Accepted Manuscript

Title: Gelatin/Carboxymethyl chitosan based scaffolds for

dermal tissue engineering applications

Author: Tarun Agarwal Rajan Narayan Somnath Maji

Shubhanath Behera Senthilguru Kulanthaivel Tapas Kumar
Maiti Indranil Banerjee Kunal Pal Supratim Giri

PII: S0141-8130(16)30336-1
DOI: http://dx.doi.org/doi:10.1016/j.ijbiomac.2016.04.028
Reference: BIOMAC 5996

To appear in: International Journal of Biological Macromolecules

Received date: 13-11-2015

Revised date: 9-4-2016
Accepted date: 12-4-2016

Please cite this article as: Tarun Agarwal, Rajan Narayan, Somnath Maji, Shubhanath
Behera, Senthilguru Kulanthaivel, Tapas Kumar Maiti, Indranil Banerjee, Kunal
Pal, Supratim Giri, Gelatin/Carboxymethyl chitosan based scaffolds for dermal
tissue engineering applications, International Journal of Biological Macromolecules
http://dx.doi.org/10.1016/j.ijbiomac.2016.04.028

This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.
To,
The Editor,
International Journal of Biological Macromolecules

Subject: Submission of the Manuscript

Dear Sir,
This is hereby to submit a research manuscript entitled as Gelatin / Carboxymethyl Chitosan
based scaffolds for dermal tissue engineering application for publication in special issue on
tissue engineering in your esteemed journal.
In the present investigation, we successfully demonstrated in vitro that Gelatin /
Carboxymethyl Chitosan (GC) scaffolds supported the adhesion, growth and proliferation of
fibroblasts. The cells acclimatized to the micro-environment provided by the scaffolds and
showed higher expression of native collagen expression. In addition, the expression of VEGF
and HIF1 was also found to be higher, suggesting their ability to support angiogenesis and
neo-vascularization. Also, an evaluation of drug release profile showed a sustained release of
the drug from the scaffolds. All together, it could be concluded that gelatin / carboxymethyl
chitosan based scaffolds could be suitable for wound healing applications.
Uniqueness of the study is that we prove the efficacy of our system with tissue engineering
and clinic-pharmacological point of view.
We hope that the findings reported here will be useful to the scientists working in this field.
We are ready to accept any constructive suggestion from your side regarding the manuscript.
This is to further mention that-
(i) No part of this manuscript has been published or submitted for publication anywhere else.
(ii) There is no conflict of interest among the authors.
As per reviewers suggestions, we have incorporated suitable modifications in the
manuscript. All the modifications have been highlighted in red.
Looking forward for your kind response,
Regards,
Dr. Tapas Kumar Maiti
IIT Kharagpur

1
Gelatin / Carboxymethyl chitosan based scaffolds for dermal tissue engineering application
Tarun Agarwal1, Rajan Narayan1, Somnath Maji1, Shubhanath Behera1, Senthilguru
Kulanthaivel2, Tapas Kumar Maiti1*, Indranil Banerjee2, Kunal Pal2, Supratim Giri2
1
Indian Institute of Technology, Kharagpur, West Bengal 721302, India
2
National Institute of Technology, Rourkela, Odisha 769008, India

Tarun Agarwal
Department of Biotechnology,
Indian Institute of Technology, Kharagpur
West Bengal, Pin: 721302. India
Email: tarun3agarwal5@gmail.com
Phone: +919933968910

Rajan Narayan
Department of Biotechnology,
Indian Institute of Technology, Kharagpur
West Bengal, Pin: 721302. India
Email: rajanncc@gmail.com
Phone: +918001596169

Somnath Maji
Department of Biotechnology,
Indian Institute of Technology, Kharagpur
West Bengal, Pin: 721302. India
Email: somnath.2812@gmail.com
Phone: +918972122264

Shubhanath Behera
Department of Biotechnology,
Indian Institute of Technology, Kharagpur
West Bengal, Pin: 721302. India
Email: snb.1430@gmail.com
Phone: +919861385137

Senthilguru Kulanthaivel
Department of Biotechnology and Medical Engineering,
National Institute of Technology, Rourkela
Odisha, Pin: 769008. India
Email: senthilgurubt@gmail.com

2
Phone: +917735671699

Indranil Banerjee
Department of Biotechnology and Medical Engineering,
National Institute of Technology, Rourkela
Odisha, Pin: 769008. India
Email: indraniliit@gmail.com
Phone: +919438507035

Kunal Pal
Department of Biotechnology and Medical Engineering,
National Institute of Technology Rourkela
Odisha, Pin: 769008. India
Email: pal.kunal@yahoo.com
Phone: 0661-2462289

Supratim Giri
Department of Chemistry,
National Institute of Technology, Rourkela
Odisha, Pin: 769008. India
Email: girisupr@nitrkl.ac.in
Phone: +919438501472

*Author for correspondence:

Tapas Kumar Maiti
Department of Biotechnology,
Indian Institute of Technology, Kharagpur
West Bengal, Pin: 721302. India
Email: tkmaiti@hijli.iitkgp.ernet.in
Phone: +91-3222-283766

3
Abstract

The present study delineates the preparation, characterization and application of gelatin-

carboxymethyl chitosan scaffolds for dermal tissue engineering. The effect of carboxymethyl

chitosan and gelatin ratio was evaluated for variations in their physico-chemical-biological

characteristics and drug release kinetics. The scaffolds were prepared by freeze drying method

and characterized by SEM and FTIR. The study revealed that the scaffolds were highly porous

with pore size ranging between 90-170m, had high water uptake (400-1100%) and water

retention capacity (>300%). The collagenase mediated degradation of the scaffolds was

dependent on the amount of gelatin present in the formulation. A slight yet significant variation

in their biological characteristics was also observed. All the formulations supported adhesion,

spreading, growth and proliferation of 3T3 mouse fibroblasts. The cells seeded on the scaffolds

also demonstrated expression of collagen type I, HIF1 and VEGF, providing a clue regarding

their growth and proliferation along with potential to support angiogenesis during wound

healing. In addition, the scaffolds showed sustained ampicillin release, confirming their

suitability as a therapeutic delivery vehicle during wound healing. All together, the results

suggest that gelatin-carboxymethyl chitosan based scaffolds could be a suitable matrix for

dermal tissue engineering applications.

Keywords:

Gelatin; Carboxymethyl Chitosan; Dermal skin tissue engineering

4
1. Introduction

Wound healing is a multi-factorial physiological event that involves the interaction and

synchronization among different cells and tissues [1, 2]. A number of solutions have already

been recommended for the cure of wounds, but still there exist an urge for the development of

more effective treatment strategies due to various limitations posed by the existing

methodologies. Traditional approaches including allografts, autografts, and xenografts are still

considered better due to their potential to support efficient and faster healing [3-5]. However,

these grafting procedures are associated with a number of limitations including immune rejection

of grafts, probability of transfer of infectious agents to the host and laborious surgical procedures

[4, 5]. In this regard, aspects of tissue engineering had provided an upper hand. The prime goal

for the researchers is to regenerate skin with restoration of complete structural and functional

properties of the wounded area. The current engineered skin substitutes rely on creating three

dimensional scaffolds to mimic their native extracellular matrix [5]. This matrix allows them to

guide the dermal fibroblasts and keratinocytes for adhesion, growth, proliferation and

differentiation to form structurally and functionally defined skin tissue [6]. These scaffolds also

provide a physical barrier against the external environment and prevent any chances of infection.

In recent years, a number of natural biopolymers including alginate, collagen and chitosan have

been studied extensively for their potential to support wound healing process [7-9]. These

biopolymers are preferred due to their biocompatibility, biodegradability and few structural

similarities with the human tissues [10]. Gelatin and chitosan have also been used extensively for

various tissue engineering applications. Gelatin is a denatured protein derived from the triple

helix of collagen. It is a biodegradable and non-antigenic polymer, which provide hemostasis and

facilitates cell adhesion and proliferation during healing process. However, poor mechanical

5
properties, low elasticity, low shape stability, low thermal stability limit its use [11]. These

disadvantages can be overcome either by crosslinking or combining it with other biopolymers

[12]. In this regard, chitosan has been considered as a better choice by number of investigators

due to its versatility. Chitosan (poly-1,4-D-glucosamine) is a polysaccharide biopolymer derived

from chitin by alkaline deacetylation [13, 14]. Although, it is a functionally versatile polymer;

yet has various limitations including insolubility at neutral pH, slower and uncontrollable rate of

degradation [12, 15]. Thus, various derivatives of chitosan have been introduced in the market

such as carboxymethyl chitosan, chitosan esters, N-trimethylene chloride chitosan etc., which

have better solubility at neutral pH and improved degradability [15, 16].

In previous studies, Mishra et al. had shown application of carboxymethyl chitosan, gelatin and

nano-hydroxyapatite based injectable gel for bone tissue engineering application [12]. Zhou et al.

has demonstrated the synthesis and characterization of silver nanoparticles, gelatin and

carboxymethyl chitosan hydrogel based antibacterial hydrogels [17]. In addition, Huang et al.

demonstrated the influence of carboxymethyl-chitosan and gelatin based hydrogel on cutaneous

wound healing [18]. The report by Huang et al. was majorly concentrated on the biological

characterization of carboxymethyl-chitosan and gelatin based hydrogels. However, physico-

chemical characterization and pharmaceutical evaluation of this formulation were found missing.

Keeping the above perspective in mind, we report the preparation, characterization and

application of gelatin (G) - carboxymethyl chitosan (C) based freeze-dried scaffolds for dermal

tissue engineering. The scaffolds were subjected to physico-chemical characterization (SEM and

FTIR). Suitability of the prepared scaffolds for dermal tissue engineering was analyzed using

3T3 mouse fibroblast cells. In addition, the scaffolds were also analyzed for their potential as a

drug delivery vehicle.

6
2. Materials and methods

2.1 Materials

Gelatin (bloom number: ~300, average molecular weight: 50000-100000 Da), chitosan (medium

molecular weight, 200-800cP viscosity and 75-85% degree of deacetylation) and glutaraldehyde

(25% aqueous solution) were bought from Sigma Aldrich, Mumbai, India. Dulbeccos Modified

Eagles Media (DMEM), fetal bovine serum (FBS) and Calcien-AM were brought from

Invitrogen, Mumbai, India. Trypsin-EDTA, antibiotic-antimycotic solution and ampicillin were

purchased from Himedia, Mumbai, India. NIH 3T3 mouse embryonic fibroblast cell line was

procured from NCCS, Pune, India.

2.2 Methods

2.2.1. Preparation of GC scaffolds

The N, O-carboxymethyl chitosan was prepared following the protocol previously described by

Mishra et al. [12]. The GC scaffolds were prepared by freeze drying technique as per protocol

described by Banerjee et al. [19]. In brief, gelatin and carboxymethyl chitosan were dissolved in

milliQ water at a concentration of 10% (w/v) and 2% (w/v) respectively. Thereafter, both the

solutions were mixed in a definite ratio (w/w) that include 3:1 (GC31), 1:1 (GC11) and 1:3

(GC13). The solutions were crosslinked by glutaraldehyde with a final concentration of 0.2% in

the formulation (40l glutaraldehyde stock (25%) per 5ml of the formulation), mixed uniformly

and casted into a 20mm diameter dish. The gels were allowed to crosslink for 1h and thereafter,

placed in -20oC overnight prior to lyophilization for 12h (Lyodel Freeze Dryer).

7
2.2.2. Physico-chemical characterization of the GC scaffolds

Morphological characterization of the lyophilized GC scaffolds (GC11, GC13 and GC31) was

done by scanning electron microscopy (JOEL JSM-5800) at 20kV post gold sputter coating. The

porosity of the scaffolds was measured by liquid displacement method following the protocol

described by Han et al. [6]. In brief, the scaffold was immersed in a known volume (V1) of

absolute ethanol for 15min. The total volume of absolute ethanol and the scaffold was recorded

(V2). Thereafter, ethanol impregnated scaffold was removed and the residual volume of ethanol

was recorded (V3). The total volume of the scaffold was calculated by equation:

% Porosity = (V1 V3) * 100 / (V2 V3)

The FTIR spectra of the GC scaffolds in the scanning range of 4000-400cm-1 was obtained using

FTIR spectrophotometer (NEXUS-870) by KBr pellet method.

The tensile strength of the GC membranes was tested using a Stable Microsystems (TA-HD

plus, U.K.) tensile testing machine at the tension test mode. The pre- and post-test speed was

kept at 1 mm/min and break sensitivity was adjusted to 10g.

2.2.3. Equilibrium swelling and water retention analysis

The equilibrium swelling of the GC scaffolds was determined as per the protocol described by

Pasparakis et al. [20]. In brief, accurately weighed, GC scaffolds (W1, 100 mg) were immersed

in phosphate buffer saline (PBS; pH 7.4). At defined time intervals, the scaffolds were

withdrawn, blotted to remove excess fluid and weighed (W2). The increase in the scaffold

weight was measured as a function of time. Equilibrium swelling degree (ESD) was expressed

as:

ESD = (W2 W1) / W1

8
For water retention analysis, the accurately weighed samples (W3, 100mg) were immersed in

PBS (pH 7.4) at 37oC for 24h. The wet samples were taken and placed in an eppendorf tube

containing a small piece of filter paper at the bottom. After centrifugation (Eppendorf Mini Spin

Centrifuge, 500rpm, 3min), the weight of the samples was recorded (W4). The percentage water

retention (%WR) was calculated as:

%WR = (W4 W3) * 100 / W3

2.2.4. Biodegradation analysis

The biodegradation analysis of the GC scaffolds was carried out in collagenase type I, lysozyme

and bacterial enzyme cocktail [6]. In brief, 100mg of the dried scaffolds were placed in PBS (pH

7.4) and allowed to reach swelling equilibrium (W5). Thereafter, the three enzymes were added

to the solution at a concentration of 0.1% (v/v) in individual sets. At defined time intervals, the

scaffolds were withdrawn, blotted and weighed (W6). The change in their weight was calculated

as a function of time. The percentage degradation of scaffolds was expressed as:

Degradation % = (W5 W6)*100 / W5

2.2.5. Biological characterization of the GC scaffolds

The biological compatibility of the GC scaffolds was evaluated using NIH 3T3 mouse

embryonic fibroblasts. The cell line was maintained in DMEM supplemented with 10% heat

inactivated FBS in a humidified (95%), CO2 (5%) incubator at 37oC with regular passaging

every 3-4 days. For all the experiments, the cells were harvested using 0.25% Trypsin-EDTA

solution and were seeded onto the sterile scaffolds at a concentration of 1x105cells/ml. The

sterilization of the scaffolds was done by UV and 70% ethanol treatment. The biocompatibility

of the scaffolds was accessed 24h after cell seeding, using MTT assay as described elsewhere

[21]. The hemocompatibility of the scaffolds was also analyzed as described by Satapathy et al.

9
[22]. The cell proliferation analysis was done using Alamar Blue assay for a period of 7 days.

The adhesion and viability of the cells seeded onto the scaffolds were analyzed after 3 and 7 days

stained with calcien-AM using a confocal microscope (Olympus IX 81 confocal microscope

using Fluoview1000). In addition, a live/dead assay and cell cycle analysis were also performed

post 72h of cell seeding using flow cytometry (Accuri C6, BD Biosciences; carried out at NIT

Rourkela).

The expression of collagen alpha-1 (ColI), Hypoxia inducible factor (HIF1) and vascular

endothelial growth factor (VEGF) was also evaluated by semi-quantitative reverse transcriptase

polymerase chain reaction after 7 days of cell seeding. For this, mRNA isolation and cDNA

synthesis were performed using Qiagen RNeasy fibrous tissue mini kit and BioBharti MuLV

Reverse Transcriptase plus kit respectively, following manufacturers instructions. Further, the

gene specific amplification was done using PCR (Eppendorf Mastercycler) and expression

profile was assessed based on their band intensities. GAPDH was used as an internal control for

the study. The mouse specific primers used include - 5 GCACCCACGACAGAAGGAG 3

(VEGF_F), 5 ACACAGGACGGCTTGAAGATGT 3 (VEGF_R), 5

GTTTACTAAAGGACAAGTCACC 3 (HIF1_F), 5 TTCTGTTTGTTGAAGGGAG 3

(HIF1_R), 5 AGACTGGCAACCTCAAGAAGGC 3 (ColI_F), 5

CGGGAGGTCTTGGTGGTTTTGT 3 (ColI_R), 5 CACGAGAAATATGACAACTCACT 3

(GAPDH_F) and 5 AGTCCTTCCACAATGCCAAAGT 3 (GAPDH_R).

2.2.6. In vitro drug release study and evaluation of their therapeutic potential

The drug release kinetics of the GC scaffolds was analyzed following the method described

elsewhere [21]. In brief, 100mg of the drug loaded scaffold sample was immersed in PBS (pH

7.4) under slight shaking conditions. At definite time interval, the supernatant (10l) was

10
withdrawn and corresponding drug concentration was evaluated using nanodrop (Thermo

Scientific Nanodrop 2000c). For the analysis, ampicillin (max=228nm) was taken as model drug.

The drug release kinetics was predicted by fitting various release models (zero order, first order,

Higuchian model and Korsmeyer Peppas model).

Furthermore, in vitro assessment of therapeutic potential of scaffolds loaded with bioactive

molecules was done by antibiotic susceptibility test against Escherichia coli (Gram negative) and

Staphylococcus epidermidis (Gram positive) as described elsewhere [23]. In brief, the bacterial

suspension (100l of 2106CFU/ml) was spreaded over solid nutrient agar petri-dishes and the

drug loaded scaffold was placed in the center of the dish. The plates were then incubated at 37C

for overnight and the zone of inhibition was measured by taking images (Canon A2400 IS) and

was analyzed using MBF ImageJ software.

2.2.7. Statistical analysis

All the data have been reported as mean S.D. (Standard deviation). In order to evaluate the

statistical significance of the data, one way ANOVA was performed.

3. Results and Discussion

3.1. Scaffold preparation

The gelatin-carboxymethyl chitosan (GC) scaffolds were prepared post-glutaraldehyde

crosslinking by freeze drying method. During this, the amine groups of both, gelatin and

carboxymethyl chitosan participate in crosslinking [24, 25]. In addition, the hydroxyl groups

present in the carboxymethyl chitosan also participate in crosslinking via acetal bond formation

[21]. Both crosslinking types simultaneously resulted in formation of GC hydrogel which was

11
further freeze dried to get porous scaffolds intended for skin tissue engineering applications. The

GC scaffolds appeared pale yellowish, translucent with an average thickness of 1.30.12 mm.

3.2. Physicochemical characterization

A well documented fact is that for skin repair and regeneration, a scaffold with high porosity and

three dimensional porous structures is a prerequisite. It significantly influences the cellular

activity and subsequently the process of wound healing. The pore size and porosity of the

scaffolds determine the cell migration and diffusion of nutrients and waste products. The analysis

of the SEM micrographs showed that the variation in the gelatin and carboxymethyl chitosan

ratio in the formulation did not significantly affect the pore size (p > 0.05) (Fig. 1a, Table 1).

Previously, Han et al. has already reported that a scaffold with average pore size ranging

between 100-200m is suitable for skin tissue engineering applications. Herein, the pore size of

our GC scaffolds lied in the range suggested in literature. In addition, the percentage porosity of

the GC scaffolds showed an insignificant difference (p > 0.05) (Table 1).

The IR spectroscopic analysis of the composite scaffolds provided their chemical insight (Fig.

1b). It was observed that composites were characterized by the presence of typical amide bond

peaks of gelatin at ~1650cm1 and ~1550cm1 corresponding to C=O stretching and NH

deformation respectively [12]. The presence of carboxymethyl chitosan was ascertained by peaks

at ~1323cm1, ~1155cm1, ~1082cm1, ~1599cm1, ~1643cm1 and 1405cm-1 corresponding to

CH stretch, bridge O stretch, CO stretch, NH bending, C=N Schiffs base and carboxymethyl

group respectively [12]. A broad peak near 3400cm-1 in all the samples represented the O-H

stretching. The increased intensity of this peak in composite formulations suggests increased

intermolecular hydrogen bonding [21].

12
The mechanical testing analysis demonstrated a reduction of the tensile strength (from 0.908

0.036 to 0.513 0.027 MPa) of the three dimensional GC film matrixes with a decrease in

gelatin concentration. On the contrary, a significant increase in percentage elongation (from 9.5

0.76 to 26.895 2.96 %) was observed with a decrease in gelatin concentration (Fig. 1c).

Fig. 1 (a) Scanning electron micrographs of GC scaffolds. (a1) GC31; (a2) GC13; (a3) GC11. (b)

FTIR profile of the GC scaffolds: GC11 (Black); GC13 (dark gray); GC31 (light gray). The

arrows demonstrate the prominent IR peaks of gelatin (black arrows) and carboxymethyl

13
chitosan (grey arrows). (c) Mechanical tensile strength profile of the GC scaffolds: Stress (MPa,

horizontal lines); Force (N, diagonal lines); Percentage elongation (%, vertical lines).

Table 1- Pore size and porosity of the gelatin-carboxymethyl chitosan (GC) scaffolds

Sample Pore Size (m) Porosity (%)

GC11 118.8628.07 73.5

GC13 136.5321.79 78.5
GC31 140.9027.53 76.5

3.3. Equilibrium swelling and water retention analysis

The ability of a scaffold for water absorption and retention forms an important aspect to evaluate

its potential for skin tissue engineering applications. The water absorption determines the

diffusivity of the essential nutrition into the scaffold core and prevents the accumulation of fluid

exudates generated at the wound site [26, 27]. However, excessive fluid absorption would result

in dehydration of wounds, slowing down the healing process [28]. Thus, in order to keep the

wound site humidified, the water retention potential of scaffolds must also be good. Our results

demonstrated that GC13 showed maximum swelling index of 10.05 0.51 at the end of 72h of

analysis. The same for GC11 and GC31 was found to be 5.21 0.27 and 4.14 0.21

respectively. The variation in the percent swelling was found to be statistically significant (p <

0.05) (Fig. 2a). It was evident that increase in the concentration of gelatin resulted in a decrease

of swelling degree. This could possibly be due to an increased degree of crosslinking with an

increase in gelatin concentration. In addition, the water retention for all the samples also varied

significantly (p < 0.05). The percent water retention for GC11, GC13 and GC31 was found to be

401.49 21.98, 322.32 21.24 and 363.28 26.87 % respectively (Fig. 2b). Interestingly, GC11

showed highest water retention which may be due to presence of gelatin and carboxymethyl
14
chitosan in optimal concentrations owing to higher interaction with water molecules and with

greater strength. It was clearly evident from the study that most of the water absorbed by the

scaffolds remained loosely bound. Also, an increase in either gelatin or carboxymethyl chitosan

content resulted in decreased water retention capacity.

3.4. Biodegradation analysis

Biodegradability is often considered as an essential factor for all sorts of tissue engineering

applications. The scaffolds should preferably degrade under controlled mechanism and get

absorbed by the surrounding tissues, eliminating the necessity of their surgical removal. Herein,

collagenase, lysozyme and bacterial enzyme cocktail were used for the degradation analysis.

Lysozyme specifically hydrolyses 1,4--linkages between N-acetylmuramic acid and N-acetyl-

D-glucosamine residues or between N-acetyl-D-glucosamine residues. Collagenase specifically

cleaves collagen fibrils at Gly775Leu/Ile776, located in the region with a loose triple helical

conformation and forms a crucial enzyme during wound healing and repair. The bacterial

enzyme cocktail contains a mixture of reductive and hydrolytic enzymes including

glucuronidase, xylosidase, galactosidase, arabinosidase, nitroreductase, azoreductase, deaminase

and hydroxylase [21]. From the results, a significant variation in the degradation profile of

GC11, GC13 and GC31 was observed in the presence of collagenase enzyme (p < 0.05) (Fig.

2c1). Among the three scaffolds, GC31 showed maximum rate of degradation in collagenase. It

is important to mention that for initial 72h of analysis, GC31 followed a degradation profile

similar to that of GC11 and GC13. Thereafter, it underwent a rapid degradation and degraded

completely within 312h (13 days) of the study period. This might be due to the higher

concentration of gelatin, a known substrate of collagenase. However, GC11 and GC13 showed

slower rate of degradation rate with percentage degradation of 37.39 1.87 and 25.25 1.26%

15
respectively, at the end of analysis (360h, 15 days). The increased concentration of

carboxymethyl chitosan reduced the scaffold degradation drastically. A plausible explanation to

this could be the physical interaction between gelatin and carboxymethyl chitosan, which may

prevent exposure of collagenase specific cleavage sites of gelatin, thus reducing its degradation

rate. The reduced rate of scaffold degradation would assist in proper wound healing. However, in

case of lysozyme (Fig. 2c2) and bacterial cocktail enzymes (Fig. 2c3), scaffolds showed a much

lower degradation rate. It was observed that GC11, GC13 and GC31 underwent 5.65 0.28, 6.44

0.32 and 5.6 0.23% degradation respectively, in the presence of lysozyme (p < 0.05). Herein,

an insignificant variation in the degradation profile of GC11 was observed when compared

individually with GC31 (p = 0.8228). Moreover, a similar trend was observed in the case of

bacterial enzyme cocktail, wherein GC11, GC13 and GC31 showed a percentage degradation of

10.30 0.51, 13.32 0.67 and 11.66 0.58% respectively. However, each formulation had

significant variation when compared individually with others in the group (p < 0.05). This study

clearly suggests that the enzymes of bacterial origin had lower specificity towards GC scaffold

for degradation.

16
 Fig. 2 (a) Swelling profile of GC scaffolds in phosphate buffer saline (pH 7.4). (b) Percentage

water retention in the GC scaffolds. (c) Degradation profile of the GC scaffolds in the presence

of (c1) collagenase type I; (c2) lysozyme; (c3) bacterial enzyme cocktail. All the data were

represented as Mean SD (*, p<0.005). The graphs represent GC11, GC13 and GC31 by empty

squares, filled circles and filled triangles respectively.

3.5. Biological characterization of the GC scaffolds

17
The physicochemical properties of a scaffold including the nature of material and its surface

properties may greatly affect the physiological functioning of the cells [29]. Herein, our results

demonstrated that all the GC scaffold formulations were highly biocompatible and supported

adhesion and proliferation of 3T3 mouse fibroblasts. The proliferation index was found to be

greater in comparison to the tissue culture plate (Supp. Fig. S1). Such an increase may be due to

suitable three-dimensional environment provided by the scaffolds, favoring the cell proliferation.

The time lapsed analysis of the cell proliferation using Alamar blue assay showed an increased

dye reduction from day 1 to 7. As a general rule, increased reduction of dye directly correlates

with the cell proliferation. It is important to mention that GC11 and GC13 scaffolds showed a

similar growth pattern with an insignificant variation between them (p > 0.05). However, the

scaffold GC31 supported lower cell growth and proliferation which may be due to it inadequate

micro-architecture for fibroblasts. Another plausible explanation to it may be the higher rate of

matrix degradation of GC31 by the matrix metallo-proteases (MMPs) released during the cell

migration and growth. It is important to mention that during wound healing a significant increase

in the expression of collagenase is observed which may degrade GC31 matrix at much faster rate

than other formulations (shown in biodegradation studies). Lack of stable matrix may affect the

cell growth, proliferation and migration or even result in cell death (as observed in later studies).

The percentage dye reduction of 70.794 4.55, 71.99 5.07 and 56.458 4.87% was observed

for GC11, GC13 and GC31 samples respectively, at the end of the analysis (Fig. 3b). Our results

directly correlate with the in vivo results obtained by Huang et al, wherein higher amount of

carboxymethyl chitosan in the formulations supported the cell proliferation [18].

In addition, all the samples were also found hemocompatible with percentage hemolysis ~ 4-5 %.

The percentage hemolysis observed for scaffolds GC11, GC13 and GC31 was 5.1 0.56, 4.59

18
0.38 and 4.77 0.64 % respectively. A slight hemolysis in the samples may be due to the

presence of free glutaraldehyde molecules which are considered to be cytotoxic. Furthermore,

the flow cytometry based live dead assay confirmed the long term cell viability with greater than

85 % live cells in the total cell population for all the scaffolds. It was observed that scaffolds

GC11, GC13 and GC31 showed 91.25, 90.88 and 87.89% viable cells respectively after 72h of

the analysis (Supp. Fig. S1). The cell cycle analysis showed that variation in the composition of

the formulations did not affect the cell cycle progression of 3T3 fibroblasts much (p > 0.05). For

all the formulations, major fraction of cells population lied in G0/G1 phase (~65-67%), followed

by G2/M phase (~21.5-27.0%) and S phase (~7.09-10.9%) (Fig. 3c). It is important to mention

sample GC31 had higher apoptotic/dead cell population in comparison to GC11 or GC13 as

evident from cell cycle and live dead assay.

The confocal micrographs showed that the fibroblast attained a well spreaded and elongated

morphology during the culture of the scaffolds. The growth followed a random pattern, without

any fixed directionality. In consistency with the proliferation data, the cell growth was observed

to increase on all the scaffolds with time (Fig. 3a). Figure 3a shows a stacked image derived

from z-sectioned image of the cell seeded scaffold. Furthermore, we also estimated the gene

expression profile of the cells seeded on the scaffolds, 7 days post cell seeding (Fig. 3d). The

RT-PCR results showed that the fibroblasts expressed of collagen type I on all the formulation,

suggesting the fibroblast adjusted to their environment and started the synthesizing their native

extracellular matrix proteins. It is important to mention that cells seeded on scaffold GC13

showed highest collagen type I expression (~1.69 folds in comparison to GC31), indicating the

suitability of its micro-architecture for the growth of fibroblasts. In addition, expression of

VEGF and HIF-1 genes was observed in all the cases. The cells seeded on GC11 and GC13 had

19
a similar expression profile of VEGF and HIF-1. However, the same for GC31 was lower by

around 2 folds in comparison to other formulation. This could be due higher rate of matrix

degradation by MMPs which would not allow the cells to adjust to continuously changing

microenvironment and thus affecting their expression profiles. The analysis of HIF-1 and

VEGF was carried out to find a clue regarding the potential of the scaffolds to support and

enhance angiogenesis. VEGF is a key player in the signaling pathways pertaining to

angiogenesis, endothelial cells migration and survival [30]. On the other hand, HIF-1 is a key

regulator of the VEGF expression. The angiogenesis at the wound area would enhance the rate of

wound healing [31]. These results were found in accordance with the in vivo studies carried out

by Huang et al, which demonstrated that the hydrogels with higher carboxymethyl chitosan in

the formulations supported higher degree of neo-vascularization [18].

20
 Fig. 3 Biological characterization of the GC scaffolds. (a) Confocal micrographs of the 3T3

mouse embryonic fibroblasts seeded on GC11, GC13 and GC31. (b) Proliferation of 3T3 cells on

GC scaffolds analyzed using Alamar blue assay. All the data were represented as Mean SD.

The graphs represent GC11, GC13 and GC31 by empty squares, filled circles and filled triangles

respectively. (c) Cell cycle profiling of 3T3 cells seeded on GC11 (c1), GC13 (c2) and GC31

(c3). (d) Semi-quantitative RT-PCR analysis of gene expression profiling.

3.6. In vitro drug release study

During wound healing, the release of drugs and therapeutics becomes essential in order to aid the

process. Both, natural and synthetic macromolecules have extensively been exploited for the

21
drug release application in order to maximize bioefficacy and facilitate clinical applicability [32].

Herein, ampicillin was used as a model drug to analyze release profile from the scaffolds. The

results revealed a significant variation in the release profiles of the three samples (p = 0.0170)

(Fig. 4). However, an insignificant difference was observed in the release profile of GC11 when

compared individually with the other two samples, GC13 (p = 0.1573) and GC31 (p = 0.0714).

GC31 showed the highest rate of release at the end of analysis, with percentage release of 70.73

4.36%. The same for GC11 and GC13 was 64.73 4.09 and 56.94 3.73% respectively.

Furthermore, the model fitting of the drug release profile of all the scaffolds showed to follow

KP model of release kinetics (R2 0.98). It is important to mention that the n value for all the

scaffolds was < 0.45, suggesting a Fickian diffusion mechanism of drug release [33].

Furthermore, a release profile of the protein therapeutics was also analyzed, taking bovine serum

albumin (BSA) as our model protein. A protein release of 38.41 2.69, 34.40 2.58 and 35.07

2.45% was observed for GC11, GC13 and GC31 respectively. In addition, the scaffolds also

showed a clear zone of inhibition in antibiotic susceptibility test, indicating the diffusional

release of ampicillin. Consistent with the drug release data, GC31 showed the maximum release

of antimicrobial drug, ampicillin; owing to maximum zone of inhibition (33.4 1.2 and 25 1.8

for E. coli and S. epidermis respectively). The same for GC11 and GC13 was found to be 30.9

0.81 and 28.18 0.89 mm respectively against E. coli and 21.9 1.1 and 19.8 1.6 mm

respectively against S. epidermis (Supp. Fig. S2). This clearly suggests that the drug loaded

scaffolds had an effective bactericidal activity and could prevent the wound from the exogenous

infections.

These results, taken together support the applicability of GC scaffolds for dermal tissue

engineering. Amongst all the three formulations, GC31 showed higher therapeutic release than

22
GC11 and GC13. However, the biodegradation results showed its rapid degradation in the

presence of collagenase, thus limiting its applicability for wound healing which is a slower

process. In addition, the biological characterization of the scaffolds also demonstrated lower

growth and proliferation of fibroblasts onto GC31 scaffold than GC11 or GC13. This indicates

that higher carboxymethyl chitosan in the formulation (GC11 and GC13), resulted in lower rate

of collagenase assisted scaffold degradation with a sustained rate of therapeutic release and

supported the fibroblast growth, which might provide optimal conditions for the wound healing

to occur.

23
 Fig. 4 Analysis of release of ampicillin and BSA from GC scaffolds. (a) CPDR of the drug

loaded scaffolds; (b) KP model fitting. All the data were represented as Mean SD. The graphs

represent release of ampicillin (filled symbols) and BSA (empty symbols) from GC11 (black

squares), GC13 (light gray circles) and GC31 (dark gray triangles).

4. Conclusion
24
In the present study, we have demonstrated the applicability of gelatin (G) - carboxymethyl

chitosan (C) scaffolds for dermal tissue engineering application. The preparation of scaffolds

was done by freeze drying method and their physico-chemico-biological characterizations were

carried out. The results revealed that the scaffolds had uniform porous structure with pore size,

high water uptake and water retention capacity. The scaffolds degraded slowly in the presence of

lysozyme and bacterial enzyme cocktail. However, collagenase mediated degradation was

dependent on the amount of gelatin present in the formulation especially those containing gelatin

in higher concentration. All the formulations supported adhesion, growth and proliferation of

mouse fibroblasts. The cells seeded on the scaffold showed the expression of collagen type I,

HIF1 and VEGF expression, thus providing a clue regarding their potential to support

angiogenesis and enhance the rate of wound healing. In addition, the scaffolds showed a

sustained release of ampicillin, confirming their therapeutic delivery potential at the wound site.

All together, gelatin carboxymethyl chitosan based scaffolds provide a potential candidature for

wound healing applications. Amongst all the investigated formulations; GC13 was found to have

highest suitability for such applications.

Conflicts of Interests

Authors declare no conflicts of interest.

References

[1] A.D. Sezer, E. Cevher, Biopolymers as wound healing materials: challenges and new

strategies, INTECH Open Access Publisher, 2011.

[2] B. Steffensen, L. Hkkinen, H. Larjava, Crit Rev Oral Biol Med, 12 (2001) 373-398.

25
[3] A.S. Halim, T.L. Khoo, S.J.M. Yussof, Indian J Plast Surg, 43 (2010) S23-S28.

[4] M.P. Rowan, L.C. Cancio, E.A. Elster, D.M. Burmeister, L.F. Rose, S. Natesan, R.K. Chan,

R.J. Christy, K.K. Chung, Critical Care, 19 (2015) 1-12.

[5] R. Augustine, N. Kalarikkal, S. Thomas, Prog biomater, 3 (2014) 103-113.

[6] F. Han, Y. Dong, Z. Su, R. Yin, A. Song, S. Li, Int J Pharm, 476 (2014) 124-133.

[7] W. Paul, C.P. Sharma, Trends Biomater Artif Organs, 18 (2004) 18-23.

[8] T. Dai, M. Tanaka, Y.-Y. Huang, M.R. Hamblin, Expert Rev Anti Infect Ther, 9 (2011) 857-

879.

[9] A. Tanaka, T. Nagate, H. Matsuda, Journal of veterinary medical science, 67 (2005) 909-913.

[10] P. Agrawal, S. Soni, G. Mittal, A. Bhatnagar, Int J Low Extrem Wounds, 13 (2014) 180-

190.

[11] Q. Xing, K. Yates, C. Vogt, Z. Qian, M.C. Frost, F. Zhao, Sci Rep, 4 (2014).

[12] D. Mishra, B. Bhunia, I. Banerjee, P. Datta, S. Dhara, T.K. Maiti, Mater Sci Eng C, 31

(2011) 1295-1304.

[13] J. Shi, N.M. Alves, J.F. Mano, J Biomed Mater Res Part B Appl Biomater, 84 (2008) 595-

603.

[14] T. Gotoh, K. Matsushima, K.-I. Kikuchi, Chemosphere, 55 (2004) 135-140.

[15] N. Alves, J. Mano, Int J Biol Macromol, 43 (2008) 401-414.

[16] V. Bansal, P.K. Sharma, N. Sharma, O.P. Pal, R. Malviya, Adv Biol Res, 5 (2011) 28-37.

[17] Y. Zhou, Y. Zhao, L. Wang, L. Xu, M. Zhai, S. Wei, Radiat Phys Chem, 81 (2012) 553-560.

[18] X. Huang, Y. Zhang, X. Zhang, L. Xu, X. Chen, S. Wei, Mater Sci Eng C, 33 (2013) 4816-

4824.

[19] I. Banerjee, D. Mishra, T.K. Maiti, Int J Biomater, 2009 (2009).

26
[20] G. Pasparakis, N. Bouropoulos, Int. J. Pharm., 323 (2006) 34-42.

[21] T. Agarwal, S.G.H. Narayana, K. Pal, K. Pramanik, S. Giri, I. Banerjee, Int J Biol

Macromol, 75 (2015) 409-417.

[22] S. Satapathy, V.K. Singh, S.S. Sagiri, T. Agarwal, I. Banerjee, M.K. Bhattacharya, N.

Kumar, K. Pal, J Appl Polym Sci, 132 (2015).

[23] V.K. Singh, I. Banerjee, T. Agarwal, K. Pramanik, M.K. Bhattacharya, K. Pal, Colloids Surf

B Biointerfaces, 123 (2014) 582-592.

[24] S. Gorgieva, V. Kokol, Collagen-vs. gelatine-based biomaterials and their biocompatibility:

review and perspectives, INTECH Open Access Publisher, 2011.

[25] I. Migneault, C. Dartiguenave, M.J. Bertrand, K.C. Waldron, Biotechniques, 37 (2004) 790-

806.

[26] H.-M. Wang, Y.-T. Chou, Z.-H. Wen, Z.-R. Wang, C.-H. Chen, M.-L. Ho, PloS one, 8

(2013) e56330.

[27] A. Mittal, N. Kumar, Pharm Res, 29 (2012) 3110-3121.

[28] C.K. Field, M.D. Kerstein, Am J Surg, 167 (1994) S2-S6.

[29] Q. Cai, J. Bei, S. Wang, J Biomater Sci Polym Ed, 11 (2000) 273-288.

[30] S. Kulanthaivel, U. Mishra, T. Agarwal, S. Giri, K. Pal, K. Pramanik, I. Banerjee, Ceram

Int, 41 (2015) 11323-11333.

[31] M.G. Tonnesen, X. Feng, R.A. Clark, in: J Investig Dermatol Symp Proc, Nature

Publishing Group, 2000, pp. 40-46.

[32] Y. Fu, W.J. Kao, Expert Opin Drug Deliv, 7 (2010) 429-444.

[33] S. Dash, P.N. Murthy, L. Nath, P. Chowdhury, Acta Pol Pharm, 67 (2010) 217-223.

27
TABLE CAPTION LIST

Table 1 Pore size and porosity of the gelatin-carboxymethyl chitosan (GC) scaffolds

FIGURE CAPTION LIST

Fig. 1 (a) Scanning electron micrographs of GC scaffolds. (a1) GC31; (a2) GC13; (a3) GC11. (b)

FTIR profile of the GC scaffolds: GC11 (Black); GC13 (dark gray); GC31 (light gray). The

arrows demonstrate the prominent IR peaks of gelatin (black arrows) and carboxymethyl

chitosan (grey arrows). (c) Mechanical tensile strength profile of the GC scaffolds: Stress (MPa,

horizontal lines); Force (N, diagonal lines); Percentage elongation (%, vertical lines).

Fig. 2 (a) Swelling profile of GC scaffolds in phosphate buffer saline (pH 7.4). (b) Percentage

water retention in the GC scaffolds. (c) Degradation profile of the GC scaffolds in the presence

of (c1) collagenase type I; (c2) lysozyme; (c3) bacterial enzyme cocktail. All the data were

represented as Mean SD (*, p<0.005). The graphs represent GC11, GC13 and GC31 by empty

squares, filled circles and filled triangles respectively.

Fig. 3 Biological characterization of the GC scaffolds. (a) Confocal micrographs of the 3T3

mouse embryonic fibroblasts seeded on GC11, GC13 and GC31. (b) Proliferation of 3T3 cells on

GC scaffolds analyzed using Alamar blue assay. All the data were represented as Mean SD.

The graphs represent GC11, GC13 and GC31 by empty squares, filled circles and filled triangles

respectively. (c) Cell cycle profiling of 3T3 cells seeded on GC11 (c1), GC13 (c2) and GC31

(c3). (d) Semi-quantitative RT-PCR analysis of gene expression profiling.

Fig. 4 Analysis of release of ampicillin and BSA from GC scaffolds. (a) CPDR of the drug

loaded scaffolds; (b) KP model fitting. All the data were represented as Mean SD. The graphs

28
represent release of ampicillin (filled symbols) and BSA (empty symbols) from GC11 (black

squares), GC13 (light gray circles) and GC31 (dark gray triangles).

29
Supplementary Figures

Supplementary Figure S1 Biocompatibility and Live Dead assay of the 3T3 cells seeded on the

GC scaffolds. The dead cells took propidium iodide stain and thus grouped as a separate cell

population.

30
Supplementary Figure S2: Antibiotic susceptibility test of ampicillin loaded GC scaffolds

against E. coli and S. epidermis.

31