37
kcalmin-1, p < 0.05). SIRT3 gene expression decreased (p < 0.05) following both exercise (8%) and fasting (-19%); however SIRT3 whole muscle protein content was unaltered
following fasting. No changes were observed in SIRT3 mitochondrial localization following
either exercise or fasting. Fasting also decreased the Vmax of glutamate (80 43 vs. 50 21
pmolsec-1mg-1 dry wt, p < 0.05). These findings suggest that SIRT3 does not appear to be
regulated by changes in mitochondrial localization at the time points measured in the current
study in response to cellular energy stress in human skeletal muscle.

KEYWORDS: Cellular Localization, Exercise, Fasting, Mitochondrial Function, SIRT3,

Skeletal Muscle

INTRODUCTION
Lysine acetylation is emerging as an important post-translational modification
involved in regulating mitochondrial function (Kim et al., 2006; Hebert et al., 2013; Still et
al., 2013). Approximately 65% of mitochondrial proteins have at least one acetylated lysine
residue, many of which are modified in response to altered nutrient availability (Hebert et al.,
2013). The sirtuin (SIRT) family of NAD+-dependent deacetylases are proposed to be major
regulators of cellular acetylation status, with SIRT3 implicated as the major deacetylase
responsible for changes in mitochondrial protein acetylation (Lombard et al., 2007). More
specifically, SIRT3 is believed to deacetylate key enzymes involved in the promotion of fatty
acid oxidation and oxidative metabolism (Ahn et al., 2008; Hirschey et al., 2010; Liu et al.,
2014; Vassilopoulos et al., 2014). At present, the evidence supporting SIRT3 as a regulator of
mitochondrial function is derived primarily from cellular and animal studies in liver and
adipose tissue (Shi et al., 2005; Lombard et al., 2007; Hirschey et al., 2010; Hebert et al.,

This article is protected by copyright. All rights reserved.

2013). Consequently, the role of SIRT3 in regulating mitochondrial function in human

skeletal muscle is currently unclear.
Evidence from liver and adipose tissue suggests that SIRT3 is activated following
changes in cellular energy status as part of a coordinated response to maintain cellular ATP
levels (Shi et al., 2005; Hirschey et al., 2010; Liu et al., 2014; Lu et al., 2015). Following
fasting, altered SIRT3 expression may contribute to the regulation of fatty acid oxidation and
oxidative metabolism in murine skeletal muscle (Shi et al., 2005; Palacios et al., 2009;
Hirschey et al., 2010; Jing et al., 2013). However, both increased SIRT3 expression with a
proposed decrease in mitochondrial acetylation (Palacios et al., 2009; Caton et al., 2011), and
decreased SIRT3 expression with increased mitochondrial acetylation (Jing et al., 2013),
have been observed in murine skeletal muscle. Further, while SIRT3 abundance is
consistently elevated following exercise training in both rodents (Palacios et al., 2009; Hokari
et al., 2010; Brandauer et al., 2015) and humans (Johnson et al., 2014; Vargas-Ortiz et al.,
2015), the acute impact of exercise on SIRT3 expression has yet to be examined in humans.
Thus, the impact of fasting and acute exercise on SIRT3 expression in human skeletal muscle
is unknown, as is the relationship between SIRT3 expression and acute changes in fatty
acid/oxidative metabolism.
There is also some evidence that existing SIRT3 protein can be translocated to
mitochondria in response to cellular stress (Scher et al., 2007), and mitochondrial SIRT3 is
required for fasting-mediated increases in fatty acid oxidation and ATP production in liver
(Hirschey et al., 2010; Liu et al., 2014). In cellular and animal models, SIRT3 appears to act
via deacetylation of several enzymes involved in the regulation of fatty acid and oxidative
metabolism (Ahn et al., 2008; Yu et al., 2012; Bharathi et al., 2013; Hebert et al., 2013;
Vassilopoulos et al., 2014). While we have previously observed no change in mitochondrial
SIRT3 following acute exercise in rat skeletal muscle (Gurd et al., 2012), whether SIRT3

This article is protected by copyright. All rights reserved.

translocates to mitochondria in human skeletal muscle following fasting and/or exercise is

unknown. It is also unknown whether translocation of SIRT3 to mitochondria is required for
changes in fatty acid oxidation and mitochondrial respiration in human skeletal muscle.
Therefore, the purpose of the present study was twofold: 1) to examine the impact of
fasting and acute exercise on SIRT3 expression and mitochondrial localization, and 2) to
determine if changes in these variables are associated with changes in fatty acid and oxidative
metabolism known to accompany fasting and exercise in human skeletal muscle (Horowitz &
Klein, 2000; Wijngaarden et al., 2013). To accomplish this, changes in SIRT3 expression and
mitochondrial SIRT3 protein content were compared with changes in whole body fat
oxidation and mitochondrial respiration in permeabilized skeletal muscle fibre bundles
(PmFB) following a prolonged (48 hours) fast. To isolate the acute regulation of fatty acid
oxidation by SIRT3 (i.e. without changes in whole muscle SIRT3 protein content), we also
examined changes in mitochondrial SIRT3 protein content with whole body fat oxidation
following an acute bout of endurance exercise.

MATERIALS AND METHODS

Ethics Statement
All participants in this study were young, healthy, recreationally active men
(participant characteristics are presented in Table 1). All experimental procedures performed
on human participants were approved by the Health Sciences Human Research Ethics Board
at Queens University and conformed to the Declaration of Helsinki. Verbal and written
explanation of the experimental protocol and associated risks was provided to all participants
prior to obtaining written informed consent.
Experimental Design

This article is protected by copyright. All rights reserved.

The current study involved the completion of two distinct experiments. The first
experiment examined the acute effect of exercise (1 hour at 55% of peak work rate) on
changes in whole-body fatty acid oxidization, mitochondrial SIRT3 protein content and gene
expression, and mitochondrial acetylation (using a pan-acetylation antibody). The second
experiment examined the impact of a 48-hour fast on the same variables listed above, with
the addition of mitochondrial respiration in PmFB. A subset of data from experiment two,
including participant characteristics, has been published previously (Walsh et al., 2015).
VO2peak for all participants was determined during a ramp protocol to volitional fatigue as
described previously (Edgett et al., 2013), and both studies obtained skeletal muscle samples
from the vastus lateralis using the Berstrom muscle biopsy technique (Bergstrom, 1975)
modified with manual suction (Edgett et al., 2013). A portion of each biopsy was
immediately used to isolate mitochondria, while another was placed into ice-cold BIOPS
(described below) and used to prepare permeabilized muscle fibre bundles (PmFB). The
remaining tissue was immediately frozen in liquid nitrogen and stored at -80C until gene
analysis was performed using real-time PCR.
Experiment 1: Impact of Acute Exercise
The protocol outlining the timing of sample collection for experiment one is presented
in Figure 2A. Participants reported to the lab in the morning following an overnight fast (~12
hours) after consuming a standardized dinner the night before [Stouffers Saut Sensations
Country Beef Pot Roast (540 kcal; 56 g carbohydrate (CHO), 20 g fat, 14 g protein) and 500
mL of 2% milk (260 kcal; 24 g CHO, 10 g fat, 18 g protein)]. After arriving at the lab
participants were fed breakfast consisting of a plain bagel (190 kcal; 1 g fat, 36 g CHO, 7 g
protein) with cream cheese (88 kcal; 8.5 g fat, < 1.0 g CHO, 1.8 g protein) and 200 mL of
apple juice (90 kcal; 22 g CHO, 0 g fat, 0 g protein). Twenty minutes after completion of
breakfast, two incisions were made over the vastus lateralis of one leg under local anaesthesia

This article is protected by copyright. All rights reserved.

(2% lidocaine with epinephrine) separated by ~2 cm. These incisions were then covered with
sterile gauze such that biopsies could be taken immediately following the collection of resting
gas exchange and immediately post-exercise (EX-0). Forty minutes after completion of
breakfast, resting gas exchange was collected using a metabolic cart (Moxus, AEI
Technologies, Pittsburgh, PA, USA) for 15 minutes. Immediately following gas exchange
participants had a resting biopsy taken from the first incision site. Following the resting
biopsy (~1 hour after breakfast) participants were moved to a stationary bike (Monark
Ergomedic 874 E; Vansbro, Sweden) where they exercised at 55% of their peak work rate for
1 hour. Gas exchange was collected again during the final 15 minutes of exercise.
Immediately following the cessation of exercise, a second muscle biopsy was taken (EX-0).
Participants then rested for 3 hours before a third muscle biopsy sample was taken (EX-3)
from a separate incision site on the same leg as the first two biopsies.
Experiment 2: The Impact of a 48-hour Fast
An overview of experiment two is presented in Figure 3A. Participants were provided
with dinner (Stouffers Saut Sensations Mediterranean Chicken Stir Fry [520 kcal; 74 g
carbohydrate (CHO), 10 g fat, 32 g protein], Dole Fruit Crisp [160 kcal; 29 g CHO, 3.5 g fat,
2 g protein], and 500 mL of 2% milk [260 kcal; 24 g CHO, 10 g fat, 18 g protein]) to
consume the night before the start of the 48-hour fast no later than 9:00 pm. The following
morning after a 12-hour fast, participants reported to the lab in the fasted state and were fed
breakfast consisting of a plain bagel (190 kcal; 1 g fat, 36 g CHO, 7 g protein) with peanut
butter (110 kcal; 10 g fat, 4 g CHO, 4 g protein) and 200 mL of apple juice (90 kcal; 22 g
CHO, 0 g fat, 0 g protein) followed 2 hours later by lunch (12 Black Forest Ham Sandwich
from Subway [~690 kcal; 20 g fat, 106 g CHO, 34 g protein] and 500 mL of 2% milk [260
kcal; 24 g CHO, 10 g fat, 18 g protein]). Anthropometric measures (height, weight, and waist
circumference) were recorded during this visit.

This article is protected by copyright. All rights reserved.

Forty-five minutes after participants were provided with lunch, resting gas exchange
was collected using a metabolic cart (Moxus, AEI Technologies, Pittsburgh, PA, USA) for 15
minutes. Following gas exchange collection (1-hour postprandial [fed state]) a muscle biopsy
was taken (Edgett et al., 2013). Forty-eight hours later participants returned to the lab for 15
minutes of fasted-state gas exchange collection and a muscle biopsy (taken from the opposite
leg of the fed-state biopsy). During the fasting period participants were provided with six
calorie-free electrolyte beverages (Powerade Zero) and were permitted to drink water ad
libitum.
Calculation of Whole Body Fatty Acid Oxidation Rates
The last 10 minutes of gas exchange data of each collection was used to determine the
rate of fatty acid oxidation, and was calculated according to the following formula (Pronnet
& Massicotte, 1991): fat (gmin-1) = 1.695 x O2 production (Lmin-1) 1.701 x CO2
production (Lmin-1). To convert fat oxidation rates to kcalmin-1, resulting values were
multiplied by 9 kcalg-1.
Isolation of Mitochondria
Mitochondria were isolated from 70-100 mg of tissue as described previously (Peters
et al., 1998). All mitochondrial isolation steps were performed at 4C. Samples were minced
in 750 L of solution 1 (100 mM KCl, 40 mM Tris-HCl, 10 mM Tris base, 5 mM MgSO4, 1
mM EDTA, and 1 mM ATP, pH 7.5). Minced muscle was then homogenized by
approximately 40 strokes in a glass Dounce homogenizer with a total of 20 volumes of
solution 1, and then transferred to a 15 mL tube. Samples were centrifuged for 10 minutes at
700 x g, the supernatants collected, and subsequently spun for 10 minutes at 14000 x g to
pellet the mitochondria. The supernatants were discarded, and pellets containing
mitochondria were then resuspended and washed in 10 volumes of solution 2 [100 mM KCl,
40 mM Tris-HCl, 10 mM Tris base, 1 mM MgSO4, 0.1 mM EDTA, 0.25 mM ATP, and 1%

This article is protected by copyright. All rights reserved.

of BSA (fatty acid content < 0.005%)], then centrifuged for 10 minutes at 7000 x g. This
process was repeated using solution 3 (100 mM KCl, 40 mM Tris-HCl, 10 mM Tris base, 1
mM MgSO4, 0.1 mM EDTA, 0.25 mM ATP) and the final pellet was resuspended in 220 mM
sucrose, 70 mM mannitol, 10 mM Tris-HCl, and 1 mM EDTA (pH 7.4), the final volume
corresponding to 1Lmg-1 of starting tissue.

RNA Extraction and Real-Time PCR

RNA extraction and real-time PCR were performed as we have done previously
(Edgett et al., 2013; Scribbans et al., 2014) on Fed and Fasted samples, and on resting and
EX-3 samples. Briefly, RNA was extracted using a modified version of the single-step
method by guanidinium thiocyanate-phenol-chloroform extraction (Chomcyzynski & Sacchi,
1987), and then quantified spectrophotometrically at 260 nm using a Take3 Plate (Biotek).
Protein contamination was assessed by measuring absorbance at 280 nm (samples had an
average 260:280 ratio of 1.98 0.02, mean SD). One microgram of resulting RNA was
reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen, Mississauga,
ON, Canada). Transcript levels were determined on an ABI 7500 Real Time PCR System
(Foster City, CA, USA). Primer set efficiencies were determined using real-time PCR with an
appropriate cDNA dilution series prior to sample analysis. Average primer set-specific
efficiencies (Rasmussen, 2001) were E = 2.02 0.07 (mean SD). All samples were run in
duplicate 25 L reactions containing: 50 ng cDNA, 0.58 M primers, and GoTaq PCR
Master Mix containing SYBR Green (Promega, Madison, WI, USA). Primer sequences are
provided in Table 2. All RNA data are expressed relative to TATA-binding protein (TBP),
which was stable across all states with no difference in the raw CT values observed between

This article is protected by copyright. All rights reserved.

fed and fasted states (Fed: 24.18 0.16, Fasted: 24.35 0.26, p = 0.176) or between resting
and 3 hours post-exercise (Rest: 22.17 0.11, EX-3: 22.25 0.25, p = 0.287).
Western Blotting
Mitochondrial samples were quantified spectrophotometrically to determine protein
content (BCA Protein Assay Kit 23225, Pierce, Rockford, IL, USA), then solubilized in
sample buffer (12.5% sucrose, 1.9% SDS, 15.6 mM Tris HCl pH 6.8, 0.5 mM EDTA, 0.8%
DTT, 0.003% bromophenol blue) and heated to 95C for 5 minutes. Equal amounts of protein
(7.5 g for SIRT3 and 15 g for pan-acetylation) were loaded onto 12% polyacrylamide gels
and separated by SDS-PAGE. Gels were subsequently transferred to a polyvinylidene
difluoride membrane via wet transfer for 1 hour at 100 volts. Membranes were blocked at
room temperature by incubating in 5% BSA with TBS-T (0.1%). Blots were then incubated
with primary antibodies (both at 1:1000) overnight at 4C in 5% BSA with TBS-T (0.1%).
Commercially available antibodies from Cell Signaling (Danvers, MA, USA) were used to
detect SIRT3 (#4590); and Acetylated-Lysine (#9441). All primary antibodies were used at a
concentration of 1:1000 and diluted in 5% BSA with TBS-T (0.1%). Proteins were visualized
by chemiluminescent detection according to manufacturers instructions (Millipore,
Denmark) and imaged using the FluorChem HD2 system (Protein Simple, San Jose, CA).
Band intensities were quantified using AlphaView software (Protein Simple). All quantified
mitochondrial samples are expressed relative to total protein (amido black staining).
Acetylated-Lysine was analyzed both by quantifying individual bands, and by quantifying all
bands within specified molecular weight ranges.
Preparation of PmFB
This technique is partially adapted from previous methods (Kuznetsov et al., 1996;
Tonkonogi et al., 2003) and has been described in detail by us previously (Perry et al., 2011,
2013). Briefly, small portions (~25 mg) of muscle were dissected from each biopsy and

This article is protected by copyright. All rights reserved.

placed in ice-cold BIOPS. The muscle was trimmed of connective tissue and fat and divided
into several small muscle bundles (~27 mm, 1.02.5 mg wet weight). Each bundle was
gently separated along their longitudinal axis with a pair of anti-magnetic needle-tipped
forceps under magnification (Zeiss Stemi). Bundles were then treated with 30 mgmL-1
saponin in BIOPS and incubated on a rotor for 30 minutes at 4C. Following
permeabilization, PmFB were washed at 4C (< 30 minutes) in MiR05 (0.5 mM EGTA, 3
mM MgCl26H2O, 60 mM potassium lactobionate, 20 mM taurine, 10 mM monopotassium
phosphate, 20 mM Hepes, 110 mM sucrose and 1 gL-1 fatty acid free BSA) until respiratory
measurements were initiated.
Mitochondrial Respiration in PmFB
High-resolution respirometry was conducted in 2 mL of respiration medium (MiR05)
using the Oroboros Oxygraph-2k (Oroboros Instruments, Corp., Innsbruck, Austria) with
stirring at 750 rpm. MiRO 5 contained 20 mM creatine hydrate to saturate creatine kinase
(CK), which facilitates mitochondrial-cytosolic energy exchange through ADP/ATPdependent phosphate shuttling (Saks et al., 1994, 1995; Walsh et al., 2001; Anmann et al.,
2006). All experiments were conducted in the Oxygraph chamber with an initial [O2] of 300
M and completed before the oxygraph chamber [O2] reached 150 M. To prevent PmFB
spontaneous contraction and PmFB disintegration, and to ensure respiratory kinetics were
assessed in a relaxed state, 25 M Blebbistatin (BLEB) dissolved in DMSO (5 mM stock)
was added to the chamber for all respirometric assessments (Perry et al., 2011). We examined
the differences in mitochondrial respiratory response between the fed and fasted state to a
variety of substrates that generate NADH for complex I (pyruvate and glutamate), FADH2 for
complex II (succinate), or both including FADH2 for electron transfer flavoprotein
(palmitoylcarnitine), using 4 different protocols in separate PmFB. Substrates were added in a
step-wise titration until maximal respiration was achieved. Cytochrome c was then added to

This article is protected by copyright. All rights reserved.

test for mitochondrial membrane integrity, as partial loss of cytochrome c during sample
preparation may limit active respiration. A cytochrome c response was detected in < 5% of all
experiments and no response generated > 10% increase in respiration. At the conclusion of
each experiment, PmFB were washed in double-distilled H2O to remove salts, frozen at
20C, and freeze-dried. Polarographic oxygen measurements were acquired at 2 second
intervals, with the rate of respiration derived from 40 data points and expressed as pmols

per mg of dry weight. The Kmapp for ADP was determined through the MichaelisMenten
enzyme kinetics fitting model (Y=VmaxX/(Kmapp+X)), where X is [free ADP] (ADPf) and
Y is JO2 at [ADPf] using Prism (GraphPad Software, Inc., La Jolla, CA, USA), as published
previously (Perry et al., 2011).
Statistical Analysis
Statistical analysis of gene expression was performed on linear data using the 2-CT
method using TATA-binding protein (TBP) as a housekeeping gene (Schmittgen & Livak,
2008). Pre- and post-intervention data (i.e. fasting or exercise) was compared using a paired
Students t-test with statistical significance set at p < 0.05. Gene expression and protein
content have been presented graphically as fold change relative to pre-intervention data for
ease of viewing. Linear regression analysis was performed to determine if changes in SIRT3
gene expression were predicted by changes in PGC-1 in response to exercise.

RESULTS
Mitochondrial Purity
Mitochondrial isolations were analyzed via western blot to determine the purity of
samples (Figure 1). Enrichment of mitochondrial samples was confirmed with COX IV,
which was highly abundant in isolated mitochondria (IM) samples. As expected, the cytosolic
protein lactate dehydrogenase (LDH) was found mainly in whole muscle samples (WM), and
This article is protected by copyright. All rights reserved.

was either absent from, or detected in negligible amounts in IM and nuclear extract (NE)
samples. SIRT3 was found in IM and WM samples, and was also either absent from, or
detected in negligible amounts in NE samples.
SIRT3 Expression, Localization, and Activation in Response to Endurance Exercise
In response to an acute bout of endurance exercise, the rate of fat oxidation (Rest:
0.96 0.32, Exercise: 5.66 1.97, p < 0.001, Figure 2B) and oxygen consumption (Rest:
0.34 0.07, Exercise: 2.56 0.70 Lmin-1, p < 0.0001) were significantly elevated.
Additionally, SIRT3 gene expression decreased (-8%, p < 0.05, Figure 2C) and SIRT3
mitochondrial content remained unchanged (Figure 2D). Mitochondrial acetylation was also
unaltered in response to exercise, regardless if quantified by molecular weight ranges (Figure
2E) or individual bands (not presented). A representative blot for pan-acetylation of
mitochondrial protein is presented in Figure 2F. Changes in PGC-1 gene expression did not
predict changes in SIRT3 gene expression following exercise, F(1, 5) = 0.938, p = 0.337, R2
= 0.158, r = -0.398.
SIRT3 Expression, Localization, and Activation in Response to Prolonged Fasting
Following a 48-hour fast, the rate of fat oxidation increased (Fed: 0.87 0.51, Fast:
1.30 0.37 kcalmin-1, p < 0.05, Figure 3B), while oxygen consumption (Fed: 0.35 0.03,
Fast: 0.31 0.04 Lmin-1, p < 0.01) decreased. Similar to experiment one, SIRT3 gene
expression also decreased (-19%, p < 0.01, Figure 3C) and mitochondrial SIRT3 content and
acetylation remained unchanged (Figure 3D, E). Whole muscle SIRT3 content was also
unaltered (data not shown).
Mitochondrial Respiration Following Prolonged Fasting
Due to tissue limitations we were unable to complete a full data set for
palmitoylcarnitine and the data we obtained did not fit Michaelis-Menten-like kinetics, thus
we were unable to calculate Kmapp or Vmax. However, calculating maximal respiration rates

This article is protected by copyright. All rights reserved.

observed at the end of a 6-point palmitoylcarnitine titration up to 60 m showed no difference

between fed (33.7 8.1 pmolsec-1mg-1 dry wt) and fasted (32.8 11.7 pmolsec-1mg-1 dry
wt) states (unpaired t-test, p = 0.948; Fed n = 6, Fast n = 5). For the remaining protocols, no
change in the apparent Kmapp occurred following fasting (data not shown). The maximal net
mitochondrial respiratory O2 flux (Vmax) for pyruvate and succinate did not change; however,
there was a significant decrease in Vmax for glutamate (Fed: 80.4 42.5, Fast: 50.1 21.2
pmolsec-1mg-1 dry wt, p < 0.05, Figure 4), indicating a lower capacity for glutamatestimulated mitochondrial respiration.
Relationship between SIRT3 mRNA and Protein Expression
We found there were no significant correlations between SIRT3 mRNA and SIRT3
protein expression in response to either an acute bout of exercise (p = 0.873, R2 = 0.007, r =
0.075) or 48-hours of fasting (whole muscle SIRT3: p = 0.451, R2 = 0.083, r = 0.289;
mitochondrial SIRT3: p = 0.613, R2 = 0.055, r = -0.234).

DISCUSSION
The present study investigated the relationship between SIRT3 expression and cellular
localization with fatty acid oxidation in human skeletal muscle. We hypothesized that
increases in fatty acid oxidation that occur with fasting and exercise would be accompanied
by increased mitochondrial SIRT3. The major novel findings of the current study were that,
in response to fasting and exercise: 1) SIRT3 gene expression was modestly decreased and 2)
changes in fatty acid oxidation were not associated with changes in mitochondrial SIRT3
content. These results are inconsistent with findings from animal models, which suggest that
changes in fatty acid oxidation require changes in SIRT3 expression (Palacios et al., 2009;
Hirschey et al., 2010; Caton et al., 2011; Jing et al., 2013). In addition, based on the time

This article is protected by copyright. All rights reserved.

points measured in the present study, our findings also suggest that mitochondrial SIRT3
translocation is not required for increases in fatty acid oxidation in human skeletal muscle.
Regulation of SIRT3 Expression by Exercise and Fasting
We report that SIRT3 gene expression is moderately decreased following an acute
bout of endurance exercise in human skeletal muscle, while in rats SIRT3 gene expression is
unaltered 2, 4, and 8 hours post-exercise (Hokari et al., 2010). Although SIRT3 gene
expression does not appear to be elevated following a single bout of exercise, repeated bouts
seem to be effective in stimulating its expression (Hokari et al., 2010). In support of this,
exercise training results in an increase in SIRT3 protein content in both murine (Palacios et
al., 2009; Hokari et al., 2010; Brandauer et al., 2015) and human (Lanza et al., 2008; Johnson
et al., 2014; Brandauer et al., 2015; Vargas-Ortiz et al., 2015) skeletal muscle. While it is
possible that, similar to citrate synthase (Perry et al., 2010), a single bout of exercise may not
be strong enough of a stimulus to increase SIRT3 gene expression, repeated bouts of exercise
may result in cumulative increases in SIRT3 gene expression and subsequently protein
content. Conversely, alterations in SIRT3 gene expression may not be required for changes in
SIRT3 protein content, and perhaps the stability of SIRT3 protein may play a more important
role. Regardless, future research should investigate whether higher intensities of exercise
differentially regulate SIRT3 expression and activity.
In murine skeletal muscle, fasting for 24 hours decreases SIRT3 mRNA expression
(Caton et al., 2011; Jing et al., 2013), and can both increase (Palacios et al., 2009; Caton et
al., 2011) and decrease (Jing et al., 2013) SIRT3 protein content. Consistent with previous
reports (Caton et al., 2011; Jing et al., 2013), we observed a decrease in SIRT3 mRNA
expression following 48 hours of fasting in human skeletal muscle. Interestingly, we failed to
observe a change in SIRT3 protein content following fasting, adding to the controversy
surrounding the impact of fasting on SIRT3 protein content in skeletal muscle (Palacios et al.,

This article is protected by copyright. All rights reserved.

2009; Caton et al., 2011; Jing et al., 2013). SIRT3 expression is proposed to be controlled by
PGC-1 (Giralt et al., 2011; Gurd et al., 2012; Brandauer et al., 2015; Satterstrom et al.,
2015) via estrogen-related receptor (Giralt et al., 2011) and nuclear respiratory factor 2
(Satterstrom et al., 2015); however, in the present study we found no relationship between
changes in PGC-1 and SIRT3 gene expression. While it is possible that this lack of
relationship between SIRT3 and PGC-1 gene expression may be explained by additional
transcriptional regulators of SIRT3, at present the mechanisms controlling SIRT3 expression
in human skeletal muscle are still unknown and should be addressed in future studies.
SIRT3 Cellular Localization is Unaffected by Cellular Energy Stress and Not Associated with
Whole Body Fatty Acid Oxidation
In HeLa and 293T cells, SIRT3 translocates to the mitochondria in response to
cellular stress caused by UV-irradiation and DNA damage (Scher et al., 2007), and changes
in mitochondrial SIRT3 are associated with altered fatty acid oxidation in liver (Hirschey et
al., 2010; Liu et al., 2014). While these results raise the possibility that translocation of
SIRT3 into mitochondria may contribute to the control of fatty acid oxidation, we did not
observe any change in mitochondrial SIRT3 following either fasting or exercise in human
skeletal muscle. These results agree with our previous observations that acute exercise does
not increase mitochondrial SIRT3 abundance in rat skeletal muscle (Gurd et al., 2012).
However, it is possible that in human skeletal muscle SIRT3 may control more chronic
changes in fatty acid oxidation by regulating proteins involved in the transcriptional control
of mitochondrial gene expression, such as mitochondrial transcription factor A (TFAM)
(Hebert et al., 2013) and leucine-rich protein 130 (LRP130) (Liu et al., 2014). If this is the
case, changes in SIRT3 mitochondrial localization may also occur later in the post-exercise
period than examined in the present study. An obvious limitation is that we were unable to
directly measure SIRT3 activity or regulation of its specific targets, which prevents us from

This article is protected by copyright. All rights reserved.

concluding whether SIRT3 activity was altered in response to exercise or fasting. Regardless,
our results suggest that if SIRT3 is involved in the acute regulation of fatty acid oxidation in
human skeletal muscle, then its activity is not regulated by cellular localization. Future
studies should be done to determine whether changes in SIRT3 activity are involved in
regulating both acute and chronic changes in fat oxidation in human skeletal muscle.
As changes in mitochondrial acetylation are associated with increases in fatty acid
oxidation (Hirschey et al., 2010; Liu et al., 2014), and SIRT3 is the main deacetylase in the
mitochondria (Lombard et al., 2007), we also examined changes in the acetylation of
mitochondrial lysine residues following fasting and exercise using a pan-acetylation
antibody, as has been done previously (Schwer et al., 2009; Hirschey et al., 2010; Jing et al.,
2013). In contrast to studies in mice where a pan-acetylation antibody was also used to
estimate mitochondrial protein acetylation (Hirschey et al., 2010; Jing et al., 2013), we
observed that increases in fatty acid oxidation were not accompanied by changes in
mitochondrial acetylation in human skeletal muscle following either fasting or exercise. The
limitations of utilizing a pan-acetyl-lysine antibody may explain our lack of change in
mitochondrial acetylation, including the possibility that not all acetylation sites were
detected, or that at a given molecular weight (i.e. within a given band) opposing changes in
acetylation of multiple proteins could cause a net change of zero. In addition, only 15 g of
protein was loaded to detect changes in acetyl-lysine residues, and therefore less abundant
acetylated proteins/sites may not have been detected. In support of this, recent evidence
suggests that SIRT3 may have fewer, but more selective regulatory targets in skeletal muscle
where SIRT3 is less abundant (Dittenhafer-Reed et al., 2015). While these results are difficult
to interpret given the limitations associated with the use of a pan-acetylation antibody, the
fact that this technique was able to discern changes in mitochondrial acetylation following
fasting in animal models (Hirschey et al., 2010; Jing et al., 2013; Vassilopoulos et al., 2014)

This article is protected by copyright. All rights reserved.

suggests that our findings may be indicative of a divergent response in human skeletal
muscle.
SIRT3 and Mitochondrial Respiration: The Role of Glutamate in the Fasting Response
We also investigated the effect of fasting on mitochondrial function by examining
mitochondrial respiration in PmFB. We believed that mitochondrial SIRT3 would be elevated
with fasting, where it would act on complexes in the electron transport chain, as well as
enzymes involved in fatty acid oxidation and the citric acid cycle, to promote ATP
production (Ahn et al., 2008; Schlicker et al., 2008; Yu et al., 2012; Bharathi et al., 2013;
Vassilopoulos et al., 2014). Of the substrates tested in the current study, only glutamatestimulated respiration, which was reduced, was altered. While glutamate dehydrogenase
(GDH) is a proposed target of SIRT3 (Schlicker et al., 2008; Pacella-Ince et al., 2014), it is
difficult to comment on the role of SIRT3 in the changes in glutamate utilization observed in
the present study as no changes in mitochondrial SIRT3 were observed. In addition, SIRT3 is
proposed to deacetylate and regulate several proteins involved in pyruvate and succinate
oxidation (Ahn et al., 2008; Schlicker et al., 2008; Cimen et al., 2010; Yu et al., 2012; Hebert
et al., 2013; Vassilopoulos et al., 2014), which were both unaltered in the current study.
Thus, if SIRT3 was involved in reducing GDH activity then it is likely that succinate and
pyruvate oxidation would also be depressed; however, it is still possible that alterations in
SIRT3 activity (not measured in the present study) may be responsible for decreases in
glutamate respiration following fasting in human skeletal muscle. Interestingly, the change in
glutamate oxidation does agree with previous reports that GDH may be inhibited in skeletal
muscle during fasting in order to stimulate the conversion of glutamate to glutamine to
support liver gluconeogenesis (Mezzarobba et al., 2003). Thus, it is possible that the
decreased glutamate respiration observed in the present study occurs in order to direct
glutamate away from the citric acid cycle, so that it may be used for glutamine synthesis.

This article is protected by copyright. All rights reserved.

Whether SIRT3 specifically targets the glutamate pathway in human skeletal muscle remains
to be determined.
Conclusion
This is the first study to investigate changes in SIRT3 expression and mitochondrial
localization in response to cellular energy stress in human skeletal muscle. We demonstrate
that fasting and exercise decrease SIRT3 gene expression, but do not alter SIRT3
mitochondrial localization despite marked increases in fatty acid oxidation. These findings
indicate that if SIRT3 activity is altered by fasting and/or exercise in human skeletal muscle,
this change in activity is not accomplished by changes in cellular localization. Future research
should investigate whether SIRT3 regulates specific targets within human skeletal muscle
mitochondria to further our understanding of SIRT3s role in the regulation of mitochondrial
function.

ADDITIONAL INFORMATION
Competing Interests
The authors have no conflicts of interest, financial or otherwise, to declare.
Author Contributions
BAE, CGRP, and BJG conceived and designed the study. BAE, MCH, JBLM, CGRP,
CAS, and BJG collected the data. BAE, MCH, JBLM, CGRP, and BJG contributed to
analysis and interpretation of the data. BAE and BJG drafted the manuscript. BAE, MCH,
JBLM, CGRP, CAS, and BJG edited and revised the manuscript and approved the final
version of the manuscript.
Funding
This study was supported by funding from the National Sciences and Engineering
Research Council of Canada (NSERC) to Brendon J. Gurd (RGPIN-402635-2011) and

This article is protected by copyright. All rights reserved.

Christopher G.R. Perry (RGPIN-436138-2013). Brittany A. Edgett was supported by an

Ontario Graduate Scholarship and an Alexander Graham Bell Canada Graduate Doctoral
Scholarship from NSERC.
Acknowledgements
We thank all of the participants who volunteered for this study.

REFERENCES
Ahn B-H, Kim H-S, Song S, Lee IH, Liu J, Vassilopoulos A, Deng C-X & Finkel T (2008).
A role for the mitochondrial deacetylase Sirt3 in regulating energy homeostasis. Proc
Natl Acad Sci U S A 105, 1444714452.
Anmann T, Guzun R, Beraud N, Pelloux S, Kuznetsov A V, Kogerman L, Kaambre T, Sikk
P, Paju K, Peet N, Seppet E, Ojeda C, Tourneur Y & Saks V (2006). Different kinetics
of the regulation of respiration in permeabilized cardiomyocytes and in HL-1 cardiac
cells. Importance of cell structure/organization for respiration regulation. Biochim
Biophys Acta 1757, 15971606.
Bergstrom J (1975). Percutaneous needle biopsy of skeletal muscle in physiological and
clinical research. Scand J Clin Lab Invest 35, 609616.
Bharathi SS, Zhang Y, Mohsen AW, Uppala R, Balasubramani M, Schreiber E, Uechi G,
Beck ME, Vockley J, Rardin MJ, Verdin E, Gibson BW, Hirschey MD & Goetzman ES
(2013). Sirtuin 3 (SIRT3) protein regulates long-chain acyl-CoA dehydrogenase by
deacetylating conserved lysines near the active site. J Biol Chem 288, 3383733847.
Brandauer J, Andersen M a., Kellezi H, Risis S, Frsig C, Vienberg SG & Treebak JT (2015).
AMP-activated protein kinase controls exercise training- and AICAR-induced increases
in SIRT3 and MnSOD. Front Physiol 6, 116.
Caton PW, Holness MJ, Bishop-Bailey D & Sugden MC (2011). PPAR-LXR as a novel
metabolostatic signalling axis in skeletal muscle that acts to optimize substrate selection
in response to nutrient status. Biochem J 437, 521530.
Chomcyzynski P & Sacchi N (1987). Single-step method of RNA isolation by acid
guanidinium thiocyanate. Anal Biochem 162, 156159.
Cimen H, Han M-J, Yang Y, Tong Q, Koc H & Koc EC (2010). Regulation of succinate
dehydrogenase activity by SIRT3 in mammalian mitochondria. Biochemistry 49, 304
311.
Dittenhafer-Reed KE, Richards AL, Fan J, Smallegan MJ, Fotuhi Siahpirani A, Kemmerer
ZA, Prolla TA, Roy S, Coon JJ & Denu JM (2015). SIRT3 Mediates Multi-Tissue
Coupling for Metabolic Fuel Switching. Cell Metab 21, 637646.
Edgett BA, Foster WS, Hankinson PB, Simpson CA, Little JP, Graham RB & Gurd BJ
(2013). Dissociation of Increases in PGC-1 and Its Regulators from Exercise Intensity
This article is protected by copyright. All rights reserved.

and Muscle Activation Following Acute Exercise. PLoS One 8, e71623.

Giralt A, Hondares E, Villena JA, Ribas F, Daz-Delfn J, Giralt M, Iglesias R & Villarroya F
(2011). Peroxisome proliferator-activated receptor- coactivator-1 controls
transcription of the Sirt3 gene, an essential component of the thermogenic brown
adipocyte phenotype. J Biol Chem 286, 1695816966.
Gurd BJ, Holloway GP, Yoshida Y & Bonen A (2012). In mammalian muscle, SIRT3 is
present in mitochondria and not in the nucleus; And SIRT3 is upregulated by chronic
muscle contraction in an adenosine monophosphate-activated protein kinaseindependent manner. Metabolism 61, 733741.
Hebert AS, Dittenhafer-Reed KE, Yu W, Bailey DJ, Selen ES, Boersma MD, Carson JJ,
Tonelli M, Balloon AJ, Higbee AJ, Westphall MS, Pagliarini DJ, Prolla T a., AssadiPorter F, Roy S, Denu JM & Coon JJ (2013). Calorie Restriction and SIRT3 Trigger
Global Reprogramming of the Mitochondrial Protein Acetylome. Mol Cell 49, 186199.
Hirschey MD et al. (2010). SIRT3 regulates mitochondrial fatty-acid oxidation by reversible
enzyme deacetylation. Nature 464, 121125.
Hokari F, Kawasaki E, Sakai A, Koshinaka K, Sakuma K & Kawanaka K (2010). Muscle
contractile activity regulates Sirt3 protein expression in rat skeletal muscles. J Appl
Physiol 109, 332340.
Horowitz JF & Klein S (2000). Lipid metabolism during endurance exercise. Am J Clin Nutr
72, 558S 63S.
Jing E, ONeill BT, Rardin MJ, Kleinridders A, Ilkeyeva OR, Ussar S, Bain JR, Lee KY,
Verdin EM, Newgard CB, Gibson BW & Kahn CR (2013). Sirt3 regulates metabolic
flexibility of skeletal muscle through reversible enzymatic deacetylation. Diabetes 62,
34043417.
Johnson ML, Irving BA, Lanza IR, Vendelbo MH, Konopka AR, Robinson MM, Henderson
GC, Klaus KA, Morse DM, Heppelmann C, Bergen HR, Dasari S, Schimke JM, Jakaitis
DR & Nair KS (2014). Differential Effect of Endurance Training on Mitochondrial
Protein Damage, Degradation, and Acetylation in the Context of Aging. Journals
Gerontol Ser A Biol Sci Med Sci18.
Kim SC, Sprung R, Chen Y, Xu Y, Ball H, Pei J, Cheng T, Kho Y, Xiao H, Xiao L, Grishin
N V., White M, Yang XJ & Zhao Y (2006). Substrate and Functional Diversity of
Lysine Acetylation Revealed by a Proteomics Survey. Mol Cell 23, 607618.
Kuznetsov A V, Tiivel T, Sikk P, Kaambre T, Kay L, Daneshrad Z, Rossi A, Kadaja L, Peet
N, Seppet E & Saks VA (1996). Striking differences between the kinetics of regulation
of respiration by ADP in slow-twitch and fast-twitch muscles in vivo. Eur J Biochem
241, 909915.
Lanza IR, Short DK, Short KR, Raghavakaimal S, Basu R, Joyner MJ, McConnell JP & Nair
KS (2008). Endurance exercise as a countermeasure for aging. Diabetes 57, 29332942.
Liu L, Nam M, Fan W, Akie TE, Hoaglin DC, Gao G, Keaney JF & Cooper MP (2014).
Nutrient sensing by the mitochondrial transcription machinery dictates oxidative
phosphorylation. J Clin Invest 124, 768784.
Lombard DB et al. (2007). Mammalian Sir2 homolog SIRT3 regulates global mitochondrial
lysine acetylation. Mol Cell Biol 27, 88078814.
This article is protected by copyright. All rights reserved.

Lu Z, Chen Y, Aponte AM, Battaglia V, Gucek M & Sack MN (2015). Prolonged Fasting
Identifies Heat Shock Protein 10 as a Sirtuin 3 Substrate. J Biol Chem 290, 24662476.
Mezzarobba V, Torrent A, Leydier I, Alles S, Brajon B, Mignon M, Attaix D & MeynialDenis D (2003). The role of adrenal hormones in the response of glutamine synthetase to
fasting in adult and old rats. Clin Nutr 22, 569575.
Pacella-Ince L, Zander-Fox DL & Lane M (2014). Mitochondrial SIRT3 and its target
glutamate dehydrogenase are altered in follicular cells of women with reduced ovarian
reserve or advanced maternal age. Hum Reprod 29, 14901499.
Palacios OM, Carmona JJ, Michan S, Chen KY, Manabe Y, Iii JLW, Goodyear LJ & Tong Q
(2009). Diet and exercise signals regulate SIRT3 and activate AMPK and PGC-1 in
skeletal muscle. 1, 771783.
Pronnet F & Massicotte D (1991). Table of nonprotein respiratory quotient: an update. Can
J Sport Sci 16, 2329.
Perry CGR, Kane DA, Lanza IR & Neufer DP (2013). Methods for assessing mitochondrial
function in diabetes. Diabetes 62, 10411053.
Perry CGR, Kane DA, Lin C-T, Kozy R, Cathey BL, Lark DS, Kane CL, Brophy PM, Gavin
TP, Anderson EJ, Neufer PD & Neufer DP (2011). Inhibiting myosin-ATPase reveals a
dynamic range of mitochondrial respiratory control in skeletal muscle. Biochem J 437,
215222.
Perry CGR, Lally J, Holloway GP, Heigenhauser GJF, Bonen A & Spriet LL (2010).
Repeated transient mRNA bursts precede increases in transcriptional and mitochondrial
proteins during training in human skeletal muscle. J Physiol 588, 47954810.
Peters SJ, St.Amand TA, Howlett RA, Heigenhauser GJ & Spriet LL (1998). Human skeletal
muscle pyruvate dehydrogenase kinase activity increases after a low-carbohydrate diet.
Am J Physiol Endocrinol Metab 275, E980E986.
Rasmussen R (2001). Quantification on the LightCycler. In Rapid Cycle Real-Time PCR, ed.
Meuer S, Wittwer C & Nakagawara K-I, pp. 2134. Springer Berlin Heidelberg, Berlin,
Heidelberg.
Saks VA, Khuchua ZA, Vasilyeva EV, Belikova YO & Kuznetsov AV (1994). Metabolic
compartmentation and substrate channelling in muscle cells. Role of coupled creatine
kinases in in vivo regulation of cellular respiration--a synthesis. Mol Cell Biochem 133134, 155192.
Saks VA, Kuznetsov AV, Khuchua ZA, Vasilyeva EV, Belikova YO, Kesvatera T & Tiivel T
(1995). Control of cellular respiration in vivo by mitochondrial outer membrane and by
creatine kinase. A new speculative hypothesis: possible involvement of mitochondrialcytoskeleton interactions. J Mol Cell Cardiol 27, 625645.
Satterstrom FK, Swindell WR, Laurent G, Vyas S, Bulyk ML & Haigis MC (2015). Nuclear
respiratory factor 2 induces SIRT3 expression. Aging Cell 14, 818825.
Scher MB, Vaquero A & Reinberg D (2007). SirT3 is a nuclear NAD+-dependent histone
deacetylase that translocates to the mitochondria upon cellular stress. Genes Dev 21,
920928.
Schlicker C, Gertz M, Papatheodorou P, Kachholz B, Becker CFW & Steegborn C (2008).
Substrates and Regulation Mechanisms for the Human Mitochondrial Sirtuins Sirt3 and
This article is protected by copyright. All rights reserved.

Sirt5. J Mol Biol 382, 790801.

Schmittgen TD & Livak KJ (2008). Analyzing real-time PCR data by the comparative C(T)
method. Nat Protoc 3, 11011108.
Schwer B, Eckersdorff M, Li Y, Silva JC, Fermin D, Kurtev MV., Giallourakis C, Comb MJ,
Alt FW & Lombard DB (2009). Calorie restriction alters mitochondrial protein
acetylation. Aging Cell 8, 604606.
Scribbans TD, Ma JK, Edgett BA, Vorobej KA, Mitchell AS, Zelt JGE, Simpson CA,
Quadrilatero J & Gurd BJ (2014). Resveratrol supplementation does not augment
performance adaptations or fibre-type-specific responses to high-intensity interval
training in humans. Appl Physiol Nutr Metab 39, 13051313.
Shi T, Wang F, Stieren E & Tong Q (2005). SIRT3, a mitochondrial sirtuin deacetylase,
regulates mitochondrial function and thermogenesis in brown adipocytes. J Biol Chem
280, 1356013567.
Still AJ, Floyd BJ, Hebert AS, Bingman CA, Carson JJ, Gunderson DR, Dolan BK, Grimsrud
PA, Dittenhafer-Reed KE, Stapleton DS, Keller MP, Westphall MS, Denu JM, Attie
AD, Coon JJ & Pagliarini DJ (2013). Quantification of mitochondrial acetylation
dynamics highlights prominent sites of metabolic regulation. J Biol Chem 288, 26209
26219.
Tonkonogi M, Fernstrm M, Walsh B, Ji LL, Rooyackers O, Hammarqvist F, Wernerman J
& Sahlin K (2003). Reduced oxidative power but unchanged antioxidative capacity in
skeletal muscle from aged humans. Pflugers Arch 446, 261269.
Vargas-Ortiz K, Perez-Vazquez V, Diaz-Cisneros FJ, Figueroa A, Jimnez-flores LM,
Rodriguez-DelaRosa G & Macias MH (2015). Aerobic training increases expression
levels of SIRT3 and PGC-1 in skeletal muscle of overweight adolescents without
change in caloric intake. Pediatr Exerc Sci 27, 177184.
Vassilopoulos A, Pennington JD, Andresson T, Rees DM, Bosley AD, Fearnley IM, Ham A,
Flynn CR, Hill S, Rose KL, Kim H-S, Deng C-X, Walker JE & Gius D (2014). SIRT3
Deacetylates ATP Synthase F1 Complex Proteins in Response to Nutrient- and
Exercise-Induced Stress. Antioxid Redox Signal 21, 551564.
Walsh B, Tonkonogi M, Sderlund K, Hultman E, Saks V & Sahlin K (2001). The role of
phosphorylcreatine and creatine in the regulation of mitochondrial respiration in human
skeletal muscle. J Physiol 537, 971978.
Walsh JJ, Edgett BA, Tschakovsky ME & Gurd BJ (2015). Fasting and exercise differentially
regulate BDNF mRNA expression in human skeletal muscle. Appl Physiol Nutr Metab
40, 9698.
Wijngaarden MA, van der Zon GC, van Dijk KW, Pijl H & Guigas B (2013). Effects of
prolonged fasting on AMPK signaling, gene expression, and mitochondrial respiratory
chain content in skeletal muscle from lean and obese individuals. Am J Physiol
Endocrinol Metab 304, E1012E1021.
Yu W, Dittenhafer-Reed KE & Denu JM (2012). SIRT3 protein deacetylates isocitrate
dehydrogenase 2 (IDH2) and regulates mitochondrial redox status. J Biol Chem 287,
1407814086.

This article is protected by copyright. All rights reserved.

Table 1. Participant Characteristics

Fasting (n = 10)

Exercise (n = 8)

22.0 1.5
181.0 5.9
77.2 6.2
23.4 2.0
81.4 2.0
3563 430
46.9 6.0

21.4 2.8
177.2 8.9
75.3 13.3
23.9 3.2
85.8 9.9
3604 1310
47.1 11.8

Age (years)
Height (cm)
Weight (kg)
BMI (kgm-2)
Waist Circumference (cm)
Absolute VO2peak (mLmin-1)
Relative VO2peak (mLmin-1kg-1)
Values are mean standard deviation

Table 2. List of Primer Sequences used for Real-Time PCR

Gene
Forward Primer (5-3)
Reverse Primer (5-3)
PGCCACTTACAAGCCAAACCAACAAC CAATAGTCTTGTTCTCAAATGGGGA
1
SIRT3 GCTTCCTCTAGTGACACTGTTAG
TGCAGAAGTAGCAGTTCAGTG
TBP
AGACGAGTTCCAGCGCAAGG
GCGTAAGGTGGCAGGCTGTT

This article is protected by copyright. All rights reserved.

Figure 1. Representative Western blots of lactate dehydrogenase (LDH), Cytochrome c

oxidase subunit IV (COX IV), and SIRT3 from human isolated mitochondria (IM), nuclear
extractions (NE), and whole muscle (WM) samples to demonstrate purity of mitochondrial
isolations.

IM

NE

LDH (37 kDa)

COX IV (17 kDa)

SIRT3 (28 kDa)

This article is protected by copyright. All rights reserved.

WM
Cytosolic

Mitochondrial

Figure 2. Overview of acute exercise protocol (A). The effect of an acute bout of endurance
exercise on whole body fat oxidation (B), skeletal muscle SIRT3 gene expression (C),
mitochondrial SIRT3 content (D), and representative blot (E) of mitochondrial acetyl-lysine
residues (F). Values are normalized to rest and presented as mean SEM, * p < 0.05 Rest vs.
EX-0.

Muscle Biopsy

(A)

Muscle Biopsy

Gas Exc.

Muscle Biopsy

Gas Exc.

12-Hour Fast

Cycling @ 55% WRpeak

9 AM
Rest

3 Hours of Rest

10 AM
EX-0

1 PM
EX-3

8 AM Standardized Breakfast

Rest

8 PM Start Overnight Fast

EX-0

SlRT3 (28 kDa)

7 PM Standardized Dinner

(C)

Fat Oxidation (kcal/min)

8.0

6.0
4.0
2.0
0.0

(D)

1.5

1.0

1.5

SIRT3 Protein Content

(EX-0 Relative to Rest)

(B)

SIRT3 mRNA Expression

(EX-3 Relative to Rest)

Amido Black

0.5

0.0

1.0

0.5

0.0
SIRT3

Rest Exercise

(E)

250 kDa

Mitochondria

(F)
250 - 75 kDa

75 kDa

<75 - 37 kDa
37 kDa

<37 - 25 kDa

25 kDa

<25 - 15 kDa

<15 kDa
15 kDa

0.0

Amido Black

Rest

EX-0

This article is protected by copyright. All rights reserved.

0.5

1.0

1.5

Acetyl-Lys Content
(EX-0 Relative to Rest)

2.0

Figure 3. Overview of fasting protocol (A). The effect of a 48-hour fast on whole body fat
oxidation (B), skeletal muscle SIRT3 gene expression (C), mitochondrial SIRT3 content (D),
and representative blot (E) of mitochondrial acetyl-lysine residues (F). Values are normalized
to fed and presented as mean SEM. * p < 0.05 Fast vs. Fed.

(A)

Muscle Biopsy

Muscle Biopsy

Gas Exc.

Gas Exc.

12-Hour Fast

48-Hour Fast

12 PM
Fed

12 PM
Fast

11 AM Standardized Lunch

Fed

9 AM Standardized Breakfast

SlRT3 (28 kDa)

9 PM Start Overnight Fast

8 PM Standardized Dinner

(C)

1.0

0.5

0.0
Fed

(D)

1.5

1.0

1.5

SIRT3 Protein Content

(Fasted Relative to Fed)

Fat Oxidation (kcal/min)

1.5

Amido Black

SIRT3 mRNA Expression

(Fasted Relative to Fed)

(B)

Fast

0.5

0.0

1.0

0.5

0.0
SIRT3

Fasted

(E)

250 kDa

Mitochondria

(F)
250 - 75 kDa

75 kDa

37 kDa

<75 - 37 kDa

<37 - 25 kDa

<25 - 15 kDa
25 kDa

<15 kDa
15 kDa

Amido Black

Fed

0.0

Fast

This article is protected by copyright. All rights reserved.

0.5

1.0

1.5

Acetyl-Lys Content
(Fasted Relative to Fed)

2.0

Figure 4. Respiratory kinetics for pyruvate, succinate, and glutamate in response to fasting in
permeabilized muscle fibers. Net mitochondrial respiratory O2 flux (JO2) in both fed (closed
circles) and fasted (open circles) states supported by increasing concentrations of pyruvate
(A), succinate (B), or glutamate (C). Maximal net JO2 (Vmax) in the fed (white bars) and
fasted (grey bars) state for pyruvate (D), succinate (E), or glutamate (F). Values presented as
mean SEM. * p < 0.05 significantly different from fed.

(D)

200

JO2

150
100
50
0
0

2000

4000

(pmolsec1mg1 dry wt)

JO2

(pmolsec1mg1 dry wt)

(A)

250

Pyruvate V max

200
150
100
50
0
Fed

6000

Fasted

[Pyruvate M]

(E)

400

JO2

300
200
100
0
0

5000

10000

15000

(pmolsec1mg1 dry wt)

JO2

(pmolsec1mg1 dry wt)

(B)

800

Succinate V max

600
400
200
0
Fed

20000

Fasted

[Succinate M]

(F)

100
80

JO2

60
40
20
0
0

500

1000

1500

(pmolsec1mg1 dry wt)

JO2

(pmolsec1mg1 dry wt)

(C)

100

Glutamate V max

80

60
40
20
0

2000

[Glutamate M]

This article is protected by copyright. All rights reserved.

Fed

Fasted