UNIVERSIDAD DE LA FRONTERA

FACULTAD DE CIENCIAS AGROPECUARIAS Y FORESTALES

Identificacin de genes de expresin diferencial en

cncer pancretico mediante hibridacin
sustractiva por supresin/microarray y su
evaluacin como potenciales biomarcadores

Tesis presentada a la Direccin Acadmica

de Postgrado de la Universidad de La
Frontera para obtener el grado de Doctor en
Ciencias mencin Biologa Celular y
Molecular Aplicada.

JAIME ANDRES ESPINOZA RUIZ

GUIA: DR. MANUEL GIDEKEL

CO GUIA: OSVALDO PODHAJC :K RECiBa DO
Programa Form<:~cln Capital Humano Avanzado

TEMUCO-CH 1LE
2ODIC 2012
2012
lflgr~s Nfl;,..............!:;_.;?._,J!.;~.....
OiJ&tfn~ '"'"""''''""lt''~tnu"""''"'"n
-
- -- -
 UNIVERSIDAD DE LA FRONTERA
DE CIENCIAS AGROPECUARIAS Y FOREST . ~~~"'\
Q~.(:.C\(;)N -\
. ,-:.; . AV.,;,).lSM't.:.;A r;. i
~ N' :;:1
. :; ?O>:rr~iO j
INFORME DE APROBACIN .. .. - '
/l
.:~.-.:-~
\:
TESIS DE DOCTORADO

Se informa a la Direccin Acadmica de Postgrado de la Universidad de La Frontera

que la Tesis de Doctorado presentada por la candidata

JAIME ANDRES ESPINOZA RUIZ

ha sido aprobada por la Comisin Informante de Tesis' como requisito para el Grado de
Doctor en Ciencias mencin Biologa Celular y Molecular Aplicada, en el examen de
::f .... de ... ~~~~~ .......... de 2012.
defensa de Tesis rendido el ... .

Gua de Tesis

Dr. Manuel Gidekel

Ca-Gua

Dr. Osvaldo Podhajcer

Evaluador Interno

Dra. Ana Gutirrez Moraga

Evaluador Externo

Dr. Guillermo Mazzolini

Dr. lvn Roa . /.

COMISION EXAMINADORA

PROFESOR GUIA

Dr. Manuel Gidekel

Vice Rectora Investigacin y postgrado.
Universidad de La Frontera, Temuco-Chile

PROFESOR CO-GUIA

Dr. Osvaldo Podhajcer.

Laboratorio de Terapia Molecular y Celular,
Fundacin Instituto Leloir. Buenos Aires, Argentina.

PROFESOR EVALUADOR INTERNO

Dra. Ana Gutirrez Moraga.

Departamento de produccin agropecuaria. Facultad de Ciencias Agropecuarias y
Forestales. Universidad de La Frontera, Temuco- Chile

PROFESORES EVALUADORES EXTERNOS

Dr. Guillermo Mazzolini

Laboratorio de Terapia Gnica
Facultad de Medicina, Universidad Austral. Buenos Aires-Argentina

Dr.lvn Roa
Servicio de Anatoma Patolgica de la Clnica Alemana
Santiago-Chile
Esta tesis fue realizada en el Laboratorio CTI Salud - VentureL@b. Escuela de
Negocios. Universidad Adolfo lbez. Santiago - Chile y cont con el financiamiento
de:

1. Consorcio de Tecnologa e Innovacin para la Salud S.A. CONICYT PIA-06

2. Beca Doctorado en Chile CONICYT N 21080240.
3. Beca CHILE Pasanta Doctoral en el Extranjero. N 75110023.
4. Beca de Apoyo de Tesis Doctoral CONICYT N 24100124.
5. Beca de Exencin de Arancel UFRO 2008-2012.
 INDICE DE CONTENIDOS

IN DICE DE CONTENIDOS ............................................................................................. O

AGRADECIMIENTOS ..................................................................................................... 3
PRODUCTIVIDAD CIENTFICA ..................................................................................... 5
RESUMEN ....................................................................................................................... S
ABSTRACT ................................................................................................................... 1O
1.1NTRODUCCIN ....................................................................................................... 12
1.1 El pncreas ...................................................................................................... 12
1.1.1 Ubicacin, morfologa y tipos celulares del pncreas ................................... 12
1.1.2 Antecedentes epidemiolgicos ..................................................................... 14
1.1.3 Diagnstico y tratamiento ............................................................................. 15
1.1.4 Patofisiologa ................................................................................................ 16
1.1.5 Alteraciones genticas del adenocarcinoma ductal pancretico .................. 18
1.2 Transcriptmica y Cncer ................................................................................ 22
1.2.1 El transcriptoma ............................................................................................ 22
1.2.2 El transcriptoma del cncer .......................................................................... 24
1.2.3 El transcriptoma del adenocarcinoma ductal pancretico ................................ 25
1.3 Microarray de expresin gnica ........................................................................... 26
1.4 Hibridacin sustractiva por supresin .............................................................. 28
2. PRESENTACION DEL PROBLEMA ..................................................................... 33
2.1 Justificacin ......................................................................................................... 33
2.2 Hiptesis .............................................................................................................. 33
2.3 Objetivo general de la tesis ................................................................................. 34
2.4 Objetivos especficos ........................................................................................... 34
3. MATERIAL Y MTODOS ......................................................................................... 35
3.1. Muestras clnicas ................................................................................................ 35
3.2 Extraccin de RNA ............................................................................................. 35
3.2.1 Extraccin de RNA de tejidos tumorales y no neoplsicos ........................... 35
3.2.2 Determinacin de la integridad del RNA. ......................................................... 36
3.3 Hibridacin supresiva sustractiva (SSH) ............................................................ 37
3.3.1 Sntesis de cONA mediante tecnologa SMART .............................................. 37
 3.3.2 Sustraccin gnica mediante PCR-Select ....................................................... 41
3.4 Amplificacin y marcaje de las muestras ........................................................... 43
3.5 Hibridacin de los microarrays ........................................................................... 47
3.6 Extraccin de la fluorescencia y anlisis bioinformtico .................................... .48
3.7 Sntesis de cONA y PCR cuantitativo en tiempo real ......................................... 50
3.8 lnmunohistoqumica ........................................................................................ 53
3.8.1. Anticuerpos ..................................................................................................... 53
4. RESULTADOS .......................................................................................................... 57
4.1 Diseo experimental ............................................................................................ 57
4.2 Estrategia Directa ................................................................................................ 59
4.3 Estrategia SSH .................................................................................................... 59
4.3.1 Sntesis de cONA mediante tecnologa Super SMART ............................... 62
4.3.2 Ligacin de adaptadores .............................................................................. 62
4.3.3 Sustraccin gnica por PCR-Se/ect .............................................................. 64
4.4 Integracin de los perfiles de expresin gnica analizados mediante microarray
de las estrategias Directa y SSH ............................................................................... 67
4.4.1 Secuencias de expresin diferencial entre tejidos tumorales y no neoplsicos,
identificados mediante estrategia Directa y SSH ....................................................... 67
4.4.2 Anlisis de enriquecimiento de ontologa de genes ......................................... 70
4.4.3 Ambas estrategias identifican genes que codifican para protenas de secrecin.

75
4.5 Validacin de los genes diferenciales obtenidos por la estrategia directa y SSH
por PCR en tiempo real. ............................................................................................ 81
4.6 Validacin de genes diferenciales mediante tincin inmunohistoqumica ........... 83
4.6.1. Genes candidatos de la estrategia Directa ...................................................... 83
4.6.1.1. PMEPA 1 prostate transmembrane protein, androgen induced 1 ................. 83
4.6.1.2 BHLHE40 basic helix-loop-helix fa mi/y, member e40 .................................... 86
4.6.1.3. CALU calumenin ........................................................................................... 88
4.6.2. Genes identificados en la estrategia Directa contrastados con la base de datos
del Human Atlas Protein . ........................................................................................... 91
 4.6.3. Genes candidatos de la estrategia SSH .......................................................... 93
4.6.3.1. PLEKHM1 pleckstrin homo/ogy domain containing, family M (with RUN
doma in) member 1...... ............................................................................................... 93
4.6.3.2. WNT9A wingless-type MMTV integration site family, member 9A ............... 99
4.6.3.3. MMP? matrix metallopeptidase 7 (matrilysin, uterine) y STAT1 signa/
transducer and activator of transcription 1, 91 kDa .................................................. 102
4.6.3.4. DPYSL4 dihydropyrimidinase-like 4 ........................................................... 104
4.6.4. Genes identificados en la estrategia SSH contrastados con la base de datos
del Human Atlas Protein . ......................................................................................... 105
5. DISCUSION ............................................................................................................. 107
5.1 La estrategia Directa permite la identificacin de transcritos relacionados con la
reaccin desmoplstica del ADP ............................................................................. 108
5.2 La estrategia SSH permite enriquecer grupos de genes distintos de los
identificados mediante la estrategia Directa ............................................................ 111
5.3 Ambas estrategias permiten identificar genes que codifican para protenas de
secrecin .................................................................................................................. 115
5.4 Validacin de genes candidatos de la estrategia Directa .................................. 117
5.5 Validacin de genes candidatos de la estrategia SSH ...................................... 120
5.6 Realidad actual del diagnstico de adenocarcinoma ductal pancretico .......... 122
6. CONCLUSIONES GENERALES ........................................................................... 127
7. BIBLIOGRAFA....................................................................................................... 129
8. ANEXOS ................................................................................................................ 148
PATENTE PROVISORIA 2010 ................................................................................ 150
PATENTE PROVISORIA 2012 ................................................................................ 154
ARTICULO ENVIADO 1........................................................................................... 156
ARTCULO ENVIADO 2 ........................................................................................... 224
ARTCULO PUBLICADO (Ce-autora) ..................................................................... 263
 "El hecho de ver un tumor pequeo y extraerlo del cuerpo no nos garantiza que
estemos libres del cncer, algo que todava nos cuesta creer.
En definitiva, una mamografa o un frotis de Pap no son un retrato del cncer en su
infancia. Como cualquier retrato, lo hacemos con la esperanza de que capte algo
esencial del sujeto: su psique, su ser interno, su futuro, su comportamiento.
Todas las fotografas son fieles -se complaca en decir el artista Richard Avedon-,
pero ninguna es la verdad".

El emperador de todos los males: Una biografa del cncer

Siddhartha Mukherjee [1]

" ... los genes son como las teclas de un piano;

Aunque son esenciales, es el contexto el que hace la msica"
Nelson C.M. & Bissell M.J. [2]

2
AGRADECIMIENTOS

Quiero agradecer a mi padre, madre y hermana, quienes me dieron en primer

lugar la oportunidad de escoger este camino y me han apoyado constantemente
durante este proceso. Un agradecimiento no es suficiente para demostrar el amor y
admiracin que tengo por ellos.

Al Dr. Manuel Gidekel y la Dra. Ana Gutierrez por darme la oportunidad de

desarrollar mi proyecto en su laboratorio y apoyarme en el trmino de la tesis.

A Carolina Bizama, Felipe Benavente y Edgardo Salvatierra, mis ms cercanos

compaeros de laboratorio con quienes compart las alegras del trabajo en el
laboratorio y me apoyaron cuando lo necesit. Gracias por compartir sus experiencias
conmigo y brindarme su amistad.

A mis compaeros de laboratorio de hoy y de siempre: Jennifer Osorio, Graciela

Berros, Gustavo Cabrera, Mnica Ramrez, Claudia Caldern, Ismael Riquelme,
Daniel Weinecker, Claudia Caldern, Yamil Bernardo, Alejandra Sandoval, Helga
Weber, Eduardo Sagredo y Francisco Gamn, por todos los gratos momentos, el apoyo
brindado y sus contribuciones para implementar, ejecutar, interpretar y discutir los
resultados obtenidos en este proyecto.

A los integrantes del laboratorio de Proteomics of Cancer del Danish Cancer

Society, Copenhagen, Dinamarca. A Jos Moreira, Sofia Svensson, Anni Handesten y
Lene Brogaard por su apoyo, entusiamo y constante preocupacin por mi. Quiero
agradecer en especial a Julio Celis y Teresa Cabezn, por recibirme en su laboratorio,
apoyarme y compartir sus conocimientos conmigo. Me permitieron recordar las
razones del por que escog este camino tanto tiempo atrs.

Al Dr. Osvaldo Podhajcer, Dr. Guillermo Mazzolini, Dr. Elmer Fernndez y Dr.
lvn Roa por sus valiosos aportes al desarrollo de este proyecto.
3
 A Soledad Lantadilla, Gabriela Bascuan, Tamara Snchez del Servicio de
Anatoma Patolgica de Clnica Alemana de Santiago, por la buena voluntad y la
enorme ayuda que me dieron durante este proceso.

A Jorge Dinamarca y Nicols Saavedra, quienes tuvieron la voluntad y paciencia

de enviarme decenas (cientos quizs) de papers cientficos que les solicit durante los
ltimos aos.

4
PRODUCTIVIDAD CIENTFICA

La presente tesis de Doctor origin hasta la fecha la siguiente productividad

cientfica (ver anexos):

Propiedad intelectual
GIDEKEL Manuel, PODHAJCER Osvaldo, ROA lvn, BIZAMA Carolina,
BENAVENTE Felipe, ESPINOZA Jaime, SALVATIERRA Edgardo, FERNANDEZ
Elmer, GUTIERREZ Ana, ROA Juan Carlos, MAZZOLINI Guillermo: Novel
genes and uses thereof, expression profile of colon, gastric and pancreatic
cancer. Patent USPTO non-provisional and PCT. Nmero de presentacin
61/404,141, fecha 09/28/201 O.

GIDEKEL Manuel, ESPINOZA Jaime, CABEZON Teresa, MAZZOLINI Guillermo.

Tumor biomarkers for pancreatic cancer. Patent USPTO provisional. Filling
number 61/634832.

Publicaciones

JA Espinoza, C Bizama, F Benavente, EA Fernndez, E Salvatierra, HA

Gutierrez, 1 Roa, G Mazzolini, O Podhajcer, M Gidekel. Low-abundance
transcriptome of pancreatic ductal adenocarcinoma as a source of
potential molecular markers. Artculo sometido a Molecular Oncology.

C Bizama, F Benavente, JA Espinoza, E Salvatierra, HA Gutierrez, EA

Fernndez, EA Sagredo, 1 Roa, G Mazzolini, M Gidekel & OL Podhjcer. Low
abundance trancriptome analyses identifies novel markers, specific
intracelular pathways and target genes in advanced human
gastrointestinal cancer. Artculo sometido a Cancer Research.

Otras publicaciones generadas durante el perodo 2008-2012

M Malvicini, M lngolotti, F Piccioni, M Garca, J Bayo, C Atorrasagasti, L

Alaniz, J Aquino, JA Espinoza, M Gidekel, OG Scharovsky, P Matar & G
Mazzolini. Reversa! of gastrointestinal carcinoma-induced
immunosuppression and induction of antitumoural immunity by a
combination of cyclophosphamide and gene transfer of IL-12. Molecular
Oncology 2011, 5(3):242-55.
5
 JA Espinoza, U Paasch & JV Villegas. Mitochondrial membrane potential
disruption pattern in human sperm. Human Reproduction 2009 24(9):2079-
2085.

JA Espinoza, MA Schulz, R Snchez & JV Villegas. lntegrity of Mitochondrial

Membrane Potential Reflects Human Sperm Quality. Andrologia 2009,41:51-
54.

P Navarrete, JA Espinoza, J Parodi, JG lvarez & R Snchez. Protective effect

of Fallopian tubal fluid against activated leukocyte-induced sperm DNA
fragmentation: preliminary results. Andrologia 2009, 41 (3): 196-198.

Cursos

Functional Genomics and Systems Bio/ogy. Wellcome Trust Genome

Campus, Hinxton, Cambridge, UK. 16-25 Junio 201 O.

FEBS Advanced Lecture Course on Translational Cancer Research. Hotel

Porto Bay Falesia, Algarve, Portugal September 27 - October 4, 2011.

Pasantas de investigacin

Laboratory of Cancer Proteomic, Danish Cancer Society Research Center,

Copenhagen, Denmark. Agosto-Diciembre 2011. Investigador responsable: Dr.
Julio Celis.

Presentaciones en congresos y cursos

Bizama C., Benavente F., Espinoza JA., Salvatierra E., Fernndez E., Sagredo
E. A., Roa 1., Mazzolini G., Gidekel M., Podhajcer OL. Transcriptome analyses
identifies specific intracellular pathways and target genes in gastric
cancer. CTI-Salud, Universidad de La Frontera. XXXV Reunin Anual Sociedad
de Bioqumica y Biologa Molecular de Chile. 2-5 de Octubre 2012. Puerto
Varas. Premio mencin honrosa en categora mejor trabajo de incorporacin.

Espinoza JA, Salvatierra E, Freeman T, Bizama C & Gidekel M. Network

analysis reveals a strong desmoplastic signature of pancreatic ductal
adenocarcinoma. FEBS Advanced Course on Translational Cancer Research.
Algarve, Portugal. September 27- October 4, 2011.
6
 Sagredo E, Espinoza JA, Brito C, Bizama C, Cabrera G y Gutirrez-Moraga A.
Transcriptomic network analysis of Arabidopsis thaliana under UVB-stress
particular transcriptions factors involved in the response to stress. VI
Encuentro de Estudiantes de Ingeniera en Biotecnologa (ENEIB). Universidad
Nacional Andrs Bello (UNAB) Via del Mar, Chile. 23 a 25 de Agosto de 2011.

Sagredo E, Espinoza JA, Brito C, Bizama C, Cabrera G, Gutirrez-Moraga A y

Gidekel M. Transcriptomic network analysis of Arabidopsis thaliana reveals
specific gene regulation under cold, salt and UV-B stress conditions.
XXXIV Reunin Anual Sociedad de Bioqumica y Biologa Molecular de Chile,
Valdivia, Chile. 27 al 30 de Septiembre de 2011.

Sagredo E, Espinoza JA, Brito C, Bizama C, Cabrera G, Gutirrez-Moraga A y

Gidekel M. Transcriptomic network analysis of Arabidopsis thaliana under
UVB-stress reveals time-dependent changes of biological processes
involved in the adaptation to stress. Workshop de Genmica Vegetal y
Biologa de Sistemas. Santiago, Chile. 1O y 11 de Noviembre de 2011

7
RESUMEN

El adenocarcinoma ductal pancretico (ADP) representa el decimotercer

cncer ms frecuente a nivel mundial y es la causa de muerte de alrededor de
260,000 personas cada ao. Esta enfermedad es ms comn en la tercera edad y
solo alrededor del 20% de los pacientes presentan tumores localizados y
potencialmente curables mediante la extraccin quirrgica del rgano. La tasa de
sobrevivencia en pacientes a los 5 aos es menor al 5%, lo que convierte al ADP
en uno de los tumores slidos ms mortales. El psimo pronstico del ADP est
directamente vinculado a la falta de metodologas de diagnstico temprano y de
tratamientos antineoplsicos efectivos. La sobrevida de los pacientes mejora
sustancialmente si el tumor es diagnosticado en etapas tempranas de la
enfermedad. Recientemente se demostr que la progresin del ADP, desde la
generacin de la clula tumoral de origen hasta la aparicin del primer clan
metastsico, ocurre en un tiempo promedio de 15 aos, permitiendo una hipottica
ventana de tiempo para el diagnstico temprano de la enfermedad. En este
contexto, es de importancia identificar biomarcadores moleculares que permitan
detectar la lesin tumoral y cuya implementacin pueda ser transferible al uso
clnico rutinario. En este estudio empleamos la metodologa de hibridacin
sustractiva por supresin (SSH, de su sigla en ingls) acoplada a microarray para
estudiar el transcriptoma de baja abundancia de tumores de adenocarcinoma
ductal pancretico, con el objetivo de identificar molculas que se expresen
diferencialmente con respecto de tejidos no neoplsicos y que posean
especificidad por el tejido tumoral. La estrategia SSH permite enriquecer diferentes
genes a los identificados mediante la estrategia directa (microarray convencional),
permitiendo una reduccin de genes de alta abundancia relacionados con matrix
extracelular y favoreciendo la identificacin de genes de funcin
predominantemente intracelular. Por otra parte, la estrategia SSH enriqueci
genes relacionados con la va de sealizacin de Wnt asociada a {3-catenin.
Identificamos incremento de los niveles del transcrito y la protena de los genes
WNT9A y PLEKHM1 en tejidos de ADP. La protena WNT9A se expresa a bajos
niveles en las clulas ductales de tejidos pancreticos no neoplsicos, sin
embargo, mayores niveles de expresin se observaron en tejidos tumorales de
ADP. La protena codificada por el gen PLEKHM1 se expresa de forma exclusiva
en clulas tumorales y no en otros tipos celulares del pncreas. Ambas protenas
se expresan de forma diferencial y presentan gran especificidad por el tejido
tumoral. En conclusin, con esta investigacin hemos identificado nuevos
potenciales biomarcadores de cncer pancretico a partir del transcriptoma de
baja abundancia del ADP, analizado mediante hibridacin sustractiva por
supresin. Nuevos marcadores de alta especificidad pueden contribuir a
desarrollar nuevas metodologas de diagnstico molecular para el cncer
pancretico.
ABSTRACT

Pancreatic ductal adenocarcinoma (PDA) is the thirteenth most common cancer

worldwide and is the cause of death of about 260,000 people each year. This
disease is more common in old age and only about 20% of patients have tumors
potentially curable by surgical removal of the organ. The survival rate in patients at
5 years is less than 5%, making the ADP in one of the deadliest salid tumors. The
poor prognosis of ADP is directly linked to the lack of methods for early diagnosis
and effective cancer treatments. The patient survival improves substantially if the
tumor is diagnosed in early stages of the disease. Recently it was demonstrated
that the progression of ADP from the generation of the tumor cell of origin to the
first appearance of metastatic clone, occurs in an average of 15 years, allowing a
hypothetical time window for early diagnosis of the disease. In this context it is
important to identify molecular biomarkers to detect the tumor and whose
implementation can be transferable to routine clinical use. In this study we used a
suppressive subtractive hybridization (SSH) coupled to microarray to study the low
abundance transcriptome of pancreatic ductal adenocarcinoma tumors, with the
aim of identify molecules that are differentially expressed with respect to non-
neoplastic tissues. The SSH strategy enrich different genes to those identified by
the direct strategy (conventional microarray), allowing a reduction of genes of high
abundance extracellular matrix-related and favoring the identification of genes
predominantly intracellular function. Moreover, the strategy SSH enriched genes
related to Wnt signaling pathway associated with ~-catenin, a signaling pathway of
increasing importance in cancer. We identified higher transcript and protein levels
of PLEKHM1 and WNT9A in ADP tissues. WNT9A protein is expressed at low
levels in the pancreatic ductal cells of non-neoplastic tissue, however, higher levels
of expression were observed in tumor tissues ADP. The protein encoded by
PLEKHM1 is expressed exclusively in tumor cells and not in other cell types of the
pncreas. Both proteins are expressed differentially and are highly specific for
tumoral tissue. In conclusion, we found new potential biomarkers of pancreatic
cancer from the transcriptome of low abundance of ADP, analyzed by suppression
subtractive hybridization. Highly specific markers can help to develop new
molecular diagnostic methods for pancreatic cancer.
1. INTRODUCCIN

1.1 El pncreas

1.1.1 Ubicacin, morfologa y tipos celulares del pncreas

El pncreas es un rgano con funciones endocrinas y exocrinas, que se ubica

en la regin retroperitoneal de la parte superior de la cavidad abdominal, junto al bazo
y detrs del hgado y el estomgo (Figura 1A y 1B). En humanos, el rgano posee
distintivamente una cabeza, cuerpo y cola, con la cabeza del pncreas contactando
directamente la regional duodenal del intestino. Las clulas del pncreas estn
organizadas en distintos lbulos compuestos principalmente por clulas acinares, las
cuales se ordenan estructuralmente en acinos (Figura 1C). Las clulas acinares
representan el 90-95% de la masa total del pncreas y son las encargadas de producir
las enzimas digestivas que son vertidas en el duodeno para la digestin de los
alimentos. Entre las enzimas que producen se encuentra la carboxipeptidasa 1(Figura
1H), ribonucleasa A (Figura 11), proteasa, elastasa, fosfolipasa, amilasa y tri psi na. Otro
tipo celular del acino es la clula centroacinar progenitora que expresa SOX9, protena
reguladora de la transcripcin (Figura 1J). Las enzimas son transportadas a travs de
los duetos hacia el duodeno. Los duetos estn compuestos de clulas de origen
epitelial, que expresan, entre otros marcadores, queratina 19 (Figura 1K). El
componente endocrino del pncreas lo constituyen los islotes de Langerhans donde se
encuentran las clulas alfa (productoras de la hormona glucagn) (Figura 1D), las
clulas beta (productoras de la hormona insulina) (Figura 1E) y las clulas delta
(productoras de la hormona somatostatina) (Figura 1F). Otro tipo celular caracterizado
recientemente es la clula estelar pancretica [3], la cual reside entre los acinos
pancreticos normales, extendiendo proyecciones celulares. Se caracteriza por
expresar marcadores moleculares asociados a fibroblastos y clulas de musculatura
lisa, como la actina de msculo liso (Figura 1G). Otros tipo celulares productores de
hormonas son las denominadas clulas PP (PP ce//), que producen el polipptido
pancretico y las clulas psilon, que producen la hormona grelina.

12
 A Vista posterior B Vista anterior

Cola

Cuerpo

Islote de
...-~-t--:
Langerhans

;.; . .___--+-- Acinos

. ':...
<, ,

Dueto

Islotes de Langerhans Clulas estelares

Clulas Delta ( Ste/late ce/ls)
...... '
~. .... f ...
\.'.,.

..:-,-"'-
. . ~. .
.. .
. . \1:
~
~.
.
'

~; t
.
,.
~
\
.

,
J/.'
,..: ._r.."', _. r
..... ;, .. ~,"'

Glucagn Insulina Somatostatina Actina de msculo liso

Clulas acinares

Carboxipeptidasa A 1 Ribonucleasa, RNasaA SRY (sex determining Keratina 19

familia, 1 region Y)-box 9

Figura 1. Ubicacin, morfologa y tipos celulares del pncreas. A) Vista posterior y

B) Vista anterior de la ubicacin retroperiteoneal del pncreas, oculto tras el hgado y
el estomgo y posicionado al lado del bazo. El dueto biliar atraviesa en pncreas en su
camino al duodeno. C) Los tres principales compartimentos del pncreas: los acinos
productores de enzimas digestivas, los duetos que transportan las enzimas hacia el
duodeno y los islotes de Langerhans, componente endocrino del pncreas. D)
13
Tinciones inmunohistoqumicas de cortes histolgicos de tejidos pancreticos normales
marcados con diferentes anticuerpos primarios dirigidos contra protena de especficas
de tipo celular. Imgenes de figura 1A y 18 fueron obtenidas del recurso online open-
access Science Photo Library (http://www.sciencephoto.com/). Las imgenes de las
figuras 1D-K fueron obtenidas desde el Human Atlas Protein [4] respetando su poltica
de uso de imgenes (http://www.proteinatlas.org/about/datausage).

1.1.2 Antecedentes epidemiolgicos

El adenocarcinoma ductal pancretico (ADP) es la neoplasia ms comn del

pncreas, constituyendo cerca del 85% de todos los tumores de este rgano. Esta
neoplasia representa el decimotercer cncer ms frecuente del mundo, con
aproximadamente 232,000 nuevos casos diagnosticados anualmente. La tasa de
sobrevivencia a los 5 aos oscila entre el 3 y 5%, la ms baja dentro de los cnceres
importantes [5]. En Chile, el ADP posee el ndice de mortalidad ms elevado de todas
las neoplasias, donde prcticamente el 99% de los pacientes fallecen al corto o
mediano plazo [6]. En Estados Unidos, el ADP constituye la cuarta causa de muerte
por neoplasias, con una cifra estimada para el ao 2008 de 37,000 nuevos casos y
ms de 34,000 muertes [7]. La mortalidad es dos a tres veces superior en pases
desarrollados en comparacin con pases menos desarrolldos [8]. Las razones para la
baja sobrevivencia del ADP incluyen la tpica naturaleza agresiva de este tipo de
tumores, el diagnstico tardo, la baja tasa de reseccin quirrgica y la falta de terapias
efectivas [5]. El ADP es predominantemente una enfermedad de la tercera edad,
siendo los 73 aos la mediana al momento del diagnstico y rara vez se presenta
antes de los 40 aos. El tabaquismo es el principal factor de riesgo modificable, donde
se estima que al menos uno de cada cuatro casos es producido por la adiccin al
tabaco. Otros factores de riesgo establecidos para esta neoplasia incluyen dietas ricas
en carnes y grasas, bajos niveles de folato srico, diabetes mellitus crnica y
pancreatitis crnica [9]. El ADP es responsable de una cantidad sustancial de
carcinomas con tumor primario desconocido debido a que con frecuencia se encuentra
ampliamente diseminado al momento del diagnstico y el sitio primario de origen no es
detectado a menos que el estudio sea cuidadoso [1 0]. Debido a su patrn infiltrativo y

14
diseminacin temprana, rara vez el tumor primario forma una lesin compacta de ms
de 5 cm, contribuyendo a que la opcin de extraer quirrgicamente el rgano tan solo
pueda ser considerada en menos del 20% de los casos [11]. El ADP produce una
masa tumoral firme y altamente esclertica. Los bordes del tumor suelen estar mal
definidos y con largas extensiones de carcinoma ms all de la masa tumoral principal.
A nivel microscpico, el tejido tumoral se compone de un epitelio neoplsico infiltrante
de formas glandulares con una intensa reaccin desmoplstica. La invasin vascular y
perineural se encuentran presentes en la mayora de los cnceres extrados
quirrgicamente y son muy comunes las metstasis a los ganglios linfticos regionales
y al hgado [9].

1.1.3 Diagnstico y tratamiento

Al momento de la presentacin de la enfermedad, los pacientes frecuentemente

sufren de dolores abdominales profundos y difusos, que se localizan ampliamente
alrededor del rea del tumor. La mayora de los pacientes manifiestan sntomas
sistmicos como astenia (sensacin de fatiga), anorexia (falta de apetito) y prdida de
peso. Otras manifestaciones menos frecuentes abarcan trombosis venosas profundas
y superficiales, paniculitis (inflamacin del tejido adiposo subcutneo), alteracin de las
funciones hepticas, obstruccin de la salida gstrica, aumento de la circunferencia
abdominal y depresin [12]. Ms del 40% de los pacientes con cncer pancretico
asisten tres o ms veces a la consulta mdica antes de ser diagnosticados, situacin
que solo es superada por el mieloma mltiple con ms del 50% de los pacientes [13].
La presencia de sntomas inespecficos y la carencia de un sistema de screening
sensible y especfico para esta enfermedad, contribuyen enormemente a la ineficacia
del diagnstico del cncer pancretico, que se ve reflejada con el alto nmero de
visitas al mdico que deben realizar los pacientes antes de ser diagnosticado
correctamente.
La evaluacin de un paciente se centra en el diagnstico y la estadificacin de la
enfermedad, as como en la evaluacin de la resecabilidad y la paliacin de los

15
sntomas. La tomografa computarizada helicoidal multicorte junto con la administracin
intravenosa de material de contraste es el procedimiento de eleccin para la .
evaluacin inicial. La molcula CA 19-9 es el nico biomarcador que posee una utilidad
clnica demostrada, siendo empleado para monitorear la terapia y la deteccin
temprana de recurrencia de la enfermedad despus del tratamiento, sin embargo,
posee escasa utilidad como metodologa de diagnstico temprano de lesiones
tumorales y no es especfico de cncer pancretico [12, 14]. Actualmente existe una
urgente necesidad de identificar nuevas estrategias moleculares de diagnstico
temprano de ADP, sin embargo, la carencia de biomarcadores especficos no es solo
un problema del ADP. El campo de investigacin de biomarcadores para biomedicina a
proporcionado no ms de 100 biomarcadores con utilidad clnica hasta la fecha, a
pesar de las ms de 150,000 publicaciones que han reportado el hallazgo de
biomarcadores, dejando al descubierto la baja eficiencia de trasladar biomarcadores
candidatos al mbito clnico [15].
Actualmente, la droga escogida para el tratamiento del cncer pancretico es
gemcitabine, un anlogo de nuclesido que interfiere con la replicacin del DNA. La
sobrevivencia al cabo de un ao en pacientes tratados con esta droga es tan slo del
18%, representando un avance significativo pero modesto en la calidad de vida del
paciente [16, 17]. En ensayos clnicos fase 3, la combinacin de gemcitabine y erlotinib,
inhibidor del receptor de crecimiendo epidrmico, ha demostrado ser modestamente
superior al tratamiento individual con gemcitabine. Erlotinib fue aprobado por la Food
and Drug Administration (FDA) de EE.UU. para el tratamiento de cncer pancretico. A
pesar de la gran cantidad de investigaciones publicadas en el campo de la terapia del
cncer pancretico, actualmente no hay disponibilidad de terapias eficaces que
extiendan la vida de los pacientes ms all de unos pocos meses [12].

1.1.4 Patofisiologa

Los adenocarcinomas ductales pancreticos evolucionan a partir de lesiones

precursoras no invasivas como las neoplasias intraepiteliales pancreticas (Pancreatic

16
intraepithelial neoplasia; PaniNs, de su sigla en idioma ingls), las cuales adquieren
clonalmente una serie de alteraciones genticas y epigenticas. Adems, otros
tumores pancreticos invasivos pueden originarse a partir de neoplasias papilares
mucinosas intraductales o neoplasias qusticas mucinosas [14].
Las PaniNs se dividen en tres grados en funcin del grado de atipia epitelial. Las
lesiones con atipia mnima se designan como PaniN-1, aquellos con atipia moderada
son PaniN-2, y aquellos con marcada atipia son PaniN-3 (carcinoma in situ). Adems,
las lesiones PaniN-1 se subdividen en los tipos plano (PaniN-1A) y papilares (PaniN-
1B) (Figura 2).

;~:f.{."~~ ... -/~: n. ~ ; -~,~~~' .~: ..

.... .:.-.~,11~. . . .. ..)\. r.{:' . , ~ .
1 ,
. . .; . -
.;~ ~ ' \ "

t-~:-,.. ,.--;.J' . '! , <". . .'. .} \ \r t ~-- .- ~: ~~

.. !.'. .: ......{'. .' ~ .'(...... . ~ '~~' ..,._
... t.,

l.. .
~
1 ~ .:.: , . . ...
-. ' . ' ' ' " ,, ' '
r,. ,. ' ~, ; , :" .. .' 1 "''(~ .\. ,

~,_:; ' .. ..: 't'

~::;-~ ~~-~-- ~- :.~
ft '''-' v, ~~J'i ': .
.,'. ,-T.~:;~,;, ;~~~?~-:V::.._:
11 P~llf"ile.: . ~'.f .~IN:W' ~-~ .. -: Pa~lN;_~. ' ,/ :'PaniN-3

Figura 2. Progresin morfolgica de las lesiones PaniN desde el tejido normal

hasta la lesin PaniN-3. PaniN=pancreatic intraepithelial neoplasia. Imagen adaptada
sin modificaciones desde referencia [18].

Cuando las lesiones preneoplsicas (PaniN) destruyen la lmina basal, el tumor

adquiere un fenotipo invasivo. A nivel macroscpico, el tumor presenta bordes mal
definidos que son difciles de distinguir de otras lesiones benignas que forman
cicatrices, como la pancreatitis crnica. Microscpicamente, el tumor se presenta a
menudo "bien diferenciado", con elementos glandulares similares a los duetos
pancreticos normales [19]. A pesar de que el ADP se encuentra con frecuencia bien
diferenciado, tiene una gran propensin a la infiltracin insidiosa y se caracteriza por
presentar invasin perineural en la totalidad de los casos, siendo el ADP el cncer
donde ms frecuentemente se identifica este fenmeno y que se asocia al fuerte dolor
y a un mal pronstico [20].

17
 Una de las principales caractersticas del ADP es la extensa reaccin
desmoplstica que se encuentra en la mayora de los casos y que constituye,
probablemente, la ms intensa desmoplasia observada entre todos los tumores
epiteliales [21]. Esta desmoplasia se caracteriza por la acumulacin de tejido fibrtico
(principalmente por acumulacin de colgeno), clulas inflamatorias y formacin de
vasos sanguneos. Actualmente sabemos que la clula pancreatica estelar (stel/ate ce//)
participa activamente en la generacin de esta reaccin desmoplstica mediante la
sobreproduccin de colgenos y otras molculas de matriz extracelular [22], fenmeno
que contribuye a la quimioresistencia del ADP a terapias con agentes antineoplsicos
[23] y nanopartculas [24].

1.1.5 Alteraciones genticas del adenocarcinoma ductal pancretico

El ADP es una enfermedad causada por mutaciones heredadas y somticas,

caracterizndose por tener una firma mutacional que la diferencia de otras neoplasias
pancreticas. La mutacin del oncogn KRAS2 es la alteracin gentica ms comn,
presente en -90-95% de los casos a nivel mundial [25-27], reportndose en Chile una
frecuencia de -60% [28]. La elevada presencia de mutaciones de KRAS en las
lesiones preneoplsicas del ADP humano apoya su rol como gen precursor del
proceso neoplsico, lo que ha sido corroborado reiteradas veces en modelos animales,
donde la expresin de KRAS mutante ha mostrado ser un requisito previo para la
aparicin del ADP [29, 30]. El gen p16/CDKN2A (tambin conocido como INK4A) es el
gen supresor de tumores ms comnmente inactivado en ADP (80-95%). Otros genes
con alta frecuencia de mutacin en el ADP son TP53 (50-75%), DPC4 (45-55%) y
BRAC2 (7-10%) [18].
El proyecto del Atlas del Genoma del Cncer (The Cancer Genome Atlas; TCGA
http://cancergenome.nih.gov/) public el ao 2008 un anlisis gentico integral del
exorna de 24 tumores de ADP estudiados mediante next generation sequencing [31].
El estudi demostr que al menos 12 procesos se encuentran alterados genticamente
en la gran mayora de los ADPs, estableciendo genes de las vas de sealizacin de
KRAS, Wnt/Notch, Hedgehog, TGF-~ y regulacin de la transicin entre G1/S que se

18
encontraron mutados en todos los casos estudiados y explican las principales
caractersticas de la tumorognesis pancretica (Figura 3). La intervencin teraputica
de las vas o procesos de sealizacin, en vez de alteraciones genticas individuales,
provee un nuevo paradigma para el tratamiento de esta enfermedad [31].

M'rC. WNT9A. CASPlO. VCP.

GATA6. TCF.:. CAD. liiPl
MAP2. TSC2

TGF BR 2 __--
.,, CRCC4.
BMPR2 fRCC6. CP300.
S\IAf~. , RANBP2.
S\IAD3 .. WnVNotc:h ApopCOSis '-., TPS3
IICnalinC
DNA '
TGFf
IICMiinC .f ~./ . damate
control
AGIIGU7. / / - t 1 CDKN2A.
CCXA2BPA. [ Pancr~vtic-
. , FBX\\17.
DEPOC2. Smiol GTPase . / ' C..'IOC~r R~&ulatlon of .
' CHDl.
APC 2
PL CR l dependen! G1!S phaM ':
u,n.Hng transltlon 1

i
ADA.\111 Replaton
OPP6. TB\'>
MfPJA
of lnwaslon so o
PCSK6 LPR2.
APG-lA. GL/1. BOC
PRSS23 KRAS Homophltlc: CRfBBP
llenallng c:eU
CJun ed~
Nlermln<~l lntecrtn
I<RA5. klnase ignatin& COHl.
(01110. FAT.
I.IAP21\-l. IICINIUn& PCOH15.
RASGRPJ
PCDiill
ITGA-l.
MAP-11<3
/TGA9.
TNr. ATF2.
LA\IAl. fNl.
NFATC l
ILK

Figura 3. Principales vas de sealizacin alteradas en el adenocarcinoma ductal

pancretico. 12 vas y procesos cuyos genes que los componen presentan
alteraciones genticas en la mayora de los casos de ADP. Genes identificados en al
menos 16 de 24 casos de ADP son sealados en el crculo ms externo. GTPase=
guanosine triphosphatase; TGF-13= transforming growth factor {3. Imagen adaptada sin
modificaciones desde referencia [32]

KRAS mutado posee un rol activo en el origen de la lesin neoplsica

pancretica, donde su expresin permite a la clula conservar su viabilidad durante el
desarrollo tumoral temprano [33]. Este proceso est asociado al concepto de "adiccin
oncognica", donde los tumores requieren la expresin y actividad sostenida de un
solo gen aberrante para su desarrollo, a pesar de la acumulacin de otras lesiones
oncognicas [34]. Las mutaciones de KRAS son detectables en etapas tan tempranas
como la lesin Pan 1N-1 A [35]
19
 El modelo actual de progresin tumoral para el ADP (Figura 4) propone que la
mutacin de KRAS y el acortamiento de los telmeros son pasos importantes para el
comienzo del proceso carcinognico, as como la mutaciones en los genes TP53 y
DPC4 (SMAD4; SMAD fa mi/y member 4) son relevantes para desencadenar el fenotipo
invasivo del adenocarcinoma. En etapas iniciales, el ADP adquiere alteraciones
genmicas relacionadas con disfuncin del telmero y desregulacin del ciclo celular.
La elevada inestabilidad genmica frecuentemente persiste despus de la
diseminacin del cncer, resultando as en una evolucin constante, paralela e incluso
convergente entre las distintas metstasis [36], sin embargo, la mayora de los re-
arreglos genmicos ocurren tempranamente en el tumor primario y antes de la
enfermedad metastsica. El ao 2012, Yachida et al evaluaron cuantitativamente los
tiempos requeridos para la evolucin gentica del ADP, estableciendo un tiempo
promedio de alrededor de 1O aos entre la adquisin de la primera mutacin y el
nacimiento de la primera clula parental tumoral no metastsica (Figura 5). Al menos
otros cinco aos ms son necesarios para la adquisicin de la capacidad metastsica y,
en promedio, los pacientes fallecen al cabo de dos aos a partir de ese momento [37].
Este estudio establece que la enfermedad transcurre en ms de dos dcadas desde su
inicio hasta la muerte del paciente. Lamentablemente, la mayora de los casos son
diagnosticados en la etapa T3 (Figura 5), donde las clulas metastsicas ya se
encuentran diseminadas y creciendo en rganos distantes. Sin embargo, desde el
inicio de la enfermedad hasta antes de la metstasis, existe una ventana de tiempo
terica de -18 aos, donde el cncer puede ser diagnosticado. Este hallazgo estimula
el desarrollo de nuevas alternativas de diagnstico para el ADP.

20
Figura 4. Modelo PaniN de progresin tumoral. Las alteraciones genticas y
moleculares ms comunes de cada estada morfolgico son mostradas.
PaniN=pancreatic intraepithelial neoplasia. Imagen adaptada sin modificaciones desde
referencia [38].

1 Normal 1-+ ~a ni~-+ 1 PaniN2J-+ 1 PaniN31-+

T1=11.7 yrs T2=6.8 yrs T3=2.7 yrs

lnitiation Gain of Gain of Death

invasive metastatic
ability ability

Figura 5. Lnea de tiempo estimada para la progresin gentica del ADP.

Sucesivas ondas de progresin clonal ocurren con la adquisin de mutaciones
adicionales y que corresponden con el modelo de progresin Pan IN (T1 ). En T2 el ADP
adquiere un fenotipo invasivo y durante T3, el tumor comienza la diseminacin
metastsica. En promedio, 21.2 aos transcurren desde el inicio del tumor hasta el
fallecimiento del paciente debido a la enfermedad metastsica. Imagen adaptada sin
modificaciones desde referencia [39].

21
1.2 Transcriptmica y Cncer

1.2.1 El transcriptoma

El transcriptoma es el conjunto completo de transcritos y sus niveles de

expresin en una clula, en un determinado momento del desarrollo o estado
fisiolgico. Los transcritos incluyen a diversas clases de molculas de RNA, tales como
los RNAs mensajeros (mRNA), RNAs de transferencia (tRNA), RNAs ribosmicos
(rRNA) y a otras clases de RNAs no codificantes [40]. A diferencia del genoma, el cual
es relativamente estable, el transcriptoma es dinmico y vara enormemente
dependiendo del tipo celular, tejidos y condiciones ambientales.
Como los mRNAs transportan la informacin codificante del genoma (exorna)
para la sntesis proteca, se espera que los niveles de expresin de estas molculas
reflejen sus respectivos niveles de protenas. Ha sido una prctica comn en
investigacin usar las concentraciones de los mRNAs como un reflejo de las
concentraciones y actividades de sus correspondientes protenas, asumiendo as que
la abundancia de los transcritos es el principal determinante de las concentraciones de
las protenas [41 ]. Estudios previos donde se han comparado los niveles de mRNA y
protenas han concluido que la correlacin es pobre, sin embargo, estas conclusiones
fueron obtenidas con una baja cantidad de genes debido, principalmente, a
limitaciones tcnicas [42, 43]. Recientemente, un estudio publicado por
Schwanhausser et al [44] midi simultneamente los niveles de mRNA y protena de
ms de 5,000 genes en clulas mamferas. El estudio concluy que los niveles de
mRNA explican alrededor del 40% de la variabilidad observada en los niveles de
protenas (en clulas en divisin y no sincronizadas), destacando la importancia del
control traduccional del ribosoma en el proceso de la regulacin de la expresin
gnica. Este porcentaje es similar al observado en otros estudios [41]. Futuras
investigaciones an deben dilucidar el aporte de otros procesos a la regulacin global
de la expresin gnica, tales como son la transcripcin, degradacin de mRNA y
degradacin de protenas [41, 44].

22
 Determinados mRNAs y protenas pueden tener diferentes abundancias y tasas
de degradacin segn sus funciones. Por ejemplo, mRNAs y protenas de genes
metablicos tienden a ser muy estables y tener elevadas razones de protena/mRNA.
Por el contrario, protenas involucradas en la organizacin de cromatina y regulacin
de la transcripcin tienden a ser rpidamente degradadas. Por lo tanto, la regulacin
de las protenas y sus mRNAs reflejan roles biolgicos especficos: protenas
regulatorias pueden ser producidas y degradadas muy rpido para reaccionar ante
estmulos, mientras que protenas estructurales o "housekeeping" pueden tener vidas
ms largas [41].
Las investigaciones transcriptmicas que han empleado las tecnologas de
microarray y secuenciacin de RNA (RNA-seq) han revelado que los niveles de
expresin de mRNAs se desplegan a travs de un amplio rango, observndose
trancritos altamente representados y otros de muy baja expresin. En promedio, la
mediana de expresin de transcritos es de solo 17 copias por clula, como se ha
observado en fibroblastos murinos [44]. Sin embargo, al analizar transcritos
individualmente las diferencias son dramticas. En poblaciones purificadas de clulas
Th2, los transcritos de GATA3 se encuentran en promedio entre 25 a 150 copias por
clula, en cambio, los transcritos de TBX21 se encuentran en menos de una copia por
clula. Estas variaciones en los niveles de expresin, estudiadas ya sea mediante
microarray o RNA-seq, han revelado dos componentes sobrepuestos de distribucin de
niveles de expresin gnica: genes de alta y de baja expresin. Los genes de alta
expresin participan activamente de las funcionales celulares, sin embargo, la
relevancia funcional de los genes de baja abundancia ha sido puesta en duda [45].
Recientemente, un estudio protemico y transcriptmico realizado en tres lneas
celulares tumorales de distintos tipos de cncer e histologa (U-2 OS, osteosarcoma
humano; U-251 MG, human glioma; A-431, carcinoma epidermoide), revel que los
transcritos expresados nicamente en un tipo celular y no en los otros dos, poseen una
baja abundancia relativa, comparados con genes de expresin moderada o alta que se
expresan de forma similar en las tres lneas celulares [45]. Esta caracterstica sugiere
que los genes de baja expresin pueden tener potencial como marcadores de

23
identidad y por lo tanto, pueden ser empleados como biomarcadores para la
identificacin, por ejemplo, de clulas tumorales.
La baja expresin de muchos transcritos implica que hay diferencias
transcriptmicas sustanciales entre las clulas, incluso en aquellas cultivadas
clonalmente, sugiriendo que cada clula posee una firma transcriptmica individual, si
es que no nica. Esta caracterstica reta el concepto de que exista un transcriptoma
individual y estable mediante el cual se pueda caracterizar una clula.
La convergencia de conclusiones obtenidas por estudios recientes como la
caracterizacin del transcriptma de clula nica [46] y un modelo transcripcional
dinmico y de modificacin veloz [47], permiten inferir que el transcriptoma humano
posee una ontogenia altamente especfica, con identidad posicional, dinamismo,
plasticidad y diversidad [48].

1.2.2 El transcriptoma del cncer

La secuencia y estructura del genoma cncer, junto a sus variaciones

epigenticas, influyen en varios fenotipos mesurables dentro los cuales encontramos la
progresin tumoral, la metstasis, la respuesta a drogas y la sobrevivencia de los
pacientes. Estas variaciones genmicas y su influencia en el tumor pueden ser
conducidas a travs de la alteracin de vas de sealizacin oncognicas, que a su vez
pueden ser evaluadas a travs del anlisis de sus perfiles de expresin gnica. En el
mbito clnico, el uso de los perfiles de expresin gnica aplicados al estudio del
cncer ha servido para identificar diversos subtipos moleculares [49-51] y para predecir
sobrevivencia y recurrencia de la enfermedad [52-54]. Por otra parte, estas tecnologas
han sido aplicadas adems para disectar molecularmente las vas de sealizacin
involucradas en la carcinognesis y evaluar as su potencial como alternativa
terapetica [55-57].
El cncer de mama representa una de las neoplasias ms intensamente
estudiadas a nivel de expresin gnica desde los inicios del uso masivo de las
tecnologas de microarray [50-52]. Luego de ms de una dcada de estudios, se han

24
obtenido importantes conclusiones: los tumores que expresan el receptor de estrgeno
representan una grupo molecularmente muy distinto de los tumores que no expresan el
receptor, principalmente debido a la fuerte influencia hormonal en la transcripcin; por
otra parte, los niveles de expresin de genes relacionados con proliferacin tumoral
representan un factor pronstico en tumores positivos para el receptor de estrgeno
[58]. El estudio del transcriptoma del cncer de mama ha contribuido enormemente a
comprender la biologa de este tumor, sin embargo, la medicin de expresin gnica
no ha sido introducida a ningn nivel de la prctica clnica [58, 59].

1.2.3 El transcriptoma del adenocarcinoma ductal pancretico

El ADP es un tumor caracterizado por tener una firma gentica caracterstica [9],
que le confiere un comportamiento agresivo y difcil de intervenir teraputicamente.
Adems, este tumor cursa paralelamente con una intensa reaccin estroma!
caracterizada por una gran acumulacin de material fibrtico e infiltracin de clulas
inflamatorias de origen inmune. La tecnologa de microarray ha sido empleada para
entender las complejidades de la heterogenidad del ADP y su regulacin
transcripcional. A nivel de expresin gnica, las masas tumorales del ADP pueden ser
divididas en al menos cuatro tipos de compartimentos con arquitecturas definidas: 1)
epitelio neoplstico; 2) estroma juxtatumoral (estroma inmediatamente adyacentes al
tumor); 3) panestroma (el resto del estroma no juxtatumoral) y 4) el tejido angio-
endotelial [60]. Estos estudios han identificado una serie de molculas cuya expresin
se encuentra mas elevada en tejidos tumorales en comparacin a los tejidos no
neoplsticos [61-63]. El ejemplo de la molcula mesotelina (mesothelin) destaca la
aplicacin verstil que puede tener el descubrimiento de un solo gen up-regulated.
Mesotelina codifica para una protena localizada en la superficie de la clula y que se
encuentra up-regulated ubicuamente en la mayora de los casos de ADP,
observndose infrecuentemente en lesiones preneoplsicas no invasivas y totalmente
ausente de los tejidos normales pancreticos [64, 65]. El marcaje con anticuerpo anti-
mesotelina es til como marcador auxiliar para el diagnstico de ADP en muestras de

25
biopsia o citologas dudosas [66] y, debido a que mesotelina tambin se secreta, la
deteccin de niveles sricos elevados se ha propuesto como un posible biomarcador
de ADP [67]. Adems, anticuerpos monoclonales humanizados anti-mesotelina e
inmunotoxinas de Pseudomonas conjugadas a anti-mesotelina han sido desarrolladas
como estrategia teraputicas basada en esta protena [64]. El caso de la mesotelina
demuestra que los estudios de expresin gnica tienen el potencial de impactar el
manejo clnico actual del ADP.
Luego de la masificacin el uso de la tecnologa de microarray, surgieron varios
estudios transcriptmicos aplicados a diferentes aspectos de a biologa del ADP:
identificacin de biomarcadores [62, 63, 68-71], estudio de la metstasis [72, 73],
caracterizacin molecular de la reaccin desmoplstica [60, 74] y de la pancreatitis
crnica [75]. Si bien estos trabajos han contribuido enormemente a la comprensin de
la biologa del cncer pancretico, a la fecha, pocos descubrimientos han sido
transferidos al mbito clnico en materia de diagnstico molecular [14, 76]. En este
contexto, el transcriptoma de baja expresin del ADP representa una fuente de
molculas con potencial de convertirse en biomarcadores. Una forma eficiente de
evaluar un transcriptoma de baja abundancia es mediante la tecnologa de hibridacin
sustractiva por supresin.

1.3 Microarray de expresin gnica

Los microarrays son plataformas de alto rendimiento, diseadas para medir la

expresin de miles de genes simultneamente. Esta tecnologa se desarroll
rpidamente y su uso en investigacin explot entre los aos 1999 y 2002, permitiendo
asi la caracterizacin de los transcriptomas de mltiples especies, tanto a nivel
fisiolgico como en enfermedad, siendo el cncer una de las reas ms extensamente
estudiadas con esta tecnologa [77]. Diferentes tipos de microarray han sido diseados,
pero todos se basan en el principio de detectar transcritos a travs de hibridacin de
cidos nucleicos. Una gran cantidad de sondas (spotted cDNAs u oligonucletidos
impresos), cada una correspondiente a una parte especfica de un transcrito, son

26
adheridas a un substrato slido, usualmente portaobjetos de vidrio. Los mRNAs
extrados de cada muestra experimental, controles o referencias son convertidas en
cDNAs o cRNAs de hebra simple, marcadas con una molcula fluorescente y
posteriormente hibridadas con las sondas complementarias impresas en el array
(Figura VA) [78]. Las diferencias de expresin gnica son calculadas en base a la
cuantificacin y anlisis estadstico de la seal de fluorescencia emitida por los cDNAs
o cRNAs marcados [79] .
Los mcroarrays de dos colores (two-colour mcroarrays) permiten que dos
muestras biolgicas diferentes sean hibridadas en el mismo mcroarray, debido a que
dos flurforos distintos son usados para marcar cada muestra de cONA. Esta
estrategia permite eliminar parcialmente las diferencias originadas en los distintos
arrays, tales como la eficiencia de la hibridacin y las variaciones en el tamao del spot
[80]. Dos muestras biolgicas son hibridadas en un solo mcroarray de dos colores y
varios mcroarrays son usualmente necesarios para analizar las muestras de un
determinado experimento. Debido a esto, mltiples forma de combinaciones posibles
emergen al momento de decidir como sern combinadas las muestras en estos
mcroarrays. Estas combinaciones son denominadas "diseo de hibridacin" o "diseo
experimental", e influyen enormemente en la eficiencia y el poder de posteriores
anlisis estadsticos. Un diseo experimental popular es el denominado diseo de
referencia (reference desgn) y representa un tipo de comparacin indirecta (Figura 6).
Este diseo emplea un cONA de referencia comn en todos los arrays contra el que
todas las otras muestras experimentales sern comparadas. Este tipo de diseo
experimental permite ser extendido para incluir muestras adicionales en diferentes
momentos, siempre y cuando la misma muestra de referencia est disponible; es
relativamente fcil de analizar estadsticamente y como las muestras son procesadas
de la misma manera, reduce la posibilidad de errores en la manipulacin [81, 82].

27
 A TR+ 8
"'"'
~::""1..
Extraccin Marcaje
...1\N1\NIVV . . N\/~ ~
EXP1
~
C1

Clulas
mRNAen
estudio
cONA
\
& B
88
Tejidos Hibridacin 00000
IV\/ /VV NV ... 0000 EXP2 REF C2
NVIVV IVV 0000
00000 Gen

"'"" M:~c:je 1 rep~i:doEscanear

"' activado
""........ .,.1\N NV . . /\IV NV
~.,_ ...,. 1\N N\/ Anlisis EXP3 C3
mRNA cONA
Clulas referencia
Tejidos

Figura 6. Diseo de referencia. A) Las muestras experimentales y controles

procesadas para extraer el RNA en estudio y sintetizar el cONA, el cual ser marcado
con un fluorforo (ej: Alexa 647) e hibridado en el microarray junto a la muestra de
referencia, que ha sido procesada de la misma manera pero conjugada a un fluorforo
distinto (ej: Alexa 555). B) Esquema del diseo de referencia. La muestra de referencia
es hibridada competitivamente junto con cada muestra en estudio. REF= muestra de
referencia; EXP1-3= replicados biolgicos experimentales; C1-3: replicados biolgicos
de los controles. Figura adaptada con modificaciones desde referencias [78] y [81].

1.4 Hibridacin sustractiva por supresin

La hibridacin sustractiva por supresin (Suppression subtractive hybridization;

SSH, de su sigla en ingls) ha sido ampliamente usada para identificar transcritos
(cONAs) que discriminan dos muestras complejas muy relacionadas entre s [83]. La
metodologa de SSH normaliza (ecualiza) la abundancia de transcritos entre los
transcriptomas en estudio, permitiendo enriquecer ms de 1000 veces los transcritos
de expresin diferencial, independientemente de su abundancia relativa original [84].
La metodologa de SSH est basada globalmente en el efecto de supresin de
la reaccin en cada de la polimerasa (PCR; polimerase chain rection) [85, 86],
combinando la normalizacin y sustraccin en un solo paso. Primero, el cONA es
sintetizado a partir del RNA extrado de las muestras en estudio. La poblacin de cONA
donde sern identificados los transcritos de inters se denomina tester y la poblacin
de cONA referencia utilizada para sustraer se denomina driver. Si la cantidad de RNA
inicial no es suficiente, la tecnologa de amplificacin SMART (Switching Mechanism At
28
5'end of RNA Iranscript) es adecuada para amplificar cDNAs de alta calidad. A
continuacin, los cDNAs de doble cadena son sintetizados independientemente a partir
de las muestras tester y driver, y posteriormente digeridas con enzimas de restriccin
que generen extremos romos, tales como Rsa 1 o Alu l. La muestra tester es luego
dividida en dos porciones, cada una es ligada a dos diferentes adaptadores de doble
cadena (1 y 2R). Los extremos de los adaptadores no estn fosforilados, por lo tanto
solo una hebra de cada adaptador es ligada covalentemente a los extremos 5'de los
cDNAs. Los pasos moleculares que ocurren durante la SSH son descritos en la figura 7.
En la primera hibridacin, se aade un exceso de cONA driver a cada muestra tester (1
y 2R). Las muestran son posteriormente desnaturalizadas mediante calor y luego
alineadas. Luego de este paso, en cada muestra se generan los tipos de molculas A,
B, C y D (Figura 7). Durante esta primera hibridacin el grupo de molculas de hebras
simple de las muestras tester es normalizado, equiparando asi las concentraciones de
los cDNAs de alta y baja abundancia. La normalizacin ocurre porque el paso de
alineamiento genera homohbridos (B) y heterohbridos (C) ms rpidamente para las
molculas de mayor abundancia, debido a la cintica de segundo orden de las
hibridaciones de cidos nucleicos. Las hebras menos abundantes permanecen en
hebra simple. Controlando la duracin de la hibridacin, las hebras simples de los
cDNAs de alta abundancia son reducidas al mismo nivel de aquellas menos
abundantes, normalizando as la representatividad de los cDNAs de la muestra tester.
Al mismo tiempo, la poblacin de molculas tipo A son significativamente enriquecidas
para transcritos de expresin diferencial, debido a que los cDNAs comunes para las
muestras tester y driver forman molculas tipo C. Durante la segunda hibridacin, las
dos muestras de la primera hibridacin son combinadas y alineadas en presencia de
cONA driver adicional, desnaturalizado recientemente. Bajo estas condiciones, solo las
hebras simples tester tipo A pueden reasociarse y formar nuevos hbridos tipo B, C y E
(Figura 7). Los hbridos tipo E son molculas tester de doble cadena con diferentes
extremos, uno de los cuales corresponde al adaptador 1 y el otro al adaptador 2R.
Posteriormente, cONA driver desnaturalizado es luego aadido para enriquecer
la fraccin E. Toda la poblacin de molculas es luego sometida a dos rondas de PCR
para amplificar selectivamente las secuencias de expresin diferencial. Antes de la

29
primera PCR, los extremos de las hebras son rellenados, creando el sitio
complementario para la unin de los primers necesarios para la amplificacin. Las
molculas tipo A y D carecen de sitios de unin a primers y no pueden ser amplificados.
Las molculas tipo B forman estructuras de bucle plegadas sobre si mismas,
suprimiendo as el alineamiento de primers y la posterior amplificacin. Solo las
molculas tipo E son amplificados exponencialmente debido que tienen distintos tipos
de adaptadores en sus extremos, y por lo tanto, diferentes sitios de alineamiento para
primers. Estas molculas son el principal producto enriquecido en las muestras
sustradas y representan transcritos de baja abundancia y de expresin diferencial en
la muestra tester [87].
La metodologa SSH puede ser acoplada a una plataforma de microarray para
incrementar el rendimento y la cobertura de la identificacin de transcritos [88-92]. Esta
estrategia ha sido validada metodolgicamente para identificar transcritos de relativa
especificidad en tejidos tumorales tales como carcinoma hepatocelular [88-90], cncer
de mama [88, 93], cncer nasofarngeo [88, 92] y carcinoma pulmonar escamoso [91].
La estrategia SSH-microarray es de particular utilidad en el enriquecimiento de
transcritos de baja abundancia, que como se ha descrito previamente, suelen tener
una expresin especfica de tipo celular [94] y tambin pueden ser empleados para
identificar tipos especficos de tumores [88]. Sin embargo, un hecho importante de
destacar, es que ningn estudio realizado en tumores utilizando la metodologa de
SSH-microarray ha desarrollado una evaluacin exhaustiva de expresin de las
respectivas protenas codificadas por esos transcritos especficos. Esto es de
importancia debido a que, como sabemos, solo un -40% de la abundancia de mRNAs
tiene una correlacin con sus respectivas protenas [41] y estas poseen adems un
rango dinmico de concentracin 900 veces superior a los mRNAs [44], convirtiendo a
las protenas en buenos candidatos para ser medidos en los fluidos y tejidos.
Estudios previos han empleado la tecnologa de hibridacin sustractiva por
supresin acoplada a microarray con el objetivo de identificar potenciales marcadores
de cncer [88-92]

30
 e=
Tester cONA+ Adaptador 1 Driver cONA Tester cONA+ Adaptador 2R
1 1

A-----
B-1::~-
e~=~
l Primera
Hibridacin &:J

==-
l
A

e
Segunda Hibridacin

-- Mezclar muestras
Aadir Driver desnaturalizado
Alinear (Anneal)

l
E

A -11111--- A
sll---11- &:J--r= B
..:J-oEII

e-- -=:1--
&:J
e

--
!
A

No amplificacin

-~~---->~ B o B.

e } Amplificacin lineal

E Amplificacin exponencial
3'~5'

e!>
Figura 7. Fundamento molecular de la hibridacin sustractiva por supres1on.
Molculas tipo E se forman slo si la secuencia se encuentra up-regulated en el cONA
tester. Cajas negras representan la parte exterior del adaptador 1 y 2R y cebador de
correspondiente secuencia para la PCR primaria. Cajas rojas representan la parte
interna del adaptador 1 y la correspondiente secuencia de cebador de PCR nested 1.
Las cajas verdes representan la parte interna del adaptador 2R y la correspondiente
secuencia de cebador de PCR nested 2R

31
 Considerando los antecedentes presentados, el presente proyecto de
investigacin tuvo como propsito aplicar tecnologas de transcriptmica para
identificar nuevos genes candidatos y evaluar su aplicacin como potenciales
herramientas de diagnstico del adenocarcinoma ductal pancretico.

32
2. PRESENTACION DEL PROBLEMA

2.1 Justificacin

El ADP es la causa de muerte de alrededor de 260,000 personas cada ao a

nivel mundial. Esta enfermedad no posee terapias efectivas y carece de metodologas
de diagnstico temprano. Actualemtne, es de urgencia identificar nuevas estrategias
que permitan el desarrollo de metodologas de diagnstico eficientes para el ADP. El
presente trabajo de tesis tiene por objetivo investigar la biologa del ADP en busca de
molculas que puedan servir como marcadores de la enfermedad, con el propsito
final de desarrollar nuevas metodologas de diagnstico.
Basados en estos antecedentes se ha planteado la siguiente hiptesis y objetivos
de identificacin:

2.2 Hiptesis

La hiptesis de trabajo sostiene que mediante la aplicacin de la metodologa de

hibridacin sustractiva por supresin, acoplada a anlisis de microarray y
bioinformtica, es posible identificar genes de expresin diferencial entre muestras
neoplsicas y no neoplsicas de pacientes con ADP. Esta informacin permite la
identificacin de genes up-regulated asociados a carcinognesis pancretica que
podran servir como potenciales marcadores gnicos de la enfermedad.

33
2.3 Objetivo general de la tesis

El objetivo general es identificar nuevos marcadores de adenocarcinoma ductal

pancretico (ADP), mediante anlisis del transcriptoma de alta y baja abundancia en
tejido neoplsico y no neoplsico, provenientes de pacientes con ADP avanzando.
Abordamos esta pregunta mediante dos estrategias de genmica funcional: hibridacin
sustractiva supresiva (SSH) acoplada a deteccin por microarray.

2.4 Objetivos especficos

Determinacin de genes de expresin diferencial en tejidos de adenocarcinoma

ductal pancretico y tejidos no neoplsicos de pncreas mediante tecnologa de
microarray (estrategia directa).
Determinacin de genes de expresin diferencial en tejidos de adenocarcinoma
ductal pancretico y tejidos no neoplsicos de pncreas mediante hibridacin
sustractiva por supresin acoplada a tecnologa de microarray (estrategia SSH).
Comparacin de los genes de expresin diferencial obtenidos por ambas
estrategias. Enriquecimiento de ontologas de genes y pathways. Seleccin de
genes candidatos.
Identificacin de potenciales marcadores moleculares mediante anlisis
inmunohistoqumico sistemtico en tejidos de ADP empleando tissue
microarrays.

34
3. MATERIAL Y MTODOS

3.1. Muestras clnicas

El anlisis de expresin gnica mediante microarray y SSH-microarray fue

realizado empleando muestras del Banco Nacional de Tumores. Los tejidos de cncer
pancretico y su correspondiente tejido adyacente no neoplsico fueron colectados de
6 pacientes con diagnstico histolgico de adenocarcinoma ductal pancretico
avanzado sometidos a reseccin quirrgica sin terapia adyuvante previa a la ciruga.
Las muestras fueron procesadas e incubadas en RNAiater (Ambion lnc, Austin Tx,
USA) durante 12 horas a 4 oc. Posteriormente, las muestras fueron introducidas en
criotubos, sometidas a congelacin en isopentano a -50 oc por 2 min y almacenadas a
-80 oc hasta su utilizacin. Se consider como tiempo mximo aceptable 30 minutos
desde la extraccin del tejido hasta su congelacin.
Para la validacin inmunohistoqumica se emplearon tissue microarrays {TMAs)
de cncer pancretico que contienen tejidos de 30 pacientes, incluyendo 2 cores de
tejido tumoral por cada core de tejido no neoplsico del mismo paciente (AccuMax
Array A307). El anlisis de expresin en tejidos normales fue realizado usando un TMA
Pantomic Normal Tissues MN0661, construido con 33 tejidos normales por duplicado
(Pantomics lnc.) y donado amablemente por el Dr. Julio Celis.

3.2 Extraccin de RNA

3.2.1 Extraccin de RNA de tejidos tumorales y no neoplsicos

Para la extraccin de RNA (Ribonucleic acid) total de los tejidos se utiliz el

reactivo de Trizo!, (lnvitrogen, Carlsbad, CA, USA) siguiendo las instrucciones del
proveedor. Los tejidos (1 00-150 mg) fueron pulverizados mediante congelacin en
nitrgeno lquido y homogenizados con 1 mi de reactivo Trizo!. La suspensin fue
incubada durante 5 mina temperatura ambiente {TA) y centrifugada a 12.000 g durante
1O min a 4 oc. Luego de la separacin, la fase acuosa fue recuperada en un tubo
35
nuevo al cual se adicionaron 200 ~-ti de cloroformo. El tubo fue agitado vigorosamente e
incubado en hielo durante 3 min y centrifugado a 12000 g por 1O m in. El sobrenadante
fue recuperado en un tubo y el RNA fue precipitado con 500 ~-ti de isopropanol. El tubo
fue incubado por 10 min en hielo y centrifugado a 12000 g por 10 min. El RNA
precipitado fue lavado una vez con 500 ~-ti etanol 75% y centrifugado a 7500 g por 5
min. Luego, el RNA precipitado fue secado durante 5 mina temperatura ambiente (TA)
y resuspendido en 30- 50 ~-ti de agua desionizada estril tratada con DEPC O, 1 %. A
continuacin, los RNAs fueron sometidos a digestin enzimtica con DNAsa 1 (Ambion
lnc, Austin Tx, USA) para degradar trazas de DNA genmico, seguido de una
purificacin mediante columnas de afinidad RNeasy (Qiagen, Hilden, Germany). La
concentracin y pureza del RNA extrado fue determinada por espectrofometra UV
(NanoDrop Technologies, USA), seguida de una evaluacin de la integridad del RNA
mediante electroforesis en gel de agarosa. Finalmente, las muestras de RNA fueron
almacenadas a -80 oc hasta su utilizacin. El RNA proveniente de tejido normal
pancretico fue obtenido comercialmente (Ciontech, Palo Alto, CA, USA).

3.2.2 Determinacin de la integridad del RNA

Para determinar la integridad del ARN, se realiz una electroforesis horizontal

en gel de agarosa al 1.5 % teido con bromuro de etidio (0,5 Jg 1 mi) con cada una de
las muestras extradas. Durante este procedimiento, 500 ng de cada muestra de RNA
fue nivelada a un volumen total de 5 !JI y mezclada con 1 !JI de buffer azul celeste 6X
(Winkler, Santiago, Chile). Las muestras fueron cargadas en el gel y la electroforesis
se realiz en buffer TAE 1X (Tris-Acetato-EDTA) a 50 voltios durante 30 min. Para
visualizar el RNA, el gel fue expuesto a luz ultravioleta en un transluminador (Aipha
lnnotech Corporation, CA, USA).

36
 3.3 Hibridacin supresiva sustractiva (SSH)

La hibridacin sustractiva supresiva requiere como material inicial un cONA de

alta calidad, sintetizado a partir de las muestras de RNA extradas de los casos
tumorales y sus respectivos tejidos no neoplsicos. Para la sntesis de cONA se
emple el kit Super SMART PCR cONA Synthesis (Ciontech, Terra Ave, CA, USA),
siguiendo las indicaciones del manufacturador. Posteriormente, los procedimientos de
la SSH fueron realizados empleando el kit PCR-Select cONA Subtraction (Ciontech,
Terra Ave, CA, USA), con algunas modificaciones.

3.3.1 Sntesis de cONA mediante tecnologa SMART

Los mtodos comnmente usados para la sntesis de cONA se basan en la

habilidad de la enzima transcriptasa reversa (TR) de transcribir una hebra simple de
cONA a partir de mRNA en una sola reaccin. Sin embargo, debido a que la TR no
siempre transcribe la secuencia completa del mRNA, los extremos 5'de los genes
tienden a estar pobremente representados en las poblaciones de cONAs. Este es a
menudo el caso para los mRNAs largos, especialmente si la nica estrategia de
cebado (priming) es el uso de primers oligo(dT) o si el mRNA tiene estructuras
secundarias persistentes. En ausencia de degradacin de RNA, las molculas de
cONA truncadas se deben a la tendencia de la TR a detenerse antes de que se
complete la transcripcin. La tecnologa SMART fue desarrollada con el propsito de
enriquecer preferentemente cONAs de longitud completa.
La sntesis de cONA mediante SMART emplea nanogramos de RNA inicial.
Como primer de la primera reaccin se emplea un oligo(dT) modificado (3' SMART
COS Primer 11 A). Cuando la TR alcanza el extremo 5', la actividad de transferasa
terminal de la enzima aade unos pocos nucletidos adicionales, principalmente
desoxicitosinas, al extremo 3'de la hebra de cONA. El oligonucletido SMART, que
posee una secuencia oligo(G) en su extremo 3', se une complementariamente a la
secuencia de desoxicitosinas sintetizada previamente, creando un templado extendido.

37
A continuacin, la TR cambia de templado y continua extendiendo hasta el final del
templado. El cONA de longitud completa y de hebra simple recin sintetizado, contiene
la secuencia completa del extremo 5'del mRNA, as como tambin, las secuencias que
son complementarias al oligonucletido SMART. La secuencia de anclaje SMART y la
secuencia poli(A) sirven como sitios de cebado para la amplificacin de extremo a
extremo del cONA [95] (Figura 8). El procedimiento realizado se describe a
continuacin:

a) Sntesis de la primera hebra de cONA

Por cada reaccin se utiliz 1 IJg de RNA de cada muestra en un volumen de 50

IJI. El RNA fue incubado con 71JI de 3' SMART COS Primer IIA (12 IJM) y 7 IJI SMART
IIA oligonucleotide (12 IJM) a 65 C por 2 min. Luego se redujo la temperatura a 46 C y
se adicion a la reaccin la siguiente mezcla: 20 IJI de 5X First-Strand Buffer, 2 IJI OTT
(1 00 mM), 1O IJI de 50X dNTP (1 O mM), 2,5 IJI RNaseOUT (40 U 1 IJI), 2 IJI SuperScript
111 Reverse Transcriptase 200 U 1 IJI y 5,5 IJI de agua desionizada estril (AOESI). La
reaccin fue mezclada gentilmente e incubada a 46 oc por 90 min y luego a 70 oc por
15 min en un termociclador (Thermal Cycler 2720, Applied Biosystem). Como control
de sntesis se utiliz 1O ng de RNA de placenta humana.
La purificacin del cONA fue realizada utilizando el kit NucleoSpin Extract 11
(Macherey-Nagel, Oren, Alemania). A los 100 IJI de cada reaccin de sntesis fueron
aadidos 212 IJI de Buffer NT y se mezclaron con la pipeta. La solucin fue traspasada
a una columna NucleoSpin Extract 11 (Macherey-Nagel, Oren, Alemania) y
centrifugada a 14.000 rpm por 1 min y as descartar el eludo. Luego, la columna fue
lavada con 600 IJI de Wash Buffer NT3 y centrifugada a 14.000 rpm por 1 min,
descartando nuevamente el eludo. Para remover cualquier residuo de buffer la
columna fue centrifugada a 14.000 rpm por 2 min. Posteriormente, la columna fue
puesta en un tubo plstico nuevo y el cONA fue eludo con 50 IJI de agua Milli-Q,
incubndose por 2 min a TA y centrifugando a 14.000 rpm por 1 min. Este paso fue
repetido nuevamente con 35 IJI de agua Milli- Q, obteniendo as un volumen total de
aproximadamente 85 IJI.
38
 poli(A) RNA
0 5' . . . poli(~)3'. .
;0G
primer CDS Smtes1s de pnmera
oligonucletido
SMARTIIA
! Hebra mediante TR

0 5' poli(A} 3'

;0G Adicin de

0 5'.
! dC adicionales

poli{A) 3'
Un solo
paso
; 0 G CCC
Cambio de templado

-GGG
! y extensin mediante TR

poli(A) 3'
-ccc
Amplificacin de cONA
! mediante LD-PCR
con primer PCR

cONA de doble cadena

Figura 8. Fundamento molecular de la amplificacin de cONA mediante

tecnologa SMART. La figura es descrita en el texto (punto 3.5.1 ).

b) Amplificacin del cONA por reaccin de polimerasa en cadena (PCR).

Para identificar el nmero de ciclos ptimos necesarios para comenzar con la

SSH , el cONA fue amplificado mediante PCR de larga distancia (LD-PCR) con 15, 18,
21, 24, y 27 ciclos separadamente y el producto de PCR fue chequeado mediante
electroforesis en gel de agarosa 1, 2 % [96]. Para cada reaccin el cONA fue mezclado
con 172 1-11 de ADESI, 30 !JI de 10X Advantage 2 PCR Buffer, 6 !JI de 50X dNTP (10
mM), 6 1-11 de 5' PCR Primer 11 A (12 1-JM), 6 1-11 50X Advantage 2 Polymerase Mix. El
volumen total de la PCR fue de 300 !JI, el que se dividi en 3 alcuotas de 100 !JI cada
una (etiquetadas A, By C). Las tres alcuotas fueron sometidas al siguiente ciclo termal:
95 C por 1 min y 15 ciclos de 95 C por 5 seg, 65 oc por 5 seg y 68 C por 6 min.
Para determinar el ciclo ptimo de la reaccin, a partir del tubo C se obtuvo una
alcuota de 30 1-11 al cual se denomin tubo experimental, el cual fue incubado 15 ciclos
adicionales de PCR, extrayendo 5 !JI de la reaccin cada 3 ciclos. Todas las alcuotas
obtenidas para cada caso fueron chequeadas por electroforesis en gel de agarosa al

39
 1,2 % y se seleccion como ptimo el ciclo anterior a la saturacin del PCR. Una vez
determinado el ciclo ptimo, se procedi a realizar los ciclos faltantes a los tubos A, B
y C. Finalmente, se detuvo la reaccin con 2 JI de EOTA 0,5 M y se cheque la
amplificacin de cada tubo mediante electroforesis en gel de agarosa 1,2%.
Luego de la reaccin de PCR, los tubos A, B y C fueron mezclados y purificados
por extraccin con igual volumen de fenol: cloroformo: alcohol isoamlico (25:24: 1). La
mezcla fue agitada vigorosamente y centrifugada a 14.000 rpm por 1O min. Luego, con
la finalidad de concentrar el cONA, la fase superior acuosa fue traspasada a un nuevo
tubo, mezclada con 700 JI de n-butano! y se centrifugada a 14.000 rpm durante 1 min.
Este ltimo paso fue necesario repetirlo con 100 JI de n-butano! hasta conseguir un
volumen final de 40-70 JI. Como ltima etapa de la purificacin, se traspas todo el
cONA concentrado a una columna Chroma Spin - 1000 (Ciontech, Terra Ave, CA, USA)
y se adicion buffer TNE 1X hasta completar un volumen final de 320 JI. Finalmente,
se recuper el cONA de la columna por centrifugacin a 700 g por 3 min.
Adicionalmente, cONA residual fue recuperado de la columna por elucin con 75 JI de
TNE 1X.

e) Digestin con Rsal

Esta etapa fue realizada para generar, fragmentos de cONA ms cortos y con
extremos romos que son necesarios para la posterior ligacin de adaptadores y
sustraccin. Antes de proceder con la digestin con Rsa 1, se guard una alcuota de
1O JI de cONA purificado para chequear el efecto de la digestin. La digestin fue
realizada utilizando la fraccin purificada de cONA (-320 !JI), 36 JI de buffer de
digestin Rsal 1OX y 1,5 JI de enzima Rsal (1 O U /JI). La reaccin fue incubada a
3rC por 4 horas. Para confirmar la digestin, se realiz una electroforesis en gel
agarosa al 1,2% de 1O JI de cONA no cortados y 1O JI de cONA digerido con Rsal
(Figura xxx). Para terminar la reaccin se adicion al tubo 8 JI de 0,5 M de EOTA.
El cONA digerido posteriormente fue purificado, para esto se utiliz el kit E.Z.N.A.
Cycle-Pure (Omega bio-tek, Norcross, GA, USA). A cada reaccin le fueron
adicionados 6 volmenes de buffer CP, mezclando la solucin con pipeta y la totalidad
40
de volumen fue transferido a una columna HiBind DNA. Posteriormente, fue
centrifugado a 10.000 g por 1 min a TA y se descart el eludo. Luego, la columna fue
lavada dos veces con 700 JI y 500 JI de DNA Wash Buffer respectivamente y
centrifugacin a 10.000 g por 1 m in. Finalmente, el cONA fue recuperado desde la
desde la columna con 30 JI de agua MilliQ y centrifugacin a alta velocidad.

3.3.2 Sustraccin gnica mediante PCR-Select

Este mtodo permite la deteccin de secuencias gnicas diferencialmente

expresadas en una poblacin y no en otra. Aunque existe diferentes variaciones de
este mtodo, la teora bsica es simple: Primero ambas poblaciones de RNA son
convertidas a cONA. El cONA que contiene los transcritos de inters se denomina
tester y la muestra de referencia, driver. Tester y driver son hibridados y las secuencias
hbridas son removidas. Los fragmentos de cONA del tester que no hibridan, contienen
genes potencialmente presentes en el tester y no en el driver (Figura 7). La
metodologa SSH fue realizada con el protocolo del kit de Clontech con algunas
modificaciones. Durante la PCR secundaria el partidor PCR Nested primer 1 fue
reemplazado por la secuencia 5'- CTAATACGACTCACTATAGGGCTCGAGCGGCC-3'
que posee un sitio promotor T7 que permite la transcripcin in Vitro del amplicn
sustractivo, para la posterior hibridacin en el microarray.
El procedimiento realizado para la SSH se describe a continuacin:

a) Ligacin de adaptadores

Cada muestra tester es separada en dos alcuotas de 120 ng y sometidas a una

ligacin independiente con los adaptadores 1 y 2R, resultando dos poblaciones de
cONA tester. Como control de cONA tester no sustrado, en un tubo nuevo fueron
mezclados 2 JI de Tester 1 y 2 JI de Tester 2R. Posteriormente, las reacciones de
ligacin fueron incubadas a 16 oc durante 14 h. Finalizada la incubacin, la reaccin
es detenida aadiendo 1 JI de EDTA/Giicgeno a cada tubo e incubada durante 5 min

41
a 72 oc. Posteriormente, cada cONA tester y cONA control fue diluido 1:200 en agua
para la determinacin de eficiencia de la ligacin de adaptadores mediante PCR,
empleando los partidores PCR primer 1 y 3' GAPDH para amplificar fragmentos desde
cDNAs correctamente ligados y los partidores GAPDH 3'y GAPDH 5', para determinar
los niveles totales del cONA de GAPDH. Para completar la extensin de los
adaptadores la reaccin fue incubada a 75 oc por 5 min, seguida de un programa de
termociclado de 1 ciclo a 94 oc por 30 seg y 25 ciclos de 94 oc por 1O seg, 65 oc por
30 seg y 68 oc por 150 seg. Finalmente, 5 !JI de cada tubo fueron analizados en gel de
agarosa 1,2%. La eficiencia de la reaccin se relaciona presencia de la banda de 750
pb con los primer G3PDH 3' y PCR primer 1, que debe ser de una intensidad similar a
la banda de 500 pb obtenida con ambos primer para G3PDH.

b) Primera y segunda hibridacin

Durante la primera hibridacin fue mezclada separadamente una pequea

cantidad de cONA tester ligado con cada adaptador y un exceso de cONA driver.
Luego, se aadieron 2 gotas de aceite mineral a cada tubo, fueron centrifugados
brevemente, incubados a 98 oc por 90 seg y finalmente a 68 oc por 8 horas.
En la segunda hibridacin, las dos muestras de la primera hibridacin se
mezclaron e hibridaron con un exceso de cONA driver desnaturalizado. Durante esta
reaccin 1 !JI de cONA driver digerido (300 ng/IJI) fue diludo, con 1 1-11 de buffer de
hibridacin 4X y 2 1-11 de agua estril. Luego, 1 !JI de esta dilucin fue desnaturalizado a
98 oc por 90 seg y mezclado simultneamente con las muestras de hibridacin 1 y 2R.
Esta reaccin fue incubada a 68 oc por 12 h. Durante esta etapa se enriquecern los
genes diferencialmente expresados mediante la formacin de molculas hibridas que
contendrn diferentes adaptadores en cada extremo.

e) Amplificacin por PCR

Luego de la segunda hibridacin, los cONA diferencialmente expresados son

amplificados selectivamente mediante dos amplificaciones por PCR. La primera

42
amplificacin de las secuencias tester especficas se realiz utilizando el partidor PCR
1. Posteriormente, para la PCR secundaria (nested) se emplearon los partidores PCR
nested primer 1 modificado y el PCR nested 2R para reducir los niveles de
amplificacin inespecfica y enriquecer las secuencias diferencialmente expresadas.
Las condiciones del PCR primario fueron las siguientes: una incubacin de 75C por 5
min, seguida por un total de 27 ciclos a 94 oc por 30 seg, 66 oc por 30 seg y 72oC por
90 seg. Para la PCR secundaria se utilizaron las mismas condiciones de termociclado,
pero solo durante 12 ciclos a una temperatura de annealing de 68 C. Finalmente,
ambos productos de PCR fueron chequeados en un gel de agarosa al 1,2%.

d) Evaluacin de la eficiencia de la sustraccin.

La eficiencia de la sustraccin fue analiada mediante el monitoreo por PCR

cuantitativa en tiempo real de genes controles en muestras sustradas y no sustradas.
La reaccin de PCR fue preparada con el reactivo Brillant 111 de Stratagene y cargada
con 2 ng de amplicn sustractivo y amplificada en un equipo Stratagene Mx3000p
(Stratagene, Cedar Creek, TX, USA) con el siguiente programa de termociclado: 1 ciclo
de 3 min a 95 C; 55 ciclos de 1O seg a 95 C, 15 seg a 60 C y 15 seg a 72. El retraso
de la amplificacin en ms de cinco ciclos amplificacin de la muestra sustrada
comparada con la muestra sin sustraer es considerado como eficiente.

3.4 Amplificacin y marcaje de las muestras

La amplificacin y marcajde las muestras se realiz mediante transcripcin In

Vitro empleando kit comercial SuperScript lndirect RNA Amplification System
(lnvitrogen, Carlsbad, CA, USA). El fundamento molecular se describe en la figura 9.

43
 mRNA
~

... --;_
-
1
.
-,..-,... .. .... ~ AAAAAAA

Sntesis primera
Transcriptasa Reversa
TTTTTTITT-Promotor T7

hebra cONA mRNA:::::::::::::::::::::::::::::::AAAAAAA

1 hebracDNA TTTTTTITT-PromotorT?

! Rnasa HE. coli

TTTTTTITT-P

cONA doble hebra 121 hebra

hebra cDNA-
! AAAAAAA-PromotorT7
cDNA TTTTTTITT-PromotorT7

! NTPs + Aminoallyl Uracilos + RNA Polimerasa T7

Amplificacin de mRNA: Transcripcin In Vitro mediada porT7

.:::::::::::::::~uuuuuuuu uuuuuuuu
............ ..............uuuuuuuu
uuuuuuuu
aRNA
aminoallyl

............................ ~
amplificado

Figura 9. Transcripcin In Vitro conducida por promotor T7. La primera hebra de

cONA es sintetizada a partir de un mRNA, empleado un primer politimina-promotor T7
y la enzima SuperScript 11/. La segunda hebra es sintetizada con una polimerasa de E.
co/i que emplea como primers pequeas secuencias de RNA, resultantes de la
degradacin incompleta producida por la RNasa H de E. coli. La enzima ligasa de E.
coli une los puentes restantes entre los nucletidos. La doble hebra de cONA es
incubada con nucletidos normales y uracilos modificados con cadenas alifticas
(Uracilo aminoal/yl) para la amplificacin de aRNA. A continuacin, el aRNA generado
es conjugado covalentemente con los fluorforos correspondientes.

El protocolo es descrito a continuacin:

a) Sntesis de la primera hebra de cONA

La reaccin para la sntesis de la primera hebra de cONA se prepar a partir de

1 IJg de RNA, en el caso de estrategia Directa, y 500 ng de cONA sustrado en el caso
de la estrategia SSG. A cada reaccin se le aadi 1 J.JI de primer T7-oligo(dT)
completando a un volumen de 1O 1-11 con agua desionizada estril. La solucin fue

44
incubada a 70 oc por 1O min y luego en hielo por 1 min. Terminada la incubacin, fue
adicionada a la reaccin una mezcla con 4 IJI de 5X First-Strand Buffer, 2 IJI de OTT O, 1
M, 1 IJI de dNTP mix 1O mM, 1 IJI de RNaseOUT (40 U 1 IJI) y 2 IJI de SuperScript 111 RT
(200 U 1 IJI). Posteriormente, la reaccin fue incubada a 46 oc por 2 horas y a 70 oc
por 10 min.

b) Sntesis de la segunda hebra de cONA y purificacin

Luego de terminada la sntesis de la primera hebra, los 20 IJI de la reaccin

fueron adicionados a una mezcla constituida por 91 IJI de AOESI-OEPC, 30 IJI de 5X
Second-Strand Buffer, 3 IJI de dNTP mix 1O mM, 4 IJI de E. coli DNA Polymerase 1 (1 O

U/ul), 1 IJI de E. coli ONA Ligase (1 O U 1 IJI) y 1 IJI E. coli RNase H (2 U 1 IJI).
Gentilmente, se homogeiniz la solucin con la pipeta y se incub a 16 oc por 2 horas
(Figura 8). Finalmente, la reaccin fue colocada en hielo. Para la purificacin del cONA,
los 150 IJI de la reaccin fueron mezclados con 500 IJI de cONA Loading Buffer y
transferidos a la columna Low-Eiution Volume Spin Catridge. El eludo fue descartado
por centrifugacin a 6.000 g a TA por 1 min. Posteriormente, la columna fue lavada
con 700 IJI de cONA Wash-Buffer y centrifugada a 6.000 g por 1 min a TA. Para
eliminar el buffer residual la columna fue centrifugada nuevamente a 6.000 g por 2 min.
Finalmente, se agregaron 24 IJI de AOESI-OEPC al centro de la columna incubndose
por 2 mina T.A. El cONA fue eludo por centrifugacin a 10.000 g por 1 mina TA.

e) Transcripcin In Vitro y purificacin de aRNA.

Para proceder a la transcripcin in vitro del cONA de doble cadena, al cONA

eludo en el paso anterior se le adicionan los siguientes componentes: 1,5 IJI de ATP
(100 mM), 1,51JI de CTP (100 mM), 1,51JI de GTP (100 mM), 0,751JI de UTP (100 mM),
2 .JI de aa-UTP (50 mM), 4 IJI de 1OX T7 Reaction Buffer y 7 IJI de T7 Enzyme Mix. La
solucin fue mezclada e incubada a 37 C por 14 horas aproximadamente. Terminada
la incubacin se eliminaron las trazas de cONA mediante la adicin de 2 IJI de ONase 1

(1 U 1 IJI) e incubacin a 37 C por 30 min. Para la purificacin de aRNA, se adicion a

45
la reaccin 160 IJI de aRNA Binding Buffer y 100 IJI de Etanol 100%. La solucin fue
mezclada con la pipeta y luego transferida a la columna Purelink Spin Column. El
eludo fue descartado por centrifugacin a 12.000 gaTA por 15 seg. La columna fue
lavada dos veces con 500 j.JI de aRNA Wash-Buffer y centrifugada a 12.000 g por 15
seg a T.A. El buffer residual fue eliminado de la columna por centrifugacin a 12.000 g
durante 2 min. Finalmente, se agreg 100 IJI de ADESI-DEPC al centro de la columna
e incub por 1 mina T.A. El aRNA fue eludo por centrifugacin a 12.000 g por 2 mina
TA.

d) Cuantificacin y marcaje del aRNA

Una vez terminada la amplificacin, el aRNA fue cuantificado y se procedi al

marcaje con el fluorforo correspondiente. El aRNA proveniente de las muestras
normales y tumorales sustradas y sin sustraer fue marcado con Alexa Fluor 647,
mientras que el aRNA de la referencia fue marcado con Alexa 555 (lnvitrogen,
Carlsbad, CA, USA). Para realizar la incorporacin del fluorforo se redujo el volumen
inicial de 5 j.Jg de aRNA a 3 IJI utilizando una centrfuga al vaco (Speed vac, Savant,
NY, USA). Una vez alcanzado el volumen de reaccin, el fluorforo correspondiente
fue resuspendido en 46 j.JI de DMSO (volumen para 4 reacciones). Posteriormente, el
aRNA concentrado fue combinado con 8 j.JI de 2X Coupling Buffer y 11 IJI del fluorforo
resuspendido, la mezcla fue mezclada con vrtex, centrifugada brevemente e incubada
por 30 min aTA en oscuridad. Finalmente, el aRNA marcado fue purificado como se
describi anteriormente.
Luego de la purificacin del aRNA, se determin la eficiencia de incorporacin
de picomoles de fluorforo empleando para ello un espectrofotmetro Nanodrop ND
1000 que mide simultneamente la cantidad de RNA y el fluorforo incorporado.

46
 3.5 Hibridacin de los microarrays

Los vidrios utilizados para la hibridacin fueron 48,5K The Human Exonic
Evidence Based 0/igonuc/eotide (HEEBO) (Microarray lnc, Huntsville, USA). Este
microarray est constituidos por un set 48.958 sondas de oligonucletidos de 70 Mer,
de las cuales 40.604 representan sondas especficas de genes y 4.650 sondas de
control. Este microarray fue desarrollado por una colaboracin entre la Universidad de
Stanford e !Ilumina. Para la hibridacin de los vidrios se siguieron las instrucciones del
proveedor que se describen a continuacin.

a) Prehibridacin de los vidrios

La pre-hibridizacin en un paso que se realiza para aumentar la sensibilidad de

la seal. Durante este procedimiento se incuban dos slides de microarray en un tubo
de 50 mi con la solucin de pre-hibridizacin (SSC 5X, SDS O, 1% y O, 1% BSA) a 50 oc
durante 30 min. Luego, los slides son lavados 5 veces durante intervalos de 1 min con
agua desionizada. Finalmente, los vidrios fueron secados mediante centrifugacin.
Los cubreobjetos de vidrio para los microarrays (25 x 60 mm) fueron lavados
con etanol 70% y secados cuidadosamente. Por ltimo, los bordes de los slides fueron
marcados con un lpiz hidrfobo (Pen, Burlingame, CA, USA) para evitar la prdida de
la solucin durante la hibridacin.

b) Hibridacin de los vidrios

La sonda de hibridacin contuvo 60 pmoles de aRNA de referencia universal

marcado con Alexa Fluor 555 y 60 pmoles de aRNA de la condicin experimental
marcado con Alexa Fluor 647 en un volumen final de 25 .JI. Esta solucin fue
combinada con 25 .JI del buffer de hibridacin 2X (formamida desionizada 50%, SSC
1OX, SDS 0,2%, 0.02% DNA esperma de salmn) en un tubo mbar de 1,5 mi y fue
incubada a 95C por 2 min. El volumen total de reaccin fue distribuido sobre la
superficie del arreglo, cuidando de no formar burbujas. Finalmente, los vidrios fueron
47
incubados en un horno de hibridacin (lnSiide Out, Boekel Scientific, Pennsylvania, PA,
USA) a 42C durante 16 horas.

e) Lavados post-hibridacin

Luego de hibridar la sonda es necesario remover el material excedente que no fue

hibridado en la matriz, para esto todos los vidrios fueron lavados 4 veces en agitacin,
cuidando de no secar el vidrio entre lavados. El primer lavado se realiz durante 5 min
utilizando la solucin de lavado 1 (SSC 2X, SOS O, 1%) previamente calentada a 42 C.
El segundo lavado se realiz durante 5 min con solucin de lavado 2 (SSC 0,1X, SOS
0,1%) aTA y los dos ltimos lavados durante 1 min utilizando solucin 3 (SSC 0,1X).
Finalmente, los vidrios fueron secados por centrifugacin y escaneados en un
ScanArray Gx Microarray Scanner (Perkin Elmer, Waltham, MA).

3.6 Extraccin de !a fluorescencia y anlisis bioinformtico

La intensidad de seal de los vidrios fue cuantificada con el Software SpotReader

(Niles Scientific, USA). Para el grillado de la imagen se utiliz el patrn de "orange
pack 1" y crculo elptico adaptativo. Los artefactos dentro del slide fueron eliminados
de forma manual. El anlisis de los datos y la obtencin de los genes diferenciales
fueron realizados en colaboracin con el Dr. Elmer Fernndez del Grupo de Minera de
Datos, Facultad de Ingeniera de la Universidad Catlica de Crdoba (UCC), Argentina.
El anlisis de los chips se realiz mediante el programa estadstico "R" (www.r-
proyect.org) y el paquete de anlisis LIMMA junto con aplicaciones propias de modelos
mixtos. Los datos fueron procesados usando los mtodos de sustraccin de fondo
standard y normexp [97]. El mtodo standard es la sustraccin clsica donde a cada
spot se le resta su fondo directamente. El mtodo normexp el fondo como una
distribucin mezcla entre normal y exponencial. Para la normalizacin dentro del vidrio
se utiliz el mtodo printipploess y para normalizacin de intensidades entre vidrios se
utilizaron dos mtodos de normalizacin: GQuantile y SCALE utilizando la funcin

48
mediana de sus desvos absolutos (MAD) [98]. La normalizacin de GQuantile supone
que dado que todos los vidrios estn hibridados con la referencia universal marcada
con fluorforo verde (Aiexa 555), esta debera tener el mismo comportamiento en todos
los slides, por lo tanto los datos son forzados a seguir este comportamiento y se
genera una distribucin nica basada en los cuantiles del flurforo Alexa 555, la cual
es posteriormente utilizada sobre todos los vidrios. La normalizacin "SCALE" supone
que dado que los valores a comparar tumor versus adyacente son los cocientes entre
muestra/referencia universal, el logaritmo de este cociente (LogFC) debe tener un
comportamiento "normal". Esta normalizacin tiende a hacer que las distribuciones del
LogFC tengan una distribucin simtrica semejante para cada chip. Para la obtencin
de genes de expresin diferencial entre las muestras tumorales y las adyacentes al
tumor, se utiliz el siguiente modelo lineal: LogFCtgp = J-19 + f3t+ pp + f.tgp, donde J-19 es un
efecto global del gen "g", f3t es el efecto del tumor (parmetro de inters), Pp,..,.N(O. v;)
es el efecto aleatorio que modela el apareamiento de las muestras de un mismo
paciente y Et:gp""N(O,a:) es el error. El parmetro J-19 contiene la expresin global del gen
ms el efecto del tejido adyacente, por lo que el parmetro f3t nos indica si el tumor
produce un efecto en exceso o en depreciacin de la expresin. Para la identificacin

Alexa 555 Alexa 647 Imagen compuesta

de los genes que se diferencian con respecto a Tumor versus Adyacente se evala si e
Figura 10. Imagen representativa de s/ide de microarray HEEBO hibridado. El
escaneo del slide fue realizado con una resolucin de 5 1Jm. La imagen compuesta es
generada por la sobreposicin de la imagen Alexa 555 y Alexa 647.

49
este parmetro f3t es estadsticamente distinto de cero. Por otro lado, dadas las
caractersticas de este tipo de experimento y la baja cantidad de muestras tambin
imponemos como condicin que este valor supere un determinado umbral.
El parmetro Jlg contiene la expresin global del gen ms el efecto del tejido no
neoplsico, por lo que el parmetro f3t nos indica si el tumor produce un efecto en
exceso o en depreciacin de la expresin. Para la identificacin de los genes que se
diferencian con respecto a Tumor versus Adyacente se evala si este parmetro f3teS
estadsticamente distinto de cero. Por otro lado, dadas las caractersticas de este tipo
de experimento y la baja cantidad de muestras tambin imponemos como condicin
que este valor supere un determinado umbral.
La determinacin de estos umbrales (tanto para la significancia estadstica, como
para el umbral del nivel de expresin) no es trivial y no existe un consenso especfico,
lo cual implica que su determinacin sea caracterstica de cada experimento y basada
en la premisa de encontrar informacin biolgicamente relevante.
La visualizacin de los datos mediante heatmaps fueron realizados con el
programa MeV: multiExperimentis Viewer que es parte de TM4 Microarray Software
Suite (http://www.tm4.org/mev/) [99].
Los anlisis de enriquecimiento de funciones y de vas de sealizacin se
realizaron utilizando la base de datos DAVID Bioinformatic Resources 6.7. La
significancia estadstica (valor p <0.05) es calculada con un test exacto de Fisher
modificado (EASE score) [100].

3.7 Sntesis de cONA y PCR cuantitativo en tiempo real

Para la sntesis de cONA se utiliz el kit comercial AffinityScript qRT-PCR

(Stratagene, Cedar Creek, TX, USA), siguiendo las especificaciones del fabricante. La
transcripcin reversa se realiz a partir de 1 .Jg de RNA y como primers se us una
mezcla de oligo(dT) (170 ng) y random primer (30 ng) en un volumen total de 20 !JI. La
combinacin de estos dos tipos de primers permite enriquecer los extremos 3' y 5'del
cONA, optimizando la calidad del templado. La reaccin fue incubada durante 5 min a

50
25C, 45 min a 42 oc y 5 min a 95C. La reaccin de qPCR fue realizada en un
volumen total de 20 JI, utilizando como templado 2 JI de cONA previamente diluido
1/1 O y una mezcla de 0,5 JI de partidores (1 O !JM), 1O JI Brilliant 11 SYBR Green
(Stratagene, Cedar Creek, TX, USA) y 7,5 JI de agua desionizada. La reaccin de
qPCR se realiz en un termociclador de tiempo real Stratagene Mx3000p (Stratagene,
Cedar Cree k, TX, USA), utilizando el siguiente ciclo termal: 1O min a 95C y 45 ciclos
de 15 sega 95 oc, 15 sega 60 oc, 15 sega 72 oc.
El programa AmplifX v1.5.4 fue empleado para el diseo de los primers y
posteriormente contrastados con la herramienta web PrimerBLAST para confirmar
especificidad (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Las secuencias de los
primers empleados son descritas en la tabla 2. Luego de las reacciones de PCR, los
amplicones fueron analizados mediante gel de electroforesis en agarosa 1% para
confirmar la amplificacin de un fragmento nico y corroborar peso molecular
correspondiente. El fragmento nico fue contrastado a su vez con la curva de melting
obtenida durante la fase final de la qPCR. Las eficiencias de las reacciones de PCR
fueron evaluadas empleando el programa LinReg con el objetivo de establecer que las
eficiencias estuvieran dentro de rangos aceptables de 90 a 110%, sin embargo, tres
pares de primers tuvieron porcentajes menores a 90% [101].
La identificacin de genes normalizadores fue realizada usando el software
GeNorm (http://medgen.ugent.be/-jvdesomp/genorm/) empleando los datos de todos
los genes en estudio ms un panel de genes normalizadores candidatos. El propsito
de la normalizacin es remover las diferencias en las muestras (como cantidad o
calidad de RNA) con el objetivo de identificar la variacin real especfica del gen. Los
genes normalizadores o controles internos deben poseer una variacin mnima. Para
validar la estabilidad de los genes el algoritmo del software Genorm mide un valor M
comparando el promedio de variacin pareada entre cada gen y todos los dems. A
menor valor M menor es la variabilidad, permitiendo as indentificar los mejores genes
normalizadores [1 02]. Escogimos desde la literatura un panel de cinco genes
candidatos [1 03, 104], los cuales fueron analizados en muestras pancreticas
provenientes de pacientes y lneas celulares. Los genes QARS y TBP fueron

51
identificados como los genes ms estables y fueron usados como normalizadores para
los posteriores experimentos de qRT-PCR (Figura 10).

Smbolo Sentido Secuencia 5'-->3' Amplicn Eficiencia

QARS Forward ACCTGAACCTGGCATCACTACA 100 pb 101%
Reverse CCAAGACGCTCAAACTGGAACT
TBP Forward ACCAGGTGATGCCCTTCTGTAA 180 pb 99%
Reverse CCTCAAACCAACTTGTCAACAGC
CALU
Forward CAGCAACTGAACCTGCCATT 66 pb 93.50%
Reverse TTGGGCCAAGCTTTCCTAGA
BHLHE40 Forward CACGATCAGCAATCAGGCATAGT 150 pb 102%
Reverse CAACGGCATATGGAGTGTCCTT
TOP2A
Forward TTCAGCTCTTGACCTGTCCC 108 pb 93.50%
Reverse CAAATGTTGTCCCCGAGTCT
COL4A1
Forward CGTAAGCACATTCGGGCCATTT 108pb 102%
Reverse TCAGGCCTAGTGGTCCGAATCT
CTSK
Forward TTTCCCTGACAGCTGTGTACTC 109 pb 99%
Reverse TGTGAAAATCTCCAGCCTGTACC
Forward ACTTTTGGGAGCACGGACTGT 143 pb
SPARC 99%
Reverse TTTTGGCCTTCCTGGCTGAAAC
FN1
Forward AAGGCTTGAACCAACCTACGGA 128 pb 91.50%
Reverse AAAGCCTAAGCACTGGCACAAC
IGFBPS
Forward TGTGTACCTGCCCAATTGTGAC 116 pb 97%
Reverse GCAGCTTCATCCCGTACTTGT
PMEPA1
Forward TGCGTAGGTGAAAAGGCAGAAC 149 pb 91.50%
Reverse AGCTTGTGCATTCAGACCAGAC
SBN02 Forward ACCCTTGAAATCCGTGAAACCG 170 pb 86.30%
Reverse AGAGGTGAGCGGGCAATAACT
CD55 Forward GCTTTGGAAGGCCGTACAAGTT 196 pb 99.50%
Re verse AAGGCTGTTTGAGGGATGCAGA
OASL Forward AGCAGGTGCTCCTTAGCCAAAT 146 pb 88.50%
Reverse AGGATGAAGCTGTTGGGGTTGA
KNG1 Forward ATTGACTTCGTGGCCAGGGAAA 168 pb 97.3
Re verse TCCCAGTGGTTGACAGTTGACA
SYT12 Forward TTCCCCATCGCAAATGCAGTTC 191 pb 77%
Re verse TTGGACCTCTGGTTCTTGCCAT
MMP7 Forward TGGGACATTCCTCTGATCCT 165 pb 88%
Reverse TGAATGGATGTTCTGCCTGA
LAMA3 Forward TGCAGATGCAAGCCCAGAATCA 109 pb 99.40%
Reverse GCTCAGTCCCATCTCTGTTGCAAT
SYNE2 Forward CTGATGCTCGCTGGAAAGAGTT 171 pb 96.80%
Reverse GCCGCAGTGCTGTCTCTAAA
PLEKHM1 Forward AAGTGACCTGGTCCTAAGCTGT 105 pb 94.50%
Reverse GGCAAGTTCAGTGATGCTTTGG
DPYSL4 Forward AGCCCTCATCCAGGGAAGTTTT 175 pb 90%
Reverse TTCACATCAGAGGCAGGATGAC
STAT1 Forward TCCGTGGCACTGCATACAATCT 184 pb 93.70%
Reverse TGCCGAATTCCCAAAGGGCAAA

52
Tabla 2. Secuencia de primers usados para la verificacin de ambas estrategias
mediante qRT-PCR. Smbolo azul=genes normalizadores; Smbolo verde= genes de
la estrategia Directa; Smbolo rojo=genes de a estrategia SSH.

Valores de estabilidad de expresin promedio de genes normalizadores

POL2R TFCP2 UBE2D

Genes menos estables Genes ms estables
111(
Figura 10. Genes de mayor estabilidad identificados mediante el programa
Genorm. QARS= glutaminyl-tRNA synthetase; TBP= TATA box binding protein;
UBE2D2= ubiquitin-conjugating enzyme E2D 2; TFCP2= transcription factor CP2;
POL2R= polymerase (RNA) 11 (DNA directed) polypeptide L, 7.6kDa.

El procesamiento de los datos de qPCR fue realizado con el software de

Stratagene MxPro, siguiendo las intrucciones del proveedor. El anlisis estadstico de
los datos fue realizado con el Software GraphPad Prism version 5.0 (GraphPad
Software lnc., San Diego, USA), utilizando anlisis de tipo t-test de student y los
valores de p value < 0.05 fueron considerados estadsticamente significativos.

3.8 lnmunohistoqumica

3.8.1. Anticuerpos

Los siguientes anticuerpos fueron empleados en este estudio: PLEKHM1

(Human Atlas Protein HPA021558; dilucin 1:75); MMP7 (R&D Systems; dilucin
1:500); STAT1 (Affinity antibodies; dilucin 1:400); DPYSL4 (Abcam; dilucin 1:600);
WNT9A (Human Atlas Protein HPA011223; dilucin 1:25); BHLHE40 (Human Atlas
Protein HPA028921; dilucin 1:300), PMEPA1 (Abnova H00056937-M01; 1:100),
53
CALU (Human Atlas Protein HPA006018; dilucin 1:300). Adicionalmente las muestras
fueron procesadas con anticuerpos anti-p53 (Dako clone D0-7; dilucin 1:250) para
deteccin de p53 mutado; anti-Ki67 (Dako clone MIB-1; dilucin 1:200) para evaluar
proliferacin celular y anti-keratina 19 (Thermo scientific; dilucin 1:1 000) para
identificar clulas de origen epitelial. Las diluciones de trabajo de todos los anticuerpos
fueron testeadas en controles positivos para establecer concentracin ptima.
Las tinciones inmunohistoqumicas de los anticuerpos anti-PMEPA 1, anti-
BHLHE40 y anti-CALU fueron realizados en colaboracin con el Dr. lvn Roa y la TM
Soledad Lantadilla del Laboratorio de Patologa y Biologa Molecular de la Clnica
Alemana de Santiago. Los tejidos tumorales y adyacentes fueron fijados por inmersin
en formalina tamponada neutra al 10 % (pH 6.8-7.2), deshidratadas en diluciones
seriadas de alcohol, clarificadas con xileno y embebidos en bloques de parafina.
Luego, se cortaron secciones de 4 Jm usando un microtomo de rotacin (RM 2245,
Leica Nussloch, Germany), las cuales fueron posteriormente montadas sobre un
portaobjetos silanizado. Antes de proceder con la inmunohistoqumica, las secciones
fueron incubadas a 60 oc durante 30 min, desparafinadas en xileno y rehidratados en
diluciones seriadas de etanol. La recuperacin antignica se realiz en buffer citrato a
10 mM (pH 6.0) en una vaporera durante 10 min. Para eliminar la actividad peroxidasa
endgena, los portaobjetos fueron incubados con una solucin acuosa de perxido de
hidrogeno al 3% durante 1O m in a temperatura ambiente y lavados con buffer TBS-
Tween O, 1% (TBS-T). El bloqueo de cargas inespecficas se realiz con una solucin
bloqueadora de protenas durante 15 min a temperatura ambiente (DAKO, #X0909).
Luego los cortes fueron incubados con 100 !JI de cada anticuerpo primario diludo
adecuadamente en solucin diluyente de anticuerpo (DAKO, #S3022) durante 40 min a
temperatura ambiente en cmara hmeda. Luego de la incubacin, los cortes fueron
lavados con una buffer TBS-T e incubados con 50 !JI de anticuerpo secundario HRP
polmero conjugado por 15 min a temperatura ambiente en cmara hmeda (Super
Picture Polymer, lnvitrogen Cat. N. 87-8963). Posteriormente, los cortes fueron
lavados con TBS-T e incubados con 50 !JI de sustrato cromgeno (Nova Red, Vector
Lab. # SK-4800), monitoreando la reaccin bajo microscopio. Para diferenciar las
estructuras celulares las secciones fueron contrateidas con hematoxilina de Mayer y
54
alcalinizadas con solucin de carbonato de litio saturada. Finalmente, fueron
deshidratadas con diluciones de alcoholes, aclaradas en xileno y montadas.
El anlisis de los tissue arrays de los anticuerpos anti-PMEPA 1, anti-BHLHE40 y
anti-CALU fue analizado semicuantitativamente asignando scores a la intensidad y
celularidad. La intensidad de la tincin fue evaluada en una escala de 0-3 (O=negativo;
1=1eve; 2=moderada y 3=fuerte). El porcentaje de clulas con inmunoreactividad fue
evaluada en una escala de 1-4 (1=0-25% de clulas positivas; 26-50% de clulas
positivas; 51-75% de clulas positivas y 76-100% de clulas positivas). El staining
score fue calculado como el mltiplo de la intensidad y a celularidad, generando una
escala de 0-12.
Las tinciones inmunohistoqumicas de los anticuerpos anti-PLEKHM1, anti-
WNT9A, anti-MMP7, anti-STAT1, anti-DPYSL4, anti-Ki67, anti-Keratin 19 y anti-p53
fueron realizadas en colaboracin con el Dr. Julio Celis y la Dra. Teresa Cabezn del
Group Cancer Proteomics del Danish Cancer Society Research Center, Copenhagen,
Denmark. Cortes histolgicos de 4 .Jm fueron montados en slides Super Frost,
incubados a 65C durante 60 min, desparafinados, bloqueadas con perxido de
hidrgeno 1% durante 1O min y rehidratados mediante sucesivas incubaciones en
alcoholes graduados. La recuperacin antignica fue realizada incubando los slides en
un buffer de Tris/EDTA pH 9.0 (10mM Tris, 1mM EDTA) y calentados en microondas a
750W durante 1O min. Posteriormente, las muestras fueron incubadas en suero 1% en
buffer TBS para bloquear tincin inespecfica. La presencia del antgeno fue evaluada
incubando las muestras durante 45 min con el anticuerpo primario seguido de una
deteccin con anticuerpo secundario conjugado a un complejo peroxidasa EnVision
poly-HRP system (DAKO) durante 45 min. Luego las muestras fueron incubadas con
DAB+Chromogen (DAKO) durante 15 min para el desarrollo del color y finalmente
contrastadas con hematoxilina.
El anlisis de las tinciones inmunohistoqumicas para los anticuerpos anti-
PLEKHM1, anti-WNT9A, anti-MMP7 y anti-STAT1 fue realizado usando el sistema
automtico ACIS 111 (DAKO) para digitalizar y cuantificar la tincin IHQ. El software
ACIS 111 permite reconocer de forma separada pixels de color caf (tincin positiva) y
pixels de color azul (contratincin de hematoxilina). Para el anlisis de los TMAs

55
generamos un staining score en funcin de la intensidad de la tincin y el porcentaje de
clulas que presentan inmunoreactividad dentro del core (staining score).

56
4. RESULTADOS

4.1 Diseo experimental

Las muestras de PDAC y sus respectivos tejidos no neoplsicos fueron

analizadas mediante dos estrategias. La primera, denominada estrategia Directa,
consiste en amplificar el RNA mediante transcripcin In Vitre e hibridar el material
directamente en el microarray. Esta estrategia busca evaluar el transcriptoma nativo
sin pasos previos de intervencin. La segunda estrategia, denominada SSH, consiste
en aplicar la hibridacin sustractiva por supresin a los tejidos tumorales y no
neoplsicos (testers), empleando un tejido normal de pncreas como muestra
sustractora (driver). Esta estrategia permite detectar genes diferenciales entre las
muestras en estudio y enriquece transcritos de expresin especfica. Estos genes no
son detectados mediante la estrategia Directa de microarray [88, 90].
Tanto para la estregia Directa como para la estrategia SSH, las muestras
tumorales y no neoplsicas fueron comparadas entre s, empleando un diseo de
referencia (Figura 6) [81]. Las muestras objetivo fueron hibridadas con el fluorforo
Alexa 647 que emite fluorescencia color rojo. De la misma manera, se obtuvo aRNA a
partir de una muestra Referencia Universal marcada con el fluoroforo Alexa 555, que
emite fluorescencia de color verde. Cada muestra tumoral y no neoplsica (en ambas
estrategias) fue incubada competitivamente con la muestra Referencia Universal. De
esta manera, la muestra de referencia se encuentra hibridada de manera comn en
todos los microarrays. En la figura 11 se describen las etapas del diseo experimental.

57
 Seis tejidos de ADP y sus correspondientes
tejidos adyacentes no neoplsticos

l 1
Extraccin de RNA y
anlisis de integridad
J
1 1
[ Estrategia Directa J [ Estrategia SSH l
t
Sntesis de cONA
Amplificacin de cONA mediante

--
tecnologa SMART
Digestin con RSAI
........_
1 TESTER 1 DRIVER
Sntesis cONA
Transcripcin In vitro y marcaje [ Ligacin de
adaptadores
J Tejido
normal
J
+
Hibridaciones
PCR primario y anidado
Purificacin y eficiencia de SSH
Hibridacin en microarrnys HEEBO
Escaneo y extraccin de la fluorescencia +
Transcripcin In vitro y marcaje
Hibridacin en microarrays HEEBO
Escaneo y extraccin de la fluorescencia

..
Anlisis bioinformtico
Validacin de datos mediante qRT-PCR
Anlisis de ontologa de genes y pathways

Validacin de genes candidatos a nivel de

protena en tejidos de ADP, tejidos no
neoplsicos y tejidos normales mediante IHQ.

Figura 11. Diseo experimental. Seis tejidos de ADP y sus respectivos tejidos no
neoplsicos fueron empleados como testers, mientras que un tejido normal de
pncreas fue empleado como driver. SSH= Subtractive supressive hybridization;
ADP=Adecarcinoma ductal pancretico; HEEBO= Human Exonic Evidence Based
0/igonuc/eotide; qRT-PCR= quantitative reverse transcription - polymerase chain
reaction; IHQ= inmunohistoqumica.

58
4.2 Estrategia Directa

Para el anlisis del transcriptoma de los tejidos tumorales y adyacentes fueron

empleados microarrays de oligonucletidos HEEBO provistos por Microarray lnc
(http://www.microarrays.com/). Este microarray permite la medicin de alrededor de
40.600 transcritos mediante sondas especficas.
Luego de la extraccin de RNA desde los tejidos tumorales y no neoplsicos,
cada muestra fue sometida a una transcripcin In Vitro con el objetivo de amplificar
material suficiente para ser hibridado sobre los slides de microarray. La transcripcin In
Vitre mediada por promotor T7 es una de las metodologas ms populares y eficientes,
permitiendo obtener aRNA amplificado que conserva la abundancia relativa de
transcritos observada en la muestra original [1 05]. Las muestras objetivo fueron
posteriormente marcadas con el fluorforo Alexa 647 (color rojo) e hibridado de forma
comparativa frente a un mismo aRNA de referencia Universal (Ciontech) marcado con
Alexa 555 (color verde). Los fluorforos Alexa 555 y 647 son ms fotoestables y
presentan una mayor correlacin de seal que los colorantes clsicos Cy3 y Cy5 [1 06].
La descripcin de los resultados de la estrategia directa ser abordada en
captulos posteriores en conjunto con los resultados de la estrategia SSH.

4.3 Estrategia SSH

La hibridacin sustractiva por supresin (SSH) es una tcnica descrita por

Diatchenko et al, 1996 y que facilita la deteccin de genes diferencialmente
expresados entre dos sistemas biolgicos complejos [96]. Este procedimiento, consiste
en dos pasos sucesivos de hibridacin entre una muestra prueba que presenta los
transcritos de inters (tester) y un exceso de RNA mensajero proveniente de una
muestra control (driver), que conduce a la normalizacin de molculas especficas en
la muestra tester, con lo que se favorece el enriquecimiento de los transcritos de baja
abundancia (Figura 7). Sin embargo, uno de los principales inconvenientes de esta
tcnica es que para la deteccin de los transcritos se requiere de la creacin de una
biblioteca sustractiva que conlleva muchas veces a la prdida de informacin y con
esto se ve limitada la sensibilidad de la tcnica [90]. Por otro lado, la tecnologa de
59
microarray ofrece una extraordinaria plataforma para la deteccin de una gran cantidad
de transcritos, siendo una limitante importante la baja sensibilidad que presenta esta
metodologa para la deteccin de transcritos de bajo nivel expresin [1 07]. Por lo tanto,
la combinacin de ambas tecnologas sera una herramienta de alto rendimiento y
sensibilidad para la deteccin de transcritos raros y de baja abundancia [90].
La estrategia SSH fue desarrollada en paralelo con la estrategia Directa,
empleando los mismos seis tejidos tumorales con su respectivo tejido adyacente no
neoplsico (Figura Diseo). Las muestras tester tumorales y no neoplsicas fueron
sustradas de forma independiente contra una muestra pool de RNA normal
pancretico como driver.
Debido a la baja cantidad de RNA extrada a partir de las muestras en estudio,
amplificamos los RNA poli-A mediante la tecnologa SMART, basada en la tcnica de
PCR (ver Material y Mtodos 3.5.1 ). De esta manera fue obtenido el material suficiente
para comenzar el protocolo de SSH. Para acoplar la ltima etapa de la SSH con la
transcripcin In Vitro (paso previo de la hibridacin sobre el microarray), el partidor
PCR nested primer 1 fue modificado mediante la adicin de la secuencia del promotor
T7. En la PCR secundaria (nested) se emplea el partidor PCR nested primer 1
modificado en conjunto con el PCR nested primer 2, para de esta forma amplificar
mediante PCR las secuencias diferencialmente expresadas y a la vez, incorporar en
cada transcrito el promotor necesario para la posterior sntesis de aRNA (Figura 12).

60
 PCR Primaria

Promotorl7
Adaptador 1 S'-CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT-3'
1 1
5'-CTAATACGACTCACTATAGGGC-3'
PCR primer 1
Promotorl7
Adaptador 2R S'-CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT-3'

PCR Secundaria (Nested}

Promotorl7
Adaptador 1 5'-CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT-3'
1 1
5'-CTAATACGACTCACTATAGGGCTCGAGCGGCC-3'
Nested PCR primer 1 modificado

Promotorl7
Adaptador 2R 5'-CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT-3'
1 1
5'-AGCGTGGTCGCGGCCGAGGT-3'
Nested PCR primer 2R

Figura 12. Primers empleados para la PCR primaria y secundaria de la SSH. PCR
primer 1 es empleado para amplificar los transcritos enriquecidos durante la SSH. La
PCR secundaria (nested) fue modificada mediante la adicin de la secuencia del
promotor T7 en el Nested PCR primer 1(originalmente ausente). De esta manera, el
promotor es conservado en los amplicones y permite la posterior transcripcin In vitre y
marcaje de las muestras procesadas mediante la estrategia SSH.

61
4.3.1 Sntesis de cONA mediante tecnologa Super SMART

Para obtener la cantidad de cONA necesaria para el primer paso de la SSH, las
muestras fueron amplificadas mediante una variante de la PCR basada en la
tecnologa SMART (ver Material y Mtodos 3.5.1 ). El principio de esta tecnologa es la
utilizacin de un primer oligo-dT modificado (3'SMART COS Primer 11 A) y de un
oligonucletido SMART para la sntesis de la primera cadena de cONA, los cuales
posteriormente servirn como partidores universales para la amplificacin del cONA
por reaccin de polimerasa en cadena de larga distancia (LO-PCR) [95].
En la figura 13A se observa se muestra una figura representativa de la
determinacin de ciclo ptimo de la amplificacin SMART, donde la cantidad de cONA
amplificado alcanza una meseta. Comnmente, es posible observar un barrido entre
100-2000 pb a partir de los RNAs aislados de las muestras en estudio. El cONA de
doble hebra fue purificado usando las columnas Chroma Spin - 1000 y sometido a una
digestin enzimtica con la enzima RSAI, la cual reconoce y cliva el sitio
5' ... GTtAC ... 3', generando molculas con extremos romos, necesarios para la
posterior ligacin de los adaptadores. En la figura 138 se observa un ejemplo de
digestin enzimtica con RSAI, donde la muestra sin digerir (RSAI-) presenta cONAs
de entre 0.5 a 1.5 kb de peso, los cuales disminuyen su peso luego de la digestin
(RSAI+).

4.3.2 Ligacin de adaptadores

Luego de la digestin enzimtica, cada muestra es dividida en dos alcuotas, las

cuales sern ligadas cada una con un adaptador distinto, llamados 1 y 2R. La
eficiencia de la ligacin de adaptadores es verificada mediante PCR, utilizando como
parmetro la deteccin de la ligacin de los adaptadores en el gen GAPOH. Para este
objetivo, se emple el PCR Primer 1 (que une la secuencia adaptadora) y el partidor
GAPOH 3' para detectar el transcrito correctamente ligado, mientras que los partidores
3'y 5' de GAPOH fueron usados para medir los niveles totales de GAPOH. Para
62
confirmar la correcta ligacin de los adaptadores deberamos observar la presencia de
una banda de 750 pb, la cual no debe ser menos de cuatro veces la intensidad de la
banda de 500 pb, que representa el nivel total de GAP OH en la muestra (Figura 14 ).

A Ciclos Ciclos
J
.l 15, 18
17- 'O
-
MP

- ....-
- .., . ~
-~~-+1kb

Caso 56 Adyacente Caso 56 Tumor

B
MP 'RSAI- RSA~+

--
-... m
3kb+

1kb+-

-"

Pan creas normal

Figura 13. Anlisis de la amplificacin del cONA por PCR de larga distancia
usando la tecnologa Super SMART y digestin enzimtica con RSAI. A) El ciclo
ptimo fue determinado de forma independiente para cada muestra y consisti en un
ciclo antes de la meseta de la PCR. Para el caso 56, el ciclo ptimo para la muestra
adyacente y tumoral fue de 23 ciclos. B) Digestin enzimtica del RNA normal de
pncreas antes (RSA-) y despus (RSA+). MP= marcador de peso molecular.

63
 A 750 pb
1
Adaptador
,
GAPDH

'
500 pb

B Adaptador 1 Adaptador 2R

MP l l
J..
---.-
.. ,...---..-- - . . . , - - - - GAPDH ligado con
!!!!!! adaptadoffis

~~~ ~:::-
1 1 GAPDH total
Caso 636 No neoplstico

Figura 14. Determinacin de eficiencia de la ligacin de adaptadores. A) El

transcrito de GAPOH ligado debe generar un fragmento de 750 pb, mientras que el
transcrito de GAPOH generar una banda de 500 pb. B) Ligacin eficiente de la
muestra 636 No neoplsica. MP= marcador de peso molecular.

4.3.3 Sustraccin gnica por PCR-Se/ect

Luego de ligacin de adaptadores, las muestras son sometidas a dos rondas de

hibridaciones en presencia de cONA driver desnaturalizado (Ver Material y Mtodos
3.5.2b). Al trmino de la segunda hibridacin, las muestras son posteriormente
amplificadas mediante dos reacciones de PCR consecutivas. El PCR primario consiste
en la amplificacin de secuencias especficas del tester con el PCR Primer 1. El PCR
secundario (nested) es realizado con los primers PCR nested 1 modificado y nested 2R
y tiene como objetivo reducir los niveles de amplificacin inespecfica y enriquecer las
secuencias diferencialmente expresadas. A continuacin, el amplicn sustractivo es
purificado y sometido a transcripcin in vitre y marcado con Alexa 647 para efectuar la
posterior hibridacin y deteccin con el microarray HEEBO (ver Material y Mtodos 3.7
y 3.8).
La eficiencia de la sustraccin se determina mediante la comparacin de la
abundancia de cONA de genes control en las muestras sustradas y sin sustraer
(amplicn de la PCR secundaria). El protocolo convencional de anlisis de eficiencia se
64
realiza midiendo semicuantitativamente los niveles de transcritos del gen GAPDH,
donde el retardo en la amplificacin en ms de 5 ciclos es considerado una sustraccin
exitosa. Para medir la eficiencia de la sustraccin reemplazamos el protocolo
convencional de punto final por una reaccin de PCR cuantitativa en tiempo real. Para
la comparacin entres muestras sustradas (SSH) y no sustradas (No SSH) las
muestras fueron normalizadas por carga, aadiendo 2 ng de amplicn sustractivo a
cada reaccin de PCR. Las curvas de amplificacin (Figura 15) muestran que el cONA
de GAPDH fue sustrado eficientemente en 11 de 12 muestras.

65
 Cidos Ciclos Ciclos

: 56T
: A ciclos 6.34

..... NoSSH
...... SSH

Figura 15. Anlisis de eficiencia de la sustraccin. Curvas de amplificacin del

cONA de GAPDH de las muestras sustradas (SSH) y no sustradas (No SSH) en cada
caso. Las muestras sustradas (crculos azules) presentan un retraso de ms de cinco
ciclos en su amplificacin comparados con las muestras no sustradas (cuadrados
cafs), con excepcin de la muestras 687A. Cada muestra fue normalizada por carga
con 2 ng de amplicn por reaccin de PCR, empleando el mismo cyc/e threshold (Ct)
para todos los anlisis. T=tejido tumoral; A=tejido adyacente no neoplsico.

66
4.4 Integracin de los perfiles de expresin gnica analizados mediante
microarray de las estrategias Directa y SSH

4.4.1 Secuencias de expresin diferencial entre tejidos tumorales y no

neoplsicos, identificados mediante estrategia Directa y SSH

Luego de la hibridacin y extraccin de la fluorescencia de los slides de

microarray de ambas estrategias (ver Materiales y Mtodos 3. 7 y 3.8) se procedi con
la sustraccin del ruido (background), la normalizacin de las intensidades y un paso
de filtracin de datos. Las sondas que reportaron una baja intensidad y/o un valor de
ruido superior a la intensidad del spot fueron retiradas del anlisis. De esta forma se
descartaron los datos que aportan al ruido global del anlisis, logrando una
considerable reduccin de los falsos positivos dentro del grupo de genes diferenciales.
El anlisis estadstico de genes de expresin diferencial fue realizado utilizando el
paquete LIMMA del entorno "R", junto con aplicaciones propias de modelos mixtos.
Este tipo de modelos es apropiado para analizar datos pareados, por ejemplo,
diferentes muestras o mediciones provenientes del mismo paciente. En cada estrategia
fueron comparados los mismos grupos: Tejido tumoral y tejidos no neoplsicos
adyacentes a la lesin tumoral.
Para determinar la eficiencia de la sustraccin a nivel de la matriz de microarray,
escogimos 100 genes housekeeping, cuyos niveles de expresin fueron comparados
entre ambas estrategias. En promedio se observa una disminucin de seal en la
estragia de SSH de un 20% en -49 genes, 50% en -37 genes y 80% en -14 genes
(Tabla 2). Los genes que presentaron una reduccin de seal mayor al 50% en el 75%
(al menos 9 de 12) de las muestras son: NACA (11 genes); RPL 13A (9 genes); RPL29
(12 genes); TAF2 (9 genes); LDHA (9 genes); RPL 19 (10 genes); TKT (9 genes); FAU
(10 genes); ZFP36L 1 (11 genes) y RPS11 (10 genes), de los cuales, 4 genes
participan como componentes estructurales de ribosomas.
Establecimos criterios de seleccin de secuencias diferenciales en funcin de su
significancia estadstica y fold change de expresin. Para la estrategia Directa

67
escogimos los secuencias diferenciales con valores p < 0.01 y con fold changes
mayores a 0.4 y menores a -0.4, obteniendo un total de 736 secuencias, de las cuales
505 se encuentran up-regu/ated y 231 down-regulated en los tejidos de
adenocarcinoma ductal. Para la estrategia SSH escogimos las secuencias
diferenciales con valores p < 0.05 y con fold changes mayores a 0.35 y menores a -
0.35, obteniendo un total de 616 secuencias, de las cuales se encuentran 312 up-
regulated y 304 down-regu/ated en tejidos de adenocarcinoma ductal. La cantidad de
secuencias obtenidas mediante estos criterios permiten realizar anlisis de
enriquecimiento de trminos ontolgicos para determinar que procesos, funciones y
compatimentos celulares pueden ser identificados en ambas estrategias. Las
variaciones de expresin gnica de ambas estrategias son mostradas mediante
heatmaps en las figuras 16A y 168.

68
A Estrategia Directa B Estrategia SSH
No neoplsico ADP

-2 o 2
log2 fold change

-2 o 2
log2 fold change

Figura 16. Heatmaps de los valores de expresin (fo/d changes) de los genes
diferenciales entre tejidos tumorales y no neoplsicos identicados mediante
ambas estrategias. A) 736 secuencias diferenciales identificados mediante la
estrategia Directa. B) 616 secuencias diferenciales identificadas mediante la estrategia
SSH. Valores expresados como log2 del fold change obtenido de la razn entre la
intensidad de fluorescencia de canales (rojo/verde)

69
Tabla 2. Resumen de sustraccin de genes 100 constitutivos exnicos en cada
muestra.

Reduccin
56T 56 A 271T 271A 558T 558A 617T 617A 636T 636A 687T 687A Promedio
de seal
20% 42 39 37 53 54 60 64 59 58 42 49 42 49.9
50% 28 22 25 44 49 39 49 44 42 32 39 32 37.1
80% 10 5 9 14 16 21 26 19 13 18 16 6 14.4

4.4.2 Anlisis de enriquecimiento de ontologa de genes

Las listas de genes de expresin diferencial obtenidas mediante ambas

estrategias fueron sometidas a la base de datos web DAVID Bioinformatics Resources
6.7. Esta herramienta permite la extraccin de caractersticas de relevancia biolgica
asociada a largas listas de genes obtenidas mediante diversas plataformas de anlisis,
facilitando la exploracin e interpretacin de experimentos. El concepto de anlisis de
enriquecimiento se basa en que si los procesos biolgicos son anormales en un
estudio determinado, los genes desregulados pueden tener un mayor potencial
(enriquecimiento) de ser seleccionados como grupos relevantes mediante un
tecnologa de screening de alto rendimiento, como la tecnologa de microarray [108].
Cuando las listas de genes a comparar poseen distintos tamaos y diferente lmites, el
enriquecimiento absoluto de los valores p pueden variar de lista a lista. Sin embargo, el
orden relativo de los trminos se mantiene muy estable, permitiendo obtener
conclusiones globales consistentes a travs de listas de distintos tamaos obtenidas a
partir del mismo conjunto de datos. El anlisis de ontologa (Gene ontology; GO) cubre
tres dominios: componente celular (cellular component), las partes de una clula o su
ambiente extracelular; funcin molecular (molecular function), la actividad elemental de
un producto gnico a nivel molecular, tales como catlisis o capacidad de unin; y
proceso biolgico (biological process), operaciones o conjuntos de eventos
moleculares con inicios y trminos definidos, pertinentes para el funcionamiento de
unidades vivientes integradas: clulas, tejidos, rganos y organismos [1 09].
Para obtener el grado de enriquecimiento, un determinado fondo (background)
debe ser establecido para realizar la comparacin. El genoma de Horno sapies fue
70
empleado como fondo para la comparacin de las listas de genes obtenidas mediante
ambas estrategias. El enriquecimiento de los trminos GO es mostrado en la figura 17
y es representado por el Log10 del valor p.
Los procesos biolgicos de mayor enriquecimiento identificados por la estrategia
Directa comprenden genes cuyos productos estn relacionados con comunicacin
celular, respuesta al stress y al dao, organizacin de estructura extracelular, adhesin
celular, migracin celular, metabolismo del cogeno y respuesta inflamatoria (Figura
17A). Estos procesos celulares no fueron enriquecidos en la estrategia SSH, la cual
permiti el enriquecimiento de procesos relacionados con morfognesis de rganos,
metabolismo del calcio, diferenciacin de stem ce//s y va de sealizacin de Wnt. A
nivel de componente celular, se observa en la estrategia Directa un fuerte
enriquecimiento de genes cuya expresin es de ubicacin preferentemente extracelular,
hallazgo contrario al obervado en la estrategia SSH, donde el enriquecimiento se debe
a genes de ubicacin predominantemente intracelular aunque no es significativamente
estadstico (Figura 178).
Los genes relacionados "Wnt receptor signaling pathway through beta-catenin"
son APC, CCND1, TCF7L2 y WNT9A. Los genes relacionados a "Stem ce//
differentiation" ERCC2, MSI2, ACE, APC, RIF1, TFC7L2.
Empleando la base de datos KEGG (http://www.genome.jp/kegg/) realizamos un
anlisis complemetario con el obejtivo de identificar vas de sealizacin presentes en
la lista de genes de la estrategia SSH. La va Wnt signaling pathway (hsa04310-Homo
sapiens) posee 9 genes representados en la lista, lo cual se encuentra en
concordancia con lo identificado mediante el anlisis de procesos biolgicos (Figura
18). Estos genes son WNT9A, NFAT5, TCF7L2, CCND1 (cycD1), MMP7 (Uterine),
PPP2R 1B (PP2A), APC Y TBL 1Y (TBL 1). La va de sealizacin posee una creciente
importante en la investigacin biomdica del cncer.

71
 Biological Process
Organ morphogenesis-....- -SSH
Response to calcium ion WDirecta Cellular Component
Stem cell differentiation Cell projection -SSH
'Vnt receptor signaling pathway through beta-catenin Synapse O Directa
lntracellular signaling casca de Plasma membrana part
Glycoprotein metabolic process Cell junction
Regulation of catalytic activity-1...----+-' Adherens junction
lnflammatory response..,-----' Nuclear eh ramoso me
Regulation of cell motion .1;;=:::1== Collagen
Col!agen metabolic process -J::=::j:=::: Endoplasmic reticulum
Regulation of cell migration -l;;;;==t== Actin cytoskeleton
Blood circulation .!;;;;;:::::=!=== Golgi apparatus
Programmed cell death .J==::j::== Basement membrane
Cell adhesion .l;;=:::f:===:::J Cytoplasmic.vesicle
Response to wounding -t:=:::f==== Extracellular matrix-t:=!=====:::::J
Extracellular structure organization -!==+==== Proteinaceous extracellular matrix -t:::::i======
Response to stress .l;;;;;::::t====== Extracellular region.l;;;;:::l========
Regulation of cell communication 1!E~~~~=:;:=~---, lntracellular F""T'--r-r-.-r--r-r-r-.
o 2 3 4 5 6 o 2 3 4 5 6 7 8 9
-lo9 10 P value -lo9 10 P value

Molecular Function
--, : -SSH
Enzyme binding
Nucleoside kinase activity WDirecta
Calcium ion binding
Extracellular matrix binding

---
1
Actn binding
!
Glycosaminoglycan bindng
Polysaccharide binding
:
Protein binding
Receptor binding -
o 2 3 4
-lo910 P value

Figura 17. Anlisis de trminos de ontologa de genes enriquecidos mediante las

estrategias Directa y SSH. El enriquecimiento de los trminos GO es representado
con el Log1o de la significancia estadstica (P value).

72
 1 WNT SIGNALING PATHWAY 1

-- ''
---~~---------'------- G'netrn=ip<>ou

(MAPK~)
l_ pe.thw:ay .

043103.12fJ2
(e) K~Iti:;a Lab:mOOries

Figura 18. Genes de la va de sealizacin de Wnt identificados mediante la

estrategia SSH. Genes destacados en color rojo. En la figura: WNT=WNT9A;
TCF/LEF= TCF7L2; cycD= CCND1; Uterine=MMP7; PP2A=PPP2R1 B; TBL 1=TBL 1Y.
Imagen obtenida desde la base de datos KEGG (http://www.genome.jp/kegg/)

En la figura 19 se describen genes up-regu/ated en tejidos de ADP, presentados

segn su asociacin a los trminos de ontologa de extracellular matrix (G0:0031 012),
inf/ammatroy response (G0:0006954) y ce// motion (G0:0006928). Entre los genes
asociados a matriz extracelular se encuentran varias fibras de colgeno (e.j. COL 1A1,
COL 17A 1 y COL4A 1), metaloproteinasas de matriz (MMP1 y MMP11 ), fibronectin 1
(FN1 ), periostin (POSTN) y versican (VCAN). La respuesta inflamatoria se ve reflejada
con la alta abundancia de interleukin 8 (IL8), interleukin 1 receptor accessory protein
(IL 1RAP), mo/ecu/e, decay accelerating factor for complement (CD55), coagulation

73
factor 11 (thrombin) receptor (F2R), coagulation factor 111 (thromboplastin, tissue factor)
(F3) y coagulation factor VIII, procoagulant component (F8).

Q)
1/1
1:
o
c.
1/1
Q)'<t
'-lll
~~
o8
'lijo
E(!)
E
m
:
E

1:

-"'
0"'
-"'
0"'
Eg
=o
Gl(!)
o

Figura 19. Ontologas de genes up-regulated identificados en la estrategia

Directa. Componentes de la matriz extracelular, de respuesta inflamatoria y
movimiento celular se encuentran enriquecidos en tejido tumoral debido principalmente
a la presencia de una intensa desmoplasia. Los genes se muestran segn ontologa.
74
 En la figura 20 se observan los niveles de expresin de los genes de la
estrategia SSH y sus respectivos valores en la matriz de la estrategia Directa. Los
transcritos identificados como diferenciales en la estrategia Directa presentan en
promedio un valor de fold change cercano a O lo que demuestra que mediante la
estrategia Directa estos genes no pudieron ser identificados como diferenciales.

2.0

Ql oo 0
C) o
e
ra
c3 0.5

o
ooo

SSH

Figura 20. Comportamiento de los genes diferenciales de la estrategia SSH en la

matriz de la estrategia Directa. Los genes identificados en la estrategia SSH fueron
extrados de la matrix de la estrategia Directa.

4.4.3 Ambas estrategias identifican genes que codifican para protenas de

secrecin.

Las protenas secretadas por varios tipos celulares, incluidas las clulas
malignas, representan una potencial fuente de biomarcadores debido a que reflejan
varios estadios celulares en tiempo real y bajo determinadas condiciones [11 0]. Para
identificar los genes que codifican para protenas de secrecin (predichas
computacionalmente y validadas) realizamos un anlisis en la base de datos DAVID.
Las protenas de secrecin de la estrategia Directa y SSH se muestran en las tablas 3
y 4 respectivamente. Entre los genes de secrecin de la estrategia Directa

75
encontramos molculas tales como ANXA2, FAS, CD59, VCAN, IL8, SPARC, WNT5A.
Entre los genes identificados mediante la estrategia SSH encontramos a MMP?,
WNT9A, NMU, EGFR y OLFML 1, de los cuales WNT9A fue escogido para estudios
posteriores.

Estrategia Directa
Smbolo Nombre oficial
ANGPT2 angiopoietin 2
ANXA2 annexin A2 pseudogene 3; annexin A2; annexin A2 pseudogene 1
FAS Fas (TNF receptor superfamily, member 6)
C4BPB complement component 4 binding protein, beta
CALU calumenin
CD59 CD59 molecule, complement regulatory protein
COL1A1 collagen, type 1, alpha 1
COL4A1 collagen, type IV, alpha 1
COL6A3 collagen, type VI, alpha 3
COL8A2 collagen, type VIII, alpha 2
COL17A1 collagen, type XVII, alpha 1
VCAN versican
DAG1 dystroglycan 1 (dystrophin-associated glycoprotein 1)
F8 coagulation factor VIII, procoagulant component
FGFR2 fibroblast growth factor receptor 2
FN1 fibronectin 1
IGFBP3 insulin-like growth factor binding protein 3
IGFBP5 insulin-like growth factor binding protein 5
IGFBP7 insulin-like growth factor binding protein 7
IL1RAP interleukin 1 receptor accessory protein
IL8 interleukin 8
KNG1 kininogen 1
LCN2 lipocalin 2
LGALS1 lectin, galactoside-binding, soluble, 1
UF leukemia inhibitory factor (cholinergic differentiation factor)
LTBP1 latent transforming growth factor beta binding protein 1
MATN3 matrilin 3
MFGE8 milk fat globule-EGF factor 8 protein
MMP1 matrix metallopeptidase 1 (interstitial collagenase)
MMP11 matrix metallopeptidase 11 (stromelysin 3)
NID1 nidogen 1
TNFRSF11B tumor necrosis factor receptor superfamily, member 11 b
PVRL11 poliovirus receptor-related 1 (herpesvirus entry mediator C)
CXCL5 chemokine (C-X-C motif) ligand 5

76
 SFRP2 secreted frizzled-related protein 2
SLPI secretory leukocyte peptidase inhibitor
SPARC secreted protein, acidic, cysteine-rich (osteonectin)
STC1 stanniocalcin 1
TCN1 transcobalamin 1 (vitamin 812 binding protein, R binder family)
TGFBI transforming growth factor, beta-induced, 68kDa
TNXB tenascin X8; tenascin XA pseudogene
VEGFC vascular endothelial growth factor e
~NTSA wingless-type MMTV integration site family, member 5A
M lA melanoma inhibitory activity
GGH gamma-glutamyl hydrolase
~IMP1 aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
CRISP3 cysteine-rich secretory protein 3
SEMA3C sema domain, immunoglobulin domain (semaphorin) 3e
POST N periostin, osteoblast specific factor
ADAM28 ADAM metallopeptidase domain 28
LILRA3 leukocyte immunoglobulin-like receptor, subfamily A, member 3
ESM1 endothelial cell-specific molecule 1
PRSS23 protease, serine, 23
FSTL1 follistatin-like 1
DKK1 dickkopf homolog 1 (Xenopus laevis)
LY96 lymphocyte antigen 96
OLFML2B olfactomedin-like 28
GREM1 gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis)
PILRA paired immunoglobin-like type 2 receptor alpha
CKLF chemokine-like factor
TREM2 triggering receptor expressed on myeloid cells 2
PDGFC platelet derived growth factor e
TWSG11 twisted gastrulation homolog 1 (Drosophila}
PRSS22 protease, serine, 22
C12orf49 chromosome 12 open reading frame 49
LOXL4 lysyl oxidase-like 4
CTHRC1 collagen triple helix repeat containing 1
DEFB118 defensin, beta 118
IZG16B zymogen granule protein 16 homolog 8 (rat)
OVOS2 ovostatin; ovostatin 2
OTOA otoancorin
IGFL2 IGF-Iike family member 2
CDCP2 eU8 domain containing protein 2
LIPH lipase, member H
C3orf58 chromosome 3 open reading frame 58
AGRN agrin
FIBIN fin bud initiation factor homolog (zebrafish}
Tabla 3. Genes que codifican para protenas secretadas identificados mediante la
estrategia Directa. Genes up-regulated de la estrategia Directa fueron analizados

77
mediante la base de datos DAVID empleando la categora SP_PIR_KEYWORDS. Un
total de 77 protenas fueron identificadas como secretadas.

Estrategia SSH
Smbolo Nombre oficial
C8A complement component 8, alpha polypeptide
CP ceruloplasmin (ferroxidase)
CPB2 carboxypeptidase B2 (plasma)
HAPLN1 hyaluronan and proteoglycan link protein 1
CST1 cystatin SN
EGFR epidermal growth factor receptor
FGG fibrinogen gamma chain
IL16 interleukin 16 (lymphocyte chemoattractant factor)
KNG1 kininogen 1
LAMA3 laminin, alpha 3
LIPC lipase, hepatic
MMP7 matrix metallopeptidase 7 (matrilysin, uterine)
NRTN neurturin
WNT9A wingless-type MMTV integration site family, member 9A
WISP2 WNT1 inducible signaling pathway protein 2
IL18BP interleukin 18 binding protein
NMU neuromedin U
C1orf56 chromosome 1 open reading frame 56
MMELI1 membrane metallo-endopeptidase-like 1
ADAMTS20 ADAM metallopeptidase with thrombospondin type 1 motif, 20
PVRL4 poliovirus receptor-related 4
RSP03 R-spondin 3 homolog (Xenopus laevis)
C1QTNF3 C1 q and tumor necrosis factor related protein 3
C4orf26 chromosome 4 open reading frame 26
TAC4 tachykinin 4 (hemokinin)
OLFML1 olfactomedin-like 1

Tabla 4. Genes que codifican para protenas secretadas identificados mediante la

estrategia SSH. Genes up-regulated de la estrategia SSH fueron analizados mediante
la base de datos DAVID empleando la categora SP_PIR_KEYWORDS. Un total de 26
protenas fueron identificadas como secretadas.

78
 Un total de 35 transcritos son compartidos entre ambas estrategias,
representando solo un 5 y 6% de la lista Directa y la lista SSH, respectivamente (Figura
21A). Los genes compartidos entre ambas estrategias son 22 up-regulated y 13 down-
regulated (Figura 21 B). Entre los genes up-regulated se encuentran CD55 y EGFR, los
cuales han sido descritos previamente como genes up-regulated en cncer pancretico.
El transcrito de CD55 es detectable en jugo pancretico de pacientes con cncer
pancretico, donde se encuentra aumentado con respecto a casos controles [111].
EGFR se encuentra up-regulated en ms del 90% de los casos de ADP y es
actualmente un objetivo teraputico de cncer pancretico mediante el uso de la droga
erlotinib, aprobada por la FDA para el tratamiento de esta enfermedad [112].
Otro aspecto interesante de destacar es que la estrategia Directa contiene
varios genes previamente descritos como potenciales marcadores de ADP (Figura 22).
Es el caso de ANXA8 [113], CEACAM [114, 115], CLDN 18 [113], CTSB [116], CTSL
[116] Y TOP2A [117].

79
 Estrategia Estrategia
Directa SSH
B
ID Smbolo Nombre oficial
1604 CD55 CD55 molecule, decav acceleratina factor for comolement
1770 DNAH9 dvnein, axonemal, heavv chain 9
1956 EGFR epidermal growth factor receptor
2152 F3 coaaulation factor 111
3827 KNG1 kininogen 1
3909 LAMA3 laminin, alpha 3
6772 STAT1 signa! transducer and activator of transcriotion 1, 91 kDa
7050 TGIF1 TGFB-induced factor homeobox 1
7273 TTN titin
7932 OR2H2 olfactorv receptor, familv 2, subfamilv H, member 2
8853 ASAP2 ArfGAP with SH3 domain, ankvrin reoeat and PH domain 2
9344 TAOK2 TAO kinase2
10753 CAPN9 calpain 9
23224 SYNE2 spectrin repeat containing, nuclear envelooe 2
55821 ALLC allantoicase
57718 PPP4R4 lorotein ohosohatase 4, reaulatorv subunit 4
64072 CDH23 cadherin-like 23
79925 SPEF2 sperm flagellar 2
80144 FRAS1 Fraser svndrome 1
114907 FBX032 F-box orotein 32
116966 WDR17 WD repeat domain 17
170482 CLEC4C C-type lectin domain familv 4, member C
472 IE,Tf'F: ataxia telanaiectasia mutated
1111 ICHEl~'l CHK1 checkooint homoloa (5. oombe)
2568 IG.'\BHF gamma-aminobutvric acid (GABA) A receptor, pi
7052 lrm,;r transglutaminase 2
7083 in~ thvmidine kinase 1, soluble
9833 ,;;:u: maternal embrvonic leucine zioper kinase
10863 J:,Oj'\[,129 ADAM metallopeptidase domain 28
10933 lic1'JHFPU mortalitv factor 4; mortality factor 4 like 1
26031 IOSEPL3 oxvsterol bindina orotein-like 3
54798 IDCHS2 dachsous 2 (Drosoohila)
54991 l:;,d133 chromosome 1 open readino frame 159
55520 IEUi.Gj elaC homoloo 1 (E. coli)
80178 IG'i6orf39 chromosome 16 ooen readina frame 59

Figura 21. Genes diferenciales identificados mediante ambas estrategias. A)

Diagrama de Venn de los genes comunes identificados mediante la estrategia Directa y
SSH. 8) Lista de 22 genes up-regulated (color rojo) y 13 genes down-regulated (color
verde).

80
Figura 22. Genes identificados en la estrategia Directa que han sido previamente
validados como biomarcadores de ADP.

4.5 Validacin de los genes diferenciales obtenidos por la estrategia directa y

SSH por PCR en tiempo real.

La tecnologa de microarray es una herramienta poderosa para la

caracterizacin de la expresin gnica a alta escala. Sin embargo, esta tecnologa
puede generar falsos positivos que deben ser corroborados para anlisis posteriores.
El PCR cuantitativo en tiempo real (qPCR) es una herramienta sensible y robusta para
medir niveles de expresin gnica y ha sido utilizada para confirmar los resultados
obtenidos de plataformas de microarray. Para confirmar la veracidad de los resultados
de ambas estrategias aplicamos la metodologa de qPCR para validar grupos de genes
escogidos. Los genes fueron seleccionados a partir de los genes up-regulated de cada
lista. Como el objetivo principal del proyecto es identificar molculas cuya expresin
sea de utilidad para la caracterizacin y potencial diagnstico de la enfermedad,
decidimos optimizar la validacin y caracterizacin de genes candidatos con tendencia
a la sobre expresin (up-regulated) en tejidos tumorales.
Los valores de expresin de los genes de la estregia Directa y SSH identificados
mediante microarray y validados mediante qRT-PCR son mostrados en la figura 23. De
los diez genes analizados para la estrategia Directa, ocho son significativamente
estadsticos. De los diez genes analizados para la estrategia SSH, cuatro genes son
significativamente estadsticos, sin embargo, el resto de los genes presenta una
tendencia hacia la sobre expresin (Figura 22).
81
 Estrategia Directa Estrategia SSH

BHLHE40 CD55
CALU DPYSL4
COL4A1 KNG1
CTSK LAMA3
FN1 MMP7
IGFBP5 OASL
PMEPA1 PLEKHM1
SBN02 STAT1
SPARC SYNE2
TOP2A SYT12

BHLHE40 CD55*
CALU * DPYSL4
COL4A1* KNG1
CTSK LAMA3
FN1* MMP7*
IGFBP5 OASL*
PMEPA1* PLEKHM1
SBN02* STAT1
SPARC * SYNE2
TOP2A * SYT12 *

-3.0 0.0 -3.0

Log2 fold change

Figura 23. Validacin por qRT-PCR de genes diferenciales de las estrategias

Directa y SSH. Diez genes de cada estrategia fueron escogidos para validacin. La
cuantificacin relativa por qRT-PCR fue realizada empleando como calibrador un cONA
de pncreas normal. Los genes en estudio fueron analizados en duplicado y
normalizados a la expresin de los genes QARS y TBP. *= P value<O.OS determinado
mediante t test pareado de una cola.

82
4.6 Validacin de genes diferenciales mediante tincin inmunohistoqumica

4.6.1. Genes candidatos de la estrategia Directa.

Es de relevancia validar si los niveles de los transcritos identificados se

correlacionan con los niveles de las respectivas protenas. Con el objetivo de confirmar
los resultados obtenidos mediante estrategia Directa, realizamos un estudio
inmunohistoqumico en tejidos de adenocarcinoma ductal y tejidos no neoplsicos
adyacentes al tumor. Seleccionamos tres genes candidatos de la lista de genes up-
regu/ated identificados en la estrategia Directa y los estudiamos mediante tissue arrays.
Los genes PMEPA1 (prostate transmembrane protein, androgen induced 1), BHLHE40
(basic helix-loop-helix fami/y, member e40), y CALU (calumenin) fueron escogidos en
funcin de la escasa literatura cientfica y propiedad intelectual asociada a ellos,
adems de la disponiblidad anticuerpos.

4.6.1.1. PMEPA1 prostate transmembrane protein, androgen induced 1

No se observa expresin de PMEPA1 en duetos de morfologa normal en tejidos

no neoplsicos, con expresin leve en clulas acinares (Figura 24A y 248). En tejidos
tumorales se observan clulas positivas para PMEPA 1, con un marcado patrn nuclear
exclusivo (Figura 24C) o en combinacin con expresin citoplasmtica (Figura 24C-
24E). En algunos casos se observa intensa expresin nuclear (Figura 24F).

83
Figura 24. Tincin inmunohistoqumica de PMEPA1. A y B) Duetos pancreticos de
morfologa normal con nula expresin de PMEPA1 (flecha roja). Clulas acinares
presentan una tincin leve; C) Clulas tumorales con tincin nuclear intensa de
PMEPA 1 (flecha roja); D y E) Clulas tumorales con tincin nuclear intensa y
citoplasmtica leve de PMEPA 1 (flecha roja); F) Clulas tumorales con expresin
nuclear intensa y citoplasmtica moderada de PMEPA1 (flechas rojas).

84
 Non-neoplastic Adenocarcinoma

Figura 25. Anlisis inmunohistoqumico de la expresin de PMEPA1 en tissue

arrays de tejidos no neoplsicos y adenocarcinoma pancretico. Los staining
scores obtenidos como mltiplo de la intensidad de la tincin y la celularidad de cada
grupo fueron comparados mediante t test pareado de una cola. Media y SD de un n=30.
***=p<0.001.

El anlisis de tissue microarray muestra que el tejido de ADP presenta niveles

mayores de la protena PMEPA1, en comparacin con los tejidos no neoplsicos.
PMEPA1 se encuentra ubicado en el brazo largo del cromosoma 20 (20q13.3).
Esta regin del cromosoma se presenta amplificada en un gran porcentaje de casos de
cncer pancretico [118-120], estmago [121] y colon [122]. Un aumento en el nmero
de copias del gen explicara por que PMEPA1 se encuentra up-regulated en
adenocarcinoma pancretico, ya que se ha observado que otros genes de esta regin
se encuentran up-regulated en tejidos tumorales de cncer de pncreas, estmago y
colon.

20p13

20p12

20p11.2
20p11.1
20q11.1
20<:t11.2
+JiJt-;!J.tWMg.r.!~MMf,,l$Pidl
20.,1~.1 SERINC3 UBE2C DDX27
ZNF217 MMP9 TMEM189
21~.2

20.,1~.~
BCASl AURKA
CTSZ PMEPAl

Figura 26. Representacin grfica del cromosoma 20. La regin coloreada de gris
muestra la regin del brazo largo a la que con mayor frecuencia se le ha asociado
incremento en el nmero de copia de diferentes genes. PMEPA 1 se ubica en esta
regin. La tabla de la derecha muestra ejemplos de genes que pertenecen a esta
regin y que presentan incremento en el nmero de copias [118, 119, 121, 122].
85
4.6.1.2 BHLHE40 basic helix-loop-helix family, member e40

En tejidos no neoplsicos se observan duetos positivos (Figura 27A) y negativos

(Figura 278) para BHLHE40. Las clulas acinares presentan una tincin leve. Las
clulas tumorales presentan un patrn intenso de expresin citoplasmtica
supranuclear (Figura 27C) o difusa (Figura 27D-F).

.' . ...
,. .
"\ iJ

..
i .,....\ti. ' '
'

Figura 27. Tincin inmunohistoqumica de BHLHE40. A) Dueto pancretico de

morfologa normal con expresin leve de BHLHE40 (flecha roja). Clulas acinares
presentan una tincin leve; B) Dueto pancretico de morfologa normal con nula
expresin BHLHE40 (flecha roja); C-F) Clulas tumorales con expresin citoplasmtica
intensa de BHLHE40 (flechas rojas) Clulas estromales no expresan la protena.

86
 BHLHE40
**

Non-neoplastic Adenocarcinoma

Figura 28. Anlisis inmunohistoqumico de la expresin de BHLHE40 en tissue

arrays de tejidos no neoplsicos y adenocarcinoma pancretico. Los staining
scores obtenidos como mltiplo de la intensidad de la tincin y la celularidad de cada
grupo fueron comparados mediante t test pareado de una cola. Media y SO de un n=30.
**=p<0.01.

El anlisis de tissue array muestra que el tejido de ADP presenta niveles mayores
de la protena BHLHE40, en comparacin con los tejidos no neoplsicos (Figura 28).

87
4.6.1.3. CALU calumenin

En tejidos no neoplsicos de pncreas se observan duetos que no expresan CALU

(Figura 29A) o lo expresan de forma leve (Figura 298). A diferencia de PMEPA1 y
BHLHE40, CALU se expresa predominantemente en el citoplasma de clulas de
fenotipo ahusado presentes en el tejido estroma! reactivo alrededor de las clulas
tumorales, presentando una intensa tincin (Figura 29 C y D). Este fenotipo es
compatible con fibroblastos activados o clulas estelares pancreticas (CEP) [123].
Adicionalmente, se observa expresin leve y ubicua de CALU en clulas tumorales.
Las CEPs expresan conjuntamente marcadores de fibroblastos y clulas de
msculo liso. La actina de msculo liso (ACTA2; actin, alpha 2, smooth muse/e, aorta;
a-SMA) ha sido utilizada como marcador para identificar CEPs en tejidos neoplsicos
de pncreas. Realizamos una doble tincin de inmunofluorescencia con anticuerpos
anti-CALU y anti-a-SMA en tejidos de adenocarcinoma ductal pancretico. Ambas
moleclas se encuentran presentes en el compartimento estroma! reactivo y se
observan clulas que expresan ambas molculas (Figura 29F). Es de inters destacar
que CALU es una molcula que es secretada al espacio extracelular, lo que la
convierte en un potencial candidato a biomarcador (Tabla 3).

88
Figura 29. Tincin inmunohistoqumica de CALU. A y B) Duetos pancreticos de
morfologa normal que no expresan CALU (flechas rojas); C) y D) Clulas de
morfologa ahusada (probablemente fibroblastos o clulas estelares) con expresin
intensa de CALU (flechas rojas); E) Clulas tumorales que expresan CALU (flecha
roja); F) Tincin de inmunofluorescencia de tejido de adenocarcinoma ductal
pancretico. Clulas de fenotipo ahusado expresan simultneamente CALU (verde) y
actina de msculo liso (a-SMA, rojo), marcador de clulas estelares activadas.
DAPI=tincin nuclear.

89
 A B
CALU Adenocarcinoma CALUStroma

-.
e

o
c..
::J
e
]l
..
o
c..
::J
***

..J
< ;!
(.) (.)
....o ....o
..
Cl)

o
u
..o
Cl)

u
U) U)
C) C)
e e

-
'2

tJ)

Non-neoplastic Adenocarcinoma
'2
-

tJ)

Non-neoplastic Adenocarcinoma

Figura 30. Anlisis inmunohistoqumico de la expresin de CALU en tissue

arrays de tejidos no neoplsicos y adenocarcinoma pancretico. La expresin de
CALU fue analizada de forma independiente segn compartimento celular. A) Los
tejidos ductales y acinares fueron comparados con el tejido de adenocarcinoma. B) El
tejido estroma! normal fue comparado con la reaccin desmoplstica del ADP). Los
staining scores obtenidos como mltiplo de la intensidad de la tincin y la celularidad
de cada grupo fueron comparados mediante t test pareado de una cola. Media y SD de
un n=30. ***=p<0.001.

El anlisis de tissue array muestra que el tejido estroma! reactivo de tumores de

ADP presenta niveles mayores de la protena CALU, en comparacin con las clulas
estromales del tejido no neoplsico (Figura 308). Por el contrario, las clulas tumorales
expresan niveles similares en comparacin con los duetos y acinos no neoplsicos
(Figura 30A).

90
4.6.2. Genes identificados en la estrategia Directa contrastados con la base de
datos del Human Atlas Protein.

El Human Atlas Protein (HAP) es una base de datos disponible pblicamente

con millones de imgenes de alta resolucin que muestran la distribucin espacial de
ms de 12,000 protenas humanas en 46 tejidos humanos diferentes y 20 tipos de
cncer, as como en 47 lneas celulares humanas (http://www.proteinatlas.org/).
Genes up-regulated escogidos de la estrategia Directa fueron contrastados con
la base de datos del Human Atlas Protein. La figura 31 muestra ejemplos de expresin
en dos tejidos no neoplsicos y dos tejidos tumorales diferentes para cada protena.
Las protenas codificadas por los genes SPARC (secreted protein, acidic, cysteine-rich
(osteonectin)), FN1 (fibronectin 1) y CDH11 (cadherin 11, type 2, OB-cadherin
(osteoblast)) presentan una intensa expresin en el tejido estroma! reactivo que rodea
al tejido tumoral. Por el contrario, las protenas codificadas por los genes CEACAM6
(carcinoembryonic antigen-related cell adhesion molecule 6), CLDN18 (claudin 18),
TOP2A (topoisomerase (DNA) 11 alpha 170kDa), DKK1 (dickkopf 1 homolog (Xenopus
laevis)) y RAB23 (RAB23, member RAS oncogene family) presentan tincin tumoral
que va de leve a intensa.
Las protenas codificadas por los genes SPARC, FN1 y CDH11 presentan una
intensa expresin en el estroma reactivo que rodea al tejido tumoral, sin embargo, su
expresin en tejido no neoplsico es dbil y aislada. Por el contrario, es posible
encontrar tumores que expresan intensamente CEACAM6, CLDN18, TOP2A y DDK1
en sus clulas tumorales, observndose expresin nula o leve de estas protenas en
los tejidos pancreticos no neoplsicos. El hallazgo de tumores que sobre expresan
estas protenas en comparacin con tejidos no neoplsicos se encuentra en
concordancia con los hallazgos transcriptmicos identificados mediante la estrategia
Directa.

91
 No neoplsico ADP

..-
..-
I
o

' .
..
..-
z
LL
l/

0:::
0:en . !t
...
J
: >
..... ~-
....
CD
~
<(

<(
w ;

(()
'
..-
z
o_J
' ...,
. :.:'-

<(
N
a..
o
1--

Figura 31. Imgenes de tinciones inmunohistoqumicas de genes de la estrategia

Directa obtenidas del Human Atlas Protein. Tinciones IHQs de 8 genes up-regulated
identificados mediante la estrategia Directa. ADP=adenocarcinoma ductal pancretico.

92
4.6.3. Genes candidatos de la estrategia SSH.

Con el objetivo de confirmar los resultados obtenidos mediante estrategia

Directa, realizamos un estudio inmunohistoqumico en tejidos de adenocarcinoma
ductal y tejidos no neoplsicos adyacentes al tumor.
Seleccionamos cinco genes candidatos de la lista de genes up-regulated
identificados mediante la estrategia SSH en function de la disponibilidad de anticuerpo
y si ha sido reportado antes en cncer pancretico: PLEKHM1 (pleckstrin homology
domain containing, family M (with RUN domain) member 1), WNT9A (wingless-type
MMTV integration site family, member 9A), DPYSL4 (dihydropyrimidinase-like 4),
MMP7 (matrix metallopeptidase 7 (matrilysin, uterine)) y STAT1 (signal transducer and
activator of transcription 1, 91 kDa).

4.6.3.1. PLEKHM1 p/eckstrin homology domain containing, family M (with RUN

domain) member 1.

El producto gnico de PLEKHM1 fue identificado inicialmente como una protena

unida fuertemente a una mucina positiva para el grupo Sialii-Lewis(x) en un screening
de cONA humano de colon contra un antisuero de conejo desarrollado contra mucinas
Lewis positivas [124]. Posteriormente, PLEKHM1 fue vinculado con el transporte
vesicular en osteoclastos [125] y la mutacin de este gen produce un tipo de
osteopetrosis en humanos, asociada con osteopenia general y osteoclerosis focal [126].
Al momento de escribir este documento no existe informacin de PLEKHM1 asociada a
neoplasias.
Los tejidos pancreticos normales no expresan PLEKHM1 en duetos, clulas
acinares o islotes de Langerhans (Figura 32A-B). Por el contratrio, clulas tumorales
positivas para queratina 19 (marcador epitelial), expresan PLEKHM1 (Figura 32C-F).
Posteriormente se realiz una tincin doble de inmunofluorescencia en dos
tejidos tumorales, donde fue confirmado que solo las clulas positivas para queratina
19 expresan PLEKHM1, no observndose expresin de esta protena en otros

93
 compartimentos del tejido pancretico (Figura 33). Es interesante destacar que en
algunos tejidos analizados fue posible observar clulas solitarias positivas para
PLEKHM1 en aparente proceso de invasin. Estas clulas a su vez presentan
expresin de MMP?, una metaloproteinasa de matriz asociada a procesos invasivos
(Figura 34 ).
Posteriormente analizamos los niveles de PLEKHM1 mediante un tincin IHQ de
un tissue array compuesto por 90 cores provenientes de 30 pacientes con
adenocarcinoma ductal. Por cada core de tejido no neoplsico adyacente a la lesin
tumoral, estn representados dos cores de tejido tumoral del mismo paciente. El tissue
array fue escaneado y cuantificado empleando el sistema ACIS 111 (DAKO), para
determinar un staining score para cada core (ver Material y Mtodos 3.12.1 ). Para el
anlisis estadstico el score tumoral fue calculado del promedio de ambos replicados y
comparado con el score no neoplsico mediante t test pareado de dos colas. En la
figura 35 se observa que los niveles de expresin de PLEKHM1 son significativamente
mayores en tejidos neoplsicos que en tejidos no neoplsicos de pncreas. Tres
tejidos no neoplsicos presentan un alto staining score para PLEKHM1, sin embargo,
la morfologa de estos cores se encuentra alterada (datos no mostrados). A excepcin
de estos tres casos, no hay expresin detectable de PLEKHM1 en tejidos no
neoplsicos pancreticos. Por el contrario, alrededor del -30% de los casos de
adenocarcinoma ductal del tissue array presentan algn grado de expresin de
PLEKHM1.
Para determinar la expresin de PLEKHM1 en otros rganos empleamos un
tissue array de tejidos normales. PLEKHM1 no se expresa en tejidos pancreticos
normales (Figura 36), sin embargo, es expresada por tipos celulares de la prstata
(prostate), timo (thymus), amgdala (tonsil), cuello del tero (uterus cervix) y piel (skin),
siendo este ltimo el rgano donde se observa una mayor expresin de PLEKHM1
(Figura 36). No detectamos expresin de PLEKHM1 en tejidos de glndula adrenal,
vejiga, mdula sea, ojo, mama, cerebelo, corteza cerebral, trompa de Falopio,
estmago, esfago, intestino delgado, colon, recto, corazn, rin, hgado, pulmn,
ovario, glndula paratiroides, glndula pituitaria, placenta, bazo, msculo estriado,
testculo y glndula tiroides

94
 Pancreas no neoplsico
~L '"~- , .... ;~ ~~-...,_.'::, B
.... . . .. . . ....
f

~
.~-'
, .
,.'
~ ~ ..... ~ . ~"'
. .t.,A..;J
'~ .,.... ~
. J;".,.. . . \~--~
~ .~-, ;.
.
. ,.
.' : ..... . .
' \ 1, 4'.. .. . ,, . 1 .,
'
~ . .:
'1r .~ ' , L '..f'.. . ~- ....:
~
-==
..::::;
... ...._;,
1 'r

.
,
.
,

~ ';
'.......
'. : '..
-"""' ... ' ' ,1:. ..:'-"-
: .... . '
J

- . f' .
~-~
.

:::E:
~
;;.:~.:'

r "':. '::'
" " ... , .'1
/ . .: . .,: ....
. 1.. .. . .
-~
~ ~ '4 1 ...... . '... ~- .,, ., J ... -.
w . J,"-.
'......11 ,.-.\.1.
..-::-.. ~...'
..J
a. ....., ...... '._.,,....
~--
1 .....
..
. '
'r :.,. . ...
, ,. _.. . ;. ...
J. ..
"'~ .~ ',~
~
. :.. . \ ., ... ..
1

_~....._ ~: .} .
'
;,

.
':_~-
.
...... /, ~,.
:~
. ;<..:' -:~~:,.~.;-\
..... 1 ". ~~ . , ..... - ' -
.. . '. . .. ' .
- .,. ,.... .
. "' 1 '
~.
......-.-~
. . . . . . 1 t ""
~. -"-~.

~
;'
,.
~
-
''{\
~ . .t
t.~
~-''
..
/~
/ ......
. . . . _,.
J
.
. '
# .. t ,:.. ~ .~~~-. -~.' : ... " .. ,. .
Queratina 19 PLEKHM1

a.
e
<(

'. ......

:-:

.-' J 1. ~ ~ ~

:\. .; : : .~ . \

Figura 32. Expresin de PLEKHM1 en tejidos pancreticos tumorales y no

neoplsicos. A y B) Nula expresin de PLEKHM1 en duetos (flecha roja), islotes de
Langerhans (flecha azul) y clulas acinares; D y F) El producto gnico de PLEKHM1 se
expresa en clulas tumorales positivas para queratina 19 (C y D respectivamente).
ADP= adenocarcinoma ductal pancretico.
95
 DAPI PLEKHMl

Keratin 19 Merged
Figura 33. Doble tincin inmunohistoqumica de PLEKHM1 y queratina 19. Tejido
de adenocarcinoma ductal pancretico marcado con anti-PLEKHM1 (AiexaFiuor 488,
verde); Queratina 19 (AiexaFiuor 568, rojo); tincin nuclear DAPI (azul).

PLEKHM1 MMP7

.. ,_
-":'~~-------"'-_ . -- ~
..... _ ... , .

? ~- ty~,;
.... .... --
' :~<- . ~-,.
--~ '<. ..: .....
a. :-<
e
<( ~-.-,. :

Figura 34. Expresin de PLEKHM1 en clulas solitarias en aparente proceso

invasivo. Clulas positivas para PLEKHM1 se encuentran en regiones desprendidoas
de la masa tumoral principal y expresan MMP7. ADP= adenocarcinoma ductal
pancretico.

96
 2.0 PLEKHMl
J ;
o*
/ ...ocu o o ~
/ <J 1.5 00
"'
....;>.
00
"jl oo
S::
....S::cu o
..
~...J
o
e-o 1.0 o
aS:: o ,;-.

:E
.\.
..
,;
: -
u
<
"'
r;f)
0.5
., ~:

._:;.

.. .
n=30 0.0354 \../

..
0.0 *
Non-neoplastic Adenocarcinoma

Figura 35. Anlisis inmunohistoqumico de PLEKHM1 en muestras tumorales y

no neoplsicas de pncreas. Anlisis t test pareado de dos colas de los staining
scores de PLEKHM1 para 30 casos de adenocarcinoma ductal y sus respectivo tejidos
no neoplsicos adyacentes. Lnea punteada representa la media del score para cada
grupo.

97
 Pan creas

Timo Prstata

' ...
_,:.~,'"~
. .
- .. \-

Piel Amgdala Cuello del tero

. ..: \ .~
::!
:.., \
+'I;.\:
.

1
"\,
"1 .
. .
'. , :.,
,.
,.

Figura 36. Expresin de PLEKHM1 en tejidos humanos normales de distintos

rganos evaluada mediante tincin inmunohistoqumica. Las flechas rojas indican
clulas positivas para la expresin de PLEKHM1 en timo, prstata, piel, amgdala y
cuello uterino.

98
4.6.3.2. WNT9A wingless-type MMTV integration site family, member 9A

WNT9A pertenece a la familia de protenas WNT y ha sido relacionado al

proceso de condrognesis e integridad articular en modelos murinos [127], as como a
la morfognesis y proliferacin celular en epitelio heptico de modelos aviares [128].
En zebrafish ha sido vinculado al desarrollo del paladar y mandbula inferior [129].
La expresin de WNT9A fue analizada en tejidos de adenocarcinoma ductal
pancretico mediante anlisis inmunohistoqumico. WNT9A se expresa en clulas
ductales del pncreas no neoplsico con un patrn de tincin granular de localizacin
supranuclear, sugerente de ubicacin en retculo endoplasmtico, sin embargo, esta
expresin es baja o nula en la mayora de los duetos pequeos (Figura 37A), siendo
los duetos de tamao mediano o mayor los que expresan WNT9A de forma ms
intensa (Figura 378). En tejidos de adenocarcinoma ductal, WNT9A se expresa en la
mayora de las clulas tumorales, mostrando frecuentemente patrones de tincin
intenso (Figura 37C y 370).
La expresin de WNT9A fue evaluada mediante TMA, siguiendo el mismo
protocolo empleado para PLEKHM1. En la Figura 38 se observa que la expresin de
WNT9A es significativamente mayor en los tejidos de adenocarcinoma ductal en
comparacin con los tejidos no neoplsicos. Es de inters destacar que al comparar
los staining scores de los tejidos no neoplsicos de PLEKHM1 (Figura 35) y WNT9A
(Figura 38), el primero presenta un score promedio inferior al segundo, esto debido a
que WNT9A se expresa en tejidos normales a niveles bajos, a diferencia de PLEKHM1,
que se encuentra ausente en tejidos normales y no neoplsicos de pncreas. Para el
anlisis estadstico de WNT9A fueron removidos los datos de dos pacientes por
presentar plegamiento del core sobre s mismo, invalidando el staining score.

99
 Pancreas no neoplsico

Queratina 19 WNT9A

o.
e
<C E;

Figura 37. Expresin de WNT9A en tejidos pancreticos tumorales y no

neoplsicos. A) WNT9A se expresa en duetos de morfologa normal con un patrn
supranuclear (flecha roja), B) Algunos duetos no expresan WNT9A (flecha roja). Islotes
de Langerhans (flecha azul) y clulas acinares no expresan WNT9A; El producto
gnico de WNT9A se expresa en clulas tumorales (D y F) positivas para queratina 19
(C y D respectivamente). ADP= adenocarcinoma ductal pancretico.

100
 2.0
WNT9A

o **
...o
QJ

oog o ...
> 1

~ 1.5 .. -
....>.
o; 00 ooo
~
....
QJ
o 0o o _'2.~'2.
~
''o 1.0 Ooooo
~ -~q_
:: m o0o0o oo
] 0 0ooo 8 o o
"'
rJl o
0.5 00
<

n=28 **p=O.OOJ9
0.0
Non-neoplastic Adenocarcinoma

Figura 38. Anlisis inmunohistoqumico de WNT9A en muestras tumorales y no

neoplsicas de pncreas. Anlisis t test pareado de dos colas de los staining scores
de WNT9A para 28 casos de adenocarcinoma ductal y sus respectivo tejidos no
neoplsicos adyacentes. Lnea punteada representa la media del score para cada
grupo.

101
4.6.3.3. MMP7 matrix metallopeptidase 7 (matrilysin, uterine) y STAT1 signa/
transducer and activator of transcription 1, 91kDa

MMP7 y STAT1 fueron identificados como transcritos de expresin tumoral

mediante la estrategia SSH. Adicionalmente, STAT1 fue identificada en la estrategia
Directa.
Ambas molculas fueron estudiadas mediente inmunohistoqumica en tejidos no
neoplsicos y de adenocarcinoma pancretico. Los duetos tumorales expresan MMP7
con un patrn apical de intensidad moderada (Figura 398), sin embargo, es posible
observar tejidos no tumorales que presentan expresin de MMP7. Esto se ve reflejado
en el anlisis de tissue array (Figura 39E), donde se observa que los tejidos no
neoplsicos no se diferencian significativamente de los tumores en la expresin de
MMP7, aunque hay mayor tendencia a la expresin en ADP. Una situacin similar
ocurre con STAT1, donde se observa expresin de la protena en tejidos tanto
tumorales como no tumorales, sin diferencias significativas de expresin en el anlisis
de tissue array (Figura 39F), aunque hay una leve tendencia de mayor expresin en los
tejidos de ADP.

102
 No neoplsico ADP
A

., '

.U!

' ; . ... ~ . .. : . ..
:. ;- \

-~
.... , ...

,.,,
j>',.,
. .)

;.
..
-:.'
. :-\ . ' .
,. .
-:.
'..

E 4.o MMP7 F 4.o STATl

00 ns
3.5
.,.... ns ., 3.5 o
o l5
~ 3.0 ~ 3.0 o
o
~ o 0 oooO ~
~ 2.5 0 -~ 2.5

~Ya
oo ., o o oo
oo 0 o ;:; oooo o:g 0 o
-~2.0 e;, 2.0
~
o8 o
~
-~ oo o 0 .5 -oc1'56g
] 1.5 ooo 0
oO e
] 1.5
oooo
oo ooo oo
"'
en "'
en o
1.0 oo 1.0
< < o
o
0.5 0.5
n=30 n=28
0.0 0.0
Non-neoplastic Adenocarcinoma Non-neoplastic Adenocarcinoma

Figura 39. Expresin de MMP7 y STAT1 en tejidos pancreticos. A) Nula expresin

de MMP? en tejido no neoplsico; B) Expresin moderada de MMP7 en tejido tumoral.
C) Baja expresin de STAT1 en tejido no neoplsico; D) Expresin moderada de
STAT1 en tejido tumoral y estroma reactivo. E) Anlisis t test pareado de una cola de la
expresin de MMP? en tejidos no neoplsicos y sus respectivos tejidos tumorales. F)
Anlisis t test pareado de una cola de la expresin de STAT1 en tejidos no neoplsicos
y sus respectivos tejidos tumorales. Dos casos fueron removidos debido a plegamiento
del core.

103
4.6.3.4. DPYSL4 dihydropyrimidinase-like 4

DPYSL4 fue identificada mediante la estrategia SSH como un transcrito up-

regulated en tejidos de ADP. El estudio inmunohistoqumco indica que una baja
proporcin de los pacientes expresan la protena solo un baja proporcin de las clulas
tumorales. Las escasas clulas positivas presentan un patrn de tincin supranuclear
de tipo granular (Figura 40A y 40C). Este gen no fue estudiado mediante tissue
microarray.

DPYSL4 Queratina 19

. '.\

.&

Figura 40. Expresin de DPYSL4 en tejidos de adenocarcinoma pancretico. A y

C) DPYSL4 presenta un patrn de tincin granular de ubicacin supranuclear en
clulas tumorales. By D) Tincin de queratina 19 correspondiente a las imgenes en A
y e respectivamente.

104
4.6.4. Genes identificados en la estrategia SSH contrastados con la base de
datos del Human Atlas Protein.

Genes up-regulated escogidos de la estrategia SSH fueron contrastados con la

base de datos del Human Atlas Protein y procedados de manera similar. La figura 41
muestra ejemplos de expresin en dos tejidos no neoplsicos y dos tejidos tumorales
diferentes para cada protena. Las protenas codificadas por los genes EGFR
(epidermal growth factor receptor), C1orf159 (chromosome 1 open reading frame 159),
DNAH9 (dynein, axonemal, heavy chain 9), F3 (coagulation factor 111 (thromboplastin,
tissue factor)), CD55 (molecule, decay accelerating factor for complement (Cromer
blood group)), PPP4R4 (protein phosphatase 4, regulatory subunit 4), TAOK2 (TAO
kinase 2), ZNF266 (zinc finger protein 266) presentan niveles bajos o nulos de
expresin en tejidos no neoplsicos de pncreas. Por el contrario, es posible encontrar
tejidos tumorales que expresan niveles moderados a intensos de la respectiva protena
(Figura 41 ). El hallazgo de tumores que sobre expresan estas protenas en
comparacin con tejidos no neoplsicos se encuentra en concordancia con los
hallazgos transcriptmicos identificados mediante la estrategia SSH.

105
 ADP

0:::
LL
(.9
w

(j)
1.()
T"""
't:
o
T"""
(_)

(j)
:r:
<(
z
o

('()
LL

1.()
1.()
o
(_)

:t~~~iJ?~~:
r===:::;:==::::;
,"".'

. ~ '

co
co : .-,'.
. ,
C\1
LL
z ... /.

,.
N ....... ."

Figura 41. Imgenes de tinciones inmunohistoqumicas de genes de la estrategia

SSH obtenidas del Human Atlas Protein. Tinciones IHQs de 8 genes up-regu/ated
identificados mediante la estrategia Directa. ADP=adenocarcinoma ductal pancretico.
Cada tejido no neoplsico y de adenocarcinoma provienen de muestras de pacientes
independientes.
106
5. DISCUSION

El ADP es una enfermedad devastadora con un psimo pronstico. La nica

cura es la reseccin quirrgica del rgano, pero esta opcin solo es posible en -20%
de los pacientes debido principalmente a la infiltracin arterial del tumor y el
diagnstico tardo, el cual muchas veces requiere de tres o ms visitas al mdico para
poder ser concretado [13]. Incluso en el grupo de pacientes que accede a la reseccin
quirrgica, la sobrevivencia media es menor a los 2 aos y se ha observado, en
aquellos pacientes que sobreviven por ms tiempo, que un porcentaje de ellos nunca
tuvieron adenocarcinoma ductal en el diagnstico inicial [130]. Se ha propuesto que la
nica forma de sobrevivir al ADP es el diagnstico temprano de la enfermedad seguido
de la reseccin quirrgica del pncreas [11 ]. Es por ello que es de urgente necesidad
la identificacin y desarrollo de nuevas estrategias de diagnstico para mejorar as el
desastroso pronstico de esta enfermedad.
En este proyecto de tesis hemos investigado el transcriptoma de tumores
completos de ADP con el objetivo de identificar molculas con el potencial de ser
utilizadas como elementos diagnsticos de la enfermedad. Para este objetivo hemos
empleado una plataforma de microarray de expresin gnica mediante dos estrategias
simultneas, con el propsito de caracterizar los transcriptomas de alta y baja
abundancia del ADP. Para estudiar el transcriptoma de baja abundancia hemos
acoplado las tecnologas de microarray y de hibridacin sustractiva por supresin
(SSH). La SSH es una tcnica de sustraccin de cONA basada en la reaccin en
cadena de la polimerasa [96]. Este mtodo permite normalizar y sustraer genes
diferenciales entre dos poblaciones de cDNAs. La normalizacin iguala la abundancia
de cONA y la sustraccin excluye las secuencias que son comunes entre ambas
poblaciones comparadas. Luego, mediante amplificacin se obtienen secuencias
especficas que provienen de las diferencias moleculares entre dos sistemas. Sin
embargo, la caracterizacin y cuantificacin de las clonas de cONA es laboriosa y ha
limitado su utilizacin. Debido a esto, la tcnica de SSH se ha acoplado a la tecnologa
de microarray para incrementar el rendimiento en la identificacin de las secuencias.

107
 En esta investigacin, hemos mostrado que los transcritos de alta abundancia en el
tumor, identificados mediante la estrategia Directa, se caracterizan por estar
relacionados con la elevada presencia de tejido estroma! reactivo, el cual se compone
principalmente de clulas pancreticas estelares [123] que producen cantidades
anormalmente elevadas de componentes de la matriz extracelular. Por el contrario, la
aplicacin de la estrategia SSH en las mismas muestras, empleando un tejido normal
como muestra sustractora (driver), permite una reduccin importante de trancritos
asociados a reaccin desmoplstica y revela genes de baja abundancia pero que
presentan una relativa especificidad por el tejido tumoral epitelial. Un ejemplo de esto
es la protena codificada por el gen PLEKHM1, que presenta niveles bajos u nulos en
tejido no tumoral pero se expresa en el tejido canceroso epitelial de aproximadamente
el 30% de los casos estudiados, sin embargo, el nmero de clulas tumorales que
expresan la protena es variable.

5.1 La estrategia Directa permite la identificacin de transcritos relacionados con

la reaccin desmoplstica del ADP

El estudio de la expresin gnica empleando una estrategia Directa implica que

la poblacin de transcritos en estudio es hibridada directamente sobre el microarray o
es amplificada previamente para alcanzar las cantidades necesarias. La metodologa
de amplificacin mediante transcripcin in vitro es la ms frecuentemente usada, pues
conserva la abundancia relativa de los transcritos [131]. Esta metodologa permite el
estudio de los transcriptoma nativos de los tejidos y ha sido usada ampliamente para la
caracterizacin de perfiles de expresin gnica en una variedad de tejidos tumorales
[51, 52, 132, 133], incluyendo el ADP [134, 135].
Las masas tumorales de ADP se caracterizan por tener una alta heterogeneidad
celular, donde es posible encontrar diversos tipos celulares distintos de las clulas
epiteliales cancerosas [32]. El ADP presenta una extensa y compleja reaccin
desmoplstica compuesta por una matriz extracelular, fibroblastos y miofibroblastos
activados, clulas inflamatorias, clulas sanqguneas y vasos linfticos que

108
distorsionan la arquitectura normal del tejido pancretico. Muchos tumores de origen
epitelial como el cncer de mama, prstata y ovario presentan una importante reaccin
desmoplstica con acumulcin de clulas estromales. Sin embargo, el pncreas
presenta la desmoplasia ms extensa entre los cnceres epiteliales, observndose
tumores donde el estroma reactivo representa hasta el 90% del volumen tumoral [21].
En nuestro estudio transcriptmico fue posible identificar un elevado nmero de
genes relacionados con la biologa estroma! del tumor paralelamente con genes
relacionados con el tejido tumoral epitelial. Estos hallazgos se encuentran en
concordancia con estudios previos que han utilizado la misma estrategia para
caracterizar tejidos completos de ADP. Genes tales como COL 1A 1, COL4A 1 y
COL6A3 (codifican para fibras de colgeno), CTHR1, FN1, POSTN, VCAN y FBN1 han
sido identificados como protenas de expresin predominantemente estromales. Las
fibras de colgenos son componentes mayoritarios de la matriz extracelular de los
tumores pancreticos [136] y sus transcritos se expresan abundantemente en tejidos
de ADP analizados mediante microarray [68, 137, 138]. El transcrito del gen COL 17A1
ha sido indentificado en nuestro estudio como up-regu/ated en ADP y asociado a
matriz extracelular, sin embargo, se ha demostrado que su origen es el tejido tumoral
epitelial y no el estroma reactivo [137]. A su vez, COL6A3 se expresa intensamente en
la desmoplasia tumoral pancretica [139].
Versican (VCAN) y periostin (POSTN) son proteoglicanos que se expresan
abundantemente en los tejidos tumorales pancreticos, donde las clulas estelares
representan la mayor fuente de estas molculas, observndose escasa o nula
expresin en clulas tumorales [140, 141]. En ADP y otros tumores se ha demostrado
que periostin sustenta un microambiente favorable para el crecimiento tumoral [142],
adems de ser inducido por clulas metastsicas para iniciar la colonizacin de otros
tejidos [143]. Fibronectin 1 (FN 1) es una glicoprotena de la matriz extracelular
relacionada con procesos de adhesin y migracin celular, cuyo transcrito se
encuentra en alta abundancia en tejidos tumorales de ADP [68, 70, 137, 144]. En
estudios in vitre se ha obervado que fibronectin 1 incrementa significativamente el
comportamiento invasivo de lneas celulares pancreticas [145].

109
 Expresin de SPARC en fibroblastos peritumorales del cncer de pncreas se
encuentra asociado a un mal pronstico [146, 147]. Estudios experimentales han
sugerido que la expresin de SPARC es dependiente de procesos inflamatorios y
acompaa la ca-expresin de otros componentes inflamatorios y de matriz extracelular
tales como colgenos y fibronectinas [148].
La produccin exacerbada de matriz extracelular no es exclusiva del ADP. La
pancreatis crnica (PA) es un desorden inflamatorio progresivo donde el parnquima
secretorio del pncreas es destruido y reemplazado por tejido fibrtico [149]. Varios
genes identificados en nuestro estudio ya han sido asociados a los procesos fibrticos
del ADP y de la PC. A nivel transcriptmico y protemico el tejido desmoplstico del
ADP y PC poseen muchos genes en comn, tales como fibras de colgeno, FN1,
CDH11, LTBP1, SPARC, HIF1A, MMP11, VCAN, POSTN y LYZ [75, 150-152]. El
factor comn entre la PC y el ADP es la activacin y proliferacin de las clulas
estelares, mediada por injuria tisular, necrosis y procesos inflamatorios que estimulan
la fibrosis [153].
La desmoplasia tumoral pancretica es de relevancia para el tratamiento de la
enfermedad. En modelos murinos de cncer pancretico donde el estroma reactivo es
depletado se ha observado un incremento en la eficiencia de los tratamientos
antineoplsicos, aumentando la sobrevivencia de los ratones y la biodistribucin de las
drogas antineoplsicas [23, 24].
Actualmente en el mercado no existen biomarcadores de origen estroma! para
tumores epiteliales, sin embargo, se ha propuesto que el estroma es una fuente de
marcadores para la evaluacin de la enfermedad, que pueden ser combinados con
marcadores especficos de tumor [154]. Un reciente estudio protemico realizado en
modelos HER2 de cncer de mama, demostr que tanto en el inicio como en la
progresin del tumor el proteoma plasmtico es inundado con protenas relacionados
con matriz extracelular, reparacin de heridas, sistema inmune, coagulacin, cascada
del complemento y metabolismo. Este estudio demuestra que una visin integrada de
la masa tumoral y todos sus componentes celulares tienen el potencial de ser
empleados en deteccin y diagnstico del cncer [155]. El rol del microambiente

110
tumoral y la fibrosis mediada por fibroblastos y clulas estelares son reconocidos
actualmente como fenmenos de relevancia para la progresin del cncer [156].

5.2 la estrategia SSH permite enriquecer grupos de genes distintos de los

identificados mediante la estrategia Directa

La hibridacin sustractiva por supresin permite la deteccin de transcritos de

expresin diferencial entre dos muestras complejas independientemente de la
abundancia relativa de los transcritos. Los transcritos de baja abundancia son
enriquecidos mientras que los transcritos comunes entre las muestras y de una mayor
abundancia son depletados. En nuestro estudio aplicamos la estrategia SSH a las
mismas muestras estudiadas mediante la estrategia Directa. Para la sustraccin
empleamos como muestra driver un tejido normal de pncreas, el cual se compone
aproximadamente en un 80-90% de clulas acinares y de un 10-20% de otros tipos
celulares, tales como tejidos ductales de origen epitelial, clulas estelares y
fibroblastos.
La estrategia SSH permiti una fuerte reduccin en la deteccin de transcritos
relacionados con la biologa estroma!. Una menor cantidad de transcritos relacionados
con respuesta a heridas, adhesin celular, muerte celular programada, matriz
extracelular, retculo endoplasmtico y membrana basal, entro otros. Por el contrario, la
estrategia SSH permiti un enriquecimiento de genes cuya funcin es
predominantemente intracelular y que no fueron identificados en la estrategia Directa,
tales como morfognesis de rganos, respuesta al calcio, diferenciacin de stem cells
y mediadores de la va Wnt, entre otros.
Wnt-3-catenina es una va de sealizacin de importancia para el desarrollo
embrionario y requerido para la proliferacin, diferenciacin y morfognesis de varios
rganos [157]. Los ligandos de Wnt se unen a receptores de la familia Frizzled. La
unin de los ligandos resulta en la inactivacin de un complejo de protenas
citoplasmticas (incluyendo adenomatous po/yposis coli (APC) y axin) que promueven
la degradacin proteosomal de {3-catenin, lo que resulta en la acumulacin

111
 citoplasmtica y localizacin nuclear de esta protena. A nivel nuclear, {3-catenn se une
a los factores de transcripcin TCF/LEF para activar la expresin de una serie de
genes objetivo. Diecinueve ligandos Wnt han sido identificados en mamferos y que
son capaces de activar la va cannica (dependiente de {3-catenn) y la va no cannica
(independiente de {3-catenn) a travs de la unin de los ligandos con los receptores
Frizzled y sus ce-receptores.
Estudios recientes han comenzado a establecer el rol de la va Wnt- {3-catenn
en ADP. Aunque la acumulacin de {3-catenn no es una caracterstica universal de
esta enfermedad, la acumulacin tanto nuclear (10-60%) como citoplasmtica (25-65%)
es observada en lesiones PaniN y ADP [158-160]. Los ligandos cannicos (como
WNT3 y WNT8B) se expresan intensamente en tejidos de ADP[160]. Un aumento en la
expresin de DKK1, inhibidor de los ligandos Wnt secretados, est asociado con
PaniNs avanzadas y ADP, adems de incrementar el crecimiento y motilidad de
clulas de ADP [161]. Sin embargo, la va no cannica tambin se ha relacionado al
desarrollo de la intensa reaccin desmoplstica observada en el cncer pancretico, a
travs del aumento de la expresin de WNT5A [162].
Mediante la estrategia SSH identificamos transcritos de la va Wnt que no fueron
identificados por la estrategia Directa. Entre los genes identificados encontramos a
TCF7L2, NFAT5 y WNT9A.
TCF7L2 (transcrpton factor 7-/ke 2 (T-ce/1 specfc, HMG-box)) ha sido
relacionado principalmente a la diabetes de tipo 2, donde cambios en este gen definen
el riesgo gentico ms determinante de esta enfermedad [163]. Sin embargo, se ha
demostrado que TCF7L2 posee un rol represor de la transcripcin mediante el cual
restringe el crecimiento de tumores de cncer colorectal [164]. Un reciente estudio
publicado por The Cancer Genome Atlas Network revel que miembros de la va Wnt
se encuentra mutados en ms del 94% de los tumores de colon y recto,
predominantemente en el gen APC. lnteresantemente, el gen TCF7L2 es uno de los 8
genes cuya mutacin se encuentra con mayor frecuencia. Adems, se encontr un
nuevo gen fusin entre los genes TCF7L 1 (homlogo de TCF7L2) y NAV2. Esta fusin
carece del dominio TCF3 que se une a {3-catenn. Estos hallazgos destacan el rol de la
va Wnt y de los genes TCF en el desarrollo del cncer de colon [165].
112
 NFAT5 (nuclear factor of activated T-cel/s 5, tonicity-responsive) est
relacionado a la va de sealizacin de la integrina a5l34, mediante la cual incrementa la
capacidad migratoria de clulas tumorales de mama [166].
Acerca de WNT9A y su relacin con cncer hay escasos reportes en la literatura.
Mutaciones frecuentes de este gen han sido reportadas en ADP [31], sin embargo, no
ha sido estudiado en detalle en este tipo de cncer. Debido a su relativa novedad
biolgica, WNT9A fue escogido como gen candidato de estudio y ser discutido ms
adelante.
La estrategia SSH identific genes relacionados con diferenciacin celular.
MSI2 (musashi homolog 2) ha sido relacionado a la malignidad de la leucemia mieloide
crnica [167]. La expresin de MSI2 aumenta a medida que progresa la enfermedad,
pero adems es un indicador de un mal pronstico. MSI2 participa de la va de
sealizacin que controla la diferenciacin de clulas de leucemia mieloide crnica, por
lo cual ha sido propuesta como una nueva alternativa teraputica para esta
enfermedad [168]
RIF1 (RAP1 interacting factor homolog) fue identificada originalmente en
levaduras como una protena capaz de interactuar con Rap1, una molcula localizada
en los telomeros [169]. RIF1 participa en el checkpoint de la fase S, contribuyendo a la
inhibicin de la replicacin de DNA asociada con la activacin de ATM [170]. La
expresin de RIF1 cambia progresivamente durante la diferenciacin de linajes
celulares mamarios de primates no humanos, agrupndose con otros genes
relacionados con diferenciacin tales como ESR1, TFF1 AR y IGF1 [171]. La relacin
de esta protena y el cncer no ha sido estudiada en profundidad.
ERCC2 (excision repair cross-complementing rodent repair deficiency,
complementation group 2) es un gen relacionado con la va de reparacin por escisin
de nucletidos que participa de la reparacin del dao al DNA. Se ha demostrado que
polimorfismos de ERCC2 son un factor pronstico para el tratamiento con oxaliplatino
en cncer gstrico y de colon [172]. Adems, en cncer de pulmn se ha observado
que polimorfismos de ERCC2 sirven como factores de riesgo de baja penetrancia al
contribuir con la presentacin de la enfermedad en fumadores [173].

113
 Un estudio previo realizado por nuestro grupo de investigacin aplic la
metodologa de hibridacin sustractiva por supresin al estudio de tumores avanzados
de cncer gstrico y cncer de colon. De forma similar a lo observado en cncer
pancretico, esta metodologa permiti una reduccin en el enriquecimiento de genes
relacionados con matrix extracelular y componentes inflamatorios. A su vez, esta
metodologa permiti el enriquecimiento de genes relacionados con vas de
sealizacin intracelulares tales como Wnt, PI3K, angiognesis y activacin de clulas
B y T en tumores de cncer gstrico. Un anlisis ms profundo de la va de
sealizacin Wnt mostr que transcrito de CTBP1 se encuentra aumentado en ms de
70 veces en tejidos tumorales en comparacin a tejidos no neoplsicos adyacentes a
la lesin tumoral. El silenciamiento mediante knockdown por RNAi del transcrito de
CTBP1 sensibiliza a lneas celulares tumorales frente a drogas antineoplsicas de uso
oncolgico [174]. Esto demuestra la utilidad de esta plataforma en la identificacin de
objetivos moleculares con relevancia terapetica.
El desarrollo y perfeccionamiento de las plataformas de alto rendimiento para el
anlisis de expresin gnica ha permitido identificar patrones que se asocian a una
variedad de fenotipos tumorales. El panorama ha conducido esta rea a ir ms all del
clustering y de las correlaciones de expresin gnica y en su lugar, utilizar un enfoque
ms dirigido para derivar firmas de expresin que representen "sub-fenotipos" o "meta-
genes" que reflejen fenmenos como el estatus de receptores de hormonas,
sobrevivencia a la enfermedad, respuesta a terapias, la respuesta a hipoxia o la
activacin de vas de sealizacin oncognicas que contribuyan al desarrollo tumoral
[55, 175].

114
5.3 Ambas estrategias permiten identificar genes que codifican para protenas de
secrecin.

Las protenas de secrecin representan una fuente de potenciales biomarcadores

para biomedicina [110], especialmente para la deteccin de neoplasias [176, 177].
Mediante anlisis bioinformtico identificamos protenas de secrecin enriquecidas en
ambas estrategias.

El ao 2009, Harsha et al publicaron un compendio de potenciales

biomarcadores de cncer pancretico construido a partir de un anlisis sistemtico de
la literatura cientfica y de repositorios de bases de datos de DNA microarray, tales
como GEO (NCBI), Oncomine y ArrayExpress (EBI) [178]. Comparando nuestros datos
con este estudio, la lista de genes obtenida mediante la estrategia Directa contiene 77
protenas de secrecin, de las cuales 47 (61%) ya han sido descritas por Harsha et al
como potenciales biomarcadores. Por otro lado, la lista SSH contiene 26 protenas de
secrecin, de las cuales solo 9 (35%) fueron descritas en el compendio.

Dentro de los genes descritos en la lista Directa encontramos a ANXA2, FAS,

C4BP4, CD59, CALU, VCAN, IL8, WNT9A, CXCL5, TGFBI. Varios de estos genes ha
sido estudiados con anterioridad en cncer pancretico. ANXA2 ha sido propuesto
como marcador de cncer pancretico [179], siendo posible encontrar la protena en
orina de pacientes [180]. El transcrito de CD59 ha sido identificado previamente como
sobre expresado en ADP mediante anlisis de microarray [69]. Adems, la protena de
CD59 ha sido identificada en muestras de orina de pacientes con cncer pancretico
[180]. El transcrito de FAS se ha encontrado previamente aumentado en tejidos de
adenocarcinoma ductal [181] y su abundancia en suero permite discriminar pacientes
con cncer de controles con lesiones benignas y controles saludables [182].

El transcrito de la protena y transcrito de Calumenin (CALU) se expresan a

mayores niveles en tumores de cncer de colon en comparacin con adenomas y
tejidos normales [183]. CALU fue escogido como candidato de estudio y es discutido
ms adelante.

115
 En un reciente estudio protemico, Turtoi et al identificaron protenas de alta
expresin en tejidos de adenocarcinoma pancretico. Entre las protenas identificadas
se encuentran FN1, TGFBI y AGRN las cuales fueron identificadas en la estrategia
Directa de nuestro estudio, como transcritos que codifican para protenas de secrecin
[184].

Mediante la estrategia SSH identificamos, entre otros, a MMP7, WNT9A, NMU,

EGFR, CP, NMU, y OLFML 1. NMU (Neuromedin) es un neuropptido que ha sido
descrito como molcula de alta expresin en tejidos tumorales de cncer pancretico
[185]. EGFR (epidermal growth factor receptor) es el objetivo terapetico de la droga
Erlotinib, actualmente aprobada para el tratamiento de cncer pancretico. En tejidos
de ADP se ha observado que la expresin de EGFR se correlaciona con el pronstico
de la enfermedad [186] y la presencia de metstasis en nodos linfticos y rganos
distantes [187].
CP (ceruplasmin) codifica para una protena srica que participa en la
homeostasis del hierro y que cuyos niveles se encuentran aumentados en los sueros
de pacientes con cncer pancretico [188], aunque su especificidad por la enfermedad
es baja [189]. La protena de OLFML 1 (o/factomedin-like 1), cuyo transcrito fue
identificado mediante nuestra estrategia SSH, fue descrita recientemente como una
molcula sobre expresada en un grupo de tumores de adenocarcinoma ductal
pancretico [184]. En trminos generales, ambas estrategias permitieron la
identificacin de genes que codifican para protenas de secrecin. Muchos de los
genes han sido descritos previamente en la literatura y apoyan los resultados
obtenidos mediante nuestro estudio. Sin embargo, otros genes han sido escasamente
estudiados y fueron evaluados como potenciales candidatos.

116
5.4 Validacin de genes candidatos de la estrategia Directa

PMEPA1 prostate transmembrane protein, androgen induced 1

PMEPA1 (llamado alternativamente como TMEPAI, STAG1, ERG1.2 o N4wbp4)

es una protena capaz de ser inducido por testosterona y relacionado con procesos
tumorales [190, 191]. La expresin de PMEPA1 puede ser inducido por el factor de
crecimiento transformante TGF-13 [192-194], adems de ser identificado como up-
regu/ated en cncer de estmago, rectal [122, 195] y de prstata [196].
Recientemente se ha demostrado que una posible funcin fisiolgica de
PMEPA 1 es participar en un circuito de retroalimentacin negativa (negative feedback
loop) que controla la duracin e intensidad de la va de sealizacin de TGF-13/Smad
[197]. En estudios in vitro de cncer de mama se ha observado que PMEPA 1
promueve las funciones promotoras de tumores de TGF-13, en desmedro de sus
funciones supresoras de tumores [198]. Ambas investigaciones fueron publicadas
posteriormente a nuestra decisin de caracterizar PMEPA1 en tejidos de ADP.
En nuestro estudio identificamos una alta expresin de transcritos de PMEPA 1
en tejidos de ADP. Un estudio inmunohistoqumico de la protena de PMEPA1 confirma
que su expresin es predominantemente epitelial. ..
Un estudio transcriptmico realizado en tumores de ADP identific al transcrito
de PMEPA 1 como up-regulated en tumores y asociado a una firma de expresin
dependiente de TGF-13 [199]. Sin embargo, nuestro estudio es el primero en realizar
estudios morfolgicos de expresin de PMEPA1 en ADP.

BHLHE40 basic helix-/oop-helix family, member e40

El gen BHLHE40 (tambin conocido como BHLHB2, SHARP2, Stra13 o DEC1)

es un factor de transcripcin basic helix-loop-helix que ha sido identificado como sobre-
expresado en cncer de mama [200] y gstrico [201]. BHLHE40 se caracteriza por ser
un gen que responde al descenso de los niveles de oxgeno en clulas y tejidos. Esta
asociacin con hipoxia ha sido encontrada en diferentes tumores [200, 202]. Adems
117
de hipoxia, este gen puede ser estimulado por TGF-~ [203, 204]. En una investigacin
reciente, realizada en cncer de mama, se observ que la sobre expresin de
BHLHE40 inducida por TGF-~ previene la apoptosis y el knockdown de este gen
mediante RNA de interferencia reduce la sobrevivencia inducida por TGF-~ [205]. El
reporte ms interesante vinculado a BHLHE40 fue publicado el ao 2010 y describe el
uso de la metodologa ARACNe para determinar la interaccin entre factores de
transcripcin y molculas objetivos. Mediante este algoritmo, BHLHE40 fue identificado
como uno de cinco factores de transcripcin relacionados con la transformacin
mesenquimal de gliomas de alto grado. La transformacin mesenquimal posee
similitudes con la transicin epitelio-mesenquimal [206]. Sin embargo, BHLHE40 no fue
estudiado en profundidad en este estudio.
Wang et al realizaron un estudio descriptivo y funcional de BHLHE40 en ADP
(Investigacin publicada posteriormente a nuestra eleccin de BHLHE40 como gen
candidato de estudio). Esta protena se expresa en alrededor del 50% de las clulas
acinares y en una bajo porcentaje de clulas ductales, con un patrn
predominantemente nuclear. En tejidos tumorales se observ una mayor expresin de
esta protena, con un patrn nuclear predominante, aunque alrededor del 8% de los
tejidos presentaron patrn citoplasmtico granular. Es de destacar que nuestro estudio
inmunohistoqumico identific un patrn predominantemente citoplasmtico mientras
que este Wang et al identificaron un patrn nuclear [207]. Los anticuerpos empleados
en ambos estudios son diferentes. Nuestro anticuerpo fue validado por el
manufacturador y detecta la protena predicha ms otras bandas inespecficas,
adems de detectar tincin nuclear de BHLHE40 en lneas celulares mediante
inmunofluorescencia pero no mediante inmunohistoqumica en tejidos FFPE
(http://www.proteinatlas.org/ENSG000001341 07/antibody).

CALU calumenin
El transcrito de CALU fue identificado como up-regulated en cncer pancretico
y gstrico en la estrategia directa de microarray empleada en nuestro laboratorio,
adems de encontrarse en la lista sustractiva de colon. Calumenin ha sido identificada
como una protena de retculo endoplsmico que acta como inhibidor de la y-
118
carboxilacin dependiente de vitamina K durante la sntesis de factores de coagulacin
[208, 209], adems de participar en los procesos de migracin y proliferacin de
neuronas [21 0]. Ca/umenin extracelular ha sido asociada a modificaciones de
citoesqueleto y ciclo celular en fibroblastos, mediante un hipottico mecanismo
paracrino o autocrino [211]. Esta molcula se encuentra localizada en la va secretora,
tanto en retculo endoplasmtico como en aparato de golgi y es secretada al espaci o
extracelular de clulas en cultivo [212]. La evidencia de que ca/umenin es secretada al
espacio extracelular y que adems posee un pptido seal para ser secretada, permite
suponer que esta protena posee el potencial de ser evaluada como biomarcador. Tres
estudios independientes han corroborado altos niveles de expresin del transcrito y
protena de calumenin en tejidos de cncer colon [183, 213] y cncer endometrial [214].
Un aumento en la expresin de la protena calumenina ha sido encontrado en
clulas de cncer de cuello uterino que han adquirido resistencia a cisplatino [215]. La
relacin entre CALU y procesos tumorales no ha sido estudiada en profundidad

119
5.5 Validacin de genes candidatos de la estrategia SSH

PLEKHM1 pleckstrin homology domain containing, family M (with RUN domain)

member 1

Esta molcula fue denominada originalmente como AP162 y fue identificada en

cncer de colon como una protena de peso aparente de 162 kDa que forma un
complejo con una molcula similar a mucina, sin embargo, su funcin y relacin con el
cncer no ha sido estudiada en detalle [124]. La mutacin de este gen es responsable
de la osteopetrosis autosomal recesiva tipo VI (OPTB6) [125], enfermedad
caracterizada por el incremento de la densidad sea y que es producida como
consecuencia de la alteracin de la maduracin/acidificacin del compartimiento
endosomal en osteoclastos [126]. En estudio reciente se demostr que la sobre
expresin de PLEKHM1 regula negativamente el transporte desde los endosomas
tempranos a los lisosomas. Por el contrario, el knockdown de PLEKHM1 acelera el
transporte de molculas a los lisosomas, incrementando la degradacin de protenas
dentro de los lisosomas [216]. Esto se encuentra en concordancia con el rol propuesto
para PLEKHM1 en la reabsorcin de hueso por parte de los osteoclastos.
PLEKHM1 fue identificado en nuestro estudio mediante la estrategia SSH
como up-regulated en tejidos de ADP y validado posteriormente mediante qRT-PCR.
Mediante un estudio inmunohistoqumico de tejidos de ADP confirmamos que la
protena se expresa en -30% de los casos de forma exclusiva en clulas tumorales de
origen epitelial. La mayora de los tejidos no tumorales adyacentes a la lesin tumoral
no expresa la protena y no hay evidencia de expresin de la protena en tejidos
normales de pncreas. La estrategia SSH tiene por objetivo identificar genes de
relativa especificidad en tejido tumoral, indepedientemente de su abundancia.
PLEKHM1 es un ejemplo de un gen de especfico de tejido tumoral pero cuya
abundancia es baja dentro de la masa tumoral, donde solo un porcentaje variable de
las clulas tumorales expresa la protena. Es de inters para futuras investigaciones
establecer la relacin entre este gen y el cncer pancretico.

120
WNT9A wingless-type MMTV integration site family, member 9A

WNT9A pertenece a la familia de protenas WNT y ha sido relacionado al

proceso de condrognesis e integridad articular en modelos murinos [127], as como a
la morfognesis y proliferacin celular en epitelio heptico de modelos aviares [128].
En zebrafish ha sido vinculado al desarrollo del paladar y mandbula inferior [129].
Es de relevancia destacar que WNT9A es un gen que se encuentra mutado con
frecuencia en el adenocarcinoma ductal pancretico y pertenece a un grupo de 29
genes de la va Wnt/Notch, la cual se encuentra alterada en el 100% de los canee res
pancreaticos [31]. El rol de WNT9A en cncer no ha sido estudiado en profundidad.
Mediante un estudio inmunohistoqumico de tejidos de ADP confirmamos que la
protena se expresa de forma leve o nula en duetos pancreticos de morfologa normal,
encontrndose ausente en otros tipos celulares de pncreas. Adems, mediante tissue
microarray corroboramos que los niveles de expresin de WNT9A se encuentran
aumentados significativamente en tejidos tumorales en comparacin a tejidos no
neoplsicos de pncreas.
La familia de ligandos Wnt est conformada por protenas de secrecin que
cumplen su rol de sealizacin en distancias cortas [217]. Hay evidencia de que
WNT9A se secreta al espacio extracelular [128] y mayores niveles del transcrito se han
observado en cncer de mama, colorectal, rion y pulmn, analizado mediante
bsqueda en bases de datos [218]. Por lo tanto, esta protena representa un
interesante candidato para ser estudiado como biomarcador de cncer pncreatico.
Recientemente se ha establecido un rol de la va no cannica de Wnt en el
proceso metastsico del cncer de pncreas. Un grupo de clulas tumorales
circulantes poseen niveles aumentados de Wnt2, el cual favorece la sobrevivencia
independiente de anclaje y aumenta en el nmero de metstasis en modelos murinos
[219]. Si bien la va de sealizacin de Wnt parece no participar en la iniciacin del
ADP, recientes evidiencia indican un rol de esta va en la mantencin de la enfermedad
[220]. Futuras investigaciones son requeridas para establecer el rol concreto de esta
va en el ADP y concretamente, analizar la utilidad de WNT9A en diagnstico y
posiblemente terapia.
121
 MMP7 se encuentra up-regu/ated en PaniNs y ADP [221, 222] y su expresin se
correlaciona con menor sobrevida y tamao tumoral, estado de nodo linftico y
metstasis en rganos distantes [222-224]. La delecin de MMP7 en modelos murinos
de ADP, disminuye significativamente el tamao del tumor y las metstasis distantes.
De manera importante, la medicin de MMP7 en sueros de pacientes se correlaciona
con la enfermedad metastsica y la sobrevivencia de los pacientes [225].
lnteresantemente, MMP7 ha sido asociada previamente a la va de sealizacin de
Wnt en modelos murinos de tolerancia a transplantes de rin [226], as como tambin
en modelos de cncer de ovario, donde la expresin especfica de MMP7 es regulada
activamente por WNT7 A y mediada por {3-catenin/TCF [227].
A pesar de que MMP7 ya ha sido estudiada previamente en ADP, incluimos esta
molcula en nuestro estudio con el objetivo de evaluar su especificidad por tejidos
tumorales, debido a que MMP7 fue identificada en la estrategia SSH de nuestro
estudio. Corroboramos que MMP7 se expresa en clulas tumorales de forma intensa,
sin embargo, es posible encontrar regiones positivas en el tejido no neoplsico
adyacente a las lesiones tumorales. Esto se ve reflejado en el anlisis de tissue
microarrays, donde a pesar de que el tejido tumoral presenta una mayor tendencia a la
sobre expresin, las diferencias no fueron significativamente estadsticas debido a la
expresin de MMP7 en los tejidos no neoplsicos.

5.6 Realidad actual del diagnstico de adenocarcinoma ductal pancretico

La ventana de tiempo teraputica para un tumor puede ser descrita como el

perodo de tiempo desde el diagnstico de la lesin pre-neoplsica ms temprana
removible quirrgicamente hasta el estado avanzado o metastsico donde la cura de la
enfermedad ya no es posible. Debido a la localizacin retroperitoneal del pncreas, la
falta de sntomas especficos y la limitada sensibilidad de los mtodos de diagnstico,
casi todos los pacientes se diagnostican en una fase incurable, es decir, la ventana de
tiempo est cerrada para estos pacientes.

122
 A pesar de una terica reseccin quirrgica (sin tumor en los mrgenes y sin
metstasis a ganglios linfticos) y bajo quimioterapia adyuvante, la recurrencia de la
enfermedad es solo cuestin de tiempo. Esta recurrencia se debe a la diseminacin
subclnica de la enfermedad y la resistencia innata a la terapia. Por lo tanto, teniendo
en consideracin que la extraccin quirrgica del rgano es la nica posibilidad de
curacin para los pacientes con ADP, es de suma importancia detectar los cnceres
en una etapa pre-invasiva [228].
El problema aumenta cuando se trata de la deteccin temprana de las lesiones.
La toma de biopsias pancreticas no es un procedimiento realizado de forma rutinaria
para la deteccin de lesionaes pre-neoplsicas. Adems, no se sabe con exactitud que
tipo de lesiones deben ser buscadas en los tejidos, debido a que el origen celular del
pncreas es un tema de debate permanente. Por ltimo, aunque los especialistas
traten de buscar todas las variedades de lesiones conocidas, los precursores que no
son de origen qustico estn por debajo del umbral de deteccin actual de 5-8 mm,
empleando herramientas radiolgicas convencionales [229, 230].
Actualmente, la molcula CA 19-9 es el nico biomarcador que posee utilidad
clnica demostrada, permitiendo monitorear la terapia y detectar tempranamente la
recurrencia de la enfermedad despus del tratamiento en pacientes con cncer
pancretico ya diagnosticado. Sin embargo, CA 19-9 posee importantes limitaciones.
No es un marcador especfico de cncer pancretico; niveles aumentados de esta
molcula pueden estar elevados en otras condiciones como la colestasis. Adems, los
pacientes que son negativos para el antgeno Lewis A o B (aproximadamente el 10%
de los pacientes con cncer de pncreas) son incapaces de sintetizar CA19-9 y tienen
niveles no detectables, incluso en etapas avanzadas de la enfermedad. Aunque la
medicin de este biomarcador es de utilidad en pacientes con cncer pancretico
conocido, el uso de este biomarcador como herramienta de diagnstico ha tenido
resultados decepcionates [12]. Otros biomarcadores han sido propuestos y se
encuentran en distintos niveles de validacin clnica [179].
La mayora de los marcadores tumorales carecen de la sensibilidad y
especificidad necesarias para detectar la enfermedad en estados tempranos.
Recientes evidencias abordan esta problemtica. Empleando como modelo el cncer
123
 de ovario y la deteccin del biomarcador CA-125, Hori et al propusieron rigurosamente
que la tasa de liberacin de biomarcadores a la sangre se encuentra miles de veces
por debajo de los lmites necesarios para detectar un tumor durante su primera dcada
de desarrollo [231]. Esta evidencia destaca una problemtica que ha afectado el
campo del diagnstico oncolgico durante dcadas: las herramientas moleculares
desarrolladas para el screening de enfermedades neoplsicas son incapaces de
detectar la enfermedad en etapas tempranas, a pesar de la abundante evidencia que
indica que los pacientes poseen mejor expectativa de vida si el rgano es son
removido en etapas tempranas [11].
En este contexto, nuevas molculas y tecnologas emergentes ofrecen la
oportunidad de aumentar la sofisticacin del diagnstico oncolgico. La metodologa de
hibridacin sustractiva acoplada a microarray ha sido empleada previamente para
identificar nuevos genes con potencial de ser usados como elementos de diagnstico o
terapia en cncer [88-90, 92, 93, 232]. Sin embargo, una caracterstica comn de estos
estudios es que ninguno realiz validaciones para verificar si las variaciones
observadas a nivel de transcritos se correlacionaban con los correspondientes niveles
de protenas. En nuestro estudio identificamos a WNT9A y PLEKHM1 como transcritos
diferenciales y validamos que esa expresin diferencial se extiende hasta los niveles
de la protena. Ambas protenas se expresan nula o escasamente en tejidos no
neoplsicos y normales.
La aplicacin de molculas especficas de tumor posee un gran potencial en
cncer pancretico. Plectin-1 (PLEC) es un ejemplo de este tipo de protenas [233].
Plectin-1 fue identificada como una protena expresada con alta especificidad en
tejidos de ADP. Aunque se expresa en otros tejidos normales, es posible detectar
Plectin-1 en lesiones tumorales primarias y metastsicas mediante bio-imagenologa In
vivo [234]. Otro ejemplo de la aplicacin de esta tecnologa es la deteccin de las
enzimas catepsinas en tejidos de ADP. Las cate psi nas son enzimas que se expresan
en altos niveles en lesiones preneoplsicas y tumores de ADP. Mediante microscopa
confocal de fluorescencia es posible detectar lesiones tumorales preneoplsicas de
forma sensible y especfica en modelos murinos In vivo y en tiempo real [116].

124
 Las tecnologas de bio-imagenologa han emergido como alternativas para
mejorar la situacin actual del diagnstico oncolgico [235]. A futuro, es de inters
evaluar si transcritos identificados mediante la estrategia indirecta pueden ser tiles
para la deteccin de la enfermedad mediante tecnologas como la bio-imagenologa y
ser aplicadas posteriormente a escenarios clnicos reales.
En resumen, la alta heterogeneidad celular y la biologa de matriz extracelular
del cncer pancretico contribuyen enormemente a su firma transcriptmica, afectando
as la identificacin de transcritos de baja abundancia mediante tecnologas como el
microarray. La aplicacin de la tecnologa de hibridacin sustractiva por supresin
acoplada a microarray permite diferenciar los transcriptomas de alta y baja abundancia
(Figura 43A). lnteresantemente, es posible encontrar transcritos de baja abundancia de
expresin diferencial entre tejidos no neoplsicos y tejidos tumorales pancreticos que
poseen el potencial de ser usados como marcadores de la enfermedad (Figura 438).

125
 A Transcriptoma de Transcriptoma de
alta abudancia Adenocarcinoma baja abundancia
Wnt Transporte de
Matriz Epitelio Inflamacin pathway iones metal
Colgenos CEACAMs WNT9A CP

Periostin
Versican
t
Fibronectina 1 ANXA8
CLDN18
Catepsinas
t NFAT5
TCF7L2
PPP2R1B
t KCNMA1
KCNN2 t
ARMC1
MMPs TOP2A TBL1Y SLC39A10
SPARC APC MFI2
CCND1 KCNG2
Retculo Citoesqueleto MMP7
endoplasmtico de actina Respuesta a Diferenciacin
dao del DNA de Stem cel/s
PLOD2 MYBPC1
EDEM3t ANLN t
CALU
FKBP1B
ACTA2
CAPG2UW
Clulas Clulas
CHEK1
ERCC2
LIG3
t APC
MSI2
RIF1
t
DSE DAG1 FBX018 ERCC2
endoteliales tumorales
RAD51 ACE

B Expresin diferencial de transcritos de baja abundancia

No neoplsico Adenocarcinoma Adenocarcinoma

<(
m
1-
z
5

WNT9A
Funcin: Participa en condrognesis
Va de sealizacin de WnUB-catenina
(posiblemente va cannica)
PLEKHM1
Funcin: Participa en endocitosis
Regulador negativo del transporte
endoctico, pero no la maduracin de
autofagosomas.
Va de sealizacin de Rab7

Figura 43. Transcriptomas de alta y baja abundancia del cncer pancretico. A) El

cncer pancretico se caracteriza por su heterogeneidad celular y la presencia de una
intensa reaccin desmoplstica, la cual es predominante en los estudios de
transcriptomas tumorales. La estrategia indirecta (SSH) reduce los transcritos de alta
abundancia y enriquece el transcriptoma de baja abundancia de los tumores
pancreticos, donde destacan genes relacionados con la va Wnt y diferenciacin de
stem cells. 8) El transcriptoma de baja abundancia contiene transcritos que codifican
para protenas que se expresan diferencialmente en el tumor, como es el caso de
WNT9A y PLEKHM1. Futuros estudios son necesarios para definir el potencial
diagnstico de estas protenas.

126
 6. CONCLUSIONES GENERALES

La estrategia Directa permiti la identificacin de marcadores tumorales

conocidos y nuevos candidatos. Sin embargo, debido al diseo experimental empleado
enriquece adems genes asociados a la extensa reaccin desmoplstica presente en
las masas tumorales del adenocarcinoma ductal pancretico. An queda por definir si
los genes de origen estroma! poseen relevancia para el diagnstico de esta
enfermedad.

Por otra parte, la aplicacin de la estrategia SSH a las mismas muestras de la

estrategia Directa, empleando como muestra sustractora un tejido normal de pncreas,
permiti sustraer genes de alta abundancia presentes en la masa tumoral,
principalmente componentes de matriz extracelular y genes de sistema inmune.
Paralelo a esto, la estrategia SSH permiti el enriquecimiento de genes de mediana y
baja abundancia cuya ubicacin es predominantemente intracelular y relacionados a
vas de sealizacin como es el caso de la va Wnt, ofreciendo as nuevos genes
candidatos.

De entre los genes candidatos de la estrategia Directa observamos que los

productos gnicos de PMEPA 1 y BHLHE40 se expresan con mayor abundancia en
tejidos tumorales en comparacin a tejidos adyacentes a la lesin tumoral. Por otro
lado, el producto gnico de CALU se expresa abundantemente es las clulas
pancreticas estelares activadas, presentes en el estroma reactivo de los tumores.

De entre los genes candidatos de la estrategia SSH observamos que los

productos gnicos de PLEKHM 1 y WNT9A se expresan con mayor abundancia en
tejidos tumorales en comparacin a tejidos adyacentes a la lesin tumoral. Ambos
genes se expresan exclusivamente en clulas de origen epitelial. PLEKHM1 cumple
con la teora de la estrategia SSH: un gen de nula o muy baja presencia en tejidos no
neoplsicos pero presente especficamente en los tejidos tumorales del cncer
pancretico.
127
128
 7. BIBLIOGRAFA

1. Mukherjee S: The emperor of al/ maladies: a biography of cancer. 1st Scribner hardcover edn.
New York: Scribner; 2010.

2. Nelson CM, Bissell MJ: Of extracellular matrix, scaffolds, and signaling: tissue architecture
regulates development, homeostasis, and cancer. Annual review of ce// and developmenta/
biology 2006, 22:287-309.

3. Apte MV, Haber PS, Applegate TL, Norton ID, McCaughan GW, Korsten MA, Pirola RC, Wilson
JS: Periacinar stellate shaped cells in rat pancreas: identification, isolation, and culture.
Gut 1998,43:128-133.

4. Haber S, Uhlen M: Human protein atlas and the use of microarray technologies. Curr Opin
Biotechno/2008, 19:30-35.

5. WHO (Ed.). World Cancer Report 2008. Lyon2008.

6. Medina E, Kaempffer AM: Cancer mortality in Chile: epidemiological considerations. Rev

Md Chile 2001, 129:1195-1202.

7. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Murray T, Thun MJ: Cancer statistics, 2008. CA
Cancer J Clin 2008, 58:71-96.

8. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D: Global cancer statistics. CA Cancer
J Clin 2011, 61:69-90.

9. Maitra A, Hruban RH: Pancreatic cancer. Annu Rev Patho/2008, 3:157-188.

10. Pavlidis N, Briasoulis E, Hainsworth J, Greco FA: Diagnostic and therapeutic management of
cancer of an unknown primary. Eur J Cancer 2003, 39:1990-2005.

11. Lohr M: ls it possible to survive pancreatic cancer? Nat Clin Pract Gastroenterol Hepatol
2006, 3:236-237.

12. Hidalgo M: Pancreatic cancer. N Engl J Med 2010, 362:1605-1617.

13. Lyratzopoulos G, Neal RO, Barbiere JM, Rubin GP, Abel GA: Variation in number of general
practitioner consultations befo re hospital referral for cancer: findings from the 201 O
National Cancer Patient Experience Survey in England. Lancet Onco/2012, 13:353-365.

14. Vincent A, Herman J, Schulick R, Hruban RH, Goggins M: Pancreatic cancer. Lancet 2011,
378:607-620.

15. Poste G: Bring on the biomarkers. Nature 2011, 469:156-157.

129
 16. Carmichael J, Fink U, Russell RC, Spittle MF, Harris AL, Spiessi G, Blatter J: Phase 11 study of
gemcitabine in patients with advanced pancreatic cancer. Br J Cancer 1996, 73:101-105.

17. Burris HA, 3rd, Moore MJ, Andersen J, Green MR, Rothenberg ML, Mediano MR, Cripps MC,
Portenoy RK, Storniolo AM, Tarassoff P, et al: lmprovements in survival and clinical benefit
with gemcitabine as first-line therapy for patients with advanced pancreas cancer: a
randomized trial. J Clin Onco/1997, 15:2403-2413.

18. Koorstra JB, Hustinx SR, Offerhaus GJ, Maitra A: Pancreatic carcinogenesis. Pancreatology
2008, 8:110-125.

19. Adsay NV, Thirabanjasak O, Altinel O: Spectrum of Human Pancreatic Neoplasia. In

Pancreatic Cancer. Edited by Lowy AM, Leach SO, Philip PA: Springer; 2008: 3-26.[Pollock RE
(Series Editor): M. D. Anderson So/id Ttumr Oncology Series].

20. Bapat AA, Hostetter G, Von Hoff DO, Han H: Perineural invasion and associated pain in
pancreatic cancer. Nat Rev Cancer 2011, 11:695-707.

21. Neesse A, Michl P, Frese KK, Feig C, Cook N, Jacobetz MA, Lolkema MP, Buchholz M, Olive KP,
Gress TM, Tuveson DA: Stromal biology and therapy in pancreatic cancer. Gut 201 O.

22. Yen TW, Aardal NP, Bronner MP, Thorning DR, Savard CE, Lee SP, Bell RH, Jr.:
Myofibroblasts are responsible for the desmoplastic reaction surrounding human
pancreatic carcinomas. Surgery 2002, 131:129-134.

23. Olive KP, Jacobetz MA, Davidson CJ, Gopinathan A, Mclntyre O, Honess O, Madhu B,
Goldgraben MA, Caldwell ME, Allard O, et al: lnhibition of Hedgehog signaling enhances
delivery of chemotherapy in a mouse model of pancreatic cancer. Science 2009, 324:1457-
1461.

24. Diop-Frimpong B, Chauhan VP, Krane S, Boucher Y, Jain RK: Losartan inhibits collagen 1
synthesis and improves the distribution and efficacy of nanotherapeutics in tumors. Proc
Natl Acad Sci U S A 2011, 108:2909-2914.

25. Caldas C, Kern SE: K-ras mutation and pancreatic adenocarcinoma. lnt J Pancreatol 1995,
18:1-6.

26. Smit VT, Boot AJ, Smits AM, Fleuren GJ, Cornelisse CJ, Bos JL: KRAS codon 12 mutations
occur very frequently in pancreatic adenocarcinomas. Nuc/eic Acids Res 1988, 16:7773-
7782.

27. Almoguera C, Shibata O, Forrester K, Martin J, Arnheim N, Perucho M: Most human

carcinomas of the exocrine pan creas contain mutant e-K-ras genes. Ce//1988, 53:549-554.

28. Roa JC, Anabalon L, Tapia O, Melo A, de Aretxabala X, Roa 1: [Frequency of K-ras mutation
in biliary and pancreatic tumors]. Rev Med Chi/2005, 133:1434-1440.

130
 29. Hingorani SR, Petricoin EF, Maitra A, Rajapakse V, King C, Jacobetz MA, Ross S, Conrads TP,
Veenstra TD, Hitt 8A, et al: Preinvasive and invasive ductal pancreatic cancer and its early
detection in the mouse. Cancer Ce/12003, 4:437-450.

30. Aguirre AJ, 8ardeesy N, Sinha M, Lopez L, Tuveson DA, Horner J, Redston MS, DePinho RA:
Activated Kras and lnk4a/Arf deficiency cooperate to produce metastatic pancreatic
ductal adenocarcinoma. Genes Dev 2003, 17:3112-3126.

31. Jones S, Zhang X, Parsons DW, Lin JC, Leary RJ, Angenendt P, Mankoo P, Carter H,
Kamiyama H, Jimeno A, et al: Core signaling pathways in human pancreatic cancers
revealed by global genomic analyses. Science 2008,321:1801-1806.

32. Samuel N, Hudson TJ: The molecular and cellular heterogeneity of pancreatic ductal
adenocarcinoma. Nature reviews Gastroenterology & hepatology 2011, 9:77-87.

33. Singh A, Greninger P, Rhodes D, Koopman L, Violette S, 8ardeesy N, Settleman J: A gene

expression signature associated with "K-Ras addiction" reveals regulators of EMT and
tumor cell survival. Cancer Ce/12009, 15:489-500.

34. Weinstein 18: Cancer. Addiction to oncogenes--the Achilles heal of cancer. Science 2002,
297:63-64.

35. Moskaluk CA, Hruban RH, Kern SE: p16 and K-ras gene mutations in the intraductal
precursors of human pancreatic adenocarcinoma. Cancer Res 1997, 57:2140-2143.

36. Campbell PJ, Yachida S, Mudie LJ, Stephens PJ, Pleasance ED, Stebbings LA, Morsberger LA,
Latimer C, Melaren S, Lin ML, et al: The patterns and dynamics of genomic instability in
metastatic pancreatic cancer. Nature 201 O, 467:1109-1113.

37. Yachida S, Jones S, 8ozic 1, Antal T, Leary R, Fu 8, Kamiyama M, Hruban RH, Eshleman JR,
Nowak MA, et al: Distant metastasis occurs late during the genetic evolution of pancreatic
cancer. Nature2010, 467:1114-1117.

38. Maitra A, Adsay NV, Argani P, lacobuzio-Donahue C, De Marzo A, Cameron JL, Yeo CJ, Hruban
RH: Multicomponent analysis of the pancreatic adenocarcinoma progression model using
a pancreatic intraepithelial neoplasia tissue microarray. Mod Patho/2003, 16:902-912.

39. lacobuzio-Donahue CA: Genetic evolution of pancreatic cancer: lessons learnt from the
pancreatic cancer genome sequencing project. Gut 2011.

40. Wang Z, Gerstein M, Snyder M: RNA-Seq: a revolutionary tool for transcriptomics. Nature
reviews Genetics 2009, 10:57-63.

41. Vogel C, Marcotte EM: lnsights into the regulation of protein abundance from proteomic
and transcriptomic analyses. Nature reviews Genetics 2012:227-232.

42. de Sousa Abreu R, Penalva LO, Marcotte EM, Vogel C: Global signatures of protein and
mRNA expression levels. Mol Biosyst 2009, 5:1512-1526.

131
 43. Maier T, Guell M, Serrano L: Correlation of mRNA and protein in complex biological
samples. FEBS Lett 2009, 583:3966-3973.

44. Schwanhausser B, Busse O, Li N, Oittmar G, Schuchhardt J, Wolf J, Chen W, Selbach M: Global

quantification of mammalian gene expression control. Nature 2011, 473:337-342.

45. Hebenstreit O, Fang M, Gu M, Charoensawan V, van Oudenaarden A, Teichmann SA: RNA

sequencing reveals two major classes of gene expression levels in metazoan cells.
Molecular systems bology 2011, 7:497.

46. Islam S, Kjallquist U, MolinerA, Zajac P, Fan JB, Lonnerberg P, Linnarsson S: Characterization
of the single-cell transcriptional landscape by highly multiplex RNA-seq. Genome Res
2011,21:1160-1167.

47. Hah N, Oanko CG, Core L, Waterfall JJ, Siepel A, Lis JT, Kraus WL: A rapid, extensive, and
transient transcriptional response to estrogen signaling in breast cancer ce lis. Ce//2011,
145:622-634.

48. Mercer TR, Gerhardt OJ, Oinger ME, Crawford J, Trapnell C, Jeddeloh JA, Mattick JS, Rinn JL:
Targeted RNA sequencing reveals the deep complexity of the human transcriptome. Nat
Botechnol2012, 30:99-104.

49. Alizadeh AA, Eisen MB, Oavis RE, Ma C, Lossos IS, Rosenwald A, Boldrick JC, Sabet H, Tran T,
Yu X, et al: Distinct types of diffuse large B-cell lymphoma identified by gene expression
profiling. Nature 2000, 403:503-511.

50. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, Pollack JR, Ross OT,
Johnsen H, Akslen LA, et al: Molecular portraits of human breast tumours. Nature 2000,
406:747-752.

51. Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H, Hastie T, Eisen MB, van de Rijn
M, Jeffrey SS, et al: Gene expression patterns of breast carcinomas distinguish tumor
subclasses with clinical implications. Proc Natl Acad Sc U S A 2001, 98:10869-10874.

52. van 't Veer LJ, Oai H, van de Vijver MJ, He YO, Hart AA, Mao M, Peterse HL, van der Kooy K,
Marton MJ, Witteveen AT, et al: Gene expression profiling predicts clinical outcome of
breast cancer. Nature 2002, 415:530-536.

53. Rosenwald A, Wright G, Chan WC, Connors JM, Campo E, Fisher Rl, Gascoyne RO, Muller-
Hermelink HK, Smeland EB, Giltnane JM, et al: The use of molecular profiling to predict
survival after chemotherapy for diffuse large-B-cell lymphoma. N Engl J Med 2002,
346:1937-1947.

54. Paik S, Shak S, Tang G, Kim C, Baker J, Cronin M, Baehner FL, Walker MG, Watson O, Park T,
et al: A multigene assay to predict recurrence of tamoxifen-treated, node-negative breast
cancer. N Engl J Med 2004, 351 :2817-2826.

132
 55. Bild AH, Yao G, Chang JT, Wang Q, Potti A, Chasse D, Joshi MB, Harpole D, Lancaster JM,
Berchuck A, et al: Oncogenic pathway signatures in human cancers as a guide to targeted
therapies. Nature 2006, 439:353-357.

56. Lamb J, Ramaswamy S, Ford HL, Contreras B, Martinez RV, Kittrell FS, Zahnow CA, Patterson
N, Golub TR, Ewen ME: A mechanism of cyclin 01 action encoded in the patterns of gene
expression in human cancer. Ce//2003, 114:323-334.

57. Black EP, Huang E, Dressman H, Rempel R, Laakso N, Asa SL, lshida S, West M, Nevins JR:
Oistinct gene expression phenotypes of cells lacking Rb and Rb family members. Cancer
Res 2003, 63:3716-3723.

58. Reis-Filho JS, Pusztai L: Gene expression profiling in breast cancer: classification,
prognostication, and prediction. Lancet 2011, 378:1812-1823.

59. Reis-Filho JS, Weigelt B, Fumagalli D, Sotiriou C: Molecular profiling: moving away from
tumor philately. Sci Transl Med 201 O, 2:47ps43.

60. lacobuzio-Donahue CA, Ryu B, Hruban RH, Kern SE: Exploring the host desmoplastic
response to pancreatic carcinoma: gene expression of stromal and neoplastic cells at the
site of primary invasion. Am J Patho/2002, 160:91-99.

61. Han H, Bearss DJ, Browne LW, Calaluce R, Nagle RB, Von Hoff DD: ldentification of
differentially expressed genes in pancreatic cancer cells using cONA microarray. Cancer
Res 2002, 62:2890-2896.

62. lacobuzio-Donahue CA, Maitra A, Shen-Ong GL, van Heek T, Ashfaq R, Meyer R, Walter K,
Berg K, Hollingsworth MA, Cameron JL, et al: Oiscovery of novel tumor markers of
pancreatic cancer using global gene expression technology. Am J Patho/2002, 160:1239-
1249.

63. lacobuzio-Donahue CA, Maitra A, Olsen M, Lowe AW, van Heek NT, Rosty C, Walter K, Sato N,
Parker A, Ashfaq R, et al: Exploration of global gene expression patterns in pancreatic
adenocarcinoma using cONA microarrays. Am J Patho/2003, 162:1151-1162.

64. Hassan R, Sera T, Pastan 1: Mesothelin: a new target for immunotherapy. Clin Cancer Res
2004, 10:3937-3942.

65. Argani P, lacobuzio-Donahue C, Ryu B, Rosty C, Goggins M, Wilentz RE, Murugesan SR, Leach
SO, Jaffee E, Yeo CJ, et al: Mesothelin is overexpressed in the vast majority of ductal
adenocarcinomas of the pancreas: identification of a new pancreatic cancer marker by
serial analysis of gene expression (SAGE). Clin Cancer Res 2001, 7:3862-3868.

66. McCarthy DM, Maitra A, Argani P, Rader AE, Faigel DO, Van Heek NT, Hruban RH, Wilentz RE:
Novel markers of pancreatic adenocarcinoma in fine-needle aspiration: mesothelin and
prostate stem cell antigen labeling increases accuracy in cytologically borderline cases.
Appllmmunohistochem Mol Morpho/2003, 11 :238-243.

133
 67. Corso CD, Stubbs DD, Lee SH, Goggins M, Hruban RH, Hunt WD: Real-time detection of
mesothelin in pancreatic cancer cell line supernatant using an acoustic wave
immunosensor. Cancer Detect Prev 2006, 30:180-187.

68. Jin G, Hu XG, Ying K, Tang Y, Liu R, Zhang YJ, Jing ZP, Xie Y, Mao YM: Oiscovery and
analysis of pancreatic adenocarcinoma genes using cONA microarrays. World J
Gastroenterol 2005, 11 :6543-6548.

69. Crnogorac-Jurcevic T, Efthimiou E, Nielsen T, Loader J, Terris B, Stamp G, Baron A, Scarpa A,

Lemoine NR: Expression profiling of microdissected pancreatic adenocarcinomas.
Oncogene 2002, 21:4587-4594.

70. Tan ZJ, Hu XG, Cao GS, Tang Y: Analysis of gene expression profile of pancreatic
carcinoma using cONA microarray. World J Gastroentero/2003, 9:818-823.

71. lacobuzio-Donahue CA, Ashfaq R, Maitra A, Adsay NV, Shen-Ong GL, Berg K, Hollingsworth MA,
Cameron JL, Yeo CJ, Kern SE, et al: Highly expressed genes in pancreatic ductal
adenocarcinomas: a comprehensive characterization and comparison of the transcription
profiles obtained from three major technologies. Cancer Res 2003, 63:8614-8622.

72. Friess H, Ding J, Kleeff J, Fenkell L, Rosinski JA, Guweidhi A, Reidhaar-Oison JF, Korc M,
Hammer J, Buchler MW: Microarray-based identification of differentially expressed growth-
and metastasis-associated genes in pancreatic cancer. Ce// Mol Life Sci 2003, 60:1180-1199.

73. Nakamura T, Fidler IJ, Coombes KR: Gene expression profile of metastatic human
pancreatic cancer cells depends on the organ microenvironment. Cancer Res 2007,
67:139-148.

74. Crnogorac-Jurcevic T, Efthimiou E, Capelli P, Blaveri E, Baron A, Terris 8, Jones M, Tyson K,

Bassi C, Scarpa A, Lemoine NR: Gene expression profiles of pancreatic cancer and stromal
desmoplasia. Oncogene 2001,20:7437-7446.

75. Logsdon CD, Simeone DM, Binkley C, Arumugam T, Greenson JK, Giordano TJ, Misek DE,
Kuick R, Hanash S: Molecular profiling of pancreatic adenocarcinoma and chronic
pancreatitis identifies multiple genes differentially regulated in pancreatic cancer. Cancer
Res 2003, 63:2649-2657.

76. Spratlin JL, Mulder KE: Looking to the future: biomarkers in the management of pancreatic
adenocarcinoma. lnt J Mol Sci 2011, 12:5895-5907.

77. Keating P, Cambrosio A: Too many numbers: Microarrays in clinical cancer research. Stud
Hist Phi/os Biol Biomed Sci 2012, 43:37-51.

78. Karakach TK, Flight RM, Douglas SE, Wentzell PD: An introduction to ONA microarrays for
gene expression analysis. Chemometrics and lntelligent Laboratory Systems 2010:28-52.

79. Quackenbush J: Computational approaches to analysis of ONA microarray data. Yearb Med
lnform 2006:91-103.

134
 80. Altman NS, Hua J: Extending the loop design for two-channel microarray experiments.
Genet Res 2006, 88:153-163.

81. Knapen D, Vergauwen L, Laukens K, Blust R: Best practices for hybridization design in two-
colour microarray analysis. Trends Botechno/2009, 27:406-414.

82. Churchill GA: Fundamentals of experimental design for cONA microarrays. Nat Genet 2002,
32 Suppl:490-495.

83. Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov
K, Gurskaya N, Sverdlov ED, Siebert PO: Suppression subtractive hybridization: a method
for generating differentially regulated or tissue-specific cONA probes and libraries.
Proceedngs of the Natonal Academy of Scences of the Unted States of Amerca 1996,
93:6025-6030.

84. Rebrikov DV, Desai SM, Siebert PO, Lukyanov SA: Suppression subtractive hybridization.
Methods Mol Bo/2004, 258:107-134.

85. Lukyanov KA, Launer GA, Tarabykin VS, Zaraisky AG, Lukyanov SA: lnverted terminal repeats
permit the average length of amplified ONA fragments to be regulated during preparation
of cONA libraries by polymerase chain reaction. Ana/ytca/ Bochemstry 1995, 229:198-202.

86. Siebert PO, Chenchik A, Kellogg DE, Lukyanov KA, Lukyanov SA: An improved PCR method
for walking in uncloned genomic ONA. Nuclec acds research 1995, 23:1087-1088.

87. Lukyanov SA, Rebrikov D, A. BA: Suppression Subtractive Hybridization. In Nuclec Acds
Hybrdzaton. Edited by Buzdin A, Lukyanov SA: Springer; 2007: 53-84

88. Liu BH, Goh CH, Ooi LL, Hui KM: ldentification of unique and common low abundance
tumour-specific transcripts by suppression subtractive hybridization and oligonucleotide
probe array analysis. Oncogene 2008, 27:4128-4136.

89. Liu Y, Zhu X, Zhu J, Liao S, Tang Q, Liu K, Guan X, Zhang J, Feng Z: ldentification of
differential expression of genes in hepatocellular carcinoma by suppression subtractive
hybridization combined cONA microarray. Oncol Rep 2007, 18:943-951.

90. Pan YS, Lee YS, Lee YL, Lee WC, Hsieh SY: Oifferentially profiling the low-expression
transcriptomes of human hepatoma using a novel SSH/microarray approach. BMC
Genomcs 2006, 7:131.

91. Wang T, Hopkins O, Schmidt C, Silva S, Houghton R, Takita H, Repasky E, Reed SG:
ldentification of genes differentially over-expressed in lung squamous cell carcinoma
using combination of cONA subtraction and microarray analysis. Oncogene 2000, 19:1519-
1528.

92. Zhang B, Nie X, Xiao B, Xiang J, Shen S, Gong J, Zhou M, Zhu S, Zhou J, Qian J, et al:
ldentification of tissue-specific genes in nasopharyngeal epithelial tissue and
differentially expressed genes in nasopharyngeal carcinoma by suppression subtractive
hybridization and cONA microarray. Genes Chromosomes Cancer 2003, 38:80-90.
135
 93. Barraclough DL, Sewart S, Rudland PS, Shoker BS, Sibson DR, Barraclough R, Davies MP:
Microarray analysis of suppression subtracted hybridisation libraries identifies genes
associated with breast cancer progression. Ce// Onco/201 O, 32:87-99.

94. Lundberg E, Fagerberg L, Klevebring D, Matic 1, Geiger T, Cox J, Algenas C, Lundeberg J, Mann
M, Uhlen M: Defining the transcriptome and proteome in three functionally different human
cell lines. Molecular systems bology 201 O, 6:450.

95. Chenchik A, Zhu Y, Diatchenko L, Li R, Hill J, Siebert PO (Eds.): Generation and use of high-
quality cONA from small amounts of total RNA by SMART PCR: BioTechniques Books, MA;
1998.

96. Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov
K, Gurskaya N, Sverdlov ED, Siebert PO: Suppression subtractive hybridization: a method
for generating differentially regulated or tissue-specific cONA probes and libraries. Proc
Natl Acad Sc U S A 1996, 93:6025-6030.

97. Ritchie ME, Silver J, Oshlack A, Holmes M, Diyagama D, Holloway A, Smyth GK: A comparison
of background correction methods for two-colour microarrays. Bonformatcs 2007,
23:2700-2707.

98. Yang YH, Dudoit S, Luu P, Lin DM, Peng V, Ngai J, Speed TP: Normalization for cONA
microarray data: a robust composite method addressing single and multiple slide
systematic variation. Nuclec Acds Res 2002, 30:e15.

99. Saeed Al, Bhagabati NK, Braisted JC, Liang W, Sharov V, Howe EA, Li J, Thiagarajan M, White
JA, Quackenbush J: TM4 microarray software suite. Methods in enzymology 2006, 411:134-
193.

100. Huang DW, Sherman DT, Lempicki R: Systematic and integrative analysis of large gene lists
using DAVID bioinformatics resources. Nature protocols 2008, 4:44-57.

101. Ramakers C, Ruijter JM, Deprez RH, Moorman AF: Assumption-free analysis of quantitative
real-time polymerase chain reaction (PCR) data. Neurosc Lett 2003, 339:62-66.

102. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F:

Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of
multiple interna! control genes. Genome Bo/2002, 3:RESEARCH0034.

103. Kidd M, Nadler B, Mane S, Eick G, Malfertheiner M, Champaneria M, Pfragner R, Modlin 1:

GeneChip, geNorm, and gastrointestinal tumors: novel reference genes for real-time PCR.
Physol Genomcs 2007, 30:363-370.

104. Rubie C, Kempf K, Hans J, Su T, Tilton B, Georg T, Brittner B, Ludwig B, Schilling M:

Housekeeping gene variability in normal and cancerous colorectal, pancreatic,
esophageal, gastric and hepatic tissues. Mol Gel/ Probes 2005, 19:101-109.

136
105. Zhao H, Hastie T, Whitfield ML, Borresen-Dale AL, Jeffrey SS: Optimization and evaluation of
T7 based RNA linear amplification protocols for cONA microarray analysis. BMe Genomcs
2002, 3:31.

106. eox WG, Beaudet MP, Agnew JY, Ruth JL: Possible sources of dye-related signal
correlation bias in two-color DNA microarray assays. Anal Bochem 2004, 331 :243-254.

107. eao W, Epstein e, Liu H, DeLoughery e, GeN, Lin J, Diao R, eao H, Long F, Zhang X, et al:
Comparing gene discovery from Affymetrix GeneChip microarrays and Clontech PCR-
select cONA subtraction: a case study. BMe Genomcs 2004, 5:26.

108. Huang da W, Sherman BT, Lempicki RA: Systematic and integrative analysis of large gene
lists using DAVID bioinformatics resources. Nat Protoc 2009, 4:44-57.

109. Blake JA, Harris MA: The Gene Ontology (GO) project: structured vocabularies for
molecular biology and their application to genome and expression analysis. eurr Protoc
Bonformatcs 2008, Chapter 7:Unit 7 2.

110. Stastna M, Van Eyk JE: Secreted proteins as a fundamental source for biomarker discovery.
Proteomcs 2012, 12:722-735.

111. Rogers eD, Fukushima N, Sato N, Shi C, Prasad N, Hustinx SR, Matsubayashi H, Canto M,
Eshleman JR, Hruban RH, Goggins M: Differentiating pancreatic lesions by microarray and
QPCR analysis of pancreatic juice RNAs. eancer Bol Ther 2006, 5:1383-1389.

112. Troiani T, Martinelli E, Capasso A, Morgillo F, Orditura M, De Vita F, Ciardiello F: Targeting

EGFR in Pancreatic Cancer Treatment. eurr Drug Targets 2012, 13:802-810.

113. Karanjawala ZE, lllei PB, Ashfaq R, Infante JR, Murphy K, Pandey A, Schulick R, Winter J,
Sharma R, Maitra A, et al: New markers of pancreatic cancer identified through differential
gene expression analyses: claudin 18 and annexin AS. Am J Surg Patho/2008, 32:188-196.

114. Strickland LA, Ross J, Williams S, Ross S, Romero M, Spencer S, Erickson R, Sutcliffe J,
Verbeke C, Polakis P, et al: Preclinical evaluation of carcinoembryonic cell adhesion
molecule (CEACAM) 6 as potential therapy target for pancreatic adenocarcinoma. J Pathol
2009, 218:380-390.

115. Simeone DM, Ji B, Banerjee M, Arumugam T, Li D, Anderson MA, Bamberger AM, Greenson J,
Brand RE, Ramachandran V, Logsdon CD: CEACAM1, a novel serum biomarker for
pancreatic cancer. Pancreas 2007, 34:436-443.

116. Eser S, Messer M, Eser P, von Werder A, Seidler B, Bajbouj M, Vogelmann R, Meining A, von
Burstin J, Algul H, et al: In vivo diagnosis of murine pancreatic intraepithelial neoplasia and
early-stage pancreatic cancer by molecular imaging. Proc Natl Acad Sc U S A 2011,
108:9945-9950.

117. Hansel DE, Ashfaq R, Rahman A, Wanzer D, Yeo CJ, Wilentz RE, Maitra A: A subset of
pancreatic adenocarcinomas demonstrates coamplification of topoisomerase llalpha and

137
 HER21neu: use of immunolabeling and multicolor FISH for potential patient screening
andtreatment. Am J elin Pathol2005, 123:28-35.

118. Holzmann K, Kohlhammer H, Schwaenen e, Wessendorf S, Kestler HA, Schwoerer A, Rau 8,

Radlwimmer B, Dohner H, Lichter P, et al: Genomic DNA-chip hybridization reveals a higher
incidence of genomic amplifications in pancreatic cancer than conventional comparative
genomic hybridization and leads to the identification of novel candidate genes. eancer
Res 2004, 64:4428-4433.

119. Mahlamaki EH, Barlund M, Tanner M, Gorunova L, Hoglund M, Karhu R, Kallioniemi A:

Frequent amplification of 8q24, 11 q, 17q, and 20q-specific genes in pancreatic cancer.
Genes ehromosomes eancer 2002, 35:353-358.

120. Mahlamaki EH, Kauraniemi P, Monni O, Wolf M, Hautaniemi S, Kallioniemi A: High-resolution

genomic and expression profiling reveals 105 putative amplification target genes in
pancreatic cancer. Neoplasia 2004, 6:432-439.

121. Tsukamoto Y, Uchida T, Karnan S, Noguchi T, Nguyen LT, Tanigawa M, Takeuchi 1, Matsuura K,
Hijiya N, Nakada e, et al: Genome-wide analysis of DNA copy number alterations and gene
expression in gastric cancer. J Pathol2008, 216:471-482.

122. Sheffer M, Bacolod MD, Zuk O, Giardina SF, Pincas H, Barany F, Paty PB, Gerald WL,
Notterman DA, Domany E: Association of survival and disease progression with
chromosomal instability: a genomic exploration of colorectal cancer. Proc Natl Acad Sci U
S A 2009, 106:7131-7136.

123. Apte MV, Park S, Phillips PA, Santucci N, Goldstein O, Kumar RK, Ramm GA, Buchler M, Friess
H, McCarroll JA, et al: Desmoplastic reaction in pancreatic cancer: role of pancreatic
stellate ce lis. Pancreas 2004, 29:179-187.

124. Hartei-Schenk S, Gratchev A, Hanski ML, Ogorek O, Trendelenburg G, Hummel M, Hopfner M,

Scherubl H, Zeitz M, Hanski C: Novel adapter protein AP162 connects a sialyl-Le(x)-positive
mucin with an apoptotic signa! transduction pathway. Glycoconjugate journa/2001, 18:915-
923.

125. Van Wesenbeeck L, Odgren PR, Coxon FP, Frattini A, Moens P, Perdu B, MacKay CA, Van Hui
E, Timmermans JP, Vanhoenacker F, et al: lnvolvement of PLEKHM1 in osteoclastic
vesicular transport and osteopetrosis in incisors absent rats and humans. The Journal of
clncal nvestgation 2007, 117:919-930.

126. Del Fattore A, Fornari R, Van Wesenbeeck L, de Freitas F, Timmermans JP, Peruzzi B,
Cappariello A, Rucci N, Spera G, Helfrich MH, et al: A new heterozygous mutation (R714C) of
the osteopetrosis gene, pleckstrin homolog domain containing family M (with run domain)
member 1 (PLEKHM1), impairs vesicular acidification and increases TRACP secretion in
osteoclasts. Journal of bone and mineral research : the official jo umal of the American Society
for Bone and Mineral Research 2008, 23:380-391.

127. Spater O, Hill TP, O'Sullivan R J, Gruber M, Conner DA, Hartmann C: Wnt9a signaling is
required for joint integrity and regulation of lhh during chondrogenesis. Development 2006,
133:3039-3049.
138
128. Matsumoto K, Miki R, Nakayama M, Tatsumi N, Yokouchi Y: Wnt9a secreted from the walls of
hepatic sinusoids is essential for morphogenesis, proliferation, and glycogen
accumulation of chick hepatic epithelium. Dev Bio/2008, 319:234-247.

129. Curtin E, Hickey G, Kamel G, Davidson AJ, Liao EC: Zebrafish wnt9a is expressed in
pharyngeal ectoderm and is required for palate and lower jaw development. Mech Dev
2011,128:104-115.

130. Carpelan-Holmstrom M, Nordling S, Pukkala E, Sankila R, Luttges J, Kloppel G, Haglund C:

Ooes anyone survive pancreatic ductal adenocarcinoma? A nationwide study re-
evaluating the data of the Finnish Cancer Registry. Gut 2005, 54:385-387.

131. Stoyanova R, Upson JJ, Patriotis C, Ross EA, Henske EP, Datta K, 8oman 8, Clapper ML,
Knudson AG, 8ellacosa A: Use of RNA amplification in the optimal characterization of
global gene expression using cONA microarrays. J Ce// Physio/2004, 201:359-365.

132. 8arrier A, Lemoine A, 8oelle PY, Tse C, 8rault D, Chiappini F, 8reittschneider J, Lacaine F,
Houry S, Huguier M, et al: Colon cancer prognosis prediction by gene expression profiling.
Oncogene 2005, 24:6155-6164.

133. Trautmann K, Steudel C, Grossmann D, Aust D, Ehninger G, Miehlke S, Thiede C: Expression

profiling of gastric cancer samples by oligonucleotide microarray analysis reveals low
degree of intra-tumor variability. World J Gastroentero/2005, 11:5993-5996.

134. Grutzmann R, 8oriss H, Ammerpohl O, Luttges J, Kalthoff H, Schackert HK, Kloppel G, Saeger
HD, Pilarsky C: Meta-analysis of microarray data on pancreatic cancer defines a set of
commonly dysregulated genes. Oncogene 2005, 24:5079-5088.

135. Grutzmann R, Pilarsky C, Ammerpohl O, Luttges J, 8ohme A, Sipos 8, Foerder M, Alldinger 1,

Jahnke 8, Schackert HK, et al: Gene expression profiling of microdissected pancreatic
ductal carcinomas using high-density ONA microarrays. Neoplasia 2004, 6:611-622.

136. Shields MA, Dangi-Garimella S, Redig AJ, Munshi HG: Biochemical role of the collagen-rich
tumour microenvironment in pancreatic cancer progression. Biochem J 2012, 441:541-552.

137. Lowe AW, Olsen M, Hao Y, Lee SP, Taek Lee K, Chen X, van de Rijn M, 8rown PO: Gene
expression patterns in pancreatic tumors, cells and tissues. PLoS ONE 2007, 2:e323.

138. Nakamura T, Furukawa Y, Nakagawa H, Tsunoda T, Ohigashi H, Murata K, lshikawa O, Ohgaki

K, Kashimura N, Miyamoto M, et al: Genome-wide cONA microarray analysis of gene
expression profiles in pancreatic cancers using populations of tumor cells and normal
ductal epithelial cells selected for purity by laser microdissection. Oncogene 2004,
23:2385-2400.

139. Arafat H, Lazar M, Salem K, Chipitsyna G, Gong Q, Pan TC, Zhang RZ, Yeo CJ, Chu ML:
Tumor-specific expression and alternative splicing of the COL6A3 gene in pancreatic
cancer. Surgery 2011, 150:306-315.

139
 140. Fukushima N, Kikuchi Y, Nishiyama T, Kudo A, Fukayama M: Periostin deposition in the
stroma of invasive and intraductal neoplasms of the pancreas. Mod Pathol 2008, 21:1 044-
1053.

141. Koninger J, Giese T, di Mola FF, Wente MN, Esposito 1, Bachem MG, Giese NA, Buchler MW,
Friess H: Pancreatic tumor cells influence the composition of the extracellular matrix.
Biochem Biophys Res Commun 2004, 322:943-949.

142. Erkan M, Kleeff J, Gorbachevski A, Reiser C, Mitkus T, Esposito 1, Giese T, Buchler MW, Giese
NA, Friess H: Periostin creates a tumor-supportive microenvironment in the pancreas by
sustaining fibrogenic stellate cell activity. Gastroentero/ogy 2007, 132:144 7-1464.

143. Malanchi 1, Santamaria-Martinez A, Susanto E, Peng H, Lehr HA, Delaloye JF, Huelsken J:
lnteractions between cancer stem cells and their niche govern metastatic colonization.
Nature 2012, 481:85-89.

144. Menke A, Adler G: TGFbeta-induced fibrogenesis of the pancreas. lnt J Gastrointest Cancer
2002, 31:41-46.

145. Sawai H, Okada Y, Funahashi H, Takahashi H, Matsuo Y, Yasuda A, Ochi N, Takeyama H,

Manabe T: Basement membrane proteins play an important role in the invasive processes
of human pancreatic cancer cells. J Surg Res 2008, 144:117-123.

146. Infante JR, Matsubayashi H, Sato N, Tonascia J, Klein AP, Riall TA, Yeo C, lacobuzio-Donahue
C, Goggins M: Peritumoral fibroblast SPARC expression and patient outcome with
resectable pancreatic adenocarcinoma. J Clin Onco/2007, 25:319-325.

147. Mantoni TS, Schendel RR, Rodel F, Niedobitek G, AI-Assar O, Masamune A, Brunner TB:
Stromal SPARC expression and patient survival after chemoradiation for non-resectable
pancreatic adenocarcinoma. CancerBiol Ther2008, 7:1806-1815.

148. Reding T, Wagner U, Silva AB, Sun LK, Bain M, Kim SY, Bimmler D, Graf R: lnflammation-
dependent expression of SPARC during development of chronic pancreatitis in WBN/Kob
rats anda microarray gene expression analysis. Physiol Genomics 2009, 38:196-204.

149. Braganza JM, Lee SH, McCioy RF, McMahon MJ: Chronic pancreatitis. Lancet 2011,
377:1184-1197.

150. Binkley CE, Zhang L, Greenson JK, Giordano TJ, Kuick R, Misek D, Hanash S, Logsdon CD,
Simeone DM: The molecular basis of pancreatic fibrosis: common stromal gene
expression in chronic pancreatitis and pancreatic adenocarcinoma. Pancreas 2004,
29:254-263.

151. Kennedy RH, Bockman DE, Uscanga L, Choux R, Grimaud JA, Sarles H: Pancreatic
extracellular matrix alterations in chronic pancreatitis. Pancreas 1987, 2:61-72.

152. Pan S, Chen R, Stevens T, Bronner MP, May D, Tamura Y, Mclntosh MW, Brentnall TA:
Proteomics portrait of archiva! lesions of chronic pancreatitis. PLoS ONE 2011, 6:e2757 4.

140
 153. Omary MB, Lugea A, Lowe AW, Pandol SJ: The pancreatic stellate cell: a star on the rise in
pancreatic diseases. J Cln lnvest 2007, 117:50-59.

154. Sund M, Kalluri R: Tumor stroma derived biomarkers in cancer. Cancer Metastasis Rev 2009,
28:177-183.

155. Pitteri SJ, Kelly-Spratt KS, Gurley KE, Kennedy J, Buson TB, ChinA, Wang H, Zhang Q, Wong
CH, Chodosh LA, et al: Tumor microenvironment-derived proteins dominate the plasma
proteome response during breast cancer induction and progression. Cancer Res 2011,
71:5090-51 OO.

156. Hanahan D, Weinberg RA: Hallmarks of cancer: the next generation. Ce//2011, 144:646-674.

157. Clevers H: Wnt/beta-catenin signaling in development and disease. Ce//2006, 127:469-480.

158. AI-Aynati MM, Radulovich N, Riddell RH, Tsao MS: Epithelial-cadherin and beta-catenin
expression changes in pancreatic intraepithelial neoplasia. Clin Cancer Res 2004, 10:1235-
1240.

159. Zeng G, Germinare M, Micsenyi A, Monga NK, BellA, Sood A, Malhotra V, Sood N, Midda V,
Monga DK, et al: Aberrant Wnt/beta-catenin signaling in pancreatic adenocarcinoma.
Neoplasia 2006, 8:279-289.

160. Pasea di Magliano M, Biankin AV, Heiser PW, Cano DA, Gutierrez PJ, Deramaudt T, Segara D,
Dawson AC, Kench JG, Henshall SM, et al: Common activation of canonical Wnt signaling in
pancreatic adenocarcinoma. PLoS ONE 2007, 2:e1155.

161. Takahashi N, Fukushima T, Yorita K, Tanaka H, Chijiiwa K, Kataoka H: Dickkopf-1 is

overexpressed in human pancreatic ductal adenocarcinoma cells and is involved in
invasive growth. lnt J Cancer2010, 126:1611-1620.

162. Pilarsky C, Ammerpohl O, Sipos B, Dahl E, Hartmann A, Wellmann A, Braunschweig T, Lohr M,

Jesenofsky R, Friess H, et al: Activation of Wnt signalling in stroma from pancreatic cancer
identified by gene expression profiling. J Ce// Mol Med 2008, 12:2823-2835.

163. Tong Y, Lin Y, Zhang Y, Yang J, Liu H, Zhang B: Association between TCF7L2 gene
polymorphisms and susceptibility to type 2 diabetes mellitus: a large Human Genome
Epidemiology (HuGE) review and meta-analysis. BMC Med Genet 2009, 1O: 15.

164. Tang W, Dodge M, Gundapaneni D, Michnoff C, Roth M, Lum L: A genome-wide RNAi screen
for Wnt/beta-catenin pathway components identifies unexpected roles for TCF
transcription factors in cancer. Proc Natl Acad Sci U S A 2008, 105:9697-9702.

165. TCGA-Network: Comprehensive molecular characterization of human colon and rectal

cancer. Nature 2012, 487:330-337.

166. Jauliac S, Lopez-Rodriguez C, Shaw LM, Brown LF, Rao A, Toker A: The role of NFAT
transcription factors in integrin-mediated carcinoma invasion. Nat Ce// Biol2002, 4:540-544.

141
167. Nishimoto Y, Okano H: New insight into cancer therapeutics: induction of differentiation by
regulating the Musashi/Numb/Notch pathway. Ce// Res 2010, 20:1083-1085.

168. lto T, Kwon HY, Zimdahl 8, Congdon KL, Blum J, Lento WE, Zhao C, Lagoo A, Gerrard G,
Foroni L, et al: Regulation of myeloid leukaemia by the cell-fate determinant Musashi.
Nature 201 O, 466:765-768.

169. Hardy CF, Sussel L, Shore O: A RAP1-interacting protein involved in transcriptional

silencing and telomere length regulation. Genes Dev 1992, 6:801-814.

170. Silverman J, Takai H, Buonomo SB, Eisenhaber F, de Lange T: Human Rif1, ortholog of a
yeast telomeric protein, is regulated by ATM and 53BP1 and functions in the 5-phase
checkpoint. Genes Dev 2004, 18:2108-2119.

171. Stute P, Sielker S, Wood CE, Register TC, Lees CJ, Oewi FN, Williams JK, Wagner JO,
Stefenelli U, Cline JM: Life stage differences in mammary gland gene expression profile in
non-human primates. Breast Cancer Res Treat 2012, 133:617-634.

172. Yin M, Yan J, Martinez-Balibrea E, Graziano F, Lenz HJ, Kim HJ, Robert J, lm SA, Wang WS,
Etienne-Grimaldi MC, Wei Q: ERCC1 and ERCC2 polymorphisms predict clinical outcomes
of oxaliplatin-based chemotherapies in gastric and colorectal cancer: a systemic review
and meta-analysis. C/in Cancer Res 2011, 17:1632-1640.

173. Feng Z, Ni Y, Oong W, Shen H, Ou J: Association of ERCC2/XPD polymorphisms and

interaction with tobacco smoking in lung cancer susceptibility: a systemic review and
meta-analysis. Mol Biol Rep 2012, 39:57-69.

174. Bizama C, Benavente F, Espinoza JA, Salvatierra E, Gutirrez HA, Fernndez E, Sagredo EA,
Roa 1, Mazzolini G, Gidekel M, Podhajcer OL: Low abundance transcriptome analyses
identifies novel markers, specific intracellular pathways and target genes in advanced
human gastrointestinal cancer. Manuscript submitted 2012.

175. Bild AH, Potti A, Nevins JR: Linking oncogenic pathways with therapeutic opportunities. Nat
Rev Cancer 2006, 6:735-741.

176. Gromov P, Gromova 1, Bunkenborg J, Cabezon T, Moreira JM, Timmermans-Wielenga V,

Roepstorff P, Rank F, Celis JE: Up-regulated proteins in the fluid bathing the tumour cell
microenvironment as potential serological markers for early detection of cancer of the
breast. Mol Onco/201 O, 4:65-89.

177. Xue H, Lu 8, Lai M: The cancer secretome: a reservoir of biomarkers. J Transl Med 2008,
6:52.

178. Harsha HC, Kandasamy K, Ranganathan P, Rani S, Ramabadran S, Gollapudi S, Balakrishnan L,

Owivedi SB, Telikicherla O, Selvan LO, et al: A compendium of potential biomarkers of
pancreatic cancer. PLoS Med 2009, 6:e1 000046.

179. Chakraborty S, Saine MJ, Sasson AR, Batra SK: Current status of molecular markers for
early detection of sporadic pancreatic cancer. Biochim Biophys Acta 2011, 1815:44-64.
142
 180. Weeks ME, Hariharan O, Petronijevic L, Radon TP, Whiteman HJ, Kocher HM, Timms JF,
Lemoine NR, ernogorac-Jurcevic T: Analysis of the urine proteome in patients with
pancreatic ductal adenocarcinoma. Proteomics C/in App/2008, 2:1047-1057.

181. Kornmann M, lshiwata T, Kleeff J, Beger HG, Korc M: Fas and Fas-ligand expression in
human pancreatic cancer. Ann Surg 2000, 231:368-379.

182. Brand RE, Nolen BM, Zeh HJ, Allen PJ, Eloubeidi MA, Goldberg M, Elton E, Arnoletti JP,
ehristein JO, Vickers SM, et al: Serum biomarker panels for the detection of pancreatic
cancer. Clnica/ cancer research : an official journal of the American Association for Cancer
Research 2011, 17:805-816.

183. Mikula M, Rubel T, Karczmarski J, Goryca K, Dadlez M, Ostrowski J: lntegrating proteomic and
transcriptomic high-throughput surveys for search of new biomarkers of colon tumors.
Funct lntegr Genomics 2010.

184. Turtoi A, Musmeci O, Wang Y, Dumont B, Somja J, Bevilacqua G, De Pauw E, Delvenne P,

eastronovo V: ldentification of novel accessible proteins bearing diagnostic and
therapeutic potential in human pancreatic ductal adenocarcinoma. J Proteome Res 2011,
10:4302-4313.

185. Ketterer K, Kong B, Frank O, Giese NA, Bauer A, Hoheisel J, Korc M, Kleeff J, Michalski ew,
Friess H: Neuromedin U is overexpressed in pancreatic cancer and increases invasiveness
via the hepatocyte growth factor c-Met pathway. Cancer Lett 2009, 277:72-81.

186. Valsecchi ME, McDonald M, Brody JB, Hyslop T, Freydin B, Yeo eJ, Solomides e, Peiper Se,
Witkiewicz AK: Epidermal growth factor receptor and insulinlike growth factor 1 receptor
expression predict poor survival in pancreatic ductal adenocarcinoma. Cancer 2011.

187. Pryczynicz A, Guzinska-Ustymowicz K, Kemona A, ezyzewska J: Expression of EGF and

EGFR strongly correlatas with metastasis of pancreatic ductal carcinoma. Anticancer Res
2008, 28:1399-1404.

188. Hanas JS, Hocker JR, eheung JY, Larabee JL, Lerner MR, Lightfoot SA, Margan DL, Denson
KD, Prejeant KC, Gusev Y, et al: Biomarker identification in human pancreatic cancer sera.
Pancreas 2008, 36:61-69.

189. lrigoyen Oyarzabal AM, Amiguet Garcia JA, Lopez Vivanco G, Genolla Subirats J, Munoz
Villafranca Me, Ojembarrena Martinez E, Liso lrurzun P: [Tumoral markers and acute-phase
reactants in the diagnosis of pancreatic cancer]. Gastroenterol Hepato/2003, 26:624-629.

190. Xu LL, Shanmugam N, Segawa T, Sesterhenn lA, Mcleod DG, Moul JW, Srivastava S: A novel
androgen-regulated gene, PMEPA1, located on chromosome 20q13 exhibits high level
expression in prostate. Genomics 2000, 66:257-263.

191. Giannini G, Ambrosini MI, Di Marcotullio L, eerignoli F, Zani M, MacKay AR, Screpanti 1, Frati L,
Gulino A: EGF- and cell-cycle-regulated STAG1/PMEPA1/ERG1.2 belongs to a conservad
gene family and is overexpressed and amplified in breast and ovarian cancer. Mol
Carcinog 2003, 38:188-200.

143
 192. Brunschwig EB, Wilson K, Mack D, Dawson D, Lawrence E, Willson JK, Lu S, Nosrati A, Rerko
RM, Swinler S, et al: PMEPA1, a transforming growth factor-beta-induced marker of
terminal colonocyte differentiation whose expression is maintained in primary and
metastatic colon cancer. Cancer Res 2003, 63:1568-1575.

193. Levy L, Hill CS: Smad4 dependency defines two classes of transforming growth factor
{beta} (TGF-{beta}) target genes and distinguishes TGF-{beta}-induced epithelial-
mesenchymal transition from its antiproliferative and migratory responses. Mol Gel/ Bol
2005, 25:8108-8125.

194. ltoh S, Thorikay M, Kowanetz M, Moustakas A, ltoh F, Heldin CH, ten Dijke P: Elucidation of
Smad requirement in transforming growth factor-beta type 1 receptor-induced responses.
J Bol Chem 2003, 278:3751-3761.

195. Rae FK, Hooper JO, Nicol DL, Clements JA: Characterization of a novel gene,
STAG1/PMEPA1, upregulated in renal cell carcinoma and other solid tumors. Mol Carcnog
2001' 32:44-53.

196. Xu LL, Shi Y, Petrovics G, Sun C, Makarem M, Zhang W, Sesterhenn lA, Mcleod DG, Sun L,
Moul JW, Srivastava S: PMEPA1, an androgen-regulated NEDD4-binding protein, exhibits
cell growth inhibitory function and decreased expression during prostate cancer
progression. Cancer Res 2003, 63:4299-4304.

197. Watanabe Y, ltoh S, Goto T, Ohnishi E, lnamitsu M, ltoh F, Satoh K, Wiercinska E, Yang W, Shi
L, et al: TMEPAI, a transmembrane TGF-beta-inducible protein, sequesters Smad proteins
from active participation in TGF-beta signaling. Mol Ce//201 O, 37:123-134.

198. Singha PK, Yeh IT, Venkatachalam MA, Saikumar P: Transforming growth factor-beta (TGF-
beta)-inducible gene TMEPAI converts TGF-beta from a tumor suppressor to a tumor
promoter in breast cancer. Cancer Res 201 O, 70:6377-6383.

199. Badea L, Herlea V, Dima SO, Dumitrascu T, Popescu 1: Combined gene expression analysis
of whole-tissue and microdissected pancreatic ductal adenocarcinoma identifies genes
specifically overexpressed in tumor epithelia. Hepatogastroenterology 2008, 55:2016-2027.

200. Currie MJ, Hanrahan V, Gunningham SP, Morrin HR, Frampton C, Han C, Robinson BA, Fox SB:
Expression of vascular endothelial growth factor D is associated with hypoxia inducible
factor (HIF-1alpha) and the HIF-1alpha target gene DEC1, but not lymph node metastasis
in primary human breast carcinomas. J Cln Pathol2004, 57:829-834.

201. Zheng Y, Jia Y, Wang Y, Wang M, Li B, Shi X, Ma X, Xiao D, Sun Y: The hypoxia-regulated
transcription factor DEC1 (Stra13, SHARP-2) and its expression in gastric cancer. OMICS
2009, 13:301-306.

202. Chakrabarti J, Turley H, Campo L, Han C, Harris AL, Gatter KC, Fox SB: The transcription
factor DEC1 (stra13, SHARP2) is associated with the hypoxic response and high tumour
grade in human breast cancers. Br J Cancer 2004, 91:954-958.

144
 203. Zawel L, Yu J, Torrance CJ, Markowitz S, Kinzler KW, Vogelstein B, Zhou S: DEC1 is a
downstream target of TGF-beta with sequence-specific transcriptional repressor activities.
Proc Natl Acad Sci U S A 2002, 99:2848-2853.

204. Kon N, Hirota T, Kawamoto T, Kato Y, Tsubota T, Fukada Y: Activation of TGF-beta/activin

signalling resets the circadian clock through rapid induction of Dec1 transcripts. Nat Ce//
Bio/2008, 10:1463-1469.

205. Ehata S, Hanyu A, Hayashi M, Aburatani H, Kato Y, Fujime M, Saitoh M, Miyazawa K, lmamura
T, Miyazono K: Transforming growth factor-beta promotes survival of mammary carcinoma
ce lis through induction of antiapoptotic transcription factor DEC1. Cancer Res 2007,
67:9694-9703.

206. Carro MS, Lim WK, Alvarez MJ, Bollo RJ, Zhao X, Snyder EY, Sulman EP, Anne SL, Doetsch F,
Colman H, et al: The transcriptional network for mesenchymal transformation of brain
tumours. Nature 2010,463:318-325.

207. Wang W, Reiser-Erkan C, Michalski CW, Raggi MC, Quan L, Yupei Z, Friess H, Erkan M, Kleeff
J: Hypoxia inducible BHLHB2 is a novel and independent prognostic marker in pancreatic
ductal adenocarcinoma. Biochem Biophys Res Commun 201 O.

208. Wajih N, Sane OC, Hutson SM, Wallin R: The inhibitory effect of calumenin on the vitamin K-
dependent gamma-carboxylation system. Characterization of the system in normal and
warfarin-resistant rats. J Biol Chem 2004, 279:25276-25283.

209. Wajih N, Owen J, Wallin R: Enhanced functional recombinant factor VIl production by HEK
293 cells stably transfected with VKORC1 where the gamma-carboxylase inhibitor
calumenin is stably suppressed by shRNA transfection. Thromb Res 2008, 122:405-410.

210. Vasiljevic M, Heisler FF, Hausrat TJ, Fehr S, Milenkovic 1, Kneussel M, Sieghart W: Spatio-
temporal expression analysis of the calcium-binding protein calumenin in the rodent brain.
Neuroscience 2012, 202:29-41.

211. Ostergaard M, Hansen GA, Vorum H, Honore B: Proteomic profiling of fibroblasts reveals a
modulating effect of extracellular calumenin on the organization of the actin cytoskeleton.
Proteomics 2006, 6:3509-3519.

212. Vorum H, Hager H, Christensen BM, Nielsen S, Honore B: Human calumenin localizes to the
secretory pathway and is secreted to the medium. Exp Ce// Res 1999, 248:473-481.

213. Galamb O, Gyorffy B, Sipos F, Spisak S, Nemeth AM, Miheller P, Tulassay Z, Dinya E, Molnar B:
lnflammation, adenoma and cancer: objective classification of colon biopsy specimens
with gene expression signature. Dis Markers 2008, 25:1-16.

214. Voisin SN, Krakovska O, Matta A, DeSouza LV, Romaschin AD, Colgan TJ, Siu KW:
ldentification of novel molecular targets for endometrial cancer using a drill-down LC-
MS/MS approach with iTRAQ. PLoS ONE2011, 6:e16352.

145
215. eastagna A, Antonioli P, Astner H, Hamdan M, Righetti Se, Perego P, Zunino F, Righetti PG: A
proteomic approach to cisplatin resistance in the cervix squamous cell carcinoma cell line
A431. Proteomics 2004, 4:3246-3267.

216. Tabata K, Matsunaga K, Sakane A, Sasaki T, Noda T, Yoshimori T: Rubicon and PLEKHM1
negatively regulate the endocytic/autophagic pathway via a novel Rab7-binding domain.
Molecular biology of the ce// 201 O, 21 :4162-4172.

217. elevers H, Nusse R: Wnt/beta-Catenin Signaling and Disease. ee//2012, 149:1192-1205.

218. Herr P, Hausmann G, Basler K: WNT secretion and signalling in human disease. Trends Mol
Med 2012.

219. Yu M, Ting DT, Stott SL, Wittner BS, Ozsolak F, Paul S, eiciliano Je, Smas ME, Winokur D,
Gilman AJ, et al: RNA sequencing of pancreatic circulating tumour cells implicates WNT
signalling in metastasis. Nature 2012.

220. Morris JPt, Wang Se, Hebrok M: KRAS, Hedgehog, Wnt and the twisted developmental
biology of pancreatic ductal adenocarcinoma. Nat Rev eancer 201 O, 10:683-695.

221. erawford He, Scoggins eR, Washington MK, Matrisian LM, Leach SD: Matrix
metalloproteinase-7 is expressed by pancreatic cancer precursors and regulates acinar-
to-ductal metaplasia in exocrine pancreas. J elin lnvest 2002, 109:1437-1444.

222. Yamamoto H, ltoh F, lku S, Adachi Y, Fukushima H, Sasaki S, Mukaiya M, Hirata K, lmai K:
Expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in
human pancreatic adenocarcinomas: clinicopathologic and prognostic significance of
matrilysin expression. J elin Oncol2001, 19:1118-1127.

223. Fukushima H, Yamamoto H, ltoh F, Nakamura H, Min Y, Horiuchi S, lku S, Sasaki S, lmai K:
Association of matrilysin mRNA expression with K-ras mutations and progression in
pancreatic ductal adenocarcinomas. earcinogenesis 2001,22:1049-1052.

224. Jones LE, Humphreys MJ, eampbell F, Neoptolemos JP, Boyd MT: Comprehensive analysis
of matrix metalloproteinase and tissue inhibitor expression in pancreatic cancer:
increased expression of matrix metalloproteinase-7 predicts poor survival. e/in eancer
Res 2004, 10:2832-2845.

225. Fukuda A, Wang Se, Morris JPt, Folias AE, Liou A, Kim GE, Akira S, Boucher KM, Firpo MA,
Mulvihill SJ, Hebrok M: Stat3 and MMP7 contribute to pancreatic ductal adenocarcinoma
initiation and progression. Cancer Ce// 2011, 19:441-455.

226. Jovanovic V, Dugast AS, Heslan JM, Ashton-ehess J, Gira! M, Degauque N, Moreau A, Pallier A,
ehiffoleau E, Lair D, et al: lmplication of matrix metalloproteinase 7 and the noncanonical
wingless-type signaling pathway in a model of kidney allograft tolerance induced by the
administration of anti-donor class 11 antibodies. J lmmunol2008, 180:1317-1325.

146
227. Yoshioka S, King ML, Ran S, Okuda H, Maclean JA, 2nd, McAsey ME, Sugino N, Brard L,
Watabe K, Hayashi K: WNT7A regulates tumor growth and progression in ovarian cancer
through the WNT/beta-catenin pathway. Mol Cancer Res 2012, 10:469-482.

228. Erkan M, Hausmann S, Michalski CW, Fingerle AA, Dobritz M, Kleeff J, Friess H: The role of
stroma in pancreatic cancer: diagnostic and therapeutic implications. Nature revews
Gastroenterology & hepatology 2012.

229. Holzapfel K, Reiser-Erkan C, Fingerle AA, Erkan M, Eiber MJ, Rummeny EJ, Friess H, Kleeff J,
Gaa J: Comparison of diffusion-weighted MR imaging and multidetector-row CT in the
detection of liver metastases in patients operated for pancreatic cancer. Abdom lmagng
2011,36:179-184.

230. Aichler M, Seiler C, Tost M, Siveke J, Mazur PK, Da Silva-Buttkus P, Bartsch DK, Langer P,
Chiblak S, Durr A, et al: Origin of pancreatic ductal adenocarcinoma from atypical flat
lesions: a comparative study in transgenic mice and human tissues. J Pathol 2012,
226:723-734.

231. Hori SS, Gambhir SS: Mathematical model identifies blood biomarker-based early cancer
detection strategies and limitations. Sc Transl Med 2011, 3:109ra116.

232. Bangur CS, Switzer A, Fan L, Marton MJ, Meyer MR, Wang T: ldentification of genes over-
expressed in small cell lung carcinoma using suppression subtractive hybridization and
cONA microarray expression analysis. Oncogene 2002, 21:3814-3825.

233. Kelly KA, Bardeesy N, Anbazhagan R, Gurumurthy S, Berger J, Alencar H, Depinho RA,
Mahmood U, Weissleder R: Targeted nanoparticles for imaging incipient pancreatic ductal
adenocarcinoma. PLoS Med 2008, 5:e85.

234. Bausch D, Thomas S, Mino-Kenudson M, Fernandez-del CC, Bauer TW, Williams M, Warshaw
AL, Thayer SP, Kelly KA: Plectin-1 as a novel biomarker for pancreatic cancer. Cln Cancer
Res 2011, 17:302-309.

235. Weissleder R, Pittet MJ: lmaging in the era of molecular oncology. Nature 2008, 452:580-589.

147
8. ANEXOS

ANEXO l. Patente no provisoria.

GIDEKEL Manuel, PODHAJCER Osvaldo, ROA lvn, BIZAMA Carolina,
BENAVENTE Felipe, ESPINOZA Jaime, SALVATIERRA Edgardo, FERNANDEZ
Elmer, GUTIERREZ Ana, ROA Juan Carlos, MAZZOLINI Guillermo: Novel genes and
uses thereof, expression profile of colon, gastric and pancreatic cancer. Patente
USPTO. Nmero presentacin 61/404,141 fecha 09/28/2010. CTI-Salud.

ANEXO 11. Patente provisoria.

GIDEKEL Manuel, ESPINOZA Jaime, MAZZOLINI Guillermo, CABEZON Teresa.
Tumor biomarkers for pancreatic cancer. Patente Provisional. CTI-Salud.

ANEXO 111. Artculo sometido a Molecular Oncology

Manuscrito en preparacin. Jaime A. Espinoza, Carolina Bizama, Felipe Benavente,
Elmer A. Fernndez, Edgardo Salvatierra, Hilda A. Gutierrez, lvn Roa, Guillermo
Mazzolini, Osvaldo Podhajcer. ldentification of novel human pancreatic cancer
biomarkers using low abundance transcriptome analyses.

ANEXO IV. Artculo sometido a Cancer Research

Carolina Bizama, Felipe Benavente, Jaime A. Espinoza, Edgardo Salvatierra, Hilda A.
Gutirrez, Elmer A. Fernndez, Eduardo A. Sagredo, lvn Roa, Mazzolini Guillermo
and Osvaldo L. Podhajcer. Low abundance transcriptome analyses identifies novel
markers, specific intracellular pathways and target genes in advanced human
gastrointestinal cancer. Enviado a Cancer Research.

148
ANEXO V. Artculo publicado (Co-autora)
M Malvicini, M lngolotti, F Piccioni, M Garca, J Bayo, C Atorrasagasti, L Alaniz, J
Aquino, JA Espinoza, M Gidekel, OG Scharovsky, P Matar& G Mazzolini. Reversa! of
gastrointestinal carcinoma-induced immunosuppression and induction of
antitumoural immunity by a combination of cyclophosphamide and gene transfer
of IL-12. Molecular Oncology 2011, 5(3):242-55.

149
 ANEXO 1

PATENTE NO PROVISORIA USPTO 2011

Nmero presentacin 61/404,141 fecha 09/28/201 O

Novel genes and uses thereof, expression profile of colon, gastric and pancreatic
cancer.

150
 UNITED STATES PATENT A"lD TRPJJEMARK FFIGE
UXJTJ-:0 f.!T-\Tf:::S DRP.\ RTMF.Yf OF CXJ.\11\JgRCE
Uniwd St.nW:s f':t.tE-nt aml'lrad~marl. Offi~
A<.~COMM!S!W.J.>lER .FOR PbTENi'S
PO ll<,,:::t:'ID
AkH!~~ Yll$ir1i>'l :l2:\l.:H.t.."0
v..~.:t$_?1('<$,~'<'

ATTY.DOCKET,NO
Ven!urdab-Colon
CONFIRMATION NO. 3788
27772 FILING RECEIPT
DODDS & ASSOCIATES
1707 N STREET NW
WASHINGTON, DC 20036
IIIIIIIIIII~~~JPJil~~~~~lmUIIIrnll
Date Mailed: 10/25/2010

Receipt is acl<nowledged of this provisional patent application. lt will not be examined for patentability and will
become abandoned not later than twelve months after its filing date. Any correspondence concerning the application
must include the following identification information: the U.S. APPLICATION NUMBER, FILING DATE, NAME OF
APPLICANT, and TlTLE OF INVENTION. Fees transmitted by check or draft are subject to collection. Please verify
the accuracy of the data presentad on this receipt. lf an error is noted on this Filing Receipt, please submit
a written request for a Filing Receipt Correction. Please provide a copy of this Filing Receipt with the
changes noted thereon. lf you received a "Notice to File Missing Parts" for this application, please submit
any correctlons to thls Filing Receipt with your reply to the Notice. When the USPTO processes the reply
to the Notice, the USPTO will generate another Filing Receipt lncorporatlng the requested corrections
Applicant{s)
Manuel Gdekel, Santiago, CHILE;
Osvaldo L. Podhajcer, Buenos Aires, ARGENTINA;
!van Roa, Santiago, CHILE;
Carolina Bizama, Santiago, CHILE;
Felipe Benavete, Santiago, CHILE;
Jaime E. Espnoza, Santiago, CHILE;
Edgardo Salvatierra, Buenos Aires, ARGENTINA;
Elmer Fernandez, Cordoba, ARGENTINA;
Ana Gutierrez, Santiago, CHILE;
Juan Carlos Roa, Temuco, CHILE;
Guillermo Mazzollni, Pilar, ARGENTINA;
Power of Attorney:
Leea Somersalo-L0092

lf Required, Foreign Filing License Granted: 10/21/2010

The country code and number of your priority application, to be u sed for filing abroad under the Pars Convention,
is US 61/404,141
Projected Publlcation Date: None, application is not eligible for pre-grant publication
Non-Publicatlon Request: No
Early Publication Request: No
... SMALL ENTITY "*
page 1 of 3

151
 Title
Novel genes and uses thereof, expression profile of colon, gastric and pancreatic cancer
PROTECTING YOUR INVENTION OUTSIDE THE UNITED STATES

Since the rights granted by a U.S. patent extend only throughout the territory of the United States and have no
effect in a foreign country, an inventor who wishes patent protection in another country must apply for a patent
in a specific country or in regional patent offices. Applicants may wish to consider the filing of an international
application under the Patent Cooperation Treaty (PCT). An international (PCT) application generally has the same
effect as a regular national patent application in each PCT-member country. The PCT process slmpllfies the filing
of patent app!ications on !he same invention in member countries, but does not result in a grant of "an international
patent" and does not eliminate the need of applicants to file additional documents and lees in countries where patent
protection is desired.

Almost every country has its own patent law, anda person desiring a patent in a particular country must make an
application for patent in that country in accordance wilh its particular laws. Since the laws of many countries differ
in various respects from !he patent law of the United States, applicants are advised to seek guidance from specific
foreign countries lo ensure that patent rights are not los! prematurely.

Applicants also are advised that in !he case of inventions made in !he United States, the Director ol the USPTO must
issue a license before applicants can apply for a patent in a foreign country. The fi!ing ola U.S. patent application
serves as a request for a foreign filing license. The application's filing receipt contains further information and
gudance asto the status of applicant's license for foreign filing.

Applicants may wish to consult the USPTO booklet, "Generallnforrnaton Concernng Patents" {specfically, the
secton entitled "Treates and Foreign Patents") for more nlormation on timeframes and deadlines for fling foreign
patent applicatons. The guide s available ether by contacting the USPTO Contact Center at 800-786-9 '! 99, or it
can be viewed on the USPTO webste al http://www.uspto.gov/web/offices/pac/docfgeneral/index.html.

For information on preventing theft of your intellectual property {patents, trademarks and copyrigllts), you may wisll
to consult the U.S. Government website, http://www.stopfakes.gov. Part of a Department of Commerce initative,
this website includes self-help "toolkits" giving innovators guidance on how to protect intellectual property in specific
countries such as China, Korea and Mexco. For questions regarding patent enforcement issues, applicants may
call the U.S. Government hotline at 1-866-999-HALT (1-866-999-4158).

LICENSE FOR FOREIGN FILING UNDER

Title 35, United States Code, Section 184
Title 37, Code of Federal Regulations, 5.11 & 5.15
GRANTED

The applicant has been granted a license under 35 U.S.C. 184, if the pllrase "IF REOUIRED, FOREIGN FILING
LICENSE GRANTED" followed by a date appears on this form. Such licenses are issued in all applicatons where
the conditions for issuance of a license have been met, regardless of whether or nota license may be required as
set forth in 37 CFR 5.15. The scope and limitations of this license are set forth in 37 CFR 5.15(a) unless an earlier
license has been ssued under 37 CFR 5. 15(b). The license is subject to revocation upon written notification. The

page2of3

152
date indicated is the effective date of the license, unless an earlier license of similar scope has been granted under
37 CFR 5.13 or 5.14.

Ths lcense is to be retained by the lcensee and may be used at any time on or alter the effective date thereof unless
t s revoked. This license is automatically transferred to any related applcations(s) fled under 37 CFR 1.53(d). This
license is not retroactiva.

The grant of a license does not in any way lessen the responsibility of a licensee for the securty of the subject matter
as imposed by any Government contract or the provisions of existing laws relating to espionage and the natlonal
securty or the export of technical data. Ucensees should apprise themselves of curren! regulatons especially with
respect to certan countries, of other agencies, particularly the Oflce of Defensa Trade Controls, Department of
State (wth respect to Arms, Muntions and lmplements of War (22 CFR 121-128)); the Bureau of lndustry and
Security, Department of Commerce (15 CFR parts 730-774); the Offce of Foregn AssetsControl, Department of
Treasury (31 CFR Parts 500+) and the Department of Energy.

NOTGRANTED

No license under 35 U.S.C. 184 has been granted at this time, if the phrase "IF REOUIRED, FOREIGN FILING
U CENSE GRANTED" DOES NOT appear on this form. Applicant may stlll petition for a lcense under 37 CFR 5. i 2,
l a lcense is desired before the expiration of 6 months from the filing date of the application. lf 6 months has lapsed
from the filing date of this application and the licensee has not received any ndication of a secrecy order under 35
U.S.C. 181, the licensee may toreign file the application pursuant to 37 CFR 5.15(b).

page 3 of3

153
 ANEXO 11

PATENTE PROVISORIA 2012

Tumor biomarkers for pancreatic cancer.

154
 IJS. PTO
JIIIIIIJII
61634832
030712
Provisional Patent Applicaton
Inventor- 1\ftanuel Gdekel
1nventon: Tumor Bomarkers tor Pancreatc Canear
Specifcaton &Figures
Payment check $125
Data Sheet
Oaths
Submtted by Dodds and Associates

155
 ANEXO 111

ARTICULO SOMETIDO A MOLECULAR ONCOLOGY

Jdentification of novel human pancreatic cancer biomarkers using low-abundance

transcriptome analyses

156
 Elsevier Editorial System(tm) for Molecular Oncology
Manuscript Draft

Manuscript Number:

Title: Identification ofnovel human pancreatic cancer biomarkers using low-abundance transcriptome
analyses

Article Type: Research Paper

Keywords: Pancreatic cancer, microarray, suppression subtractive hybridisation, low-abundance

transcriptome, PLEKHMl, WNT9A.

Corresponding Author: Dr Manuel Gidekel, Ph.D.

Corresponding Author's Institution: La Frontera University

First Author: Jaime A Espinoza, PhD

Order of Authors: Jaime A Espinoza, PhD; Carolina Bizama, PhD; Felipe Benavente, PhD; Guillermo
Mazzolini, MD, PhD; Elmer A Fernndez, PhD; Edgardo Salvatierra, PhD; Ana Gutirrez-Moraga, PhD;
Antonio Ferrndez-Izquierdo, MD; Osvaldo Podhajcer, PhD; Ivn Roa, MD; Manuel Gidekel, Ph.D.

Abstract: Pancreatic cancer is a deadly disease with no effective treatment for patients with advanced-
stage disease. Thus, analyses of the low-abundance transcriptome of cancer cells are important to
identify mechanisms underlying tumour progression, especially for advanced pancreatic cancer. Using
suppression subtractive hybridisation followed by transcriptome analysis ofhuman samples obtained
from pan creatic cancer tissues and paired, adjacent non-cancerous tissues, we identified novel cancer
biomarkers, such as WNT9A and PLEKHMl, that were not detectable by direct transcriptomic analyses.
Then, by performing tissue microarrays, WNT9A and PLEKHM 1 were confirmed as proteins that are
differentially expressed in pancreatic cancer tissues. The use ofthese combined platforms may have
important implications for the understanding of pancreatic cancer biology, although further
investigation is required to evaluate the diagnostic potential ofthese markers.
er Letter

November, 2012

Julio Celis, Editor-in-Chief

Molecular Oncology

Please, find enclosed a manuscript by Jaime Espinoza and colleagues entitled

"Identification of novel human pancreatic canccr biomarkcrs using low abundancc
transcriptomc analyses" to evaluate its publication in your prestigious journal.

It is widely kno\vn that the prognosis of patients with advanced pan creatic cancer is
very poor and no efficacious treatment has yet been established. We believe, as others, that
studies on the lo\v abundance transcriptome are of paramou11t importance to clarify the
intimate mecha11isms of tumor progression and identify novel genes that can serve as
biomarkers and/or targets.

With this in mind we applied a combination of subtractive hybridization followed

by microarrays 011 samples obtained from patients with pancreatic cancer. The RNA
obtained from the malignant and paired adjacent non-malignant tissue was subtracted with
a common reference RNA and further hybridized with microarrays spanning most of the
genome. We perforrned exhaustive controls to assured that the subtractive step indeed
worked as expected.

By using this combined platform we identified:

a) Differe11tially expressed genes that have been validated by qRT-PCR

b) Novel biomarkers that have been validated by tissue microarrays 011 a new
cohort of samples

This two steps platform combines an initial procedure that eliminated most of the
highly expressed genes mainly associated with extracellular matrix, which are the commo11
genes found associated with cancer when direct microarrays hybridization is perforn1ed.
We believe that the present approach that can be afforded by a11y molecular biology
laboratory in the world could be very useful in the identification of novel genes with
mportant roles in cancer as other diseases as well.

All the authors declare no financia! co11flict of interest that might be construed to
influence the rcsults or interpretation of the present rnanuscript. In addition, there are no
restrictions to the availability of any materials, data, or infonnation related to the

~~
manuscript.

~ Manuel iidekel
Universidad de La Frontera

-..,..-,.....,._...,--- ----
hlights (for review)

Highlights

We studied the low abundance transcriptome of human pancreatic cancer

samples.

Novel markers that might help in tumor diagnosis were identified.

PLEKHMI and WNT9A are differentially expressed in pancreatic cancer at

the transcription and protein level.
'Manuscript
:lick here to view linked References

1 Identification of novel human pancreatic cancer biomarkers usmg low-

2 abundance transcriptome analyses

3 Jaime A. Espinoza 1, Carolina Bizama1, Felipe Benavente 1, Guillermo Mazzolini2 , Elmer

4 A. Fernndez3, Edgardo Salvatierra4, Ana Gutirrez-Moraga5, Antonio Ferrndez-
5 Izquierdo6 , Osvaldo Podhajcer \ Ivn Roa7 , Manuel Gidekel 8

6 1 Applied Cell and Molecular Biology PhD Program, La Frontera University, Temuco
7 4811230, Chile

8 2 Gene Therapy Laboratory, School of Medicine, Austral University, Pilar-Buenos

9 Aires B1664INZ, Argentina

10 3 School of Engineering, Biosciences Data Mining Group, Catholic University of

11 Crdoba, Crdoba X5016DHK, Argentina

12 4 Laboratory of Molecular and Cellular Therapy, Fundacin Instituto Leloir, Buenos

13 Aires C1405BWE, Argentina

14 5 Laboratory of Applied Molecular Biology, Faculty of Agriculture and Forestry, La

15 Frontera University, Temuco 4811230, Chile

16 6 Department of Pathology, Clinical Hospital, University of Valencia, Valencia 46007,

17 Spain

18 7 Pathology Service, Clnica Alemana de Santiago, Faculty of Medicine, Universidad

19 del Desarrollo, Santiago 7650568, Chile

20 8 Vicerrectora de Investigacin y Postgrado. La Frontera University, Temuco 4811230,

21 Chile

22

23

24

25 Correspondence to: Manuel Gidekel, Av. Alvaro Casanova 4090, Pealoln, Santiago,
26 7941068. Phone: +56-999970216; E-mail: mgidekel@gmail.com

27

1
 28 Abbreviations:

29 CK 19, Cytokeratin 19;

30 GAPDH, glyceraldehyde-3-phosphate dehydrogenase;

31 GO, Gene ontology;

32 lliQ, Immunohistochemistry;

33 MMP7, Matrix metalloproteinase 7;

34 PLEKHM1, pleckstrin homology domain containing, family M (with RUN domain)

35 member 1;

36 PC, Pancreatic cancer;

37 SSH, Suppression subtractive hybridisation;

38 TMA, Tissue microarray;

39 qRT-PCR, quantitative reverse transcription polymerase chain reaction.

40 WNT9A, wingless-type MMTV integration site family, member 9A.

41

42

43

44

45

46

47

48

49

50

2
51 Abstract

52 Pancreatic cancer is a deadly disease with no effective treatment for patients

53 with advanced-stage disease. Thus, analyses of the low-abundance transcriptome of
54 cancer cells are important to identi:f)r mechanisms underlying tumour progression,
55 especially for advanced pancreatic cancer. Using suppression subtractive hybridisation
56 followed by transcriptome analysis of human samples obtained from pancreatic cancer
57 tissues and paired, adjacent non-cancerous tissues, we identified novel cancer
58 biomarkers, such as WNT9A and PLEKHMl, that were not detectable by direct
59 transcriptomic analyses. Then, by performing tissue microarrays, WNT9A and
60 PLEKHMl were confirmed as proteins that are differentially expressed in pancreatic
61 cancer tissues. The use of these combined platforms may have important implications
62 for the understanding of pancreatic cancer biology, although further investigation is
63 required to evaluate the diagnostic potential of these markers.

64

65

66

67

68

69

70

71

72

73

74

75

76

3
 77 Keywords: Pancreatic cancer, microarray, suppression subtractive hybridisation, low-
78 abundance transcriptome, PLEKHMI, WNT9A.

79

80

81

82

83

84

85

86

87

88

89

90

91

92

93

94

95

96

97

98

99

4
 100 l. Introduction

101 Pancreatic cancer (PC) is a devastating disease with an overall 5-year survival
102 rate of less than 5% (Hidalgo, 201 0). The factors responsible for this extremely low
103 overall survival rate include the lack of early diagnostic tests and the limited efficacy of
104 therapies for patients with advanced-stage disease (Vincent et al., 2011 ). Recent
105 evidence indicates that PC grows very slowly, which provides a potential window for
106 early diagnosis and curative therapy (Yachida et al., 201 0). Unfortunately, PC is
107 extremely difficult to detect in its early stages.

108 Gene expression profiling by DNA microarray technology has been used for the
109 molecular characterisation of cancers, including PC, to better understand cancer biology
110 and aid in the development of new diagnostic and therapeutic targets (Badea et al.,
111 2008; Cmogorac-Jurcevic et al., 2002; Iacobuzio-Donahue et al., 2003b; Iacobuzio-
112 Donahue et al., 2002a; Iacobuzio-Donahue et al., 2002b ). However, a frequent
113 limitation of these expression profiles is the transcriptomic predominance of the
114 desmoplastic reaction, a common aspect ofthese types oftumours (Neesse et al., 2010).
115 This strong desmoplastic signature may affect the identification of markers specific for
116 PC.

117 Suppression subtractive hybridisation (SSH) is a PCR-based technique that

118 permits cDNA normalisation and subtraction in a single procedure (Diatchenko et al.,
119 1996), allowing for the enrichment of specific transcripts present in biological samples
120 such as normal and tumoural tissues. Combining SSH with oligonucleotide microarray
121 increases the efficiency of the characterisation of low-abundance transcripts that are
122 expressed specifically in target samples. This technique has been successfully used for
123 the analysis ofthe low-expression transcriptomes ofhepatocellular (Liu et al., 2008; Liu
124 et al., 2007; Pan et al., 2006), breast, nasopharyngeal (Liu et al., 2008), lung and renal
125 cell carcinoma (Amatschek et al., 2004).

126 In the present study, we applied SSH-microarray (indirect strategy) technology

127 to the transcriptomic study of PC to identify low-abundance transcripts. The indirect
128 strategy enriched distinct ontologies and pathways than those identified by conventional
129 microarray (direct strategy) and highlighted the presence of genes related to the Wnt
130 signalling pathway. Furthermore, for two genes identified using the indirect strategy,

S
131 WNT9A and PLEKHMl, we used tissue microarray to confirm that the differential
132 expression was reflected at the protein level.

133

6
 134

135 2. Materials and Methods

136

137 2.1. Clinical specimens and tissue microarrays (TMAs)

138 Six fresh frozen PC samples and non-neoplastic matched tissues were obtained from
139 the National Tumour Bank of Chile. Approval from the Ethics Committee Bank was
140 obtained before the samples were analysed. Each patient signed the informed consent
141 form, and an anonymization algorithm was applied for deceased patients. In all cases,
142 the tissues were collected from patients who did not receive any adjuvant therapy prior
143 to surgery. The collected tissues were preserved in RNALater (Ambion Inc, Austin TX,
144 USA) at -80 oc until the transcriptomic analysis was performed. Commercially
145 available pancreatic adenocarcinoma TMA (A307; AccuMax Array), obtained from ISU
146 ABXIS (Seoul, South Korea), contained 30 PC cases with matched non-neoplastic
147 tissues. Each tumoural tissue was spotted in duplicate, while each non-neoplastic tissue
148 was spotted in a single core. Additional formalin-fixed paraffin-embedded tissue
149 sections of pancreatic cancer tissues were obtained from tumor bank of University
150 Hospital ofValencia, Spain. Pantomic MN0661 multi-normal human TMA containing
151 33 normal tissues spotted by duplicate was kindly donated by the Departament of
152 Proteomics in Cancer (Danish Cancer Society Research Center, Copenhagen,
153 Denmark).

154

155 2.2. Suppressive subtractive hybridisation (SSH) and microarray

156 procedures

157 Total RNA was extracted from PC tissues using Trizol reagent (Invitrogen Corp.,
158 Carlsbad, CA, USA) and purified using RNeasy mini kit columns (Qiagen, Hilden,
159 Germany) according to the manufacturer' s instructions. Human Universal Reference
160 RNA and Human Pancreas Total RNA were purchased from Clontech (Palo Alto, CA,
161 USA). The integrity of the RNA was assessed by denaturing agar and ultraviolet
162 spectrophotometry. Total RNA from PC and non-neoplastic tissues was used as the
163 tester, and commercial Human Pancreas Total RNA served as the driver. First strand
164 cDNA was synthesised from 1 Jlg of total RNA using a Super SMART PCR cDNA

7
165 Synthesis kit (Clontech, Palo Alto, CA, USA) and SuperScript III Reverse Transcriptase
166 (Invitrogen, Carlsbad, CA, USA) according to the supplier's protocol. SSH was
167 performed using the Clontech PCR-Select cDNA Subtraction kit (Clontech, Palo Alto,
168 CA, USA). SSH was performed according to the manufacturer' s instructions except for
169 the use of a modified nested PCR Primer IR 5 '-
170 CTAATACGACTCACTATAGGGCTCGAGCGGCC-3' in the secondary PCR, which
171 included a T7 promoter site to carry out in vitro transcription of the subtractive
172 amplicon. After the secondary PCR, the subtractive cDNA was purified using an
173 E.Z.N.A Cycle Pure kit (Omega Bio-Tek, Norcross, GA, USA). Subtraction was
174 confirmed by measuring the GAPDH transcript by qPCR and was considered successful
175 if the subtracted samples amplified more than five cycles later than the non-subtracted
176 samples.

177 For in vitro transcription, 300 ng ofthe purified subtractive cDNA was used as the
178 template. The aRNA was synthesised and labelled with aminoallyl-UTP and AlexaFluor
179 647 (Invitrogen, Carlsbad, CA, USA) using the SuperScript Indirect RNA
180 Amplification System (Invitrogen, Carlsbad, CA, USA). The aRNA for the direct
181 strategy was amplified from 1 .tg of total RNA and labelled using the same system
182 described above. Labelled aRNA from the direct and the SSH-strategy were employed
183 for hybridisation on 48.5K Exonic Evidence-Based Oligonucleotide (HEEBO) arrays
184 purchased from Microarray Inc. (Nashville, TN, USA). Prior to hybridisation, slides
185 were pre-blocked with 5X SSC, 0.1% BSA and 0.1% SDS. The fluorescent-labelled
186 probe was mixed with IX hybridisation solution (SX SSC, 50% formamide, 0.1% SDS,
187 and 0.01% salmon sperm DNA) and heated at 95 oc for 2 min. The samples were
188 hybridised on microarray slides for 16 hours at 42 oc and then scanned using a
189 ScanArray Gx (Perkin Elmer, Waltham, MA, USA).

190

191 2.3. Data analysis and gene set enrichment

192 The microarray signal intensity was evaluated using SpotReader software (Niles
193 Scientific, Portola Valley, CA, USA). The raw data were deposited in the Gene
194 Expression Omnibus (GEO, http://vvww.ncbi.nlm.nih.gov/projects/geo/) under the
195 accession number GSE39751. The normalisation was performed in an R statistical
196 environment using the Limma package (http://w\vw.r-proyect.org). The raw data from

8
 197 the individual arrays were processed using standard and normexp background correction
198 (Ritchie et al., 2007) and printtiploess normalisation (Smyth and Speed, 2003 ). The
199 global scale normalisation function using the median absolute deviation was used for
200 normalisation between arrays (Yang et al., 2002). Heatmaps were constructed using
201 MeV software (Saeed et al., 2006). The gene ontology (GO) analysis was performed
202 using DAVID Bioinformatics Resources 6.7 (http://david.abcc.ncifcrf.gov/) (Huang da
203 et al., 2009), and a pathway analysis was performed with the KEGG database
204 (http://WW\v.genome.jplkegg/) (Kanehisa et al., 2012).

205 2.4. Quantitative reverse-transcription PCR (qRT-PCR)

206 To confirm the data obtained using the direct and indirect strategies, we chose ten
207 genes from each strategy to analyse with qRT-PCR for the same six-pair samples used
208 in the microarray experiments. Por the direct strategy, BHLHE40, CALU, COL4A1,
209 CTSK, PN1, IGPBP5, PMEPA1, SBN02, SPARC and TOP2A were analysed. Por the
210 indirect strategy, CD55, DPYSL4, KNG1, LAMA3, MMP7, OASL, PLEKHM1,
211 STATl, SYNE2 and SYT12 were analysed. A list ofprimer sequences can be found in
212 Supplementary table Sl. QARS and TBP were used as interna! controls for
213 normalisation using GeNorm software (Vandesompele et al., 2002) (data not shown).
214 Por cDNA synthesis, 1 flg of RNA was reverse-transcribed using the AffinityScript
215 qRT-PCR cDNA Synthesis kit (Stratagene, USA). Brilliant II SYBR Green qRT-PCR
216 Master Mix (Stratagene, USA) was used according to the manufacturer's instructions.
217 Reactions were quantified with a real-time thermocycle Mx3000p (Stratagene, USA).
218 Relative quantification was performed using MxPRO software (Stratagene, La Jolla,
219 CA, USA). The statistical significance of the difference between the two groups was
220 determined by one-tailed paired Student's t-tests using GraphPad Prism version 5.0 for
221 windows (GraphPad Software Inc., San Diego, USA); p values < 0.05 were considered
222 statistically significant.

223 2.5. Immunohistochemistry (IHQ) and immunofluorescence staining and

224 analysis

225 Rabbit polyclonal antibodies against PLEKHM1 (HPA021558; dilution 1:75)

226 and WNT9A (HPA011223; dilution 1:25) were purchased from Atlas Antibodies AB
227 (Stockholm, Sweden). The MMP7 antibody (clone 111433; dilution 1:500) was
228 purchased from R&D Systems (Minneapolis, MN, USA), and the CK19 antibody

9
229 (mouse mono-clona!; dilution 1: 1000) was purchased from Labvision-Thermo Scientific
230 (Kalamazoo, MI, USA). The tissue microarray slides were baked at 70 oc for 60 min,
231 deparaffmised, blocked with 3% H2 0 2 in 99% ethanol and rehydrated through graded
232 alcohol rinses. Heat-induced antigen retrieval was performed by immersing the TMA
233 slides in Tris/EDTA (pH 9.0) buffer (10 mM Tris, 1 mM EDTA) and then microwaving
234 in a 750 W microwave oven for 10 min. Nonspecific staining was blocked by
235 incubating with 1% foetal bovine serum in TBS for 1O min. The slides were incubated
236 with the primary antibody for 45 min, an anti-rabbit antibody conjugated to a
237 peroxidase complex for 45 min (Envision+ detection kit DAKO, Denmark) and finally
238 with the chromogen, and then the slides were counterstained with hematoxylin. Indirect
239 immunofluorescence analysis was performed as previously described with minor
240 modifications (Moreira et al., 2010). Immune complexes were detected with anti-
241 ideotypic secondary antibodies conjugated to Alexa Fluor 488 (Green, PLEKHM1) and
242 Alexa Fluor 568 (Red, cytokeratin 19) (Molecular Probes, USA).

243 The automated imaging system ACIS III was used for the digitalisation of the
244 TMAs and the quantitative assessment of the IHQ staining. For the TMA analysis, a
245 staining score was generated for each core based on the staining intensity and the areas
246 with positive immunostaining, as described elsewhere (Gromov et al., 2010). The
247 staining scores were compared using a two-tailed Student's t test (p < 0.05 was
248 considered statistically significant). An average of two tumour cores from each patient
249 was compared with the respective non-neoplastic tissues. The statistical analysis of the
250 data was GraphPad Prism 5 software (GraphPad Software, Inc, San Diego, CA, USA).

251

252

253

254

255

256

257

10
258 3. Results
259

260 3.1. Validation of the indirect strategy

261 To identify genes differentially expressed in PC tissues, we performed a gene

262 expression study using a conventional microarray approach for gene expression analysis
263 (direct strategy) and a modified approach coupling suppression subtractive
264 hybridisation with microarray (indirect strategy). Total RNA extracted from six PC
265 tissues with their corresponding matched non-neoplastic tissues was used as the tester
266 for subtractions, and human normal pancreas RNA was used as the driver. fu parallel,
267 the same 12 tissues were analysed using the direct strategy to compare data obtained
268 from both strategies (Figure 1). The subtraction efficiency was confirmed using qPCR
269 prior to hybridisation on microarray slides. The GAPDH transcript was measured in
270 subtracted and non-subtracted samples, and the subtraction was considered efficient if
271 there was an amplification delay of greater than five cycles for the subtracted sample
272 compared to the non-subtracted sample (Supplementary figure S 1).

273 To confmn the subtraction efficiency of the indirect strategy, we analysed the
27 4 relative expression of 100 housekeeping genes related to ribosome structure,
275 mitochondria, carbohydrate and nucleotide metabolism, and other biological processes.
276 Then, we compared both the direct and indirect strategies. A reduction of relative
277 expression >50% was observed for a mean of 37 genes in all samples (Supplementary
278 table S2). The following genes showed reduced expression in >80% of the samples:
279 RPSll, ZFP36Ll, FAU, COX4Il, TKT, RPL19, LDHA9, TUB6A, RPL29, RPL13A
280 and NACA.

281

282 3.2. Differential gene expression of direct and indirect strategies

283 For both the direct and indirect strategies, a statistical analysis was performed
284 according to the comparison between PC and non-neoplastic tissues. For the direct
285 strategy, 736 sequences were identified with a p value < 0.01 and fold changes >0.4 and
286 <-0.4 (505 up-regulated and 231 down-regulated). For the indirect strategy, 616
287 sequences were identified with a p value < 0.05 and fold changes >0.35 and <-0.35 (312
288 up-regulated and 304 down-regulated) (Figure 2A and Supplementary table S3). The p

11
 289 values and fold change thresholds were selected to achieve a level of differentially
290 expressed genes that allowed for a proper ontology analysis (Fresno et al., 20I2). For
291 both strategies, the differentially expressed genes enabled discrimination between PC
292 and non-neoplastic samples with an overlap of 35 genes (Figure 2B). Among those
293 genes, CD55, EGFR, F3 STATl and TAOK2 were identified. The up- and down-
294 regulated genes identified by the indirect strategy were tracked in the data matrix of the
295 direct strategy to identifY the levels of change. The mean expression of these genes was
296 approximately a zero-fold change, indicating that the direct strategy was not suitable for
297 measuring fold changes of genes expressed at low levels (data not shown).

298 To confirm the microarray data obtained from the direct and indirect strategies,
299 a qRT-PCR assay was performed to measure the transcription levels of IO up-regulated
300 genes for each strategy. Each measured gene tended to be overexpressed in PC tissue
301 compared with non-neoplastic tissues. This was consistent with the results obtained
302 from the microarray analysis. Eighty percent (8/10) ofthe genes from the direct strategy
303 and 40% (4/I O) of the genes from the indirect strategy were statistically significant and
304 tending to overexpression in tumoural tissues (Figure IC and ID, respectively).

305

306 3.3. Gene ontology

307 To examine whether particular gene ontologies (GO) were enriched with each
308 strategy, indirect and direct gene lists were submitted to the DA VID bioinformatics
309 resource, which employs a Fisher's exact test to assess GO terms over-representation,
310 using a p value cut-off ofp < 0.05.

311 As PC is a highly fibrotic tumour, the presence of stromal components was

312 expected because whole tissue was used as the starting material. The results of the
313 direct strategy were significantly enriched for genes that encode proteins of
314 predominantly extracellular location, as well as genes related to collagen (COLlAI,
315 COL17AI, CTHRCI), the extracellular matrix (VCAN, POSTN, FNI), the
316 endoplasmic reticulum (EDEM3, STIMI, FNDC3B), the basement membrane (NIDI,
317 DAGI) and the Golgi apparatus (RAB7A, RABIO) (Figure 3A). We identified the
318 regulation of cell communication, response to wound healing, cell adhesion and

12
 319 programmed cell death as biological processes enriched by the direct strategy (Figure
320 3B).

321 The indirect strategy dramatically reduced the enrichment of genes that encode
322 extracellular matrix proteins and enabled further enrichment of genes that encode
323 intracellular proteins, although this enrichment was not statistically significant (Figure
324 3A). Interestingly, the indirect strategy enriched genes encoding proteins involved in
325 stem cell differentiation (APC, MSI2, RIFI, ERCC2 and ACE) and the Wnt/~-catenin

326 signalling pathway. Further analysis of the indirect strategy using the KEGG database
327 revealed the following six up-regulated genes involved in the Wnt signalling pathway
328 that were not found with the direct strategy: WNT9A, PPP2RIB, TCF7L2, CCNDl,
329 MMP7 and NFATS.

330 Overall, the indirect strategy reduced the identification of transcripts highly
331 represented in PC transcriptomes and allowed for the enrichment of genes encoding
332 proteins involved in biological processes that were not detected using the direct
333 strategy.

334

335 3.4. Immunohistochemical validation of the expression microarray

336 results

337 To confirm the data obtained by the indirect strategy, an immunohistochemical

338 analysis was performed using PDAC and non-neoplastic tissues sections. Two candidate
339 genes, WNT9A and PLEKHMl, were chosen based on their biological novelty.

340 WNT9A-positive staining was observed in non-neoplastic ducts with a moderate

341 to intense supranuclear granular pattem. Acinar cells and the islets of Langerhans were
342 negative for WNT9A (Figure 4A). A similar pattem of expression was observed in
343 tumoural cells but with greater signa! intensity (Figure 4B and C). WNT9A expression
344 in non-neoplastic pancreas and tissues from primary PC was compared using a tissue
345 microarray (n=28). The TMA analysis established that WNT9A expression was
346 increased significantly in tumour samples compared to non-neoplastic tissues (Figure
347 4D); nearly 50% ofthe tumour samples had above-average WNT9A expression levels.

13
348 PLEKHM1 was not detected in acinar cells, the is1ets of Langerhans or non-
349 neoplastic ducts (Figure 4E). A group of pancreatic tumours showed a diffuse
350 cytoplasmic pattern of staining for PLEKHM1 as well as sorne cell membrane staining
351 (Figure 4F and G). The TMA analysis established that PLEKHM1 expression increased
352 significantly in tumour samples compared to non-neoplastic tissues (n=30) (Figure 4H);
353 above-average expression levels were observed in ~30% of the samples. To confirm
354 that the reactive cells were of epithelial origin, a three-colour indirect
355 immunofluorescence analysis was performed using an anti-CK 19 (keratin 19) antibody
356 as an epithelial marker. PLEKHM1 expression was restricted to CK 19-positive cells in
357 PC tissues (Figure 5A). Interestingly, PLEKHM1 expression was observed in cancer
358 cells that were involved in an apparent invasive process and displayed positive staining
359 for MMP7 (Figure 5B), a matrix metalloproteinase implicated in the initiation and
360 progression of pancreatic cancer (Fukuda et al., 2011). In addition, MMP7 was
361 identified by the indirect strategy as a transcript that was differentially expressed in PC
362 tissues. The IHQ analysis of the human normal TMA revealed that PLEKHM1 was not
363 detected in most normal tissues, including the pancreas, with the exception of the skin,
364 uterus, cervix, thymus, tonsil and prostate (Supplementary figure S2).

365

14
366

367 4. Discussion

368 PC remains a challenging disease with an overall cumulative 5-year survival rate
369 below 1% (Hidalgo, 201 0). One of the characteristics of PC is its early loco-regional
370 dissemination that precludes the application of curative treatments in the majority of
371 patients. Despite important progress in understanding the molecular alterations involved
372 in PC growth, the processes of cancer initiation, progression and metastasis are still not
373 fully understood (Lyratzopoulos et al., 2012). However, it is clear that the progression
374 of PC, from the generation of the initiating mutation to the appearance of the first
375 metastatic clone, takes approximately 15 years, which provides a hypothetical time
376 window for early detection and curative therapy (Yachida et al., 201 0). Therefore, there
377 is an urgent need to identify new potential markers for this disease.

378 Previous studies have examined the native transcriptome of PC tissues to

379 characterise the biological behaviour of this disease and identify new potential
380 molecular markers. A common feature of many of these studies has been the
381 transcriptomic predominance of desmoplastic components such as fibroblasts,
382 pancreatic stellate cells, and other components of the tumour microenvironment,
383 including endothelial and inflammatory cells (Badea et al., 2008; Iacobuzio-Donahue et
384 al., 2003a; Iacobuzio-Donahue et al., 2002a; Iacobuzio-Donahue et al., 2002b).
385 Consistent with this, we found a strong enrichment of genes that encode for
386 extracellular proteins, especially structural proteins of the extracellular matrix. In
387 addition, genes related to biological processes such as the inflammatory response, cell
388 adhesion and programmed cell death were also represented at high levels in our
389 . samples.

390 The indirect strategy was performed for the same samples evaluated by the
391 direct strategy. PC and non-neoplastic tissues were used as testers, and normal pancreas
392 tissue was used as the driver for the subtraction assay. After subtraction and microarray
393 hybridisation, the PC and non-neoplastic tissues were compared to identify
394 differentially expressed transcripts in tumour samples. Significantly, indirect strategy-
395 enriched genes related to biological processes and cellular components were
396 dramatically different from those identified using the direct strategy. In addition, for
397 indirect strategy the amount of tumour microenvironment-related genes showed a

15
 398 decrease, while the intracellular-related genes were increased compared with direct
399 strategy.

400 The Wnt/j3-catenin pathway is an important embryonic signalling pathway

401 required for morphogenesis and organogenesis (Clevers, 2006). However, its aberrant
402 activation is associated with several cancers, including PC (Jones et al., 2008; Lowe et
403 al., 2007; McCleary-Wheeler et al., 2012 ). More recentiy, the Wnt/j3-catenin pathway
404 has been linked to the metastatic process ofPC and is considered a potential therapeutic
405 target (Yu et al., 2012). In our study, severa} up-regulated transcripts in the Wntlj3-
406 catenin signalling pathway were identified by the indirect strategy but not by the direct
407 strategy. Among the up-regulated genes, WNT9A, TCF7L2 and NFATS were
408 identified. Recently, TCF7L2 was found to be up-regulated in PC tissues irrespective of
409 patient outcome (Van den Broeck et al., 2012) and was also reported as one ofthe most
410 frequently mutated genes in colorectal cancers (TCGA-Network, 2012).

411 WNT9A is a member of the Wnt signalling pathway, and it has a role in joint
412 integrity during chondrogenesis (Spater et al., 2006). WNT9A is also required for
413 proper morphogenesis of hepatic architecture during chicken embryogenesis
414 (Matsumoto et al., 2008). In our study, WNT9A was identified by the indirect strategy
415 as an up-regulated transcript in pancreatic cancer and was further validated as a protein
416 over-expressed in PC cells but not in non-tumoural pancreatic cells. The WNT9A gene
417 is commonly mutated in PC (Jones et al., 2008), although the role ofthis gene in PA has
418 not been studied in depth. The WNT9A protein has been reported to be a molecule
419 secreted into the extracellular space from the walls of hepatic sinusoids (Matsumoto et
420 al., 2008). Because many biomarkers used in the clinic are detected in patient fluids,
421 WTN9A may be an interesting candidate marker for further studies. The PLEKHM1
422 gene encodes a non-secretory adaptor protein that negatively regulates endosomal
423 trafficking (Tabata et al., 201 0), and a mutation in this gene causes osteopetrosis, a
424 disease generated by an altered endosomal acidification/maturation process in
425 osteoclasts (Del Fattore et al., 2008). However, there is a lack of information regarding
426 PLEKHM1 and its role in cancer. In our study, the PLEKHM1 protein was absent in the
427 majority of non-neoplastic pancreatic tissues, but positive lesions were found in ~30%

428 of PC samples. In our samples, PLEKHM1 expression was restricted to cykeratin (19
429 positive cells). Interestingly, MMP7, a matrix metalloproteinase intimately involved in
430 the initiation and progression of PC (Crawford et al., 2002; Fukuda et al., 2011 ), was

16
431 also detected in PLEKHMl-positive cells, suggesting a role for this factor in the
432 invasive process (Crawford et al., 2002; Fukuda et al., 2011). Moreover, the plasma
433 level of MMP7 has been reported to serve as a potential diagnostic biomarker when
434 used in combination with CA19-9 or other markers (Kuhlmann et al., 2007). However,
435 further research is needed to evaluate the role of PLEKHMl in PC progression and its
436 diagnostic potential.

437 WNT9A and PLEKMl were expressed differentially at the transcript and protein
438 levels in PC samples compared with matched non-neoplastic tissues. Interestingly, both
439 proteins were expressed at low levels in non-neoplastic tissues, with PLEKHMl
440 expression nearly absent in normal tissues. This is consistent with the fact that the goal
441 of the indirect strategy is to identify not only differentially expressed genes of low
442 abundance but also genes with high tumour-specific expression. Low abundance
443 transcripts are often misrepresented in conventional microarrays due to their low
444 intensities and are often excluded from further analysis (Qin et al., 2006). Coupling
445 microarray technology with subtractive suppressive hybridisation has been successful in
446 identifying low-abundance and tumour-specific transcripts in hepatocellular carcinoma
447 (Liu et al., 2008; Liu et al., 2007; Pan et al., 2006) as well as breast (Barraclough et al.,
448 2010; Liu et al., 2008), nasopharyngeal (Liu et al., 2008; Zhang et al., 2003) and lung
449 cancer (Bangur et al., 2002; Wang et al., 2000). Interestingly, none of these studies
450 included a subsequent analysis of protein expression to ascertain whether the
451 differential expression oftranscripts affects protein levels.

452 This study provides evidence that the low-abundance transcriptome ofPC can be
453 a source of potential tumour markers. To the best of our knowledge, this was the first
454 study to apply suppressive subtractive hybridisation coupled with microarray analysis in
455 PC tissues, and the validation of differentially expressed transcripts at the protein level
456 increased the strength of our work. However, future studies are needed to evaluate the
457 clinical usefulness ofthese markers.

458

459

460

461

17
462 Conflict of interest

463 The authors declare that they have no competing interests.

464

465 Acknowledgements

466 We would like to thank Sofia Svensson, Anni Handesten, Lene Brogaard,
467 Soledad Lantadilla, Tamara Snchez, Gabriela Bascun, Mnica Ramrez and
468 Francisco Gamn for their expert technical assistance. We thank Teresa Cabezn and
469 Jos Moreira for their contribution to the immunohistochemistry procedures, image
470 acquisition and analysis.

471

472 Funding

473 The present study was funded by PIA CTE-06 and Innova 12IDL2-13610. J.A.E
474 acknowledges the CONICYT fellowships N21080240 and N24100124 and the CHILE
4 7S fellowship N7 511 0023.

476

477 Appendix A. Supplementary data

478 Supplementary data related to this article can be found online at

479

480

18
481 References

482 Amatschek, S., Koenig, U., Auer, H., Steinlein, P., Pacher, M., Gruenfelder, A., Dekan, G.,
483 Vogl, S., Kubista, E., Heider, K.H., Stratowa, C., Schreiber, M., Sommergruber, W., 2004.
484 Tissue-wide expression profiling using cDNA subtraction and microarrays to identify tumor-
48S specific genes. Cancer research 64, 844-856.

486
487 Badea, L., Herlea, V., Dima, S.O., Dumitrascu, T., Popescu, 1., 2008. Combined gene
488 expression analysis ofwhole-tissue and microdissected pancreatic ductal adenocarcinoma
489 identifies genes specifically overexpressed in tumor epithelia. Hepatogastroenterology 55, 2016-
490 2027.

491
492 Bangur, C.S., Switzer, A., Fan, L., Marton, M.J., Meyer, M.R., Wang, T., 2002. ldentification
493 of genes over-expressed in small celllung carcinoma using suppression subtractive
494 hybridization and cDNA microarray expression analysis. Oncogene 21, 3814-3825.

49S
496 Barraclough, D.L., Sewart, S., Rudland, P.S., Shoker, B.S., Sibson, D.R., Barraclough, R.,
497 Davies, M.P., 201 O. Microarray analysis of suppression subtracted hybridisation libraries
498 identifies genes associated with breast cancer progression. Cell Oncol32, 87-99.

499
SOO Clevers, H., 2006. Wnt/beta-catenin signaling in development and disease. Cell 127, 469-480.

S01
S02 Crawford, H. C., Scoggins, C.R., Washington, M.K., Matrisian, L.M., Leach, S.D., 2002. Matrix
S03 metalloproteinase-7 is expressed by pancreatic cancer precursors and regulates acinar-to-ductal
S04 metaplasia in exocrine pancreas. J Clin lnvest 109, 1437-1444.

sos
S06 Cmogorac-Jurcevic, T., Efthimiou, E., Nielsen, T., Loader, J., Terris, B., Stamp, G., Baron, A.,
S07 Scarpa, A., Lemoine, N.R., 2002. Expression profiling ofmicrodissected pancreatic
S08 adenocarcinomas. Oncogene 21,4587-4594.

S09
S10 Del Fattore, A., Fomari, R., Van Wesenbeeck, L., de Freitas, F., Timmermans, J.P., Peruzzi, B.,
Sll Cappariello, A., Rucci, N., Spera, G., Helfiich, M.H., Van Hui, W., Migliaccio, S., Teti, A.,
S12 2008. A new heterozygous mutation (R714C) ofthe osteopetrosis gene, pleckstrin homolog
S13 domain containing family M (with run domain) member 1 (PLEKHM1), impairs vesicular
S14 acidification and increases TRACP secretion in osteoclasts. Joumal ofbone and mineral
515 research: the officialjoumal ofthe American Society for Bone and Mineral Research 23, 380-
516 391.

517
518 Diatchenko, L., Lau, Y.F., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov,
519 S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D., Siebert, P.D., 1996. Suppression subtractive
520 hybridization: a method for generating differentially regulated or tissue-specific cDNA probes
521 and libraries. Proceedings ofthe National Academy ofSciences ofthe United States of America
522 93, 6025-6030.

523
524 Fresno, C., Llera, A.S., Girotti, M.R., Valacco, M.P., Lopez, J.A., Podhajcer, O.L., Balzarini,
525 M.G., Prada, F., Femandez, E.A., 2012. The multi-reference contrast method: facilitating set
526 enrichment analysis. Comput Biol Med 42, 188-194.

19
527
528 Fukuda, A., Wang, S.C., Morris, J.P.t., Folias, A.E., Liou, A., Kim, G.E., Akira, S., Boucher,
529 K.M., Firpo, M.A., Mulvihill, S.J., Hebrok, M., 2011. Stat3 and MMP7 contribute to pancreatic
530 ductal adenocarcinoma initiation and progression. Cancer Cell19, 441-455.

531
532 Gromov, P., Gromova, I., Friis, E., Timmermans-Wielenga, V., Rank, F., Simon, R., Sauter, G.,
533 Moreira, J.M., 2010. Proteomic profiling ofmammary carcinomas identifies C7orf24, a gamma-
534 glutamyl cyclotransferase, as a potential cancer biomarker. J Proteome Res 9, 3941-3953.

535
536 Hidalgo, M., 2010. Pancreatic cancer. N Engl J Med 362, 1605-1617.

537
538 Huang da, W., Sherman, B. T., Lempicki, R.A., 2009. Systematic and integrative analysis of
539 large gene lists using DA VID bioinformatics resources. Nat Protoc 4, 44-57.

540
541 Iacobuzio-Donahue, C.A., Ashfaq, R., Maitra, A., Adsay, N.V., Shen-Ong, G.L., Berg, K.,
542 Hollingsworth, M.A., Cameron, J.L., Yeo, C.J., Kem, S.E., Goggins, M., Hruban, R.H., 2003a.
543 Highly expressed genes in pancreatic ductal adenocarcinomas: a comprehensive
544 characterization and comparison ofthe transcription profiles obtained from three major
545 technologies. Cancer Res 63, 8614-8622.

546
547 Iacobuzio-Donahue, C.A., Maitra, A., Olsen, M., Lowe, A.W., van Heek, N.T., Rosty, C.,
548 Walter, K., Sato, N., Parker, A., Ashfaq, R., Jaffee, E., Ryu, B., Jones, J., Eshleman, J.R., Yeo,
549 C.J., Cameron, J.L., Kem, S.E., Hruban, R.H., Brown, P.O., Goggins, M., 2003b. Exploration of
550 global gene expression pattems in pancreatic adenocarcinoma using cDNA microarrays. Am J
551 Pathol162, 1151-1162.

552
553 Iacobuzio-Donahue, C.A., Maitra, A., Shen-Ong, G.L., van Heek, T., Ashfaq, R., Meyer, R.,
554 Walter, K., Berg, K., Hollingsworth, M.A., Cameron, J.L., Yeo, C.J., Kem, S.E., Goggins, M.,
555 Hruban, R.H., 2002a. Discovery of novel tumor markers of pancreatic cancer using global gene
556 expression technology. Am J Pathol160, 1239-1249.

557
558 Iacobuzio-Donahue, C.A., Ryu, B., Hruban, R.H., Kem, S.E., 2002b. Exploring the host
559 desmoplastic response to pancreatic carcinoma: gene expression of stromal and neoplastic cells
560 at the site ofprimary invasion. Am J Pathol160, 91-99.

561
562 Jones, S., Zhang, X., Parsons, D.W., Lin, J.C., Leary, R.J., Angenendt, P., Mankoo, P., Carter,
563 H., Kamiyama, H., Jimeno, A., Hong, S.M., Fu, B., Lin, M. T., Calhoun, E.S., Kamiyama, M.,
564 Walter, K., Nikolskaya, T., Nikolsky, Y., Hartigan, J., Smith, D.R., Hidalgo, M., Leach, S.D.,
565 Klein, A.P., Jaffee, E.M., Goggins, M., Maitra, A., Iacobuzio-Donahue, C., Eshleman, J.R.,
566 Kem, S.E., Hruban, R.H., Karchin, R., Papadopoulos, N., Parmigiani, G., Vogelstein, B.,
567 Velculescu, V.E., Kinzler, K.W., 2008. Core signaling pathways in human pancreatic cancers
568 revealed by global genomic analyses. Science 321, 1801-1806.

569
570 Kanehisa, M., Goto, S., Sato, Y., Furumichi, M., Tanabe, M., 2012. KEGG for integration and
571 interpretation oflarge-scale molecular data sets. Nucleic acids research 40, Dl09-114.

572

20
 573 Kuhlmann, K.F., van Till, J.W., Boermeester, M.A., de Reuver, P.R., Tzvetanova, I.D.,
574 Offerhaus, G.J., Ten Kate, F.J., Busch, O.R., van Gulik, T.M., Gouma, D.J., Crawford, H.C.,
575 2007. Evaluation ofmatrix metalloproteinase 7 in plasma and pancreatic juice as a biomarker
576 for pancreatic cancer. Cancer Epidemiol Biomarkers Prev 16, 886-891.

577
578 Liu, B.H., Goh, C.H., Ooi, L.L., Hui, K.M., 2008. Identification ofunique and common low
579 abundance tumour-specific transcripts by suppression subtractive hybridization and
580 oligonucleotide probe array analysis. Oncogene 27, 4128-4136.

581
582 Liu, Y., Zhu, X., Zhu, J., Liao, S., Tang, Q., Liu, K., Guan, X., Zhang, J., Feng, Z., 2007.
583 ldentification of differential expression of genes in hepatocellular carcinoma by suppression
584 subtractive hybridization combined cDNA microarray. Oncol Rep 18, 943-951.

585
586 Lowe, A. W., Olsen, M., Hao, Y., Lee, S.P., Taek Lee, K., Chen, X., van de Rijn, M., Brown,
587 P.O., 2007. Gene expression pattems in pancreatic tumors, cells and tissues. PLoS ONE 2,
588 e323.

589
590 Lyratzopoulos, G., Neal, R.D., Barbiere, J.M., Rubin, G.P., Abel, G.A., 2012. Variation in
591 number of general practitioner consultations before hospital referral for cancer: fmdings from
592 the 2010 National Cancer Patient Experience Survey in England. Lancet Oncoll3, 353-365.

593
594 Matsumoto, K., Miki, R., Nakayama, M., Tatsumi, N., Yokouchi, Y., 2008. Wnt9a secreted
595 from the walls ofhepatic sinusoids is essential for morphogenesis, proliferation, and glycogen
596 accumulation of chick hepatic epithelium. Dev Biol319, 234-247.

597
598 McCleary-Wheeler, A.L., McWilliams, R., Femandez-Zapico, M.E., 2012. Aberrant signaling
599 pathways in pancreatic cancer: a two compartment view. Mol Carcinog 51, 25-39.

600
601 Moreira, J.M., Cabezon, T., Gromova, 1., Gromov, P., Timmermans-Wielenga, V., Machado, 1.,
602 Llombart-Bosch, A., Kroman, N., Rank, F., Celis, J.E., 2010. Tissue proteomics ofthe human
603 mammary gland: towards an abridged definition ofthe molecular phenotypes underlying
604 epithelial normalcy. Mol Oncol4, 539-561.

605
606 Neesse, A., Michl, P., Frese, K.K., Feig, C., Cook, N., Jacobetz, M.A., Lolkema, M.P.,
607 Buchholz, M., Olive, K.P., Gress, T.M., Tuveson, D.A., 2010. Stromal biology and therapy in
608 pancreatic cancer. Gut.

609
610 Pan, Y.S., Lee, Y.S., Lee, Y.L., Lee, W.C., Hsieh, S. Y., 2006. Differentially profiling the low-
611 expression transcriptomes ofhuman hepatoma using a novel SSH/microarray approach. BMC
612 Genomics 7, 131.

613
614 Qin, L.X., Beyer, R.P., Hudson, F.N., Linford, N .J., Morris, D.E., Kerr, K.F., 2006. Evaluation
615 ofmethods for oligonucleotide array data via quantitative real-time PCR. BMC Bioinformatics
616 7, 23.

617

21
618 Ritchie, M.E., Silver, J., Oshlack, A., Holmes, M., Diyagama, D., Holloway, A., Smyth, G.K.,
619 2007. A comparison ofbackground correction methods for two-colour microarrays.
620 Bioinformatics 23, 2700-2707.

621
622 Saeed, A.I., Bhagabati, N.K., Braisted, J.C., Liang, W., Sharov, V., Howe, E.A., Li, J.,
623 Thiagarajan, M., White, J.A., Quackenbush, J., 2006. TM4 microarray software suite. Methods
624 in enzymology 411, 134-193.

625
626 Smyth, G.K., Speed, T., 2003. Normalization of cDNA microarray data. Methods 31, 265-273.

627
628 Spater, D., Hill, T.P., O'Sullivan R, J., Gruber, M., Conner, D.A., Hartmann, C., 2006. Wnt9a
629 signaling is required for joint integrity and regulation oflhh during chondrogenesis.
630 Development 133, 3039-3049.

631
632 Tabata, K., Matsunaga, K., Sakane, A., Sasaki, T., Noda, T., Yoshirnori, T., 2010. Rubicon and
633 PLEKHM1 negatively regulate the endocytic/autophagic pathway via a novel Rab7-binding
634 domain. Molecular biology of the cell21, 4162-4172.

635
636 TCGA-Network, 2012. Comprehensive molecular characterization ofhuman colon and rectal
637 cancer. Nature 487, 330-337.

638
639 Van den Broeck, A., Vankelecom, H., Van Eijsden, R., Govaere, 0., Topal, B., 2012. Molecular
640 markers associated with outcome and metastasis in human pancreatic cancer. Journal of
641 experimental & clinical cancer research : CR 31, 68.

642
643 Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman,
644 F., 2002. Accurate normalization ofreal-tirne quantitative RT-PCR data by geometric averaging
645 ofmultiple interna] control genes. Genome Biol3, RESEARCH0034.

646
647 Vincent, A., Herman, J., Schulick, R., Hruban, R.H., Goggins, M., 2011. Pancreatic cancer.
648 Lancet 378, 607-620.

649
650 Wang, T., Hopkins, D., Schmidt, C., Silva, S., Houghton, R., Takita, H., Repasky, E., Reed,
651 S.G., 2000. Identification of genes differentially over-expressed in lung squamous cell
652 carcinoma using combination of cDNA subtraction and microarray analysis. Oncogene 19,
653 1519-1528.

654
655 Yachida, S., Jones, S., Bozic, 1., Anta], T., Leary, R., Fu, B., Kamiyama, M., Hruban, R.H.,
656 Eshleman, J.R., Nowak, M.A., Velculescu, V.E., Kinzler, K.W., Vogelstein, B., Iacobuzio-
657 Donahue, C.A., 2010. Distant metastasis occurs late during the genetic evolution ofpancreatic
658 cancer. Nature467, 1114-1117.

659
660 Yang, Y.H., Dudoit, S., Luu, P., Lin, D.M., Peng, V., Ngai, J., Speed, T.P., 2002. Normalization
661 for cDNAmicroarray data: a robust composite method addressing single and multiple slide
662 systematic variation. Nucleic Acids Res 30, el5.

22
 663
664 Yu, M., Ting, D. T., Stott, S.L., Wittner, B.S., Ozsolak, F., Paul, S., Ciciliano, J.C., Smas, M.E.,
665 Winokur, D., Gilman, A.J., Ulman, M.J., Xega, K., Contino, G., Alagesan, B., Brannigan, B.W.,
666 Milos, P.M., Ryan, D.P., Sequist, L.V., Bardeesy, N., Ramaswamy, S., Toner, M., Maheswaran,
667 S., Haber, D.A., 2012. RNA sequencing ofpancreatic circulating tumour cells implicates WNT
668 signalling in metastasis. Nature.

669
670 Zhang, B., Nie, X., Xiao, B., Xiang, J., Shen, S., Gong, J., Zhou, M., Zhu, S., Zhou, J., Qian, J.,
671 Lu, H., He, X., Li, X., Hu, G., Li, G., 2003. Identification oftissue-specific genes in
672 nasopharyngeal epithelial tissue and differentially expressed genes in nasopharyngeal carcinoma
673 by suppression subtractive hybridization and cDNA microarray. Genes Chromosomes Cancer
674 38, 80-90.

675

676

677

678

679

680

681

682

683

684

685

686

687

688

689

690

691

692

23
693 Figure l. Experimental procedures. Total RNA extracted from pancreatic
694 adenocarcinoma tissues and their matched non-neoplastic samples were processed in
695 parallel for the direct and indirect strategies. The direct strategy included cDNA
696 synthesis, aRNA amplification and microarray hybridisation to measure the native
697 transcriptome of the whole mass tumour. The indirect strategy included a PCR-based
698 suppressive subtractive hybridisation prior to aRNA amplification and microarray
699 hybridisation to identify highly tumour-specific differentially expressed genes of low
700 abundance. The data were obtained separately for each strategy and analysed to identify
701 differentially expressed genes in adenocarcinoma and non-neoplastic tissues.
702 Subsequent validation using tissue microarray was performed for candidate genes
703 identified using the indirect strategy. PDAC=pancreatic ductal adenocarcinoma.

704

705

706

707

708

709

710

711

712

713

714

715

716

717

24
 718 Figure 2. Direct and indirect strategies identify differentially expressed genes with
719 minimal overlap.

720 A) Differentially expressed genes from both strategies discriminate between PC and
721 non-neoplastic tissues. Red represents up-regulation, and green represent down-
722 regulation. PDAC= pancreatic adenocarcinoma. B) Only 35 genes overlapped between
723 strategies. C) qRT-PCR validation ofup-regulated genes from both strategies measured
724 in the same 12 samples processed by microarray. Log2-fold changes were obtained as
725 the ratio in PC/non-neoplastic tissue. The red colour represents up-regulation in PC
726 samples. *=p value < 0.05 for qRT-PCR assay.

727

728

729

730

731

732

733

734

735

736

737

738

739

740

741

742

25
743 Figure 3. Comparison of gene ontology enrichment between strategies.

744 A) Cellular components. B) Biological processes. Differentially expressed genes were

745 analysed using the DAVID database. Significantly enriched GO terms for each strategy
746 are represented in a histogramas the -log 10 ofp values. Representative GO terms with p
747 values < 0.05 are shown. The stippled line indicates the significance threshold.

748

749

750

751

752

753

754

755

756

757

758

759

760

761

762

763

764

765

26
 766 Figure 4. Immunohistochemistry analysis of WNT9A and PLEKHMl expression
767 in PC samples.

768 A) WNT9A positive staining in ductal cells of non-neoplastic pancreas, showing a

769 supranuclear granular pattem. Islets of Langerhans and acinar cells were negative (red
770 arrow). B-C) Tumoural cells showed stronger WNT9A immunoreactivity than non-
771 neoplastic pancreatic cells (red arrows) Scale bars, 50 Jlm. D) Tissue microarray
772 analysis revealed significantly higher intensity scores for WNT9A expression in
773 adenocarcinoma tissues compared with non-neoplastic pancreatic tissue (Student's two-
774 tailed paired t test). The mean intensity scores for each group are indicated by stippled
775 lines. E) PLEKHMl expression was negative in ductal cells, the islets of Langerhans
776 and acinar cells. F-G) Tumoural cells showed stronger PLEKHMl immunoreactivity
777 than non-neoplastic pancreatic cells (red arrows). Scale bars, 50 Jlm. H) Tissue
778 microarray analysis revealed significantly higher intensity scores for PLEKHMl
779 expression in adenocarcinoma tissues compared with non-neoplastic pancreas (student's
780 two-tailed paired t test). The mean intensity scores for each group are indicated by the
781 stippled Iines.

782

783

784

785

786

787

788

789

790

791

792

27
793 Figure 5. PLEKHMl positive expression in tumoural epithelial cells.

794 A) Indirect three-color immunofluorescence analysis of PC tissues revealed that only

795 CK19 positive cells (AlexaFluor 568; red) were positive for PLEKHMI expression
796 (AlexaFluor 488, green); cells were counterstained with the nuclear stain DAPI (blue).
797 Scale bars, 25 )liD. B) Tumoural cells in an apparent invasive process were positive for
798 PLEKHMI and MMP7 (red arrows). Scale bars, 50 )liD.

799

800

801

802

803

804

805

806

807

808

28
1re 1
k here to download high resolution image

Six PDAC tissues with corresponding

non-neoplastic adjacent tissues
1
RNA extraction and
integrity analysis

Direct strategy lndirect strategy

SMART cONA synthesis

Long distance PCR
RSAI digestion

1
TESTER DRIVER
PDAC Normal
Non-neoplastic pancreas
- Adaptar ~ 1
ligation ......,_........._ ....

Subtractive hybridizations
Primary and secondary PCR
Subtraction efficiency
\.

r
In vitro transcription
- Microarray hybridization
Fluorescence extraction
l
r Differential expression between '
PDAC and non-neoplastic tissues
qRT-PCR validation
Gene ontology analysis
Tissue microarray confirmation for
indirect strategy
~ ~
 2
aere to download high resolution image

A
Direct strategy lndirect strategy

e D

FN1
IGFBPS
*
BHLHE40
*
TOP2A
*
SPARC
COL4A1
*
CALU
SBN02
CTSK
PMEPA1

Log2 fold dlange o 1 2

Log2 fold changa
Jre 3
k here to download high resolution image

A CeUular component
-lndirect
Cell pro~ctloo - - - - c:::J Direct
Synapse
Plasma membmne part
Ce1! junotion
Adnerens junctlon
NuClear chromosome
CoUagen
Endoplasmic reticulum
AC1m cy1oske!etoo .r-~
Golg1 apparatus.t==!:::
Basement membrane +==P
Cytoplasmic vesic!e..l::::!=::
Extracelluiar ma1rlx ..t:=!t=====~
Protemaceous extrace!lular ma1rx ,.t::=!~======:J
Exttacellular region
lntracel!.uJar
o 1 2 3 4 s 6 1 a 9
-log10 P value

B Biological process

. -lndirect
Organ morphogenes1s t-. c::JDirect
---, 1
Rcspooso lo calcium 10n
t
Stem cell differenhallon
l
\lnt receptor SJgnahng pathway through t:>eta-c.atenn
lnlracellu!ar signa!ing c.asc.ade
.
!
Gly'CO>ro!etn metaoohc process

-.
:
Rogulation of cata~c nc~1vty
..
-
lnfl..'lmtn.3tory respMse
j
Regulaban of cell mohon
1
Coflagen metabolic pmcess
~
Rogu!ation of celi m!grli!On
~
Slood circulatK>n ~ .'
-
Programmed ceU death
1
Cel adhes10n
i
Response lo wound.ing 1 1
Edr&ceflu!ar strudUf(l Ofganizat)(m
l
Respoose to stress ,.... .
Regul(tton of cell commnication ~

O 12
. 3 4 S
'
6
-togu1 P value
 4
1ere to download high resolution image

Non-neoplastlc Adenocarclnoma

A
_ . .,. .
B e .~ . . .,.
~-
~
o 2.0 WNT9A
1-!
',\., .

..
~
f ..
(.' . . "' .
~ .: .1
!o

;u
u
Oooooo
, .
< ~ 1
.. J,'.r ,
... a.,
. 1
00
00
(1)
1-
z
:>
~~~
.. ~'...r;

., .;, .
1

..
.. 1

~1.0
o QQQ---
___
DoooO
oD
00

.. ..
:

,.
(
3: ...\ ', ~
:S o0 o
+ ,y .. 1,. t
.., .
l.' . ''l .1:1

:,. ...., .......

. 00
ji ,~
:0.5
, .
~. ' ..~
~ ....
~

,. ,.'
.,
:.... . . .
- - .... ~ . ....;. ~~ 1

. ..... 0.0
M.0019

e:_. H 2.o PLEKHM1

!
o

.. ;u
u
- co
:er'"" .
..
...
!
S
oo
00
...... S 1O e
lll: !!''
IU :E ---~ge---
.J .1:1
a. ooo
.. .: 0.5
o88~oo
:1- ~ o
" ; n30 P.O.Ol~
.. O.OJ..:.:....;;.;:.-.,-----:....,.;.::.:.::..:....
.. -~ Hon.,..,plutic Ad.nocarclnom.a
5
ere to download high resolution image

B PLEKHM1 MMP7
~- ........
. . ... {.

ns
, ..... ~.
.;# .. r
(

.
.......-==-~""'"
. -~."'
:. ~....~
~

E
o
e:
~
ns
u ..
o /" ~.

e:
,
Cl)
J

...'
e:(
'. ~
~.J.~>
- ., i,
.
. ....
Supplementary data

SUPPLEMENTARY DATA

Supplementary figure Sl. Subtraction efficiency assayed by qPCR. The abundance

of GAPDH transcripts was measured in non-subtracted and subtracted samples. A delay
ofmore than five cycles in the amplification ofthe subtracted sample with respect to the
non-subtracted was regarded as efficient. N=Non-neoplastic; T=Tumour.

<

:4T -.:-n.::::::::: 5T
' -=- ovl

6T
1

.:::::::::::::::-.:::-.::
1l:Ac;yelo.-10.0f / 1l-IAc:ye._.l.~' / 1JiAc:yeiMI.I .7
B< , B<~: ; ; ~- / ;
: ; ! al 1 1 ~ ' 1
e;- / 5 ~1 i / ~- ! 1
f : if. r------/- -}- --------r----.+.'-:~------
t~~~~__;~~~_;:;:.;:~~~, >, 0 0 0 0 ,' - ,- ,
,-, ~:-:::: 'a' , 0o.~.:'. ~
; 0 o o" , , o, o

Cydes Cycles Cycles

..... NoSSH
..... SSH

1
Supplementary figure S2. PLEKHMl expression in normal tissues. Negative
staining was observed in normal pancreatic tissues. Positive cells were found in the
thymus, prostate, skin, uterus (cervix) and tonsil (red arrows).

Pancreas

~:: '. '

~

Thymus Prostate

. ~

. ------
~ _ .... ~:;

S kin Tonsil Cervix uterus

2
Supplementary table Sl. qRT-PCR primer sequences.

Official Amplicon
Sense Sequence 5'-->3' Efficiency
symbol size
OARS Forward ACCTGAACCTGGCATCACTACA 100 bp 101%
Reverse CCAAGACGCTCAAACTGGAAC
TBP Forward ACCAGGTGATGCCCTTCTGTAA 180 bp 99%
Reverse CCTCAAACCAACTTGTCAACAG
CALU Forward CAGCAACTGAACCTGCCATT 66 bp 93.50%
Reverse TTGGGCCAAGCTTTCCTAGA
BHLHE40 Forward CACGATCAGCAATCAGGCATA 150 bo 102%
Reverse CAACGGCATATGGAGTGTCCTT
TOP2A Forward TTCAGCTCTTGACCTGTCCC 108 bp 93.50%
Reverse CAAATGTTGTCCCCGAGTCT
COL4Al Forward CGTAAGCACATTCGGGCCATTT 108 bp 102%
Reverse TCAGGCCTAGTGGTCCGAATCT
CTSK Forward TTTCCCTGACAGCTGTGTACTC 109 bo 99%
Reverse TGTGAAAATCTCCAGCCTGTAC
SPARC Forward ACTTTTGGGAGCACGGACTGT 143 bo 99%
Reverse TTTTGGCCTTCCTGGCTGAAAC
FNl Forward AAGGCTTGAACCAACCTACGG 128 bp 91.50%
Reverse AAAGCCTAAGCACTGGCACAA
IGFBPS Forward TGTGTACCTGCCCAATTGTGAC 116 bp 97%
Reverse GCAGCTTCATCCCGTACTTGT
PMEPAl Forward TGCGTAGGTGAAAAGGCAGAA 149 bo 91.50%
Reverse AGCTTGTGCATTCAGACCAGAC
SBN02 Forward ACCCTTGAAATCCGTGAAACCG 170 bo 86.30%
Reverse AGAGGTGAGCGGGCAATAACT
CDSS Forward GCTTTGGAAGGCCGTACAAGTT 196 bp 99.50%
Reverse AAGGCTGTTTGAGGGATGCAG
OASL Forward AGCAGGTGCTCCTTAGCCAAAT 146 bp 88.50%
Reverse AGGATGAAGCTGTTGGGGTTG
KNGl Forward ATTGACTTCGTGGCCAGGGAAA 168 bo 97.3
Reverse TCCCAGTGGTTGACAGTTGACA
SYT12 Forward TTCCCCATCGCAAATGCAGTTC 191 bp 77%
Reverse TTGGACCTCTGGTTCTTGCCAT
MMP7 Forward TGGGACATTCCTCTGATCCT 165 bp 88%
Reverse TGAATGGATGTTCTGCCTGA
LAMA3 Forward TGCAGATGCAAGCCCAGAATC 109 bo 99.40%
Reverse GCTCAGTCCCATCTCTGTTGCA
SYNE2 Forward CTGATGCTCGCTGGAAAGAGTT 171 bp 96.80%
Reverse GCCGCAGTGCTGTCTCTAAA
PLEKHM Forward AAGTGACCTGGTCCTAAGCTGT 105 bp 94.50%
Reverse GGCAAGTTCAGTGATGCTTTGG
DPYSL4 Forward AGCCCTCATCCAGGGAAGTTTT 175 bo 90%
Reverse TTCACATCAGAGGCAGGATGA
STATl Forward TCCGTGGCACTGCATACAATCT 184 bp 93.70%
Reverse TGCCGAATTCCCAAAGGGCAA

3
Supplementary table S2. Signal subtraction of 100 housekeeping genes. N= Non-
neoplastic tissue; T=Tumoural tissue.

Signal
1T 1N 2T 2N 3T 3N 4T 4N ST SN 6T 6N Mean
subtraction
>20% 42 39 37 53 54 60 64 59 58 42 49 42 50%
>50% 28 22 25 44 49 39 49 44 42 32 39 32 37%
>80% 10 5 9 14 16 21 26 19 13 18 16 6 14%

Housekeeping gene list

ACTB HMBS SDHA ZWlO COX7A2L RABIA YARS

ADA HPRTl SUil ALDOA BTF3 UBE2M UBE2I
AGPATl HSPCB TAF2 LDHA ATP5J2 GNAS PABPCl
ALG9 LRPl TBP RPS27A SFRS9 PTBPl COX4Il
ATP5B MCRSl TEGT RPL19 CSTB RPL36AL SPAG7
B2M NACA TFCP2 RPLll TETRAN C2lorf33 PSMD8
CAPN2 PGKl TPTl NONO HADHA GPI ZFP36Ll
CETN2 PMMl TUBA6 RPS18 VEGFB COX7C ODCl
CLTC POLR2L TXNRDl ILF2 STK24 FAU RPL18
CYCl PSMB6 UBB USPll EFNA3 GRIK5 RPSll
FLOT2 QARS UBC UBEl ARHGAPl COX5B
GAPDH RPL13A UBE2D2 CTNNBl TAPBP COX5A
GPNMB RPL29 UBR2 EIF3S7 BATl VAMP3
GUSB RPS13 YWHAZ NDUFAl TKT GPAAl
HDAClO RPS23 ZNF410 SAFB HLA-C HSBPl

4
Supplementary table 53

Direct strategy
Gene ID Accession Symbol Average Fold Change p-value
1277 NM 000088 COL1A1 1.390 0.001
6374 NM 002994 CXCL5 1.159 0.004
3556 NM 002182 IL1RAP 1.153 0.000
1009 NM 001797.2 CDH11 1.115 0.000
10205 NM 005797.2 EVA1 1.074 0.000
115908 NM 138455.2 CTHRC1 1.066 0.000
7474 NM 003392.3 WNT5A 1.057 0.000
9859 - KIAA0470 1.018 0.000
283209 NM 173582.3 PGM2L1 1.014 0.000
2335 NM 002026.2 FN1 1.005 0.000
8942 - KYNU 1.004 0.000
3576 NM 000584.2 IL8 0.962 0.003
2274 NM 201557.1 FHL2 0.957 0.000
5918 NM 206963.1 RARRE$1 0.952 0.000
6590 NM 003064.2 SLPI 0.948 0.000
51715 NM 183227.1 RAB23 0.944 0.002
142913 - CFL1P1 0.932 0.000
3488 NM 000599 IGFBP5 0.929 0.001
26509 NM 133337.1 FER1L3 0.914 0.000
64063 NM 022119.3 PRS$22 0.908 0.000
8553 NM 003670 BHLHB2 0.903 0.000
4680 - CEACAM6 0.901 0.000
6513 NM 006516.1 SLC2A1 0.899 0.000
10631 NM 006475.1 POSTN 0.890 0.005
135228 NM 133493.1 CD109 0.887 0.003
2706 NM 004004.3 GJB2 0.878 0.000
2595 NM 198141 GANC 0.871 0.008
1293 NM 057167.2 COL6A3 0.867 0.003
2335 NM 002026.2 FN1 0.866 0.008
84419 NM 032413.2 NMES1 0.866 0.004
388272 NM 001001436.1 C16orf87 0.858 0.001
4070 NM 002353.1 TACSTD2 0.853 0.001
1728 NM 000903.1 NQ01 0.847 0.000
2568 NM 014211.1 GABRP 0.847 0.001
63898 NM 022071.2 SH2D4A 0.846 0.004
55454 NM 018590 GALNACT-2 0.844 0.001
8190 NM 006533.1 M lA 0.838 0.006
11082 NM 007036.2 ESM1 0.823 0.004
4085 NM 002358 MAD2L1 0.823 0.000
5743 NM 000963 PTGS2 0.813 0.000
55858 NM 018475.2 TPARL 0.809 0.005
3433 NM 001547.3 IFIT2 0.806 0.000
7321 NM 003338.3 UBE2D1 0.805 0.000
54209 NM 018965.1 TREM2 0.804 0.001
7153 NM 001067.2 TOP2A 0.798 0.000
6678 NM 003118.2 SPARC 0.793 0.000
221035 - REEP3 0.790 0.007
5918 NM 206963.1 RARRES1 0.790 0.002
 139201 AK056535 MAP2K4P1 0.790 0.001
114884 NM 017784.3 OSBPL10 0.788 0.000
83540 NM 145697.1 CDCA1 0.781 0.001
8898 NM 201281.1 MTMR2 0.771 0.001
129642 NM 138799.2 OACT2 0.767 0.000
10103 NM 005727.2 TSPAN1 0.764 0.004
1282 NM 001845 COL4A1 0.764 0.001
4312 NM 002421.2 MMP1 0.762 0.005
51208 NM 016369.3 CLDN18 0.761 0.005
163223 NM 001001411 ZNF676 0.760 0.009
665 NM 004331.2 BNIP3L 0.754 0.002
122786 NM 152330.2 C14orf31 0.754 0.007
2123 NM 001003927.1 EVI2A 0.753 0.009
3486 NM 001013398.1 IGFBP3 0.750 0.002
64778 NM 022763.2 FNDC3B 0.749 0.000
10973 NM 006828.1 ASCC3 0.747 0.000
7514 NM 003400.3 XP01 0.744 0.000
7045 NM 000358.1 TGFBI 0.744 0.003
441258 XM 499330 LOC441258 0.740 0.006
7127 NM 006291.2 TNFAIP2 0.738 0.000
57162 NM 020651 PELI1 0.732 0.003
7058 NM 003247.2 THBS2 0.727 0.000
1084 NM 001815.1 CEACAM3 0.727 0.001
6423 NM 003013.2 SFRP2 0.726 0.005
155061 NM 152557.3 ZNF746 0.725 0.009
2149 NM 001992.2 F2R 0.724 0.000
81470 NM 001001915 OR2G2 0.723 0.000
9859 NM 014812 CEP170 0.722 0.003
3827 NM 000893.2 KNG1 0.722 0.010
128611 XM 066058.3 C20orf174 0.721 0.006
2591 NM 004482.2 GALNT3 0.720 0.004
3176 NM 006895.2 HNMT 0.720 0.002
611477 NM 024604.1 RPAP3 0.719 0.001
54443 NM 018685.2 ANLN 0.717 0.006
23643 NM 015364.2 LY96 0.716 0.004
149992 NM 153773.1 C21orf99 0.713 0.001
10159 NM 005765.2 ATP6AP2 0.712 0.001
11098 NM 007173.3 PRSS23 0.710 0.000
114907 NM 058229.2 FBX032 0.709 0.000
2182 NM 004458.1 ACSL4 0.709 0.004
64581 NM 197949.1 CLEC7A 0.708 0.004
7052 NM 004613 TGM2 0.708 0.001
6781 NM 003155 STCl 0.708 0.000
55709 - KBTBD4 0.706 0.004
56122 NM 018934.2 PCDHB14 0.706 0.009
360023 NM 194314.2 ZBTB41 0.703 0.006
2263 NM 022971.1 FGFR2 0.702 0.005
5159 NM 002609.3 PDGFRB 0.700 0.001
30001 NM 014584.1 EROlL 0.699 0.001
84196 NM 032236 USP48 0.698 0.007
 51334 NM 016644.1 PRR16 0.696 0.000
4982 NM 002546.2 TNFRSFllB 0.695 0.001
122809 NM 080867.2 SOCS4 0.695 0.001
51339 NM 016651.4 DACTl 0.694 0.002
5738 NM 020440.2 PTGFRN 0.693 0.003
23636 NM 012346.3 NUP62 0.691 0.002
23552 NM 178432.1 CCRK 0.689 0.008
3775 - KCNK1 0.689 0.005
23414 NM 012082.2 ZFPM2 0.684 0.009
813 NM 001219 CALU 0.682 0.000
22904 - SBN02 0.680 0.002
10944 - SMAP 0.678 0.002
59 NM 001613.1 ACTA2 0.678 0.002
9683 NM 153029.3 N4BP1 0.678 0.000
3866 NM 002275.2 KRT15 0.677 0.002
285 NM 001147.1 ANGPT2 0.676 0.003
55612 NM 017671 C20orf42 0.675 0.007
1462 NM 004385.2 VCAN 0.675 0.000
80267 NM 025191.2 C1orf22 0.675 0.002
4320 NM 005940.3 MMPll 0.671 0.000
8935 NM 003930.3 SCAP2 0.668 0.002
147920 NM 001002915 IGFL2 0.668 0.007
85441 NM 033405 PRIC285 0.663 0.001
3399 NM 002167.2 103 0.663 0.006
170463 NM 032627.2 SSBP4 0.660 0.007
196 NM 001621 AHR 0.660 0.002
9255 NM 004757.2 SCYE1 0.656 0.002
5885 NM 006265 RAD21 0.653 0.000
1508 NM 147780.2 CTSB 0.652 0.002
375790 NM 198576.2 AGRN 0.651 0.000
255374 NM 203397.1 MBLAC1 0.650 0.006
146183 NM 144672.2 OTOA 0.650 0.010
84935 NM 032849.2 C13orf33 0.647 0.002
29940 NM 013352.1 SART2 0.645 0.006
3556 NM 002182.2 IL1RAP 0.644 0.003
1655 NM 004396.2 DDXS 0.644 0.002
90316 NM 138960 TGIF2LX 0.644 0.003
6947 NM 001062.2 TCN1 0.641 0.000
55959 NM 198596.1 SULF2 0.641 0.001
3091 NM 181054.1 HIF1A 0.640 0.010
56034 NM 016205.1 PDGFC 0.639 0.001
10321 NM 006061.1 CRISP3 0.639 0.003
2623 NM 002049.2 GATA1 0.638 0.002
26165 - C9orf36 0.638 0.000
6286 - S100P 0.638 0.002
26585 NM 013372 GREM1 0.637 0.003
1296 NM 005202.1 COL8A2 0.636 0.000
22943 NM 012242.2 DKK1 0.636 0.000
8491 NM 003618.2 MAP4K3 0.634 0.004
441707 XM 497432 LOC441707 0.633 0.005
 9168 NM 021103 TMSB10 0.632 0.008
9749 NM 014721.1 PHACTR2 0.631 0.001
8836 - GGH 0.631 0.001
6045 NM 007212.3 RNF2 0.629 0.000
7045 NM 000358.1 TGFBI 0.626 0.005
79690 NM 024637.3 GAL3ST4 0.625 0.001
3934 NM 005564.2 LCN2 0.624 0.001
5277 NM 020473.1 PIGA 0.624 0.000
10487 NM 006367 CAP1 0.621 0.000
11177 NM 182648.1 BAZ1A 0.619 0.005
8767 NM 003821.4 RIPK2 0.618 0.000
79794 NM 024738.1 C12orf49 0.618 0.009
3976 NM 002309.2 LIF 0.618 0.005
84168 NM 032208.1 ANTXR1 0.617 0.001
6507 NM 004172 SLC1A3 0.617 0.003
150094 NM 173354.2 SNF1LK 0.616 0.004
2152 NM 001993.2 F3 0.614 0.001
84790 NM 032704.2 TUBA6 0.612 0.000
54799 NM 017643.1 MBTD1 0.611 0.000
23362 - PSD3 0.610 0.002
400221 XM 379075 FU22447 0.608 0.003
90390 NM 080651.1 THRAP6 0.607 0.001
306 NM 005139.1 ANXA3 0.605 0.000
402247 XM 377928 LOC402247 0.605 0.001
699 NM 004336.2 BUB1 0.604 0.003
55614 NM 024704.3 C20orf23 0.602 0.006
10561 NM 006417.2 IFI44 0.601 0.000
25903 NM 015441.1 OLFML2B 0.601 0.007
1513 NM 000396.2 CTSK 0.601 0.004
11167 NM 007085.3 FSTL1 0.599 0.009
5530 NM 000944.2 PPP3CA 0.599 0.005
153830 NM 144726.1 RNF145 0.598 0.001
2218 NM 006731.1 FCMD 0.598 0.004
23213 NM 015170.1 SULF1 0.597 0.003
822 NM 001747.2 CAPG 0.597 0.005
57234 AB007962 FAM91A2 0.594 0.002
1475 NM 005213.3 CSTA 0.594 0.004
6888 NM 006755.1 TALD01 0:594 0.001
3956 NM 002305.2 LGALS1 0.593 0.001
285927 BC044242 CCZ1 0.593 0.003
55858 NM 018475.2 TPARL 0.593 0.001
1514 NM 145918.1 CTSL 0.592 0.003
6443 NM 000232 SGCB 0.591 0.004
25932 NM 013943.1 CLIC4 0.590 0.001
23291 NM 033644.2 FBXW11 0.589 0.006
57045 - TWSG1 0.588 0.001
441273 XM 496912 SPDYE2 0.588 0.005
387805 XM 370649 LOC387805 0.587 0.000
136 NM 000676.2 ADORA2B 0.587 0.004
81606 NM 030915.1 LBH 0.587 0.002
 57561 NM 020801.1 ARRDC3 0.586 0.009
50486 NM 015714.2 GOS2 0.586 0.007
28962 NM 014028.3 OSTM1 0.582 0.003
9344 NM 018348.4 TAOK2 0.582 0.001
1087 NM 006890.1 CEACAM7 0.580 0.008
2825 - GPR1 0.579 0.001
1263 NM 004073.2 PLK3 0.576 0.001
57480 XM 027307.3 PLEKHG1 0.576 0.001
51347 NM 016281.2 TAOK3 0.575 0.001
261729 NM 152999.2 STEAP2 0.573 0.001
284033 - SHISA6 0.573 0.004
4680 NM 002483 CEACAM6 0.572 0.010
692196 - SNORD76 0.570 0.002
27071 NM 014395.1 DAPP1 0.570 0.002
117285 NM 054112.1 DEFB118 0.569 0.001
9957 NM 005114.2 HS3ST1 0.569 0.001
11178 NM 021020 LZTS1 0.569 0.002
6659 NM 003107 SOX4 0.568 0.001
84641 NM 032558.1 HIATL1 0.568 0.002
387758 NM 203371.1 FIBIN 0.567 0.000
6336 NM 006514.1 SCN10A 0.567 0.001
23224 NM 015180.3 SYNE2 0.566 0.001
1462 - VCAN 0.565 0.001
100129460 XM 496860.1 DPY19L1P1 0.565 0.003
6382 NM 002997.4 SDC1 0.565 0.003
29127 NM 013277 RACGAP1 0.565 0.004
253981 AK025431 RELL1 0.564 0.009
6856 NM 006754.2 SYPL1 0.563 0.003
130940 NM 138803.2 CCDC148 0.563 0.004
10769 NM 006622.1 PLK2 0.562 0.001
60485 NM 021818.2 SAV1 0.561 0.006
1001 NM 001793.3 CDH3 0.559 0.001
283824 BX647541 XYLTl 0.559 0.004
1462 NM 004385.2 VCAN 0.558 0.008
3280 NM 005524.2 HES1 0.556 0.004
6591 NM 003068.3 SNAI2 0.555 0.001
55035 - NOL8 0.554 0.003
1718 NM 014762.2 DHCR24 0.551 0.003
6772 NM 007315 STATl 0.551 0.006
374 NM 001657.2 AREG 0.551 0.003
10146 NM 198395.1 G3BP 0.550 0.002
55030 NM 017943 FBX034 0.548 0.005
600246 - ELK4 0.547 0.004
29005 AF001542 MALATl 0.545 0.000
10487 NM 006367.2 CAP1 0.545 0.001
161742 NM 152594.1 SPRED1 0.544 0.001
10728 NM 006601 PTGE$3 0.544 0.007
57688 XM 035299.6 ZSWIM6 0.543 0.002
387103 NM 001012507 C6orf173 0.542 0.008
863 NM 175931.1 CBFA2T3 0.542 0.002
 27242 NM 014452.3 TNFRSF21 0.542 0.001
390680 XM 372611 LOC390680 0.541 0.004
7148 - TNXB 0.541 0.001
4604 NM 206821.1 MYBPC1 0.539 0.010
57552 NM 020792.3 AADACL1 0.538 0.003
9052 NM 003979.3 GPRC5A 0.538 0.002
1894 NM 018098.4 ECT2 0.537 0.002
9689 NM 014670.2 BZW1 0.537 0.002
10092 NM 005717.2 ARPC5 0.536 0.003
308 - ANXA5 0.536 0.004
9140 NM 004707.2 APG12L 0.535 0.007
284397 XM 209180 LOC284397 0.535 0.009
7050 NM 173211.1 TGIF 0.534 0.001
7171 NM 003290.1 TPM4 0.534 0.001
2877 NM 002083.2 GPX2 0.532 0.003
11026 NM 006865.2 LILRA3 0.530 0.005
4148 NM 002381.3 MATN3 0.530 0.007
55281 NM 018295.1 TMEM140 0.530 0.001
1385 NM 004379.2 CREB1 0.530 0.001
84002 NM 032047 B3GNT5 0.530 0.007
57157 NM 020432.2 PHTF2 0.530 0.002
114884 NM 017784 OSBPL10 0.529 0.002
159 NM 001126.2 ADSS 0.527 0.005
197021 - KLPH 0.526 0.008
10926 NM 006716 ASK 0.526 0.002
79188 NM 024334.1 TMEM43 0.526 0.002
10617 NM 213622.1 STAMBP 0.526 0.003
205428 NM 173552.2 C3orf58 0.525 0.002
51495 NM 016395.1 HSPC121 0.524 0.006
118672 NM 153336.1 Cl0orf89 0.523 0.005
51056 NM 015907 LAP3 0.522 0.007
55714 XM 371717.2 ODZ3 0.521 0.002
2697 NM 000165.2 GJA1 0.521 0.003
55689 NM 018023.3 YEATS2 0.521 0.003
2737 NM 000168.2 GLI3 0.520 0.001
4811 - NID1 0.520 0.008
84920 NM 032834 ALG10 0.520 0.002
51174 NM 016261.2 TUBD1 0.519 0.002
151306 NM 170699.1 GPBAR1 0.519 0.010
8543 NM 006769.2 LM04 0.519 0.004
91404 NM 178123.3 SESTD1 0.518 0.002
10672 - GNA13 0.518 0.003
23508 XM 027236.5 TTC9 0.518 0.001
244 NM 001630 ANXA8 0.516 0.003
79919 - C2orf54 0.515 0.006
1604 NM 000574.2 DAF 0.515 0.002
157922 NM 015447 CAMSAP1 0.515 0.002
115207 - KCTD12 0.513 0.006
1999 NM 004433.3 ELF3 0.512 0.010
286410 NM 001010986.1 ATP11C 0.512 0.004
169436 NM 153710.2 C9orf96 0.512 0.009
9897 NM 014846.2 KIAA0196 0.512 0.004
51278 NM 016545.3 IER5 0.512 0.006
22856 NM 014918.3 CHSY1 0.511 0.002
665 NM 004331 BNIP3L 0.510 0.006
8460 NM 003596.2 TPSTl 0.510 0.004
9315 NM 004772.1 C5orf13 0.510 0.002
200008 NM 201546.2 CDCP2 0.509 0.006
9069 NM 012129.2 CLDN12 0.509 0.008
1075 NM 001814.2 CTSC 0.509 0.005
81611 - ANP32E 0.508 0.001
83468 NM 031302.2 GLT8D2 0.508 0.006
10049 NM 005494.2 DNAJB6 0.507 0.002
79444 NM 022161.2 BIRC7 0.507 0.005
286367 - LOC286367 FP944 0.507 0.005
54541 NM 019058.2 DDIT4 0.507 0.003
26504 NM 020184.2 CNNM4 0.506 0.009
254848 - AFAP1-AS1 0.506 0.003
7879 NM 004637.5 RAB7 0.506 0.004
8853 NM 003887.1 DDEF2 0.505 0.007
284441 XM 208204 LOC284441 0.505 0.001
23024 - PDZRN3 0.503 0.007
5996 NM 002922.3 RGS1 0.502 0.008
84674 NM 032587.2 CARD6 0.501 0.006
161742 - SPRED1 0.501 0.002
124220 - ZG16B 0.501 0.009
3832 NM 004523.2 KIF11 0.501 0.009
151011 NM 178584.1 10-Sep 0.501 0.008
355 NM 152873.1 FAS 0.501 0.002
1111 NM 001274.2 CHEK1 0.500 0.008
131566 NM 080927.3 DCBLD2 0.498 0.006
6566 - SLC16A1 0.497 0.008
50507 NM 016931.2 NOX4 0.497 0.004
23204 NM 015161.1 ARL61P 0.496 0.005
91607 NM 152270.2 SLFN11 0.496 0.008
7532 NM 012479.2 VWHAG 0.496 0.005
113146 XM 290629.5 AHNAK2 0.496 0.007
124583 - CANTl 0.496 0.004
25871 C3orf17 0.496 0.009
136319 NM 145808.1 MTPN 0.495 0.001
283417 NM 173812.3 DPV19L2 0.493 0.007
25923 - ATL3 0.493 0.009
5530 NM 000944.2 PPP3CA 0.492 0.006
6515 NM 006931 SLC2A3 0.492 0.004
303 NR 001562.1 ANXA2P1 0.492 0.003
25800 - SLC39A6 0.491 0.003
8915 NM 003921.2 BCL10 0.488 0.007
387 NM 001664.2 RHOA 0.487 0.003
9833 NM 014791.2 MELK 0.486 0.001
57038 NM 020320.2 RARSL 0.486 0.005
 23612 - PHLDA3 0.486 0.001
10092 NM 005717 ARPC5 0.485 0.008
11031 NM 006868 RAB31 0.484 0.004
3460 NM 005534.2 IFNGR2 0.484 0.010
2017 NM 005231.2 CTTN 0.483 0.003
390790 XM 372668 ARL12 0.482 0.005
824 NM 001748 CAPN2 0.481 0.003
5230 NM 000291.2 PGK1 0.481 0.009
11236 NM 007218.3 RNF139 0.480 0.008
1075 NM 001814.2 CTSC 0.480 0.003
7932 - OR2H2 0.480 0.009
1495 NM 001903.2 CTNNA1 0.480 0.003
51192 NM 181641.1 CKLF 0.479 0.006
57523 XM 370756.2 NYNRIN 0.478 0.004
546 NM 000489.2 ATRX 0.477 0.006
84171 NM 032211.6 LOXL4 0.477 0.005
1605 NM 004393 DAG1 0.476 0.006
10097 NM 005722.2 ACTR2 0.476 0.001
11335 NM 016587.2 CBX3 0.476 0.004
10863 NM 014265.2 ADAM28 0.476 0.008
10933 NM 206839 MORF4L1 0.476 0.008
64770 NM 022757.3 CCDC14 0.475 0.008
389137 XM 371655 ARMC10P1 0.475 0.004
283126 AK094403 - 0.474 0.004
653464 XM 209227 SRGAP2P1 0.474 0.007
147339 NM 145055.2 C18orf25 0.474 0.005
91543 NM 080657.3 RSAD2 0.474 0.009
79139 NM 024295 DERL1 0.474 0.004
84945 NM 032859.2 C13orf6 0.473 0.003
6916 - TBXAS1 0.473 0.007
160492 NM 152590.1 IFLTD1 0.473 0.007
1308 NM 000494.2 COL17A1 0.473 0.004
54661 AF217751 PCDHB17 0.472 0.003
8323 NM 003506.2 FZD6 0.472 0.009
4069 NM 000239.1 LYZ 0.471 0.006
23075 NM 015055 SWAP70 0.471 0.003
25907 NM 015444.1 RIS1 0.471 0.003
4673 NM 004537.3 NAP1L1 0.470 0.005
10890 NM 016131.2 RAB10 0.470 0.008
283050 XM 378238.1 LOC283050 0.470 0.008
7171 NM 003290 TPM4 0.469 0.002
8099 NM 004642.2 CDK2AP1 0.469 0.008
80213 NM 078474.1 BLP2 0.469 0.005
10512 NM 006379.2 SEMA3C 0.469 0.005
22822 - PHLDA1 0.469 0.004
114908 NM 052932.1 PORIMIN 0.468 0.003
5782 NM 002835.2 PTPN12 0.467 0.003
10743 NM 030665.3 RAI1 0.467 0.007
2157 NM 000132.2 F8 0.467 0.008
4240 MFGE8 0.467 0.006
 23512 NM 015355.1 SUZ12 0.467 0.006
51449 NM 016297.2 PCYOX1 0.466 0.001
444 NM 032468 ASPH 0.466 0.007
123970 NM 144602.2 C16orf78 0.465 0.008
7408 NM 003370.3 VASP 0.465 0.006
29982 NM 030759 NRBF2 0.463 0.007
29992 NM 013439.2 PILRA 0.462 0.004
3840 NM 002268.3 KPNA4 0.462 0.001
283911 AL833480 LOC283911 0.461 0.006
9315 NM 004772 C5orf13 0.461 0.004
5818 AK095375 PVRL1 0.459 0.006
340107 BC040315 LOC340107 0.459 0.004
1513 NM 000396.2 CTSK 0.458 0.002
26031 NM 015550.2 OSBPL3 0.458 0.005
2182 NM 004458.1 ACSL4 0.457 0.005
7424 NM 005429.2 VEGFC 0.457 0.006
754 NM 004339 PTIG11P 0.456 0.003
10529 NM 006393.1 NEBL 0.455 0.004
6240 - RRM1 0.454 0.008
151579 XM 045290 BZW1P2 0.454 0.004
597 NM 004049.2 BCL2A1 0.451 0.004
3099 NM 000189 HK2 0.451 0.006
10644 NM 006548.4 IMP-2 0.450 0.008
84168 NM 032208.1 ANTXR1 0.449 0.005
725 NM 001017367.1 C4BPB 0.449 0.002
3122 NM 019111.3 HLA-DRA 0.448 0.006
9780 NM 014745.1 FAM38A 0.448 0.002
10097 NM 005722.2 ACTR2 0.448 0.005
1258 - CNGB1 0.448 0.005
29107 NM 013248 NXTl 0.448 0.003
55233 NM 018221.1 MOBK1B 0.447 0.006
10054 NM 005499 UBA2 0.445 0.003
26005 - C2CD3 0.445 0.003
8604 NM 003705.2 SLC25A12 0.444 0.006
5493 - PPL 0.443 0.004
195828 - ZNF367 0.443 0.010
5901 - RAN 0.442 0.008
8731 NM 003799 RNMT 0.442 0.003
2983 - GUCY1B3 0.442 0.007
200879 NM 139248.2 LIPH 0.442 0.003
345778 NM 001010891.1 MTX3 0.441 0.008
3142 NM 021958.2 HLX1 0.441 0.004
128102 XM 371285.2 HSD3BP4 0.440 0.004
55610 NM 017667.2 FU20097 0.439 0.006
11217 - AKAP2 0.437 0.006
7321 NM 003338.3 UBE2D1 0.436 0.004
1087 NM 006890 CEACAM7 0.435 0.009
4683 NM 001024688.1 NBN 0.435 0.006
10753 - CAPN9 0.435 0.003
50809 NM 016287.2 HP1BP3 0.435 0.007
 858 NM 198212.1 CAV2 0.432 0.009
441668 XM 497388 POTE M 0.432 0.003
6515 NM 006931.1 SLC2A3 0.432 0.010
144203 BN000357 OVOS2 0.432 0.008
80014 NM 024949 BOMB 0.432 0.006
728524 XM 499321 LOC442580 0.430 0.004
3992 NM 013402 FADS1 0.430 0.005
10426 NM 006322.3 TUBGCP3 0.430 0.007
26010 NM 015535.1 DNAPTP6 0.429 0.003
10123 NM 005737.3 ARL7 0.429 0.004
1612 NM 004938.1 DAPK1 0.428 0.008
8886 NM 006773.3 DDX18 0.428 0.002
55017 NM 017924.2 C14orf119 0.427 0.003
4052 NM 206943.1 LTBP1 0.427 0.004
51571 NM 016623.3 FAM49B 0.427 0.003
158427 NM 139246.3 C9orf97 0.426 0.005
6427 NM 003016.2 SFRS2 0.425 0.002
387745 XM 370603 LOC387745 0.424 0.007
80853 XM 376680.2 KIAA1718 0.424 0.008
84065 - TMEM222 0.424 0.003
768 NM 001216.1 CA9 0.424 0.009
991 NM 001255 CDC20 0.423 0.006
22803 NM 012255.3 XRN2 0.423 0.008
6596 NM 139048.1 SMARCA3 0.423 0.005
7083 - TK1 0.422 0.004
23317 NM 173823.1 DNAJC13 0.420 0.004
51729 NM 016312.2 WBPll 0.419 0.007
5879 NM 006908.3 RAC1 0.419 0.007
57522 NM 020762.1 SRGAP1 0.418 0.010
2591 NM 004482.2 GALNT3 0.417 0.007
983 NM 001786.2 CDC2 0.417 0.009
1371 NM 000097.4 CPOX 0.417 0.008
51088 NM 001007075.1 KLHL5 0.416 0.008
1660 NM 030588.1 DHX9 0.416 0.006
56937 NM 199171.1 PMEPAI 0.415 0.004
54534 NM 019051.1 MRPL50 0.413 0.004
10010 NM 004180.2 TANK 0.411 0.008
57047 NM 020359.1 PLSCR2 0.410 0.008
84168 NM 018153.2 ANTXR1 0.410 0.008
26499 NM 016445.1 PLEK2 0.410 0.004
440253 XM 496050 WHAMMP2 0.409 0.004
2036 NM 012156.2 EPB41L1 0.409 0.008
11260 NM 007235 XPOT 0.408 0.007
829 - CAPZA1 0.408 0.004
966 NM 000611.4 CD59 0.407 0.010
3839 NM 002267.2 KPNA3 0.407 0.008
8467 NM 003601.2 SMARCA5 0.406 0.008
90861 NM 144570.2 C16orf34 0.406 0.009
5573 NM 212471.1 PRKAR1A 0.404 0.005
64710 NM 022731 NUCKS 0.404 0.004
 51095 NM 182916.1 TRNTl 0.402 0.009
23353 NM 025154.2 UNC84A 0.402 0.009
196074 NM 152636 METI5D1 0.402 0.009
25806 - VAX2 0.402 0.010
441731 XM 497465 LOC441731 0.402 0.008
3490 NM 001553.1 IGFBP7 0.401 0.003
113174 NM 138421.1 LOC113174 0.401 0.006
5577 NM 002736.2 PRKAR2B -0.401 0.010
1936 NM 032378.2 EEF1D -0.402 0.003
51166 NM 016228.3 AADAT -0.403 0.005
129080 NM 133455.2 EMID1 -0.403 0.007
402275 XM 377943 LOC402275 -0.405 0.007
81554 NM 148842.1 WBSCR16 -0.406 0.010
6649 NM 003102.1 SOD3 -0.408 0.006
292 NM 001152.1 SLC25A5 -0.409 0.008
64342 NM 022460.3 HS1BP3 -0.413 0.008
4118 NM 002371.2 MAL -0.413 0.009
115557 NM 182947.1 GEFT -0.413 0.003
442675 XM 499419 LOC442675 -0.414 0.008
54498 NM 019025.2 SMOX -0.416 0.009
2819 NM 005276 GPD1 -0.418 0.005
441464 XM 499160 LOC441464 -0.418 0.008
55361 NM 018425.2 PI4KII -0.419 0.007
6506 NM 004171 SLC1A2 -0.421 0.005
64219 NM 145119.1 PJA1 -0.421 0.008
10439 NM 014279.2 OLFM1 -0.422 0.010
5314 NM 138694.2 PKHD1 -0.422 0.007
27034 NM 014384.1 ACAD8 -0.424 0.004
5998 NM 144488.3 RGS3 -0.425 0.006
391481 XM 372970 LOC391481 -0.429 0.008
9576 NM 172242.1 SPAG6 -0.430 0.007
6584 - SLC22A5 -0.430 0.003
4622 NM 017533.1 MYH4 -0.431 0.009
7125 NM 003279.2 TNNC2 -0.431 0.006
441599 XM 497281 LOC441599 -0.432 0.009
7367 NM 001077 UGT2B17 -0.433 0.008
54715 NM 018723.2 A2BP1 -0.433 0.008
9686 - VGLL4 -0.433 0.003
8775 NM 003827.2 NAPA -0.434 0.004
389549 NM 001024613.1 LOC389549 -0.438 0.004
7273 NM 133378.2 TIN -0.438 0.009
5687 - PSMA6 -0.441 0.008
441449 XM 499150 LOC441449 -0.442 0.008
2494 NM 205860.1 NR5A2 -0.442 0.004
5777 NM 080548.2 PTPN6 -0.442 0.007
55592 NM 017600.1 DKFZp434M0331 -0.442 0.008
388444 XM 371097 LOC388444 -0.444 0.003
151354 - NSE1 -0.444 0.003
89886 NM 033438.1 SLAMF9 -0.446 0.008
58510 NM 021232.1 PRODH2 -0.447 0.003
 5966 NM 002908.2 REL -0.447 0.003
308 - ANXA5 -0.447 0.006
54205 NM 018947 CYCS -0.450 0.006
5968 NM 006507 REG1B -0.450 0.006
1153 NM 001280 CIRBP -0.451 0.005
441809 XM 497573 LOC441809 -0.452 0.007
441997 XM 497818 LOC441997 -0.453 0.005
55520 NM 018696.2 ELAC1 -0.453 0.007
80144 NM 025074.3 FRAS1 -0.458 0.002
284612 NM 001006603.1 SYPL2 -0.463 0.004
5930 NM 006910.4 RBBP6 -0.465 0.009
80174 NM 145663.1 DRF1 -0.465 0.007
22807 NM 016260.1 ZNFN1A2 -0.466 0.003
23426 XM 290559.5 GRIP1 -0.466 0.005
11317 NM 014276.2 RBPSUHL -0.471 0.006
150000 NM 172024.1 ABCC13 -0.471 0.009
64577 NM 022568.2 ALDH8A1 -0.475 0.007
1523 NM 181552.1 CUTL1 -0.477 0.004
80196 NM 194271.1 RNF34 -0.477 0.007
54937 NM 017826.1 FU20449 -0.478 0.007
1196 NM 003993.2 CLK2 -0.479 0.010
403315 - - -0.480 0.002
2488 NM 001018080.1 FSHB -0.482 0.002
4135 NM 207577.1 MAP6 -0.484 0.008
64072 NM 022124.2 CDH23 -0.485 0.007
5354 NM 199478.1 PLP1 -0.485 0.007
1674 NM 001927.3 DES -0.490 0.004
5245 NM 002634 PHB -0.495 0.007
10230 - NBR2 -0.496 0.009
22947 NM 033178 DUX4 -0.497 0.009
64581 NM 197952.1 CLEC7A -0.498 0.005
57628 NM 001004360.1 DPP10 -0.498 0.005
284339 NM 173633.1 FU90805 -0.498 0.009
6786 - STIM1 -0.499 0.007
51092 NM 015996.1 SIDT2 -0.501 0.003
7881 NM 172159.2 KCNAB1 -0.501 0.005
25837 - RAB26 -0.502 0.007
3909 NM 198129.1 LAMA3 -0.502 0.005
55260 NM 018273.2 TMEM143 -0.504 0.003
22905 NM 014964.3 EPN2 -0.504 0.006
2053 NM 001979.4 EPHX2 -0.505 0.002
27020 NM 012428.1 SDFR1 -0.507 0.008
38 NM 000019.2 ACATl -0.507 0.004
196120 XM 114987 SSU72P5 -0.510 0.005
23336 NM 145728.1 DMN -0.511 0.009
23229 NM 015185.1 ARHGEF9 -0.511 0.005
85445 NM 033401.2 CNTNAP4 -0.513 0.003
63906 NM 022078.1 GPATC3 -0.513 0.006
51386 NM 016091.2 EIF3S61P -0.514 0.004
2742 NM 002063.2 GLRA2 -0.516 0.010
 26063 NM 020664.3 DECR2 -0.518 0.005
170482 NM 203503.1 CLEC4C -0.519 0.002
253980 NM 178863.2 KCTD13 -0.520 0.006
80178 NM 025108.1 C16orf59 -0.521 0.008
1956 NM 005228.3 EGFR -0.521 0.002
81033 NM 030779.2 KCNH6 -0.521 0.010
317705 NM 173858 VN1R5 -0.525 0.004
57337 NM 020654.2 SENP7 -0.525 0.002
128344 NM 181643.2 C1orf88 -0.525 0.007
496 NM 000705.2 ATP4B -0.527 0.007
56673 NM 020643.1 Cllorf16 -0.528 0.007
56163 NM 031994.1 RNF17 -0.528 0.002
2903 NM 000833.2 GRIN2A -0.529 0.002
79656 NM 024603.1 BEND5 -0.529 0.005
441060 XM 498993 LOC441060 -0.529 0.001
151295 NM 144712.2 SLC23A3 -0.529 0.008
389599 XM 372002 STRADBP1 -0.535 0.006
2281 NM 004116.2 FKBP1B -0.535 0.009
112483 NM 133491.2 SAT2 -0.537 0.001
148638 - LOC148638 -0.538 0.003
55208 NM 018185.2 C13orf17 -0.539 0.003
57644 NM 020884.1 MYH7B -0.541 0.007
161380 BF109853 Cl4orf42 -0.543 0.008
285622 - NBPF22P -0.544 0.009
154872 XM 380140 LOC154872 -0.545 0.002
472 NM 000051.2 ATM -0.546 0.006
64130 NM 022165.2 LIN7B -0.547 0.002
7273 NM 133437.1 TIN -0.549 0.005
2346 NM 004476.1 FOLH1 -0.549 0.004
2984 NM 004963.1 GUCY2C -0.550 0.002
948 NM 000072.2 CD36 -0.553 0.003
10811 NM 006647.1 NOXA1 -0.554 0.007
2030 - SLC29A1 -0.558 0.004
56980 NM 199439.1 PRDM10 -0.559 0.006
390705 XM 372626 LOC390705 -0.560 0.001
9098 NM 004505 USP6 -0.561 0.008
2157 NM 000132.2 F8 -0.563 0.006
51011 NM 016044 FAHD2A -0.563 0.001
57678 NM 020918 GPAM -0.567 0.001
55821 - ALLC -0.571 0.001
5352 NM 182943.2 PLOD2 -0.571 0.002
3475 NM 001007245.1 IFRD1 -0.571 0.007
23495 NM 012452 TNFRSF13B -0.575 0.008
5037 NM 002567.2 PBP -0.577 0.001
4494 NM 005949.1 MTlF -0.578 0.001
284835 AK094492 LINC00323 -0.579 0.000
9148 - NEURL -0.579 0.001
64900 XM 372866 LPIN3 -0.581 0.010
56647 NM 078469.1 BCCIP -0.582 0.007
4968 NM 016819.2 OGG1 -0.583 0.008
 388959 XM 373989 LOC388959 -0.587 0.006
24140 NM 177439.1 FTSJ1 -0.590 0.001
91948 XM 378549.2 LOC91948 -0.591 0.006
148362 NM 144695.1 Clorf58 -0.595 0.008
441339 XM 499103 LOC441339 -0.598 0.006
4329 NM 005589.2 ALDH6A1 -0.607 0.002
440464 XM 371081 LOC440464 -0.608 0.006
6425 NM 003015.2 SFRP5 -0.608 0.000
140801 NM 080746.2 RPL10L -0.608 0.009
8526 NM 003647.1 DGKE -0.609 0.004
284 NM 139290.1 ANGPTl -0.611 0.003
54885 NM 017752.2 TBC1D8B -0.611 0.009
119749 NM 001004703 OR4C46 -0.612 0.003
25924 NM 015460.2 MYRIP -0.612 0.010
340268 XM 374401 LOC340268 -0.612 0.005
144165 - PRICKLE1 -0.612 0.005
9154 NM 004213.3 SLC28A1 -0.613 0.006
54991 NM 017891.2 C1orf159 -0.614 0.004
9063 NM 173206.2 PIAS2 -0.617 0.005
65258 NM 023075.3 MPPE1 -0.617 0.001
1576 NM 017460.3 CYP3A4 -0.622 0.007
340178 BC044924 LOC340178 -0.623 0.007
147184 - TMEM99 -0.629 0.010
18 NM 020686.3 ABAT -0.631 0.001
5106 NM 004563.2 PCK2 -0.633 0.003
84315 NM 032355.2 MON1A -0.636 0.006
127540 NM 145205.3 HMGB4 -0.638 0.006
2625 NM 002051.2 GATA3 -0.639 0.005
4498 NM 175622 MTlJ -0.639 0.006
57556 NM 020796.2 SEMA6A -0.641 0.005
3083 NM 001528.2 HGFAC -0.646 0.006
100507203 XM 379432.1 LOC100507203 -0.648 0.010
399920 XM 378300 LOC399920 -0.652 0.001
10143 NM 005752.2 CLEC3A -0.655 0.009
1842 NM 001393.2 ECM2 -0.656 0.001
388591 NM 207396.1 RNF207 -0.657 0.001
1472 NM 001899 CST4 -0.659 0.006
202151 NM 145000.2 RANBP3L -0.661 0.001
9340 - GLP2R -0.663 0.004
2309 NM 001455 FOX03A -0.666 0.001
256691 NM 153267.3 MAMDC2 -0.669 0.007
83747 AK000652 C20orf57 -0.669 0.004
1770 NM 001372.2 DNAH9 -0.673 0.004
5210 NM 004567.2 PFKFB4 -0.677 0.003
11162 NM 198041.1 NUDT6 -0.677 0.001
57535 NM 020775.2 KIAA1324 -0.678 0.002
57057 NM 020417.1 TBX20 -0.679 0.002
5893 NM 134423.1 RAD52 -0.679 0.008
390667 NM 001013658 PTX4 -0.682 0.009
222052 XM 499284 TIC4P1 -0.683 0.003
 10908 NM 006702.2 NTE -0.689 0.005
3651 NM 000209.1 IPFl -0.690 0.004
84107 NM 032153.3 ZIC4 -0.690 0.008
81472 NM 198074.3 OR2C3 -0.691 0.001
57718 NM 058237.1 PPP4R4 -0.695 0.002
79925 NM 024867.2 SPEF2 -0.706 0.005
84820 XM 499280.1 POLR2J4 -0.714 0.009
4496 NM 005951 MTlH -0.717 0.000
134548 NM 175873.3 ANKRD43 -0.718 0.004
51480 NM 016378.2 VCX2 -0.723 0.009
54798 NM 017639.2 DCHS2 -0.725 0.006
85282 NM 033059 KRTAP4-14 -0.734 0.000
5593 NM 006259.1 PRKG2 -0.736 0.006
2938 NM 145740 GSTA1 -0.742 0.004
478 NM 152296.3 ATP1A3 -0.747 0.004
56344 NM 019855.3 CABP5 -0.747 0.002
1558 NM 000770.2 CYP2C8 -0.750 0.003
53820 NM 018962.1 DSCR6 -0.752 0.008
93463 XM 376186.2 LOC93463 -0.759 0.002
245932 NM 153289.2 DEFB119 -0.762 0.003
10911 NM 006786.2 UTS2 -0.763 0.007
79366 NM 030763.1 NSBP1 -0.772 0.005
54897 NM 017766.2 CASZ1 -0.774 0.004
4653 NM 000261.1 MYOC -0.778 0.003
4607 NM 000256.2 MYBPC3 -0.779 0.000
7273 NM 133378.2 TIN -0.785 0.003
57282 - SLC4A10 -0.788 0.007
6563 NM 015865.1 SLC14A1 -0.796 0.010
54097 NM 058186.3 FAM3B -0.821 0.006
353288 NM 181539.3 KRT25B -0.856 0.008
50629 AF109299 PCANAP6 -0.862 0.004
116966 NM 181265.2 WDR17 -0.872 0.005
116444 NM 138690.1 GRIN3B -0.907 0.004
7681 NM 005664.1 MKRN3 -0.917 0.001
7364 NM 001074 UGT2B7 -1.086 0.003
186 NM 000686.3 AGTR2 -1.374 0.003
2939 NM 000846 GSTA2 -1.424 0.002
948 NM 000072.2 CD36 -1.451 0.004

lndirect strategy
Gene ID Accession Symbol Average Fold Change p-value
8638 NM 003733.2 OASL 1.915 0.008
91683 NM 177963.2 SYT12 0.979 0.007
56114 NM 031993.1 PCDHGA1 0.895 0.029
2583 NM 001478.2 GALGT 0.857 0.013
81607 - PVRL4 0.851 0.002
7273 NM 133378.2 TIN 0.771 0.005
10874 NM 006681.1 NMU 0.742 0.009
4316 NM 002423.2 MMP7 0.725 0.007
 10212 NM 138998.1 DDX39 0.725 0.010
201163 - FLCN 0.723 0.004
7483 NM 003395.1 WNT9A 0.721 0.010
3827 - KNG1 0.716 0.005
79925 NM 024867.2 SPEF2 0.714 0.020
84276 NM 032316.2 NICN1 0.686 0.041
9344 NM 004783.2 TAOK2 0.677 0.015
2266 NM 000509.3 FGG 0.673 0.010
2152 NM 001993.2 F3 0.669 0.013
1469 NM 001898.2 CSTl 0.666 0.013
5373 NM 000303.1 PMM2 0.663 0.011
54843 NM 032943.2 SYTL2 0.656 0.042
7706 NM 005082.4 TRIM25 0.656 0.014
2329 NM 002022.1 FM04 0.649 0.022
51227 NM 016430.2 DSCR5 0.648 0.002
23001 NM 014991.3 WDFY3 0.642 0.003
157680 - VPS13B 0.641 0.010
7140 NM 006757.1 TNNT3 0.633 0.008
7769 - ZNF226 0.614 0.008
1604 NM 000574.2 CD55 0.613 0.005
25893 NM 015431.2 TRI M 58 0.610 0.012
10066 - SCAMP2 0.607 0.003
7050 NM 170695.2 TGIF 0.604 0.011
80852 XM 042936.5 GRIP2 0.601 0.023
54726 NM 199324.1 HSHIN1 0.600 0.008
10781 NM 006631.2 ZNF266 0.597 0.012
8013 NM 173199.1 NR4A3 0.584 0.008
55764 NM 052985.1 WDR10 0.584 0.028
7273 NM 133378.2 TIN 0.581 0.004
1404 NM 001884.2 HAPLN1 0.580 0.023
535 NM 005177.2 ATP6VOA1 0.572 0.004
132 NM 006721.2 ADK 0.571 0.004
79864 NM 024806.2 Cllorf63 0.570 0.004
54880 NM 017745.4 BCOR 0.568 0.043
7634 NM 007136.1 ZNF80 0.566 0.009
2986 NM 001522.1 GUCY2F 0.566 0.005
51014 NM 181836.3 TMED7 0.561 0.050
136991 NM 130768.1 ASZ1 0.561 0.021
5790 - PTPRCAP 0.560 0.029
558 NM 001699.3 AXL 0.560 0.011
9842 NM 014798.1 PLEKHM1 0.558 0.002
64072 NM 022124.2 CDH23 0.553 0.036
22948 NM 012073.3 CCT5 0.553 0.005
55669 NM 033540.2 MFN1 0.552 0.016
94120 - SYTL3 0.550 0.037
29123 - ANKRDll 0.550 0.021
648987 - LOC648987 0.549 0.010
10068 NM 173044.1 IL18BP 0.546 0.025
4739 NM 006403.2 NEDD9 0.545 0.023
6915 NM 201636.1 TBXA2R 0.544 0.001
 55074 - OXR1 0.544 0.047
2784 NM 002075.2 GNB3 0.541 0.019
57144 NM 020341.2 PAK7 0.539 0.036
80333 - KCNIP4 0.538 0.019
23224 NM 182914.1 SYNE2 0.537 0.042
116540 NM 053050.2 MRPL53 0.537 0.022
7273 NM 133378.2 TTN 0.536 0.008
255877 NM 181844.2 BCL6B 0.535 0.014
55063 NM 017984.2 ZCWPW1 0.532 0.012
79074 NM 024093.1 C2orf49 0.530 0.015
55218 - Cl4orf114 0.525 0.050
56853 - BRUNOL4 0.524 0.021
55183 NM 018151.3 RIF1 0.522 0.031
58493 NM 021218.1 C9orf80 0.521 0.040
1305 - COL13A1 0.520 0.001
55193 NM 018313.2 PB1 0.520 0.002
3164 NM 173158.1 NR4A1 0.519 0.013
56986 NM 020234.3 MDS009 0.519 0.050
3990 NM 000236.1 LIPC 0.517 0.035
10846 NM 006661.1 PDE10A 0.516 0.047
11282 NM 054013.1 MGAT4B 0.516 0.022
219771 NM 181698.1 C10orf9 0.514 0.014
150763 NM 207328.1 GPAT2 0.514 0.023
5888 NM 002875.2 RAD51 0.512 0.015
26287 NM 020349.2 ANKRD2 0.512 0.003
138724 NM 203299.1 C9orf131 0.512 0.009
168975 NM 173538.1 FU35802 0.511 0.017
11193 NM 007187.3 WBP4 0.511 0.035
59307 NM 021805.1 SIGIRR 0.510 0.020
80144 NM 025074.3 FRAS1 0.509 0.003
197350 XM 113871.4 LOC197350 0.507 0.029
203111 NM 173549.1 FU39553 0.506 0.011
387535 - HCRP1 0.505 0.044
3225 NM 006897.1 HOXC9 0.501 0.028
170482 NM 130441.2 CLEC4C 0.500 0.031
23224 NM 015180.3 SYNE2 0.496 0.006
170959 NM 133473.1 ZNF431 0.496 0.018
1770 NM 001372.2 DNAH9 0.493 0.016
9330 - GTF3C3 0.486 0.002
57404 - CYP20A1 0.486 0.012
7050 NM 173207.1 TGIF 0.485 0.009
3603 NM 172217.1 IL16 0.484 0.008
6872 - TAF1 0.482 0.005
81796 NM 030958.1 SLC05A1 0.481 0.010
1544 - CYP1A2 0.480 0.027
51601 NM 145197.1 LIPTl 0.478 0.047
57096 NM 020366.2 RPGRIP1 0.478 0.024
54961 NM 017857.2 SSH3 0.477 0.018
84870 NM 032784.2 THSD2 0.477 0.019
51253 - MRPL37 0.477 0.002
 29967 - LRP12 0.477 0.023
8839 - WISP2 0.476 0.002
54964 NM 017860.3 C1orf56 0.475 0.003
1788 NM 022552.3 DNMT3A 0.475 0.017
8241 NM 152856.1 RBM10 0.473 0.025
23279 NM 015231.1 NUP160 0.473 0.002
79650 - FU13154 0.472 0.015
2139 NM 005244.3 EYA2 0.472 0.041
10896 NM 022375.2 OCLM 0.472 0.048
80086 NM 025019.1 TUBA4 0.472 0.034
85442 NM 033404.2 KNDC1 0.472 0.008
128025 NM 144625.2 WDR64 0.471 0.010
124540 - MSI2 0.471 0.031
65981 NM 001002259.1 C1QDC1 0.470 0.016
254013 - MGC50559 0.469 0.048
51199 - NIN 0.468 0.025
7932 NM 007160.2 OR2H2 0.467 0.018
7368 NM 003360.2 UGT8 0.467 0.022
55022 NM 017933.3 FU20701 0.467 0.024
11215 NM 144490.1 AKAPll 0.466 0.008
23658 NM 012322.1 LSM5 0.466 0.021
1956 NM 005228.3 EGFR 0.462 0.027
81491 NM 030784.1 GPR63 0.459 0.044
160728 NM 145913.2 SLC5A8 0.459 0.026
120406 - FAM55B 0.456 0.007
595 NM 053056.1 CCND1 0.455 0.049
57181 NM 020342.1 SLC39A10 0.453 0.018
7221 XR 000147.4 TRPC2 0.452 0.022
6718 NM 005989.2 AKR1D1 0.452 0.007
8701 NM 003777.2 DNAHll 0.452 0.013
3980 - LIG3 0.452 0.047
5939 NM 002898.2 RBMS2 0.449 0.024
11127 - KIF3A 0.448 0.014
255488 NM 182757.2 IBRDC2 0.447 0.008
26272 NM 012176.2 FBX04 0.445 0.022
158798 NM 178813.5 AKAP14 0.443 0.043
283298 NM 198474.2 OLFML1 0.443 0.012
22876 NM 198331.1 INPP5F 0.442 0.031
147841 NM 182513.1 SPBC24 0.441 0.007
5892 - RAD51L3 0.440 0.025
7442 - TRPV1 0.438 0.031
374659 NM 198527.1 MGC45386 0.437 0.040
51091 - SLA/LP 0.436 0.048
1770 NM 001372.2 DNAH9 0.435 0.048
3659 NM 002198.1 IRF1 0.435 0.034
27094 NM 171829.1 KCNMB3 0.435 0.010
7110 - TMF1 0.433 0.039
26154 NM 173076.2 ABCA12 0.433 0.015
57718 NM 058237.1 PPP4R4 0.432 0.007
2553 - GABPB1 0.430 0.016
 56242 NM 021047.1 ZNF253 0.429 0.015
64106 NM 022146.1 GPR147 0.428 0.021
152024 XM 379183.1 LOC152024 0.428 0.036
9463 - PRKCABP 0.428 0.046
4481 NM 138716.1 MSR1 0.424 0.033
28512 NM 020345.3 NKIRAS1 0.424 0.010
89884 NM 033343.2 LHX4 0.423 0.048
7337 - UBE3A 0.422 0.006
51105 NM 016018.3 PHF20L1 0.422 0.016
9824 NM 014783.2 ARHGAP11A 0.421 0.040
54442 - KCTD5 0.420 0.005
255061 - TAC4 0.418 0.015
2334 NM 002025.1 AFF2 0.418 0.006
2678 NM 013421.1 GGTl 0.417 0.005
166979 NM 152623.1 FU37927 0.415 0.013
2257 - FGF12 0.415 0.016
5067 XM 039627.10 CNTN3 0.414 0.035
93654 - ST7-AS2 0.414 0.013
2957 - GTF2A1 0.414 0.028
6934 - TCF7L2 0.413 0.028
220074 NM 145309.1 LRRC51 0.413 0.040
5793 NM 002841.2 PTPRG 0.412 0.018
116496 NM 052966.1 C1orf24 0.412 0.005
284723 NM 207348.1 SLC25A34 0.412 0.030
9552 NM 004890.1 SPAG7 0.410 0.012
11078 NM 138632.1 HRIHFB2122 0.410 0.034
80013 NM 024948.2 C10orf97 0.409 0.022
10559 - SLC35A1 0.408 0.031
55607 XM 371933.1 PPP1R9A 0.408 0.046
154661 NM 138290.1 RPIB9 0.408 0.024
80352 NM 025236.2 RNF39 0.408 0.038
126205 NM 176811.2 NALP8 0.407 0.046
55245 NM 018244.3 C20orf44 0.406 0.039
339400 - FLG-AS1 0.406 0.040
127255 NM 145258.1 LRRC44 0.405 0.014
26115 XM 371074.2 TANC2 0.405 0.012
9374 - PPT2 0.405 0.017
80070 NM 025003.2 ADAMTS20 0.405 0.021
51542 NM 001005739.1 VPS54 0.405 0.028
27430 NM 182796.1 MAT2B 0.404 0.010
4902 NM 004558.2 NRTN 0.404 0.008
3909 NM 198129.1 LAMA3 0.403 0.029
79815 NM 024759.1 NIPAL2 0.403 0.011
1827 - RCAN1 0.403 0.045
146223 NM 181521.1 CKLFSF4 0.403 0.027
56899 - ANKS1B 0.402 0.026
84067 NM 032127.1 FAM160A2 0.402 0.049
353174 NM 180990.2 LGICZ 0.402 0.011
93594 NM 145647.1 WDR67 0.402 0.026
3909 NM 198129.1 LAMA3 0.401 0.025
 636 NM 001714.2 BICD1 0.401 0.044
374907 NM 198540.2 B3GALT7 0.399 0.050
266977 NM 153840.2 GPRllO 0.399 0.048
65078 NM 023004.5 RTN4R 0.398 0.032
2900 NM 014619.2 GRIK4 0.397 0.031
9887 NM 173156.1 C1orf16 0.396 0.018
375601 - OR7E31P 0.396 0.026
168537 NM 153236.3 GIMAP7 0.394 0.005
152816 - C4orf26 0.394 0.021
58529 NM 021245.2 MYOZ1 0.394 0.030
639 NM 182907.1 PRDM1 0.392 0.017
114899 NM 181435.4 C1QTNF3 0.391 0.023
1912 - PHC2 0.390 0.006
219938 NM 174927.1 SPATA19 0.390 0.036
9043 NM 172345.1 SPAG9 0.389 0.009
116966 NM 181265.2 WDR17 0.389 0.027
1361 - CPB2 0.389 0.036
79686 NM 024633.2 Cl4orf139 0.388 0.028
7273 NM 133378.2 TIN 0.388 0.020
3773 NM 170742.1 KCNJ16 0.388 0.030
731 NM 000562.1 C8A 0.387 0.050
3755 - KCNG1 0.387 0.043
29062 NM 014149.2 HSPC049 0.387 0.032
114907 NM 148177.1 FBX032 0.386 0.016
55260 NM 018273.2 TMEM143 0.385 0.035
79675 NM 024622.2 FASTKD1 0.385 0.030
7273 NM 133378.2 TIN 0.384 0.022
80144 NM 025074.3 FRAS1 0.384 0.038
123775 NM 152337.1 C16orf46 0.383 0.042
79092 NM 024110.2 CARD14 0.383 0.012
54802 NM 017646.3 TRITl 0.383 0.038
1977 NM 001968.2 EIF4E 0.382 0.037
79258 NM 033467.2 MELL1 0.382 0.022
4617 NM 005593.1 MYF5 0.382 0.010
10570 - DPYSL4 0.381 0.013
1538 XM 088636.6 CYLC1 0.381 0.041
6758 NM 021015.3 SSX5 0.381 0.017
3805 NM 002255.3 KIR2DL4 0.381 0.044
3980 NM 002311.2 LIG3 0.380 0.036
9894 NM 016111.1 TEL02 0.380 0.035
158521 - FMR1NB 0.380 0.015
2140 NM 001990.2 EYA3 0.380 0.006
55758 NM 018254.2 RCOR3 0.379 0.013
23001 NM 178585.1 WDFY3 0.379 0.016
136371 NM 080871.2 ASB10 0.378 0.011
545 NM 001184.2 ATR 0.378 0.025
3841 NM 002269.2 KPNA5 0.378 0.011
27130 - INVS 0.377 0.030
11254 NM 007231.1 SLC6A14 0.377 0.039
22 NM 004299.3 ABCB7 0.377 0.046
148022 NM 182919.1 TICAM1 0.377 0.035
9177 NM 006028.3 HTR3B 0.376 0.033
152078 - C3orf55 0.375 0.032
4241 NM 033316.2 MFI2 0.375 0.032
375298 NM 201548.3 CERKL 0.374 0.016
79862 NM 024804.1 ZNF669 0.373 0.016
57409 NM 020679.2 AD023 0.372 0.032
4939 NM 002535.1 OAS2 0.371 0.026
7220 - TRPCl 0.371 0.026
4063 NM 002348.2 LY9 0.370 0.037
114814 - GNRHR2 0.370 0.029
2786 NM 004485.2 GNG4 0.369 0.013
3925 NM 203401.1 STMN1 0.369 0.045
55294 NM 018315.3 FBXW7 0.368 0.008
116092 NM 052951.2 DNTIIP1 0.368 0.009
8496 NM 003622.2 PPFIBP1 0.368 0.022
3431 - SP110 0.367 0.025
10599 NM 006446.2 SLC01B1 0.367 0.035
23234 NM 015190.3 DNAJC9 0.366 0.013
51599 NM 205834.2 LISCH7 0.366 0.039
1386 NM 001880.2 ATF2 0.365 0.011
1846 NM 057158.2 DUSP4 0.364 0.023
2626 NM 002052.2 GATA4 0.364 0.011
6772 NM 007315.2 STATl 0.364 0.021
1859 NM 130436.1 DYRK1A 0.364 0.023
64072 NM 022124.2 CDH23 0.364 0.021
84893 NM 032807.3 FBX018 0.363 0.030
22876 NM 014937.2 INPP5F 0.363 0.023
84617 - TUBB6 0.362 0.040
9092 NM 005146.3 SARTl 0.362 0.043
8853 - DDEF2 0.362 0.027
25843 - PREI3 0.361 0.017
79956 NM 024896.2 ERMP1 0.361 0.019
220594 NM 145809.1 USP32P2 0.360 0.028
23637 NM 012197.2 RABGAP1 0.360 0.020
81562 NM 030805.1 LMAN2L 0.359 0.006
1356 NM 000096.1 CP 0.358 0.044
10725 - NFAT5 0.357 0.049
286135 XM 379573.2 LOC286135 0.357 0.044
253143 NM 173566.1 PRR14L 0.357 0.024
132884 NM 147127.2 EVC2 0.357 0.035
257169 NM 152786.1 C9orf43 0.356 0.040
84069 NM 032129.1 PLEKHN1 0.356 0.010
8290 NM 003493.2 HIST3H3 0.356 0.032
9337 - CNOT8 0.356 0.049
974 NM 000626.1 CD79B 0.355 0.024
10782 NM 016325.2 ZNF274 0.355 0.047
80835 NM 138697.2 TAS1R1 0.355 0.032
10753 - CAPN9 0.355 0.044
26251 NM 012283.1 KCNG2 0.353 0.017
 55527 NM 018708.1 FEM1A 0.352 0.011
55821 NM 018436.2 ALLC 0.352 0.035
8863 NM 016831.1 PER3 0.351 0.047
64062 NM 022118.3 C13orf10 0.351 0.034
6873 NM 003184.2 TAF2 -0.350 0.007
81617 NM 030925.1 CAB39L -0.351 0.021
9465 NM 016377.2 AKAP7 -0.351 0.037
5923 NM 002891.3 RASGRF1 -0.353 0.016
9770 NM 014737.1 RASSF2 -0.353 0.021
22876 NM 014937.2 INPP5F -0.353 0.036
4200 NM 002396.3 ME2 -0.354 0.012
8749 NM 014237.1 ADAM18 -0.355 0.031
2068 - ERCC2 -0.356 0.036
84109 NM 198179.1 GPR103 -0.357 0.028
7593 NM 198055.1 ZNF42 -0.357 0.012
3234 NM 019558.2 HOXD8 -0.357 0.040
63036 NM 033440.1 ELA2A -0.357 0.045
94239 NM 138635.2 H2AFV -0.357 0.035
91120 - ZNF682 -0.359 0.019
54949 NM 017841.1 FU20487 -0.359 0.029
1056 NM 001807.2 CEL -0.360 0.027
57502 NM 020742.2 NLGN4X -0.360 0.028
55148 NM 018108.2 C14orf130 -0.360 0.012
91289 NM 033200.1 BC002942 -0.360 0.023
7699 NM 003440.2 ZNF140 -0.360 0.014
163183 NM 153233.1 FU36445 -0.361 0.019
80243 NM 025170.4 DEPDC2 -0.361 0.027
83546 NM 031429.1 RTBDN -0.361 0.034
472 NM 000051.2 ATM -0.361 0.041
1038 NM 004065.2 CDR1 -0.361 0.036
54207 NM 138318.1 KCNK10 -0.361 0.013
55967 NM 018838.3 DAP13 -0.362 0.025
9258 - MFHAS1 -0.363 0.009
29106 NM 013243.2 SCG3 -0.363 0.016
9899 NM 014848.2 SV2B -0.364 0.036
55156 NM 018120.3 ARMCl -0.364 0.035
130560 NM 139073.2 SPATA3 -0.365 0.021
25 NM 007313.2 ABL1 -0.365 0.035
1907 NM 001956.2 EDN2 -0.366 0.010
2694 NM 005142.2 GIF -0.366 0.017
29765 NM 013353.1 TMOD4 -0.367 0.034
283373 XM 370696.2 FU34236 -0.367 0.040
9645 NM 014632.2 MICAL2 -0.369 0.028
5933 NM 002895.2 RBL1 -0.369 0.048
127255 - LRRC44 -0.369 0.034
63941 NM 031232.2 APBA2BP -0.370 0.041
758 NM 001585.2 C22orf1 -0.370 0.045
51105 NM 032205.2 PHF20L1 -0.372 0.035
845 NM 001232.1 CASQ2 -0.374 0.014
1848 NM 001946.2 DUSP6 -0.374 0.019
 84295 NM 032458.2 PHF6 -0.374 0.036
55012 NM 017917.2 C14orf10 -0.375 0.044
7273 NM 133378.2 TIN -0.375 0.035
4756 - NE01 -0.375 0.017
23095 NM 015074.2 KIFlB -0.377 0.030
79658 NM 024605.3 ARHGAP10 -0.377 0.036
128646 NM 178460.1 PTPNS1L2 -0.378 0.044
27065 NM 014392.2 D4S234E -0.378 0.046
23060 XM 042833.8 ZNF609 -0.378 0.038
112802 NM 033448.1 KRT61RS -0.379 0.013
286046 NM 173683.2 C8orf21 -0.380 0.022
80741 NM 001002849.1 LY6G5C -0.381 0.011
60506 NM 022567.1 NYX -0.381 0.036
5222 NM 014224.1 PGA5 -0.381 0.045
64175 NM 022356.2 LEPRE1 -0.381 0.019
84239 NM 032279.2 ATP13A4 -0.382 0.013
146712 NM 194288.1 LOC146712 -0.382 0.033
143279 NM 182765.1 HECTD2 -0.382 0.034
399669 NM 203307.1 MGC35402 -0.382 0.044
64924 NM 022902.2 SLC30A5 -0.382 0.048
26154 NM 015657.3 ABCA12 -0.383 0.043
7052 NM 004613.2 TGM2 -0.383 0.048
55119 - PRPF38B -0.383 0.048
23624 NM 012116.2 CBLC -0.384 0.041
6932 NM 201633.1 TCF7 -0.384 0.037
90665 NM 134259.1 TBL1Y -0.384 0.043
3375 NM 000415.1 IAPP -0.385 0.048
63901 NM 198847.1 FU22794 -0.385 0.015
8100 NM 175605.2 TIClO -0.385 0.046
63027 NM 021945.4 C6orf85 -0.386 0.018
324 NM 000038.3 APC -0.386 0.010
114899 NM 181435.4 C1QTNF3 -0.386 0.027
55520 NM 018696.2 ELAC1 -0.387 0.014
55032 NM 017945.2 SLC35A5 -0.387 0.019
6772 NM 139266.1 STATl -0.387 0.023
51514 NM 016448.1 DTL -0.387 0.027
9941 - ENDOGL1 -0.387 0.007
22930 NM 012233.1 RAB3GAP -0.388 0.024
201163 NM 144997.4 FLCN -0.388 0.018
55773 - FU11046 -0.389 0.014
79712 NM 024659.2 GTDC1 -0.389 0.045
51703 NM 016234.3 ACSL5 -0.389 0.028
80339 NM 025225.2 ADPN -0.390 0.017
84436 NM 032423.2 ZNF528 -0.390 0.041
4058 NM 002344.3 LTK -0.390 0.045
6252 NM 021136.2 RTN1 -0.390 0.045
81035 - COLEC12 -0.391 0.010
8621 NM 031267.1 CDC2L5 -0.392 . 0.020
5897 NM 000536.1 RAG2 -0.393 0.029
3547 NM 001555.2 IGSF1 -0.394 0.035
 30819 - KCNIP2 -0.394 0.025
80709 - AKNA -0.394 0.006
79019 NM 001002876.1 C22orf18 -0.395 0.023
80178 - FU13909 -0.397 0.016
3781 NM 021614.2 KCNN2 -0.397 0.018
1656 NM 004397.3 DDX6 -0.398 0.011
361 NM 004028.3 AQP4 -0.398 0.050
202134 XM 371783.2 LOC389347 -0.399 0.032
10214 NM 021014.2 SSX3 -0.400 0.019
54798 NM 017639.2 DCHS2 -0.400 0.031
51562 - MBIP -0.402 0.037
2299 NM 012188.3 FOXI1 -0.405 0.029
56956 - LHX9 -0.405 0.048
11066 - U1SNRNPBP -0.405 0.007
93624 XM 291105.1 TADA2B -0.405 0.014
89231 XM 496860.1 DPY19L1P1 -0.406 0.033
157680 NM 017890.3 VPS13B -0.407 0.004
54581 NM 022050.2 SCAND2 -0.407 0.021
130120 NM 198448.2 REG3G -0.407 0.006
375719 - AQP7P1 -0.407 0.006
9057 NM 003983.3 SLC7A6 -0.408 0.041
3547 NM 001555.2 IGSF1 -0.408 0.028
4771 NM 181825.1 NF2 -0.408 0.010
9637 - FEZ2 -0.408 0.026
9963 NM 152685.2 SLC23A1 -0.409 0.006
26268 NM 033481.2 FBX09 -0.409 0.028
26122 NM 015630.2 EPC2 -0.409 0.025
55181 NM 018149.5 SMG8 -0.410 0.040
8287 - USP9Y -0.410 0.015
448835 - LCE6A -0.410 0.021
1841 NM 012145.2 DTYMK -0.412 0.029
51338 NM 024021.2 MS4A4A -0.413 0.012
27198 NM 032554.2 GPR81 -0.413 0.039
54906 XM 374765.2 C10orf18 -0.414 0.022
54904 NM 023034.1 WHSC1L1 -0.416 0.033
55075 NM 001008224.1 UACA -0.417 0.021
9156 NM 130398.2 EX01 -0.417 0.012
5886 NM 005053.2 RAD23A -0.417 0.042
10349 NM 080282.2 ABCA10 -0.417 0.030
10903 NM 181873.1 MTMR11 -0.418 0.035
6891 NM 000544.2 TAP2 -0.418 0.030
6872 NM 138923.1 TAF1 -0.419 0.040
5519 NM 181699.1 PPP2R1B -0.419 0.009
84106 NM 032152.3 PRAM1 -0.421 0.023
64601 - VPS16 -0.421 0.026
283820 - NOM02 -0.421 0.035
83850 NM 031913.1 FAM62C -0.421 0.034
2618 NM 000819.3 GART -0.421 0.022
80018 NM 024953.2 NAA25 -0.423 0.029
84132 - USP42 -0.423 0.032
 2744 NM 014905.2 GLS -0.423 0.048
23192 - APG4B -0.424 0.019
286205 NM 173690.1 C9orf126 -0.424 0.039
6815 - STYX -0.426 0.021
10842 NM 006658.2 C7orf16 -0.427 0.029
123263 NM 139242.2 MtFMT -0.428 0.039
54991 NM 017891.2 FU20584 -0.428 0.019
25852 NM 015396.3 ARMC8 -0.429 0.018
89777 NM 080474.1 SERPINB12 -0.429 0.026
51513 NM 016135.2 ETV7 -0.431 0.018
27022 NM 012183.1 FOXD3 -0.431 0.028
79442 NM 024512.2 LRRC2 -0.432 0.045
222962 NM 153247.1 SLC29A4 -0.432 0.006
117155 - CATSPER2 -0.432 0.043
10368 NM 006539.2 CACNG3 -0.432 0.011
79041 - TMEM38A -0.433 0.021
10933 NM 206839.1 MORF4L1 -0.434 0.028
10771 NM 212479.1 ZMYND11 -0.434 0.016
115362 NM 052942.2 GBP5 -0.435 0.027
925 NM 171827.1 CD8A -0.437 0.033
286103 XM 497002.1 C8orf77 -0.437 0.014
284340 NM 198477.1 CXCL17 -0.438 0.020
85465 NM 033505.1 SEU -0.438 0.031
5473 NM 002704.2 PPBP -0.438 0.009
5255 NM 002637.1 PHKA1 -0.439 0.016
3889 NM 002282.2 KRTHB3 -0.440 0.005
9986 - RCE1 -0.441 0.012
26628 NR 002163.1 OR7E37P -0.442 0.012
6752 NM 001050.2 SSTR2 -0.443 0.010
202020 NM 152684.1 FU39653 -0.444 0.002
25911 NM 015448.1 DPCD -0.444 0.048
27434 NM 013284.1 POLM -0.445 0.015
3269 NM 000861.2 HRH1 -0.445 0.017
6493 NM 005069.2 51M2 -0.446 0.017
411 NM 000046.2 ARSB -0.447 0.025
80758 NM 030567.2 PRR7 -0.447 0.048
56659 - KCNK13 -0.447 0.019
79022 - TMEM106C -0.448 0.006
288 NM 020987.2 ANK3 -0.448 0.013
22954 NM 012210.2 TRIM32 -0.450 0.006
4477 NM 002443.2 MSMB -0.450 0.029
7201 NM 003301.1 TRHR -0.452 0.030
5373 NM 000303.1 PMM2 -0.452 0.003
7020 - TFAP2A -0.455 0.017
256356 NM 152776.1 GK5 -0.456 0.012
115548 NM 138782.1 FCH02 -0.457 0.036
2100 NM 001437.1 ESR2 -0.457 0.024
55103 - RALGPS2 -0.459 0.024
55758 - RCOR3 -0.460 0.034
1545 NM 000104.2 CYP1B1 -0.463 0.026
 51184 NM 016301.2 GPN3 -0.464 0.019
84654 NM 032567.2 SPZ1 -0.465 0.044
26031 NM 015550.2 OSBPL3 -0.469 0.021
865 NM 022845.2 CBFB -0.470 0.021
51277 NM 016544.1 RBJ -0.470 0.015
60676 NM 020318.1 PAPPA2 -0.474 0.023
8829 NM 003873.3 NRP1 -0.475 0.017
1723 NM 001361.3 DHODH -0.476 0.006
143686 NM 144665.2 SESN3 -0.476 0.025
1111 - CHEK1 -0.476 0.048
1594 NM 000785.2 CYP27B1 -0.477 0.003
23549 - DNPEP -0.477 0.023
168002 NM 214462.1 DACT2 -0.478 0.014
144717 NM 144671.2 FAM109A -0.481 0.004
147699 NM 178494.2 PPM1N -0.482 0.009
22894 - 0153 -0.482 0.030
152687 NM 182524.1 ZNF595 -0.483 0.008
8556 NM 003672.2 CDC14A -0.484 0.006
83451 NM 148912.2 ABHD11 -0.486 0.050
114899 - C1QTNF3 -0.487 0.002
25809 - TTLL1 -0.488 0.026
767 NM 004056.4 CA8 -0.489 0.005
2322 NM 004119.1 FLT3 -0.489 0.038
10040 NM 005486.1 TOM1L1 -0.489 0.021
160857 NM 144974.1 CCDC122 -0.489 0.014
159989 - CCDC67 -0.490 0.012
203228 NM 018325.1 C9orf72 -0.494 0.010
5611 - DNAJC3 -0.494 0.007
10249 NM 201648.1 GLYAT -0.497 0.048
23001 NM 014991.3 WDFY3 -0.497 0.008
54845 NM 017697.2 ESRP1 -0.500 0.011
9833 NM 014791.2 MELK -0.506 0.027
51118 NM 016037.2 UTP11L -0.506 0.007
5276 NM 006217.3 SERPINI2 -0.508 0.026
81848 NM 030964.2 SPRY4 -0.510 0.008
150290 NM 152511.3 DUSP18 -0.510 0.003
54112 NM 022049.1 GPR88 -0.513 0.021
2888 - GRB14 -0.513 0.019
23504 - RIMBP2 -0.517 0.016
7013 - TERF1 -0.519 0.026
9847 - KIAA0528 -0.520 0.017
51061 NM 015914.5 TXNDC11 -0.526 0.007
201140 - DHRS7C -0.526 0.018
134957 NM 139244.2 STXBP5 -0.526 0.003
3785 NM 172109.1 KCNQ2 -0.527 0.012
54108 NM 017444.3 CHRACl -0.530 0.017
260434 NM 152901.1 PYDC1 -0.531 0.036
84874 NM 032788.1 ZNF514 -0.531 0.013
79666 NM 024613.2 PLEKHF2 -0.532 0.016
131450 - CD200R1 -0.533 0.014
 4211 NM 002398.2 MEIS1 -0.533 0.036
124626 NM 198844.1 ZPBP2 -0.538 0.016
26275 - HIBCH -0.544 0.024
2618 NM 000819.3 GART -0.546 0.001
1636 NM 000789.2 ACE -0.548 0.003
3688 NM 033668.1 ITGB1 -0.549 0.019
4771 NM 016418.4 NF2 -0.555 0.005
7083 NM 003258.1 TK1 -0.556 0.014
10655 NM 006557.3 DMRT2 -0.557 0.037
84141 NM 032181.1 FAM176A -0.559 0.020
114134 NM 052885.1 SLC2A13 -0.561 0.003
36 NM 001609.2 ACADSB -0.564 0.010
85440 NM 033407.2 DOCK7 -0.567 0.001
4684 NM 181351.1 NCAM1 -0.571 0.015
285704 NM 173670.2 RGMB -0.572 0.012
2568 NM 014211.1 GABRP -0.574 0.006
7319 NM 181777.1 UBE2A -0.585 0.003
10396 NM 006095.1 ATP8A1 -0.588 0.023
7556 NM 015394.4 ZNF10 -0.588 0.003
152330 NM 175607.1 CNTN4 -0.590 0.017
51283 NM 016561.1 BFAR -0.590 0.036
89866 - LZTR2 -0.591 0.015
2257 - FGF12 -0.593 0.049
166378 NM 145207.1 SPATA5 -0.594 0.005
79672 NM 024619.2 FN3KRP -0.595 0.005
3196 NM 001534.2 TLX2 -0.595 0.002
80309 - SKIP -0.600 0.008
2235 NM 001012515.1 FECH -0.603 0.015
51444 NM 198128.1 RNF138 -0.605 0.021
145173 - B3GTL -0.606 0.002
9718 NM 014693.2 ECE2 -0.610 0.034
50839 NM 023921.1 TAS2R10 -0.618 0.003
11080 NM 007034.3 DNAJB4 -0.618 0.040
140803 NM 017662.3 TRPM6 -0.619 0.026
387837 - CLEC12B -0.626 0.002
7499 NM 175569.1 XG -0.627 0.006
1956 NM 005228.3 EGFR -0.632 0.033
8291 NM 003494.2 DYSF -0.638 0.008
221756 XM 376463.2 MGC39372 -0.640 0.011
54810 NM 017655.4 GIPC2 -0.650 0.021
26127 - FGFR10P2 -0.652 0.024
54751 NM 001024216.1 FBLIM1 -0.659 0.044
10863 - ADAM28 -0.665 0.007
284402 XM 378794.1 SCGB2B2 -0.668 0.013
23483 NM 014305.1 TGDS -0.673 0.005
9923 NM 014870.2 ZBTB40 -0.696 0.001
114879 NM 020896.2 OSBPL5 -0.708 0.028
57827 NM 021184.3 C6orf47 -0.710 0.019
143425 NM 175733.2 SYT9 -0.736 0.025
91807 NM 182493.1 MLCK -0.739 0.034
63892 NM 022065.3 THADA -0.746 0.016
1757 NM 007101.2 SARDH -0.813 0.017
253018 - HCG27 -0.829 0.048
80019 NM 024954.3 UBTD1 -0.867 0.029
9923 - ZBTB40 -1.023 0.017
23163 NM 138619.1 GGA3 -1.112 0.036
199699 NM 152654.1 DANOS -1.131 0.049
285033 XM 379111.2 LOC285033 -1.135 0.031
 ANEXO IV

ARTCULO ENVIADO A CANCER RESEARCH

Low abundance transcrptome analyses identifes novel markers, specific intracel/ular

pathways and target genes in advanced human gastrointestinal cancer

224
Manuscript Home Author Instructions Revlewer Instructions Help Tips Logout Joumal Home

Detailed Status lnfonnation

IManuscript # jcAN-12-3474
o
!j:l012-09-lll0:46:23- -- ---- _.. _ - ---- --
lsubmission Date
lcurrent Stage
i'Low abundance transcriptome analyses identifies novel markers1 specific
. Title _ __ 'intracellular pathways and target genes in human advanced human
... . . ... _ gastrointestinal cancer . _ __
IRunning Title ;jLo~abund~nce-tr~nscriptome in gast;i-cand col~n cancers
-l~~ot_a_n-_u_s_c-=.!-_ipt-.-
.._-T-y~p-e~.---,.[Res~arch Article_ _ __ .. _ . .
IC:CSteg()ry :jTheraPE!!Jtics1 Jarget?l_lf1d_C:t1ef11ical l3iQiogy
Carolina Bizama and Felipe Benavente contributed equally to this work.
Manuscript Comment
Osvaldo Podhajcer and Manuel Gidekel both are corresponding authors.

Dr. Carolina Bizama 1 Dr. Felipe Benavente 1 Dr. Jaime A. Espinoza 1 Dr.
Contributing Authors Edgardo Salvatierra 1 Dr. Hilda A. Gutirrez 1 Dr. Elmer Fernndez, Mr.
Eduardo A. Sagrec!g 1 Mr.}vr:tRoa, Qr. Manuel. Gidekel_ . . __ ____ __ __ _
. Studies on the low abundance transcriptome are of paramount importan ce to
identify the intimate mechanisms of tumor progression. By using subtractive
hybridization followed by transcriptome analysis of human samples obtained
~ from gastric and colon cancer and paired adjacent non-cancerous tissues we
: identified novel cancer biomarkers such as LAMA3 and TfN 1 highly specific
intracellular pathways and gene targets such as IR52 1 IL17 1 IFNy 1 VEGF-C,
Abstract
WISP1 1 FZD5 and CfBPl that were not detectable by direct transcriptomic
analyses. Knocking down the expression of CTBPl sensitized gastric cancer
cells to 5-FU, cisplatin and epirubicin that are part of the mainstay repertoire
for gastric cancer treatment. The use of these affordable combined platforms
might have important implications in the understanding and treatment of
: cancer.
'In search for novel markers and therapeutic targets we applied a combined
strategy of subtractive hybridization followed by transcriptomic microarrays
: analysis to study the low abundance transcriptome of gastric and colon cancer
, Prcis
: samples obtained from patients at advanced stages of the disease. Cancer type
specific- signaling pathways and unique genes were identified that could
i serve as targets for potential clinical application.

tu~~;:=o~fi~~cf ~t!y;~;cfs'ILo~ ~b~ ~dan_ce:_t~~;_s~;pto rT1~~. s~btr~~ti~~ ~U[>P~t!~~i o~ h'J'~i~i-~ltiQF1;:6~f'i

_Gastrointestinal cancers: colorectal, __Gastrointestinal cancers:
stomach, __Signa! transduction, CB CELLULAR, MOLECULAR, AND TUMOR
iiKeywo<ds . BIOLOGY, __ Signa! transduction pathways, __Gene expression profiling,
=-Functiof1_l_l genomics, New targets _. _
Ves

PhD. Osvaldo L. Podhajcer. Member number 75447 .

....

225
 Do you confrm that nether this paper nor any similar paper, in whole orn
part, other than abstract or prelminary communication, has been or will be
submtted to or published elsewhere?

Dual Publication Yes

If no, please explain why below.:

Do you declare that authorization has been given to use any information
conveyed by either personal communication or release of unpublshed
experimental data?
Information
Yes
Authorization

f no, please explan be!ow.:

Disclosure of Chemical
Structures
ell Line
uthentication

Awaiting Submsson PayrT}er~ [i()i?~()~~Q~j~ji:42

)M<ll1t1S(:~ipt $Ubn1SSi()l1 m mi!?9~?~Q?~?9 .11,: 55:24

14anusr.:ript Heme 1 Author !nstructions 1Reviewer Jnstrvctions 1 Help 1 Logout 1Joumal Home
Terms of Serv ce UCensed under Patent #US 7,520,55561

226
 Page 1
Low abundance transcriptome analyses identifies novel markers, specific intracellular pathways and

target genes in human advanced human gastrointestinal cancer

Authors and Affiliations: Carolina Bizama, 1,7 Felipe Benavente, 1' 7 Jaime A. Espinoza, 1 Edgardo

Salvatierra, 2 Hilda A. Gutirrez, 1 Elmer A. Femndez, 3 Eduardo A. Sagredo,4 Ivn Roa, 5 Guillermo

Mazzolini, 6 Manuel Gidekel, 1' * and Osvaldo L. Podhajcer2,*.

1
Applied Cellular and Molecular Biology PhD Program, Agricultura! and Forestry Sciences Faculty. La

Frontera University, Temuco, 4811230, Chile.

2
Laboratory of Molecular and Cellular Therapy, Fundacin Instituto Leloir-CONICET, Buenos Aires,

C1405BWE Argentina.
3
School of Engineering, Intelligent Data Analysis Group, Catholic University of Crdoba, X5016DHK

Crdoba, Argentina.
4
Biotechnology Program, Agricultura! and Forestry Sciences Faculty, La Frontera University, Temuco,

4811230, Chile.
5
Pathology Service, Clnica Alemana de Santiago, Faculty of Medicine, Universidad del Desarrollo,

Santiago, 7650568, Chile.

6
Gene Therapy Laboratory, School of Medicine, Austral University, Pilar-Buenos Aires, B1664INZ ,

Argentina.
7
These authors contributed equally to this work.

Running Title: Low abundance transcriptome in gastric and colon cancers

Keywords: Low abundan ce transcriptome, subtractive suppression hybridization, CTBP l.

*Corresponding authors: Osvaldo L. Podhajcer, Laboratory of Molecular and Cellular Therapy,

Fundacin Instituto Leloir, Buenos Aires, Argentina, C 1405BWE. Phone: +54-11-52387500 int31 07; Fax:

+54-11-52387501; E-mail: opodhajcer@leloir.org.ar. Manuel Gidekel, Av. Alvaro Casanova 4090,

Pealoln, Santiago, 7941068. Phone: +56-999970216; E-mail: mgidekel@gmail.com.

 Page2
Word account (excluding references): 4977. This research article includes six principal figures and two

tables. The supplementary information includes four figures, three tables and supplemental experimental

procedures.
 Page 3
Abstract
Studies on the low abundan ce transcriptome are of paramount importance to identizy the intimate

mechanisms of tumor progression. By using subtractive hybridization followed by transcriptome analysis

of human samples obtained from gastric and colon cancer and paired adjacent non-cancerous tissues we

identified novel cancer biomarkers such as LAMA3 and TIN, highly specific intracellular pathways and

gene targets such as IRS2, IL17, IFNy, VEGF-C, WISPI, FZD5 and CTBPI that were not detectable by

direct transcriptomic analyses. Knocking down the expression of CTBPI sensitized gastric cancer cells to

5-FU, cisplatin and epirubicin that are part ofthe mainstay repertoire for gastric cancer treatment. The use

of these affordable combined platforms might have important implications in the understanding and

treatment of cancer.
 Page4
Introduction

Each year worldwide, more than 2 million people are diagnosed with gastric and colon cancer and

more than 1,3 million people die of both diseases, representing ~ 17% of cancer mortality globally (1 ).

Despite advances in diagnostic imaging that improved early detection of gastric and colon cancer advanced

stages ofboth diseases have still a poor prognosis (2). Recent advances in stratified medicine has improved

response in advanced colorectal carcinoma patients treated with the EGFR targeted antibody cetuximab or

panitumumab and in gastric cancer patients expressing the HER2 receptor treated with trastuzumab (3);

but even in those cases resistance develops rapidly, the benefit is transient and most of these individuals do

progress eventually (4).

Increasing evidence suggests that low abundance transcripts may play fundamental roles in

biological processes. A challenge in functional genomics applied to human diseases and in particular to

cancer research is to identify the expression profile of the low abundance transcriptome in cancerous

tissues as a potential source of tumor-specific genes with potential diagnostic or therapeutic uses.

Microarrays platforms were very helpful in the identification of differentially expressed genes between

cancer and non-cancerous adjacent tissue. However, direct screening of human tissues highlighted mainly

transcripts related to cytoskeleton, cell-ECM interaction, cell cycle, focal adhesion contacts and other gene

ontology groups that clearly represented highly abundant transcripts (5-6). It became clear that microarray

analysis did not provide sufficient sensitivity to measure low abundance transcripts reproducibly (7). PCR-

based suppressive subtractive hybridization technique is a highly sensitive platform identifying variations

in gene expression. Subtractive hybridization equalizes the abundance of cDNA within the target samples

enriching low abundance and rare transcripts (8-9). Transcript detection and coverage can be significantly

increased by coupling the initial subtraction to gene expression microarrays platforms. This approach has

been applied and methodologically validated to cancer research to systematically identify tumor-specific

transcripts that are not identified by conventional microarrays analysis (1 0-12).

 Page 5
Identification of low abundan ce transcripts can be a so urce of potential diagnostic and therapeutic

targets. Here we applied subtractive hybridization followed by microarray analysis to identify tumor

specific, low abundance transcripts that were differentially expressed in human gastric and colon

adenocarcinomas compared with their paired adjacent non-cancerous tissues. The vast majority ofthe low

abundant differentially expressed transcripts the cancer type-specific signaling pathways were not detected

when a direct microarray analysis was performed, leading to the identification of novel biomarkers and

gene targets aberrantly expressed in cancer samples. Further functional studies identified CTBPl as a

novel target to sensitize gastric cancer cells to chemotherapeutic drugs.

Material and Methods

Clinical Samples

Samples were obtained from the Hospital Temuco Tumor previous approval of the Ethics

Committee Bank and corresponded to patient that signed informed consent or following a previous step of

anonymization in deceased patients. Cancerous and adjacent non- cancerous tissues were obtained from

twelve patients with advanced gastric adenocarcinoma and ten patients with advanced colon

adenocarcinoma who did not receive adjuvant therapy prior. Collected tissues were preserved immediately

in RNALater (Ambion Inc, Austin Tx, USA) and stored at -80C until used. Befare RNA extraction

samples were histologically analyzed to confirm malignancy.

Suppression subtractive hybridization (SSH)

Total RNA was extracted with Trizo! reagent (Invitrogen, Carlsbad, CA, USA), followed by RNA

purification using RNeasy mini kit columns (Qiagen, Hilden, Germany) according to the manufacturer's

instructions. Human Universal Reference RNA and normal gastric and colon RNAs were purchased from

Clontech (Palo Alto, CA, USA). Total RNA (l..tg) was used for first strand synthesis using Super SMART

PCR cDNA Synthesis kit (Clontech, Palo Alto, CA, USA) and SuperScript III Reverse Transcriptase
 Page 6
(Invitrogen, Carlsbad, CA, USA) following the supplier' s protocol. Subtractive hybridization was

performed with the aid of the Clontech PCR-Select cDNA Subtraction Kit (Clontech, Palo Alto, CA,

USA). A customized primer 1 was designed to keep the T7-promoter region in the 5'end ofthe subtractive

amplicon (5'- CTAATACGACTCACTATAGGGCTCGAGCGGCC-3') in the secondary PCR. The in

vitro transcription of the secondary product was generated a single antisense RNA of the differentially

expressed genes that can be subsequently analyzed with the oligonucleotide arrays. Details are provided in

the Supplemental Experimental Procedures.

Microarray gene expression analysis

We used the 48.5K Exonic Evidence Based Oligonucleotide (HEEBO) arrays purchased from

Microarray Inc. (Nashville, TN, USA) based on a probe set designed by Illumina (San Diego,

http://www.illumina.com) and Stanford University. A detailed description of these arrays and protocols

can be found (http://microarray.org/sfgf/heebo.do). Normalization was performed in R statistical

environment using Limma pachage (www.r-proyect.org). The raw data have been deposited in the Gene

Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/projects/geo/) under accession number

GSE38940 and subseries GSE38932, GSE38939. Differentially expressed gene lists were tested for

enrichment using the NIH database annotation, visualization and integrated discovery (DAVID) v6.7

analysis (13). The expanded list obtained from the indirect strategy was analyzed with PANTHER (protein

analysis through evolutionary relationships) Classification System for pathways enrichment (14).
 Page 7
Results

Validation ofthe subtractive procedure before microarrays analysis .

The aim of this study was to identify differentially expressed genes between paired cancerous and

adjacent non-cancerous tissues using suppression subtractive hybridization followed by microarrays

analysis. This indirect strategy was compared with the differentially expressed genes obtained after direct

microarrays analysis of the same samples. HEEBO microarrays were used that contain 44,544 70-mer

oligonucleotide probes, representing approximately 30,718 unique genes. Por subtraction experiments,

cDNAs from each cancer sample or its paired adjacent non-cancerous tissue were used separately as tester

while cDNAs obtained from normal gastric or colon tissue RNA were used as driver. Twenty four

independent runs in gastric tissues and twenty in colon tissues were performed on the twelve gastric cancer

samples and the ten colon cancer cDNAs and their paired adjacent non-cancerous tissue, respectively.

Comparison of both approaches was possible because the transcripts with or without previous subtractive

hybridization were prepared individually and hybridized in a similar HEEBO microarray against an aRNA

obtained from a Universal Reference (Fig.l).

The subtraction efficiency was confirmed by an average decrease of 50% in the expression levels of

100 housekeeping selected probes following the subtraction step (data not shown). Additionally, we

confirmed the decreased expression ofG3PDH, QARS, TBP and UBE2D2 by qRT-PCR (data not shown).

Most of the genes that were identified in the indirect strategy showed expression values near zero in the

direct one confirming the enrichment of low abundance transcripts using a previous subtractive

hybridization (data not shown). The differentially expressed genes corresponding to gastric and colon

cancer as well as the function and the biological process in which they are involved are depicted

(Supplementary Table S 1).

 Page 8
Identification oflow abundance cancer-associated transcripts

In gastric cancer, a total of 119 differentially expressed genes were detected by direct microarray

analysis, 81 up-regulated and 38 down-regulated (absolute fold change > 1.2, P value < 0.05). Whereas,

149 differentially expressed genes, 59 up-regulated and 90 down-regulated genes (absolute fold change >

1.5 and P value < 0.05) were identified using the indirect strategy. Only three down-regulated genes were

detected by both strategies (Fig. 2A and data not shown). In colon cancer, 103 differentially expressed

genes, 78 of them up-regulated and 25 down-regulated (absolute fold change > 1.2, P value < 0.05) were

detected with the direct strategy; whereas 67 differentially expressed genes were obtained with the indirect

strategy, 40 up-regulated and 27 down-regulated (absolute fold change > 1.3, P value < 0.002). Only 7 up-

regulated genes and 2 down regulated genes were detected by both strategies (Fig. 2B and data not shown).

Following the direct strategy, we found 13 transcripts shared by colon and gastric cancer including

TGFBI, THIL, CSEIL, CLDNI, XRN2, EST_AA911832, PMEPAI, LAMP2, LACTB2, NAT5, PPAI and

ZF that were up-regulated in the cancer samples and PKIB that was down-regulated. Only two transcripts

were shared between the two cancer types following the indirect approach, FCGBP and CA2, indicating

that the low abundance transcriptome is slightly more specific of each cancer type. Clustering analysis

demonstrated that the sets of differentially expressed genes (obtained either from the direct or indirect

strategies) were able to segregate cancer from non-cancerous samples with perfect accuracy

(Supplementary Fig. S 1).

Further qRT-PCR analyses validated 88% (22/25) and 90% (27/30) ofthe genes obtained with the

direct strategy in gastric and colon cancer, respectively (Fig. 2C andE). qRT-PCR analyses also validated

70% (14/20) and 68.4% (13/19) of the genes obtained with the indirect strategy in gastric and colon

cancer, respectively (Fig. 2D and F). Overall, these results indicate that the data obtained from the indirect

strategy is robust since the vast majority of differentially expressed genes were validated by qRT-PCR.
 Page 9
Tissue Microarrays validation of differentially expressed transcripts

In order to further validate the direct microarrays data we performed tissue microarrays analysis

(TMA) of RCC2 (regulator of chromosome condensation 2) that was differentially expressed in gastric

cancer and JPH1 (Junctophilin 1) that was differentially expressed in colon cancer. RCC2 protein

expression was assessed in a cohort of 39 paired primary gastric cancer samples with adjacent non-

cancerous gastric tissue and 5 normal gastric tissues. Most gastric cancer samples showed high to moderate

staining of RCC2 protein (Fig. 3A) compared to the moderate to low staining intensity in adjacent non-

cancerous tissue (Fig. 3B). Normal gastric tissue exhibited low to complete absence of RCC2 expression

(Fig. 3C). Almost 70% of gastric cancer samples (28/39) showed increased expression levels of RCC2

compared to the adjacent non-cancerous tissues (Supp1ementary Fig. S2A and data not shown). As a

who1e, cancer samples exhibited more than 2-fo1d increased RCC2 expression compared to adjacent non-

cancerous samples (P < 0.0001; Fig. 3D). In addition, more than 30% of cancerous samples exhibited al so

nuclear staining compared to on1y 7% ofthe adjacent tissues (Supp1ementary Fig. S2B). Interestingly, the

nuclear staining in adjacent non ma1ignant epithe1ia1 cells was observed in the highest proliferative region

of the gastric mucosa and in signet-ring cells present in the diffuse subtype of gastric cancer

(Supplementary Fig. S2C and S2D).

JPH1 analysis was performed in 46 paired primary colon cancer tissues, their respective non-

cancerous adjacent tissues and 8 normal colon tissues. Seventy percent of cancer samples (32/46) exhibited

higher expression 1evels of JPH1 compared to their non-cancerous paired tissue (Fig. 3E and F;

Supplementary Fig. S2E and data not shown). Moreover, a1most 95% of adjacent non-cancerous samples

and all normal colon tissues exhibited none to low JPH1 expression 1eve1s (Fig. 3F and 3G; Supplementary

Fig. S2E). As a who1e, colon cancerous samples exhibited in average 2-fold increased expression 1evels of

JPH-1 compared to adjacent non-cancerous tissues (P < 0.0001; Fig. 31!). Interestingly, the two cases of

signet-ring cell tumor availab1e showed negative JPH1 staining (Supplementary Fig. S2F).
 Page 10
To validate the information obtained by the indirect strategy, we performed TMA analysis on two

previously unexplored genes in gastric cancer: LAMA3 (Laminin alpha 3) a subunit of laminin 5 with

essential roles in cell adhesion and motility (15) and TTN (Titin), also known as connectin, that is

responsible for the passive elasticity of muscle and has been reported as a potential melanoma biomarker

(16-17). The expression ofLAMA3 was analyzed in 37 paired primary gastric cancerous tissues with their

respective adjacent non-cancerous tissues and 5 normal gastric tissues. Eighty four percent of malignant

samples (31/37) showed increased LAMA3 intracytoplasmic staining compared to its non-cancerous

counterpart (Fig. 4A and B; data not shown). Of note, 95% of the non-cancerous samples and all the

normal gastric samples exhibited negative staining while almost 60% of cancerous tissue exhibited

moderate to high Ievels (Fig. 4C). As a whole, gastric cancer samples exhibited in average 17-fold

increased expression levels ofLAMA3 compared to adjacent non-cancerous tissues (P < 0.0001; Fig. 4D).

The expression of TTN was studied in 35 paired primary gastric cancer tissues compared to their

respective adjacent non-cancerous one and in 5 gastric normal samples. Moderate to high intensity ofTTN

staining was observed in more than 60% of cancer samples (Fig. 4G) compared to less than 40% of

samples in non-cancerous adjacent tissues (Fig. 4E, F, G and H). In addition 5/6 samples ofnormal tissues

showed low or none TTN staining (data not shown). Moreover, 63% ofmalignant gastric samples (22/35)

expressed increased TTN expression compared to their respective adjacent non-cancerous tissues (data not

shown). Mostly important, the moderate and strong staining intensity ofTTN in non-cancerous tissues was

observed in areas of intestinal metaplasia, a pre-malignant lesion involved in gastric carcinogenesis (Fig.

41).

Both strategies enrich different gene ontologies terms and pathways

The differentially expressed genes were further analyzed for enrichment of gene ontology terms

(GO) and pathways, using the functional annotation clustering classification tool ofDAVID v6.7 database.

The main functional categories enriched in gastric cancer using the direct strategy included processes
 Page 11
associated to cell interaction with the surrounding stroma such as collagen; extracellular matrix; integrin

binding; cell adhesion; and growth factor binding (Supplementary Table S2). Interestingly, in the indirect

strategy the mostly enriched groups corresponded to genes involved in detection of biotic stimulus,

regulation of cell migration, ion binding, cell recognition and adaptive immune response (Supplementary

Table S2). Using the DAVID Pathway Viewer, a short list of significantly enriched pathways was obtained

that strongly differed between the direct and the indirect strategies. In close coincidence with the enriched

functional categories, the differentially expressed genes detected by the direct strategy in gastric tissues

were enriched in four pathways related to cell interaction with the ECM: integrin signaling pathway, ECM-

receptor interaction, Gap junction and Focal adhesion. Interestingly, the genes detected by the indirect

strategy were enriched along two main pathways: PB kinase pathway and calcium signaling pathway that

were not detected by the direct strategy (Supplementary Table S2).

We performed a similar analysis in colon cancer that, with the exception of certain groups such as

regulation of cell adhesion, rendered data clearly different from that obtained with gastric cancer. The

enriched functional categories obtained with the direct strategy in colon cancer involved mainly purine

biosynthetic process, regulation of protein ubiquination, cell death and cell cycle (Supplementary Table

S2). On the other hand, the indirect strategy highlighted genes involved in mitosis, response to organic

substance, protein transport and extracellular region. Furthermore, the colon cancer genes detected by the

direct strategy were enriched in three pathways: cell cycle, de novo purine biosynthesis and DNA

replication. In contrast, genes detected by the indirect strategy were enriched along two pathways:

Parkinson's disease and antigen processing and presentation (Supplementary Table S2). Thus, we found

substantial differences in the biological functions and signaling pathways represented in the differentially

expressed genes detected by both strategies indicating that the major pathways involved in these two

cancer types appear essentially different (see below).

 Page 12
The indirect strategy highlighted cancer type-specific signaling pathways

We performed an additional pathway enrichment analysis with the PANTHER database using an

expanded list of differentially expressed genes obtained with the indirect strategy in gastric cancer. For this

aim, we selected genes with > 1.3 absolute fold change and p-value < 0.05. Following this criterion,

enrichment analysis of the 408 up-regulated and 335 down-regulated genes in gastric cancer highlighted

discrete intracellular signaling pathways. U sing a similar cutoff of p-value for enriched pathways, analysis

of colon cancer samples highlighted intracellular pathways that differed from those observed in gastric

cancer tissue (Table 1). The differences between gastric and colon cancer-enriched signaling pathways

were seen even at the level of single gene analysis; despite the fact that the integrin, apoptosis and

hedgehog signaling pathways were highlighted both in gastric and colon cancer, no single gene was

shared between both tumor types (Table 2).

For a more detailed analysis of the enriched pathways, we conducted gene expression analysis on

custom designed PCR arrays consisting ofgenes involved in the Wnt/Hedgehog, PBK/AKT, Angiogenesis

and BIT cell activation pathways. Four samples of gastric cancer and their paired adjacent non-cancerous

tissue were used to assess mRNA expression levels of the different genes associated with the specific

pathways. The relative fold change of each gene in the cancer tissue was expressed in relation to their

paired adjacent tissue; only those genes with an average differential fold expression value >2.0 were

included. The data demonstrate that most of the genes in the different pathways were overexpressed with

only few genes showing down-regulated expression (Fig. 5A and D).

It was interesting to see an increased expression ofwnt/hedgehog pathway-associated genes such as

Wnt-1 induced secreted protein 1 (WJSPJ), protein patched homolog 1 (PTCH), e-terminal of E1A

binding protein (CTBP 1) and secreted frizzled-related protein 4 (SFRP4); moreover, among all the family

of FZD receptors we observed a remarkable expression of frizzled family receptor 5 (FZD5) and its ligand

Wnt5 (Fig. 5A). In the PBK pathway we observed a striking overexpression of insulin receptor substrate 2

(IRS2) and the down regulation of IRSJ and IRS4. We could also observe a clear overexpression ofprotein
 Page 13
kinases such as PIK3C2B, PIK3CD, PRKCA, PRKCG and AKTJ, the protooncogen ABL1 and the insulin-

like growth factors IGF1, IGF2 and epidermal growth factor receptor (EGFR) (Fig. 5B). Regarding

angiogenesis, the lymphoangiogenesis promoter vascular endothelial growth factor C (VEGF-C), the

interleukin 8 (IL8), the inhibitor of DNA bind 2 (ID2) and the neurophylin 1 (NRP 1) were notably

upregulated in gastric cancer samples compared to adjacent non-cancerous tissue (Fig. 5C). It was also

remarkable that the two genes that exhibited the largest levels of expression in the T cell and B cell

activation pathway in gastric cancer corresponded to two inflammatory cytokines such as IL17B and IFN-

gamma (Fig. 5D). Thus, the overall data identified only few specific genes that might be responsible for

leading the aberrant activity of each signaling pathway.

One of the overexpressed genes, CTBP1 was further analyzed since no previous evidence

associated its hyper-expression with gastric cancer. CTBP is a nuclear protein that associates with histone

deacetylases and binds to chromatin but may also function as a transcriptional co-repressor that interacts

with adenoviral E1A (18). In both cases it is involved in the regulation ofthe transcriptional status ofthe

cell. CTBP1 was found to be expressed by the six gastric and colon cancer celllines analyzed (Fig. 6A and

Supplementary Fig. S3). Targeting CTBP1 expression with a specific siRNA reduced mRNA and protein

levels in gastric cancer cell lines by almost 80% (Fig. 6B and C). Decreased expression of CTBP1

following transient siRNA expression in gastric cancer cells inhibited their clonogenic and migration

capacity (Fig. 6D andE).

In addition to the regulation of the transcriptional activity, CTBP1 has been shown to sensitize

certain malignant cell lines to the genotoxic effects of chemotherapeutic drugs such as 5-FU through

mechanisms associated either with apoptosis or modulation ofMDR1 levels (19). Therefore, we decided to

target gastric cancer cells with the siRNA to CTBP1 followed by cells exposure to chemotherapeutic drugs

under current use in gastric cancer treatment. We observed a highly remarkable chemosensitizing effect

when gastric cancer cells expressing reduced levels of CTBP1 dueto siRNA expression were treated with

the different drugs. 5-FU had an IC50 of 29.4 ~M and 11.8 ~M in the presence of control siRNA in AGS
 Page 14
and MKN45 gastric cancer cells, respectively (Fig. 6F). Treatment with the specific anti-CTBP1 siRNA

followed by the addition of 5-FU reduced significantly the IC50 to 5.6 flM and 1.9 flM in AGS and

MKN45 cells, respectively (Fig. 6F). The genotoxic agent cisplatin and the anthracycline epirubicin are

also part of the mainstay treatment in gastric cancer. Interestingly, treatment of gastric cancer cells with

cisplatin significantly reduced the IC50 of MKN45 cells from 10.7 J.!M to 2.5 flM and that of AGS cells

from 11.2 flM to 2.6 J.!M while epirubicin treatment reduced the IC50 of AGS cells from 0.07 flM to 0.005

flM and that ofMKN45 from 0.06 flM to 0.005 flM (Fig. 6F).

Discussion

One of the main limitations of global gene expression analysis is the identification of the low

abundance transcriptome. This is of paramount importance in cancer research since subtle changes in gene

activity of few genes could lead to malignant transformation and tumor dissemination. In this work we

demonstrate that the combined use of subtractive hybridization followed by microarrays analysis identified

novel genes that could serve as markers of the disease. Mostly important, these combined strategy led to

the identification of specific intracellular signaling pathways, their leading genes and potential novel

targets for improving treatment of advanced gastric and colon cancer. To our knowledge this is the first

study that makes use of the combination of subtractive hybridization and microarrays to identizy the low

abundance transcriptome in advanced human gastric and colon cancer.

Previous studies that combined suppressive subtractive hybridization with microarrays used the

cDNA clones obtained after subtraction as probes printed in the array to screen malignant tissues such as

breast (20-22), prostate (23), lung (12, 20, 24) and colon (25) cancer. These studies identified novel

biomarkers and potentially new targets that were not identified by common gene expression analysis.

However, the main drawback was that the results were directly dependent on the signal level of the target

sequences rather than the probes and the strategy was quiet ineffective for detecting genes with low

expression levels. In this work we used the subtracted product as the target sequence, thus avoiding losing
 Page 15
the original molecular complexity of tissue samples and eliminating the need for further library

construction for the subsequent identification by sequencing of differentially expressed genes (10). Thus,

by using suppressive subtractive hybridization followed by microarrays analysis we were able to found

differentially expressed low abundance transcripts that would have not been detected as differential by

direct microarrays analysis.

Consistent with prevwus data (5-6, 26) direct transcriptome analysis identified genes with

biological functions mainly associated with cell-ECM interaction and immune response, and genes

associated with cell cycle in colon cancer. We validated by TMA two novel genes that were not previously

associated with gastric and colon cancer, RCC2 and JPH1, respectively. RCC2 role was associated with

fibronectin-dependent cell adhesion and cytokinesis (27-28). Consistent with the assigned roles for RCC2

we observed its expression both in the cytoplasm and nucleous of gastric cancer samples. Further

preliminary studies demonstrated that knockdown of RCC2 expression in AGS gastric cancer cells using a

specific siRNA led to almost 50% inhibition of tumor cell migration (Supplementary Fig. S4) while cell

proliferation and clonogenicity were not affected. The present data also showed that JPH1 Gunctophilin 1)

a gene associated with Ca2+ signaling, was overexpressed by more than 70% of colon cancer samples;

interestingly, JPH1 appeared in a profile of genes highly related to sensitivity to the bcr-abl tyrosine kinase

inhibitor dasatinib recently approved for the treatrnent of chronic myeloid leukemia (29).

The use of subtractive hybridization as a previous step identified a novel set of genes that shared

with the direct strategy only 3 genes in gastric cancer and 9 genes in colon cancer. Further analysis by

qRT-PCR ofthe differentially expressed genes after the previous subtraction step validated clase to 70% of

the differentially expressed genes demonstrating the robustness of the method. Moreover, TMA studies

validated the overexpression oflaminin a3 (LAMA3) one ofthe three subunits ofLaminin-322 (Ln-332).

There is no evidence of ln-332 involvement in human gastric cancer; however, more recent studies

demonstrated that gastric cancer cell lines exhibit transcriptional silencing of LAMA3 due to promoter
 Page 16
methylation (30). Interestingly, the present data demonstrated more than 15-fold overexpression of

LAMA3 in gastric cancer samples compared to the adjacent non-malignant tissue while normal gastric

samples exhibited no expression. Moreover, LAMA3 staining was located in the cytoplasm of malignant

epithelial cells of gastric cancer samples showing no evidence of expression silencing. In addition, the

possibility that TTN might become a marker of a premalignant les ion warrants further investigation

In clear contrast to the direct microarray analysis, the enriched transcripts that appeared after

previous subtraction in gastric cancer were associated with pathways related to different signa!

transduction pathways and immune response. In addition, gene expression analysis of colon cancer

samples after previous subtractive hybridization highlighted signaling pathways different from those

observed in gastric cancer; both tumor types shared only the hedgehog, apoptosis and integrin signaling

pathway although no common gene was observed. Among the intracellular signaling pathways that we

selected for validation, we observed up to 50 genes out of 250 that exhibited at least 20-fold higher

expression in gastric cancer tumors compared to the adjacent non-cancerous tissue.

Interestingly, only 2, 10, 6 and 5 genes exhibited more than 100-fold overexpression in the

wntlhedgehog, the PBK/Akt, angiogenesis and T/B cell activation intracellular pathways, respectively.

These genes can be considered as leading the aberrant activities of the enriched signaling pathways in

gastric cancer. The largest overexpression levels in gastric cancer samples associated with the angiogenesis

pathway was observed with VEGF-C. Recent studies have demonstrated that VEGF-C is associated with

lymphatic spread and invasion of many cancer ce lis including gastric carcinoma (31-32). The present data

confirmed that gastric adenocarcinomas showed elevated expression levels ofVEGF-C in 70% ofthe cases

compared with the paired adjacent non-cancerous tissue (data not shown). However, we found no

significant association between the expression levels of VEGF-C and the number of lymph nodes

metastasis, most probably dueto the small amount of samples used in this study.
 Page 17
The largest differential expression between gastric cancer samples and non-cancerous tissue

associated with the PBK/AKT signaling pathway was observed with IRS2 in coincidence with the

simultaneous upregulation of IGF1, both IGF2 and its receptor IGF2R, and INS, all ofthem components

ofthe insulin/IGF signaling pathway. IRS2 is an intracellular signaling adaptor protein that binds to IGF-

IR and IR; thus, resulting in the activation ofPBK and the ERK pathway. Otherwise, IRS can interact with

other signaling pathways in a noncanonical manner and numerous cytokines and interferons have been

shown to induce downstream IRS signaling (33). Increased expression level of IRS-2 was associated with

lymph node metastasis in gastric cancer (34-35). IRS-2 plays a critica! role in determining the cellular

response to IGF stimulation anda recent report linked type 2 diabetes and incidence or mortality in gastric

cancer (36-37).

IL-17 and IFNy expression was associated with the activation of cytotoxic T and NK cells

pathways in response to Helicobacter pylori infection (38). Interleukin-17 is a CD4 T cell-derived

proinflammatory cytokine that plays a potential role in inflammatory response and has been shown to

stimulate the production of severa! other cytokines, including IL6, IL8 and TNF-a (39). In coincidence

with the present data, IL-17 expression has been observed in gastric cancer samples (40-41 ). IFNy is

another proinflammatory cytokine secreted by NK cells and CD8 T-cells that was associated with different

tumor lineages (42-43).

Among the large family of FZD receptors, FZD5 exhibited almost 1,000-fold overexpression in

gastric cancer samples. Interestingly, its ligand, Wnt5a, also exhibited the largest differential expression

between cancer and adjacent non-cancerous samples. Wnt5a is in volved in the activation of the canonical

and the non-canonical Wnt cascade in cells at tumor-stromal interface in invasion and metastasis (44).

Interestingly, increased IL-6 and TNFa levels due to Helicobacter Pylori infection upregulated Wnt5a

levels in gastric cancer (45) and this overexpression has been correlated with advanced stages of the

disease and poor prognosis (46). The largest overexpression in the Wnt pathway was associated with
 Page 18
WISPl. Although the expression of WISP1 was initially observed in wntl-overexpressing cells, and is

known at present as a wntfP-catenin effector, additional studies have demonstrated that its expression

could be explained by the coordinated effect ofwnt5a with antagonists ofthe canonical wnt pathway (47).

In order to functionally validate the PCR Arrays studies we decided to perform additional studies

with CTBP1 whose transcriptional activity was upregulated more than 70 fold in gastric cancer samples

compared with non-malignant adjacent tissue. We found that knocking down the expression of CTBP1

inhibited cell clonogenic and migration capacity that is consistent with CTBP1 role as mediator of

hypoxia-induced tumor cell migration (48). CTBP1 seems to contribute also to epithelial-mesenchymal

transition by repressing the expression of epithelial cell adhesion molecules (E-cadherin) and proapoptotic

genes (e.g. PERP, p21, Bax, Noxa) (49). However, the most interesting role ofCTBP1 is as sensitizer of

chemotherapeutic drugs (19). Here we show for the first time that knocking down the expression of

CTBP1 sensitized two different gastric cancer cell types AGS and MKN to three different

chemotherapeutic drugs, 5-FU, cisplatin and epirubicin decreasing their IC50 by 5-6 fold, 4-6 fold 12-14

fold respectively. A plausible explanation of the broad chemosensitizing effect of CTBP1 is the recent

evidence that CTBP1 can promote drug resistance by increasing the expression of MDR1 and in fact

downregulation of CTBP1 expression in breast cancer cells rendered malignant cells more sensitive to 5-

FU and other genotoxic agents such as cisplatin and etoposide (19, 50).

Molecular-targeted drug development has become an inflection point for cancer treatment.

However, even the most successful biological drugs are effective only in a minority of patients, sometimes

even less that 10% of them can benefit from treatment. What has emerged from this highly sensitive

microarray analysis is that we could identizy potential novel biomarkers and leading genes of signaling

pathways aberrantly activated in these gastrointestinal carcinomas that might become novel targets. For

advanced gastric cancer no effective drug has been developed so far; thus, it is tempting to speculate that

this kind of affordable approach (subtractive hybridization + microarrays) might help identizy novel highly
 Page 19
specific targets that can provide the basis for increasingly specific targeted therapies and 1mprove

treatment efficacy.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

We thank Juan Carlos Roa MD, for tissue contribution and collaboration and Johannes Rainer, PhD

for CARMAweb support. We acknowledge the excellent technical support and help ofSoledad Lantadilla,

Gabriela Bascuan, Tamara Snchez, Javier Elorza, Germn Gonzlez, Mnica Ramrez, Alejandra

Sandoval and Francisco Gamn.

Grant Support

This work was funded by PIA CTE-06, World Bank CONICYT Project. Carolina Bizama was

funded by PhD CONICYT Fellowship grant N21070552 and CONICYT Internship grant N28070019,

Felipe Benavente was funded by PhD PIA CTE-06 Fellowship and Jaime Espinoza was funded by PhD

CONICYT Fellowship grant No 21080240.

 Page 20
References

l. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J

Clin. 2011;61:69-90.

2. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of

cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010;127:2893-917.

3. Fomaro L, Lucchesi M, Caparello C, Vasile E, Caponi S, Ginocchi L, et al. Anti-HER agents in

gastric cancer: from bench to bedside. Nat Rev Gastroenterol Hepatol. 2011 ;8:369-83.

4. Jorgensen JT, Hersom M. HER2 as a Prognostic Marker in Gastric Cancer- A Systematic Analysis

ofData from the Literature. J Cancer. 2012;3:137-44.

5. Cui J, Chen Y, Chou WC, Sun L, Chen L, Suo J, et al. An integrated transcriptomic and

computational analysis for biomarker identification in gastric cancer. Nucleic Acids Res. 2011;39:1197-

207.

6. Yap YL, Zhang XW, Smith D, Soong R, Hill J. Molecular gene expression signature pattems for

gastric cancer diagnosis. Comput Biol Chem. 2007;31:275-87.

7. Cao W, Epstein C, Liu H, DeLoughery C, Ge N, Lin J, et al. Comparing gene discovery from

Affymetrix GeneChip microarrays and Clontech PCR-select cDNA subtraction: a case study. BMC

Genomics. 2004;5:26.

8. Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, et al. Suppression

subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes

and libraries. Proc Natl Acad Sci U S A. 1996;93:6025-30.

9. Pan YS, Lee YS, Lee YL, Lee WC, Hsieh SY. Differentially profiling the low-expression

transcriptomes ofhuman hepatoma using a novel SSH/microarray approach. BMC Genomics. 2006;7:131.

10. Liu BH, Goh CH, Ooi LL, Hui KM. Identification ofunique and common low abundance tumour-

specific transcripts by suppression subtractive hybridization and oligonucleotide probe array analysis.

Oncogene. 2008;27:4128-36.
 Page 21
11. Liu Y, Zhu X, Zhu J, Liao S, Tang Q, Liu K, et al. Identification of differential expression of genes

in hepatocellular carcinoma by suppression subtractive hybridization combined cDNA microarray. Onco1

Rep. 2007;18:943-51.

12. Wang T, Hopkins D, Schmidt e, Silva S, Houghton R, Takita H, et al. Identification of genes

differentially over-expressed in lung squamous cell carcinoma using combination of cDNA subtraction and

microarray analysis. Oncogene. 2000; 19:1519-28.

13. Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists

using DAVID bioinformatics resources. Nat Protoc. 2009;4:44-57.

14. Thomas PD, Kejariwal A, eampbell MJ, Mi H, Diemer K, Guo N, et al. PANTHER: a browsable

database of gene products organized by biological function, using curated protein family and subfamily

classification. Nucleic Acids Res. 2003;31:334-41.

15. Hamill KJ, Palier AS, Jones JC. Adhesion and migration, the diverse functions of the laminin

alpha3 subunit. Dermatol el in. 201 0;28:79-87.

16. Labeit D, Watanabe K, Witt e, Fujita H, Wu Y, Lahmers S, et al. ealcium-dependent molecular

spring elements in the giant protein titin. Proc Natl Acad Sci U S A. 2003;100:13716-21.

17. Pfohler e, Preuss KD, Tilgen W, Stark A, Regitz E, Fadle N, et al. Mitofilin and titin as target

antigens in melanoma-associated retinopathy. Int J eancer. 2007;120:788-95.

18. Boyd JM, Subramanian T, Schaeper U, La Regina M, Bayley S, ehinnadurai G. A region in the e-

terminus of adenovirus 2/5 E1a protein is required for association with a cellular phosphoprotein and

important for the negative modulation of T24-ras mediated transformation, tumorigenesis and metastasis.

EMBO J. 1993;12:469-78.

19. Birts eN, Harding R, Soosaipillai G, Halder T, Azim-Araghi A, Darley M, et al. Expression of

etBP family protein isoforms in breast cancer and their role in chemoresistance. Biol eell. 2010;103:1-19.
 Page 22
20. Amatschek S, Koenig U, Auer H, Steinlein P, Pacher M, Gruenfelder A, et al. Tissue-wide

expression profiling using cDNA subtraction and microarrays to identifY tumor-specific genes. eancer

Res. 2004;64:844-56.

21. Barraclough DL, Sewart S, Rudland PS, Shoker BS, Sibson DR, Barraclough R, et al. Microarray

analysis of suppression subtracted hybridisation libraries identifies genes associated with breast cancer

progression. eell Oncol. 2010;32:87-99.

22. Yang GP, Ross DT, Kuang WW, Brown PO, Weigel RJ. eombining SSH and cDNA microarrays

for rapid identification of differentially expressed genes. Nucleic Acids Res. 1999;27: 1517-23.

23. Xu J, Stolk JA, Zhang X, Silva SJ, Houghton RL, Matsumura M, et al. Identification of

differentially expressed genes in human prostate cancer using subtraction and microarray. eancer Res.

2000;60: 1677-82.

24. Bangur es, Switzer A, Fan L, Marton MJ, Meyer MR, Wang T. Identification of genes over-

expressed in small cell lung carcinoma using suppression subtractive hybridization and cDNA microarray

expression analysis. Oncogene. 2002;21 :3 814-25.

25. ehen Y, Zhang YZ, Zhou ZG, Wang G, Yi ZN. Identification of differently expressed genes in

human colorectal adenocarcinoma. World J Gastroenterol. 2006; 12:1025-32.

26. Bertucci F, Salas S, Eysteries S, Nasser V, Finetti P, Ginestier e, et al. Gene expression profiling of

colon cancer by DNA microarrays and correlation with histoclinical parameters. Oncogene. 2004;23:1377-

91.

27. Humphries ID, Byron A, Bass MD, eraig SE, Pinney JW, Knight D, et al. Proteomic analysis of

integrin-associated complexes identifies Ree2 as a dual regulator of Rac1 and Arf6. Sci Signal.

2009;2:ra51.

28. Mollinari e, Reynaud e, Martineau-Thuillier S, Monier S, Kieffer S, Garin J, et al. The

mammalian passenger protein TD-60 is an Ree1 family member with an essentia1 role in prometaphase to

metaphase progression. Dev eell. 2003;5:295-307.

 Page 23
29. Huang F, Reeves K, Han X, Fairchild C, Platero S, Wong TW, et al. Identification of candidate

molecular markers predicting sensitivity in solid tumors to dasatinib: rationale for patient selection. Cancer

Res. 2007;67:2226-38.

30. Ii M, Yamamoto H, Taniguchi H, Adachi Y, Nakazawa M, Ohashi H, et al. Co-expression of

laminin beta3 and gamma2 chains and epigenetic inactivation oflaminin alpha3 chain in gastric cancer. Int

J Oncol. 2011;39:593-9.

31. Stacker SA, Achen MG, Jussila L, Baldwin ME, Alitalo K. Lymphangiogenesis and cancer

metastasis. Nat Rev Cancer. 2002;2:573-83.

32. Feng LZ, Zheng XY, Zhou LX, Fu B, Yu YW, Lu SC, et al. Correlation between expression of

S100A4 and VEGF-C, and lymph node metastasis and prognosis in gastric carcinoma. J Int Med Res.

2011 ;39: 1333-43.

33. Dearth RK, Cui X, Kim HJ, Hadsell DL, Lee AV. Oncogeni~ transformation by the signaling

adaptar proteins insulin receptor substrate (IRS)-1 and IRS-2. Cell Cycle. 2007;6:705-13.

34. Zuo QS, Yan R, Feng DX, Zhao R, Chen C, Jiang YM, et al. Loss of imprinting and abnormal

expression ofthe insulin-like growth factor 2 gene in gastric cancer. Mol Carcinog. 2011;50:390-6.

35. Lu Y, Lu P, Zhu Z, Xu H, Zhu X. Loss of imprinting of insulin-like growth factor 2 is associated

with increased risk of lymph node metastasis and gastric corpus cancer. J Exp Clin Cancer Res.

2009;28:125.

36. Gong Y, Yang YS, Zhang XM, Su M, Wang J, Han ID, et al. ABO blood type, diabetes and risk of

gastrointestinal cancer in northem China. World J Gastroenterol. 2012;18:563-9.

37. Tian T, Zhang LQ, Ma XH, Zhou JN, Shen J. Diabetes mellitus and incidence and mortality of

gastric cancer: a meta-analysis. Exp Clin Endocrino! Diabetes. 2012;120:217-23.

38. Algood HM, Gallo-Romero J, Wilson KT, Peek RM, Jr., Cover TL. Host response to Helicobacter

pylori infection befare initiation of the adaptive immune response. FEMS Immunol Med Microbio!.

2007;51 :577-86.
 Page 24
39. Jovanovic DV, Di Battista JA, Martel-Pelletier J, Jolicoeur FC, He Y, Zhang M, et al. IL-17

stimulates the production and expression ofproinflammatory cytokines, IL-beta and TNF-alpha, by human

macrophages. J Immunol. 1998;160:3513-21.

40. Zhang B, Rong G, Wei H, Zhang M, Bi J, Ma L, et al. The prevalence of Th17 cells in patients

with gastric cancer. Biochem Biophys Res Commun. 2008;374:533-7.

41. Iida T, Iwahashi M, Katsuda M, Ishida K, Nakamori M, Nakamura M, et al. Tumor-infiltrating

CD4+ Th 17 cells produce IL-17 in tumor microenvironment and promote tumor progression in human

gastric cancer. Oncol Rep. 2011;25:1271-7.

42. Dunn GP, Koebel CM, Schreiber RD. Interferons, immunity and cancer immunoediting. Nat Rev

Immunol. 2006;6:836-48.

43. Nishikawa H, Kato T, Tawara I, Ikeda H, Kuribayashi K, Allen PM, et al. IFN-gamma contro1s the

generation/activation of CD4+ CD25+ regulatory T cells in antitumor immune response. J Immunol.

2005; 175:4433-40.

44. Katoh M. Dysregulation of stem cell signaling network due to germline mutation, SNP,

Helicobacter pylori infection, epigenetic change and genetic alteration in gastric cancer. Cancer Biol Ther.

2007;6:832-9.

45. Katoh M. STAT3-induced WNT5A signaling loop in embryonic stem cells, adult normal tissues,

chronic persistent inflammation, rheumatoid arthritis and cancer (Review). Int J Mol Med. 2007;19:273-8.

46. Kurayoshi M, Oue N, Yamamoto H, Kishida M, Inoue A, Asahara T, et al. Expression of Wnt-5a is

correlated with aggressiveness of gastric cancer by stimulating cell migration and invasion. Cancer Res.

2006;66: 10439-48.

47. Price RM, Tulsyan N, Dermody JJ, Schwalb M, Soteropoulos P, Castronuovo JJ, Jr. Gene

expression after crush injury of human saphenous vein: using microarrays to define the transcriptional

pro file. J Am Coll Surg. 2004; 199:411-8.

 Page 25
48. Zhang Q, Wang SY, Nottke AC, Rocheleau JV, Piston DW, Goodman RH. Redox sensor CtBP

mediates hypoxia-induced tumor cell migration. Proc Natl Acad Sci U S A. 2006;103:9029-33.

49. Grooteclaes M, Deveraux Q, Hildebrand J, Zhang Q, Goodman RH, Frisch SM. C-terminal-binding

protein corepresses epithelial and proapoptotic gene expression programs. Proc Natl Acad Sci U S A.

2003;100:4568-73.

50. Jin W, Scotto KW, Hait WN, Yang JM. Involvement ofCtBP1 in the transcriptional activation of

the MDR1 gene in human multidrug resistant cancer cells. Biochem Pharmacol. 2007;74:851-9.
 Page 26
Figure legends

Figure l. Workflow procedures of the direct and the indirect strategies for the identification of

differentially expressed transcripts. Total RNA obtained from gastric and colon samples were processed

through a direct strategy, which included cDNA synthesis, aRNA amplification, microarray hybridization

and a indirect strategy, that included a previous PCR-based suppressive subtractive hybridization. Data

was separately obtained from each strategy and analyzed as described in experimental procedures.

Figure 2. The use of a previous subtractive hybridization step led to the identification of novel cancer-

associated transcripts by microarrays analysis. A-B, Venn diagrams showing overlapping genes obtained

by both strategies for the two types of cancer studied. C-F, quantitative real- time PCR (qRT-PCR)

analysis was performed on a selected list of differentially expressed genes in gastric and colon cancer

obtained by the direct and indirect strategies. mRNA levels were assessed in six samples of gastric and

colon cancer samples and their respective paired non-cancer tissue and results were normalized using three

housekeeping genes. Red color represent up-regulation and green color represent down-regulation. qRT-

PCR significance values: * P <0.05, ** P <0.01, *** P <0.001. ns, non significant by Student's t test.

Figure 3. Tissue microarray analyses confirmed the augmented expression of RCC2 and JPH1 in gastric

and colon cancer, respectively. A-C, RCC2 immunohistochemical staining in gastric cancer (A), adjacent

non-cancerous sample (B) and normal sample (C). D, quantification of RCC2 staining in gastric cancer

and adjacent non-cancerous tissue samples. Mean SD (n=39). *** P < 0.001 by Student's t test.
E-G, JPHI immunohistochemical staining of JPH1 in colon cancer (E), non-cancer sample (F) and normal

colon tissue (G). H, quantification of JPH1 staining in colon cancer and adjacent non-cancerous

counterpart. Data are expressed as mean SD (n=46). *** P < 0.001 by Student's t test. Scale bars, 50 ..tm.
 Page 27
Figure 4. Tissue microarray analyses confirmed the augmented expression of LAMA3 and TTN in gastric

cancer. A and B, LAMA3 immunohistochemical staining in gastric cancer (A) and adjacent non-cancerous

sample (B). e and D, quantification of LAMA3 expression in gastric cancer and adjacent non-cancerous

samples. D, data are expressed as mean SD (n=37), *** P < 0.001 by Student's t test.

E-1, TlN immunohistochemical staining in gastric cancer (E) adjacent non-cancerous sample (F) and

intestinal metaplasia (I). G and H, quantification of TlN expression in gastric cancer and adjacent non-

cancerous counterpart. H, data are expressed as mean SD (n=35). * P < 0.05. 1, the red arrows show the
strong staining ofTlN in intestinal metaplasia. Scale bars, 100 Jlm.

Figure 5. PeR-Array analysis highlights overexpressed genes in the different pathways. A-D, the

expression profiles of genes relevant to the Wnt/Hedgehog (A); PBK/AKT (B); Angiogenesis (C); T and

B cell activation (D). Each PeR-Array contained 87 genes relevant to each pathway as well as 9

housekeeping genes and the expression values represent the average fold change of gastric cancer samples

relative to non-cancerous tissues. The data correspond to genes showing fold changes > 2.0.

Figure 6. Knockdown of eTBP1 expression using a siRNA sensitizes gastric cancer cells to

chemotherapeutic drugs. A, relative expression of eTBP1 in six gastric cancer cell lines (SNU16, AGS,

N87, SNU1, MKN45, Kato 111). Quantification of eTBP1 was performed by qRT-PeR using QARS and

TFeP2 as an interna! control. B and e, validation of eTBP1 knockdown by assessing mRNA and protein

levels. AGS and MKN45 gastric cancer cells were transfected with eTBP1 and control siRNA. QARS and

TFeP2 were used as an interna! control, while a-tubulin was used as an interna! control for protein

loading. D and E, MKN45 following pre-incubation for 48 hr with eTBP1 and control siRNA. D,

migration analysis. Representative photographs of Giemsa-stained cells are shown. E, clonogenic capacity

following pre-incubation for 48 hr with an siRNA against eTBP1. Representative photographs of crystal

violet-stained colonies are shown. Data are expressed as mean SD (n=3). ** P <0.01, *P <0.05 by
 Page 28
Student's t test. F, gastric cancer cells were transfected with a siRNA against CTBPl. After 48 hours, cells

were treated with varying concentration of the different chemotherapeutic agents for an additional 72

hours. Cell viability was evaluated with MTS. Data is expressed as mean SD (n=3).
 12 gastric cancer and 12 adjacent 10 colon cancer and 10 adjacent
non-cancerous samples non-cancerous samples

Total RNA extraction and i ntegrity analysis

Direct strategy

------ .. 1-----------~----~~
First strand c.DNA synthesis Superscript:IIJ cONA synthesis
cONA amplification S MART technology and
[ RSA 1Digestion amplfication
~------~---------

DNA 1 First strand~DNA synthess by .,)

1thess Superscript 111
laRNA Second strand synthesis
lification In vifro transcription and aRNA labelmg
Suppresson

3ene
<ression
:roarray
Hybrdizaton on HEEBO mcroarray
Scanning and data extraction Frst and second hybridization
Primary and secondary (Nested) PCR
l Subtractive
Hybr dization

Purifi:tion:n_d :ffiiency va~:: -=l-

r In vitro transcription and aRNA labeling

Hybridization in HEEBO microarray
Scanning and data extraction
--
Gene
expresson
microarray

Bloinformatic analysls
Data validation with qRT-PCR and
Gene ontology
~-----------
:r
A Gastric cancer B Colon cancer

Direct lndirect Direct lndirect

strategy strategy strategy strategy

8"
E vtJ.
<1$:
** ADAT2 ns TOP2A * CTSC
* ILSBP ns PPAT * TGFB1
*
* SH3TC1 ns CLDN1 * PGM3
*
* MACC1
** IL8 * MMP7 ns
** SYNE2 * PPM1H * CSE1L *
** SRGAP1
ANX13 * AXIN2 * FAM498 ns
MMP7 ns ZNF410 ns
*ns TMPRSS4 * **
*ns CKS2
**
NXT2
XRN2 *
* SAM09
ns
CSE1L
* *
*ns GPR68
STAP2
XPOS
USPL1 *
KPNA2
FLNB
*
** ** SUT1A1 *
* TRIM26 * TARBP1
** *
* IGJ * TGFB1
*
NFKB1A
CA12
*
FOXA1
** AKR1C3 *
** JPH1
*** HLA-A
*
ns
* MAST3 ns
GTPBP4
RACGAP1 * ZNF292 ns
* *
** XYLT2 ** XRN2
**
FUCA1
*
*
ns
AGR2 TOMM34
*
SELENBP1
CA2
*
CD209
GKN2
* IARS
* *
* * NIT2
*
** COX7A1
*
* PADI2
LMOD1 ns
** Log2 Fold change *
Log2 Fold change
*** SLC02A1
*
** -3 o 3
CA12
SULT1A1 * -3 o 3

USP2 *
CA4 ns
PKIB *
SCIN *
 RCG2 Jt-JH1

U)
:S
oS..
G)
u
e
m
u
U)
:S
e
G)
(.)
e
m
u
e
o
z

.......
m
E
S..
o
z

e: ***
~.... ***
c.
N
o
o
IX:
o
~
o
u
111
en
.5

-
e:
"i
U)

Non-cancerous Cancerous Non-cancerous Cancerous

c::J Noncanearous
Cancerous

Non~anc:ero\11 Cancerous

c::J Noncaneetous
Cancero11s

Non-canc:ero111 Cancero11s
IIP1
Wnt/Hedgehog 8
IRS4
Pl3KIAKT e Angiogenesis D T cell and B cell activation

U:B CBL CCLZ

~LK KIT PTGS1
<3A CAP1 ADAMTS1
IYC BTK EFNA1
IRS1 KOR
T9A CXCR4 FIGF
2A1 LCK CXCL6
~H1 TGFBR1
PIKJCA SERPINF1
'300 SRC ANGPT1
1A1 SHC1 NRP2
IOU CDKN1B TNFAIP2
X17 E2F1 COL4A2
Z07 IFNA1
ERBB2 TIMP2
JFU NFKB1 FGF1
T'2B ACACA TIMP3
823 HRAS SPHK1
LI2 CREB1 FGF2
GRB2 ENG
IG1 PROK2
EF1 INS PDGFA
1L1 AEBP1 ANGPTL4
Z08 PIK3R1 PLXOC1
Z02 PTEN IL6
CD40 JAGt
:o1 BAI1
'C1 NFKBIA FLTt
~T3 RAF1 CXCL11
tOZ COKN2A ITGAV
JAK2 EFNB2
m1 NOTCH1
tL4 IGF2 TGFB2
:et ITGB1 PGF
ANG PLAU
:W2 CCR5 ITGB3
~06 IGF2R MDK
SL1 MAPK1 CDHS
IC2 PIK3R4 LAMAS
IR1 IFNG
PRKCE TGFB
lOA SPP1 ECGFt
ws RHOA CXCL9
(86 ACOX1 MMP9
~P2 SOS1 TEK
rsA EFNA3
ABL1 LTA
(N1 COKN1A 1 TNF
181 GSK3B 1 THBS2

---
Qf COH1 TIMPt
CDC42 EDG1
102

PRKCA MMP2
103 ANPEP
rc1 AKT1 PEF4
iHB EGFR COL18A1
!P4 MAPK8 IU
PIK3C2B THBS1
:H1 NRPt
!P1 PRKCG - 1011000 120000 102
~os
IGF1 VEGFC
pf IRS2 ~~ -20 o 20 40 250 500 7501000
-10 o 10 20 30 20 20 6() 200 600 1000 20 40 &O 80 2000
Fold Change Expression Values Fold Change Exprenion Values Fold Changtl Expression Yalues
Fold Change Expression Valuu
 8~1.0 o 100
~
... 0.8
a. - 80
....(,) 0.6
al t:. "*
! 60 .T
'O u
Cll ""
e
esE o.4
.5!
T"'" ~ 40
.. l!
f
8
"'
~0.2
.!!
20 j
~
O.QI.LL-.....-'-.L-.....,..-L.. o
sRNA control CTBPf siRNA c:ontrol CTBP1

~~
. ... . ,.
CTBP1 , _ CTBP1,. . __., .....~ -~:
...,.; ..... :
a-Tubulinl- -lo-Tubulinl- _,
,

).:_ ;~_: : ,\;~1

siR NA siR NA
CTBP1 CTBP1
Control Control

5-Fiuoracil Cisplatin Epirubicin

120 ICSO (o M) 120 IC50(oM) 120 IC50(oM)
WT 3UI WT 13 8 4WT 0.09
100 siRNAcontrol29.4 100 a siRNA control 14.9
100 a siRNA control 0.07
o CTBP1 CTBP1 2.6 o CTBP1 0.005

\
5.6 G

80 80 80
g g \T\J
60 aso g 60
(,)
~
(,)
~
~\
4(1 40 40 \
\
;;:,
20 20 20 \
);_
....._,~~
o
3 4 ~ 6 7 8 9 10
o
4 5 6 7 8
1!
9 10
o
2 3 4 5 6 7 8
Log (M]5-FU Log [MJ Cisplatln Log [M) Epirubicin

120 IC50(tM) 120 120 ICSO {!.o M

IC50{tM)
4WT 0.09
T AWT 12.1 WT 10.7
a siRNAcontrol 0.07
100 a siRNA control11 .6 100 a siRNA control11.2 100
o CTBP1
o CTBP1 1.9 o CTBP1 2.6 "\! 0.005

80
g
80
g
80
\ \T
60 5 60 f$6 ~
u
40
u
~
40 -\T ~
40
\
'
')
1\'-1._ ~---
20 20 20

o o o
3 4 5 6 7 8 9 10 4 5 6 7 8 9 10 2 3 4 S 6 7 8
Log [M}5-FU Log [M] Clsplalln Log [M) Epirubicln
Table 1. Subtractive hybridization followed by microarray analysis identified mostly non-overlapping
intracellular pathways in gastric and colon cancer
Gastric cancer principal pathways Number of genes P- value
P00012:Cadherin signaling pathway 11 2.18E-03
P00056:VEGF signaling pathway 7 4.23E-03
P0001 0:8 cell activation 7 6.76E-03
P00036:1nterleukin signaling pathway 10 1.17E-02
P00006:Apoptosis signaling pathway 8 1.79E-02
P00053:T cell activation 7 2.01E-02
P00046:0xidative stress response 5 2.27E-02
P00034:1ntegrin signaling pathway 10 2.40E-02
P00054:Toll receptor signaling pathway 5 2.56E-02
P00025:Hedgehog signaling pathway 2 2.94E-02
P00026:Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha
3 3.41 E-02
mediated pathway
P00048:PI3 kinase pathway 7 3.50E-02
P00057:Wnt signaling pathway 14 4.52E-02
Colon cancer principal pathways Number of genes P- value
P00017:DNA replication 4 3.11 E-03
P00016:Cytoskeletal regulation by Rho GTPase 4 7.14E-03
P00004:Aizheimer disease-presenilin pathway 9 8.37E-03
P00034:1ntegrin signaling pathway 11 1.46E-02
P002738:De novo purine biosynthesis 4 1.61 E-02
P00029:Huntington disease 10 2.12E-02
P00006:Apoptosis signaling pathway 8 2.44E-02
P00025:Hedgehog signaling pathway 2 3.41E-02
P00024:Giycolysis 3 3.41 E-02
P00059:P53 pathway 7 4.22E-02
Principal pathways were identified by PANTHER analysis using 743 and 651 genes differentially expressed
in gastric and colon cancers.
Table 2. Single gene analysis of common pathways enriched in gastric and colon cancers
Pathway Gastric genes Colon genes

lntegrin signaling COL8A 1*, CUZD1, TRIM23, c14orf133, COL5A2, COL1A1, ITGB8, RND3, ITGAS,
ARPC2, RAPGEF1, ITGAX, CDSL, FCRL3, SLC40A 1, ARPC3,GGT6, RAP2B, HSP90AB1,
COL 12A1 RAPGEF1, LIMS1

Apoptosis signaling LARP2, ADAT2, IMPDH1, BAX, BIRC3, HSPA8, XIAP, TNFRSF10D, NFKBIA,
HIST1H1E, CHUK, NFKB2, ATF2 CASP7, CCNB11P1, TNFSF10

Hedgehog signaling STK36, FBXW11 SAP, PROZ

* L1st of genes 1ncluded 1n the ennched pathway. Pnnc1pal pathways were 1dent1fied by PANTHER analys1s
using 743 and 651 genes differentially expressed in gastric and colon cancers.
 ANEXO V

ARTCULO PUBLICADO (Co-autora)

Reversa/ of gastrointestinal carcinoma-induced immunosuppression and induction of

anttumoural immunity by a combination of cyc/ophosphamide and gene transfer
of/L-12

263
 l'v!OLECULAR ONCOLOGY XXX (2011) 1-14

o
available at www.sciencedirect.com

_,,
;;, ScienceDirect
=..,_: i "'i .. ~~ ...

www .e lsevi e r .e o m/1 o cate/m o 1o n e

Reversa! of gastrointestinal carcinoma-induced immunosuppression

and induction of antitumoural immunity by a combination of
cyclophosphamide and gene transfer of IL-12

Mariana Malvicinia, Mariana Ingolottia, Flauia Piccionia, Mariana Garciaa,b, Juan Bayoa,
Catalina Atorrasagastia, Laura Alaniza,b, jorge B. Aquinoa,b, Jaime A. Espinozad,e, Manuel
Gidekeld, O. Graciela Scharovskyc, Pablo Matarb,c,**, Guillermo Mazzolinia,b,*
aGene Therapy Laboratory, Liver Unit, School of Medicine, Austral University, Av. Presidente Pern 1500, (B16290DT) Derqui-Pilar,
Buenos Aires, Argentina
bCONICET (Consejo Nacional de Investigaciones Cientficas y Tcnicas), Argentina
cinstitute of Experimental Genetics, School of Medica! Sciences, National University of Rosario, Santa Fe 3100, 2000 Rosario, Argentina
ctventureLab, Adolfo Ibez University, Santiago, Chile
eApplied Cellular and Molecular Biology Program, De la Frontera University, Temuco, Chile

ARTICLE INFO ABSTRACT

Article history: Immunotherapy-based strategies for gastrointestinal carcinomas (GIC) have been exploited
Received 30 December 2010 so far, but these approaches haveto fa ce strong mechanisms of immune escape induced by
Received in revised form tumours. We previously demonstrated that sub-therapeutic doses of an adenovirus ex-
29 March 2011 pressing IL-12 genes (AdiL-12) mediated a potent antitumour effect against subcutaneous
Accepted 30 March 2011 (s.c.) colorectal carcinomas (CRC) in mice pre-treated with low doses of cyclophosphamide
Available online (Cy). In our study we used this combination to assess its impact on the immunosuppressive
microenvironment. In s.c. CRC model we demonstrated that non-responder mice failed to
Keywords: decrease Tregs in tumour, spleen and peripheral blood. Reconstitution of Tregs into
Gastrointestinal carcinoma tumour-bearing mice treated with combined therapy abolished the antitumoural effect.
Immunosuppression In addition, Cy + AdiL-12 modified Tregs functionality by inhibiting the in vitro secretion
Cyclophosphamide of IL-10 and TGF-~ and their ability to inhibit dendritic cells activation. Combined treat-
IL-12 ment decreased the number of myeloid-derived suppressor cells (MDSCs) in comparison
Tregs to non-treated mice and, interestingly, administration of Tregs restored splenic MDSCs
population. Furthermore, combined therapy potently generated specific cytotoxic IFN-y-
secreting CD4+ T cells able to eradicate established CRC tumours after adoptive transfer.
Finally, we evaluated the combination on disseminated CRC and pancreatic carcinoma
(PC). Cy + AdiL-12 were able to eradicate liver metastatic CRC (47%) and PC tumour nodules
(40%) and to prolong animal survival. The results of this study support the hypothesis that
Cy + AdiL-12 might be a valid immunotherapeutic strategy for advanced GIC.
2011 Federation of European Biochemical Societies.
Published by Elsevier B.V. Al! rights reserved.

Corresponding author. Gene Therapy Laboratory, Liver Unit, School of Medicine, Austral University. Av. Presidente Pern 1500,
(B16290DT) Derqui-Pilar, Buenos Aires, Argentina. Tel.: +54 2322 482618.
Corresponding author. Institute of Experimental Genetics, School of Medica! Sciences, National University of Rosario, Santa Fe 3100,
2000 Rosario, Argentina. Tel.: +54 341 4804558x244; fax: +54 341 4804569.
E-mail addresses: matarpablo@hotmail.com (P. Matar), gmazzoli@cas.austral.edu.ar (G. Mazzolini).
1574-7891/$ - see front matter 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. Al! rights reserved.
doi:10.1016/j .molonc.2011.03.007

Please cite this article in press as: Malvicini, M. et al., Reversa! of gastrointestinal carcinoma-induced immunosuppression and
induction of antitumoural immunity by a combination of cyclophosphamide and gene transfer of IL-12, Molecular Oncology
(2011), doi:10.1016/j.molonc.2011.03.007
 2 MOLECULAR ONCOLOGY XXX (2011) 1-14
l. Introduction
Potent mechanisms of immunosuppression are active during
tumour growth limiting the effectiveness of immunotherapy
strategies (Zou, 2005). Mechanisms used by malignant
tumours to elude immune recognition include tumour-
induced impairment of antigen presentation, activation of
negative co-stimulatory signals and secretion ofimmunosup-
pressive factors (Almand et al., 2001; Bell et al., 1999;
Ghiringhelli et al., 2005; Nestle et al., 1997). In addition, cancer
cells may induce the expansion anci/or recruitment of regula-
tory cell populations that may promete and sustain this im-
munosuppressive network; these populations include
regulatory T cells (Tregs), myeloid-derived suppressor cells
(MDSCs) and distinct subsets of immature and mature regula-
tory dendritic cells (DCs) (Croci et al., 2007).
Colorectal carcinoma (CRC) is the second most common
cause of cancer mortality in westem countries and the 9.7%
of the most commonly diagnosed cancers worldwide (Feriay
et al., 2010). Twenty five percent of the patients have meta-
static disease at diagnosis, and their predicted 5-year survival
among non-surgical patients is less than 10% (Lorenz et al.,
2000). Pancreatic cancer is the fourth leading cause of
cancer-related death and surgery is the only curative option;
however, more than 80% of the patients showed local or dis-
seminated recurrence (Lorenz et al., 2000). Therefore, there
is an urgent need for new therapeutic strategies for advanced
GIC. During the last two decades multiple immunotherapy-
based strategies for GIC have been developed with promising
results not only at preclinical stage but also in the clinic
(Elkord et al., 2008; Shapira et al., 2010). The loss/down regula-
tion of MHC class I antigens, the lack of co-stimulatory mole-
cules, detective death receptor signalling, apoptosis of
activated T cells, immunosuppressive cytokines, and activa-
tion of suppressor T cells have been described as responsible
for the failure of anticancer treatment in mice and humans
(Mazzolini et al., 2007).
Interleukin 12 (IL-12), a cytokine with multiple biological
effects, is one of the most potent antitumour cytokines
(Mazzolini et al., 2003; Trinchieri, 2003). However, high doses
of IL-12 are needed to achieve significan! antitumour effects
that results in severe toxicity (Leonard et al., 1997). In recent
years, gene therapy has emerged as a therapeutic too! to allow
desired levels ofiL-12 or other cytokines into tumoural/peritu-
moural milieu avoiding undesired side effects (Colombo and
Fomi, 1994). The efficacy of IL-12 gene transfer for advanced
GIC in animal models has been shown consistently by differ-
ent research groups including ours (Barajas et al., 2001;
Caruso et al., 1996; Mazzolini et al., 1999; Putzer et al., 2001).
Intratumoural administration of an adenovirus expressing
IL-12 genes (AdiL-12) in patients with advanced GIC in a phase
Itria! was a feasible and well-tolerated procedure that exerted
only mild antitumoural activity (Sangro et al., 2004). Immuno-
suppressive activity induced by tumoural and peritumoural
cells seem to be critica! and might be responsible for the
lack of clinical success in immune- and non immune-based
therapies (Rabinovich et al., 2007; Zwimer et al., 2010). Seeking
for immunotherapeutic synergies to fight against cancer, it
was possible to increase the efficacy of IL-12, by combining
r~dli! ~ -- ~ 81. Reversalof
this cytokine with other procedures, such as chemotherapy,
immunostimulatory monoclonal antibodies, dendritic cells,
and other immunotherapy approaches (Gomez et al., 2001;
Melero et al., 2001). Cyclophosphamide (Cy) is a widely known
chemotherapeutic agent that displays either immunosup-
pressive or immunopotentiating effects, depending on the
dosage and the duration of administration of this drug
(Brodsky et al., 1998; Colvin, 1999). Severa! mechanisms have
been proposed to explain Cy immunomodulatory activity in-
cluding depletion of tumour-induced regulatory T cells, pro-
duction of soluble growth factors, Th2/Th1 shift in cytokine
production, and others (Ghiringhelli et al., 2004; Matar et al.,
2002; Proietti et al., 1998). However, the precise mechanism
is not yet clarified.
Recently, we have shown a novel synergistic combination
of Cy and AdiL-12 for the eradication of CRC in mice. Cur-
rently, we explored the mechanisms of action between Cy
and AdiL-12 combination and observed that the potent anti-
cancer effect obtained in advanced GIC is based on their capa-
bility to block Tregs secretion ofiL-10 and TGF-13 cytokines, as
well as on the loss of their inhibitory activity exerted on DCs.
In addition, we observe a decrease in the number ofMDSCs af-
ter Tregs inhibition. Finally, combined treatment showed syn-
ergistic activity not only at the induction of the immune
response but also at the effector phase by generating potent
IFN-y-secreting CD4+ T cells that were able to eradicate estab-
lished CRC tumour nodules.
2. Materials and methods
2.1. Animals and cell Iines
Six- to eight-week-old male BALB/c mice and C57BU6 mice
were purchased from CNEA (National Atomic Energy Commis-
sion, Ezeiza, Argentina). Animals were maintained at our An-
imal Resource Facilities (School of Biomedical Sciences,
Austral University) in accordance with the experimental ethi-
cal committee and the NIH guidelines on the ethical use of an-
imals. The CT26 (colorectal carcinoma), BNL (hepatocellular
carcinoma) and Panc02 (pancreatic carcinoma) tumour cell
lines were used (kindly provided by Prof. Prieto, University of
Navarra, Spain). Cells were maintained in DMEM or RPMI
1640 supplemented with 10% heat-inactivated FCS, 2 mmol/
L L-glutamine, 100 U/mL streptomycin, and 100 mg/mL peni-
cillin and incubated at 37 oc in a 5% co2 humidified
atmosphere.
2.2. Drugs
Cyclophosphamide (Filaxis, Argentina) was dissolved in ster-
ile water at a concentration of 20 mg/mL and injected i.p. at
the indicated dose.
2.3. Adenouiral uectors
Construction of a recombinant adenovirus encoding for IL-12
(AdiL-12) was previously described (Mazzolini et al., 1999).
testiDa1 induced l ancr
 MOLECULAR ONCOLOGY XXX (2011) 1-14
2.4. In vivo experiments
2.4.1. Subcutaneous CRC model
CT26 cells were injected at a dos e of 5 x 105 cells s.c. into the
right flank of BALB/c rnice (day 0). Tumours were allowed to
reach approximately 85 mm3 in size befare treatment was
started. Animals were distributed in different groups and
then treated with saline i.p.; Cy (50 mg/kg i.p., day 8); AdiL-
12 (109 TCID50 intratumourally (i.t.), day 9); Cy (50 mg/kg
i.p.) + AdiL-12 (10 9 TCID50 i.t.). Adenovirus were diluted in sa-
line (final volume 50 11L) and i.t. injected in a single site; no
leakage of material was observed after inoculations.
2.4.2. Adoptive transfer of CD4+CD25+ T cells (Tregs)
CT26 tumour-bearing rnice (approximately 85 mm3 in size)
were i.p. treated with saline or Cy (50 mglkg i.p, day 8) + AdiL-
12 (109 TCID50 i.t, day 9). Forty-eight and 96 h later, rnice were
injected i.v with 1 x 106 CD4+CD25+ T lymphocytes isolated
by magnetic cell sorting from spleen of non-treated tumour-
bearing rnice excised at day 14 of tumour growth evolution.
2.4.3. Adoptive transfer of CD4+CD25- T cells
2.4.3.1. Preventive model. BALB/c rnice were simultaneously
inoculated with 5 x 105 CT26 cells s.c. into the right flank, and
with 2.5 x 106 CD4+CD25- cells i.v., isolated by magnetic cell
sorting and in vitro re-stimulated, from spleen of saline, Cy,
AdiL-12 or Cy + AdiL-12-treated mice (see Section 2.13 below).
2.4.3.2. Therapeutic model. CT26 tumour-bearing mice (appr-
oximately 65 mm3 in size) were adoptively transferred with
2.5 x 106 CD4+CD25- cells i.v., isolated by magnetic cell sort-
ing, from saline, Cy, AdiL-12 or Cy + AdiL-12-treated rnice.
2.4.4. Pancreatic tumour modei
C57BU6 mice were inoculated in the right flank with 5 x 105
Panc02 cells s.c. When tumours reached 85 mm3 in size, ani-
mals were treated with saline, Cy (50 mglkg i.p., day 8),
AdiL-12 (10 9 TCID50 i.t., day 9) or Cy + AdiL-12. Tumour
growth was assessed twice a week by calliper.
2.4.5. Liver metastatic CRC model
BALB/c mice received an intra-hepatic inoculation of 5 x 105
CT26 cells (day 0). Then, rnice were distributed in experimen-
tal groups and treated with saline; Cy (50 mglkg i.p., day 8);
AdiL-12 (10 9 TCID50 i.t., day 9) or Cy + AdiL-12. At day 20, an-
imals were sacrifi.ced and the volume of metastatic nodules
were measured with calliper.
2.5. Sample preparationfor Tregs and MDSCs cytometry
analysis
BALB/c rnice were injected with S x 105 CT26 cells s.c. into the
right flank (day O) and tumours were allowed to reach 85 mm3
befare the beginning of the treatment. For Tregs analysis, ani-
mals were distributed and treated with saline or Cy + AdiL-12.
At day 15 and 22 (7 and 14 days post-treatment), peripheral blood
was collected by cardiac puncture and anticoagulated with
EDTA. Single splenic and tumoural cell suspensions were
"Please cite tl:s article"in presa as: Yalvic:ini,JL etal., Reversal of gastrointestinal can:inoma-induced immunosuppression and
indncrion of antituDomal immunit;y by a combination of cyclophosphamide and gene transfer of D.-12, Molecular Oncology
,.(2.011), ti10.1016/j.molori.c.2011.03.007
3
obtained bymechanical disruption and then treated with RBC ly-
sis buffer (0.15 mol/L NH4Cl, 1 mmol/L KHC03, 0.1 mmol/L Na2-
EDTA) and washed with PBS 1% bovine serum alburnin, before
flow cytometry analysis. For MDSCs analysis, tumour-bearing
animals were distributed into different groups and treated
with saline, Cy, AdiL-12 or Cy + AdiL-12. The mice were sacri-
ficed on day 15, spleens were excised and single cell suspensions
were prepared for flow cytometry analysis as described below.
MDSCs were phenotypically characterized as CD11b+ Gr1+.
2.6. Generation of bone marrow-derived DCs
DCs were generated from BALB/c rnice as described elsewhere
(Alaniz et al., 2009). Flow cytometric analysis for CD11c and
the capacity to produce IL-12 after LPS activation was per-
formed to certify the presence and functional status of gener-
ated DCs at the end of procedure.
2.7. Cell purification by magnetic cell sorting
Spleen cell suspensions were obtained by mechanical disrup-
tion of spleen from CT26-bearing mice treated with saline, Cy,
AdiL-12 or Cy + AdiL-12. CD4+CD25+ and CD4+CD25- cells
were purified by magnetic cell sorting using a mouse T regula-
tory cell isolation kit and LD plus MS columns according to the
manufacturers' instructions (Miltenyi Biotec, Auburn, CA,
USA). CD4+CD25+ cells (Tregs) obtained were >95% in purity
by flow cytometric analysis of intracellular Foxp3.
2.8. Expansion of CD4+CD25+ T cells and ca-culture
with DCs
Purifi.ed CD4+CD25+ T cells were cultured for 48h with rmiL-2
(10 UI!ml) (Peprotech, Rocky Hill, NJ, USA). Supematants were
collected and used for allogeneic splenocytes proliferation as-
say and cytokines quantification. Tregs and DCs (ratio = 1:1)
were co-cultured for 24 h and then LPS (Sigma Chernicals, St
Louis, MO, USA) was added (1 11g/ml) for additional 24 h.
2.9. Celllabelling
Tregs were labelled with the fluorescent dye Fast DiO (Molec-
ular Probes, Eugene, USA) according to the manufacturer in-
structions. Briefly, cells were incubated with 3 mM Fast DiO
cell solution for 5 rnin at 37 oc in 5% COThumidifi.ed atmo-
sphere and for 15 rnin at 4 oc and then washed with PBS. After
labelling Fast DiO-stained Tregs were diluted in saline and i.v.
injected into mice. Five days later, peripheral blood was col-
lected and rnice were sacrifi.ced. Spleen, liver, tumour and re-
gionallymph nodes were excised from each animal and single
cell suspensions were obtained by digestion with collagenase I
(Calbichem, Merck KGaA, Darmstadt, Germany). The cell
suspension was treated with RBC lysis buffer, washed with
PBS 1% bovine serum alburnin, fi.xed in 1% paraformaldehyde
and then analysed by flow cytometry (FACSAria, BD).
2.10. Flow cytometry
Peripheral blood mononuclear cells, tumour cells or spleno-
cytes were stained with the following conjugated antibodies:
 4 MOLECULAR ONCOLOGY XXX (2011) 1-14
phycoeritrin-anti-Foxp3 (eBioscience), PEeyS-anti-eD4 (BD
Biosciences), allophycocyanin-anti-eDllb (BD Biosciences),
PE-anti-Grl (BD Bioscience) and their respective isotypes.
Des were stained with APe-anti-eDllc (kindly provided by
Dr. Gabriel Rabinovich, IByME, Argentina), PE-anti-MHeii (BD
biosciences), FITe- anti-eD40 (BD biosciences) and their re-
spective isotypes. eel!s were fixed with 1% paraformaldehyde
and subjected to flow cytometry (FAeSAria, BD). Data were
analysed using WinMDI software.
2.11. eytokine quantificationby ELISA
Transforrning growth factor-) (TGF-3), IL-10 and IL-12 concen-
trations in culture supernatants were measured by specific
ELISA kits (OptEIA, BD Biosciences Pharrningen for IL-10 and
IL-12 and R&D Systems for TGF-3). Assays were carried out
according to the instructions provided by the manufacturers.
2.12. Allogeneic splenocytes proliferation assay
Borre marrow-derived Des (1 x 105 ) from BALB/c rnice were
treated for 20 min with 50 .tg/ml mitomycin e (Sigma ehemi-
cal,St. Louis, MO, USA), washed and used as stimulators. Sple-
nocytes (1 x 106 ) from naive e57BU6 mice were plated in
U-bottom 96-well plates ata ratio of 1:10 (Des: splenocytes).
Assays were carried out in the presence ofTregs supernatants
derived from saline, ey, AdiL-12 or Cy + AdiL-12-treated rnice.
Cell proliferation was evaluated after 4 days in culture, as de-
scribed elsewhere (Malvicini et al., 2009).
2.13. In vitro re-stimulation of CD4+CD25- T cells
BALB/c rnice were injected with CT26 cells and treated with
Cy, AdL-12 or Cy + AdiL-12 as described above. Splenocytes
were isolated 14 days after treatment and CD4+CD25- T cells
were obtained by immunomagnetic selection. Then, purified
CD4+eD25- T cells were pooled, and 4 x 106 cel!s/ml were
co-cultured with rnitomycin C-treated CT26 cells (4 x 105/ml)
and mitomycin C-treated splenocytes (4 x 105/ml) in a 24-
well plate (1 mi/well) with 10 UI/ml rmiL-2. Seven days later,
viable cells were harvested and washed, adjusted to 4 x 106/
mL, and co-cultured again with rnitomycin e-treated eT26
cells and splenocytes. On day 14, CD4+CD25- T cel!s were
used for in vivo adoptive T cells transfer experiments.
2.14. Statistical analysis
Mann Whitney, Kruskal-Wallis tests and Kaplan-Meier, log
rank (InStat, GraphPad Software) were used to statistically ex-
amine the differences between groups. P < 0.05 was consid-
ered statistically significant.
3. Results
3.1. Tregs depletion is required to generate an effective
antitumoural response after treatment with Cy +AdiL-12
We previously demonstrated that the sequential adrninistration
of Cy followed by adenoviral gene transfer of IL-12 induced
'Please cite tbis arti<;1e in pmss as: Malvicini, M. et al, Reversa! of gastrointestinal carcinoma-induced immunosuppression and
induction of antitumoural immunity by a combination of cyclophosphamide and gene transfer of U.-12, Molecular Oncology
(2Q1~!lrJJ~Q:12!M1!PJl'()nc.2Q).1.03,gJ7
a synergistic antitumoural effect on s.c. CRC model (CT26)
(Malvicini et al., 2009). Two well defined groups were found in
Cy + AdiL-12-treated rnice. The two categories were identified
as responders (R) and non-responders (NR) mice, depending on
whether they showed a >50% in tumour size reduction or not.
Post-treatrnent tumour sizes in NR mice at days 7 and 14 post-
treatrnent were significantly higher (566 143 and
614 92 mm3 , respectively) than in R mice (58 19 and
126 58 mm3 , respectively) (p < 0.01) (Fig. lA). To determine
whetherimmunosuppressive T cell-mediated mechanisms could
be involved in the observed differential antitumoural response
obtained after treatrnent with Cy + AdiL-12, we first analysed
the prevalence of Tregs in peripheral blood and spleens using
triple-staining flow cytometry. While the levels of CD4+ T cel!s
were similar for either untreated mice or treated with the combi-
nation (Supplementaryfigure#l), the percentage ofTregs was sig-
nificantly higherin NR than in R mice ( p < 0.05), in both peripheral
blood and spleens (Fig. lB and C). In addition, we observed an in-
crease in the percentage of tumour-infiltrating CD4+ cells in R
mice compared to NR and satine groups ( p < 0.05; Fig. lD, left
panel). The tumour-infiltrating CD4+eD25+Foxp3+/CD4+ pro-
portian were evaluated in the same experiment. The percentage
of Tregs in R was significantly lower than in untreated mice
(P < 0.05, Fig. 1D, right panel). On day 14, the percentage ofintra-
tumoural Tregs in Rwas lower than in NR and satine-treated mice
( p < 0.05), in agreement with the results obtained in peripheral
blood and spleen. These results showed an association between
increased circulating and tumour-infiltrating Tregs with tumour
resistance to combined ey + AdiL-12 therapy. These results indi-
cate that depletion ofTregs is critica! to achieve a therapeutic ben-
efit in CT26 CRC-bearing mice.
To confirm the inhibitory effect ofTregs on the antitumoural
efficacy of combined therapy, we adoptively transferred
CD4+CD25+Foxp3+ T cells into CT26 tumour-bearing rnice
that were treated with the combination. Thus, 1 x 106
eD4+CD25+Foxp3+ T cel!s derived from untreated tumour-
bearing mice were administered i. v. on days 11 and 13 after tu-
mour inoculation (days 2 and 4 after the combined treatment
with ey + AdiL-12). As a result, adoptive transfer ofTregs signif-
icantly abolished the antitumoural effect achieved with the
combined treatment (mean tumour volume SE [mm3 ] at day
28, Cy + AdiL-12: 144 81 vs. ey + AdiL-12+ Tregs: 3191 394,
p < 0.01; Fig. 2A). Moreover, animal survival was strongly re-
duced after adoptive transfer of Tregs, showing a similar val u e
in saline group (Fig. 2B). The trafficking behaviour of adminis-
tered Tregs was also analysed. Interestingly, FastDio-stained
Tregs injected i.v. revealed that Tregs were distributed in differ-
ent organs, with higher levels in peripheral blood,lymph nades
and tumours (Fig. 2C). Altogether, these results strongly suggest
that, at least in this tumour model, CD4+eD25+Foxp3+ T cel!s
should be inhibited in arder to achieve a potent antitumoural
immune response.
3.2. Combined therapy with Cy + AdiL-12 reverts the
inhibitory effects of Tregs on DCs activation
We investigated the effects of Cy + AdiL-12 on the immunosup-
pressive functions ofTregs derived from eT26 tumour-bearing
rnice. Thus, we decided to assess the effects of combined ther-
apy on the ability ofTregs to modulate not onlythe number but
 lv!OLECULAR ONCOLOGY XXX (2011) 1-14 5

A 8 perlpheral blood e spleen

, C,.""--1> Ni IL-12 R
~~
~Saln
Saline
1000 e C,>M. l

1 21.2%
'i aoo 17.7% 1 .1. 13.8% ' 2.9%
..
~
Day7 ! ---
!~! . 1
11..---"-
-~..
600
o
i 400
... . .;.. ~
-~ ..:. . . -' FoxpJ - Foxp3
~

~ ~ -
200

' ___:_ '1 "' 1 ... '/..___-:

""'"~ '_ .-: '_e_ '14~ l~~-. -_ L.
- - - - - - - - - - - - - Foxp3 Foxp3
D tumour

:~~1>-NR 1 _Ad_4:_~_1_:R :~(J(-A-'~-~~%-1_'_"~~ ;M: 1> R

Saline

.1
-li~
2.3%
Oay7

.L-. """'"
... a!ofl'eC)'S

- - - - - - - - - - - - - - C04
..- '"coc~ ... _. .. .. . . . . 0111 ... ...

- - - - - - - - - - - - - Foxp3
~ .-.. .. ~ ~-~~~-.. - - ..

~"it_ Lt;_ ll:. l.L ~l ~ :~ C04 - -

.
..:. Foxp3

Fig. 1 - Assessment ofTregs in miceR (responder) and NR (non-responders) to combined treatment Cy + AdiL-12 in s.c CT26 tnmour model.
(A) Tunzour volunze in R and NR nzice. BALE/e mice (n = 35) were s.c. inoculated with 5 X 105 CT26 cells into the right flank (day O) and tumours
were allowed to reach 85 mm3 before the treatment began. Animals were treated with Cy (50 mglkg i.p., day 8) + AdiL-12 (109 TCID50 i.t., day
9) (n = 12) or with saline (n = 6). Tumour growth was assessed twice a week by calliper. Tumour volumes at days 7 and 14 after treatment are
expressed as mean (bars, SEM). The experiment was performed four times. Mann Whitney test, Cy + AdiL-12 NR vs. Cy + AdlL-12 R:
(##p < 0.01). Percentage ofCD4+CD25+Foxp3+1CD4+ cells in peripheral blood (B) or spleen (C) ofR and NR nzice. Mann Whitney test, Peripheral
blood, day 7 and day 14: Cy + AdiL-12 R vs. saline (**p < 0.01) and vs. Cy + AdiL-12 NR (#p < 0.05). Spleen, day 7: Cy + AdiL-12 R vs. saline
and Cy + AdlL-12 NR (#p < 0.05); Cy + AdiL-12 NR vs. saline (*p < 0.05); day 14: Cy + AdiL-12 R vs. saline and Cy + AdiL-12 NR (*and
#p < 0.05). (D) Percentage oftunzour-infiltrating CD4+ Tcells {lift) and CD4+CD25+Foxp3+1CD4+ cells (right). Mann-Whitney test, CD4+
Tcells, day 7: Cy + AdiL-12 R vs. saline, (*p < 0.05); day 14: Cy + AdiL-12 R vs. saline and Cy + AdiL-12 NR (#p < 0.05); Cy + AdiL-12 NR
vs. saline (*p < 0.05). CD4+CD25+Foxp3+1CD4+ cells, day 7: Cy + AdlL-12 R vs. saline, (*p < 0.05); day 14: Cy + AdiL-12 R vs. saline and
Cy + AdiL-12 NR (#p < 0.05). The results shown represent four independent experiments.

also the maturation and/or functional status of DCs. To this
end, nalve DCs were co-cultured with Tregs isolated from dif-
ferent experimental groups. When DCs were cultured with
saline-derived Tregs there was a significant reduction in the
production ofiL-12 as well as in the expression ofMHC-11 and
the CD40 co-stimulatory molecules induced by LPS ( p < 0.05,
Fig. 3A and B). In contrary, when DCs were cultured in the pres-
ence of Cy +AdiL-12-treated mice-derived Tregs, they showed
a similar pattem of activation, IL-12 production and MHC-II-
CD40 expression phenotype than the observed in control DCs
after LPS stimulation.
3.3. Combined therapy with Cy + AdiL-12 reverts Tregs-
immunosuppressive phenotype by reducing IL-10 and TGF-{J
production
We investigate in uitro the secretion of IL-10 and TGF-[3 by
Tregs derived from spleens of CT26 tumour-bearing mice,
Please cite this article in press as: Malvicini, M. et al., Reversal of gastrointestinal carcinoma-induced immunosuppression and
induction of antitumoural immunity by a combination of cyclophosphamide and gene transfer of IL-12, Molecular Oncology
(2011), doi:10.1016/j.molonc.2011.03.007
untreated or treated with Cy, AdiL-12 or with a combination
of both. We found that Tregs from untreated mice (saline
group) produced high levels of IL-10 and TGF-[3 (mean SEM
[mm 3]: 172 8, and 3820 213 pg/ml, respectively; (Fig. 3C
and D). In contrast, we observed that Tregs of mice treated
with a single agent (Cy or AdiL-12) produced significantly
lower amounts ofboth cytokines (IL-10: 41 Sor 62 11 pg/
ml, respectively [p < 0,05 vs. saline]; TGF-[3: 926 35 or
866 42 pg/ml, respectively [p < 0,01 vs. saline]). Importantly,
Cy + AdiL-12 induced further inhibition ofiL-10 and TGF- [3 pro-
duction by Tregs, in comparison to saline and single treat-
ments (11 8 pg/ml; p < 0,05 and 647 43 pg/ml; p < 0,01,
respectively). Consistently with these results, supematants
of Tregs from untreated tumour-bearing mice inhibited DCs
stimulated allogeneic splenocytes proliferation (Fig. 3E). How-
ever, when supematants of Tregs derived from CT26-bearing
animals treated with Cy + AdiL-12 were assayed, a strong pro-
liferation activity was detected. Tregs cell viability from all
 6 l'l'! OLE e U LAR ON e O LO G Y XXX ( 2 O11) 1-14

A 4000 -ti- Saline B 1oo

kl1~
~- Saline plus Tregs
_,_. Cy+Adll-12 80
3500
Cy+Adll-12 plus Tregs

J. . **
M'
3000
'
!
~ 2500 20
., Ll
E
::>
o> 2000 0+------- -----~-----,
o 20 40 60
L
::>
o Days after tumour inoculation
E 1500 /)
::>
1- .,.,/ / e
1000
/ti / +
o
500

~4t"~
!: J
./"' ,f< ...
i5
....
..
!:.
o C)
o
,"'
5 10 15 20 25 30
~
++
Tregs
Oays after tumor lnoculatlon

t
..1:"'
,._
..
!:;
,._
o
o~

Fig. 2- Re-infusion ofTregs in CT26-bearing mice treated with the combination Cy + AdiL-12. (A) Tumour growth: BALE/e mice were s.c.
inocnlated with 5 X 105 CT26 cells into the right flank (day O) and tumours were allowed to reach 85 mm3 before the treatrnent began. Animals
(n = 6/group) were treated with saline or Cy (50 mglkg i.p., day 8) + AdiL-12 (10 9 TCID50 i.t., day 9). In addition,saline or Cy + AdiL-12-
treated mice were inoculated i.v. on days 11 and 13 with 1 X 106 CD4+CD25+ T cells (Tregs) isolated from untreated tumour-bearing mice.
Tumour volume was assessed twice a week by calliper. The experiment was performed four times. Data are expressed as mean (bars, SEM).
Kruskal-Wallis test, day 28: Cy + AdiL-12 vs. saline and Cy + AdlL-12+Tregs (*p < 0.05). B) Survival: Kaplan-Meier, log rank test,
(**p < 0.01), C) In vivo distribution pattem of re~infitsed Tregs: Cy + AdiL-12-treated mice were inoculated with 1 X 106 fastDiO-dyed
CD4+ CD25 + T cells (i.v; days 11 and 13) and biodistribution was analysed by flow cytometry. The results shown represent three independent
experiments.

groups was confirmed by trypan blue exclusion test (not
shown); no evidence of apoptosis was observed by TUNEL as-
say in all groups (data no shown). Altogether, these results
suggest that treatment of CT26-bearing mice with
Cy + Ad!L-12 reverts the inhibitory activity of Tregs on DCs,
probably by reduction of IL-10 and/or TGF-13 secretion.
3.4. Depletion of MDSCs induced by the combination of
Cy with AdiL-12 is reverted after re-infusion ofTregs
splenic MDSCs ( p < 0.01; Fig. 4A). Interestingly, these reduced
levels of MDSCs induced after Cy + Ad!L-12 treatment
returned to baseline when Tregs from untreated tumour-
bearing mice were adoptively transferred (Fig. 4B). These
results suggest that the combined treatment affect the pro-
portian of MDSCs. Also, the restitution of MDCSs levels after
adoptive transfer of Tregs in Cy + Ad!L-12-treated mice
suggests a cross-regulation between both cell types in our
tumour modeL

It has been demonstrated that MDSCs contribute to generate 3.5. Adoptive transfer of in vitro expanded speciftc
an immunosuppressive microenvironment leading to tumour IFN-r secreting CD4+ T lymphocytes derived from
progression (Huang et aL, 2006). We decided to investigate Cy + AdiL-12-treated mice has potent antitumoural effects
whether Cy + Ad!L-12 could affect the number of splenic
MDSCs. The prevalence of CD11b+Gr1+ cells (Bronte et aL, We have previously found that sequential treatment of mice
1998) was determined in spleens derived from CT26 bearing CT26 with Cy followed by AdiL-12 significantly
tumour-bearing mice treated with Cy, Ad!L-12 or the combi- increased IFN-y secretion by CD4+ T lymphocytes (Malvicini
nation by flow cytometry. We observed that Cy or Ad!L-12 et aL, 2009). Here, we decided to further assess whether in vitro
as a single treatment induced a slight decrease in the amount expanded CD4+CD25- T cells (from here on CD4+) might have
of MDSCs in comparison to the saline group. However, a direct therapeutic activity in vivo after i.v. injection in two
Cy + Ad!L-12 induced a 3-fold decrease in the percentage of models. In a therapeutic model (Fig. SA), CD4+ T cells from
Please cite this article in press as: Malvicini, M. et aL, Reversa! of gastrointestinal carcinoma-induced immunosuppression and
induction of antitumoural immunity by a combination of cyclophosphamide and gene transfer of IL-12, Molecular Oncology
(2011), doi:10.1016/j.molonc.2011.03.007
 lVIOLECULAR ONCOLOGY XXX (2011) 1-14 7

8 oc 1
DC+Tregs (sal...) DC+Tregs (Cy)
1
DC+Tregs (Adll12) 1 DC+Tregs (Cy+Adll12)
l

CD11e

:l/b\'"
-:;--~-~-~ ...
1

'11 ; -
l\
.J \.___.. -. . .
32.%.

c:lllc,~t

1 37%
MHCII li
!l \--~~~~-=-

~ ~
1
v<
~-------~
IPE ~ ~
.L _._:c,.:__,
~
__ _
"'""'PE . ,.

, 1;

' !

C040 !
'
1
45%
!1 24%
!1
!
38% 35%
! 40%

! 1
.i .-~ ...~.-~~-~- .,., ~-------

~,u.c
.i
'""""' '""""'
e

50

Fig. 3 - Effect of combined tberapy Cy + AdiL-12 on tbe interaction DC/Tregs. A) Quantijication rif IL-12: Data are expressed as mean (hars,
SEM). Kruskal-Wallis and Dunn's multiple comparisons test: DC vs. DC+Tregs (saline), *p < 0.05; DC+Tregs (saline) vs. DC+Tregs
(Cy + AdiL-12), ***p < 0.001. B) Pbenotype of DCs (CD11c+MHC-II+CD40+). Mann Whitney test: DC vs. DC + Tregs (saline), *p < 0.05;
DC + Tregs (saline) vs. DC+ Tregs (Cy + AdiL-12), *p < 0,05. The results shown represent tbree independent experiments. IL-10 (C)and TGF-
{3 (D) secretion by Tregs: Mann Whitney test, saline vs. Cy, AdiL-12, and Cy + AdiL-12, *p < 0.05; Cy + AdiL-12 vs. Cy and AdiL-12;
#p < 0.05. (E) Effect ofTregs supernatants (SN) on allogeneic spleen cell (SC) proliferation under stimulation witb mitomycin C-treated DC.
fH-Tbymidine). Mann Whitneytest, SC+DCvs. SC+DC+Tregs SN (saline), ***p < 0.001; SC+DC+Tregs SN (saline)vs. SC+DC+Tregs
SN (Cy + AdiL-12), ***p < 0.001.

mice treated with Cy or Ad!L-12 as single agents were devoid of Ad!L-12) (Fig. 5C). The specificity of cytotoxic effect was con-
any significant effect on tumour growth and survival. On the firmed against BNL cells.
contrary, CD4+ T cells from mice treated with Cy + Ad!L-12
showed a significant reduction of tumour volume {89% vs. sa- 3.6. Cy + AdiL-12 is highly effective in two stringent
line group at day 23, p < 0,05; 81% and 78% vs. Cy and Ad!L-12 gastrointestinal cancer models
groups, respective!y; at day 28, p < 0,05) andan increase in ani-
mal survival ( p < 0.01). Similar result was obtained when CD4+ In order to examine whether combined treatment exert anti-
T cells from combined treatment were adoptively transferred in tumoural effects in aggressive tumour models we investigated
a preventive tumour model {Fig. 5B). On the other hand, we in- its therapeutic efficacy in a liver metastatic CRC model using
vestigated the in vitro cytotoxic activity of CD4+ T cells used CT26 cells and also against an established pancreatic cancer
for in vivo experiments and saw that cells derived from mice re- model using Panc02 cells. For this purpose, we injected CT26
ceivingthe combined treatment displayed a significantly higher cells into the liver of mice (day 0), treated with Cy (day 10)
lytic activity against CT26 cells ( p < 0.001 vs. saline; p < 0.01 vs. and 24 h later with Ad!L-12. Fig. 6A (left panel) shows that
Cy or Ad!L-12) and produced higher levels ofiFN-y in compari- no significant antimetastatic effect was observed when only
son with control group ( p < 0.001 vs. saline; p < 0.01 vs. Cy or Cy and Ad!L-12 were administered, whereas the combined
Please cite this article in press as: Malvicini, M. et al., Reversa! of gastrointestinal carcinoma-induced immunosuppression and
induction of antitumoural immunity by a combination of cyclophosphamide and gene transfer of IL-12, Molecular Oncology
(2011), doi:10.1016/j.molonc.2011.03.007
8 lv!OLECULAR ONCOLOGY XXX(2011) 1-14

Salina
A
20
~
e..
lt)

~ 15
u
u
"E
CD
g.1o AdiL-12 Cy+AdiL-12
+
1:
C)
+
.e
.....
.....
o
o

~(:-e
t::>~

B Salina Cy+AdiL-12 plus Trags

.e
~
e.. ......
o
o

u
"E
CD
'ii
lf)
10
+
1: Cy+AdlL-12
C)
+ ** il
.e
.....
.....
o
o

Gr1

Fig. 4 - (A) E.ffect of combined treatment Cy + AdiL-12 on splenic MDSCs (CD11b+Gr1+): Mann Whitney test, saline vs. Cy + Ad-12
(**p < 0.01). Data are representative of three independent experiments (n = 5/group per experiment) B) E.ffect of in vivo administration oJTregs on
splenic MDSCs in mice treated with the combination Cy + AdiL-12. Mann Whitney test, Cy + AdiL-12 vs. Saline, **p < 0,01 and Cy + AdiL-12
plus Tregs, #p < 0.05. Data are representative of two independent experiments (n = 6/group per experiment).

therapy showed a significant reduction in metastases growth (70% and 74% at day 54, respectively). However, no complete
(98% vs. saline group, at day 20, p < 0.001). Therapeutic efficacy tumour regression was observed in mice treated with a single
of the combination was superior to each individual agent therapy. In contrast, the combined therapy resulted in
(mean metastases volumeSE [mm3 ] at day 20: Cy + AdiL- a marked reduction in tumour volume (95% vs. saline group,
12: 15,6 11,7; Cy: 191 87,4; and Ad!L-12: 306 167; at day 54; p < 0,05) and complete tumour regressions in 40%
p < 0.01) and complete metastases regressions were observed of animals (4/10) (Fig. 6B, left panel). Importantly, the com-
in 7 out of 15 animals (47% vs. 0% in saline and single agents bined treatment produced a significant reduction in tumour
groups). In addition, survival of mice receiving combined ther- growth in comparison to the effects of each single agent
apy was significan tiy higher than the controls ( p < 0.001; (mean tumour volume SE [mm 3] at day 54; Cy + Ad!L-12:
Fig. 6A; right panel). Remarkably, Cy followed by Ad!L-12 209 127; Cy: 1330 358; Ad!L-12: 1177 173; p < 0.05). Sur-
showed a potent antitumoural effect on Panc02 tumour nod- viva! of mice receiving combined therapy was also signifi-
ules. Animals treated only with Cy or Ad!L-12 showed a signif- cantly increased in comparison to mice receiving individual
icant reduction in tumour volume with respect to saline group therapy or saline ( p < 0.001, Fig. 6B; right panel). Analysis of
Please cite this article in press as: Malvicini, M. et al., Reversa! of gastrointestinal carcinoma-induced immunosuppression and
induction of antitumoural immunity by a combination of cyclophosphamide and gene transfer of IL-12, Molecular Oncology
(2011), doi:10.1016/j .molonc.2011.03.007
 J\IOLECULAR ONCOLOGY XXX (2011) 1-14 9

A 35oo
C04+CD25- (satine)
3000 ~ C04+CD25- (Cy)
........- C04+CD25- (Adll-12)
~ C04+CD25- (Cy + Adll12)
C04+CD25- (saline) -+- C04+CD25- (Adll-12)
~ 2500
-+ C04+CD25- (Cy) ~ C04+CD25- (Cy +Adll12)
.
G> 100,----...,.,--,-,
E 2000
:::1
o>
5
o
1500 -
~
!....
-
80

60

E >
1000
~ ;;:
.... 40
:::1
(/)
500 20

0+----r----.-, _...,.__.,.---r---.
10 20 30 o 10 20 30 40 50 60
Days after tumour inoculation Oays after tumour inoculation

B 3500 C04+CD25- (saline)

-+ C04+CD25- (Cy)
3000 -+- C04+CD25- (Adll-12)
~ C04+CD25- (Cy + Adll12)
C04+CD25- (saline) -+- CD4+CD25- (Adll-12)
~ 2500 -+ C04+CD25- (Cy) ....,._ C04+CD25- (Cy +Adll.12)
.
G> 100~---------.---,.--,
2000

o> 80
...:::1 ~
o - 60
~ >
"E;: 40
(/)
20

0+---~--~-~~--~~~---,
o 10 20 30 40 50 60
Days after tumour inoculation Days after tumour inoculation

e 80
- CT26
C BNL
***" 1000

60 800
.....
~
!1.....
... 40

C)
- S:
:J Lt
~
20

o
~~ Ci~ ~ ~
,$-0
":>~
(j.
.;""' ""'
~~ t::J'Ii ~
"'i-ti
~
'i-ti
ej. " ej.

Fig. 5 - Antitumour effect of in vitro expanded CD4 + T -lymphocytes from CT26-bearing mice treated with Cy, AdiL-12 or Cy + AdiL-12. (A)
Therapeutic model: BALB/c mice were s.c. inoculated with 5 X 105 CT26 cells into the right flank (day O) and when tumours reached 65 mm3 in size
(day 6) the mice were treated with vitro expanded CD4+ cells (2,5 X 106 i.v) from different experimental groups (n = 4/group) {lift panel). Data
are expressed as mean (bars, SEM). Mann Whituey test, days 23 and 28: CD4+CD25- (Cy + AdiL-12) vs. CD4+CD25- (saline, Cy and
AdiL-12), *p < 0.05. Survival (right panel). Kaplan-Meier, log rank test, **p < 0.01. Data are representative of three independent experiments.
B) Preventive model: BALB/c mice (n = 4/group) were simultaneously inoculated with 5 X 105 CT26 cells s.c. into the right flank and adoptive
transfer of 2,5 X 106 CD4 + cells at the same time (day O) {lift panel). Data are expressed as mean (bars, SEM). Mann Whituey test, days 23 and
26:CD4+CD25- (Cy + AdiL-12) vs. CD4+CD25- (saline, Cy andAdiL-12), p < 0.05. Survival (rightpanel). Kaplan-Meier, log rank test,
**p < 0.01. Data are representative of three independent experiments. C) Specific CTL adivity {liftt panel): CD4+ T cells from different

Please cite this article in press as: Malvicini, M. et al., Reversa! of gastrointestinal carcinoma-induced immunosuppression and
induction of antitumoural immunity by a combination of cyclophosphamide and gene transfer of IL-12, Molecular Oncology
(2011), doi:10.1016/j .molonc.2011.03.007
 10 MOLECULAR ONCOLOGY XXX (2011) 1-14

the in vivo interaction between both treatments was per-
formed by the fractional product method (FTV) (Yokoyama
et al., 2000). Fig. 6C summarises the relative tumour volume
of different groups at 4 different time points. On day 29 after
treatment, in the combination group there was a 1.3-fold im-
provement in the antitumour efficacy when compared to the
expected additive effect. On days 33 and 36, Cy + AdiL-12
showed a 1.4-fold increase in the inhibition of tumour growth
over an additive effect (expected fractional tumour volume).
Moreover, on day 40 the increase was of 1.7-fold over the ad-
ditive effect. These results allow us to conclude that
Cy + AdiL-12 has a synergistic effect on pancreatic carcinoma
growth inhibition. Similar doses of control adenovirus (Adi3-
Gal), alone or in combination with Cy, did not produce any sig-
nificant change of tumour growth in both experimental
models (data no shown). In both tumour models, the com-
bined Cy plus AdiL-12 strategy was well tolerated with no
signs of toxicity (data not shown). Altogether, these results
show that the antitumour effects of the combined treatment
can be achieved in very aggressive tumour models including
pancreatic cancer.
4. Discussion
A number of immunotherapy strategies for advanced GIC are
currently under preclinical and clinical evaluation (Mazzolini
et al., 2007). However, there is a frustrating inconsistency in
the correlation between biological and clinical responses.
The reasons for the mentioned data discrepancies are mani-
fold but the presence of strong mechanisms of immune es-
cape induced by tumours appears to be important (Clark
et al., 2009; Croci et al., 2007). Thus, it seemed reasonable to
explore immunotherapy strategies aimed at inducing rever-
sien of tolerogenic processes in tumour-bearing hosts, such
as those induced by Tregs (Zou, 2006).
We have previously demonstrated the synergistic antitu-
moural effect of sequential systernic administration of sub-
optimal Cy doses followed by immuno-gene therapy with
AdiL-12 in rnice with CRC (Malvicini et al., 2009). One impor-
tant finding was that, regardless of the individual response
of each mouse, the synergistic antitumour activity was associ-
ated with depletion of regulatory T cells.
We analysed the levels of Tregs after treatment with the
combination and classified them according to the treatment
response in R and NR rnice. As a result, we observed that NR
mice failed to significantly decrease Tregs significantly in
spleen, peripheral blood, and inside tumours. The relevance
of Tregs depletion to achieve a therapeutic response in our
model was consisten! when the efficacy of Cy + AdiL-12 was
completely abolished following reconstitution of Tregs by
adoptive transfer. Importantly, the levels of Tregs reached
with adoptive therapy in Cy + AdiL-12-treated rnice (Fig. 2C)
were similar to the percentages of Tregs found in NR rnice
(Fig. 1B; 1D). Considering that Tregs are up regulated in cancer
and that they induce a detrimental effect on the immune sys-
tem, strategies aimed at reducing Tregs number may increase
the efficacy of any immunotherapy (Curiel et al., 2004;
Orrnandy et al., 2005; Sakaguchi et al., 2001). A myriad of in-
hibitory mechanisms have been proposed to explain the im-
munosuppression induced by Tregs, including secretion of
cytokine suppressors and the induction of apoptosis/cell cycle
arrest on effector T cells (Tang and Bluestone, 2008). It has also
been suggested that Tregs could modulate the maturation
and/or function of DCs (Larmonier et al., 2007; Onishi et al.,
2008). Indeed, intravital rnicroscopy studies have suggested
that Tregs contact DCs more frequently than potential effector
T cell targets (Bluestone and Tang, 2005). Taking into account
the current data regarding Tregs function in cancer and to the
way tumour cells drive Tregs induction, we decided to inves-
tigate the immunosuppressive effects of Tregs derived from
tumour-bearing rnice and the effects of the combined Cy
and AdiL-12 treatment on their regulatory capacity (Beyer
and Schultze, 2006; Ghiringhelli et al., 2005).
Previously we demonstrated that in vivo treatment with
Cy + AdiL-12 affected the maturation status ofDCs. Currently,
we provide new evidence showing that this effect is mediated,
at least in part, by Tregs. Ca-cultures of nai:ve DC with Tregs
from untreated animal tumours resulted in a significant inhi-
bition of IL-12 production as well as in MHC-II and CD40 ex-
pression by DCs. More importantly, the inhibitory activity of
Tregs on the maturation/activation status of DCs was com-
pletely abolished when Tregs derived from mice that received
Cy + AdiL-12 were used.
The mechanisms used by Tregs to generate immunosup-
pression remain conflictive and controversia!. Direct cell-cell
interaction between Tregs and their target cells (effector
T cells or DCs) has been established as a prerequisite to exert
their immunoregulatory activity (Vignali et al., 2008). On the
other hand, the role of soluble factors, such as IL-10 and
TGF-13 has also been investigated extensively (Dieckmann
et al., 2001; Takahashi et al., 1998; Thornton and Shevach,
1998). In the present work, we have detected high levels of
both cytokines in supernatants of Tregs isolated from spleen
of untreated tumours. These supernatants containing high
levels ofiL-10 and TGF-13 were able to inhibit allogeneic sple-
nocytes proliferation under stimulation with DCs. It is impor-
tant to note that Cy + AdiL-12 significantly reduced the
production of IL-10 and TGF-13 by Tregs and also abolished
their inhibitory effect on lymphocyte proliferation. Alto-
gether, our results suggest that treatment of CRC-bearing
rnice with Cy + AdiL-12 not only induces CD4+CD25+Foxp3+

experimental groups (n = 4/group) were isolated and stimulated in vitro with mitomycin C-treated splenocytes and CT26 cells for 5 days. Specific
CTL activity was evaluated against CT26 and BNL cells. The percentage of specific cytotoxicity was quantified whit the LDH Cytotoxicity
Detection Kit and calculated according to the following formula: ([abs 492 nm experimental- abs 492 nm background])/[abs 492 nm maximum-
abs492 nm background]) X 100. Mano Whitney test, Cy + AdiL-U vs. saline, -p < 0.001; Cy + AdiL-12 vs. Cy and AdiL-12, #:ll#p < 0.01.
Data represent the mean of triplicate cultures. Quantification rif IFNy (right panel}: The amount of IFN-y secreted by CD4+ T cells was evaluated
after its isolation and in vitro stimulation as described above. Data are expressed as mean (bars, SEM). Kruskal-Wallis and Dunn's multiple
comparisons test: Cy + AdiL-U vs. saline, -p < 0.001; Cy + AdiL-12 vs. Cy and AdiL-12, ##p < 0.01.
7
Please cite this anide in press as: Yalvicini, M. et al., Reversa) of gastrointestinal can::inoma-induced mmunosuppression and
induction of antitumoural immunity by a combination of cyclophosphamide and gene transfer of n.-12, Molecular Oncology
J?011}, doi:10.t!ll{m.qt.qn~.20-ll~~-~Q07
 :MOLECULAR ONCOLOGY XXX(2011) 1-14 11

A 14oo

Saline ..... Cy-+- AdiL-12 ....,_ Cy + Ad IL-12

~ 100
..
..
.,
~.,
80

..
.f! ~
~
60

..
E
....
>
::::
-;
>
>....
:;, 40
en
20

Days after tumour inoculation

8 4000 Saline
-+- Ad1L12
3500 -+-Cy
......... Cy+Adll12
;;- 3000
Saln e ..... Cy -+- Adll-12 ....,_ Cy + Adll-12
E

..
..
E
:;,
2500

o> 2000
....
:;,
o 1500 -;
E
:;,
>
1- 1000 1::;, 40
en
500 20

o o~~~.~~~~~~~~~
o 10 20 30 40 50 60 o 20 40 60 80 100
Days after tumour lnoculation Days after tumour inoculation

cr .Yn.-1! E:q><etod' OnaTed R'

(50g;'kc) (IO'TCD50)
29 0.25] 0.219 o.oss O.C4~ 1.3
0.2i6 0.::65 o.on O.OSl 1.4
36 6.276 o.!ss 6.671 6.631 1.4
40 0.31~ 0.2'' o.cs6 o.osi 1.7

Fig. 6- Effect of combined treatment Cy + AdiL-12 on aggressive GIC models. A) Experimentalliver metastases r:fCRC (CT26). Left panel, Liver
metastases volume: BALB/c mice received an intra-hepatic injection of 5 X 105 CT26 cells (day O). Mice were distributed in different experimental
groups and treated with saline (n = 6); Cy (50 mglkg i.p; day 8, n = 6); AdiL-12 (10 9 TCID50 i.t; day 9, n = 6); or Cy + AdiL-12 (n = 8).
Metastases volume was measured at day 20. Data are representative of three independent experiments. Mann Whitney test: Cy + AdiL-12 vs.
saline (***p < 0.001); Cy + AdiL-12 vs. AdiL-12 or Cy (##p < 0.01). Right panel, Survival: Kaplan-Meier, log rank test, (-p < 0.001). B)
Pancreatic tumour model {Panc02}. Left Panel, Tumour growth: C57BL/6 mice were inoculated s.c. in the right flank with 5 X 105 Panc02 cells.
Treatments began when tnmours reached 85 mm3 in size. Animals were treated with saline (n = 6), Cy (50 mglkg i.p; day 8, n = 5), AdiL-12 (10 9
TCID50 i.t; day 9, n = 5), or Cy + AdlL-12 (n = 6). Tumour growth was assessed twice a week by calliper. Data are expressed as mean (bars,
SEM). Data are representative of three independent experiments. Mann Whitney test: Cy + AdiL-12 vs. Cy or AdlL-12 (*p < 0.05). Right panel,
Survival: Kaplan-Meier, log rank test (***p < 0.001). C) Analysis of the in vivo interaction between Cy and AdlL-12 by the fractional product
method (FTV) in Panc02 model. a ITV (experimental mean tnmour volume)/(control mean tumour volume); b Day after treatment onset; e (Cy
mean FTV) X (AdiL-12 mean FTV); d R = Expected ITV/Observed ITV. A ratio > 1 indicates a synergistic effect, and a ratio < 1 indicates
a less than additive effect.

T cell depletion but also modifies its functionality, at least by immunoregulatory mechanisms associated with the synergis-
reduction of IL-10 and TGF-~ production. Our present results tic antitumour effects achieved with Cy + AdiL-12.
strongly suggest that depletion of Tregs and/or inhibition of Recently, myeloid-derived suppressor cells (MDSCs) have
Tregs ability to induce immunosuppression are key been recognized as a cell population that can negatively
Please cite this article in press as: Malvicini, M. et al., Reversal of gastrointestinal carcinoma-induced immunosuppression and
induction of antitumoural immunity by a combination of cyclophosphamide and gene transfer of IL-12, Molecular Oncology
(2011), doi:10.1016/j.molonc.2011.03.007
 12 MOLECULAR ONCOLOGY XXX
regulate T-cell functions (Gabrilovich et al., 2001). These cells
can act by inhibiting both the innate and adaptive immune re-
sponses (Huang et al., 2006). MDSCs are a heterogeneous pop-
ulation of myeloid cells that includes macrophages,
granulocytes and other cells that express Ly-6C/G (recognized
by Gr-1 antibody) and CD11b in mice and suppress immune
responses in vivo and in vitro (Gabrilovich and Nagaraj, 2009).
It has been observed that elimination of MDSC by antibodies
or cytotoxic agents such as gemcitabine in mouse tumour
models increased antitumour responses (Ko et al., 2010;
Suzuki et al., 2005) In our study, we analysed the phenotype
and frequency of CD11b+Gr-1+ MDSCs in spleen of mice
with CT26 tumours treated with Cy, AdiL-12 ora combination
of both. While the administration of Cy or AdiL-12 as single
agents induced a slight decrease in the percentage of MDSCs
in comparison with the saline group, the combination of
Cy + AdiL-12 produced a significan! reduction of MDSCs in
the spleens of tumour-bearing mi ce. However, other immuno-
suppressive CD11b populations, such as F4/80+ and CD11c+
cells, might be involved but were not analysed.
In agreement with our findings in CT26 tumour-bearing
mice, recent data published by Medina-Echeverz et al. {2010),
demonstrated that Cy in combination with IL-12 depleted
not only Tregs but also tumour-infiltrating monocytic-MDCs
(Mo-MDSCs) in another colorectal carcinoma model (MC38
cells). Using this approach, they observed that recruitment
of inflammatory monocytes/macrophages (IMC) into tumour
microenvironment after the elimination of Mo-MDSC by
Cy + IL-12 has a key role for the observed antitumoural effect
(Medina-Echeverz et al., 2010)
In our tumour model the immune rejection of established
CT26 tumours was clearly affected by negative regulatory
mechanisms linked to an increase in number and function
ofTregs and MDSCs. We demonstrated that these negative in-
fluences could be overcome by the combination of Cy with
AdiL-12. More importantly, the combined therapy not only
has reverted immunosuppressive mechanisms induced dur-
ing tumour progression but also generated a strong cytotoxic
immune response against tumour cells mediated by specific
IFN-y secreting CD4+ T lymphocytes.
The majority of immune therapy strategies to treat cancer
have directed to the generation of CD8+ T cell responses
against tumour-associated antigens. CD4+T cells have the
ability to sustain CTL responses but can also function as effec-
tor cells either by production of potent cytokines (such as IFN-
y) or by exhibiting anticancer cytotoxic activity (Appay et al.,
2002; Haigh et al., 2008; Spaapen et al., 2010). In our work,
the in vitro expanded specific IFN-y secreting CD4+ T lympho-
cytes generated by Cy + AdiL-12 have demonstrated to be ef-
fective in both a preventive and a therapeutic model using
CT26 tumour model. We assume that the induction ofhigh cy-
tolytic activity and the potent Th1-type response in vivo might
be the cause for the profound antitumour effects observed and
could be also exploited in the future in combination with other
immunostimulatory strategies.
The use of low-dose Cy combined with sub-therapeutic
AdiL-12 induces significan! regressions in two different and
aggressive tumour models: the CT26 liver metastatic model
and the pancreatic cancer model. In this study we have shown
by the fractional product method that the combined
Please cite tbis article in press as: Malvicini, M. et al, Reversa! of gastrointestinal carcinoma-induced immunosuppression and
induction of antitumoural immunity by a combination of cyclophosphamide and gene transfer of n.-12, Molecular Oncology
.(?!UiJ.,!1.2ltlP~9Jt.i&ttm!!tll~Z2!1,~-007
(2011) 1-14
treatment has also a synergistic effect for pancreatic carci-
noma. Thus, Cy + AdiL-12 based treatment is a promisingim-
munotherapy among the limited therapeutic options
suggesting the possibility of achieving high efficacy with IL-
12 without toxicity in more malignant tumour models. This
strategy could be improved in patients with disseminated dis-
ease by the use of tumour-targeted expression of IL-12 (Kerkar
et al., 2010). In conclusion, Cy + AdiL-12 demonstrated efficacy
to block Tregs and MDSCs-mediated immunosuppressive tu-
mour environment and, simultaneously, to amplify the effec-
tor phase of the immune response by the induction of a potent
antitumour CTL activity. Considering our previous clnica! ex-
perience of separa te usage of!L-12 gene transfer and Cy in pa-
tients with cancer, it will be of interest to evaluate this
combination as a potential therapeutic strategy in advanced
GI carcinomas clinically.
Acknowledgements
We would like to thank, Soledad Arregui and Guillermo
Gastn for their technical assistance. This work was sup-
ported in part by Agencia Nacional de Promocin Cientfica y
Tecnolgica (ANPCyT) grant PICT-2005/34788 (PM, OGS and
GM); PICTO-CRUP 2005/31179 (GM); AECID 2008 D/022066/08
(GM); PIP-CONICET 2009-2011 (PM). MM, JB and CA are fellows
from ANPCyT. FP is a fellow from CONICET.
Supplementary data
Supplementary data associated with this article can be found
in the online version at doi:10.1016/j.molonc.2011.03.007.
REFERENCES
Alaniz, L., Rizzo, M., Malvicini, M., Jaunarena, J., Avella, D.,
Atorrasagasti, C., Aquino, J.B., Garcia, M., Matar, P., Silva, M.,
Mazzolini, G., 2009. Low molecular weight hyaluronan inhibits
colorectal carcinoma growth by decreasing tumor cell
proliferation and stimulating immune response. Cancer Lett.
278, 9-16.
Almand, B., Clark, J.!., Nikitina, E., van Beynen, J., English, N.R.,
Knight, S.C., Carbone, O.P., Gabrilovich, D.!., 2001. lncreased
production of immature myeloid cells in cancer patients:
a mechanism of immunosuppression in cancer. J. Immunol.
166, 678-689.
Appay, V., Zaunders, J.]., Papagno, L., Sutton, J., Jaramillo, A.,
Waters, A., Easterbrook, P., Grey, P., Smith, D., McMichael, A.J.,
Cooper, D.A., Rowland-Jones, S.L., Kelleher, A.D., 2002.
Characterization of CD4(+) CTLs ex vivo. J. Immunol. 168,
5954-5958.
Barajas, M., Mazzolini, G., Genove, G., Bilbao, R., Narvaiza, l.,
Schmitz, V., Sangro, B., Melero, l., Qian, C., Prieto, J., 2001.
Gene therapy of orthotopic hepatocellular carcinoma in rats
using adenovirus coding for interleukin 12. Hepatology 33,
52-61.
Bell, D., Chomarat, P., Broyles, D., Netto, G., Harb, G.M.,
Lebecque, S., Valladeau, J., Davoust, J., Palucka, K.A.,
Banchereau, J., 1999. In breast carcinoma tissue, immature
dendritic cells reside within the tumor, whereas mature
 MOLECULAR ONCOLOGY XXX (2011) 1-14
dendritic cells are located in peritumoral areas. J. Exp. Med.
190, 1417-1426.
Beyer, M., Schultze, ].L., 2006. Regulatory T cells in cancer. Blood
108, 804-811.
Bluestone, ].A., Tang, Q., 2005. How do CD4+CD25+ regulatory
Tcells control autoimmunity? Curr. Opin. Immunol. 17,638-642.
Brodsky, R.A., Petri, M., Smith, B.D., Seifter, E.]., Spivak, J.L.,
Styler, M., Dang, C.V., Brodsky, l., ]ones, R.]., 1998.
Immunoablative high-dose cyclophosphamide without stem-
cell rescue for refractory, severe autoimmune disease. Ann.
Intem. Med. 129, 1031-1035.
Bronte, V., Wang, M., Overwijk, W.W., Surman, D.R., Pericle, F.,
Rosenberg, S.A., Restifo, N.P., 1998. Apoptotic death of CD8+ T
lymphocytes after immunization: induction of a suppressive
population ofMac-1+/Gr-1+ cells. ]. Immunol. 161, 5313-5320.
Caruso, M., Pham-Nguyen, K., Kwong, Y.L., Xu, B., Kosai, K.!.,
Finegold, M., Woo, S.L., Chen, S.H., 1996. Adenovirus-mediated
interleukin-12 gene therapy for metastatic colon carcinoma.
Proc. Natl. Acad. Sci. U S A 93, 11302-11306.
Clark, C.E., Beatty, G.L., Vonderheide, R.H., 2009.
Immunosurveillance of pancreatic adenocarcinoma: insights
from genetically engineered mouse models of cancer. Cancer
Lett. 279, 1-7.
Colombo, M.P., Fomi, G., 1994. Cytokine gene transfer in tumor
inhibition and tumor therapy: where are we now? Immunol.
Today 15, 48-51.
Colvin, O.M., 1999. An overview of cyclophosphamide development
and clinical applications. Curr. Pharm. Des S, 555-560.
Croci, D.O., Zacarias Fluck, M.F., Rico, M.]., Matar, P.,
Rabinovich, G.A., Scharovsky, O.G., 2007. Dynamic cross-talk
between tumor and immune cells in orchestrating the
immunosuppressive network at the tumor microenvironment.
Cancer Immunol. Immunother 56, 1687-1700.
Curiel, T.]., Coukos, G., Zou, L., Alvarez, X., Cheng, P., Mottram, P.,
Evdemon-Hogan, M., Conejo-Garcia, ].R., Zhang, L., Burow, M.,
Zhu, Y., Wei, S., Kryczek, l., Daniel, B., Gordon, A., Myers, L.,
Lackner, A., Disis, M.L., Knutson, K.L., Chen, L., Zou, W., 2004.
Specific recruitrnent of regulatory T cells in ovaran carcinoma
fosters immune privilege and predicts reduced survival. Nat.
Med. 10, 942-949.
Dieckmann, D., Plottner, H., Berchtold, S., Berger, T., Schuler, G.,
2001. Ex vivo isolation and characterization of CD4(+)CD25(+)
T cells with regulatory properties from human blood. ]. Exp.
Med. 193, 1303-1310.
Elkord, E., Hawkins, R.E., Stem, P.L., 2008. Immunotherapy for
gastrointestinal cancer: current status and strategies for
improving efficacy. Expert Opin. Biol. Ther. 8, 385-395.
Ferlay, ]., Shin, H.R., Bray, F., Forman, D., Mathers, C.,
Parkin, D.M., 2010. Estimates of worldwide burden of cancer in
2008: GLOBOCAN 2008. In t. ]. Cancer.
Gabrilovich, D.!., Nagaraj, S., 2009. Myeloid-derived suppressor
cells as regulators of the immune system. Nat. Rev. Immunol.
9, 162-174.
Gabrilovich, D.!., Velders, M.P., Sotomayor, E.M., Kast, W.M.,
2001. Mechanism of immune dysfunction in cancer mediated
by immature Gr-1+ myeloid cells. ]. Immunol. 166,
5398-5406.
Ghiringhelli, F., Larmonier, N., Schmitt, E., Parcellier, A.,
Cathelin, D., Garrido, C., Chauffert, B., Solary, E., Bonnotte, B.,
Martin, F., 2004. CD4+CD25+ regulatory T cells suppress
tumor immunity but are sensitive to cyclophosphamide
which allows immunotherapy of established tumors to be
curative. Eur. ]. Immunol. 34, 336-344.
Ghiringhelli, F., Puig, P.E., Roux, S., Parcellier, A., Schmitt, E.,
Solary, E., Kroemer, G., Martin, F., Chauffert, B., Zitvogel, L.,
2005. Tumor cells convert immature myeloid dendritic cells
into TGF-beta-secreting cells inducing CD4+CD25+ regulatory
T cell proliferation. J. Exp. Med. 202, 919-929.
Please cite tbis article in press as: Malvicini, M. et al, Reversa} of gastrointestinal carcinoma-induced irnmunosuppression and
induction of antitumoural irnmunity by a combination of cyclophosphamide and gene transfer of U.-12, Molecular Oncology
cl2Ql!),gpi:10.1,llt'J,molonc.20tl:m,Q97
13
Gomez, G.G., Hutchison, R.B., Kruse, C.A., 2001. Chemo-
immunotherapy and chemo-adoptive immunotherapy of
cancer. Cancer Treat. Rev. 27, 375-402.
Haigh, T.A., Lin, X., Jia, H., Hui, E.P., Chan, A.T., Rickinson, A.B.,
Taylor, G.S., 2008. EBV latent membrane proteins (LMPs) 1 and
2 as immunotherapeutic targets: LMP-specific CD4+ cytotoxic
T cell recognition of EBV-transformed B celllines. J. Immunol.
180, 1643-1654.
Huang, B., Pan, P.Y., Li, Q., Sato, A.!., Levy, D.E., Bromberg, ].,
Divino, C.M., Chen, S.H., 2006. Gr-1+CD115+ immature
myeloid suppressor cells media te the development of tumor-
induced T regulatory cells and T-cell anergy in tumor-bearing
host. Cancer Res. 66, 1123-1131.
Kerkar, S.P., Muranski, P., Kaiser, A., Boni, A., Sanchez-Perez, L.,
Yu, Z., Palmer, D.C., Reger, R.N., Borman, Z.A., Zhang, L.,
Margan, R.A., Gattinoni, L., Rosenberg, S.A., Trinchieri, G.,
Restifo, N.P., 2010. Tumor-specific CD8+ T cells expressing
interleukin-12 eradicate established cancers in
lymphodepleted hosts. Cancer Res. 70, 6725-6734.
Ko, ].S., Rayman, P., Ireland, ]., Swaidani, S., Li, G., Bunting, K.D.,
Rini, B., Finke, ].H., Cohen, P.A., 2010. Direct and differential
suppression of myeloid-derived suppressor cell subsets by
sunitinib is compartmentally constrained. Cancer Res. 70,
3526-3536.
Larmonier, N., Marran, M., Zeng, Y., Cantrell, ]., Romanoski, A.,
Sepassi, M., Thompson, S., Chen, X., Andreansky, S.,
Katsanis, E., 2007. Tumor-derived CD4(+)CD25(+) regulatory T
cell suppression of dendritic cell function involves TGF-beta
and IL-10. Cancer Immunol. Immunother. 56, 48-59.
Leonard, ].P., Sherman, M.L., Fisher, G.L., Buchanan, L.J.,
Larsen, G., Atkins, M.B., Sosman, ].A., Dutcher, ].P.,
Vogelzang, N.]., Ryan, ].L., 1997. Effects of single-dose
interleukin-12 exposure on interleukin-12-associated toxicity
and interferon-gamma production. Blood 90, 2541-2548.
Lorenz, M., Staib-Sebler, E., Hochmuth, K., Heinrich, S., Gog, C.,
Vetter, G., Encke, A., Muller, H.H., 2000. Surgical resection of
liver metastases of colorectal carcinoma: short and long-term
results. Semin. Oncol. 27, 112-119.
Malvicini, M., Rizzo, M., Alaniz, L., Pinero, F., Garcia, M.,
Atorrasagasti, C., Aquino, ].B., Rozados, V., Scharovsky, O.G.,
Matar, P., Mazzolini, G., 2009. A novel synergistic combination of
cyclophosphamide and gene transfer of interleukin-12 e radica tes
colorectal carcinoma in mice. Clin. Cancer Res. 15, 7256-7265.
Matar, P., Rozados, V.R., Gervasoni, S.!., Scharovsky, G.O., 2002.
Th2/Th1 switch induced by a single low dose of
cyclophosphamide in a rat metastatic lymphoma model.
Cancer Immunol. Immunother. 50, 588-596.
Mazzolini, G., Murillo, 0., Atorrasagasti, C., Dubrot, ]., Tirapu, l.,
Rizzo, M., Arina, A., Alfara, C., Azpilicueta, A., Berasain, C.,
Perez-Gracia, ].L., Gonzalez, A., Melero, l., 2007.
Immunotherapy and immunoescape in colorectal cancer.
World ]. Gastroenterol. 13, 5822-5831.
Mazzolini, G., Prieto, J., Melero, l., 2003. Gene therapy of cancer
with interleukin-12. Curr. Pharm. Des. 9, 1981-1991.
Mazzolini, G., Qian, C., Xie, X., Sun, Y., Lasarte, ].]., Drozdzik, M.,
Prieto,]., 1999. Regression of colon cancer and induction of
antitumor immunity by intratumoral injection of adenovirus
expressing interleukin-12. Cancer Gene Ther. 6, 514-522.
Medina-Echeverz,]., Fioravanti,J. Zabala, M., Ardaiz, N., Prieto,].,
Berraondo, P., 2010. Successful colon cancer eradication after
chemoimmunotherapy is associated with profound
phenotypic change of intratumoral myeloid cells. ]. Immunol.
186, 807-815.
Melero, l., Mazzolini, G., Narvaiza, l., Qian, C., Chen, L., Prieto,].,
2001. IL-12 gene therapy for cancer: in synergy with other
immunotherapies. Trends Immunol. 22, 113-115.
Nestle, F.O., Burg, G., Fah, ]., Wrone-Smith, T., Nickoloff, B.]., 1997.
Human sunlight-induced basal-cell-carcinoma-associated
 14 MOLECULAR ONCOLOGY XXX (2011) 1-14
dendritic cells are deficient in T cell co-stimulatory molecules
and are impaired as antigen-presenting cells. Am. ]. Pathol.
150, 641-651.
Onishi, Y., Fehervari, Z., Yamaguchi, T., Sakaguchi, S., 2008.
Foxp3+ natural regulatory T cells preferentially form
aggregates on dendritic cells in vitre and actively inhibit their
maturation. Proc. Natl. Acad. Sci. U S A 105, 10113-10118.
Ormandy, L.A., Hillemann, T., Wedemeyer, H., Manns, M.P.,
Greten, T.F., Korangy, F., 2005. Increased populations of
regulatory T cells in peripheral blood of patients with
hepatocellular carcinoma. Cancer Res. 65, 2457-2464.
Proietti, E., Greco, G., Garrone, B., Baccarini, S., Mauri, C.,
Venditti, M., Carlei, D., Belardelli, F., 1998. Importance of
cyclophosphamide-induced bystander effect on T cells for
a successful tumor eradication in response to adoptive
immunotherapy in mice. J. Clin. Invest. 101, 429-441.
Putzer, B.M., Stiewe, T., Rodicker, F., Schildgen, 0., Ruhm, S.,
Dirsch, 0., Fiedler, M., Damen, U., Tennant, B., Scherer, C.,
Graham, F.L., Roggendorf, M., 2001. Large nontransplanted
hepatocellular carcinoma in woodchucks: treatrnent with
adenovirus-mediated delivery of interleukin 12/B7.1 genes. J.
Natl. Cancer lnst. 93, 472-479.
Rabinovich, G.A., Gabrilovich, D., Sotomayor, E.M., 2007.
Immunosuppressive strategies that are mediated by tumor
cells. Annu. Rev. Immunol. 25, 267-296.
Sakaguchi, S., Sakaguchi, N., Shimizu, J., Yamazaki, S.,
Sakihama, T., ltoh, M., Kuniyasu, Y., Nomura, T., Toda, M.,
Takahashi, T., 2001. Immunologic tolerance maintained by
CD25+ CD4+ regulatory T cells: their common role in
controlling autoimmunity, tumor immunity, and
transplantation tolerance. Immunol. Rev. 182, 18-32.
Sangro, B., Mazzolini, G., Ruiz, J., Herraiz, M., Quiroga, J.,
Herrero, !., Benito, A., Larrache, J., Pueyo, J., Subtil, J.C.,
Olague, C., Sola, J., Sadaba, B., Lacasa, C., Melero, !., Qian, C.,
Prieto, J., 2004. Phase I tria! of intratumoral injection of an
adenovirus encoding interleukin-12 for advanced digestive
tumors. J. Clin. Once!. 22, 1389-1397.
Shapira, S., Lisiansky, V., Arber, N., Kraus, S., 2010. Targeted
immunotherapy for colorectal cancer: monoclonal antibodies
and immunotoxins. Expert Opin. Investig. Drugs 19 (Suppl1),
S67-S77.
Please cite this anide in press as: Malvcini, M. et al., Reversa) of gastrointestinal carcinoma -induced "mmunosuppression and
induction of antitumoural immunity by a combination of cyclophosphamde and gene transfer of ll.-12, Molecular Oncology
1{6Qll,),"~Qi,:1Q:1Q16/j.molon~..2011.03.007
Spaapen, R.M., Groen, R.W., van den Oudenalder, K., Guichelaar, T.,
van Elk, M., Aarts-Riemens, T., Bloem, A.C., Storm, G.,
Martens, A.C., Lokhorst, H.M., Mutis, T., 2010. Eradication of
medullary multiple myeloma by CD4+ cytotoxic human T
lymphocytes directed ata single minor histocompatibility
antigen. Clin. Cancer Res. 16, 5481-5488.
Suzuki, E., Ka peor, V., Jassar, A. S., Kaiser, L.R., Albelda, S.M., 2005.
Gemcitabine selectively eliminates splenic Gr-1+/CD11b+
myeloid suppressor cells in tumor-bearing animals and
enhances antitumor immune activity. Clin. Cancer Res. 11,
6713-6721.
Takahashi, T., Kuniyasu, Y., Tod, M., Sakaguchi, N., Itoh, M.,
lwata, M., Shimizu, J., Sakaguchi, S., 1998. Immunologic self-
tolerance maintained by CD25+CD4+ naturally anergic and
suppressive T cells: induction of autoimmune disease by
breaking their anergic/suppressive state. Int. Immunol. 10,
1969-1980.
Tang, Q., Bluestone, ].A., 2008. The Foxp3+ regulatory T cell: a jack
of all trades, master of regulation. Na t. Immunol. 9, 239-244.
Thomton, A.M., Shevach, E.M., 1998. CD4+CD25+
immunoregulatory T cells suppress polyclonal T cell
activation in vitre by inhibiting interleukin 2 production. ].
Exp. Med. 188, 287-296.
Trinchieri, G., 2003. Interleukin-12 and the regulation of innate
resistance and adaptive immunity. Nat. Rev. Immunol. 3,
133-146.
Vignali, D.A., Collison, L.W., Workman, C.]., 2008. How regulatory
T cells work. Nat. Rev. Immunol. 8, 523-532.
Yokoyama, Y., Dhanabal, M., Griffioen, A.W., Sukhatrne, V.P.,
Ramakrishnan, S., 2000. Synergy between angiostatin and
endostatin: inhibition of ovarian cancer growth. Cancer Res.
60, 2190-2196.
Zou, W., 2005. Immunosuppressive networks in the tumour
environment and their therapeutic relevance. Nat. Rev.
Cancer 5, 263-274.
Zou, W., 2006. Regulatory T cells, tumour immunity and
immunotherapy. Nat. Rev. Immunol. 6, 295-307.
Zwirner, N.W., Croci, D.O., Domaica, C.!., Rabinovich, G.A., 2010.
Overcoming the hurdles of tumor immunity by targeting
regulatory pathways in innate and adaptive immune cells.
Curr. Pharm. Des 16, 255-267.