55

Microbial c o m m u n i t y analysis of thermophilic contact oxidation process by

using P C R - D G G E m e t h o d

F. Kurisua, H. Satohb, T. Minob, and T. Matsuoc

a Research Center for Water Environment Technology, the University of Tokyo.

7-3-1 Hongo, Bunkyo-ku, Tokyo, 113-8656, Japan
b Institute of Environmental Studies, the University of Tokyo.
7-3-1 Hongo, Bunkyo-ku, Tokyo, 113-0033, Japan
c Department of Civil and Environmental Engineering, Toyo University.
2100 Kujirai, Kawagoe-City, Saitama, 350-8585, Japan

A lab scale thermophilic aerobic wastewater treatment reactor was operated using peptone
and starch as primary carbon sources, and the microbial community was analyzed mainly by
denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA partial
sequences (PCR-DGGE). The temperature began to rise on day 2 and varied cyclically
between 30-65 oC after each batch feeding from day 10. PCR-DGGE indicated changes in the
community profile, which was almost unchanged after day 23. DGGE bands were further
excised and sequenced to identify the species of the DGGE bands. According to the
quantification of DGGE bands intensity, population dynamics of those species are discussed.
Gram positive bacteria with low G+C content predominated since day 2 and among that,
Bacillaceae was probably dominant. Relatives of B.licheniformis, B.pumilis and
B.thermocloacae were abundant during the stable state. Interestingly, not only facultative
thermophilic Bacillus but also obligate thermophilic and mesophilic Bacillus seemed to
appear in the reactor during the stable state, in spite of the temperature variation.

1. INTRODUCTION

Thermophilic contact oxidation process (TCOP) is a novel and unique process to treat high
strength organic wastewater. TCOP can achieve oxygen supply for aerobic degradation,
which is difficult for highly concentrated wastewater, by absorbing wastewater to water
absorbent media, such as wood chips. Organic compounds of the wastewater are aerobically
degraded on or in the wood chips. Another characteristics of TCOP is extremely high ratio of
degradation. More than 90% of organic matter can completely be degraded into carbon
dioxide [1]. Moreover, water is evaporated due to the aeration under high temperature
because of the degradation heat.
Microbiology in this process has not been clarified yet. Thus, it is not known yet how and
why such high degradation ratio which is unusual in the normal aerobic degradation can be
56

achieved. In addition, the reason why operation of the process sometimes fails due to no
temperature rise must be elucidated for further application.
Molecular biological techniques are suitable to analyze whole microbial communities.
Among them, denaturing gradient gel electrophoresis (DGGE) of PCR-amplified gene
fragments coding for 16S rRNA (PCR-DGGE method) has recently been utilized to
determine the genetic diversity of natural microbial communities [2,3]. By using DGGE,
DNA fragments of the same length but with different base pair sequences, such as PCR
fragments obtained from a mixed culture, can be separated. Similarity of microbial
communities can be analyzed from electrophoresis patterns [2] and bands can further be
excised from gels and sequenced to identify the phylogenetic affiliation of the community
members [4].
In the present study, A bench scale TCOP reactor was operated using peptone and starch
as primary carbon sources and microbial community was analyzed mainly by PCR-DGGE
method. It was utilized to determine population dynamics at species/strain level. DGGE bands
were excised and sequenced to elucidate species that constituted the community. According to
the results of community analysis, community structure and its variation were assessed in
relation to process performance.

2. M A T E R I A L S AND M E T H O D S

2.1. Operation and monitoring of TCOP reactor

The experimental set-up is shown in Figure 1. The working volume of the reactor was 10
liters, and 6 liters of wood chips sized 2-4 mm were installed as media. To maintain a
constant rate of heat loss, the reactor was placed in a styrofoam box and the temperature
outside the reactor was controlled at 4 oC lower than inside it. The media were mixed slowly
and continuously by the mixing blades in the reactor.
The reactor was fed with 300 ml of the synthetic wastewater every other day. The
synthetic wastewater contained 82 g/1 soluble starch, 82 g/1 peptone, 41 g/1 sucrose and 41 g/1

Figure 1. The experimental set up of the reactor.

 57

yeast extract, and its carbon and nitrogen content was 11 gC/1 and 1.6 gN/1, respectively. At
the beginning of the operation, 600 ml of the synthetic wastewater was added to the reactor
and mixed with the media. Then, the reactor was inoculated with 60 g (dry weight) of semi-
aerobic compost. The reactor was aerated at the rate of 1.8-2.0 1/min (300-370 1/[m3
chip]/min). The aeration rate was measured precisely by a mass flowmeter. Carbon dioxide
concentration in emission gas was monitored by CO2 meter (LX-710, Iijima electronics,
Aichi, Japan).

2.2. DNA extraction and PCR amplification

Samples for community analysis were taken from the reactor at the times shown in Figure
2. Half gram of the samples were immersed in 5 ml sterilized phosphate-buffered saline
(lxPBS; pH7.2) and the immersion was sonicated for 5 min at 15 W (Branson Sonifier 450,
Krautkramer-Branson, Penn., USA). The suspension was filtrated with a coarse filter paper
(No. 1, Advantec-Toyo, Tokyo, Japan) to remove large particles and stored in liquid nitrogen
until use.
One milliliter of suspended samples were washed with TE buffer and genomic DNA was
extracted with benzyl chloride followed by ethanol precipitation as described by Zhu et al.[5].
Primers complementary to conserved regions were used to amplify a 194-bp fragment of the
16S rDNA corresponding to nucleotides 341 to 534 in the E.coli sequence [3]. The nucleotide
sequence of the forward primer, which is specific to eubacteria (357f; 5'-
CCTACGGGAGGCAGCAG-3'), contains at its 5' end a 40-base GC clamp (357fGC; 5'-
CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCA
GCAG-3') [3]. The universal consensus sequence was used as a reverse primer (518r; 5'-
ATTACCGCGGCTGCTGG-3'). PCRs were performed by using AmpliTaq Gold DNA
polymerase (Applied Biosystems, Perkin Elmer Japan, Tokyo, Japan) according to the
instructions provided by the manufacturer. Thermalcycler we used was TaKaRa
Thermalcycler (Takara Biotechnology, Tokyo, Japan). PCR cycling parameters are as
follows. PCR mixtures were preincubated at 94 oC for 9 min to activate DNA polymerase.
Denaturing was carried out at 94 oC for 1 min, annealing was performed at 53 oC for 1 min,
and extension was performed at 72 oC for 2 min. This cycle was repeated for 35 times, and
then incubated at 72 oC for 10 min for the final elongation. All PCR products were analyzed
by electrophoresis with 4% (w/v) agarose gels before DGGE analysis was performed.

2.3. Analysis of PCR products by DGGE

DGGE was performed according to Muyzer et aL [3] with small modifications. Before
loading to the DGGE gel, PCR products were incubated at 95 oC for 5 min, at 65 oC for 1 h
and gradually cooled to room temperature to avoid non-complementary annealing of DNA.
Gels for DGGE were 8% polyacrylamide gel (8% acrylamide and N,N-methylene-
bisacrylamide solution [37.5:1 {v/v} ], x% [v/v] formamide, y M urea and lx TAE)
containing a linear gradient of the denaturant concentration ranging from 35% to 50%.
Denaturant concentration of 100% corresponds to x=40 and y=7. Denaturing gradient gels
were prepared by using Model 475 gradient delivery system (Bio-Rad Laboratories, Calif.,
USA). The gels were run by D Code system (Bio-Rad) for 300 min at 60 oC and 130V.
58

After completion of electrophoresis, the gels were stained with Vistra Green (Amersham
Pharmacia Biotech, Tokyo, Japan) by spreading the staining solution on the gel for 15
minutes, and documented by fluorescent image scanner (Fluorimager 595, Molecular
Dynamics, Calif., USA). Intensely stained bands were excised from the gels and soaked into
50gl of sterilized water. DNA was recovered from the gels by freeze-thawing more than 3
times.

2.4. Similarity analysis of DGGE banding patterns

DGGE banding patterns were compared to each other by using the dissimilarity index,
which was calculated as follows. Fluorescent intensity of the bands was quantified by using
the ImagequaNT tool provided with Fluorimager 595. The ratio of the intensity of a band to
the sum of the intensity of all the bands in a sample was defined as 'relative intensity of the
band'. Bands that had the same location among different samples were assumed to have the
same sequence and named with the same band numbers. The dissimilarity index [6] was
calculated for every two samples as follows:

D(i,j)=I/2Z I xik-xjk I, (1)

where
Z xik = Z xjk = 1 (2)
and xik and xjk are the relative intensity of the band k in the sample i and j, respectively. If a
band appeared only in one sample, the relative intensity of the other band was defined as zero.
Clustering of each sample by the group average linkage method was performed by
NEIGHBOR tools in the software package PHYLIP 3.5 based on the dissimilarity index.

2.5. Sequencing
DNA fragments recovered from the DGGE bands were reamplified with the forward
primer 357f including an additional sequence extension (T3; 5'-
AAAATTAACCCTCACTAAAG-3') at its 5' end and the reverse primer 518r with an
extension (M13r; 5'-AAATTCACACAGGAAACAG-3') at its 5' end to facilitate DNA
sequencing [4]. PCR conditions were all the same as the first amplification except the cycle
number. The cycle number was reduced to 25 times to minimize the amplification of
contaminants. The newly obtained PCR products were directly sequenced with SQ-5500
automatic sequencing system (Hitachi, Tokyo, Japan). Sequencing reactions were done by
using the Vistra Sequencing Kit (Amersham) with T3 and M13r primers labeled with Texas
Red according to the instruction provided by Amersham and Hitachi.
 59

3. RESULTS

3.1. Performance of the reactor

Temperature in the reactor throughout the operation is shown in Figure 2. The temperature
reflects bacterial activity very well because it rises due to the heat by the decomposition of
organic materials. The temperature started rising after two days, and on the day 4, it reached
65 oC. As the mixing motor stopped from day 4 to 6 due to an accident, the temperature did
not rise during this time because of the lack of oxygen supply. The temperature started rising
again after the recovery of the mixing, and it changed periodically from day 30 to day 70.
After day 70, temperature rise deteriorated gradually and from day 80, no temperature rise
occurred.
A carbon balance was performed on the system using the degradation ratio, which was
defined as the ratio of CO2-carbon discharged in two days divided by organic carbon fed in a
batch. It was 40 to 100% from day 20 to day 58 (Figure 3). After day 58, no data was
available because the CO2 meter was broken. Degradation of organic matter accumulated in
the reactor may result in the values over 100%. About 80% of total organic carbon input was
converted to CO2 and discharged from the reactor by day 58.

3.2. PCR-DGGE analysis

Figure 4 shows the result of the PCR-DGGE analysis. The banding pattern of day 0, i.e.
inoculum, was completely different from that of day 1. The patterns were quite simple until
day 8, but became diverse after day 11. From day 23, they seemed to become stable until the
end of the operation. Similarity analysis of the banding pattern was conducted and the result
is shown as cluster analysis (Figure 5). They could be classified into 3 clusters: 1) day 1 to 8,
2) day 11 and 15, and 3) day 23 to 87. The band pattern of day 0 (inoculum) was excluded
from similarity analysis because it was completely different from that of day 1 and no band
was at the same location.

3.3. Sequencing of DGGE bands

Prominent DGGE bands from the samples on day 4 and day 31 and some other distinctive
bands were sequenced to elucidate the affiliation of constituents of the communities. Table 1
shows the results of homology search for the sequences of the DGGE bands. Three bands,
SP31-2, SP4-3 and SP4-8, have completely identical sequences (100% homology) with the
described species, minimum homology was 92% and average was 96.3%. By judging from
the location of the bands, bands at the same location of those sequenced were assumed to
have the same sequences and summarized in the table. Actually, several sets of bands with the
same location were sequenced and all of them had the identical sequences. Moreover, in order
to facilitate the analysis, we classified the bands into 8 groups in accordance with their
similarity (Table 1).

3.4. Population dynamics in DGGE banding patterns

Intensity of the bands were measured, summed up in each bacterial group 1 to 8 in Table
1. The percentage of the groups to the sum of all visible bands were calculated. Figure 6
60

65
I--Temp- [] Sampling 140%
60 ~ I " Batch
55
4
Ii ,1 ,I ~i, @
120%
.. Cumulative
50 ll ~_a, ~tli,ll Illllll,, ~a, 100%
~__.45 ~i: i(.J~i' ',Oll[l'llilLlJtl]JlJllln].ll A. o 80%
N 40 !~l/llll, flllNllVllllllIlil'lllUl' vll 60%
35 'Jlll]liliVt u~J'lllll'Yl~ww"
~' "58
~:ii" ~ / ex0
~ 40%
30 0 d8illjlVw
~' 20%
25 % , , , , ,
20 . . . .
0 10 20 30 40 50
0 10 50 60 70 80
20 30 40
Days Days
Figure 2. Temperature inside the reactor.The Figure 3. Degradation ratio in a batch and
day samples were taken is indicated inthe cumulative ratio of discharge and feeding.
figure. The ratio is based on carbon balance.

Day
1
I ' 2
I ii i ii i 4

I 8
]
11
I 15
23
31
I 37
44
d 58
I I 72
87
I I I I I
0.8 0.6 0.4 0.2 0
D(a,b), Dissimilarity Index

Figure 4. A gel image of PCR-DGGE Figure 5. Similarity analysis of DGGE

analysis. Bands sequenced in this study are band pattern shown in Figure 6. Clusters
indicated with the No. 'a' to 'u' at the right are calculated by UPGMA method.
side of the bands.
 61

Table 1
Sequencing and identification of bands and their fate. The D G G E lanes, i.e.sampling date,
which have a band at the same location as the sequenced bands, are marked'+'. The bands
are classified into 8 groups according to their similarities.
II I 1

Bands Day
No.Name 1 2 4 8 11 1 5 2 3 3 1 3 7 4 4 5 8 7 2 8 7 Highest similarity a Group
a SP4-1 + + + + + + + + + + + B.oleronius 1
b SP31-2 + + + + + + + + + + Staphyl.sciuri 7
c SP4-3 + + + + + + + Eco.saccharolyticus 8
d SP31-4 + + + B.licheniformis 1
e SP31-5 + + + + + + + + B.firmus
f SP11-5 + + Mcc.carouselicus -
g SP4-8 + + + + + + + + Lcc.lactis 6
h SP31-6 + + + + + B.licheniformis 1
i SP4-9 + + + + Scc.thermophilus 1
J SP31-7 + + + + + + + B.thermocloacae 2
k SP31-8 + + + + + + + + + + B.licheniformis 1
1 SP23-11 + + + + + + + B.licheniformis 1
m SP31-10 + + + + + + + + B.licheniformis 1
n SP15-10 + + + + + B.lentus 4
O SP58-10 + + + + + + B.benzoevorans 3
P SP31-12 + + + + + B.thermocloacae 2
q SP4-13 + + + + B.badius 3
r SP31-13 + + + B.thermocloacae 2
s SP31-14 + + + + + + + + + + + B.cohnii 3
t SP44-15 + + + + + + + + + + B.pumilus 3
U SPll-17 + + + + + + B.fastidiosus 5

a B. : B a c i l l u s , S t a p h y l . : S t a p h y l o c o c c u s , E c o . : E n t e r o c o c c u s , M c c . : M a c r o c o c c u s ,

Lcc. : L a c t o c o c c u s , Scc. : S a c h a r o c o c c u s .

shows the fate of each group by the band intensity. Group 1, B. l i c h e n i f o r m i s and its relatives,
predominated after day 8. The profiles of the groups in each sample were quite stable after
day 23 except group 6, Lcc. lactis and its relatives, appeared again after day 44.

4. DISCUSSION

4.1. The community structure and its dynamics

All 21 sequences had high similarity only to B a c i l l a c e a e (in R i b o s o m a l Database
Project[7], B a c i l l u s - L a c t o b a c i l l u s - S t r e p t o c o c c u s subdivision) and so they all could be
classified into B a c i l l a c e a e , which includes genus B a c i l l u s , L a c t o c o c c u s , E n t e r o c o c c u s ,
S t a p h y l o c o c c u s , M a c r o c o c c u s , and so on. B a c i l l a c e a e is affiliated in Gram positive bacteria
with low G+C content (GPBLGC). This result was consistent with that of the quinone profile
62

analysis (detailed data not shown). From day 2 on, major quinone molecules were MK-6 and
MK-7, especially MK-7 after day 1118]. Bacteria with MK-7 as a major respiratory quinone
molecule are GPBLGC and Cytophagales[9], but Cytophagales were not observed by FISH
(Fluorescent In Situ Hybridization) with probe specific to Cytophagales[8]. Thus, we could
conclude that GPBLGC, and most probably Bacillaceae, was predominant after day 2.
In order to know the population dynamics at species/group level, we quantified the band
intensity and describe the predominancy (Figure 6). We must be aware of several biases when
using the result. First of all, nucleic acids are not evenly extracted from various bacterial
species. Some species are known to be fastidious and difficult to extract with normal DNA
extraction method. The second one is the PCR bias. The degree of multiplication by PCR
method is different depend on DNA sequences. Moreover, location of the DGGE bands, or
the degree of migration may affect the intensity of bands. However, we can still estimate the
predominancy of bacterial species to some extent if we keep those limitation in mind.

" B.licheniformis B.thermocloacae

70% A B.pumilus
mm o B.lentus
60% ~B.fastidiosus
50%
40%
30%
20%
El
10%
0%
0 10 20 30 40 50 60 70 80 90
a) Days
70%
60% "- Lcc.lactis
"" Staphl.sciuri
50% ,~ Eco.saccharolyticus
40%
30%
20%
10%
0% ~ - - - ~ m m m ~ ~
I

0 10 20 30 40 50 60 70 80 90
b) Days

Figure 6. Predominancy of the bacterial groups calculated by the band intensity in

eachsampling day. The percentage is the ratio to the total intensity of the visible bands in
aDGGE lane. G l-G8 in the legends shows the group numbers in Table 1. a): genus Bacillus;
b) other bacteria.
 63

At the beginning of the operation, bacteria other than genus Bacillus, such as Lactococcus,
Staphylococcus and Enterococcus, were predominated in the reactor. However, after day 4, B.
licheniformis group became the most abundant. Other Bacillus group also appeared and non-
Bacillus groups occupied the minor part. The composition of the groups did not change so
much after day 23.

4.2. Process performance and community structure

The trends in temperature change can be separated into 4 periods. From day 0 to day 10,
the thermophilic cycle started but an accident kept the reactor at low temperature later on.
After the accident was recovered, periodical temperature cycles occurred except three batches
until day 30. From day 30 to day 70, completely periodical temperature cycle was observed.
The highest temperature in a batch decreased from day 70 and it did not rise from day 80 on.
We call them as the initial period, the semi-stable period, the stable period, and the
deteriorated period. This separation is in quite good agreement with the cluster analysis of the
DGGE bands (Figure 5). Thus, the community structures were highly related to the
temperature change. The relationship between the process performance and community
structures were discussed in the four periods as follows.
During the initial period (from day 0 to day 10), some mesophilic fermentative bacteria
like Enterococcus, Lactococcus and Staphylococcus were found. Enterococcus and
Lactococcus can degrade starch and sucrose only fermentatively [10,11]. Thus, they
fermented starch and sucrose in the substrate but contribute little to temperature rise owing to
small energy generation in fermentation. On day 8, the DGGE band pattern was more similar
to day 2 than day 4 (Figure 5). Those non-Bacillus mesophiles again became predominant
(Figure 6). This result may have been linked to the decrease in reactor temperature between
days 4 and 8 (Figure 2). In contrast, composition of the band intensity on day 4 was similar to
that of day 11 and later. DGGE bands such as SP31-5, SP31-8 SP58-10, and SP31-14
appeared on day 4, disappeared on day 8 and reappeared after day 11. They were probably
unknown obligate thermophiles although most of their closest relatives were mesophilic
bacteria; B.firmus, B.benzoevorans and B.cohnii.
From day 10 to 30, the reactor performance was almost stable. The DGGE banding patterns
showed that the community structure shifted to a stable state. The non-Bacillus mesophiles
decreased and almost disappeared. Instead, obligate thermophilic Bacillus, B. thermocloacae
appeared and stayed in the reactor until the end of the operation. B. licheniformis, facultative
thermophilic Bacillus, got the predominancy in the community.
The performance of the reactor and the community structure was stable from day 30 to day
70. The community was composed primarily of Bacilli, including the close relatives of
B.thermocloacae (obligate thermophile), B.licheniformis (facultative thermophile) and
B.pumilis (mesophile). The group of B.licheniformis was the most abundant among them.
Facultative thermophiles have an advantage under the conditions in this experiment because
they can grow under both mesophilic and thermophilic conditions, which occurred in every
batches. B.licheniformis can utilize starch and sucrose[12], and so they could grow in the
reactor fed with those substrate. Moreover, some obligate thermophilic and mesophilic Bacilli
also played some role on the reactor performance. They might be activated under suitable
64

temperature conditions and became dormant under adverse conditions. Generally speaking,
Bacilli are tolerant under adverse conditions.
Even after the performance deteriorated and the temperature ceased to rise after feeding
(day 80), the community structure seemed to remain constant according to DGGE. Thus, this
deterioration was not caused by community change, but by some physical conditions. A
probable reason is the moisture content of the media. It was 50 to 65% from day 10 to 60 but
it rose above 70% after day 70. High moisture content reduces the diffusion rate of oxygen
and hinders active aerobic metabolism. In composting process, it was reported that
composting is impossible at the moisture content of 70% [ 13].

5. CONCLUSIONS

In the present study, microbial community structure in a TCOP reactor was determined by
using PCR-DGGE and the sequences of the DGGE bands. The community structure and its
dynamics could be related to the process performance comprehensively. Under high
performance of TCOP, facultative thermophilic Bacillus, namely B.licheniformis, may
predominate, but also obligate thermophilic Bacillus and mesophiles may play some role in
the reactor. Based on the results, however, more quantitative methods such as FISH with
genus/species specific probes or dot-blot hybridization must be employed to elucidate more
precise composition of the communities to know better about reactor performance by
community structures.

REFERENCES

1. Cai, H., and T. Mori. (1995) Proc. Environ. Eng. Res. Jpn. 32: 371-378.
2. Curtis, T., and N. Craine. (1997) p. 65-72. In Proc. of the Second International
Conference on Microorganisms in Activated Sludge and Biofilm Process, IAWQ
Specialist Group on Activated Sludge Population Dynamics, Berkeley, Calif.
3. Muyzer, G., E. C. Waal, and A. G. Uitterlinden. (1993) Appl. Environ. Microbiol. 59:
695-700.
4. Rolleke, S., G. Muyzer, C. Wawer, G. Wanner, and W. Lubitz. (1996) Appl. Environ.
Microbiol. 62: 2059-2065.
5. Zhu, H., F. Qu, and L. H. Zhu. (1993) Nucleic Acids Res. 21: 5279-5280.
6. Hiraishi, A., Y. Morishima, and J. Takeuchi. (1991) J. Gen. Appl. Microbiol. 37: 57-70.
7. Maidak, B. L., G. J. Olsen, N. Larsen, R. Overbeek, M. J. McCaughey, and C. R. Woese.
(1997) Nucleic Acids Res. 25:109-111.
8. Kurisu, F., Satoh, H., Mino, T. and Matsuo, T. (1997) Proc. of Environ. Eng. Forum,
Koriyama, Japan, 138-140 (in Japanese).
9. Collins, M. D., and D. Jones. (1981) Microbiol. Rev. 45: 316-354.
10. Farrow, J. A. E., J. Kruze, B. A. Phillips, A. J. Bramley, and M. D. Collins. (1984)
System. Appl. Microbiol. 5: 467-482.
 65

11. Sheleifer, K. H., J. Kraus, C. Dvorak, R. Klilpper-Balz, M. D. Collins, and W. Fisher.

(1985) System. Appl. Microbiol. 6: 183-195.
12. Claus D., and R. C. W. Berkeley. (1986) p. 1105-1138. In P. A. Sneath, N. S. Mair, M. E.
Sharpe, and J. G. Holt (ed.), Bergy's manual of systematic bacteriology, 2nd ed., Vol. 2.
The Williams & Wilkins Co., Baltimore, Md.
13. Bach, P. H., M. Shoda, and H. Kubota. (1984) J. Ferment. Technol. 62: 285-292.