Laboratory Exercise
A Laboratory Exercise For Visible Gel
Filtration Chromatography Using
Fluorescent Proteins
From the Department of Biology, College of Chemistry and Life
Sciences, Zhejiang Normal University, Jinhua, China, 321004
Abstract
Gel filtration chromatography (GFC) separates molecules
according to size and is one of the most widely used meth-
ods for protein purification. Here, red fluorescent protein
(RFP), green fluorescent protein (GFP), yellow fluorescent
protein (YFP), cyan fluorescent protein (CFP), and/or their
fusion proteins were prokaryotically expressed, purified,
and used in a laboratory exercise to intuitively demonstrate
GFC. Different bands, corresponding to RFP, RFP-CFP (RC),
YFP-RFP-YFP (YRY), and pyruvate kinase II-GFP (PKG) were
Keywords: gel filtration chromatography; fluorescent protein;
laboratory exercise
Introduction
As one of the most abundant biological macromolecules,
proteins occur in all organisms in a great diversity of sizes
and functions. Proteins may be separated based on their
relative size, charge, and/or affinity to resins used in col-
umn chromatography. Gel filtration chromatography (GFC),
also known as size exclusion chromatography, separates
proteins in their native state according to their relative
size. Gel filtration media consist of precisely shaped beads
with cavities of a particular size. The probability of a pro-
tein diffusing into these cavities increases with decreasing
protein size, such that smaller proteins are retained longest
[1]. Therefore, a mixture of proteins will elute from the col-
umn in order of decreasing size. The resolution of GFC
depends on many factors, including the nature of the sepa-
ration medium (particle size, uniformity, match in size
between cavities, and analyte), column factors (bed height,
*Address for correspondence to: The Department of Biology, College
of Chemistry and Life Sciences, Zhejiang Normal University, Jinhua,
China 321004. E-mail: mhsun@zjnu.cn
Received 30 April 2014; Revised 11 September 2014; Accepted 21
October 2014
DOI 10.1002/bmb.20833
Published online 00 Month 2014 in Wiley Online Library
(wileyonlinelibrary.com)
Biochemistry and Molecular Biology Education
Wenqiang Zhang
Yibin Cao
Lishan Xu
Jufang Gong
Meihao Sun*
well separated on a Superdex 200 column from a 0.5-mL
sample. Increasing the sample volume and changing the
chromatographic resin to Sephadex G-100 resulted in
lower resolution separation. Students enjoyed identifying
combinations of colored proteins and found this exercise
helpful for understanding the factors that affect GFC resolu-
tion. V
C 2014 by The International Union of Biochemistry
and Molecular Biology, 00(0):000000, 2014.
column packing quality) and several experimental factors,
such as flow rate, sample volume, and eluent viscosity.
Many fluorescent proteins, such as green (GFP), yellow
(YFP), cyan (CFP), and red fluorescent proteins (RFP), are
visible to the naked eye and are brightly colored in solution
[26]. Several of these proteins have been used in teaching
lessons on protein expression and purification [79] and
structure-function relationships [10, 11]. They have also
been used to demonstrate various protein purification tech-
niques [7, 9], including GFC with polyhistidine-tagged RFP
and MBP-tagged EGFP [9]. In order to facilitate the use of
colorful and visibly fluorescent proteins in education, Bio-
TM
Rad (http://www.bio-rad.com) supplies the pGLO bacterial
transformation kit (166-0003EDU) to express GFP in E. coli
and a GFP chromatography kit (166-0005EDU) to purify
GFP on hydrophobic chromatography columns. In the cur-
rent exercise, several fluorescent proteins were fused to
yield colored proteins that were then used to assess the
effects of sample volume and resin cavity diameter on GFC
resolution. Polyhistidine-tagged fusion proteins of RFP (26.9
kD), RFP-CFP (RC, 54.9 kD), YFP-RFP-YFP (YRY, 84.3 kD)
and pyruvate kinase II-GFP (PKG, monomer 84 kD, dimer
168.0 kD) were expressed, purified, and separated
successfully on a Superdex 200 column (globular protein
fractionation range of 10600 kD). Students found that GFC
resolution could be decreased dramatically by increasing
the sample volume or by switching the chromatographic
resin to Sephadex G-100.
1

Primers used for DNA fragment amplification
TABLE 1
Primer
name (5-3) Nucleotide sequence
RFPf GGATCCATGGACAACACCGAGGACGTCATCAAGGAG (BamH I)
RFPr GGAATTCTCACTTGTACAGCTCGTCCAT (EcoR I)
YFPf GGGAATTCCATATGGTGAGCAAGGGCGAGGAG (Nde I)
YFPrBamHI CGCGGATCCCTTGTACAGCTCGTCCAT (BamH I)
YFPrEcoRI GAATTCTCAATGATGATGATGATGATGCTTGTACAGCTCGTCCATGCCGAGAGTGATCCC (EcoR I)
GFP-F CGGGATCCGTGAGCAAGGGCGAGGAG (BamH I)
GFP-R GGAATTCTCACTTGTACAGCTCGTCCATG (EcoR I)
PKf GGGAATTCCATATGATGTCCAGAAGGCTTCGCAGAAC (Nde I)
PKr CGCGGATCCCTCTACCGTTAAAATACGCGTGGTATTAG (BamH I)
RYir CGGTGAACAGCTCCTCGCCCTTGCTCACCATCTGGGAGCCGGAGTGGCGGG
RYif CCCGCCACTCCGGCTCCCAGATGGTGAGCAAGGGCGAGGAGCTGTTCACCG
Restriction sites are underlined.
Materials and Methods
Materials and Reagents
Prime STAR Polymerase, restriction endonucleases, dNTP
mixture, DNA markers, and T4 DNA ligase were purchased
from TaKaRa (Japan). Lysozyme, DTT, IPTG, PMSF, and
pepstatin A were purchased from Amresco (USA). Ni-NTA
His
Bind Superflow Resin was from Novagen (Germany).
Superdex 200 and Sephadex G-100 resins were obtained
from GE Healthcare (USA). Ampicillin was purchased from
Oxford LTD (Hampshire, England). All other chemicals
were of analytical grade and were obtained from domestic
companies. pDsRed-N1, pEGFP-Cl, pEYFP-N1, and
pETCFP-Cl were purchased from RYgene (www.yrbio.com,
Changsha, China). pMD18-T simple vector was purchased
from TaKaRa (Shiga, Japan). Prokaryotic expression vec-
tors pHIS9 (a derivative vector of pGEX-6P-1, in which the
GST and PreScission protease coding regions were replaced
by a coding sequence for nine histidine residues), pGEX-PK
(expression vector pGEX-6P-1 harboring pyruvate kinase II
from Escherichia coli), E. coli DH5a, and BL21 (DE3) were
obtained from our laboratory collection.
Construction of pRFP for the Expression of RFP
PCR was used to amplify nucleotide sequences. The typical
PCR mixture consisted of 2 lL PCR buffer, 2 lL dNTP solu-
tion (2.5 mM), 1 lL of a solution containing forward and
reverse primers (100 ng/lL), 1 lL DNA template solution
(100 ng/lL), and 0.2 lL DNA Polymerase (1.0 unit). The
2 Visible Gel Filtration Chromatography Using Fluorescent Proteins
Biochemistry and
Molecular Biology Education
Sequence
RFP
YFP
GFP
PK
YRY
PCR conditions comprised a 5-min hot start at 95 C, fol-
lowed by 30 cycles of denaturation (30 s at 95 C), anneal-
ing (30 s at 58 C), and extending (60 s at 72 C). RFP was
amplified using primers RFPf and RFPr with pDsRed-N1 as
the template. After subsequent digestion using the corre-
sponding restriction enzymes (BamH I and EcoR I), the RFP
fragment was purified by gel chromatography and inserted
into the expression vector pHIS9 to yield pRFP. Cloned
sequences were validated by sequencing (Sangon Biotech,
Shanghai, China). Primers and amplified genes are listed in
Table 1.
Construction of pRC for the Expression of Fusion
Protein RC
Splicing of RFP and CFP was performed by overlapping
PCR. Complementary sequences to RFP and CFP are located
at the ends of primers RYir and RYif, respectively. Two
DNA fragments RFPi (derived using primers RFPf and RYir)
and CFPi (derived using primers RYif and YFPrEcoRI) were
amplified from templates pDsRed-N1 and pETCFP-Cl,
respectively. RC was further amplified using primers RFPf
and YFPrEcoRI with mixed templates of RFPi (50 ng) and
CFPi (50 ng), and the product was then inserted into pHIS9
to yield the expression vector pRC after digestion with
BamH I and EcoR I.
Construction of pYRY for the Expression of Fusion
Protein YRY
YFP was amplified using primers YFPf and YFPrBamHI
together with pEYFP-N1 as the template. Following
 loaded onto a Ni-NTA affinity column (10 3 30 mm) pre-
Timetable for a practical course on GFC equilibrated with buffer A (50 mM KPO4, 0.4 M KCl, pH
TABLE 2
8.0). The column was then washed with five-fold bed vol-
ume of buffer B (50 mM KPO4, 0.4 M KCl, 75 mM imidaz-
ole, pH 7.3) and eluted with buffer C (50 mM KPO4, 0.4 M
Days Methods
KCl, 5 mM b-ME and 250 mM imidazole, pH 7.3). After
1 Introduction dialysis using buffer D (50 mM KCl, 1.5 mM DTT, 5% glyc-
erol and 50 mM Hepes, pH 8.0), the final proteins were
Construction of plasmids
analyzed by SDS-PAGE and stored at 280 C. Protein con-
Competent cell transformation (E.coli DH5a) centrations were determined using the Bradford method
[13] with bovine serum albumin (BSA) as the standard.
2 Individual colony selection and growth in liquid media
Purification of plasmid DNA
Gel Filtration Chromatography
Either 500 mL or 2 mL of a protein mixture containing RFP,
Competent cell transformation (E.coli BL21) RC, YRF, and PKG (0.30.5 mg each) were loaded onto pre-
3 Individual colony selection and growth in liquid media equilibrated (50 mM KCl, 50 mM Hepes, pH 8.0) Superdex
200 (S200) or Sephadex G-100 (SG100) columns (1 3
IPTG induction 30 cm) with AKTA Prime (GE Health Sciences). GFC sepa-
4 Protein purification by Ni resin ration was performed at a flow rate of 0.4 mL/min.

SDS-PAGE
Concentration measurement of the proteins Results and Discussion
Laboratory Exercise Design
5 Gel filtration chromatography
This laboratory exercise was designed for an Advanced
Biochemistry course comprising students who have previ-
digestion with Nde I and BamH I, YFP was ligated into ously completed Biochemistry, Molecular Biology, and
pHIS9 to yield vector pYFP. After amplification by overlap- Genetic Engineering courses. After an initial lecture outlin-
ping PCR as described above, RY (RFP-YFP) was digested ing the goals of this exercise, a timetable (Table 2) was dis-
using BamH I and EcoR I and ligated into pYFP to create tributed to the students. Students worked in groups of two
the expression vector pYRY. to pick one gene to clone, express the corresponding
protein, and set up one GFC experiment by sharing the
Construction of pPKG for the Expression of Fusion proteins they purified.
Protein PKG
Pyruvate kinase II (PK) was amplified using primers PKf Protein Expression and Purification
and PKr and the template pGEX-PK. After double digestion Highly stable fluorescent proteins were selected for this
using Nde I and BamH I, PK was inserted into pHIS9 to laboratory exercise. Fluorescent proteins and combinations
yield pPK. GFP was amplified using primers GFPf and GFPr thereof were used to obtain various colored proteins.
and the template pEGFP-Cl. After digestion with BamH I Fluorescent protein genes were cloned and spliced into
and EcoR I, GFP was inserted into pPK to yield pPKG. expression vectors by the students (Fig. 1). Considering the
prerequisites of Molecular Biology and Genetic Engineer-
Protein Expression and Purification ing, and in particular the corresponding laboratory courses
Protein expression and purification were performed as
described previously [12]. Briefly, expression vectors were
transformed into E. coli BL21 (DE3). The transformed
strain was cultured in LB medium supplemented with
0.1 mg/mL ampicillin overnight at 37 C. Once the OD600
reached 0.60.8, the cultures were cooled to 16 C, and
isopropyl-b-D-1-thiogalactopy-ranoside (IPTG) was added
to a final concentration of 0.5 mM to induce protein expres-
sion for 16 h. Cells were harvested by centrifugation (5,000
3 g) at 4 C for 10 min. The cells were resuspended in lysis
buffer (50 mM KPO4, 0.4 M KCl, 290 lM PMSF, 1.5 lM pep-
statin A, 0.1 mg/mL lysozyme, pH 8.0) and incubated at 4 C
for 1 h. Cells were further disrupted by sonication (450 W, Illustration of the gene structures for RFP, RC,
10 min at 0 C) and the debris was removed by centrifuga- FIG 1 YRY, and PKG and their corresponding molecular
tion (18,000 g) at 4 C for 40 min. The supernatant was weights. H represents the polyhistidines.

Zhang et al. 3
 Biochemistry and
Molecular Biology Education

(a) An image of a typical Superdex 200 column

FIG 3 during protein separation using a sample volume
of 0.5 mL. From top to bottom, the four fluores-
cent bands are RFP, RC, YRY, and PKG. (b) The
corresponding OD280 chromatogram contained
four major peaks representing PKG, YRY, RC,
and RFP (from left to right).

0.4 mL/min. A typical GFC column loaded with the S200a

Typical protein purification and the purified fluo- resin is shown in Fig. 3a. The four proteins were well sepa-
FIG 2 rescent proteins. (a) Expression and purification rated on the column with RFP at the top, followed by RC,
of RFP; Lane M: protein molecular marker (kD), YRY, and PKG. The UV280 chromatogram in Fig. 3b is con-
Lane 1: before IPTG induction, Lane 2: after IPTG sistent with the visibly colored bands on the column. One
induction, Lane 3: the cell lysate supernatant,
Lane 4: the flow-through loaded to the Ni21 col-
minor peak corresponding to 22 mL was most likely due
umn, Lane 5: a wash sample of the Ni21 column, to protein contaminants. PKG was the first to elute, sug-
Lane 6: the RFP final target protein. (b) Purified gesting the oligomerization of PKII. The GFC column con-
fluorescent proteins. From left to right, the pro- taining the S200b resin is shown in Fig. 4. The four pro-
teins are RFP, RC, YRY, and PKG. teins were not separated as well, and the chromatographic
peaks overlapped significantly, demonstrating that increas-
the students were already well-versed and experienced in ing the sample volume from 0.5 to 2 mL decreased the
gene cloning and vector construction. Polyhistidine-tagged
fluorescent proteins were overexpressed prokaryotically
and then purified using a Ni-NTA affinity column. Typical
results are shown in Fig. 2a. RFP, RC, YRY, and PKG dis-
play distinct colors (Fig. 2b). Most of the students were
amazed by the new colored proteins that resulted from the
various combinations. PKII was found to exist as a dimer
based on gel filtration (H. Li and M. Sun, unpublished
data). Therefore, PKG (monomer 84 kDa) would be a 168-
kD protein in its native state.

Gel Filtration Chromatography

After purification, each group determined the concentration
of their protein solution and shared these data with the
other groups to yield a sample set of four fluorescent pro-
teins. Three sets were designated to evaluate the effects of
resin type and sample volume on the separation resolution (a) An image of a typical Superdex 200 column
of GFC. One set was used with a Superdex 200 column with FIG 4 during protein separation using a 2-mL sample
volume. From top to bottom, the four fluorescent
a 0.5-mL sample volume (S200a), a second set was used
bands are RFP, RC, YRY, and PKG. (b) The corre-
with a Superdex 200 column with a 2-mL sample volume sponding OD280 chromatogram contained four
(S200b), and the third set was used with a Sephadex G-100 major peaks representing PKG, YRY, RC, and RFP
with a 0.5-mL sample volume (SG100). Flow rates were (from left to right).

4 Visible Gel Filtration Chromatography Using Fluorescent Proteins


(a) An image of a typical Sephadex G-100 column
FIG 5 during protein separation using a sample volume
of 0.5 mL. (b) The corresponding OD280 chromat-
ogram contains only a single peak.
resolution. Performing the separation using a Sephadex G-
100 column resulted in even poorer resolution (Fig. 5). The
four proteins were not separated visibly (Fig. 5a), and only
one major peak was observed in the chromatogram (Fig.
5b). This showed that either the resin was not suitable for
these particular proteins or that the column was packed
poorly.
Discussion
This laboratory exercise was performed at the College of
Chemistry and Life Sciences, Zhejiang Normal University.
Students performed the gene cloning, protein expression,
and GFC separation. After the exercise, the students were
provided with take-home questions to reinforce the crucial
concepts and expand their knowledge on proteins in
general:
1. The four tandemly fused fluorescent proteins had appa-
rent native molecular weights of 26.9, 54.9, 84.3 and
168 kD. What was the order of proteins eluting from the
gel filtration column? Why?
2. Do most proteins exhibit visible fluorescence? Explain
why the chosen proteins are fluorescent.
3. If PKII were a monomer in its native state, how would
this affect the elution order? Why?
4. Can any kind of gel filtration chromatography resin be
used in this laboratory exercise? Why?
After-class evaluation consisted of questions such as,
What do you think about this exercise?; How helpful
was it in achieving the course objectives?; Are there any
improvements that could be made to the experiment?
Over 80% of the students left positive feedback on this
excercise. Some of their comments are listed below:
The colorful fluorescent proteins are beautiful. They
are really impressive. I will never forget this experiment.
This demonstration definitely helped me remember
that when using gel filtration chromatography, the big ones
Zhang et al.
come out first, not like in a sieve where the big ones are
retained.
One student also left a message concerning a limitation in
the experiment: When using gel filtration chromatography,
molecules are separated based on both molecular weight (size)
and their three-dimensional shape. Here, we saw the separa-
tion results based on size, but not shape. Is there any way to
show the effects of size and shape in one excercise?
This is one improvement we can make in the future.
We can also implement additional experiments to address
some of the other variables that affect GFC resolution and
provide additional choices for students in the construction
of fusion genes. All of the constructs made in this labora-
tory exercise are available upon request.
Common Errors and Safety Issues
Several common errors and safety issues are listed below:
1. Ethidium bromide, a powerful mutagen, is a component
of the agarose gel used in electrophoresis during plas-
mid construction. It should be used in a designated area.
Gloves should be worn to avoid direct skin contact.
Waste materials should be disposed of as a special waste
via a Hazardous Waste Program.
2. Sodium azide is sometimes used to prevent bacterial
growth in gel filtration columns. Gloves should be worn
while handling sodium azide. Related waste should be
quenched with nitrous acid before disposal.
3. The impurity of polyhistidine-tagged proteins can com-
plicate results. Elution using a linear gradient of 10
250 mM immidazole would solve this problem.
4. The quality of the column packing is essential for effi-
cient protein separation. Resins should be degassed
before packing. If the column dries out, it needs to be
repacked according to the manufacturers instructions.
Acknowledgements
This work was supported by the High Education and
Teaching Reformation Project from the Bureau of Educa-
tion of Zhejiang Province (kg2013080).
References
[1] Nelson, D.L., Cox, M.M., and Lehninger (2008) Principles of Biochemis-
try, W.H. Freeman and Company, New York.
[2] Bevis, B.J. and Glick, B.S. (2002) Rapidly maturing variants of the Disco-
soma red fluorescent protein (DsRed). Nat. Biotechnol. 20, 8387.
[3] Cubitt, A.B., Woollenweber, L.A., and Heim, R. (1999) Understanding
structure-function relationships in the Aequorea victoria green fluores-
cent protein. Methods Cell Biol 58, 1930.
[4] Heim, R., Cubitt, A.B., and Tsien, R.Y. (1995) Improved green fluores-
cence. Nature 373, 663664.
[5] Patterson, G.H., Knobel, S.M., Sharif, W.D., Kain, S.R., and Piston, D.W.
(1997) Use of the green fluorescent protein and its mutants in quantita-
tive fluorescence microscopy. Biophys. J. 73, 27822790.
[6] Shaner, N.C., Campbell, R.E., Steinbach, P.A., Giepmans, B.N., Palmer,
A.E., and Tsien, R.Y. (2004) Improved monomeric red, orange and
5

yellow fluorescent proteins derived from Discosoma sp. red fluorescent
protein. Nat. Biotechnol. 22, 15671572.
[7] Cohen, T.M., Rohs, A.E., and Lefebvre, B.G. (2008) A laboratory demon-
stration illustrating bioseparations using colorful proteins. Biochem.
Mol. Biol. Educ. 36, 287291.
[8] Larkin, P.D. and Hartberg, Y. (2005) Development of a green fluorescent
protein-based laboratory curriculum. Biochem. Mol. Biol. Educ. 33,
4145.
[9] Wu, Y., Zhou, Y., Song, J., Hu, X., Ding, Y., and Zhang, Z. (2008) Using
green and red fluorescent proteins to teach protein expression, purifica-
tion, and crystallization. Biochem. Mol. Biol. Educ. 36, 4354.
6 Visible Gel Filtration Chromatography Using Fluorescent Proteins
Biochemistry and
Molecular Biology Education
[10] Giron, M.D. and Salto, R. (2011) from green to blue: Site-directed muta-
genesis of the green fluorescent protein to teach protein structure-
function relationships. Biochem. Mol. Biol. Educ. 39, 309315.
[11] Medin, C.L. and Nolin, K.L. (2011) A linked series of laboratory exercises
in molecular biology utilizing bioinformatics and GFP. Biochem. Mol.
Biol. Educ. 39, 448456.
[12] Sun, M. and Leyh, T.S. (2006) Channeling in sulfate activating com-
plexes. Biochemistry 45, 1130411311.
[13] Bradford, M.M. (1976) A rapid and sensitive method for the quantitation
of microgram quantities of protein utilizing the principle of protein-dye
binding. Anal. Biochem. 72, 248254.