Ligation, Expression, and cloning of EGFP protein.

Introduction

The molecular cloning technology of today began with the discovery of restriction
endonucleases enzymes that cut DNA in specific sites (1). With restriction enzymes,
you can isolate specific DNA sequences to clone and study the function of genes.
Without the discovery of restriction enzymes, our understanding of DNA and our genes
and functions wouldnt nearly be as complete as they are now (1).

Take the protein insulin for example. Insulin before the 1980s was extracted from
pig pancreas and used as a substitute for diabetic humans who cant naturally produce
insulin (5). With recombinant technology, scientists were able to create the human
insulin we use today (3)(5).

Recombinant technology today consists of the same method: the gene of interest
is ligated with a vector, then introduced to a bacterium for transformation, and then
isolated and mass produced (4). The gene we use in our experiment, EGFP, expresses
a green fluorescent glow in organisms. The plasmid vector we use, pET41a (+), allows
the protein to be ligated in it for growth when inserted in bacterium. pET41a (+) has
kanamycin resistance and IPTG that allows for the EGFP to be expressed. The goal of
this experiment is to express the protein and be able to determine recombinant or
nonrecombinant DNA.

Methods

Ligation

We began ligation by creating 5 different ligation mixes for the gel electrophoresis
and transformation of E. coli. All ligations have a total volume of 20 l. For ligation #1,
we mixed 2 l of cut pET41a (+) DNA with 1 l of EGFP insert, 2 l of 10X ligase buffer,
1 l of DNA ligase, and 14 l of sterile dH2O into a microcentrifuge tube. For ligation #2,
we mixed 2 l of cut pET41a (+) DNA with 3 l of EGFP insert, 2 l of 10X ligase buffer,
1 l of DNA ligase, and 12 l of sterile dH2O into a microcentrifuge tube. Then, we made
one positive control and 2 negative controls. For positive control, we mixed 2 l of uncut
pET41a (+)/EGFP recombinant plasmid DNA with 18 l of sterile dH 2O into a
microcentrifuge tube. For negative control #1, we used 20 l of sterile dH 2O. Negative
control #2 contained a mixture of 2 l cut pET41a (+) DNA, 3 l of EGFP insert, 2 l of
10X ligase buffer and 13 l of sterile dH2O.

Ligations 1-5 were placed in the wells of a 40 mL 0.8% agarose gel. To make the
gel, we mixed 0.32g of agarose in 40 mL of 1X TAE buffer to obtain our agarose gel
concentration. 10 l of ligation reactions was pipetted into microcentrifuge tubes with 2
l of track dye. The ligations were run on the gel at 60V for 5 minutes and 110V for 45
minutes. The gel was then stained with 50 mL of GelRed stain in a shaking tray for 20
minutes.

Transformation

We began transformation of E. coli by first obtaining 100 l of competent E. coli

cells. We then pipetted 20 l of E. coli into each of the four microcentrifuge tubes and
added ligations 1-4 into each tube. After heat shocking at 42 C heat block, we added
80 l of Luria Broth into each tube and incubated the tube in a shaking incubator for 45
minutes at 37 C. Ligation #1-4 was plated onto four LB/Kanamycin/IPTG petri dishes.
Ligation #2 was also plated onto another petri dish with no LB/Kanamycin but no IPTG.
Ligation #4 was also plated onto another petri dish which has LB only.

DNA purification

For DNA purification, we used samples from the petri dishes from the previous
week before. We used a recombinant green fluorescent colony from one of the plates, a
white nonrecombinant colony, and an unknown colony from transformation #2. To purify,
we used a Promega Wizard miniprep kit. Before we used the kit, we re-suspended our
samples with 200 l of Cell Resuspension solution after we pelleted the cells. We also
used 200 l of Cell Lysis Solution to lyse our cells and 200 l of neutralization solution
to precipitate our DNA in each of our samples. After using the miniprep kit, we used 50
l of TE buffer to remove the DNA from the minicolumn. We checked the purity of our
plasmid DNA by using a Nanodrop Spectrophotometer.

Digestion of Plasmid DNA

In the digestion of plasmid DNA, we made mixtures of a master mix that

contained 2X buffer and restriction enzymes with our plasmid DNA and water. Each
mixture has a final volume of 20 l. We mixed 11 l of the master mix for single digest
with 4.31 l of our plasmid DNA and 4.69 l of sterile dH 2O for our single digest of
recombinant DNA. For our nonrecombinant DNA single digest, we mixed 11 l of the
master mix for with 4.45 l of plasmid DNA and 4.55 l of sterile dH 2O. For the single
digest of the unknown, we mixed 11 l of master mix with 3.16 l plasmid DNA and 5.84
l sterile dH2O. For the double digest of our recombinant DNA, we mixed 12 l of the
master mix with 4.31 l of our plasmid DNA and 3.69 l of sterile dH 2O.For the double
digest of our nonrecombinant DNA, we mixed 12 l of the master mix with 4.45 l of
plasmid DNA and 3.55 l of sterile dH2O. For the double digest of the unknown, we
mixed 12 l of the master mix with 3.16 l of plasmid DNA and 4.84 l of sterile dH 2O.
For the no digest of the recombinant DNA, we mixed 10 l of the master mix with 4.31
l of the plasmid DNA and 5.69 l of sterile dH 2O. For the no digest of the
nonrecombinant DNA, we mixed 10 l of the master mix with 4.45 l of the plasmid DNA
and 5.55 l of dH2O. For the no digest of the unknown, we mixed 10 l of the master
mix with 3.16 l of the plasmid DNA with 6.84 l of sterile dH 2O. All samples were
incubated in 37 C water bath for 1 hour and stored at -20C.

Polymerase Chain Reaction

In our PCR, we created a master mix of all reagents used for our PCR
experiment. Our reagents were: 10X PCR buffer, 10mM dNTPs, 10 M of p1 primer, 10
M of p2 primer, 5 units/l of Taq polymerase, 25 ng/l of our plasmid DNA preps, and
nuclease free H2O. Our final concentration of each reagent was 1X for PCR buffer, 800
M for dNTPs, 0.5 M for primer p1, 0.5 M for primer p2, 50 ng for plasmid DNA, 2.5
units Taq polymerase, and x l for nuclease free H 2O. The final volume of the mix is 20
l. The master mix is made of 2 l of PCR buffer, 1.6 l of dNTPs, 1 l of p1 primer, 1 l
of p2 primer, 2 l of plasmid DNA, 10 l of Taq polymerase and 2.4 l of nuclease free
H2O. To make enough for 5 tubes, 6x the volume of all reagents was used except for the
plasmid DNA. In the recombinant PCR tube, 18 l of the master mix was mixed with 2 l
of the recombinant plasmid DNA. In the nonrecombinant PCR tube, 18 l of the master
mix was mixed with 2 l of the nonrecombinant plasmid DNA. In the unknown PCR
tube, 18 l of the master mix was mixed with 2 l of the unknown plasmid DNA. The
tubes were then placed into a thermocycler that incubated PCR tubes at 95C for 10
minutes. Then 30 cycles of: 95 C for 1 minute, 56C for 1 minute, 72C for 1.5 minutes.
After the PCR cycled for 30 cycles, the PCR samples were incubated at 72C for 5
minutes. After the 5 minutes, the PCR samples were incubated at 4C to hold and
prevent DNA degradation.

The gel electrophoresis of the restriction digest samples was started by mixing
0.45g of agarose with 50ml of 1X TAE buffer. After the mixture was microwaved, we put
the dissolved agarose into 55 water bath. Then 4 l of 6X track dye was added into all
9 restriction digest samples. 6 l of DNA ladder was used in this experiment. After
loading the wells, the restriction digest samples were run at 60V on the gel for 5
minutes. After the 5 minutes, the restriction digest samples were run at 110V for 45
minutes and stained with 50mL of GelRed stain.

The gel electrophoresis of the PCR products was started by mixing 0.36g of
agarose with 50mL of 1X TAE buffer. After the mixture was microwaved, we put the
dissolved agarose in 55C water bath. 10 l of PCR product was pipetted to new
microcentrifuge tubes and 2 l of 6X track dye was then added to each of the PCR
products. 12 l of track dye was then added to each of the PCR products. PCR samples
were then run on 60V for 5 minutes after loading into the wells of the agarose gels. The
PCR products are then run on 110V for 45 minutes and then stained with 50 mL of
GelRed.
Results

Ligation of EGFP into pET41a(+) vector

Figure 1 Gel result of the ligation of EGFP into pET-41(+)a vector when digested by
NcoI and NotI restriction enzymes. Lanes 1 and 2 were test runs with water. Lane 3
shows a 1:1 molar ratio of pET-41(+)a with EGFP ligation; Lane 4 shows a 1:3 molar
ratio of pET-41(+)a with EGFP ligation; Lane 7 shows a negative control of 1:3 molar
ratio of pET-41(+)a with EGFP with no DNA ligase.

Figure 1 shows bands in different lanes of the gel. In lane 8, there is a DNA ladder
showing 10 different bands, each showing different values of base pairs. Lane 3
displays 3 bands: one at ~750 base pair (blue arrow), one band at ~6000 base pairs
(orange arrow), and one at ~10,000 base pair. Lane 4 displays two light bands: one at
~750 base pairs and one at ~6000 base pairs (black arrow). Lane 7 shows two lighter
and thinner bands: one at ~750 base pairs and one at 6000~ base pairs.

Transformation of E. coli.
Figure 2 Plated transformations of E. coli. 6 petri dishes, each with different
transformations, are shown above. Transformation 1 and 2 are on the bottom left to
right. Transformation 2 (no IPTG) is on the bottom middle left. Transformation 3 and 4
are on the top from left to right respectively. Transformation 4 (no IPTG or K) is on the
upper middle left.

Table 1

Transformation Green White Total Recombinant

s (Recombinant (Nonrecombinant transformatio transformatio
(LB/K/IPTG) ) ) n efficiency n efficiency
1
Tube 15 9
Concentration (ng/l) 3840260/280 2400
2
Recombinant 8 2
58 ng/l 12801.93 320
2 (no iptg)
Nonrecombinant 2 1
56.2 ng/l 3201.94 160
3
Unknown - -
79.1 ng/l - 1.91 -
4 - - - -
4 (no iptg or k) - - - -

Transformation 1 shows successful transformed E.coli colonies with 15 green

recombinant E.coli bacteria showing the EGFP protein. 9 white nonrecombinant
colonies also grew in the petri dishes. The transformation efficiency of transformation 1
shows efficient growth. Transformation 2 shows less success in growing recombinant
E.coli bacteria with 8 green colonies and 2 white colonies. Transformation efficiency in
transformation 2 shows less growth in the dishes. Transformation 2 (no IPTG) shows
even less recombinant E.coli colonies with 2 green recombinant colonies and 1 white
nonrecombinant colonies. The transformation efficiency of transformation 2 (no IPTG)
shows minimal growth of the bacteria.

kDNA purification/ Miniprep of Transformed E. coli DNA

Table 2

Table 2 displays the miniprep of plasmid DNA. In the recombinant tube, recombinant E.
coli that fluoresce in UV lights is placed in the tube. In the nonrecombinant tube, a
colony of E. coli DNA that did not fluoresce in UV light is within the tube. In the unknown
tube, an unknown from the E. coli colony from transformation 2 (no IPTG) (see figure 5)
is added in the tube along. Concentration of plasmid DNA was determined in a
nanodrop spectrophotometer. The 260/280 ratio determines the wavelength DNA
absorbs at 260nm and the wavelength the protein absorbs at 280nm and the purity of
the samples.
Restriction Digest of Plasmid DNA

Figure 2 Gel result of the restriction digest of 9 different samples of plasmid DNA. Lane
2 shows the undigested sample of recombinant plasmid DNA. Lane 3 shows undigested
sample of the unknown. Lane 4 shows the undigested sample of nonrecombinant
plasmid DNA. Lane 5 shows the single digest of recombinant plasmid DNA. Lane 6
shows the single digest of unknown sample. Lane 7 shows the single digest of
nonrecombinant plasmid DNA. Lane 8 shows the double digest of recombinant plasmid
DNA. Lane 9 shows the double digest of the unknown sample. Lane 10 shows the
double digest of nonrecombinant DNA.

The single, double and no digest of plasmid DNA, shown in Figure 3, showed only 2
bands in the electrophoresis gel. Each lane of the gel except the DNA ladder is smeared
(i.e. orange arrow in lane 2) and thus shows no bands. Slight bands can be seen in lane
6 (black arrow) and lane 9 (blue arrow). Both bands show up at ~700 base pairs.

PCR of plasmid DNA

Figure 3 Gel electrophoresis result of the PCR samples made. Lane 2 shows the
positive control containing known recombinant DNA. Lane 3 contains the unknown
sample of DNA. Lane 4 contains the recombinant plasmid DNA. Lane 5 contains the
nonrecombinant DNA. Lane 6 is the negative control of water.

Figure 4 shows the gel electrophoresis of PCR samples. Each lane is a little smeared
except for the DNA ladder. Lane 2 shows a band (black arrow) at ~1100 base pairs.
Lane 4 shows a band also at ~1100 base pairs. Lane 3 shows a faint band at ~6000
base pairs and lane 5 shows the same faint band at ~6000 base pairs.

Online DNA analysis of Recombinant DNA

Caagctacctgaaatgctgaaaatgttcgaagatcgtttatgtcataaaacatatttaaatggtgatcatgtaacccatcctg
acttcatgttgtatgacgctcttgatgttgttttatacatggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaaaa
acgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagcatggcctttgcagggctggcaagc
cacgtttggtggtggcgaccatcctccaaaatcggatggttcaactagtggttctggtcatcaccatcaccatcactccgcgg
gtctggtgccacgcggtagtactgcaattggtatgaaagaaaccgctgctgctaaattcgaacgccagcacatggacagc
ccagatctgggtaccggtggtggctccggtgatgacgacgacaagagtcccatggtgagcaagggcgaggagctgttc
accggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcga
gggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctc
gtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgc
catgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtga
agttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctgggg
cacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaa
cttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcg
acggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcg
cgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaag

The analysis above gave the sequence of our PCR product, which was 1183 base pairs
long. In the restriction enzyme digest experiment I designed, the size of the DNA
fragments after being cut by enzyme 1 in a single digest is 1114 base pairs long. After
being cut by enzyme 2 in a single digest, 713 base pairs remain. After being cut by both
enzymes in a double digest, 395 base pairs remain.
Discussion

Ligation

The ligation of EGFP was a successful ligation based on the result of the gel
electrophoresis done on the ligation samples. In figure 1, lane 3 shows 3 bands that
occur on different locations of the gel. Gel electrophoresis separates DNA fragments
based on their size. Electrical current is applied to the DNA fragments in the well and
smaller, shorter fragments moves faster and further than the bigger and longer
fragments. The lowest band (blue arrow), which appears on around ~700 base pairs,
must be the EGFP insert that was ligated into the pET41a (+) vector because EGFP
cDNA is 713 base pair long and thus, was moved along further throughout the gel. The
second band (orange arrow) is around 6000 base pairs long, which must be the pET41a
(+) vector since the pET41a (+) vector is 5933 base pairs long. The top band in lane 3,
however, is inexplicable. The top band is over the 10,000 base pair mark on the DNA
ladder and thus cannot be something from our ligation experiment since we have
nothing that should be over 10,000 base pairs long. In lane 4, we see similar results
because ligation #2 is the same except with different molar ratios of the vector and
EGFP. There is 3 times the EGFP in ligation #2 than in ligation #1. This displays a
difference in intensity of the bands. In lane 3, the EGFP band at 713 base pair is less
intense as the one in lane 4 because there is less DNA in the sample. In lane 5, there is
no bands because the plasmid was uncut and there was no DNA ligase or ligase buffer.
In lane 6, there is only sterile dH2O that would not show up in the gel. In lane 7, there is
two bands that shows in the same base pairs as lane 3 and 4 but shows less intensity
since there is a lack of DNA ligase in the negative control.

Transformation

The transformation of pET41 (+) with EGFP cDNA insert into E. coli was a
success with EGFP showing in colonies and good transformation efficiency.
Transformation 1 shows many colonies clearly grown with EGFP expressed in many
colonies of E. coli. A ratio of 15:9 recombinant to nonrecombinant colonies shows a
decent expression of EGFP. Transformation 2 shows a 8:2 ratio of recombinant to
enonrecombinant and shows better expression of EGFP than in Transformation 1. This
is because the concentration of EGFP in Transformation 2 is higher than the EGFP
concentration in Transformation 1. In Transformation 2 (no IPTG), there is less colonies
but oddly enough, there is recombinant colonies. When IPTG is not present, there
should be no EGFP expressed. Expression of EGFP could come from plating errors
where we might not have completely cleaned the plating bar and leftover IPTG on the
bar helped express minimal colonies.

DNA purification/miniprep of transformed E. coli DNA

The DNA purification was a success as told by the 260/280 ratio we got from the
nanodrop spectrophotometer. 260nm is the wavelength that DNA absorbs and 280nm
is the wavelength proteins absorbs. The purity of our DNA should land in the range of
1.8-2.0. The purity of our sample got 1.93 for our recombinant, 1.94 for our
nonrecombinant, and 1.91 for our unknown samples, showing great purity in each of our
samples. The concentration of our samples was within the range of purity as well. The
fluctuation of our concentration is due to the amount of bacteria in our sample.

Restriction digest of Plasmid DNA

The restriction digest of our plasmid DNA was unsuccessful due to the smear of
DNA we see in the result of our gel electrophoresis. In figure 3, it is clear that in each
lane of our restriction digestion, that there is a smear of our DNA. Lane 2-10 all shows
smearing of DNA with fluctuation in intensity of the smears. However, in lanes 6 and 9,
there are light bands at ~750 base pairs. What this could be is the EGFP insert but
there is no way to be completely certain. The smears in our gel results are because our
DNA degraded. There is no way to be completely certain why the DNA degraded
because there are many reasons but one hypothesis is that nucleases somehow got
into our samples and degraded our DNA (2). There are nucleases in our skins that
might have gone onto the pipette we used for transferring our restriction digest or it
could be from temperature related causes such as leaving the samples in room
temperature or freezing/thawing the DNA samples (2).
PCR of plasmid DNA

PCR of our plasmid DNA was successful as shown by the gel results. In figure 4,
lane 2 displayed the positive control of the known recombinant plasmid DNA that helps
us determine if our PCR product was recombinant or not. The band (black arrow) at
above 1000 base pairs (about 1183 base pairs to be exact) shows the recombinant
product and in lane 4, which our recombinant plasmid DNA was inserted, there is a
band at the same spot (blue arrow). Lane 3 (our unknown) (orange arrow) and lane 5
(our nonrecombinant) (yellow arrow) showed a faint band at ~6000 base pairs, which is
the range of the plasmid vector. This confirms that our unknown is in fact
nonrecombinant and that the EGFP was not transformed within the unknown bacterial
sample.

Online DNA analysis

The online DNA analysis of our PCR product gave us the sequence of the product,
which is 1183 base pairs long.
1. Biolabs, N. E. (n.d.). Foundations of Molecular Cloning - Past, Present and Future.
Retrieved February 15, 2017, from https://www.neb.com/tools-and-resources/feature-
articles/foundations-of-molecular-cloning-past-present-and-future
2. Your DNA may be degraded. (n.d.). Retrieved February 15, 2017, from
https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/qpcr-
education/real-time-pcr-troubleshooting-tool/snp-genotyping-troubleshooting/trailing-
clusters/dna-may-be-degraded.html
3. Making Insulin. (n.d.). Retrieved February 15, 2017, from
http://www.diabetesforecast.org/2013/jul/making-insulin.html?referrer=https%3A%2F
%2Fwww.google.com%2F
4. The application of DNA recombinant technology to the analysis of the human genome
and genetic disease. (n.d.). Retrieved February 15, 2017, from
http://link.springer.com/article/10.1007/BF00282814
5. Vajo, Z., Fawcett, J., & Duckworth, W. C. (2001, October 01). Recombinant DNA
Technology in the Treatment of Diabetes: Insulin Analogs. Retrieved February 15,
2017, from https://academic.oup.com/edrv/article-lookup/doi/10.1210/edrv.22.5.0442