Sie sind auf Seite 1von 46

Gitelman and Bartter syndromes

Rosa Vargas-Poussou
Dpartement de Gntique
Hpital Europen Georges Pompidou
Paris
Gitelman and Bartter Syndromes
Loosing salt Common
tubulopathies characteristics
Autosomal recessive Secondary activation
inheritance of renin - angiotensin
Rare diseases; - aldosteron system
prevalence Metabolic alkalosis
Gitelman Syndrome : Renal hypokalemia
1/40.000 Normal or low blood
Bartter Syndrome : pressure
1/100.000
Gitelman and Bartter Syndromes
Adolescent Gitelman
Cl -
Adult
Thiazides Na+ Cl-
Hypomagnesemi
Na+ 7% Na K+ Na
+
+
Ca2+
a
Ca2+ Na Ca2+ Hypocalciuria
Mg2+ +

Na+ Na+ Mg2+


H+

Children
Na+ Normo or Bartter
20% hypercalciuria
2Cl - Na+ Polyuria
Furosemide Na+ K+ K+
K+ Cl - Failure to thrive
Barttin
Cl -
K+ K+
H+ Na+ HCO3- Hydramnios Antenatal
Na+
Ca++
Severe polyuria Bartter
Mg+
+ Hypercalciuria
NH4
(+) (-) Failure to thrive
+
Vte
Gitelman and Bartter Syndromes

Thiazides Cl - Cl-
Na+
Na+ 7% Na+ K+ Na+
Ca2+
Ca2+
Na Ca2+
Mg2+
Na+
+

Na+ Mg2+
Gitelman
H+

Na+ Bartter type IV


20% Bartter type I
(antenatal) (antenatal with
2Cl - Na+
Furosemide Na+ K+ K+ deafness)
K+ Cl -
Barttin
Cl -
Bartter type II K+ K+
(antenatal) H+ Na+ HCO3-
Ca++ Na+
Mg++
NH4+
Bartter
(+) (-)
Vte
Bartter type III
(classic)
2Cl - Na+
Furosemide Na+ K+ K+
K+ Cl - Thiazides Cl - Cl-
Barttine Na+
K+ Na+
Cl - Na+
K+ K+ Ca2+
Ca2+
Na+ HCO3- Na Ca2+
Ca++ H+ Mg2+ +
Na+
Mg++ H+ Na+ Na+ Mg2+
NH4+ Paracelline
Na+ 7% (+) (-)
Vte

ENaC
WNK1
Na + K+
Na+ WNK4
SGK

20%
Na+ K+
2% Aldosteron
H2O
RM H2O
(-) (+)
Hypokalem
ic alkalosis Cl-
HCO3-
H+ H+ HCO3 -

H2CO3
K+ ACII
H+ CO2 H2O
2Cl - Na+
Furosemide Na+ K+ K+
K+ Cl - Thiazides Cl - Cl-
Barttine Na+
K+ Na+
Cl - Na+
K+ K+ Ca2+
Ca2+
Na+ HCO3- Na Ca2+
Ca++ H+ Mg2+ +
Na+
Mg++ H+ Na+ Na+ Mg2+
NH4+ Paracelline
Na+ 7% (+) (-)
Vte

ENaC
WNK1
Na + K+
Na+ WNK4
SGK

20%
Na+ K+
2% Aldosteron
H2O
RM H2O
(-) (+)
Hypokalem
ic alkalosis Cl-
HCO3-
H+ H+ HCO3 -

H2CO3
K+ ACII
H+ CO2 H2O
Gitelman Syndrome

-
Population
Thiazides Cl
Na+
Cl- January 2001 to August
K+ Na+ 2009
Wnk-4 Na
+
Ca2+ 448 patients with
Ca2+ TRPV5
Ca2+
clinical diagnosis of GS
Wnk-1 Na+
Mg2+
TRPM6
(219 M and 229 F)
Na+ Mg2+
Na+ French Network for
H+
Tubulopathies and
Eunefron

Criteria
Renal hypokalemia
Metabolic alkalosis
Reabsorption: NaCl losing
Na+ 7% Secondary activation of the RAA system
Ca2+ 10- 15% Hypomagnesemia
Mg2+ 10% Hypocalciuria
SLC12A3 Sequencing

MUTATIONS
448 PROBANDS
172 different (100 novel)
12% 6% 2%
14%
18%

52%
15% 63%
18%
Compound heterozygous (n = 236) 70%
Missense (n=110) Frameshift (n=26)
Homozygous (n = 79) (n=315)
One heterozygous mutation (n = 81) Splicing (n=24) Nonsense (n=11)
No mutation (n = 52) Inframe (n=4)
SLC12A3 point mutations
Frequency and distribution - 172 mutations in 711 alleles

Kunchaparty, S, et al. Am J Physiol, 1999.


De Jong, JC, et al. J Am Soc Nephrol, 2002.
52 patients without mutations
Analysis of the CLCNKB gene in 49 patients:
detection of molecular abnormalities in 14
38 patients without molecular abnormalities (8.4%)
Search for heterozygous large rearrangements

MLPA (Multiplex Ligation-dependant Probe Amplification)


Salsa MLPA kit P136 SLC12A3 Gitelman Syndrome MRC Holland
QMPSF (Quantitative Multiplex PCR Short Fluorescent Fragments)
Semi-quantitative techniques: allele dosage
Peak Ratio Patien/control
< 0.7 deletion
0.7 - 1.3 Normal
1.3 2 duplication

77 patients
53 of the 80 with one heterozygous point
mutation
24 of the 39 without mutations
MLPA and QMPSF results
11 different large rearrangements in 24 out of 53
patients with one heterozygous point mutation tested

Two or more exon


One exon deletion in deletions or duplications in
13 patients: 11 patients
E1_E7del, 2 patients
E9del, 1 patient
E2_E3del, 2 patients
E14del, 2 patients
E4_E6del, 3 patients
E18del, 1 patient E19_E23del, 1 patient
E26del, 9 patients E24_E25del, 1 patient
E1_E3dup, 1 patient
E1_E4dup, 1 patient
A. MLPA
1. 2.

1 2
22 23
20 21
19

B. QMPSF
1. 2.
LR - PCR
1 2 3 456 78 9 10 1112 13 14 15 16 17 18 19 20 21 22 23 24 25 26

E2_E3del E4_E6del E14del

2941bp
1786bp
4579bp 4082bp

2574bp
1872bp
Characterization of breakpoints
1 2

Intron1 Intron 3 Intron1 Intron 3

4
3

Intron 3 Intron 6 Intron 13 Intron 14

5 6

Intron17 Intron 18 Intron 23 Intron 25

1 2 3 456 78 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

1 (3342 bp) 4 (1183 bp) 6


2 (2720 bp) 5 (1355 bp) (10711 bp)
3 (1508 bp)

1. E2_E3 del: c.282+667_c.506-205del 4. E14del: c.1169+773_c.1825+247del, (2 patients)


2. E2_E3 del: c.283-273_c.506-213del 5. E18del: c.2178+269_c.2285+685del
3. E4_E6 del: c.506-305_c.852+185del, (3 patients) 6. E24_E25del: c.2748-324_c.2952-505
Mechanisms of large
Transposable elements
genomic rearrangements
Cordaux R and Batzer MA, 2009

Non-Allelic Homologous
Recombination
Human diseases
Non-Homologous Belancio VP et al. Genome Research 2008
End-Joining Large rearrangements
Fork Stalling and Template
Switching
50 different genes

Wenli G et al. PathoGenetics 2008


Deletions Mechanism ?

Non allelic
homologous
recombination
(NAHR)

RepeatMasker
http://www.repeatmaske
r.org/
SLC12A3
1 2 3 456 78 9 10 1112 13 14 15 16 17 18 19 20 21 22 23 24 25 26

1 (3342 bp) 4 (1183 bp) 6


2 (2720 bp) 5 (1355 bp) (10711 bp)
3 (1508 bp)

Alu(s) with homology > 80%

1. E2_E3 del: c.282+667_c.506-205del 4. E14del: c.1169+773_c.1825+247del, (2 patients)


2. E2_E3 del: c.283-273_c.506-213del 5. E18del: c.2178+269_c.2285+685del
3. E4_E6 del: c.506-305_c.852+185del, (3 patients) 6. E24_E25del: c.2748-324_c.2952-505

Non-allelic homologous recombination


NAHR
1 2 3 456 78 9 10 1112 13 14 15 16 17 18 19 20 21 22 23 24 25 26

1 (3342 bp) 4 (1183 bp) 6


2 (2720 bp) 5 (1355 bp) (10711 bp)
3 (1508 bp)

5 5 CTACTTGCTTATCACCGTGGCTCTGTGAGGACTGGGGACACAATCTG
TAAAGAGGCTTGAGGAAGACTTTTTCTTTCTTTTTTTTTTTT

4 patient TAAAGAGGCTTGAGGAAGACCCTGAGTGAGCTTCCAGGGCCT 6 patient CTACTTGCTTATCACCGTGGCTCTGAAGGCAGTAAAGTGGGGTGATG

3 GAATCCCCTGTCCGAAGGACCCTGAGTGAGCTTCCAGGGCCT 3 GCTGTTGGGACTGTGGAGGGCTCTGAAGGCAGTAAAGTGGGGTGATG

1. E2_E3 del: c.282+667_c.506-205del 4. E14del: c.1169+773_c.1825+247del, (2 patients)


2. E2_E3 del: c.283-273_c.506-213del 5. E18del: c.2178+269_c.2285+685del
3. E4_E6 del: c.506-305_c.852+185del, (3 patients) 6. E24_E25del: c.2748-324_c.2952-505

Non-homologous end-joining
NHEJ
E26del in 9 patients

AluSx
AluSx
AluSx
AluSx
AluJb
AluJb
AluSx

AluJb
26

25 26

10191pb

20000
10000
7000
5000
4000
3000

2000
1500

1000
700
500
400
7

Intron 25 3UTR
25bp insertion

1 2 3 456 78 9 10 1112 13 14 15 16 17 18 19 20 21 22 23 24 25 26

(3342 bp) 6 (10711bp)


4 (1183 bp)
7 (2416bp)
2 (2720 bp) 5 (1355 bp)

3 (1508 bp)

5
GGGTAGGGCTTGTCCCAGGTGAAGCTTTGTGGATGGAACTTCCAAGTGTGACATAGCTGTTTAGTATCCCAGTTACCCTTCTCAGAGGAG

patient GGGTAGGGCTTGTCCCAGGTGAAGCTTTTTAGTAGAGATGGGGTTTAGTAGAGATTTTTAGTAGAGATGGGGTTTCACCATGTTGACCAG

3 CTCCCGAATAGCTGGGATTACAGGCACCTGCCATCACACGAGCTAATTTTTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGACCAG
a1.
Patient:E1_7del 1. 2.
7
4 G rs7202364 A A rs7202364
2 A rs2043635 G G rs2043635
1 5 rs12444217 G A rs12444217
3 Log2 (ratio)
rs1529929 A G rs1529929

56,860 Mb
-4 -2 -1 0 +1 +2 +4
rs7199480 A G rs7199480
6 rs4784730 A C rs4784730
rs1347591 G A rs1347591
rs12445993 C G rs12445993
rs12443821 T C rs12443821
rs12932041 G G rs12932041
rs4784732 C C rs4784732
rs1436424 T G rs1436424
A rs12920659 T T rs12920659
A rs12599065 cent
C T rs12599065
6
1 2
3 4 5 7 rs12921781 A A rs12921781
rs3829502 A G rs3829502
rs11640954 G G rs11640954
2. Mother: Nle
b
rs34136389 G G rs34136389
56,899,150 bp
56,902,220 bp

NUP93
7 G A rs7202364
4
A G rs2043635
2
G rs12444217 56,904,630 bp

2410 bp
1 5
3 A rs1529929
56,912,240 bp

13090 bp
A rs7199480
6 A rs4784730
G rs1347591
C rs12445993
T rs12443821
G rs12932041

SLC12A3
C rs4784732
T rs1436424
A T rs12920659
A C rs12599065
A rs12921781
A rs3829502

56,950 Mb
G rs11640954
G rs34136389 tel

Ch. 16
Gitelman syndrome - Molecular analysis

Sequencing + MLPA
448 PROBANDS
6% 2% 6%
8% 3% 13%
17%

59%
55% 14%
17%
Compound heterozygous (n = 260)
Homozygous (n = 79) Missense (n=110)
One heterozygous mutation (n = 81)
Frameshift (n=26)
No mutation (n = 38)
CLCNKB (n=14) Splicing (n=24)
Nonsens (n=11)
91% mutation detection rate Inframe (n=4)
Large rearrangements (n=11)

Vargas-Poussou R et al., JASN 2011


Gitelman syndrome - Molecular analysis of the Paris cohort
January 2001 to December 2011

627 Probands
Sequencing + MLPA
8% 3%
15% 6%2% 7%
13%
57%
17%
59%
13%
Compound heterozygous (n = 341)
Homozygous (n = 104) Missense (n=129)
One heterozygous mutation (n = 90)
Frameshift (n=29)
Splicing (n=28)
No mutation (n = 72) Nonsens (n=13)
CLCNKB (n=20 Inframe (n=4)
Large rearrangements (n=15)

92% mutation detection rate


Gitelman syndrome Database
January 2012

375 patients : 189 M


and 186 F 9.5%

3 Centres
Paris : 314
Brussels: 32
patients
Nijmegen: 29
patients
16%
Mutations 7%
SLC12A3: 363
CLCNKB: 12 n= 348 Med IQR: 25 (14-38)
Symptoms at diagnosis
Fortuitous
25
cramps
Asthenia
20 Failure to Thrive
Polyuria
15 Tetany
% Arrhytmia
10 Malaise
Chondrocalcinosis
Vomiting
5
Paresia and paresthesia
Hypotonia
0
Abdominal pain
Enuresis
Biochemical data at diagnosis

n= 354 Med IQR: 2.70 (2.48-3.00) n= 280 Med IQR 30 (28-32) n= 235 Med IQR 98 (95-100)
Biochemical data at diagnosis

n= 250 Med IQR: 138.8 (137-140) n= 280 Med IQR 2.37 (2.25-2.47) n= 41 Med IQR 286 (240-329)
Biochemical data at diagnosis

39%

22
%

n= 322 Med IQR: 0.62 (0.52-0.68) n= 151 Med IQR 0.08 (0.03-0.18)
Classic Bartter Syndrome
Bartter syndrome type III

Na+ Na+ N = 92
K+
2Cl -
K+ K+
Cl -
21% 21%
Cl -

K+ K+

Na+ RSCa
H+ HCO3-
Na+

27% 26%
Ca++
Mg++ Claudins 16 - 19
(+) (-) 5%
NH4+ Compound heterozygous 52%
Homozygous
Heterozygous
SLC12A3
No mutation

Alkalose et Hypochlormie
++++
CLCNKA-CLCNKB 1p36

Classic Bartter/Gitelman
Missense
17%
Nonsense
7%
48% Splicing

Frameshift
14%

ClC-kb channel : 687 aa. Large


14% rearrangements

N Homozygous whole gene


deletion
Classic Bartter 73 10

Gitelman 22 2
p<0.0001
p=0.037

n=85, Med. IQR n=25, Med. IQR n=61, Med. IQR n=25, Med. IQR
30 (28-32) 32.9 (28.5-36) 97 (94.5-99) 89 (80-96.5)

p<0.0001
p<0.0001

n=94, Med. IQR n=35, Med. IQR


17.5 (8-36) 1 (0.4-3)
n=89, Med. IQR n=26, Med. IQR n=81, Med. IQR n=21, Med. IQR
p<0.0001 0.59 (0.51-0.68) 0.87 (0.77-0.96) 0.05 (0.03-0.11) 0.62 (0.23-1.14)
Antenatal Bartter
(n=97)

23% 26%
KCNJ1
SLC12A1
CLCNKB
BSND
11%
No Mutation
20%
20%

Bartter Type III


CLCNKB mutations

22%

Gitelman
Classic Bartter
53% Antenatal Barter

25%
Antenatal Barter Syndrome - Type I
Gene SLC12A1 15q15-21

3%
17%
Missense
1 2 3
3 4 5 6 7 88 9 10 11 12

COOH
7% 49% Splicing
Nonsense
Frameshift
NH2
Inframe

Na-K 2-Cl : 1.099 aa. Gene: 26 exons 24%

N = 19 : 11 homozygous, 6 compound heterozygous


Antenatal Barter Syndrome - Type II
Gene KCNJ1 11q24-25

aa hydrophobe aa acide

H5 proline P site PKA


aa polaire P site PKC
aa basique site de glycosilation
extracellulaire
21%
M1 M2

intracellulaire
P

M0 Domaine de rgulation
P

site
de la liaison l'ATP
7%
Walker-A

P
P

COOH
72%

Missense
P

NH2
Nonsense
Frameshift

Transient Hyperkalemia K channel Kir 1.1. : 391 aa. Gene: 5 exons

N = 26 : 11 homozygous, 14 compound heterozygous, 1 Heterozygous.


Antenatal Barter Syndrome - Type III
Gene CLCNKB 1p36

Antenatal Bartter

Whole homozygous gene deletion


(9/19)
8 missense mutations
ClC-kb channel. : 687 aa. 3 frameshift or nonsense
Gene: 19 exons 2 splicing

N = 19 : 11 homozygous, 5 compound heterozygous, 3 Heterozygous.


Antenatal Barter Syndrome with deafness - Type IV
BSND 1p31 CLCNKA-CLCNKB 1p36

N =11
9 Digenic Inheritance
homozygous
2 Compound Bartter IVb
Barttin. : 320 Heterozygous
aa. Bartter. IVa

Rickheit G et al EMBO 2008


Antenatal Bartter Syndrome
Phenotype -Genotype correlation
Brochard, K. et al. Nephrol. Dial. Transplant. 2009 24:1455-64

KCNJ SLC12A1 CLCNK BSND


KCNJ SLC12A1 CLCNK BSND
1 B
1 B
Nombre 31 28 16 7
Nombre 23 17 6 6
Mdiane 32 32 37 31,8
Mdiane 25 26 28 22
* p = 0,021 ** p = 0,002 *** p = 0,001
Antenatal Bartter Syndrome

KCNJ SLC12A1 CLCNK BSND KCNJ SLC12A1 CLCNK BSND


1 B 1 B
Nombre 32 18 10 7 Nombre 28 21 14 9
Mdiane 1321, 131 131 121 Mdiane 5 3 2.6 2.4
5
* p = 0,002 ** p = 0,0001 *** p = 0,0006
Antenatal Bartter Syndrome

KCNJ SLC12A1 CLCNK BSND KCNJ SLC12A1 CLCNK BSND


1 B 1 B
Nombre 18 15 9 7 Nombre 17 10 7 6
Mdiane 26.5 28 39 27 Mdiane 92 89 76 83

* p = 0,01 ** p = 0,002***p=0,003 * p = 0,01


EAST : Epilepsy, Ataxia, Sensorineural
Deafness,Tubulopathy
Reabsorption:
Na+ 7%
Ca2+ 10- 15%
Mg2+ 10%

Thiazides Cl -
Cl-
Bockenhauer D et al. New Engl J Med 360, 2009 Na+
K+ Na+
SeSAME: Seizures, sensorineural deafness,
Wnk-4 Na
+

Ca2+ K+
TRPV5
ataxia, mental retardation, electrolyte imbalance Wnk-1 Mg2+
Mg2+
TRPM6 Mg2+
Na+
Na+
H+

KCNJ10, 1q23.2
K channel kir 4.1
Heterodimer with kir 5.1
Scholl UI et al. PNAS 106, 2009
, Born 02/2010.
First child,
consanguineous family
6 months: failure to CLCNKB
D12826 130
D1S436 204
130
204 SLC12A3
D16S3039 248
D16S3057 194
260
200
thrive, hypotonia. D1S2644 245 245 D16S3071 89 91

CLCNKB analysis: No mutation


Biochemical data:
Metabolic alkalosis
pH: 7.52 Age of one year:
K : 2.6 mmol/L Seizures
Renal hypokalemia Neurological evaluation
Ur K: 82mmol/L Ataxia, nistagmus
Hypocalciuria Developmental
Ca/creat : retardation
0.035mmol/mmol) ORL evaluation
Deafness

KCNJ10 gene analysis: known homozygous mutation, p.Arg175Gln


Differential Diagnosis
Antenatal Bartter Classic Bartter/Gitelman
Congenital Chloride diarrhoea
Autosomal recessive inheritance
SLC26A3 - 7q31.1 Cystic Fibrosis
Faecal Cl > 90 mmol/L Autosomal recessive inheritance
CFTR - 7q31.2
Autosomal Dominant
hypocalcemia
Bartter type V

Diuretics toxicity
Eating disorders
Wedenoja S et al. Aliment Pharmacol Ther. 2010, Human
Mut 2011
Other causes of hypokalemia
Pseudophypoaldosteronism 1 Periodic paralysis with
hypokalemia
Autosomal recessive
SCNN1A, SCNN1B, SCNN1G Other causes of
Autosomal dominat hypomagnesemia
Proton pump inhibitors (Inexium
NR3C2
Mody 5
Persistent hyperkalemia
Conclusion
Main biological and clinical characteristics and genetic classification

Parameter Antenatal Bartter Classic Bartter Gitelman

Type I Type II Type IV Type III

Age of presentation In utero In utero In utero In utero Infant- toddler, Adolescent/adult


preschool or school /children
children
Polyhydramnios/ +++ +++ +++ ++ - -
Prematurity
Failure to thrive +++ +++ +++ +++ ++ +
Deafness - - Yes - - -
Polyuria +++ +++ +++ +++ ++ -
Tetany crisis - - - - Occasional Common
Magnesemia Normal Normal Normal Normal Normal or low Low (sometimes
normal)
Transient - +++ - - - -
Hyperkalemia
Hypochloremic ++ ++ +++ ++
++++
alkalosis
Calciuria High +++ High +++ Normal or Normal or High + Low or normal
High +
Nephrocalcinosis +++ +++ ++ +/- -
Urinary High +++ High +++ High +++ High +++ Normal or High + Normal
prostaglandins
Indomethacin +++ +++ +++ +++ ++ +
response
Conclusions and perspectives
Gitelman syndrome treatment
National PHRC GITAB : Dr Anne Blanchard
Database analysis :
Phenotype-genotype correlation
Subgroup analysis, i.e. older or younger patients
Follow-up analysis : long term morbidity
Cardiovascular
Rheumatologic
Ocular
Analysis of heterozygous relatives
New genes ?
Thanks
Patients and their families
Paris
EGPH Genetic Brussels
Pr Olivier
Department and Clinical Devuyst
Research Center Pr Karin Dahan
Pr Xavier Jeunemaitre Nijmegen
Dr Anne Blanchard Pr Nine Knoers
Technicians Physicians
Diana Kahila
Physicians
Tubulopathies French
Network