Design and evaluation of reverse

transcription nested PCR primers for the

detection of betanodavirus in finfish

J.Joseph Sahaya Rajan, P.Ezhil

Praveena, T.Bhuvaneswari &
K.P.Jithendran

VirusDisease

ISSN 2347-3584
Volume 27
Number 2

VirusDis. (2016) 27:123-129

DOI 10.1007/s13337-016-0313-0

1 23
Your article is protected by copyright and
all rights are held exclusively by Indian
Virological Society. This e-offprint is for
personal use only and shall not be self-
archived in electronic repositories. If you wish
to self-archive your article, please use the
accepted manuscript version for posting on
your own website. You may further deposit
the accepted manuscript version in any
repository, provided it is only made publicly
available 12 months after official publication
or later and provided acknowledgement is
given to the original source of publication
and a link is inserted to the published article
on Springer's website. The link must be
accompanied by the following text: "The final
publication is available at link.springer.com.

1 23
 Author's personal copy
VirusDis. (AprilJune 2016) 27(2):123129
DOI 10.1007/s13337-016-0313-0
ORIGINAL ARTICLE
Design and evaluation of reverse transcription nested PCR
primers for the detection of betanodavirus in finfish
J. Joseph Sahaya Rajan1 P. Ezhil Praveena1 T. Bhuvaneswari1
K. P. Jithendran1
Received: 30 December 2015 / Accepted: 4 April 2016 / Published online: 29 April 2016
 Indian Virological Society 2016
Abstract Viral encephalopathy and retinopathy other-
wise known as viral nervous necrosis (VNN) is a neu-
ropathological condition affecting more than 50 fish
species worldwide, mostly marine. Different PCR proto-
cols with specific primers were reported from many
countries for confirmation of VNN in fishes. In the present
study, two pairs of primers were designed and evaluated for
the diagnosis of clinical and subclinical cases of infections
from field. These primers designated as BARL-F1/BARL-
R1 amplified a 902 bp product in the variable region (T4)
of the coat protein gene by first step PCR. Nested PCR
primers BARL-F2/BARL-R2 amplified a fragment of
313 bp. The results were comparable with other commonly
used primer sets such as F2/R3 and RG668f/RG919r pri-
mers. These new primers could detect betanodavirus in
standard reference samples containing low, moderate and
high viral load. Known positive and negative control
samples of fish also revealed a predictive value of 100 %
by RT-PCR diagnosis.
Keywords Viral nervous necrosis  Viral encephalopathy
and retinopathy  Betanodavirus  Mortality  Diagnosis 
Nested RT-PCR
Electronic supplementary material The online version of this
article (doi:10.1007/s13337-016-0313-0) contains supplementary
material, which is available to authorized users.
& K. P. Jithendran
kpjithendran@yahoo.com
1 [18]. A sub genomic RNA3 synthesized from RNA1 during
Aquatic Animal Health and Environment Division, Central
Institute of Brackishwater Aquaculture, 75, Santhome High
Road, Chennai, Tamil Nadu 600 028, India
Introduction
Viral encephalopathy and retinopathy (VER) otherwise
known as viral nervous necrosis (VNN) is a neuropatho-
logical condition affecting more than 50 fish species,
mostly marine across the world [19, 27]. The disease is
caused by Betanodavirus of the family Nodaviridae which
are icosahedral, non enveloped viruses with a diameter of
about 25 nm and a bipartite positive-sense RNA genome.
Betanodaviruses have been classified into five major
genotypes: red spotted grouper nervous necrosis virus
(RGNNV), striped jack nervous necrosis virus (SJNNV),
tiger puffer nervous necrosis virus (TPNNV), barfin
flounder nervous necrosis virus (BFNNV) and turbot
nodavirus (TNV) based on the variable region (T4) of the
viral capsid protein (CP) gene [23].
In India, the betanodavirus infection has been reported
in wild and hatchery/farm grown marine fishes and con-
sidered as an emerging fish disease affecting finfish species
of aquaculture potential [1, 3, 5, 15]. Generic classifica-
tions based on partial or full coat protein gene sequences of
all these investigations revealed that the nucleotide
sequences showed up to 98 % similarity to the RGNNV
genotype. Specific clinical signs include neurological
abnormalities like erratic or aberrant swimming behavior
and lethargy. Distinct vacuolization of the nervous tissue
(brain, retina) on histological examination was observed.
Mortality may be rapid, generally during early larvae and
juvenile fish and may reach up to 100 % of the fish stock
within 23 days. Its bipartite genome consists of two
positive RNA strands; RNA1 (3.1 kb) codes for viral RdRP
(protein A) while the RNA2 (1.4 kb) codes for coat protein
early viral replication codes for protein B2 [31] which acts
against host RNA interference [9, 13]. The virus causes
123
 Author's personal copy
124
acute as well as latent infections [19]. Biological and
environmental stress factors may induce latent form of the
infection to acute infection with disease signs [20] and/or
facilitate vertical/horizontal transmission of the virus [6,
16]. The first described PCR protocol using F2/R3 primers
for betanodavirus [24] is now accepted as the gold standard
for its confirmatory diagnosis [26]. Several workers opined
that F2/R3 primers are not perfectly adapted to efficient
amplification of every betanodavirus isolates [4, 8], more
so for RGNNV due to wide range of host species and
diversity of isolates. Diagnostics with specific objectives
such as health management of broodstock and confirmation
of acute VNN were developed in many countries [10, 11,
32] but information on diagnosis of latent infection is
scanty. In this paper, an attempt was made for a robust
universal test for amplifying and genotyping betano-
daviruses, by designing two pairs of primer sets in variable
region of the viral capsid protein gene and evaluation of
RT-PCR protocol for early diagnosis of betanodavirus in
fish. The efficiency of these primers was compared with
that of F2/R3 [24] and RG668f/RG919r [22] primers using
a range of samples originated from diverse fish species
besides a reference strain in cell culture.
Materials and methods
Primer design and evaluation
Two sets of primer pair (BARL-F1/BARL-R1 and BARL-
F2/BARL-R2) were designed (Table 1) by alignment of
betanodavirus RNA2 gene sequences (n = 28) from all
five distinct genotypes (NC003449, NC013459,
AY324870, NC013461 and AJ608266) using the program
Clustal W (MegAlign program version 5.03 of the
DNASTAR package) and two consensus sequences tar-
geting the coat protein gene (RNA2) were chosen for
nested PCR. The performance of these new sets of primers
were evaluated using fish that displayed clinical signs of
VNN infection, reference strain of the betanodavirus
Table 1 Primers used in the
Primer code Sequence (50 30 )
PCR reaction to detect
betanodavirus BARL-F1 ACGCAAAGGTGAGAAGAAA
BARL-R1 GTCCCAGATGCCCCA
BARL-F2 AACTGACAACGACCACACCTT
BARL-R2 TGTGGAAAGGGAATCGTTG
F2 CGT GTC AGT CAT GTG TCG CT
R3 CGA GTC AAC ACG GGT GAA GA
RG668f ACC TGA GGA GAC TAC CGC TC
RG919r CAG CGA AAC CAG CCT GCA GG
a
OIE primer
123
J. J. S. Rajan et al.
(CSIRO, Australia) and fish samples without apparent
clinical signs (persistent or negative for VNN infection)
and compared with a set of published primers [22, 24].
Fish samples
Subclinical samples
Fish samples (Lates calcarifer, Mugil cephalus, Chanos
chanos, Liza parsia, Liza tade and Eleutheronema te-
tradactylus) were collected from finfish hatchery/farms and
wild habitats located in Chennai (Tamil Nadu) and Kakd-
wip (West Bengal) along the east-coast of India (Table 2).
The target organs (brain and eyeball) were excised using a
sterile scalpel and were collected in RNAlater Tissue
Protect Tubes (QIAGEN) or TRIzol Reagent (Invitrogen)
for molecular diagnosis.
Clinical samples
A pool of Asian seabass (L. calcarifer) larval samples with
known history of VNN outbreak in a hatchery, preserved at
-80 C was used in this study as clinical samples (BARL-
LC01). A portion of the target organs from clinical and sub
clinical samples were collected aseptically for virus isola-
tion studies by inoculation in susceptible cell line (seabass
spleen cell line-SISS) for confirmation, and for routine
histopathological studies in 10 % neutral buffered
formalin.
Virus-free fish samples (negative control)
A healthy stock of Asian seabass larvae (28 dph) collected
earlier from a hatchery and stored at -80 C was used as
negative control (n = 4).
Virus strain and viral propagation (positive control)
The strain used in this study designated as BARL-LC02
belongs to RGNNV genotype was originally isolated from
Product (bp) Application/reference (s)
902 I step PCR (this study)
313 Nested PCR (this study)
430 I step PCR [24]a
280 Nested PCR [22]
 Author's personal copy
Design and evaluation of reverse transcription nested PCR primers for the detection
Table 2 Results of RT-PCR for betanodavirus for fish samples collected from wild and culture facilities during April 2013December 2014
Species Disease Origin
status
Lates calcarifer Clinical Farm/hatchery
Sub clinical Wild
Mugil cephalus Sub clinical Farm
Sub clinical Wild
Chanos chanos Sub clinical Farm
Sub clinical Wild
Liza parsia Sub clinical Farm
Sub clinical Wild
Others Sub clinical Farm
Liza tade, Eleutheronema tetradactylus Sub clinical Wild
Total
seabass during an acute disease outbreak in a rearing
facility. Larval tissue homogenate was treated with
antibiotics (1000 IU ml-1 penicillin, 100 lg ml-1 strep-
tomycin, 500 lg ml-1 gentamycin and 10 lg ml-1
amphotericin B) filtered using 0.22 micron syringe filter
[2]. SISS cell line from Asian seabass spleen (provided by
Dr. Sahul Hameed, C. Abdul Hakeem College, Mel-
visharam, India) was used for viral propagation and were
grown in L-15 medium containing 10 % foetal bovine
serum [28], 100 ll virus suspension inoculated in over-
night cell monolayer and after an hour of viral adsorption,
the inoculum was removed and fresh maintenance L-15
medium containing 5 % foetal bovine serum was added
and incubated at 28 C up to a maximum of two weeks.
When cytopathic effect (CPE) becomes extensive, fluids
were harvested after freeze thawing for three times and
clarified by centrifugation at 30009g for 15 min at 4 C
and stored at -80 C until use. Virus titration was con-
ducted on monolayers of cells in 96 well plates using 10
fold serial dilutions in triplicate. The 50 % of the tissue
culture infective dose (TCID50/ml) was calculated as
described by Reed and Muench [30]. The titre of the cul-
ture supernatant was 103 TCID50/ml at 4 days post infec-
tion (dpi) and 108 TCID50/ml at 7 dpi. The culture
supernatants were subjected to RNA extraction and used as
positive control for further analyses by reverse transcrip-
tion nested polymerase chain reaction (RT-nPCR).
Reference standard (betanodavirus positive)
A non-infectious sample of ethanol precipitated (80 % v/v)
tissue culture supernatants from active virus cultures with
low, moderate and high dose of betanodavirus provided by
CSIRO, Australia was used for standardizing the sensitivity
of the new primer sets.
125
No. examined No. positive by No. positive by newly
OIE primers designed primers
4 4 4
3 1 1
11 1 1
1
4 2 2
9
1
6 1 1
0
1
40 9 9
RT-nPCR and sequence analysis
Total RNA was extracted from target tissues (clinical
and sub clinical), cell culture supernatants (field isolate
of BARL-LC02) and the betanodavirus reference strain
from CSIRO using TRIzolTM Reagent (Invitrogen, USA)
following the manufacturers protocol. The purity and
quantity of the extracted RNA was carried out using a
NanoSpectrophotometer (Implen, Germany) at 260 nm.
Reverse transcription was carried out using iScript
cDNA synthesis kit (BioRad) in 10 ll reaction as per the
manufacturers instructions. The synthesized cDNA was
subjected to PCR amplification using the newly designed
first and nested PCR primer sets. Following optimized
thermal cycling conditions for first step PCR was used:
95 C initial denaturation for 5 min followed by 40
cycles of 1 min denaturation at 95 C, 1 min annealing
at 60 C and 1 min extension at 72 C and final exten-
sion at 72 C for 5 min. The optimized thermal cycling
profile for nested PCR was 95 C initial denaturation for
5 min followed by 40 cycles of 30 s denaturation at
95 C, 30 s annealing at 60 C and 30 s extension at
72 C and final extension at 72 C for 5 min. PCR was
carried out in a final volume of 25 ll reaction mixture
containing Tris- HCl (pH 8.5), 1.5 mM MgCl2, 0.2 %
Tween 20, 0.4 mM dNTPs, 100 pM of forward and
reverse primer, 1U Taq DNA Polymerase, 50100 ng of
template DNA and inert dye and stabilizer (Ampliqon,
Denmark). The amplification was performed in gradient
thermal cycler (Eppendorf, Germany). The amplified
PCR products were resolved in 1.5 % TBE agarose gel
stained with 0.5 lg/ml ethidium bromide. The identities
of the first step PCR products (903 bp) were confirmed
by nucleotide sequencing (First Base Laboratories,
Malaysia) and NCBI BLAST analysis.
123
 Author's personal copy
126
Results
Fish samples and clinical history and gross
pathology
In the present study, a group of clinical, subclinical,
healthy fish samples of different fish species were used
for evaluation two pairs of newly designed primers for
the diagnosis of betanodavirus (Table 2). The disease
status and the presence of fish nodavirus in these groups
were ascertained by the known history of the disease,
histopathological studies and confirmation by a RT-
nPCR targeting T4 region of coat protein gene (RNA2)
as per the earlier published reports (22,24). The primers
designed by Nishizawa et al. [24] are the most widely
used OIE primers across the world, with capability to
detect all genotypes of betanodavirus. Of the nine
samples tested positive by published primers above,
four samples were L. calcarifer collected from clinical
disease outbreaks at different time intervals in a
hatchery, and another five from different fish species
without any apparent clinical signs of VNN infection.
Histologically, severe vacuolation in the brain and
retinal tissues of the eye was characteristically seen as
the most important and reliable diagnostic feature of
VNN in fish. Fish samples from clinical disease out-
break revealed mild necrosis and vacuolization in the
brain (Fig. 1).
A strain of betanodavirus designated as BARL-
LC02 (positive control) cultured in SISS cell line was
used as positive control used in this study. BARL-
LC02 grew well in this cell line at 28 C with pro-
gression of cytopathic effect by vacuolation of cells,
cellular aggregation and rounding up of cells and
clumps. The titre of the culture supernatant was 103
TCID50/ml at 4 days post infection (dpi) and 108
TCID50/ml at 7 dpi. Healthy seabass larvae (28 dph)
tested earlier for VNN and stored at -80 C was used
as negative control.
Fig. 1 Histological section of
brain of VNN affected Asian
seabass larvae (code 01), H&E
stain. a Peripheral vacuolation
in the brain (910); b severe
vacuolations with coalescence
of the vacuoles seen scattered in
the brain tissue (arrow), H&E
940
123
J. J. S. Rajan et al.
Reverse transcriptase nested PCR and sequence
analysis
All the forty fish samples belonging to six fish species from
wild and culture facility were tested by RT-nPCR for
betanodavirus infection using published primer sets as well
as the newly designed primers (Table 2). Nine samples
showed positive for betanodavirus by RT-nPCR using both
sets of primers. The RT-PCR amplification using the new
primer pair BARL-F1/BARL-R1 for first-step gave an
amplified product of 902 bp, while BARL-F2/BARL-R2
primer pair yielded a 313 bp nested PCR product. No PCR
artifacts or host fish genomes were amplified under the
specified thermal cycling conditions.
The new primers were specific and amplified targeted
product of betanodavirus coat protein gene in all four
samples of L. calcarifer from clinical disease outbreaks and
five samples of different fish species with no history of
disease signs (Figs. 2, 3) at par with the F2/R3 primers
(data not shown). The reference strain of betanodavirus
(CSIRO, Australia) containing low (20 copies), moderate
(100 copies) and heavy infection (200 copies) of virus also
M 1 2 3 4 5 6 M 7 8 9 10 11 12
902 bp
313 bp
Fig. 2 Evaluation of the primers using VNN affected seabass larvae
from clinical outbreak of disease (lanes 16 first step PCR using
primer set BARL-F1/BARL-R1 and lanes 712 nested PCR using
primer set BARL-F2/BARL-R2)these samples were tested positive
by OIE primer (F2/R3). M DNA ladder, 1 Asian seabass larvaecode
01, 2 Asian seabass larvaecode 02, 3 Asian seabass larvaecode
03, 4 reference strain (CSIRO), 5 negative control, 6 positive control,
7 Asian seabass larvaecode 01, 8 Asian seabass larvaecode 02, 9
Asian seabass larvaecode 03, 10 reference strain (CSIRO), 11
negative control, 12 positive control

Design and evaluation of reverse transcription nested PCR primers for the detection
M 1 2 3 4 5 6 M 7 8
902 bp
Fig. 3 Evaluation of the primers using sub-clinically affected fishes
(lanes 17 first step PCR using primer set BARL-F1/BARL-R1 and
lanes 814 nested PCR using primer set BARL-F2/BARL-R2)these
samples were tested positive by OIE primer (F2/R3). M DNA ladder,
1 M. cephalus (code-15), 2 L. calcarifer (code-27), 3 L. calcarifer
(code-28), 4 C. chanos (code-07), 5 negative control, 6 positive
control, 7 M. cephalus (code-15), 8 L. calcarifer (code-27), 9 L.
calcarifer (code-28), 10 C. chanos (code-07), 11 negative control, 12
positive control
M 1 2 3 4 5
Fig. 4 Detection of betanodavirus positive reference strain (CSIRO,
Australia) containing low, moderate and heavy infection using the
newly designed primers (lane M molecular marker (100 bp), lanes 1
3 Positive control (reference sample) containing low, moderate and
high level of betanodavirus by first step PCR using primer set BARL-
F1/BARL-R1, lanes 46 same samples by nested PCR using primer
set BARL-F2/BARL-R2
a b
M N 1 2 3 4
M N 1 2 3 4
Fig. 5 a Betanodavirus detection using published primers F2/R3 for
first step (top) and RG668f/RG919r for nested PCR (bottom); b newly
designed primers BARL-F1/BARL-R1 for first step (top) and BARL-
F2/BARL-R2 for nested PCR (bottom) showing specific products;
Author's personal copy
127
9 10 11 12 tested positive without any non-specific bands (Fig. 4).
However, F2/R3 primers (first step PCR) could not amplify
target product in cell culture supernatants (positive control)
containing low (103 TCID50/ml) viral titres in this study
313 bp (Fig. 5a), while they were amplified with the new primer
sets used in this work for both first and second step PCR
(Fig. 5b). No non-specific amplification of host fish gen-
ome was observed by using virus-free seabass larvae
(negative control).
The sequences of the PCR product obtained in this study
were analysed using NCBI BLAST and found to have
[90 % sequence homology to the nucleotide sequences of
fish nodavirus isolated from other Asian countries. Further,
the first step PCR product sequences confirmed the speci-
ficity of the amplified products as that of coat protein gene
of betanodavirus with sequence homology to RGNNV
6
genotype.
Discussion
902 bp
Molecular methods have played a pivotal role in detecting
313 bp
and characterizing betanodavirus, and RT-PCR has
emerged as a powerful, rapid and sensitive method for
detection of VNN. Recently, two conventional PCR based
methods have been used to amplify and genotype betano-
daviruses by sequencing. First one targets a region of the
polymerase gene carried by RNA1 as a source of genetic
information that is useful for identification of an isolate.
The second method, more versatile based on the amplifi-
cation of the T4 region of RNA2 [24] has been widely used
5 6 7 M N 1 2 3 4 5 6 7
902 bp
5 6 7 M N 1 2 3 4 5 6 7
280 bp 313 bp
lane M DNA ladder (100 bp), lane N negative control, lanes 13 cell
culture samples C1C3 (positive control), lanes 47 healthy Asian
seabass larval samples S1S4 (known VNN-negative control)
123
 Author's personal copy
128
on a large number of isolates in numerous studies. High
genetic variation within the T4 region occasionally leads to
mismatches between primers and their targets and conse-
quently the sensitivity [8, 25]. However, these primers
were designed before the large genetic diversity of betan-
odavirus was appreciated and is still considered as gold
standard for diagnostic purpose. Subsequently, several
diagnostic protocols have been applied to detect various
virus strains, mostly on confirmation of the virus once an
outbreak occurs [7, 8, 1013, 21, 29, 32, 33]. Among
molecular methods, quantitative PCR seems to be efficient
for this purpose, considering its sensitivity, speed and the
possible control of contamination. Unfortunately, the sig-
nificant genetic diversity of betanodaviruses is a serious
difficulty in developing universal primers and hence not yet
advantageous for accurate genotyping [4]. Epidemiological
studies till date revealed only a single genotype (RGNNV)
in India (3,5,15) with varying degree of sensitivity of F2/
R3 primers, especially in asymptomatic wild fish samples.
A similar observation has been made by Bigarre et al. [4]
indicating false positive PCR products in gilthead, Sparus
aurata. The present study demonstrated the suitability of
newly designed RT-nPCR primers for routine disease
diagnosis using different types of biological samples from
infected fish samples. The results were comparable to
commonly used primers used for VNN diagnostics in India
and may be used as a management tool for screening
hatchery samples, grow-out monitoring, quarantine and
biosecurity programme in finfish aquaculture sector.
Availability of precise and sensitive diagnostics for
betanodavirus is important, both as diagnostic tools and for
morphological studies of the virus. It is inevitable in case
of latent (persistent) betanodavirus infection where the
disease condition is asymptomatic and an acute disease
predisposes with right combination of biological and
environmental conditions. Hence, confirmatory diagnosis
of viral diseases has been always a problem in field leading
to poor documentation of fish mortalities and scarce epi-
demiological data.
In recent years, VNN as a disease entity has been rec-
ognized as an emerging disease in finfish culture with
increasing number of host species across ecosystem barri-
ers, marine to freshwater [5, 14, 17]. With the increasing
diversification of finfish aquaculture and consequent
transfer of live organisms for culture, new strains and
genotypes of betanodaviruses are likely to emerge in
future. Considering the highly destructive nature of
betanodavirus, it is increasingly crucial to prevent the
introduction of virus in farms/hatcheries by screening for
healthy stock and elucidating promptly the source of virus
in case of outbreaks. Cell culture and immunological tests
are efficient for diagnostics, with inherent limitation of
123
J. J. S. Rajan et al.
speed and strain identification. Among molecular methods,
quantitative PCR seems efficient for this purpose, consid-
ering its sensitivity and speed, but need sophisticated
equipments. In this context, the newly designed RT-nPCR
primers could serve as additional tool for routine disease
diagnosis, epidemiology, quarantine and biosecurity pro-
gramme in Indian finfish aquaculture.
Acknowledgments The authors are grateful to the Director, Central
Institute of Brackishwater Aquaculture (Chennai) for providing nec-
essary facilities. The authors also thank Australian National Quality
Assurance Program (Australia) and Commonwealth Scientific and
Industrial Research Organisation (Australia) for providing a positive
reference sample of betanodavirus (non-infectious) under a joint
Regional Proficiency Testing Programme for Aquatic Animal Disease
Laboratories in Asia, coordinated by Network of Aquaculture Centres
in Asia Pacific (Bangkok) during 20132014.
References
1. Azad IS, Shekhar MS, Thirunavukkarasu AR, Poornima M,
Kailasam M, Rajan JJS, Ali SA, Abraham M, Ravichandran P.
Nodavirus infection causes mortalities in hatchery produced lar-
vae of Lates calcarifer: first report from India. Dis Aquat Org.
2005;63:1138.
2. Bandin I, Olveira JG, Borrego JJ, Dopazo CP, Barja JL. Sus-
ceptibility of the fish cell line SAF-1 to betanodavirus. J Fish Dis.
2006;29:6336.
3. Banerjee D, Hamod MA, Suresh T, Karunasagar I. Isolation and
characterization of a nodavirus associated with mass mortality in
Asian seabass (Lates calcarifer) from the west coast of India.
Virus Dis. 2014;. doi:10.1007/s13337-014-0226-8.
4. Bigarre L, Baud M, Cabon J, Crenn K, Castric J. New PCR
probes for detection and genotyping of piscine betanodavirus.
J Fish Dis. 2010;33:90712.
5. Binesh CP, Jithendran KP. Genetic characterization of betano-
davirus isolates from Asian seabass Lates calcarifer (Bloch) in
India. Arch Virol. 2013;158:15437.
6. Breuil G, Pepin JFP, Boscher S, Thiery R. Experimental vertical
transmission of nodavirus from broodfish to eggs and larvae of
the sea bass, Dicentrarchus labrax (L.). J Fish Dis.
2002;25:697702.
7. Comps M, Raymond JC. Virus-like particles in the retina of the
sea-bream, Sparus aurata. Bull Eur Assoc Fish Pathol.
1996;16:1613.
8. Dalla Valle L, Zanella L, Patarnello P, Paolucci L, Belvedere P,
Colombo L. Development of a sensitive diagnostic assay for fish
nervous necrosis virus based on RT-PCR plus nested PCR. J Fish
Dis. 2001;23:31227.
9. Fenner BJ, Thiagarajan R, Chua HK, Kwang J. Betanodavirus B2
is an RNA interference antagonist that facilitates intracellular
viral RNA accumulation. J Virol. 2006;80:8594.
10. Gagne N, Johnson SC, Cook-Versloot M, MacKinnon AM, Oli-
vier G. Molecular detection and characterization of nodavirus in
several marine fish species from the northeastern Atlantic. Dis
Aquat Org. 2004;62:1819.
11. Gomez DK, Sato J, Mushiake K, Isshiki T, Okinaka Y, Nakai T.
PCR-based detection of betanodaviruses from cultured and wild
marine fish with no clinical signs. J Fish Dis. 2004;27:6038.
 Author's personal copy
Design and evaluation of reverse transcription nested PCR primers for the detection
12. Huang B, Tan C, Chang SF, Munday B, Mathew JA, Ngoh GH,
Kwang J. Detection of nodavirus in barramundi, Lates calcarifer
(Bloch) using recombinant coat protein-based ELISA and RT-
PCR. J Fish Dis. 2001;24:13541.
13. Iwamoto T, Mise K, Takeda A, Okinaka Y, Mori KI, Arimoto M,
Okuno T, Nakai T. Characterization of Striped jack nervous
necrosis virus subgenomic RNA3 and biological activities of its
encoded protein B2. J Gen Virol. 2005;86:280716.
14. Jithendran KP, Shekhar MS, Kannappan S, Azad IS. Nodavirus
infection in freshwater ornamental fishes in Indiadiagnostic
histopathology and nested RT-PCR. Asian Fish Sci.
2011;24:129.
15. John KR, George MR, Jeyatha B, Saravanakumar R, Sundar P,
Jithendran KP, Koppang EO. Isolation and characterization of
Indian betanodavirus strain from infected farm-reared Asian
seabass Lates calcarifer (Bloch, 1790) juveniles. Aquac Res.
2014;45:14818.
16. Kai YH, Su HM, Tai KT, Chi SC. Vaccination of grouper
broodfish (Epinephelus tukula) reduces the risk of vertical
transmission by nervous necrosis virus. Vaccine.
2010;28:9961001.
17. Keawcharoen J, Techangamsuwan S, Ponpornpisit A, Lombar-
dini ED, Patchimasiri T, Pirarat N. Genetic characterization of a
betanodavirus isolated from a clinical disease outbreak in farm-
raised tilapia Oreochromis niloticus (L.) in Thailand. J Fish Dis.
2015;38:4954.
18. Mori K, Nakai T, Muroga K, Arimoto M, Mushiake K, Furusawa
I. Properties of a new virus belonging to nodaviridae found in
larval striped jack (Pseudocaranx dentex) with nervous necrosis.
Virology. 1992;187:36871.
19. Munday BL, Kwang J, Moody N. Betanodavirus infections in
teleost fish: a review. J Fish Dis. 2002;25:12742.
20. Mushiake K, Nishizawa T, Nakai T, Furusawa I, Muroga K.
Control of VNN in striped jack: selection of spawners based on
the detection of SJNNV gene by polymerase chain reaction
(PCR). Fish Pathol. 1994;29:17782.
21. Nguyen HD, Mushiake K, Nakai T, Muroga K. Tissue distribu-
tion of striped jack nervous necrosis virus (SJNNV) in adult
striped jack. Dis Aquat Org. 1997;28:8791.
22. Nishioka T, Mori K, Sugaya T, Tezuka N, Takebe T, Imaizumi
H, Kumon K, Masuma S, Nakai T. Involvement of viral nervous
necrosis in larval mortality of hatchery-reared Pacific bluefin tuna
Thunnus olientalis. Fish Pathol. 2010;45:6972.
129
23. Nishizawa T, Furuhashi M, Nagai T, Nakai T, Muroga K.
Genomic classification of fish nodaviruses by molecular phylo-
genetic analysis of the coat protein gene. Appl Environ Micro-
biol. 1997;63:16336.
24. Nishizawa T, Mori K, Nakai T, Furusawa I, Muroga K. Poly-
merase chain reaction (PCR) amplification of RNA of striped jack
nervous necrosis virus. Dis Aquat Org. 1994;18:1037.
25. Nishizawa T, Muroga K, Arimoto M. Failure of the polymerase
chain reaction (PCR) method to detect striped jack nervous
necrosis virus (SJNNV) in Striped Jack Pseudocaranx dentex
selected as spawners. J Aquat Anim Health. 1996;8:3324.
26. OIE-World Organisation for Animal Health. Viral encephalopa-
thy and retinopathy. In: OIE, editor. Manual of diagnostic tests
for aquatic animals, chapter 2.3.11. Paris: Office International des
Epizooties; 2013.
27. Panzarin V, Fusaro A, Monne I, Cappellozza E, Patarnello P,
Bovo G, Capua I, Holmes EC, Cattoli G. Molecular epidemiology
and evolutionary dynamics of betanodavirus in southern Europe.
Infect Genet Evol. 2012;12:6370.
28. Parameswaran V, Rajesh Kumar S, Ishaq Ahmed VP, Sahul
Hameed AS. A fish nodavirus associated with mass mortality in
hatchery-reared Asian seabass, Lates calcarifer. Aquaculture.
2008;275:3669.
29. Peducasse S, Castic J, Thiery R, Jeffroy J, Le Ven A, Baudin
Laurencin F. Comparative study of viral encephalopathy and
retinopathy in juvenile seabass Dicentrarchus labrax infected in
different ways. Dis Aquat Org. 1999;36:1120.
30. Reed LJ, Muench M. A simple method of estimating fifty per cent
end points. Am J Hyg. 1938;27:4937.
31. Sommerset I, Nerland AH. Complete sequence of RNA1 and
subgenomic RNA3 of Atlantic halibut nodavirus (AHNV). Dis
Aquat Org. 2004;58:11725.
32. Thiery R, Raymond JC, Castric J. Natural outbreak of viral
encephalopathy and retinopathy in juvenile seabass, Dicentrar-
chus labrax: study by nested reverse transcriptase-polymerase
chain reaction. Virus Res. 1999;63:117.
33. Thiery R, Cozien J, de Boisseson C, Kerbart-Boscher S, Nevarez
I. Genomic classification of new betanodavirus isolates by phy-
logenetic analysis of the coat protein gene suggests a low host-
fish species specificity. J Gen Virol. 2004;85:307987.
123