Microchim Acta
DOI 10.1007/s00604-014-1297-3
ORIGINAL PAPER
Colorimetric detection of PCR products of DNA from pathogenic
bacterial targets based on a simultaneously amplified DNAzyme
Youngung Seok & Ju-Young Byun & Hyoyoung Mun &
Min-Gon Kim
Received: 22 January 2014 / Accepted: 17 May 2014
# Springer-Verlag Wien 2014
Abstract A novel strategy was devised for colorimetric anal-
ysis of the products of the polymerase chain reaction (PCR).
The method takes advantage of simultaneous amplification of
a horseradish peroxidase-mimicking DNAzyme (HRPzyme)
during the PCR process. It is performed using a DNA specific
forward primer and a universal reverse primer containing a
complementary HRPzyme sequence. The double-strand PCR
products, which include the HRPzyme sequence, are
treated with a mixture of hemin and TMB (3,3,5,5
tetramethylbenzidine) in the presence of hydrogen peroxide.
The resulting HRPzyme/hemin complex then promotes a
peroxidase mimicking reaction, which produces the blue col-
ored oxidized TMB. This colorimetric method can be more
easily performed than previously developed gel based detec-
tion procedures and, as a result, can be conveniently applied to
the specific and sensitive colorimetric analysis of DNA se-
quences arising from pathogenic bacteria. The potentially
broad applicability of the new method has been demonstrated
by its use in the identification of the 16s rDNA of Salmonella
Typhimurium.
Keywords Colorimetric assay . Polymerase chain reaction .
DNAzyme
Youngung Seok and Ju-Young Byun contributed equally to this work.
Y. Seok : J.<Y. Byun : H. Mun : M.<G. Kim (*)
Department of Chemistry, School of Physics and Chemistry,
Gwangju Institute of Science and Technology (GIST), 261
Cheomdan-gwagiro, Gwangju 500-712, Republic of Korea
e-mail: mkim@gist.ac.kr
M.<G. Kim
Advanced Photonics Research Institute, Gwangju Institute of
Science and Technology (GIST), 261 Cheomdan-gwagiro,
Gwangju 500-712, Republic of Korea
Introduction
The identification of nucleic acids has received great attention
because they play an important role in many fields. Extensive
efforts have led to the development of many sensitive, ampli-
fication based methods for identifying DNA [15] as part of
techniques aimed at the identification of pathogens, diagnosis
of biomolecules, and forensic applications [68].
The polymerase chain reaction (PCR) has provided a rev-
olutionary advance in the molecular diagnosis of nucleic acids
because the process can be used to amplify trace amounts of a
DNA target in an exponential manner. Amplified PCR prod-
ucts are typically detected by using gel electrophoresis or real-
time methods employing fluorescent dyes [9, 10]. However,
these techniques are time-consuming and they often require
the use of expensive and complicated instrumentation. Owing
to these limitations, the development of alternative methods
that can be employed for the rapid and simple identification of
PCR products is of great current interest. Efforts targeted at
this goal have led to new DNA sensing platforms that are
based on molecular beacon and nanoparticle tagged probes
[1113]. However, these techniques require the use of fluo-
rescence conjugation or probe thiolation procedures, both of
which are costly and time consuming. Therefore, simple
methods for the identification of DNA PCR products, which
can be performed rapidly and without the use of instrumenta-
tion, remain in great demand.
A novel strategy that can be applied to the design of
DNA target detection systems, takes advantage of colorimet-
ric responses produced by biocatalysts, such as DNAzymes,
comprised of a G-quadruplex nucleic acid sequence, which
upon binding of hemin mimics the catalytic activity of
peroxidase enzymes [1417]. Specifically, the created
DNAzyme in the presence of H2O2 catalyzes oxidation of
TMB (3,3,5,5tetramethylbenzidine) or ABTS (2,2-
azinobis(3-ethylbenzothiozoline)-6-sulfonic acid) that
 Y. Seok et al.

generates the colored oxidized form or the generation of
chemiluminescence in the presence of luminol and H2O2
[18, 19]. Owing to this remarkable feature, it has shown a
great potential for biosensor applications, such as sensitive
and specific detection of protein [20], small molecules [21],
and metal ions [22].
In the current investigation, we have utilized an approach
that relies on PCR techniques that lead to simultaneous
generation of a DNAzyme using the primer includes com-
plementary DNAzyme sequence. The produced double-
strand products were included amplified DNAzyme se-
quence. The amplified DNAzyme structured G-quadruplex
in the presence of hemin and G-quadruplex/hemin com-
plexes had peroxidase activity which produced a blue color
by oxidized TMB. This strategy has led to the development
of a simple colorimetric method for the naked eye detection
of PCR amplified products of pathogenic bacteria that cause
food poisoning. Compared to previous methods to detect
pathogenic bacteria, the proposed method offers the advan-
tages of simplicity, rapidity and low cost [2327]. Moreover,
the new assay technique could be applicable in the analysis
of PCR amplified DNA using the primer containing the
complementary DNAzyme sequence.
Experimental
Reagents and materials
Hemin and potassium chloride (KCl) were purchased from
Sigma-aldrich (Yongin, South Korea, www.sigmaaldrich.
com/korea.html). Agarose was purchased from Roche
(Seoul, South Korea, www.roche.co.kr). TBE buffer was
purchased from LPS solution (Daejeon, South Korea). TMB
(3,3,5,5tetramethylbenzidine) Substrate Reagent set was
purchased from BD bioscience (Seoul, South Korea, www.
bdbiosciences.com/kr). PCR kit and 100 bp DNA Ladder
(Dye plus) were purchased from Takara (Seoul, South
Korea, www.takara.co.kr). All primers used in this study
were purchased from Genotech (Daejeon, South Korea,
www.genotech.co.kr). The DNA target and primer set
designed for Salmonella. typhimurium, Escherichia. coli,
Bacillus. cereus and Listeria. monocytogenes sequence
analysis are listed in Table 1.
Amplification of target pathogen bacteria
Bacteria (S. typhimurium, E. coli, B. cereus and
L. monocytogenes) were grown in Tryptic soy broth at 37 C
and collected with sterile plastic inoculating loops form solid
culture plates. Bacterial colonies were directly used for PCR
amplification. In each case, the reaction mixture consisted of
400nM of each primer, 1.8 mM MgCl2, 0.25 mM each of
dNTP, 1 U of polymerase and a bacterial colony. PCR reac-
tions for the 16S ribosomal DNA gene were cycled using the
following conditions: initial denaturation (10 min at 95 C),
35 cycles (denaturation for 30 s at 95 C, annealing for 30 s at
60 C, extension for 35 s at 72 C) and final extension for
10 min at 72 C. The concentration of PCR product was
determined by measuring the absorbance at 260 nm using a
UVVis spectrophotometer (Shimadzu, Kyoto, Japan). DNA
amplification was confirmed by using electrophoresis in 2 %
agarose gel. The PCR control was performed in the absence of
target DNA (without the bacterial colony). To confirm the
signal arising from amplified HRPzyme sequence, the PCR
product was purified using a PCR product purification kit
(Promega, Madison, USA) and then used as the catalyst for
the color producing oxidation reaction. The specificity and
generality of the PCR process and the designed primers were
assessed using target DNA from different bacterial colonies
(S. typhimurium, E. coli, B. cereus and L. monocytogenes)
along with the respective primer sets (S-FP and AH-URP, E-
FP and AH-URP, L-FP and AH-URP, B-FP and AH-URP).
Finally, each PCR product was used in the colorimetric assay
as the oxidation catalyst.
Visual detection
After colony PCR, PCR products were determined by
measuring the absorbance at 260 nm using UV

Table 1 Oligonucleotide primers used in this work

Primer Sequence (5 3)

S-FP (S. typhimurium Forward) TGTTGTGGTTAATAACCGCAGC

E-FP (E. coli Forward) AGGGAGTAAAGTTAATACCTTTGC
L-FP (L. monocytogenes Forward) AGTGTGGCGCATGCCACGCT
B-FP (B. cereus Forward) ACTCTGTTGTTAGGGAAGAACAAGTGCTA
URP (Universal reverse) GNACCGCGGCNGCTG
AH-URP (anti-HRPzyme-Universal reverse) AAAAAATTTACCCAACCCGCCCTACCC AAAAA GNACCGCGGCNGCTG

The anti HRPzyme sequence is underlined

Colorimetric detection of PCR products from amplified DNAzyme
spectrometer and diluted with proper concentration to
PCR reaction buffer. The mixture used for the colorimet-
ric assay, consisting of 30 mM KCl, 500 nM PCR
products and 1.5 M hemin in a total volume of 20 L
was incubated at 37 C for 10 min. Then, the TMB
solution was prepared by using a TMB Substrate Reagent
set (BD bioscience) according to the manufacturers in-
structions. The solution (180 L) of freshly prepared
TMB reagent was quickly added to the mixture and the
resulting solution was incubated at room temperature for
10 min. When the color of reaction mixture started to
turn blue, a photograph was taken using a digital camera.
Following termination of the reaction by addition of
100 L H2SO4 (0.16 M), colorimetric measurements at
450 nm were performed by using a flat bottom 96-well
polystyrene plates (ThermoFicher Scientific) and a micro-
plate scanning spectrophotometer (Infinite M2000pro,
TECAN Group, Ltd., Switzerland).
Scheme 1 Scheme for the
colorimetric detection of PCR
products using a primer
containing an anti-HRPzyme
sequence
Results and discussion
Design of the colorimetric detection strategy for detection
of Salmonella typhimurium 16s rDNA
The strategy we developed for colorimetric detection
DNA PCR products is outlined in Scheme 1. Following
this plan, a reverse primer was designed to contain three
regions comprised of a sequence that is complementary to
that of the target DNA, a poly A sequence used as a
linker, and a sequence (anti-HRPzyme) that is comple-
mentary to HRPzyme. By using these forward and re-
verse primers, the double-strand DNA products of PCR
contain the HRPzyme sequence, which in the presence of
hemin folds into a G-quadruplex/hemin complex. Impor-
tantly, the G-quadruplex/hemin complex in the presence
of H2O2 is capable of catalyzing the oxidation reaction of
TMB that generates a blue colored product, which can be

detected using a UV-visible spectrometer or the naked
eye.
In a model study, this approach was employed to determine
the 16s rDNA sequence of S. typhimurium. For this purpose,
the S. typhimurium forward primer (S-FP) was designed to
bind fragments of the target DNA sequence in the 16s rDNA
gene of S. typhimurium. PCR was then carried out using S-FP,
URP (universal reverse primer) and AH-URP (anti-HRPzyme
universal reverse primer). Specific bands associated with gen-
erated fragments of the expected sizes were detected by using
2 % agarose gel electrophoresis (Fig. 1a). As can be seen by
viewing the gel, the length of the PCR product band in lane 2
(URP: PCR using S-FP and URP with target DNA) is shorter
than that of the band in lane 3 (AH-URP: PCR using S-FP and
AH-URP with target DNA). This observation shows that the
lane 3 band corresponds to the PCR products that contain the
HRPzyme sequence (32 bp). The finding that the HRPzyme
sequence is successfully amplified by using the universal
reverse primer for the anti HRPzyme sequence (AH-URP)
indicates that addition of the anti-HRPzyme sequence to
URP does not interfere with the PCR process. Importantly,
Fig. 1 Agarose gel analysis (a) and colorimetric response (b) of ampli-
fied PCR products. NC negative control (PCR using S-FP and AH-URP
without target DNA), URP PCR using S-FP and URP with target DNA,
AH-URP PCR using S-FP and AH-URP with target DNA, AH-URP
(purified) purification of DNA from the solution resulting from the
AH-URP experiment. Amplified PCR products with HRPzyme were
purified using a PCR products purification kit
Y. Seok et al.
PCR of the negative control (NC: PCR using S-FP and AH-
URP without target DNA), not containing target DNA, does
not lead to generation of bands in the gel (Fig. 1a, lane 1).
The ability of the HRPzyme sequence in the amplified PCR
products to catalyze oxidization of TMB in the presence of
hemin and H2O2 was probed next. As can be seen by inspec-
tion of the photographs shown in Fig. 1b (AH-URP), blue
color develops upon addition of the substrate TMB and H2O2
to the solution containing PCR products arising by using S-FP
and AH-URP as primers. To prove that the color change is the
result of a reaction promoted by the hemin HRPzyme complex
in the amplified PCR products, DNA was purified from the
PCR product generated using AH-URP as the reverse primer.
As shown in Fig. 1b (AH-URP (purified)), this DNA also has
HRPzyme catalytic activity. In contrast, the negative control
(NC) and non-HRPzyme containing PCR products (URP)
promote development of a weaker blue color than do the
amplified HRPzyme PCR products (Fig. 1b). This observation
suggests that the HRPzyme in the amplified PCR products
forms a G-quadruplex/hemin complex that operates as a
peroxidase.
Assay optimization
In order to obtain maximal sensitivity, the experimental con-
ditions employed for the colorimetric PCR method, such as
temperature, and hemin and potassium chloride (KCl) con-
centrations, were optimized using UV/vis absorption spectros-
copy as the detection method. After termination of the color-
imetric reaction by addition of the stop solution, the absor-
bance at 450 nm was determined. The absorption changes
obtained using this procedure in values S/N ratio=(A-A0)/A0
at 450 nm were calculated in order to evaluate sensitivity.
First, the reaction mixture (hemin and PCR products) was
incubated under different temperature conditions for 10 min.
The results show that the temperature giving the highest S/N
ratio (%) is 37 C (Fig. 2a). The results of studies in which the
HRPzyme activity was evaluated as a function of hemin
concentration Fig. 2b showed that the S/N ratio gradually
increases as the hemin concentration increases up to 1.5 M,
and then decreases at higher concentrations owing to the small
inherent peroxidase activity of hemin. Finally, we observed
that the optimal potassium chloride (KCl) concentration is
30 mM (Fig. 2c). G-quadruplex in the PCR products could
be achieved by optimal concentration of hemin and potassium
ion as well as adjusting the reaction temperature even in the
presence of its complement without the need for additional
pre-treatments. The partial sequence of double stranded
HRPzyme in the end of PCR products was opened at 37 C.
The formation of G-quadruplex/hemin structure was facilitat-
ed by adding a high concentration of hemin. The optimal
reaction conditions provided assistance to break the hybrid-
ized chain of HRPzyme sequence. Even though the
Colorimetric detection of PCR products from amplified DNAzyme
Fig. 2 Effects of temperature (a), hemin (b) and potassium ion (c)
concentrations on colorimetric PCR detection. S/N noise is calculated
using (A-A0)/A0, where A and A0 are absorbances at 450 nm for the TMB
reactions of the PCR products with and without target DNA. The PCR
products were diluted to 500 nM with PCR reaction buffer before the
colorimetric reaction
colorimetric signal of double stranded HRPzyme was reduced
in comparison with single strand HRPzyme, the detection
efficiency was enough for the detection of HRPzyme in the
amplified double stranded PCR products.
Quantitation and sensitivity of the detection system
The use of the new assay method for quantitation of the
concentrations of PCR products was explored next. Products
of PCR of bacterial colonies, utilized without pretreatment
procedures, were first diluted with PCR buffer to concentra-
tions in the range 0.11,200 nM and then analyzed by
measuring absorbance at 260 nm. The results displayed in
Fig. 3a show that the S/N ratio increases with increasing
concentrations of the amplified PCR products, with the signal
being clearly distinguishable from the negative control at 1
nM of target DNA (Fig. 3b). This exceptionally low limit of
instrument free, visual detection is one order of magnitude
lower than that obtained by using the electrophoretic method.
This feature can be seen by viewing Fig. 3c, which contains an
image of an electrophoresis gel obtained from different con-
centrations of the PCR products containing the HRPzyme.
This finding demonstrates clearly that the new HRPzyme-
based method for analysis of double strand DNA PCR prod-
ucts is highly sensitive.
Specificity and generality
The specificities of the designed primers employed in the new
assay system were probed using 16s rDNAs from the patho-
genic bacteria S. typhimurium, E. coli, B. cereus and
L. monocytogenes, which are known to possess closely relat-
ed, highly homologous sequences. Three respective forward,
bacterial DNA specific primers, S-FP, E-FP, B-FP and L-FP,
were prepared for this purpose. Utilizing the same PCR con-
ditions and the new forward primers (Table 1) PCR products
containing the HRPzyme (matching forward primer in the
each target pathogenic bacteria) and non-matching products
(non-matching forward primer in the each target pathogenic
bacteria) were generated as documented using 2 % agarose gel
electrophoresis analysis (data not shown). The results of stud-
ies probing the peroxidase activities (Fig. 4) show that PCR
products generated employing specific primers. Since the
non-matching products were not synthesized in the presence
of the other target pathogenic bacteria, do not promote oxida-
tion to form a blue color (S/N ratios <15 %, Table 2) Thus, it
appears that potentially interfering components in the
unpurified PCR products do not affect the assay response
and, as a result, that the signals obtained are only dependent
on the presence of the amplified HRPzyme sequence. In
addition, the results show that PCR using pathogen target-
specific primer sets can be used to generate double strand PCR
products containing the amplified HRPzyme sequence in a
clearly differentiated manner. Therefore, the new assay pro-
cedure, which relies on the use of specific universal primers
for the conserved region of the 16s rDNA sequence linked
with an anti HRPzyme sequence, enables differentiation of a
variety of very similar bacteria.
Conclusion
In the investigation described above, we developed a colori-
metric method for detection of DNA PCR products that is
 Y. Seok et al.

Fig. 3 Investigation of the effects

of concentrations (nM) of
amplified PCR products on the
colorimetric response (a) and S/N
noise (b). The negative control
consist of PCR products
performed in the absence of target
DNA. S/N ratios (%) with varying
target concentrations (from 0.1 to
1,200 nM) were obtained using
UVVis spectroscopy. c Agarose
gel electrophoresis (2 %) of
diluted PCR products (from 0.1 to
1,200 nM)

based on a strategy in which PCR results in simultaneous

amplification of an HRPzyme, which serves as a catalyst for
a color producing oxidation reaction. The assay yields a
qualitative colorimetric response, which can be seen by using
the naked-eye or evaluated quantitatively using UV-visible
spectroscopy. The new colorimetric assay, which is both in-
expensive and simple to perform, can be used to detect

Table 2 The specificity and generality of colorimetric detection

S/N (%) Target pathogenic bacteria

primer
S. typhimurium L.
E. monocytogenes
coli B. cereus

Fig. 4 Evaluation of the specificity of colorimetric detection of PCR S-FP 29217 1.037.8 15.32.7 9.555.6
products with designed primers (S-FP and UR, E-FP and UP, L-FP and E-FP 2.651.4 31024 13.45.8 14.71.9
UR, B-FP and UR) in the presence of each pathogenic bacteria colony
(S. typhimurium, E. coli, B. cereus and L. monocytogenes). To control the L-FP 1.124.6 4.156.9 29323 12.31.3
variation of colony PCR, the matching PCR products were diluted to 500 B-FP 17.28.7 1.269.5 15.36.4 29511
nM with PCR mixture before the colorimetric reaction. After dilution, the
PCR products were directly used to promote the color producing oxida- Bold number matching group with pathogenic bacteria and primer. These
tion reaction group have colorimetric signal following concept
Colorimetric detection of PCR products from amplified DNAzyme
pathogenic bacteria in a highly specific and sensitive manner.
We believe that the new assay technique will be broadly
applicable to the rapid, simple, quantitative, and ultrasensitive
analysis of DNA amplified by using selected primer that
include anti HRPzyme sequence.
Acknowledgments This work was financially supported by the R&D
Joint Venture Program, NLRL Program (2011-0028915) and New Indus-
try Creation Project through the National Research Foundation of Korea
(NRF) funded by the Korean government (Ministry of Science, ICT and
Future Planning).
References
1. Wang J (1999) Towards genoelectronics: electrochemical biosensing
of DNA hybridization. Chem Eur J 5:16811685
2. Patolsky F, Lichtenstein A, Willner I (2001) Detection of single-base
DNA mutations by enzyme-amplified electronic transduction. Nat
Biotechnol 19:253257
3. Wang J, Liu G, Merkoci A (2003) Electrochemical coding technol-
ogy for simultaneous detection of multiple DNA targets. J Am Chem
Soc 125:32143215
4. Weizmann Y, Patolsky F, Katz E, Willner I (2003) Amplified DNA
sensing and immunosensing by the rotation of functional magnetic
particles. J Am Chem Soc 125:34523454
5. Taton TA, Mirkin CA, Letsinger RL (2000) Scanometric DNA array
detection with nanoparticle probes. Science 5485:17571760
6. Roda A, Mirasoli M, Reschinglian P (2012) Recent developments in
rapid multiplexed bioanalytical methods for foodborne pathogenic
bacteria detection. Microchim Acta 178:728
7. Csordas A, Gerdon AE, Adams J, Qian J, Tom Soh H (2010)
Detection of proteins in serum by micromagnetic aptamer
PCR(MAP) technology. Angew Chem Int Ed 49:355358
8. Quiency D, Carle G, Alunni V, Quatrehomme G (2013) Difficulties
of sex determination from forensic bone degraded DNA: a compar-
ison of three method. Sci Justice 53:253260
9. Higuchi R, Fockler C, Dollinger G, Watson R (1993) Kinetic PCR
analysis: real-time monitoring of DNA amplification reactions.
BioTechnology 11:1026
10. Ryncarz AJ, Goddard J, Wald A, Huang ML, Roizman B, Corey L
(1999) Development of a high-throughput quantitative assay for
detecting herpes simplex virus DNA in clinical samples. J Clin
Microbiol 37:1941
11. Tyagi S, Bratu DP, Kramer FR (1998) Multicolor molecular beacons
for allele discrimination. Nat Biotechnol 16:4953
12. Song S, Liang Z, Zhang J, Wang L, Li G, Fan C (2009) Gold-
nanoparticle-based multicolor nanobeacons for sequence-specific
DNA analysis. Angew Chem Int Ed 48:86708674
13. Xu W, Xue X, Li T, Zeng H, Liu X (2009) Ultrasensitive and
selective colorimetric DNA detection by nicking endonuclease
assisted nanoparticle amplification. Angew Chem Int Ed 48:
68496852
14. Travascio P, Witting PK, Mauk AG, Sen D (2001) The peroxidase
activity of a hemin-DNA oligonucleotide complex: free radical dam-
age to specific guanine bases of the DNA. J Am Chem Soc 123(7):
13371348
15. Chinnapen DJF, Sen D (2002) Hemin-stimulated docking of cyto-
chrome c to a hemin-DNA aptamer complex. Biochemistry 41:
52025212
16. Cheng X, Liu X, Bing T, Cao Z, Shangguan D (2009)
General peroxidase activity of G-quadruplex Hemin com-
plexes and its application in ligand screening. Biochemistry
48(33):78177823
17. Willner I, Shlyahovsky B, Zayats M, Wilner B (2008) DNAzymes
for sensing, nanobiotechnology and logic gate applications. Chem
Soc Rev 37:11531165
18. Pavlov V, Xiao Y, Gill R, Dishon A, Kotler M, Willner I (2004)
Amplified chemiluminescence surface detection of DNA and telo-
merase activity using catalytic nucleic acid labels. Anal Chem 76:
21522156
19. Wang G, Zhu Y, Zhang X (2014) Colorimetric and visual determina-
tion of melamine by exploiting the conformational change of hemin
G-quadruplex-DNAzyme. Microchim Acta 181:411418
20. Li T, Wang E, Dong S (2008) G-quadruplex-based DNAzyme
for facile colorimetric detection of thrombin. Chem Commun
36543656
21. Ali MM, Li Y (2009) Colorimetric sensing by using allosteric-
DNAzyme-coupled Rolling Circle Amplification and a peptide
nucleic acid-organic dye probe. Angew Chem 121:35643567
22. Yin BC, Ye BC, Tan W, Wang H, Xie CC (2009) An allosteric dual-
DNAzyme unimolecular probe for colorimetric detection of copper
(II). J Am Chem Soc 131:1462414625
23. Yuan J, Yu Y, Li C, Wang Z (2014) Visual detection and microplate
assay for Staphylococcus aureus based on aptamer recognition
coupled to tyramine signal amplification. Microchim Acta 181:
321327
24. Tully E, Hearty S, Leonard P, Kennedy R (2006) The development of
rapid fluorescence-based immunoassay, using quantum dot-labelled
antibodies for the detection of Listeria monocytogenes cell surface
proteins. Int J Biol Macromol 39:127134
25. Suo B, He Y, Tu S, Shi X (2010) A multiplex real-time polymerase
chain reaction for simultaneous detection of Salmonella spp.,
Escherichia coli O157, and Listeria monocytogenes in Meat
Products. Foodborne Pathog Dis 7(6):619628
26. Sung YJ, Suk HJ, Sung HY, Li T, Poo H, Kim MG (2013)
Novel antibody/gold nanoparticle/magnetic nanoparticle nanocom-
posites for immunomagnetic separation and rapid colorimetric
detection of Staphylococcus aureus in milk. Biosens Bioelectron
43:432439
27. Shim WB, Song JE, Mun H, Chung DH, Kim MG (2014) Rapid
colorimetric detection of Salmonella typhimurium using a selective
filtration technique combined with antibody-magnetic nanoparticle
nanocomposites. Anal Bioanal Chem 406:859866