Graduate Theses and Dissertations Graduate College

2008

Development of obesity-induced inflammation

and insulin resistance: The role of adipose tissue,
fatty acids, and toll-like receptors
Jeremy E. Davis
Iowa State University

Follow this and additional works at: http://lib.dr.iastate.edu/etd

Part of the Nutrition Commons

Recommended Citation
Davis, Jeremy E., "Development of obesity-induced inflammation and insulin resistance: The role of adipose tissue, fatty acids, and toll-
like receptors" (2008). Graduate Theses and Dissertations. Paper 11169.

This Dissertation is brought to you for free and open access by the Graduate College at Digital Repository @ Iowa State University. It has been accepted
for inclusion in Graduate Theses and Dissertations by an authorized administrator of Digital Repository @ Iowa State University. For more
information, please contact digirep@iastate.edu.
Development of obesity-induced inflammation and insulin resistance: The role of
adipose tissue, fatty acids, and toll-like receptors

by

Jeremy E. Davis

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Nutritional Sciences

Program of Study Committee:

Michael E. Spurlock, Major Professor
Kevin Schalinske
Deborah L. Alekel
Matthew Rowling
Donald C. Beitz

Iowa State University

Ames, Iowa

2008

Copyright Jeremy E. Davis, 2008. All rights reserved.

 ii

TABLE OF CONTENTS
LIST OF FIGURES iv

LIST OF TABLES v

ABSTRACT vi

CHAPTER 1. GENERAL INTRODUCTION 1

Introduction 1
Objectives and Specific Aims 3
References 5

CHAPTER 2. REVIEW OF LITERATURE 8

Obesity and Diabetes: Role of Inflammation and Oxidative Stress 8
Obesity Prevalence and Implications 8
Metabolic Syndrome and Insulin Resistance 10
Inflammation and Insulin Resistance 12
Cytokine and Chemokine-Induced Insulin Resistance 14
Oxidative Stress and Insulin Resistance 21
Obesity-Induced Insulin Resistance: Role of Free Fatty Acids 23
Overview of Fatty Acid Induced Insulin Resistance 23
Substrate Competition and Non-Oxidative Fatty Acid Metabolism 25
Dietary Fatty Acids Play a Role in Inflammation 26
Obesity-Induced Insulin Resistance: Role of Adipose Tissue 30
Adipose Tissue Cellularity and Changes with Obesity 30
Obesity-Induced Changes in Adipose Tissue Fatty Acid Metabolism 33
Obesity-Induced Cytokine Production in Adipose Tissue 36
Obesity-Induced Macrophage Accumulation in Adipose Tissue 40
Obesity-Induced Inflammation and Insulin Resistance: Toll-like Receptor 2 and 4 43
Overview of Toll-like Receptors 43
Tlr4- and Tlr2-Induced Inflammation and Insulin Resistance 45
Fatty Acid-Induced Tlr2 and Tlr4 Signaling 49
Summary 52
References 53

CHAPTER 3. TLR4 DEFICIENCY SELECTIVELY PROTECTS AGAINST

OBESITY INDUCED BY DIETS HIGH IN SATURATED FAT 86
Abstract 86
Introduction 86
Materials and Methods 88
Results 91
Discussion 94
Acknowledgements 98
References 98

CHAPTER 4. THE C-JUN N-TERMINAL KINASE MEDIATES THE INDUCTION

OF OXIDATIVE STRESS AND INSULIN RESISTANCE BY PALMITATE AND
TOLL-LIKE RECEPTOR 2 AND 4 LIGANDS IN 3T3-L1 ADIPOCYTES 110
Abstract 110
 iii

Introduction 110
Materials and Methods 113
Results 116
Discussion 119
References 123

CHAPTER 5. ABSENCE OF TLR2 AND TLR4 HIGH FAT DIET-INDUCED

OBESITY AND ADIPOSE-SPECIFIC INFLAMMATION AND INSULIN
RESISTANCE 134
Abstract 134
Introduction 135
Materials and Methods 136
Results 139
Discussion 144
References 146

CHAPTER 6. SUMMARY 158

References 162
 iv

LIST OF FIGURES
Figure 1. Fatty acid signaling through Tlr2 and Tlr4 in adipocytes. 4
Figure 2. Development of Metabolic Syndrome (MS). 10
Figure 2. Tlr4 deficiency protects mice from increased adiposity due to consumption of a
diet high in saturated fat. 105
Figure 7. Tlr4 deficiency improves markers of insulin sensitivity and inflammation in mice
fed a diet high in saturated fat. 106
Figure 4. Accumulation of F4/80-positive macrophages is attenuated in adipose tissue of
high Tlr4 deficient (10ScN) mice fed the HFP diet. 107
Figure 5. Adipose tissue inflammatory gene expression in Tlr4 deficient (10ScN) mice is
differentially regulated in response to the HFP diet. 108
Figure 6. Tlr4 deficiency attenuates NFB activation in adipose tissue of Tlr4 deficient
(10ScN) mice. 109
Figure 7. Palmitate, ZymA, and LPS induced insulin resistance in 3T3-L1 adipocytes. 130
Figure 8. Palmitate, ZymA, and LPS induced JNK phosphorylation and NFB and AP-1
nuclear translocation in 3T3-L1 adipocytes. 131
Figure 9. JNK inhibitor, SP600125, attenuated palmitate, ZymA, and LPS induced JNK
phosphorylation and inflammation in 3T3-L1 adipocytes. 132
Figure 10. JNK inhibitor, SP600125, attenuated palmitate, ZymA, and LPS induced NFB
and AP-1 nuclear translocation, oxidative stress, and insulin resistance in 3T3-L1
adipocytes. 133
Figure 11. Tlr2-/- and 10ScN mice are protected against DIO. 154
Figure 12. Absence of Tlr2 and Tlr4 expression differentially modifies markers of systemic
insulin sensitivity and inflammation. 155
Figure 13. Absence of Tlr2 and Tlr4 expression protects against SFA-induced inflammation
in AT. 156
-/-
Figure 14. SV cells isolated from Tlr2 exhibit improved insulin sensitivity, but are not fully
protected against FA-induced insulin resistance. 157
 v

LIST OF TABLES
Table 1. Diet Composition 102
Table 2. Primer Sequences for Quantitative Real-Time Polymerase Chain Reaction 103
Table 3. Adipose tissue fatty acid profiles in normal and Tlr4 mutant mice fed low fat
control, high fat control, and high fat-palmitate diets for 16 weeks 104
Table 4. Palmitate, ZymA, and LPS induced inflammation in 3T3-L1 adipocytes 128
Table 5. Palmitate, ZymA, and LPS induced inflammation in 3T3-L1 adipocytes 129
Table 6. Diet Composition 150
Table 7. Primer sequences for quantitative real-time polymerase chain reaction 151
Table 8. Lipid profiles in Tlr2 and Tlr4 deficient mice and wild type controls fed LFC, HFC,
or HFP diet for 16 weeks 152
Table 9. Serum fatty acid profiles in Tlr2 and Tlr4 deficient mice and wild type controls fed
LFC, HFC, and HFP diet for 16 weeks 153
 vi

ABSTRACT

The innate immune receptors, toll-like receptor-2 (Tlr2) and toll-like receptor-4

(Tlr4), are implicated in the development of inflammation and insulin resistance in various

cell populations. However, little is known about the relationship of these receptors in diet-

induced obesity (DIO). We have shown that Tlr4 deficient C57BL/10ScN mice were

protected against DIO, specifically when mice were fed a high saturated fatty acid (SFA)

diet. Moreover, these mice exhibited a specific reduction in adipose tissue (AT)

inflammation as evidenced by the reduction in nuclear factor kappa B (NFB) activation,

proinflammatory gene expression, and macrophage accumulation. There was also a marked

increase in Tlr2 expression in mice fed a high fat diet. 3T3-L1 adipocytes treated with the

Tlr2 agonist, zymosan A (ZymA), exhibited increased NFB and activator protein-1 (AP-1)

activation, proinflammatory gene expression, reactive oxygen species (ROS) accumulation,

and insulin resistance, similarly to palmitate or Tlr4 agonist lipopolysaccharide (LPS). These

effects were attenuated in adipocytes treated with a specific c-jun N-terminal kinase (JNK)

inhibitor (SP600125) indicating involvement of this intracellular kinase in SFA and Tlr

agonist-mediated signaling. Finally, we demonstrated that Tlr2-/- mice were also protected

from DIO. However, unlike Tlr4 deficient 10ScN mice there were no significant changes in

body weight, energy intake, or lipid profile. Inflammatory and oxidative stress markers in

serum (C-reactive protein (CRP), endotoxin, and monocyte chemoattractant protein-1(MCP-

1)) and AT (Tumor necrosis factor (TNF), interleukin-6 (IL-6), MCP-1, F4/80, and nitric

oxide synthase-2 (NOS2) transcript abundance) were attenuated in Tlr2-/- and 10ScN mice,

which was more apparent in mice fed high SFA diet. Insulin sensitivity was improved in

10ScN, but not Tlr2-/- mice. However, stromal vascular (SV) cells isolated from AT of Tlr2-/-
 vii

mice had a marked increase in insulin sensitivity, demonstrating the potential involvement of

Tlr2 in obesity-induced insulin resistance in AT. Based on these studies, Tlr2 and Tlr4 may

represent ideal targets for pharmaceutical, as well as dietary, interventions designed to

attenuate obesity and related co-morbidities, including Type 2 diabetes mellitus (DM) and

cardiovascular disease (CVD).

 1

CHAPTER 1. GENERAL INTRODUCTION

Introduction

Currently, approximately 60 million adults in the U.S. are classified as obese (BMI > 30),

and equally alarming, the prevalence of obesity has increased 30% during the past decade

(1). The medical and economic implications of obesity are exacerbated by its co-morbidities,

which include diabetes mellitus (DM) and atherosclerotic cardiovascular disease (CVD).

Generally, a chronic inflammatory state develops in association with obesity, and likely

contributes to the development of insulin resistance and its progression to DM (2,3). This

chronic inflammation associated with obesity is evident by the increased concentrations of

circulating proinflammatory cytokines, including tumor necrosis factor (TNF) and

interleukin-6 (IL-6) (4,5). The exact mechanisms which regulate this inflammation are not

yet clearly defined, but recent evidence has unequivocally implicated the adipocyte and its

inflammatory pathways as pivotal factors in the development of insulin resistance (6,7).

Several genetic and diet-induced rodent models of obesity have revealed that obesity

promotes increased expression of proinflammatory cytokines in adipose tissue (AT) (2,8),

and that this may be mediated by activation of nuclear factor kappa B (NFB) or activator

protein-1 (AP-1) signaling pathways (9,10). Furthermore, obesity-linked inflammation

parallels changes in adipose cell populations and phenotypes as AT is expanded through

hyperplasia and hypertrophy. Excessive adipocyte hypertrophy initiates changes in the

inflammatory characteristics of the adipocyte that include greater NFB transcriptional

activity and increased expression of proinflammatory cytokines (11). Excessive adipocyte

hypertrophy has also been associated with increased cell death and recruitment of

macrophages to AT (6,7). Macrophage infiltration represents a major contributor to obesity-

 2

induced inflammation and is partially regulated by the chemokine, monocyte chemoattractant

protein-1 (MCP-1) (12,13), which is known to be increased in the circulation of obese

subjects (14).

Furthermore, innate immunity may be a primary mediator of obesity-induced

inflammation in AT. Toll-like receptors (Tlrs) represent key innate immune receptors that are

expressed in adipocytes, preadipocytes, and macrophages (15-17). Interestingly, both Tlr2

and Tlr4 expression are increased with obesity and DM (16). Collectively, recent findings

indicate lipopolysaccharide (LPS)-stimulated Tlr4 activation induces expression of TNF,

IL-6, and MCP-1 in adipocytes and preadipocytes through a NFB dependent pathway

(15,18,19). LPS also increased Tlr2 transcript abundance in adipocytes (20). The interaction

between the LPS molecule and Tlr4 is mediated through the lipid A component of LPS,

which consists of several fatty acids attached to a phosphate and a central glucosamine dimer

(21). The fact that fatty acids can directly interact with Tlr receptors and stimulate

downstream signaling pathways that lead to inflammation is therefore not surprising (Figure

1). Palmitate and other saturated fatty acids (SFA) clearly stimulate proinflammatory

cytokine expression and NFB activation in adipocytes (22).

Several recent investigations (23-25) have provided evidence linking obesity-induced

inflammation to fatty acid signaling through Tlr4. Shi and colleagues (25) have shown that

Tlr4-/- mice have improved insulin sensitivity and attenuated inflammatory markers in AT

when stimulated with either lipid infusion or a high fat diet (25). These data are further

supported by in vitro experiments in which free fatty acid (FFA)-induced inflammatory

responses in adipocytes are attenuated when Tlr4 signaling is blunted by siRNA strategies.

More recently, Lee et al. (26) observed that SFA, but not polyunsaturated fatty acids
 3

(PUFA), activated Tlr2 dimerization and activatied stress-linked kinases, such as NFB and

AP-1, in RAW264.7 macrophages. Thomas and colleagues (27) also demonstrated that the

Tlr2 ligand, Zymosan-A (ZymA), when administered at low doses in vivo, stimulated chronic

low grade inflammation contributing to the formation of new adipocytes. These studies

underscore the important link between obesity and innate immunity, and how dietary SFA

may exacerbate obesity and its related co-morbidities through direct interactions with Tlr2

and Tlr4 in AT. The significance of the current studies is that it will identify the involment of

Tlr2 and Tlr4 in obesity-induced inflammation. Moreover, elucidation of ATs role in Tlr-

mediated inflammation and insulin resistance.

Objectives and Specific Aims

Our goal is to elucidate the specific mechanisms by which SFA induce insulin

resistance in adipocytes in relation to obesity and diabetes. Our central hypothesis is that

SFA exacerbate obesity-induced inflammation and insulin resistance through interactions

with not only Tlr4, but also through Tlr2, and that the SFA signaling through Tlr2 also

culminates in activation of proinflammatory transcription factors NFB and AP-1 in AT. The

rationale for the work proposed herein is that understanding the relationship between innate

immunity and obesity will allow recommendations for specific prevention and intervention

strategies, and future recommendations directed at optimizing human nutrition and health

and thereby reducing the risk of diseases associated with obesity. The Specific Aims are: (i)

to determine whether Tlr2-/- and/or Tlr4-/- mice are protected against high fat diet-induced

obesity, inflammation, and insulin resistance, (ii) to determine involvement of Tlr2 and/or
 4

Tlr4 signaling in adipocyte inflammation and insulin resistance, and (iii) to determine the

ability of specific dietary fatty acids to induce inflammation through Tlr2 and/or Tlr4.

Figure 1. Fatty acid signaling through Tlr2 and Tlr4 in adipocytes. Our proposed
mechanism of action of Tlr2 and Tlr4 mediated inflammation in adipocytes. Activation of
Tlrs requires stimulation by respective ligands, which include SFA. Following ligand binding
an inflammatory signaling cascade is initiated resulting in activation of proinflammatory
transcription factors, NFB and AP-1. The subsequent increase in transcription leads to the
release of proinflammatory mediators, which can act in an autocrine (e.g. adipocyte),
paracrine (e.g. adipocytes, macrophages, endothelial cells, and other AT-based cells), and
endocrine (e.g. muscle and liver tissue) manner.
 5

References

1. Flegal, K. M., Carroll, M. D., Ogden, C. L. & Johnson, C. L. (2002) Prevalence and trends
in obesity among US adults, 1999-2000. Jama 288: 1723-1727.

2. Greenberg, A. S. & Obin, M. S. (2006) Obesity and the role of adipose tissue in
inflammation and metabolism. Am J Clin Nutr 83: 461S-465S.

3. Wellen, K. E. & Hotamisligil, G. S. (2003) Obesity-induced inflammatory changes in

adipose tissue. J Clin Invest 112: 1785-1788.

4. Hotamisligil, G. S., Shargill, N. S. & Spiegelman, B. M. (1993) Adipose expression of

tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science 259: 87-
91.

5. Roytblat, L., Rachinsky, M., Fisher, A., Greemberg, L., Shapira, Y., Douvdevani, A. &
Gelman, S. (2000) Raised interleukin-6 levels in obese patients. Obes Res 8: 673-675.

6. Xu, H., Barnes, G. T., Yang, Q., Tan, G., Yang, D., Chou, C. J., Sole, J., Nichols, A.,
Ross, J. S., Tartaglia, L. A. & Chen, H. (2003) Chronic inflammation in fat plays a crucial
role in the development of obesity-related insulin resistance. J Clin Invest 112: 1821-1830.

7. Weisberg, S. P., McCann, D., Desai, M., Rosenbaum, M., Leibel, R. L. & Ferrante, A. W.,
Jr. (2003) Obesity is associated with macrophage accumulation in adipose tissue. J Clin
Invest 112: 1796-1808.

8. Trayhurn, P. (2005) Adipose tissue in obesity--an inflammatory issue. Endocrinology 146:

1003-1005.

9. Shoelson, S. E., Lee, J. & Goldfine, A. B. (2006) Inflammation and insulin resistance. J
Clin Invest 116: 1793-1801.

10. Hirosumi, J., Tuncman, G., Chang, L., Gorgun, C. Z., Uysal, K. T., Maeda, K., Karin, M.
& Hotamisligil, G. S. (2002) A central role for JNK in obesity and insulin resistance. Nature
420: 333-336.

11. Suganami, T., Nishida, J. & Ogawa, Y. (2005) A paracrine loop between adipocytes and
macrophages aggravates inflammatory changes: role of free fatty acids and tumor necrosis
factor alpha. Arterioscler Thromb Vasc Biol 25: 2062-2068.

12. Kanda, H., Tateya, S., Tamori, Y., Kotani, K., Hiasa, K., Kitazawa, R., Kitazawa, S.,
Miyachi, H., Maeda, S., Egashira, K. & Kasuga, M. (2006) MCP-1 contributes to
macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in
obesity. J Clin Invest 116: 1494-1505.

13. Chen, A., Mumick, S., Zhang, C., Lamb, J., Dai, H., Weingarth, D., Mudgett, J., Chen,
H., MacNeil, D. J., Reitman, M. L. & Qian, S. (2005) Diet induction of monocyte
chemoattractant protein-1 and its impact on obesity. Obes Res 13: 1311-1320.

14. Chacon, M. R., Fernandez-Real, J. M., Richart, C., Megia, A., Gomez, J. M., Miranda,
M., Caubet, E., Pastor, R., Masdevall, C., Vilarrasa, N., Ricard, W. & Vendrell, J. (2007)
 6

Monocyte chemoattractant protein-1 in obesity and type 2 diabetes. Insulin sensitivity study.
Obesity (Silver Spring) 15: 664-672.

15. Chung, S., Lapoint, K., Martinez, K., Kennedy, A., Boysen Sandberg, M. & McIntosh,
M. K. (2006) Preadipocytes mediate lipopolysaccharide-induced inflammation and insulin
resistance in primary cultures of newly differentiated human adipocytes. Endocrinology 147:
5340-5351.

16. Creely, S. J., McTernan, P. G., Kusminski, C. M., Fisher, F. M., Khanolkar, M., Evans,
M., Harte, A. L. & Kumar, S. (2006) Lipopolysaccharide activates an innate immune system
response in human adipose tissue in obesity and type 2 diabetes. Am J Physiol Endocrinol
Metab.

17. Mohammad, M. K., Morran, M., Slotterbeck, B., Leaman, D. W., Sun, Y., Grafenstein,
H., Hong, S. C. & McInerney, M. F. (2006) Dysregulated Toll-like receptor expression and
signaling in bone marrow-derived macrophages at the onset of diabetes in the non-obese
diabetic mouse. Int Immunol 18: 1101-1113.

18. Ajuwon, K. M., Jacobi, S. K., Kuske, J. L. & Spurlock, M. E. (2004) Interleukin-6 and
interleukin-15 are selectively regulated by lipopolysaccharide and interferon-gamma in
primary pig adipocytes. Am J Physiol Regul Integr Comp Physiol 286: R547-553.

19. Ajuwon, K. M. & Spurlock, M. E. (2005) Adiponectin inhibits LPS-induced NF-kappaB

activation and IL-6 production and increases PPARgamma2 expression in adipocytes. Am J
Physiol Regul Integr Comp Physiol 288: R1220-1225.

20. Lin, Y., Lee, H., Berg, A. H., Lisanti, M. P., Shapiro, L. & Scherer, P. E. (2000) The
lipopolysaccharide-activated toll-like receptor (TLR)-4 induces synthesis of the closely
related receptor TLR-2 in adipocytes. J Biol Chem 275: 24255-24263.

21. Ernst, R. K., Hajjar, A. M., Tsai, J. H., Moskowitz, S. M., Wilson, C. B. & Miller, S. I.
(2003) Pseudomonas aeruginosa lipid A diversity and its recognition by Toll-like receptor 4.
J Endotoxin Res 9: 395-400.

22. Ajuwon, K. M. & Spurlock, M. E. (2005) Palmitate activates the NF-kappaB

transcription factor and induces IL-6 and TNFalpha expression in 3T3-L1 adipocytes. J Nutr
135: 1841-1846.

23. Davis, J. E., Gabler, N. K., Walker-Daniels, J. & Spurlock, M. E. (2007) Tlr-4 deficiency
selectively protects against obesity induced by diets high in saturated fat. Obesity (Silver
Spring) Submitted.

24. Song, M. J., Kim, K. H., Yoon, J. M. & Kim, J. B. (2006) Activation of Toll-like receptor
4 is associated with insulin resistance in adipocytes. Biochem Biophys Res Commun 346:
739-745.

25. Suganami, T., Mieda, T., Itoh, M., Shimoda, Y., Kamei, Y. & Ogawa, Y. (2007)
Attenuation of obesity-induced adipose tissue inflammation in C3H/HeJ mice carrying a
Toll-like receptor 4 mutation. Biochem Biophys Res Commun.

26. Shi, H., Kokoeva, M. V., Inouye, K., Tzameli, I., Yin, H. & Flier, J. S. (2006) TLR4 links
innate immunity and fatty acid-induced insulin resistance. J Clin Invest 116: 3015-3025.
 7

27. Lee, J. Y., Zhao, L., Youn, H. S., Weatherill, A. R., Tapping, R., Feng, L., Lee, W. H.,
Fitzgerald, K. A. & Hwang, D. H. (2004) Saturated fatty acid activates but polyunsaturated
fatty acid inhibits Toll-like receptor 2 dimerized with Toll-like receptor 6 or 1. J Biol Chem
279: 16971-16979.

28. Thomas, G. P., Hemmrich, K., Abberton, K. M., McCombe, D., Penington, A. J.,
Thompson, E. W. & Morrison, W. A. (2007) Zymosan-induced inflammation stimulates neo-
adipogenesis. Int J Obes (Lond).
 8

CHAPTER 2. REVIEW OF LITERATURE

Obesity and Diabetes: Role of Inflammation and Oxidative Stress

Obesity Prevalence and Implications

Over the past few decades the prevalence of obesity has risen dramatically

worldwide. According to the Center for Disease Control, more than 20 states had obesity

prevalence rates greater than 25% in 2006. Data from the 2003-2004 National Health and

Nutrition Examination Survey (NHANES) reported the prevalence rates of obesity in

adolescents and adults were 17.1% and 32.1%, respectively (28). These data indicate a 3%

increase in obesity from 1999-2000.

Factors related to obesity include socioeconomic status (SES), education, ethnicity,

and gender with interactions among these factors. For instance, African Americans and

Mexican Americans show greater obesity prevalence with reduced SES, whereas this

relationship is not evident in Asian Americans (29). Regardless of these distinctions among

ethnic groups, there appears to be a significant rise in obesity independent of SES. Moreover,

the trend is expected to continue with obesity prevalence possibly reaching 35%, 36%, 33%,

and 55% by 2010 among white men, white women, black men, and black women,

respectively (30).

Obesity is a major health concern in the U.S., as well as in the majority of developed

countries. Individuals with a high BMI (>35) are estimated to have a significant reduction in

life span, especially in younger adults (31). In white males, this reduction in life span

approaches 22%. The increased mortality rates observed with obesity may be due to its

associated co-morbidities, including DM, CVD, hypertension (HTN), and dyslipidemia.

 9

Severely obese adults (BMI >40) exhibit 7.38 times greater risk of developing DM, 6.38

times greater risk of developing HTN, and 1.88 times greater risk of developing dyslipidemia

as compared to healthy weight adults (BMI 18.5-24.9) (32). Furthermore, the prevalence

rates of DM have closely paralleled the increase in obesity. According to the CDC, the

number of individuals diagnosed with DM in the U.S. has increased from 5.6 million in 1980

to 15.8 million in 2005 independent of age, gender, and ethnicity. The majority of this

increase is associated with the increased prevalence of obesity.

The impact of obesity and related co-morbidities on society includes not only the

health consequences, but the financial burden. From 1987 to 2001, the health care costs in

the U.S. have risen dramatically. Obese individuals account for 27% of this inflation,

whereas 38% of health care spending is attributed to DM (33). In 2002, obesity-attributable

medical costs approached 93 billion dollars, half of which was paid through Medicaid and

Medicare (34). The financial burden of obesity and DM also affects private companies and

businesses. For instance, although only 3% of an employee population is classified as obese,

it accounts for 21% of total medical costs primarily through increased disability and

absenteeism (35). Of all obesity related co-morbidities, DM represents the largest burden to

the health care system. The American Diabetes Association (ADA) reported that in 2002, the

direct (medical care and services) and indirect (disability and premature death) costs were

over 132 billion dollars. However, it has been demonstrated that these costs can be greatly

reduced with the advent of prevention vs. treatment programs targeted at addressing obesity

before it manifests into DM or other co-morbidities (36).

 10

Metabolic Syndrome and Insulin Resistance

Investigations regarding the relationship between obesity and DM have revealed a

clustering of biological abnormalities known to precede the development of chronic DM.

Referred to as the metabolic syndrome (MS), this cluster of abnormalities involves several

obesity-related complications, including HTN, dyslipidemia, glucose intolerance, and central

adiposity (Figure 2). The Third Report of the National Cholesterol Education Program

Figure 2. Development of Metabolic Syndrome (MS). The development of MS is preceeded

by central adiposity. The primary defects appear to be insulin resistance with concominant
hyperinsulinemia. When untreated these aberrations can mediate several risk factors
(including glucose intolerance, dyslipidemia, and inflammation) that lead to chronic disease,
such as Type 2 DM and CVD.

Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults

(ATP III) defines MS as three or more of the following criteria: abdominal obesity (waist
 11

circumference >102 cm in men and >88 cm in women); hypertriglyceridemia (1.69 mmol/L);

low high-density lipoprotein (HDL) cholesterol (1.04 and 1.29 mmol/L in men and women,

respectively); HTN (systolic blood pressure >130 and diastolic blood pressure >85 mm/Hg);

impaired glucose tolerance (IGT) (6.1 mmol/L). Based on these criteria, estimate indicate

that > 20% of U.S. adults have MS, which translates to more than 47 million Americans (37).

Substantial evidence now indicates that insulin resistance may be the primary defect

contributing to the development of IGT, dyslipidemia, and HTN. Previous investigations (38)

indicated that prevalence rates for insulin resistance in subjects with IGT,

hypercholesterolemia, hypertriglyceridemia, and HTN ranged from 54 to 88%. Furthermore,

the prevalence of insulin resistance in subjects exhibiting a combination of glucose

intolerance, dyslipidemia, and hypertension was 95.2% (38). Insulin resistance, defined as

reduced sensitivity to the action of insulin, is associated with impaired glucose uptake in

peripheral tissues, particularly in skeletal muscle (39,40). The condition is also frequently

accompanied by an increase in insulin secretion from pancreatic cells. This compensatory

mechanism enables -cells to maintain euglycemia through increasing circulating insulin

concentration. When hyperinsulinemia can no longer compensate for increased insulin

resistance, aberrations in glucose metabolism occur and eventually progress to DM (39,40).

Abdominal obesity appears to be a major mediator of insulin resistance and hyperinsulinemia

(41,42). Older, insulin resistant subjects exhibit greater accumulation of AT in the abdominal

region. This centralized distribution of AT is associated with a significant reduction in

insulin sensitivity (41). Additionally, obese postmenopausal women (body fat >45%)

exhibiting preserved insulin sensitivity have nearly 50% lower visceral AT (VAT) compared

to gender, age, and body fat-matched insulin resistant subjects (43). Accumulation of VAT is
 12

also associated with the development of MS in normal weight, overweight, and obese elderly

men and women (44). The role of subcutaneous AT (SAT) in the pathogenesis of insulin

resistance and MS is less pronounced than that of VAT (45). In a review of 23 intervention

strategies (46), VAT loss in response to diet, drug, and exercise intervention represented the

highest percentage of weight loss than all other AT depots. This may be due to various

genetic and physiological differences between depots. Vohl et al (47), reported that in

severely obese subjects (BMI 45-81) nearly 350 genes were differentially regulated between

VAT and SAT. Furthermore, VAT has been shown to be more lipolytic and catecholamine

sensitive, as well as more insulin resistant, than SAT (48). These studies indicate that in

addition to overall obesity, the distribution of AT is an important factor in the development

of insulin resistance and MS.

Inflammation and Insulin Resistance

There is considerable evidence that inflammation is a primary mediator of obesity-

related co-morbidities, including DM and CVD (49-56). Additionally, several studies have

demonstrated that inflammation is an integral factor in the development of MS in several

populations (52-54,56). Ishikawa, et al (52) reported that circulating C-reactive protein

(CRP) concentrations, a common clinical indicator of systemic inflammation, was

significantly higher in Japanese men and women diagnosed with MS than their non-affected

counterparts. In this population, the odds ratio for having MS was also greatest in individuals

categorized in the highest tertile of CRP (52). Data from the Insulin Resistance

Atherosclerosis Study (IRAS) (49) confirmed that chronic subclinical inflammation, as

indicated by increased CRP, is associated with dyslipidemia, central adiposity, HTN, and

insulin resistance. These findings are consistent in African-American, Hispanic, and White
 13

Non-Hispanic populations. Increased CRP levels are also associated with higher age-

adjusted risks for developing DM, even after adjusting for presence of CVD, SES, physical

activity, alcohol consumption, smoking, and family history of DM (54). In subjects with DM,

the underlying aberration contributing to the development of insulin resistance appears to be

a subclinical inflammatory state marked by increased concentrations of circulating

leukocytes, fibrinogen, and CRP (55). Inflammation is also associated in the pathogenesis of

CVD (50,51,57). Results from the Cardiovascular Health Study (57) indicated that in adults

(>65) with atherosclerosis in combination with increased CRP had a 72% greater risk for

CVD-related death. This risk can be exacerbated in subjects diagnosed with DM, suggesting

an even greater incidence of CVD-related mortality in patients with both inflammation and

DM (58).

A novel approach for the treatment of DM and CVD is the use of anti-inflammatory

medications. Non-steroidal anti-inflammatory drugs (NSAIDs), such as aspirin, have long

been used for their ability to reduce blood glucose (59-61). The exact mechanism is not fully

understood, but may be related to reduced FFA concentrations (59,62). One early

investigation (63) demonstrated that ibuprofen reduced glucose concentration following a

glucose challenge. This improvement in glycemic control was associated with a greater

insulin response and reduced FFA (63). More recently, data from the Physicians' Health

Study, a randomized, double-blind, placebo-controlled trial, indicated a 44% reduction in

myocardial infarction with aspirin treatment compared to placebo (64). The development of

atherosclerotic CVD and stroke is increased in individuals with DM. However, the ability of

NSAIDs to reduce CVD- related morbidity and mortality in diabetic individuals remains

unclear (65). Data from the DECLARE-DIABETES Trial (66) indicated that aspirin in
 14

combination with two other anti-inflammatory medications was able to lower cardiovascular

related complications in diabetic patients. Hundal and colleagues (67,68) observed that two

weeks of aspirin treatment improved insulin sensitivity and the lipid profile in male and

female diabetics. This improvement may be mediated in part by reduced IB kinase (IKK)

activation (68), which is the upstream activator of the proinflammatory transcription factor,

NFB. Activation of IKK, either in obese mice or IKK agonist treated Fao hepatoma cells,

resulted in reduced insulin signaling which was reversed by NSAID treatment (68). Overall,

these studies indicate that treatment of inflammation improves obesity-related complications,

including insulin resistance and dyslipidemia, which are major risk factors for CVD and DM.

Cytokine and Chemokine-Induced Insulin Resistance

IL-6. Proinflammatory cytokines, such as IL-6 and TNF, are small proinflammatory

proteins that are increased with obesity (4,5,69). The importance of IL-6 in obesity-induced

inflammation is demonstrated by identification of single nucleotide polymorphisms (SNP) in

the IL-6 promoter (70-73). Fernandez-Real et al. (71) identified a SNP in the 5 flanking

region of the IL-6 gene at position -174 in which a guanine was replaced by a cytosine. This

SNP was associated with reduced plasma IL-6, as well as lower circulating insulin, TAG,

and FFA in healthy subjects. This SNP was further associated with greater insulin sensitivity

and glycemic control, as well as a reduced WBC (70). Alternatively, Kubaszek and

colleagues (72), found this IL-6 SNP to be associated with reduced energy expenditure (EE),

basal metabolic rate (BMR), whole body glucose uptake, and glucose oxidation in a healthy

Finnish population (72). These findings were further supported by a recent study (73) that

indicated this SNP is associated with higher risk of developing obesity-related metabolic

disorders, including insulin resistance.

 15

Despite the discrepancy in SNP associated phenotypes, it is evident that increased

circulating IL-6 is associated with obesity related co-morbidities. Data from the Health,

Aging and Body Composition Study (74) indicated the odds ratio of developing subclinical

CVD was greatest in the tertile of patients with the highest concentration of serum IL-6.

Additionally, Bahrami, et al (75) suggested that serum IL-6 was the strongest predictor of

obesity-associated coronary heart disease. Recent data from the Monitoring of Trends and

Determinants in Cardiovascular Disease (MONICA)/Cooperative Research in the Region of

Augsburg (KORA) study also indicated that both high IL-6 and CRP concentrations are

associated with the development of DM (76). Furthermore, elevated IL-6 concentrations is

associated with increased mortality in elderly adults (77). The impact of IL-6 on obesity-

related co-morbidities may be dependent on the development of insulin resistance. Rush, et

al (78) observed that IL-6 concentrations is positively associated with reduced -cell function

and insulin resistance in a population of Asian Indian immigrants. Furthermore, obese

adolescents exhibited insulin resistance attributed to elevated IL-6 (79).

IL-6 involvement in insulin resistance may be mediated through impairment of

insulin signaling (80-83). Chronic IL-6 administration has been shown to inhibit insulin

signaling in adipocytes, muscle, and liver (82-84). Specifically, IL-6 was observed to inhibit

autophosphorylation of the insulin receptor (IR) and downstream effectors including insulin

receptor substrate-1/2 (IRS-1/2), phosphatidylinositol-3 kinase (PI3K), protein kinase-1

(Akt/PKB), and glucose transporter-4 (GLUT4) (80-84). These effects were mediated

through activation of specific proinflammatory signaling intermediates, such as suppressors

of cytokine signaling-3 (SOCS3) (81,82,84) and protein kinase C (PKC) (82). Activation of

SOCS1/3 inhibited tyrosine phosphorylation of the insulin receptor (81,85). Furthermore,

 16

PKC activation increased serine phosphorylation of IRS-1/2 (82) and thus contributed to the

development of IL-6-mediated insulin resistance. These data suggest that IL-6 may induce

insulin resistance through multiple mechanisms including direct impairment of insulin

signaling.

TNF. Hotamisligil et al. (4,86) originally proposed the involvement of the

proinflammatory cytokine, TNF, in obesity-associated insulin resistance. More recently,

specific SNPs in the TNF gene have been associated with DM (87-89). Moreover, certain

SNPs predisposed diabetic patients to athertosclerotic-related complications (88). Fontaine-

Bisson et al. (89) identified a SNP in the TNF promoter (-238G>A) that is associated with

reduced FFA clearance and insulin resistance in obese subjects with DM but not in lean

controls. Additionally, the same SNP was observed at a higher frequency in patients with

coronary artery disease, especially in subjects with DM or HTN. Analysis of the TNF gene

and promoter indicates the importance of this cytokine in the regulation of obesity induced

insulin resistance.

Elevated TNF levels are closely related to components of MS including, IGT, HTN,

and dyslipidemia in obese adults (90) and adolescents (91). High serum TNF levels are also

associated with insulin resistance in elderly patients (92). Tam and colleagues (93) observed

that neutralization of TNF with NSAIDs contributed to improved lipid profile and insulin

sensitivity in subjects with rheumatoid arthritis.

TNF-mediated insulin resistance, as observed in obesity and DM, is suggested to

involve impairment of insulin signaling. This may include reduced IR autophosphorylation,

as well as decreased IRS-1/2 activation (94-96). The mechanism for reduced tyrosine

phosphorylation is not fully characterized. However, it may involve activation of

 17

phosphotyrosine phosphatase (PTPase) (96). Alternatively, TNF is observed to increase

serine phosphorylation of IR and IRS-1/2, thereby contributing to reduced insulin sensitivity

(97-100). Serine phosphorylation of insulin signaling intermediates involves activation of

downstream effectors, such as PKC or mitogen-activated protein kinases (MAPK),

extracellular signal-regulated kinases (ERK) (99), c-Jun N-terminal kinases (JNK) (100), and

p38-MAPK (97). However, the exact pathway involved appears to be tissue-specific. These

data implicate TNF as a major contributor to insulin resistance and further supports the idea

that proinflammatory cytokines are involved in obesity-related co-morbidities.

MCP-1. Chemokines are small proteins similar to cytokines, which also exhibit the

ability to induce chemotaxis. Certain chemokines, such as MCP-1 and interleukin-8 (IL-8),

promote migration of monocytes and neutrophils, respectively. Data from the Cooperative

Health Research in the Region of Augsburg Survey identified serum chemokine

concentrations as independent risk factors for DM (101). Moreover, MCP-1 concentration

was associated with increased risk of CVD mortality in a 7-year longitudinal study (102).

Recent work (103) has shown that a high concentration of circulating MCP-1 was associated

with insulin resistance and DM. Several SNPs have been identified in the MCP-1 gene and

promoter. Although there is still debate regarding the extent of the association, there is

evidence to suggest that the A-2518G polymorphism in the distal regulatory region of MCP-

1 is associated with heart disease and myocardial infarction (104,105). In addition, the G/G

genotype at position -2518 in the MCP-1 promoter was associated with lower plasma MCP-1

and reduced prevalence of insulin resistance and DM (103).

Obesity is associated with increased circulating MCP-1 (13,69). Overexpression of

this chemokine or its corresponding receptor (CCR2) stimulated insulin resistance and
 18

hepatic steatosis in several rodent models of obesity (12,106). Furthermore, multiple obese

mouse models, either transgenic (TG) or diet-induced (DIO), exhibited elevated MCP-1,

which was associated with greater macrophage accumulation into peripheral tissues,

including AT (12,106). More recently, it was observed that in vivo infusion of chemokine

stimulated adipogenesis in mice (107). This effect may account for the increased adiposity

and FFA observed in TG-MCP-1 mice (12).

There is limited evidence implicating the direct involvement of MCP-1 with insulin

signaling. However, it appears that recruitment of macrophages into tissues important in

glucose homeostasis, including the pancreas, liver, skeletal muscle, or AT, results in an

inflammatory response that contributes to the development of insulin resistance.

Additionally, MCP-1 involvement in oxidative stress and ROS formation represents another

potential mechanism of chemokine-induced insulin resistance (108). Finally, increased MCP-

1 expression in pancreatic islets and beta-cells could result in -cell dysfunction and thus

promote IGT. Regardless of the mechanism, it is clear that increased MCP-1 expression is

involved in the pathogenesis of obesity-related complications.

ADN. Obesity is not only associated with increased proinflammatory cytokines and

chemokines, but is also associated with reduced concentrations of anti-inflammatory

proteins, such as adiponectin (ADN). Several genetic analyses (109,110) observed that a

quantitative trait locus (QTL) on chromosome 3 (3q27), the site of the ADN gene, was

strongly correlated with insulin resistance, MS, and DM. Data from the Metabolic Risk

Complications of Obesity Genes Project (109) indicated that chromosome 3 also had the

highest association with BMI, waist circumference, and insulin sensitivity. Additional

genetic analysis observed the presence of multiple SNP in the ADN gene associated with
 19

increased risk of DM and CVD (111-115). More specifically, the G/G genotype at position

276 in the ADN gene is associated with reduced ADN, as well as insulin resistance, DM, and

CVD (111-113). Multiple investigations have since indicated that obesity is associated with

dysregulation of ADN (116-118). Arita et al. (116) initially reported a negative correlation

between BMI and plasma ADN in obese subjects. Furthermore, hypoadiponectinemia is

associated with several components of MS, including insulin resistance, dyslipidemia, and

inflammation (117,119,120). Xydakis and colleagues (120) demonstrated that obese

individuals with MS had lower serum ADN compared to obese individuals without MS.

Patients diagnosed with DM or CVD are also observed to have significantly lower plasma

ADN (118,121,122). This is especially true for high risk populations, such as Pima Indians.

ADN possesses key anti-inflammatory properties, which likely contribute to its

varied metabolic effects. Plasma ADN was negatively correlated with CRP, IL-6, and TNF

in obese subjects (123,124). Furthermore, ADN attenuated LPS-induced IL-6 and TNF

expression in both macrophages and adipocytes (19,125,126). LPS-stimulated NFB

activation was also prevented with ADN treatment (22), which may explain the observed

reduction in proinflammatory cytokines. Conversely, administration of IL-6 or TNF

blunted ADN expression and secretion in 3T3-L1 adipocytes (127-129). Furthermore,

monocyte proliferation and macrophage function, including phagocytic activity and cytokine

release, were reduced by ADN (130,131). Foam cell formation, as determined by lower

macrophage cholesteryl ester content and scavenger receptor expression, was also attenuated

by ADN (132). These data indicate that ADN is a key anti-inflammatory mediator.

Several studies have examined the role ADN plays in vivo. Genetically engineered

ADN knockout (KO) mice exhibited reduced insulin sensitivity in response to a high fat diet
 20

(133-135). Maeda et al. (133) demonstrated that ADN deficient mice had impaired insulin

signaling in skeletal muscle. Moreover, this effect was corrected by adenoviral produced

ADN (133). Alternatively, Nawroki and colleagues (134) suggested that the reduction in

insulin sensitivity in ADN KO mice was attributed to increased hepatic glucose production.

Several additional studies (136,137) indicated the liver as the primary site of ADN action.

These observed differences in the mechanism of action of ADN can be attributed to

structural differences in the protein. ADN forms several distinct oligomeric complexes.

These include a high molecular weight (HMW, >250 kDa), medium molecular weight

(MMW or hexamer, ~180 kDa), and low molecular weight (LMW or trimer, ~90 kDa)

species (138-141). Furthermore, a proteolytic cleavage product of ADN that includes the

globular C-terminal of the protein (gADN) was also present in human plasma (142).

In humans, females have a greater proportion of HMW and hexamer complexes than

males (138-140). Additionally, BMI is negatively correlated with the concentration of HMW

species, but not the hexamer or trimer forms (139). Pajvani and colleagues (138) reported

that lower HMW to total ADN was associated with lower insulin sensitivity in diabetic

subjects. Furthermore, use of insulin sensitizing drugs, such as thiazolidinedione (TZD),

increased HMW but not total ADN in these subjects (138). The HMW species is suggested to

improve hepatic insulin sensitivity (138,141). Wang et al. (141) demonstrated the HMW

species stimulated 5'AMP-activated protein kinase (AMPK) in liver, which lead to inhibition

of gluconeogenic enzymes, phosphoenolpyruvate carboxykinase (PEPCK), and glucose-6-

phosphatase (G6Pase). Alternatively, gADN was associated with skeletal muscle insulin

sensitivity in obese and diabetic humans (143,144) and rodents (142,145-147). Bruce and

colleagues (144) observed that gADN in vitro stimulated glucose uptake and FA oxidation in
 21

skeletal biopsies from lean and obese subjects. This effect was attributed to increased AMPK

and acetyl-CoA carboxylase (ACC) activation. Administration of gADN also increased IR

and IRS-1 activation, as well as glucose uptake in primary rat adipocytes (148).

Oxidative Stress and Insulin Resistance

ROS are small, highly reactive molecules possessing oxidative abilities primarily

attributed to an unpaired electron. Examples include superoxide anion (O2-), hydrogen

peroxide (H2O2), hydroxyl radical (OH), and nitric oxide (NO) (149). These molecules play

important roles in cell signaling. However, accumulation of ROS can contribute to oxidation

of amino acid side chains, protein-protein cross-links, and protein fragmentation (149).

Oxidative stress is implicated in the pathogenesis of multiple diseases (150). Several

investigations have indicated a role of oxidative damage in atherosclerosis (151), HTN (152),

and DM (153). Obesity has also been linked to increased oxidative stress (154,155). Data

from the Framingham Heart Study (155) indicated that urinary 8-epi-prostaglandin F2 alpha

(8-epi-PGF2 alpha), an F2-isoprostane, a marker of ROS, formed via a noncyclooxygenase

pathway, was positively associated with BMI and waist circumference in male and female

subjects. Moreover, for every 5 kg/m2 of BMI there was a 9.9% increase in urinary 8-epi-

PGF2 concentration, indicating very high levels of oxidative stress. Furukawa et al. (154)

also observed a positive correlation between BMI and urinary 8-epi-PGF2 in healthy

Japanese men and women. Additionally, a positive association has been shown (154)

between obesity and plasma thiobarbiturate reactive substances (TBARS), an end product of

lipid peroxidation.

Obesity-induced oxidative stress represents a potential link between obesity and its

associated co-morbidities. Cardona and colleagues (156) reported that individuals with MS
 22

exhibited increased markers of oxidative stress compared to patients without MS. This same

group also demonstrated that antioxidant defense systems were impaired in healthy

individuals following high fat feeding (157). The increased oxidative stress associated with

obesity is specifically linked to the development of insulin resistance (158-160). Obese

individuals diagnosed with DM exhibit increased oxidative stress and reduced antioxidative

capacity compared to healthy controls (158). Mohora et al. (159) determined that obesity and

DM were both associated with increased ROS, but obese subjects with DM exhibited a

greater concentration of plasma malondialdehyde (MDA), a marker of oxidative stress. These

findings are supported by additional groups (160) and clearly link oxidative stress as a bridge

between obesity and DM.

The mechanisms involved in oxidative stress-induced insulin resistance have not been

fully elucidated. However, multiple studies indicated involvement of ROS accumulation in

hepatocytes (161), skeletal muscle (162-164), and adipocytes (165-167). Kumashiro and

colleagues (161) demonstrated that overexpression of the antioxidative enzyme, superoxide

dismutase 1 (SOD1) in the liver of diabetic db/db mice reduced hepatic ROS accretion and

improved insulin sensitivity. Additionally, Dokken and colleagues (163) observed that

isolated rat skeletal muscle incubated with H2O2 significantly inhibited insulin-stimulated

glucose transport and glycogen synthesis. Furthermore, a mineralocorticoid receptor

antagonist prescribed to control blood pressure, spironolactone, attenuated ROS induced

insulin resistance through increased phosphorylation of IRS-1, Akt/PKB, and GLUT4 in

soleus muscle of insulin resistant rats (162).

Recent evidence suggests that increased oxidative stress in skeletal muscle is

secondary to changes in AT. Adipocytes themselves exhibited insulin resistance in response

 23

to oxidative stress (165-167). Rudich et al. (165) showed that low grade oxidative stress

results in impaired insulin-stimulated GLUT4 translocation and PI3K activation in 3T3-L1

adipocytes. Furthermore, basal, but not insulin-stimulated, glucose uptake was increased

along with GLUT1 expression in response to increased H2O2 content (165). Several

additional studies (164,166,168) confirmed that an increase in basal glucose transport occurs

in response to oxidative stress in adipocytes. Moreover, it appears that increased basal

glucose uptake may exacerbate ROS accumulation and inflammatory signaling in adipocytes

(169-172) through activation of NFB and AP-1 (173). These studies clearly link adipocyte-

specific oxidative stress to the development of insulin resistance and therefore connect

oxidative stress to the development of DM and related co-morbidities.

Obesity-Induced Insulin Resistance: Role of Free Fatty Acids

Overview of Fatty Acid Induced Insulin Resistance

Multiple investigations have demonstrated an increase in circulating FFA in obese

humans (174-177) and animals (178,179). This elevation in FFA is largely attributed to

increased basal AT lipolysis (180-182). However, the antilipolytic effect of insulin may also

be impaired in obesity (183,184). Regardless of the exact mechanisms involved, increased

FFA is associated with insulin resistance in obese individuals (185,186). Moreover, infusion

of FFA in lean humans and rats stimulated insulin resistance (187,188). These data indicate

that an increase in FFA represents a primary connection between obesity and insulin

resistance.

Obesity-related co-morbidities, including DM and CVD, have also been directly

associated with increased FFA (189,190). A cross-sectional analysis of offspring from

parents diagnosed with DM (191), reported that non-diabetic offspring had increased FFA
 24

that predisposed them to the development of DM. Pima Indians with the highest

concentration of FFA had a 2.3 fold greater risk of DM than individuals with the lowest

concentration of FFA (192). Impaired postprandial FFA clearance is also linked to CVD in

diabetic individuals (193). Carlsson and colleagues (194) observed that higher FFA were

associated with greater risk of myocardial infarction and stroke. Other markers of CVD,

including endothelial dysfunction, vascular smooth muscle cell proliferation, and HTN were

also associated with increased FFA (194). Additional studies (90,174) have indicated that

elevated FFA is associated with the development of several other components of the MS,

including HTN and dyslipidemia.

Insulin sensitivity can be improved by lowering FFA concentration. Studies using the

hypolipidemic drug, acipimox, demonstrated that a reduction in FFA improved insulin

sensitivity in obese and diabetic individuals (193,195,196). Santomauro et al. (196) reported

that acipimox reduced plasma FFA by more than 60%, which improved insulin-stimulated

glucose uptake by greater than 2-fold in obese subjects under euglycemic hyperinsulinemic

clamp conditions. The peroxisome proliferator-activated receptor-alpha (PPAR) agonist,

fenofibrate, is commonly used for treatment of dyslipidemia (197). Activation of PPAR is

suggested to increase -oxidation, improve lipoprotein profiles, and reduce inflammation

(197). Data from the Bezafibrate Prevention Study showed a near 10% reduction in CVD-

related mortality (198). Moreover, it has been observed that treatment with the PPAR

agonist improved several additional complications of MS, including insulin resistance (198-

200). Haluzik and colleagues (201) demonstrated that 14 d of fenofibrate treatment reduced

blood glucose, FFA, TAG, and insulin resistance in lipogenic, simple carbohydrate diet fed

mice. However, the insulin-sensitizing response of fibrates in humans is limited, which may
 25

be due to lower PPAR expression in liver and skeletal muscle (202). The ability of lipid-

lowering medication to effectively attenuate insulin resistance, as well as lower risk for

developing DM and CVD, indicates that FFA are key mediators in obesity-related co-

morbidities.

Substrate Competition and Non-Oxidative Fatty Acid Metabolism

Accumulating evidence (185,186) supports the theory that disturbances in glucose

metabolism are secondary to changes in FA metabolism. The exact mechanism of FFA-

induced insulin resistance has not been fully elucidated. However, Randle et al. (203)

originally proposed that the insulin resistant properties of FA were mediated through direct

inhibition of glucose metabolism. More specifically, as intermediates of FA and TAG

synthesis, such as citrate and acetyl-CoA, accumulate in the cytosol of muscle cells, enzymes

involved in glucose oxidation, such as phosphofructokinase-1 and pyruvate dehydrogenase

complex, are inhibited. This in turn reduces insulin-stimulated glucose uptake and

metabolism (204-207). Overall, researchers have suggested that increased FFA induces

peripheral insulin resistance and stimulates an initial hyperinsulinemic state, but as DM

develops, -cell dysfunction occurs and insulin secretion can no longer compensate for

elevated FFA and thus hyperglycemia becomes apparent.

Elevated serum FFA concentration is toxic to cells. Increasing the concentration of

lipid within non-adipose tissue, such as skeletal muscle, liver, and pancreatic -cells, has a

more profound effect on cellular metabolism than impairment of glucose metabolism. This is

evident by the increased level of apoptosis in these tissues in response to lipid accumulation

(208-210). Lipotoxicity, excess lipid accumulation in non-adipocytes, can contribute to

obesity-mediated -cell failure, non-alcoholic steatohepatitis (NASH), and skeletal muscle

 26

insulin resistance (211). The consequences of lipotoxicity may be mediated through products

of non-oxidative FA metabolism, such as diacylglycerol (DAG) and ceramide (209,211). The

accumulation of long-chain fatty acyl-CoA (LCFA) in the cytoplasm of non-adipocytes has

been associated with the synthesis of DAG and ceramide (208,209,212). This effect appeared

to be more pronounced in response to SFA, such as palmitoyl-CoA, whereas PUFA appeared

to be protective (213). The free radical, nitric oxide (NO) has also been correlated with

ceramide concentration and may represent the link between the FA metabolites and -cell

apoptosis (209). In addition to the potential reduction of insulin synthesis, that DAG and

ceramide have been shown directly to inhibit insulin signaling (208,214-216). This action

may be mediated PKB and PI3K, which are key intermediates of insulin-mediated glucose

uptake (208,214,215). More specifically, FA metabolites activate PKC (208) and protein

phosphatase 2A (PP2A) (214), which are both shown to directly inhibit insulin-mediated

GLUT4 translocation. Proinflammatory cytokines, such as IL-6 and TNF, have also been

shown to increase synthesis of ceramide (208), as well as directly stimulate PKC activation

(4,86). Therefore, the overall impact of non-oxidative FA metabolites on insulin resistance

may be secondary to inflammation.

Dietary Fatty Acids Play a Role in Inflammation

Dietary FA can be both pro- and anti-inflammatory. SFA may be responsible for the

increase in proinflammatory cytokines and chemokines observed with obesity and MS (217-

222). The consumption of a Westernized diet high in refined grains, red meat, SFA, and

hydrogenated fats has been positively related to several markers of inflammation, including

CRP, serum amyloid A (SAA), and IL-6 (223). Aeberli et al. (220) reported that total dietary

fat is associated with CRP and IL-6 in obese children. Moreover, SFA intake is specifically
 27

linked to the development of inflammation in humans. Fernandez-Real et al. (224) reported

that palmitic and myristic acid consumption were negatively correlated to plasma ADN and

insulin sensitivity. Alternatively, consumption of either omega 3 FA (n-3 FA) or

monounsaturated FA (MUFA) have been associated with reduced inflammation and

improved insulin sensitivity (225-229). More specifically, Pischon and colleagues (226)

reported intake of the n-3 FAs, eicosapentaenoic acid (EPA) and docosahexaenoic acid

(DHA), were inversely associated with plasma concentrations of the soluble TNF receptor

(sTNF-R) and CRP. Data from the Nurses Health Study (225) demonstrated that EPA and

DHA intake were also inversely related to CRP, IL-6, and several proinflammatory adhesion

factors, including E-selectin, soluble intracellular adhesion molecule (sICAM-1), and soluble

vascular adhesion molecule (sVCAM-1). Similar anti-inflammatory effects have been

observed with consumption of a diet rich in MUFA (228,229). Fito et al. (228) observed that

consumption of virgin olive oil reduced plasma IL-6 and CRP in patients diagnosed with

coronary heart disease. Thus, substitution of dietary SFA or trans FA (TFA) with either n-3

FA or MUFA may atenuate obesity-induced inflammation and reduce the risk of DM and

CVD.

The mechanism of SFA-induced inflammation and insulin resistance is not fully

elucidated, but it is clear that certain SFAs stimulate a proinflammatory response in various

cells and tissues. Palmitate and other medium chained SFA-induced proinflammatory gene

expression in endothelial cells (230,231), hepatocytes (232), myotubes (233,234),

macrophages (11), and adipocytes (22,100,235). Elevated circulating palmitate was also

positively correlated with increased plasma IL-6 (231) and negatively correlated with plasma

ADN (224). Moreover, human coronary artery endothelial cells exhibited increased IL-6
 28

mRNA and protein expression in response to palmitate treatment (231). This vascular

inflammation can in turn contribute to development of atherosclerosis (50). SFA-induced

inflammation has also been associated with development of NASH (236). Joshi-Barve et al.

(232) reported that palmitate-induced IL-8 expression stimulated lipid accumulation and

insulin resistance in cultured hepatocytes (232). These effects have been dramatically

reversed by blocking cytokine production with neutralizing antibody, improving hepatic

insulin sensitivity (237).

Skeletal muscle accounts for over 80% of glucose uptake under insulin-stimulated

conditions (238). Thus, skeletal muscle represents a major target of FA-induced

inflammation and insulin resistance. SFAs, such as palmitate, increased IL-6 and TNF

expression in skeletal muscle cells and have been associated with reduced insulin sensitivity

(233,234,239,240). Sinha and colleagues (234) demonstrated that palmitate treatment

reduced insulin-stimulated glucose uptake, corresponding to a decrease in insulin-stimulated

IRS-1, PI3K, and Akt/PKB phosphorylation in L6 myotubes. Furthermore, Jove et al. (240)

reported that palmitate inhibited insulin-stimulated glucose uptake, as well as GLUT4

expression, in C2C12 muscle cells. These studies and others (233,239,241-243) indicated

that SFA-induced insulin resistance was mediated through activation of distinct

inflammatory pathways involving extracellular signal-regulated kinases (ERK), JNKs, and

p38 mitogen-activated protein kinases (MAPK). These proinflammatory pathways lead to

activation of transcription factors, such as NFB and AP-1 (232,244,245). Blocking MAPK

kinase activity or expression through use of specific inhibitors or genetic knockdown

attenuates FA-induced insulin resistance in muscle cells. Furthermore, inhibition of NFB

activation appears to be of primary importance in blocking palmitate-induced insulin

 29

resistance (233,234,239-241). Weigert and colleagues (233) reported that the proteosome

inhibitor, MG132, completely blocked palmitate-induced NFB DNA binding and

corresponding IL-6 production in human myotubes. This relationship in consistent with other

NFB inhibitors, including pyrrolidine dithiocarbamate (PDTC), SN50, and parthenolide

(234,240,241).

The ability of FFA to induce inflammation and insulin resistance in liver and skeletal

muscle suggests that disturbances in these tissues are dependent on interactions with

adipocytes. Dietze et al. (246) observed that co-culture of human muscle cells with

adipocytes dramatically reduced insulin signaling in myotubes. In vivo studies observed an

accumulation of FFA in skeletal muscle with obesity (247,248). This ecotopic storage can

then promote systemic insulin resistance (249,250). Boden and colleagues (251) suggested

that insulin resistance occured in adipocytes prior to skeletal muscle. They provided evidence

that reduced insulin sensitivity in adipocytes promoted greater lipolysis and reduced FFA

uptake that consequently led to ecotopic fat storage. Moreover, increased FFA concentration

directly contributed to insulin resistance in adipocytes. Several groups (11,22,100)

demonstrated that FFA-induced proinflammatory cytokine and chemokine expression and

impaired insulin signaling in adipocytes. Ajuwon et al. (22) reported that palmitate induced

IL-6 expression and NFB activation in 3T3-L1 adipocytes. FFA also increased TNF and

MCP-1 expression through activation of JNK- and NFB-mediated pathways (11,100). In

addition to FFA, the proinflammatory cytokines/chemokines secreted from adipocytes

(referred to as adipokines) also contributed to insulin resistance in non-AT (11,100). The

impact of adipocytes on inflammation and insulin resistance suggests that they represent a

potential therapeutic target for treatment of obesity-related co-morbidities, such as DM.

 30

Obesity-Induced Insulin Resistance: Role of Adipose Tissue

Adipose Tissue Cellularity and Changes with Obesity

AT represents one of the most dynamic tissues in the human body. It can represent as

little as 3% of total body weight in conditioned athletes to over 70% of total body weight in

severely obese individuals (252). The cellular prolife of AT is highly variable and depends

greatly on depot location, as well as multiple genetic and environmental factors. However,

despite substantial intra- and inter-individual differences there is a basic organization to AT,

which consists of mature adipocytes, fibroblast-like preadipocytes, endothelial cells, lymph

nodes, and nerves (252,253). Adipocytes represent the major cellular component of AT.

There are two distinct classifications of adipocytes: the unilocular white adipocytes and

multilocular brown adipocytes.

White adipocytes contain a large lipid droplet composed primarily of TAG and

cholesteryl esters, ranging in size from 20 to 200 M in diameter. Moreover, they exhibit

distinct endocrine, paracrine, and autocrine properties via expression and secretion of

multiple proteins, such as leptin, ADN, IL-6, TNF, and MCP-1. Adipocytes are also targets

for various signaling molecules released from -cells, macrophages, neurons, hepatocytes,

and adipocytes themselves. Some of the adipocyte-specific receptors mediating this signaling

include insulin, cytokine (i.e. IL-6 and TNF), adrenergic/cholinergic, and lipoprotein

receptors (254). Therefore, it is clear that the physiological role of white adipocytes extends

beyond simple energy storage and involves complex interactions with central and peripheral

tissues in order to regulate energy metabolism and systemic homeostasis.

Brown adipocytes have a slightly different morphology than white adipocytes. For

instance, these cells are smaller (20 to 40 M), contain multiple lipid droplets, have
 31

pronounced nuclei and cytoplasm, as well as increased capillary density (255). Brown

adipocytes also exhibit a greater number of mitochondria contributing to the trademark

brown color. The major functional difference between the two cell populations is the role of

brown adipocytes in thermogenesis. Briefly, FAs stored within brown adipocytes are quickly

accessed by mitochondria and subsequently oxidized generating a proton gradient. Normally,

this gradient is used for ATP synthesis, but in brown adipocytes the uniquely expressed

protonophore, uncoupling protein 1 (UCP1), mediates disruption of the gradient causing the

protons generated in FA oxidation to be dissipated as heat (256). In rodents, this process

plays an important role in thermal regulation. Newborn infants also possess high levels of

brown adipocytes in several adipose depots (255). However, in adult humans the amount of

these cells is dramatically reduced and are found dispersed among white adipocytes. In lean

adults, researchers have suggested that, on average, there is one brown adipocyte for every

100 to 200 white adipocytes in VAT (257). Several studies (253,255) indicated that reduced

sympathetic stimulation of these cells resulted in transdifferentiation of brown adipocytes

into a phenotype similar to white adipocytes. Moreover, it appears that this process may be

reversed by using -adrenergic agonists (258). The ability of these two adipocyte populations

to interchange phenotypes has important implications for health and disease.

Adipose expansion involves both adipocyte hypertrophy (increase in cell size) and

hyperplasia (increase in cell number). Hypertrophy and hyperplasia occur naturally in normal

growth phases, as well as with obesity (discussed below) (259,260). Adipocyte hypertrophy

requires positive energy balance that results in accumulation of TAG. However, adipocytes

are limited in the amount of lipid that can be stored. Hence, hyperplasia represents an

important means by which AT can expand. Also referred to as adipogenesis, hyperplasia

 32

involves proliferation of fibroblast-like preadipocytes and their subsequent differentiation

into mature adipocytes (252,261). Proliferation of preadipocytes entails mitotic replication to

increase cell number. Alternatively, differentiation of preadipocytes requires cell cycle arrest,

as well as distinct molecular and cellular modifications that mediate conversion of

preadipocytes to spherical, lipid-filled mature adipocytes (253,260,262-264). Generally,

proliferation occurs prior to differentiation. However, researchers have suggested that

partially differentiated cells may still be capable of replication (260). In normal human

growth and development, differentiation is controlled by the expression of several adipogenic

transcription factors, transcriptional coactivators, and cell-cycle proteins designed to increase

the lipogenic capacity of the cell (262,263). Two transcription factors, CCAAT/enhancer

binding protein (C/EBP) and PPAR, are essential to adipocyte differentiation. Following

initiation of growth arrest, preadipocytes undergo at least one more round of DNA

replication and cell doubling, often referred to as clonal expansion (263,265). During this

process, adipogenic transcription factors upregulate genes involved in adipogenesis.

Complete (or terminal) differentiation of adipocytes is associated with complete exit from

cell cycle and an increased expression of adipocyte-specific genes and proteins, including

leptin, ADN, and TNF (263).

Obesity is associated with significant increases in adipocyte hypertrophy and

hyperplasia (252,263,266). In obesity, mature adipocytes reach their lipid storage capacity at

an accelerated rate. This in turn contributes to increased hyperplasia. Regulation of

adipogenesis is thought to be mediated through a paracrine mechanism in which hypertrophic

adipocytes secrete growth factors in response to their expanding size (264). These growth

factors, such as insulin-like growth factor (IGF), can then promote preadipocyte
 33

differentiation and proliferation (267-269). Blocking of IGF-1 signaling with specific

binding proteins attenuates obesity and implicates hyperplasia as a physiological mechanism

contributing to obesity (270). Wang and colleagues (271) observed that mice lacking

preadipocyte factor-1 (Pref-1), a known inhibitor of adipogenesis, exhibited increased

adiposity, an effect that was reversed through transgenic overexpression of the preadipocyte

marker. Moreover, use of synthetic inhibitors of adipogenesis is proposed as a potential

treatment of obesity and related co-morbidities (272). Therefore, individuals with greater

adipogenic potential may be predisposed to obesity (273).

Obesity-Induced Changes in Adipose Tissue Fatty Acid Metabolism

TAG stored in AT originates from either dietary fat that is packaged into

chylomicrons in enterocytes of the small intestine (post-prandial) or from endogenously

produced TAG that is packaged into very low density lipoproteins (VLDL) in the liver (post-

absorptive) (274). Once in the circulation, these lipid rich lipoproteins deliver TAG and FA

to peripheral tissues, including skeletal muscle and AT. Delivery of FFA to adipocytes

requires hydrolysis of lipoprotein based TAG from chylomicrons and VLDL by lipoprotein

lipase (LPL) (275) This process involves adipose-specific VLDL-receptor recognition of

apoprotein E, located on VLDL and chylomicrons (276). LPL is initially synthesized in

adipocytes and then exported to the luminal surface of capillary endothelium where it

hydrolyses, with acylation stimulating protein (ASP), TAG to FFA and glycerol (277).

Dysregulation of LPL, as observed in obesity has been associated with dyslipidemia and

insulin resistance (275,278,279). Kitajima et al. (278) reported that systemically

overexpressed LPL attenuated insulin resistance in obese rabbits. However, increased LPL

activity in AT is associated with dyslipidemia and insulin resistance (279). The mechanism
 34

underlying these differences is unclear, but may relate to the difference in the lipid oxidative

activity of various tissues.

Following hydrolysis of TAG from lipoproteins in the endothelial lumen, FFAs are

transported through the plasma membrane of adipocytes by specific FA transporters, such as

CD36 and fatty acid transport protein (FATP). Expression of these transport proteins have

been shown to be increased in obesity and DM (280,281). Gertow and Colleagues (281)

observed that increased expression of FATP4 was positively correlated with obesity and

insulin resistance in monozygotic twins. Based on these studies, it appears that regardless of

the source of TAG (endogenously produced or dietary), increased storage of TAG in AT

promotes dyslipidemia and insulin resistance in obese and diabetic individuals.

The majority of TAG is from dietary sources; however, de novo lipogenesis (DNL)

significantly contributes to AT energy reserves. DNL is defined as the synthesis of FA from

non-lipid sources, primarily glucose. In humans, DNL occurs extensively in the liver (282)

and is increased substantially in individuals consuming a high carbohydrate (CHO) diet

(283). FA generated by hepatic DNL are packaged into VLDL for transport to peripheral

tissues (284). AT is also indicated as a site for DNL in humans. The contribution of DNL in

AT compared to liver is lower on a per gram of tissue basis, but considering the total amount

of AT, especially in obese individuals, the overall contribution of FA is similar between the

two tissues (285). Furthermore, in humans, high a CHO diet appears to mediate little effect

on DNL in AT (285). Alternatively, the reduction in DNL observed in liver with a high fat

diet is not seen in AT (286), indicating that DNL in AT is less susceptible to nutrition or

endocrine regulation. However, the mechanisms regulating DNL in AT and its implication in

obesity are not fully understood.

 35

AT is not only an important site of FA/TAG synthesis and storage but also represents

a significant site of oxidative FA metabolism (287). Although the total amount of FA

oxidized in WAT is insubstantial compared to skeletal muscle (288), the large concentration

of mitochondria found within white adipocytes indicates these cells are involved in oxidation

of FA (289). Furthermore, several studies (290) elucidated that while the amount of

oxidation occurring in AT is small, it is inconsistant enough to reduce redistribution of lipid

to other tissues such as liver. Masseen and colleagues (287,290) suggested that FA in cytosol

of white adipocytes was cleared through mitochondrial oxidation, thus limiting release of

FFA into circulation. Moreover, they proposed that with a greater increase in cytosolic FA

concentration, mitochondrial uncoupling occurs, further reducing FFA released into

circulation and thus preventing lipotoxicity (290). Mitochondrial uncoupling allows a greater

amount of FA to be removed through the generation of heat rather than ATP production. In

obesity an increase influx of FA into the cytosol of adipocytes may exceed the protective

capacity of FA oxidation and mitochondrial uncoupling, thus resulting in greater amounts of

FFA released into circulation (287,290). The subsequent increase in plasma FFA contributes

to ectopic TAG accumulation in non-AT (i.e. pancreas, liver, and skeletal muscle), which

promotes the development of insulin resistance (291).

Additional studies examining the oxidative capacity of white adipocytes suggested

involvement of AMP-activated protein kinase (AMPK) and UCP1 in the regulation of

adipose-specific FA oxidation (292,293). Rossmeisl et al. (293) reported that overexpression

of UCP1 in AT of transgenic mice increased FA oxidation, as well as reduced FA synthesis

and lipolysis in white adipocytes through an AMPK-mediated mechanism. Moreover, ADN

was observed to activate AMPK signaling (294), suggesting that adipocytes regulate FA
 36

oxidation in a variety of tissues, including adipocytes. Obesity is associated with a reduction

in ADN and AMPK expression in adipocytes, indicating that downregulation of these genes

may contribute to the reduced FA oxidation observed in obesity (295).

Lipolysis, which is the hydrolysis of TAG into FFA and glycerol in adipocytes, is

catalyzed by hormone sensitive lipase (HSL) (284). Activation of HSL is mediated by

catecholamines and additional endocrine signals, including adenosine, and prostaglandins

through interactions with adrenergic receptors (296). Signaling through these receptors leads

to activation of cyclic adenosine monophosphate (cAMP) and protein kinase A (PKA) which

in turn activates HSL (284). The cAMP/PKA also mediates phosphorylation of the

phosphoprotein perilipin, which surrounds lipid droplets and serves as a docking protein for

HSL (284). The antilipolytic effect of insulin is mediated through increasing intracellular

phosphodiesterase that subsequently reduces PKA-mediated HSL activation (297). Obesity is

characterized by high circulating FFA (185,251). This would suggest that obesity is

associated with greater levels of lipolysis. However, several studies have demonstrated that

adipocytes were resistant to catecholamine-induced lipolysis (298). Moreover, HSL activity

has been shown to be dramatically reduced in obese individuals (284). This metabolic

paradox may be partially explained by an increase in basal lipolysis. The exact mechanisms

regulating basal lipolysis are not fully elucidated, but may be related to adipocyte size (299).

Therefore, adipocyte hypertrophy leads to increased basal lipolysis that in turn leads to FFA-

induced insulin resistance in skeletal muscle and liver.

Obesity-Induced Cytokine Production in Adipose Tissue

The primary connection between obesity and DM may be the development of AT

inflammation. Hotamisligil and colleagues (4) originally demonstrated that obesity is

 37

associated with increased TNF release from AT. This group subsequently reported that

adipose-specific TNF mRNA expression was negatively correlated with insulin sensitivity

in obese postmenopausal women (300). The source of this increased TNF expression in AT

was initially attributed to adipocytes, but several groups (6,301,302) recently reported that

the stromal vascular fraction (SVF) of AT released greater levels of TNF than neighboring

adipocytes. Cells located in the SVF include preadipocytes, endothelial cells, smooth muscle

cells, leukocytes, and macrophages. Weisberg and colleagues (7) suggested that adipose

tissue macrophages (ATM) represented the major source of TNF. Regardless of the source,

TNF contributes to the activation of several proinflammatory intermediates, such as NFB

and MAPK (including ERK1/2, p38 MAPK and JNK). Activation of these pathways in

obesity mediates insulin resistance. Moreover, increased expression of TNF in AT precedes

the development of systemic insulin resistance, indicating that obesity-induced TNF

expression in AT is a mediator of the reduced insulin sensitivity observed in obesity.

The regulation of TNF-induced insulin resistance in obesity may be mediated by direct

or indirect mechanisms. Several groups (78,94,95,98) have demonstrated that TNF mediates

insulin resistance in skeletal muscle. Plomgaard et al. (95) reported that infusion of TNF in

healthy humans induced insulin resistance in skeletal muscle through disruption of insulin

signaling. Specifically, TNF inhibited tyrosine phosphorylation of IR and IRS, as well as

increases serine (inhibitory) phosphorylation of IRS and Akt/PKB, leading to reduced

insulin-stimulated glucose uptake (94,95,98). TNF impairment of insulin signaling involves

activation of proinflammatory intermediates, such as NFB, ERK1/2, JNK, and PKC.

Furthermore, obesity-induced activation of these pathways and subsequent serine

phosphorylation of IR were attenuated in TNF or TNF receptor-deficient mice (303,304).

 38

These data indicate the importance of this cytokine in obesity-induced insulin resistance.

However, Ofei and colleagues (305) demonstrated that TNF-neutralizing antibody failed to

improve insulin sensitivity in obese individuals diagnosed with DM. This study suggested

that in vivo circulating TNF may not be sufficient to induce obesity-induced insulin

resistance.

One potential explanation is that TNF released from AT functions in an autocrine or

paracrine manner to regulate adipocyte metabolism. It is established that TNF causes

insulin resistance in adipocytes (306). This cytokine can block insulin-stimulated IR, IRS,

and GLUT4 activation (307,308). Moreover, TNF-induced insulin resistance in adipocytes

involves signaling through JNK (100) and NFB (307). This inflammatory signaling

contributed to accumulation of ROS (309), which can further exacerbate insulin resistance.

TNF signaling also mediates several physiological changes in adipocyte metabolism,

including reduced lipogenesis and increased lipolysis. The reduction in lipogenesis involves

impaired insulin-stimulated glucose and FA uptake. Mechanisms mediating TNF-induced

inhibition of FA uptake are not well understood, but may involve downregulation of FATP,

as well as decreased LPL activity (310,311). The induction of lipolysis and release of FFA

contributes to the development of systemic insulin resistance, which is likely mediated

through an inflammatory response initiated within skeletal muscle. Mechanistically, TNF

stimulates lipolysis through activation of kinases such as JNK and ERK1/2, which decreased

the expression of antilipolytic genes (312). TNF-induced lipolysis may also be exacerbated

by inhibition of adipogenesis. Several groups (313,314) have reported that TNF reduced

PPAR expression and activity. Therefore, TNF-induced inflammation and insulin

resistance in AT mediates systemic insulin resistance through release of FFA.

 39

IL-6 is another important adipokine involved in obesity-induced insulin resistance.

AT secretion represents 10 to 35% of circulating IL-6 (315). Adipocytes themselves express

and secrete IL-6 (22,84); however, their overall contribution to sera IL-6 concentration may

be limited as the SVF contributes a significant proportion of IL-6 released from AT (316).

Adipocyte hypertrophy is coupled with increased IL-6 production (317). Moreover,

Mohamed-Ali, et al. (318) reported that in obesity, adipocytes may contribute up to 30% of

total circulating IL-6. There are two major signaling pathways activated by IL-6: the Janus

kinase/signal transducer and activator of transcription (JAK/STAT) pathway and the

MAPK cascade (319). Activation of these inflammatory pathways contributes to obesity-

induced insulin resistance.

Like TNF, the regulation of IL-6-induced insulin resistance in obesity may be due to

direct and/or indirect effects on peripheral tissues, including skeletal muscle and liver.

Several studies have suggested that IL-6 is responsible for hepatic insulin resistance

(81,83,237). Klover and colleagues (237) demonstrated that reductions in plasma IL-6,

mediated by neutralizing antibody specific for IL-6, were associated with improved hepatic

insulin sensitivity. These effects can be attributed to improvements in insulin signaling,

which include increased activation of IR, IRS, PI3K, and Akt/PKB (81,237). Moreover, IL-6

has been shown to induce STAT3 and suppressors of cytokine signaling (SOCS) (81,83,237).

Blocking these inflammatory intermediates led to improvements in hepatic insulin sensitivity

(237). Interestingly, the effect of circulating IL-6 on insulin sensitivity in skeletal muscle is

less clear. In fact, minutes within starting exercise, the intracellular concentration of IL-6

increased 100-fold in muscle cells (237). Febbraio and colleagues (320) reported that this

elevation in IL-6 during exercise was associated with an increase in whole body glucose
 40

uptake. Furthermore, IL-6 deficient mice show a reduced capacity for aerobic exercise (321).

Therefore, these data indicate that in terms of skeletal muscle physiology, IL-6 has an

important function in energy metabolism during exercise.

The paradoxical relationship between circulating IL-6 and systemic insulin resistance

may be partially explained by the autocrine and paracrine effects of IL-6 on adipocytes.

Several groups (80,84) reported that IL-6 blunted insulin-stimulated IR, IRS-1, Akt/PKB,

and GLUT4 activation in adipocytes. Accompanying the development of insulin resistance is

a reduction in adipose-specific LPL activity (322). Hence, the lipogenic activity of

adipocytes is dramatically impaired by IL-6 through blocking the entry of substrates (glucose

and FFA) necessary for TAG synthesis. Along with the reduction in lipogenesis is a

corresponding increase in lipolysis (323,324). Peterson and colleagues (323) observed that

acute infusion of IL-6 stimulated lipolysis in elderly subjects. The overall implication of IL-6

in adipocyte metabolism is a reduced capacity for lipid storage and increased flux of FFA

into the circulation. Thus, increased adipocyte hypertrophy stimulates IL-6 production and

release from adipocytes, which in turn exacerbates lipolysis and FFA-induced insulin

resistance in skeletal muscle. This effect is further supported by a recent study that observed

conditioned medium from mature lipolytic adipocytes that stimulate inflammation and

insulin resistance in skeletal muscle (325).

Obesity-Induced Macrophage Accumulation in Adipose Tissue

Obesity is associated with increased cytokine expression and proinflammatory

signaling in AT. Corresponding with this inflammation of AT is an increase in macrophage

infiltration (3,6,7). Weisberg and colleagues (7) reported that adipocyte size was positively

correlated with expression of the macrophage marker F4/80 in AT of obese mice. In humans,
 41

the macrophage marker CD68 was correlated with BMI, as well as adipocyte size (7). The

majority (85%) of adipose-specific cells are thought to be derived from bone marrow (7).

However, the ability of preadipocytes to exhibit a macrophage-like phenotype, which

includes expression of macrophage-specific cell surface markers (i.e. F4/80 and Mac-1) and

phagocytic activity, also have implications in AT inflammation (326). In terms of ATM, it is

known that these cells originate from progenitor cells in bone marrow. Furthermore, there are

two major subpopulations of ATM, which includes a short-lived subset actively recruited to

inflamed AT and a subset that is constitutively localized to AT (327). Lumeng and

colleagues (328) also suggested that resident ATM undergo a phenotypic change in response

to obesity that results in an enhanced proinflammatory response. Macrophage infiltration

into AT (diapedesis) involves several steps that include: activation of capillary endothelium,

increased expression of adhesion molecules and attachment of blood monocytes,

transmigration of monocytes through endothelial cells, and differentiation of monocytes to

ATM (329). Recruitment of macrophages is commonly observed in ischemic and hypoxic

tissues (330). Within AT, macrophages localize primarily to sites of necrotic-like adipocyte

cell death and aggregate in crown-like structures (CLS) around individual adipocytes (331).

Cinti, et al. (331) demonstrated in HSL knockout mice that there was excessive adipocyte

hypertrophy associated with necrosis and subsequent macrophage accumulation. Based on

these data, it is evident that one of the ATM functions is to clear necrotic adipocytes.

Another proposed function of macrophages is the stimulation of AT remodeling as

observed in obesity. The expansion of AT is associated with increased adipogenesis coupled

with angiogenesis (332,333). Macrophages have been shown to mediate angiogenesis during

tumor growth (334) and inflammation (335). More recently, Pang and colleagues (336)
 42

reported that macrophages induced angiogenesis in AT of obese mice through increased

expression of platelet-derived growth factor (PDGF). Hence, ATM may regulate

neovascularlization in expanding AT in response to reduced vascular density. Alternatively,

macrophages were observed to impair adipogenesis in humans through inhibition of

adipocyte differentiation (337-339). Kim and colleagues (339) also reported that macrophage

inflammatory protein-related protein-2 (MRP-2) inhibited adipocyte differentiation but

promoted preadipocyte migration. The ability of infiltrating macrophages to regulate

adipocyte differentiation may in fact exacerbate obesity-induced inflammation and insulin

resistance through several distinct mechanisms. Specifically, impairment of adipocyte

differentiation contributed to reduced lipid storage capacity and subsequently increased

circulating FFA (339), leading to insulin resistance in adipocytes or in peripheral tissues (i.e.,

skeletal muscle and liver). Furthermore, ATM may cause preadipocytes to exhibit a

proinflammatory phenotype characterized by increased local and systemic cytokine

concentrations (15,326). Regardless of the exact mechanism, the involvement of ATM in

obesity-induced insulin resistance is apparent, as obese mice deficient in macrophage-

specific inflammatory signaling were protected from obesity-induced insulin resistance

(340).

The regulation of macrophage infiltration into AT is not fully elucidated but likely

involves multiple mechanisms including the release of proinflammatory chemokines from

hypertrophic adipocytes (7). Numerous chemoattractant proteins, such as MCP-1 and colony-

stimulating factor (CSF), were suggested mediators of macrophage infiltration in AT (6,7).

Leptin is also involved in endothelial cell activation and monocyte transmigration (329).

However, leptin deficient ob/ob mice still exhibited macrophage accumulation in AT (6),
 43

indicating involvement of additional chemokines. One potential candidate is MCP-1, which

is thought to be one of the most potent chemokines regulating macrophage infiltration.

Adipocytes, endothelial cells, and macrophages have all been observed to contribute to the

release of this chemokine from AT (69,341,342). Christiansen et al. (343) reported that

MCP-1 mRNA expression in AT was correlated with circulating MCP-1 concentration,

indicating that AT is the primary source of the chemokine in obesity and was associated with

insulin resistance. Westerbacka and colleagues (344) reported that obese and insulin resistant

women exhibited a more pronounced increase in adipose-specific MCP-1 gene expression

compared to lean subjects. Collectively, these studies suggest that adipocytes release

chemokines in response to hypertrophy. This in turn stimulates recruitment of macrophages

and increased production of cytokines/chemokines from adipocytes and macrophages, as

well as increased lipolysis, thus promoting systemic inflammation and insulin resistance.

Obesity-Induced Inflammation and Insulin Resistance: Toll-like Receptor 2 and 4

Overview of Toll-like Receptors

Toll-like receptors (Tlrs) are germline-encoded receptors expressed on a variety of

innate immune cells. In mammals, there are currently 13 identified isoforms of Tlrs (345).

Each Tlr recognizes distinct structural motifs primarily expressed on foreign pathogens such

as bacteria, viruses, fungi, and protozoa. These pathogen-associated molecular patterns

(PAMPs) range from specific lipids to nucleic acid sequences. For instance, Tlr4 recognizes

lipid based structures, such as LPS, whereas Tlr3 recognizes double stranded viral DNA

(345,346). The cellular location of Tlrs is an important factor in determining their respective

ligands. Tlrs located on the plasma membrane (i.e. Tlr1, 2, 4, 5, 6, 10, and 11) commonly

recognize lipid or protein based PAMPs (347). Alternatively, intracellular based Tlrs (i.e.
 44

Tlr3, 7, 8, and 9) most commonly recognize bacterial and viral nucleic acids (347). The wide

distribution in pathogen recognition of Tlrs, as well as their extensive in vivo expression

indicates their importance in host defense. Tlrs are expressed on immune cells involved in

innate and adaptive immunity, including macrophages, neutrophils, dendritic cells, and T and

B lymphocytes (346). More recently, expression of these innate immune receptors were

identified in cells not traditionally characterized as immune cells, such as intestinal epithelial

cells (348), myotubes (349-351), and adipocytes (20).

The activation of Tlrs through interactions with their respective ligand or PAMP

leads to an inflammatory response mediated by a common signaling pathway (345,346). The

initial event following ligand binding is the recruitment of adaptor proteins to the

intracellular domain of Tlrs. These adaptor proteins, include MyD88, TIR domain-containing

adaptor protein (TIRAP), Trif, and TRAM (352). MyD88 is the most prominent adaptor

protein involved in the majority of Tlr signaling. In fact, only Tlr3 and Tlr4 are capable of

signaling independently of MyD88 (352). The more prominent MyD88 dependent pathway

involves several additional proteins including IL-1R-associated kinase (IRAK) and TNF

receptor-associated factor 6 (TRAF6). Phosphorylation of IRAK activates TRAF6, which

subsequently activates IKK and MAPK signaling pathways (347,352). Several groups

(353,354) suggested that TRAF6 interacts with membrane-associated proteins, such as

transforming growth factor--activated kinase 1(TAK1) (transforming growth factor-(-

activated kinase 1) and transforming growth factor-(-activated protein kinase-1-binding

protein 1 (TAB1) leading to activation of IKK and MAPK pathways. However, the exact

mechanisms are yet to be fully elucidated.

 45

Activation of IKK mediates phosphorylation of IB, marking the inhibitor protein for

degradation. This is followed by nuclear translocation of NFB, which induces expression

of proinflammatory genes (355). There is evidence that MyD88-independent pathways may

also induce NFB activation through a delayed induction mediated through Tlr4 (356,357).

Alternatively, activation of MAPK requires MyD88 for an inflammatory response to occur

(352). Activation of the MAPK family, including JNK, ERK1/2, and p38, results in nuclear

translocation of the transcription factor, AP-1 (358,359). Both NFB and AP-1 are required

for cytokine production, but it is unknown how activation of these transcription factors and

the corresponding proinflammatory gene expression are affected by signaling through

distinct Tlrs.

Tlr4- and Tlr2-Induced Inflammation and Insulin Resistance

Tlr4. LPS is a major component of the gram-negative bacterial envelope and a

known inducer of inflammation in vivo (360). The proinflammatory component of LPS,

endotoxin (or lipid A), is composed of FA and phosphate groups attached to a central

glucosamine dimer (360). A specific serum binding protein transports endotoxin to cells

expressing its corresponding receptor, which was recently identified as Tlr4 (361). The Tlr4

complex consists of the Tlr4 receptor itself and two co-receptors, MD-2 and CD14 (362).

The MD-2 co-receptor is essential to Tlr4 function (363), whereas CD14 is a high affinity

GPI-linked protein necessary for LPS binding (364). Following binding of LPS to CD14,

Tlr4 is close enough to recognize endotoxin and initiate signal transduction through MyD88-

dependent and independent pathways (360).

Several studies (365-370) have examined the impact of SNP in the Tlr4 gene on the

development of CVD and DM. The findings of these studies are mixed but indicate that
 46

certain polymorphisms exhibit protective effects. For instance, the Asp299Gly SNP was

associated with changes in extracellular domain of Tlr4 causing reduced sensitivity to LPS

(371). Data from the Bruneck Study (365) determined that 53 of 810 subjects were

heterozygous for Asp299Gly SNP. Furthermore, carriers of this allele exhibited lower

proinflammatory cytokines, ACP, and adhesion molecules, which was associated with lower

atherosclerotic risk (365). Edfeldt and colleagues (370) also reported that this SNP was

associated with reduced incidence of myocardial infarction in a Swedish population. Kolek et

al. (369) reported a reduction in CVD and DM risk with individuals exhibiting the

Asp299Gly SNP. More specifically, presence of the SNP has been associated with lower

circulating CRP, with a simultaneous reduction in CVD and DM prevalence (369).

Alternatively, several studies have indicated that polymorphisms in Tlr4 have little impact on

progression of chronic disease in humans (366,367). The disparities among these studies are

difficult to explain and may be attributed to different populations.

Despite the conflicting genetic reports on Tlr4 polymorphisms in the development of

CVD and DM, there is substantial evidence that the innate immune receptor is a major

mediator of obesity-induced insulin resistance. Studies using the Tlr4 ligand, LPS, clearly

showed the importance of the receptor in the development of insulin resistance in several cell

types, including myotubes (372,373), hepatocytes (374), and adipocytes (23). Frost and

colleagues (372) suggested that LPS-induced insulin resistance in C2C12 myotubes was

mediated through Tlr4-induced activation of NFB and JNK/AP-1, leading to production of

TNF and IL-6, respectively. Moreover, these effects were attenuated in skeletal muscle of

Tlr4 deficient mice (372). Inflammation was also attributed to the LPS/Tlr4-mediated insulin
 47

resistance in hepatocytes and adipocytes (23,374). Song et al. (23) observed that LPS

stimulated TNF and IL-6 expression, which in turn resulted in impaired insulin signaling.

There is also evidence that obesity is associated with increased circulating LPS, a

major in vivo agonist of Tlr4, and that this endoxemia is a primary mediator of insulin

resistance (16,375). Cani and colleagues (375) demonstrated that plasma LPS was increased

in obese mice. In humans, serum endotoxin levels are reported to be over 75% higher in

diabetic subjects compared to non-DM controls (16). Furthermore, increased circulating

LPS concentration was associated with insulin resistance in obesity, implicating a role of

Tlr4 in obesity-induced inflammation. For instance, Tlr4 deficient mice were protected from

obesity-induced insulin resistance (24,376,377). More specifically, Suganami and colleagues

(24) observed that C3H/HeJ mice, with a missense mutation in the cytoplasmic domain of

Tlr4, exhibited reduced TNF expression in AT and improved insulin sensitivity following

16 weeks of a high fat diet (HFD) (24). These findings are supported by two recent studies

(376,377). However, the impact of aberrant Tlr4 signaling on adiposity remains unclear.

Tsukumo et al. (377) reported a reduction in epidydimal fat pad weight due to increased

oxygen consumption and reduced respiratory exchange ratio, although the exact mechanisms

are unknown. Alternatively, Poggi and colleagues (376) observed an increase in adiposity in

HFD fed C3H/HeJ mice. The disparity between these studies may be due to distinct

differences in diet composition, but this requires further investigation. Additional

investigations demonstrated that Tlr4 may also be involved in the development of

atherosclerosis (378-380). More specifically, Tlr4 is expressed in lipid-rich macrophage-

infiltrated atherosclerotic lesions of mice and humans (380). Furthermore, Kim and

colleagues (378) observed that Tlr4 knockout mice were protected from HFD-induced
 48

vascular inflammation as determined by reduced NFB activation and NO production.

Overall, these studies indicate that Tlr4 may be a potential mediator of obesity-induced

insulin resistance and related co-morbidities, including DM and CVD.

Tlr2. Of the various innate immune receptors, Tlr2 recognizes the most diverse

number of microorganisms. PAMPs commonly recognized by Tlr2 include glycolipids (i.e.

lipoteichoic acid and peptidoglycan), polysaccharides (i.e. zymosan), and whole bacteria

(381,382). LPS was originally characterized as a Tlr2 agonist (383), but it was later

determined that this effect was mediated by contaminating lipoproteins (384). However, two

studies (385,386) reported that Tlr2 recognized atypical forms of LPS from Leptospira

interrogans and Porphyromonas gingivalis. The atypical forms of LPS differ in structure and

function than the type recognized by Tlr4 by their different number of acyl groups in the

lipid A component (387). Regardless of the exact agonist, Tlr2 activation requires

dimerization with Tlr1 or Tlr6 (388,389). The specific heterodimer formed in the Tlr2

complex appears to be dependent on the size and number of fatty acyl chains. However, post-

receptor signaling appears to be the same for both dimers.

There are currently 16 polymorphisms identified in the Tlr2 gene. Of these, half are

non-synonymous mutations leading to amino acid exchanges and the remaining half are

synonymous polymorphisms (390). There is limited research investigating the relationship

between Tlr2 polymorphisms and obesity-related co-morbidities. However, two studies

(390,391) demonstrated SNPs in the Tlr2 gene that were associated with reduced cytokine

production. More specifically, Merx and Colleagues (390) reported a novel SNP in Tlr2

(arginine codon at 447 to stop codon) associated with reduced IL-6 and TNF production in

heterozygote Arg447 stop individuals. Additional genetic analyses have observed that
 49

various SNP in Tlr2 were protective against several inflammatory conditions, including Type

1 DM (392) and coronary endothelial dysfunction (393).

Despite the limited genetic analysis, there is evidence to suggest involvement of Tlr2

in obesity-induced inflammation and insulin resistance. Creely, et a. (16) reported that

expression of Tlr2 was increased in AT of obese diabetic individuals, whereas Tlr4 levels

were unchanged. Furthermore, expression of this innate immune receptor was associated

with increased inflammatory signaling, including activation of NFB and induction of

proinflammatory cytokine expression (16). Murakami and colleagues (394) utilized flow

cytometry to analyze isolated adipocytes from obese mice and observed that these cells co-

express Tlr2 and TNF. Moreover, expression of these proteins was associated with insulin

resistance (394). The exact mechanisms involved in regulation of Tlr2 expression are unclear

but may be related to elevated endotoxin levels (16,20). As mentioned previously, certain

forms of LPS may interact directly with Tlr2 (387). However, recent evidence indicates that

LPS may also indirectly regulate Tlr2 through a Tlr4-specific pathway (20). These studies

indicated a potential role of Tlr2 in the development of obesity-induced inflammation and

insulin resistance.

Fatty Acid-Induced Tlr2 and Tlr4 Signaling

Investigations into the structure of endotoxin, the bioactive component of LPS,

revealed the presence of acyl-linked SFAs (395). Furthermore, these acylated FAs were

subject to hydrolysis, which subsequently reduced the endotoxic properties (396,397).

Kitchens and colleagues (397) reported that deacylated LPS (dLPS) antagonized LPS-

induced NFB activation and TNF expression in a human monocyte cell line. Moreover,

deacylation of bacterial lipopeptides resulted in a reduction of Tlr2 to initiate a

 50

proinflammatory response in human monocytes (398). These data suggest that FAs,

specifically SFAs, act as endogenous ligands for Tlrs. Lee et al. (399) originally reported that

SFA stimulated NFB activation and cyclooxygenase-2 (COX2) activity through a Tlr4-

dependent mechanism. Additional studies (25,400) confirmed the involvement of SFA in

Tlr4 signaling that included activation of MyD88, IRAK-1, TRAF6, and PI3K-Akt pathways.

However, Lee and colleagues (26) demonstrated that SFA increased COX2 promoter activity

in bone marrow-derived macrophages (BMDM) independent of Tlr4. Moreover, this

inflammatory response stimulated dimerization of Tlr2 with its co-receptors Tlr1 or Tlr6

(26). More recently, Nguyen et al. (401) demonstrated that FFAs mediated IL-6, TNF, and

MCP-1 gene expression in macrophages through Tlr2 and Tlr4 activation of JNK. Therefore,

these data demonstrate the importance of both innate immune receptors in FA-induced

inflammation.

Obesity is associated with an increase in circulating FFA (185,251). Subsequently

this promotes Tlr signaling in insulin sensitive tissues, such as skeletal muscle and AT. For

instance, Reyna and colleagues (402) showed FFA concentration was associated with an

increase in Tlr4 gene and protein expression. Moreover, there was a strong correlation

between insulin resistance and Tlr4 expression in obese and diabetic subjects (402).

Alternatively, Senn (403) demonstrated that palmitate stimulated Tlr2 signaling in C2C12

myotubes, leading to activation of the proinflammatory mediators, JNK and NFB, as well as

reduced insulin-stimulated glucose uptake. Additionally, there is evidence that SFAs mediate

inflammation and insulin resistance in AT through Tlr-dependent mechanisms. Shi et al. (25)

observed that FFA-induced TNF and IL-6 expression in adipocytes was attenuated in Tlr4

knockout mice. Furthermore, these mice were protected from FFA-induced NFB activation
 51

and impaired insulin signaling in AT (25). Additional studies (376-378) confirmed that Tlr4

deficient mice exhibited greater insulin sensitivity than their wild type counterparts, and that

this effect may be a consequence of reduced inflammatory signaling in AT.

Macrophage infiltration is a primary contributor to AT inflammation. Furthermore,

several studies (24,401,404) suggested that SFA signaling through Tlr4 is a potential

mechanism involved in this process. Suganami and colleagues (404) utilized a co-culture

system of adipocytes and macrophages to determine that FFA released from hypertrophied

adipocytes serve as ligands for Tlr4 expressed on macrophages, as well as adipocytes

themselves. Moreover, the Tlr4-NFB pathway is critical in palmitate-induced TNF

expression in macrophages, and subsequent FFA release from adipocytes. These studies

indicate that FFA released from hypertrophied adipocytes act in a paracrine and autocrine

manner to stimulate Tlr receptors on macrophages and adipocytes located in AT and

subsequently cause local inflammation and insulin resistance. Moreover, FFAs released from

AT can then interact with Tlrs expressed in peripheral tissues, including skeletal muscle and

liver, causing inflammation and insulin resistance in these tissues.

As discussed previously, certain MUFA and PUFA have been shown to exert anti-

inflammatory properties both in vitro and in vivo (225-229). One potential explanation for

these effects may be through antagonism of Tlr2 and Tlr4 signaling. Several investigations

(26,399,400) reported that the PUFAs, DHA and EPA, antagonized SFA-induced Tlr

signaling in RAW 264.7 macrophages. Moreover, Lee and colleagues (405) demonstrated

that monocytes isolated from subjects fed 9 to 15 g fish oil (rich in omega-3 FA) per day for

8 weeks exhibited a reduction in Tlr2 and Tlr4 agonist-mediated COX2 expression and

NFB activation. Overall, these studies indicate that SFAs act as endogenous ligands for Tlr2
 52

and Tlr4, whereas PUFAs antagonize Tlr signaling, likely through a direct interaction with

these receptors.

Summary

The prevalence of obesity continues to rise dramatically in the U.S. and worldwide.

Corresponding to this rise is an increase in obesity-related co-morbidities, such as DM and

CVD. The underlying mechanism linking obesity to these diseases is the development of

insulin resistance, which is further attributed to a state of chronic low-grade inflammation

characterized by elevation in proinflammatory cytokines. Furthermore, FFA levels are

increased in obesity and induce insulin resistance through a variety of mechanisms including

inflammation and oxidative stress. However, obesity-induced changes in AT appear to

precede the development of systemic inflammation and insulin resistance. Adipocyte

hypertrophy represents the initial event contributing to AT inflammation. In response to

increased lipid accumulation, adipocytes secrete greater amounts of FFA and

proinflammatory cytokines into the circulation. These inflammatory mediators can then act

in an autocrine or paracrine manner to activate surrounding cells, including macrophages,

endothelial cells, and neighboring adipocytes. These events promote recruitment of immune

cells into AT and further amplify the release of inflammatory mediators from AT, thus

contributing to inflammation in other insulin-sensitive tissues (i.e., liver and skeletal muscle),

resulting in subsequent insulin resistance. The ability of FFA, more specifically SFA, to

induce inflammation and insulin resistance may be dependent on the presence of specific

innate immune receptors. Tlrs recognize specific PAMPs on invading pathogens, initiating a

proinflammatory response to aid in host defense. More recently, Tlr2 and Tlr4 were observed

to mediate SFA-induced inflammation in AT and other insulin-sensitive tissues. Preliminary

 53

investigations on these receptors demonstrate their potential involvement in DM and CVD.

Furthermore, elucidating the role of Tlr2 and Tlr4 in AT inflammation will provide greater

insight into the development of obesity-related co-morbidities and help identify novel

nutritional and pharmaceutical therapies.

References

1. Flegal, K. M., Carroll, M. D., Ogden, C. L. & Johnson, C. L. (2002) Prevalence and trends
in obesity among US adults, 1999-2000. Jama 288: 1723-1727.

2. Greenberg, A. S. & Obin, M. S. (2006) Obesity and the role of adipose tissue in
inflammation and metabolism. Am J Clin Nutr 83: 461S-465S.

3. Wellen, K. E. & Hotamisligil, G. S. (2003) Obesity-induced inflammatory changes in

adipose tissue. J Clin Invest 112: 1785-1788.

4. Hotamisligil, G. S., Shargill, N. S. & Spiegelman, B. M. (1993) Adipose expression of

tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science 259: 87-
91.

5. Roytblat, L., Rachinsky, M., Fisher, A., Greemberg, L., Shapira, Y., Douvdevani, A. &
Gelman, S. (2000) Raised interleukin-6 levels in obese patients. Obes Res 8: 673-675.

6. Xu, H., Barnes, G. T., Yang, Q., Tan, G., Yang, D., Chou, C. J., Sole, J., Nichols, A.,
Ross, J. S., Tartaglia, L. A. & Chen, H. (2003) Chronic inflammation in fat plays a crucial
role in the development of obesity-related insulin resistance. J Clin Invest 112: 1821-1830.

7. Weisberg, S. P., McCann, D., Desai, M., Rosenbaum, M., Leibel, R. L. & Ferrante, A. W.,
Jr. (2003) Obesity is associated with macrophage accumulation in adipose tissue. J Clin
Invest 112: 1796-1808.

8. Trayhurn, P. (2005) Adipose tissue in obesity--an inflammatory issue. Endocrinology 146:

1003-1005.

9. Shoelson, S. E., Lee, J. & Goldfine, A. B. (2006) Inflammation and insulin resistance. J
Clin Invest 116: 1793-1801.

10. Hirosumi, J., Tuncman, G., Chang, L., Gorgun, C. Z., Uysal, K. T., Maeda, K., Karin, M.
& Hotamisligil, G. S. (2002) A central role for JNK in obesity and insulin resistance. Nature
420: 333-336.

11. Suganami, T., Nishida, J. & Ogawa, Y. (2005) A paracrine loop between adipocytes and
macrophages aggravates inflammatory changes: role of free fatty acids and tumor necrosis
factor alpha. Arterioscler Thromb Vasc Biol 25: 2062-2068.

12. Kanda, H., Tateya, S., Tamori, Y., Kotani, K., Hiasa, K., Kitazawa, R., Kitazawa, S.,
Miyachi, H., Maeda, S., Egashira, K. & Kasuga, M. (2006) MCP-1 contributes to
 54

macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in
obesity. J Clin Invest 116: 1494-1505.

13. Chen, A., Mumick, S., Zhang, C., Lamb, J., Dai, H., Weingarth, D., Mudgett, J., Chen,
H., MacNeil, D. J., Reitman, M. L. & Qian, S. (2005) Diet induction of monocyte
chemoattractant protein-1 and its impact on obesity. Obes Res 13: 1311-1320.

14. Chacon, M. R., Fernandez-Real, J. M., Richart, C., Megia, A., Gomez, J. M., Miranda,
M., Caubet, E., Pastor, R., Masdevall, C., Vilarrasa, N., Ricard, W. & Vendrell, J. (2007)
Monocyte chemoattractant protein-1 in obesity and type 2 diabetes. Insulin sensitivity study.
Obesity (Silver Spring) 15: 664-672.

15. Chung, S., Lapoint, K., Martinez, K., Kennedy, A., Boysen Sandberg, M. & McIntosh,
M. K. (2006) Preadipocytes mediate lipopolysaccharide-induced inflammation and insulin
resistance in primary cultures of newly differentiated human adipocytes. Endocrinology 147:
5340-5351.

16. Creely, S. J., McTernan, P. G., Kusminski, C. M., Fisher, F. M., Khanolkar, M., Evans,
M., Harte, A. L. & Kumar, S. (2006) Lipopolysaccharide activates an innate immune system
response in human adipose tissue in obesity and type 2 diabetes. Am J Physiol Endocrinol
Metab.

17. Mohammad, M. K., Morran, M., Slotterbeck, B., Leaman, D. W., Sun, Y., Grafenstein,
H., Hong, S. C. & McInerney, M. F. (2006) Dysregulated Toll-like receptor expression and
signaling in bone marrow-derived macrophages at the onset of diabetes in the non-obese
diabetic mouse. Int Immunol 18: 1101-1113.

18. Ajuwon, K. M., Jacobi, S. K., Kuske, J. L. & Spurlock, M. E. (2004) Interleukin-6 and
interleukin-15 are selectively regulated by lipopolysaccharide and interferon-gamma in
primary pig adipocytes. Am J Physiol Regul Integr Comp Physiol 286: R547-553.

19. Ajuwon, K. M. & Spurlock, M. E. (2005) Adiponectin inhibits LPS-induced NF-kappaB

activation and IL-6 production and increases PPARgamma2 expression in adipocytes. Am J
Physiol Regul Integr Comp Physiol 288: R1220-1225.

20. Lin, Y., Lee, H., Berg, A. H., Lisanti, M. P., Shapiro, L. & Scherer, P. E. (2000) The
lipopolysaccharide-activated toll-like receptor (TLR)-4 induces synthesis of the closely
related receptor TLR-2 in adipocytes. J Biol Chem 275: 24255-24263.

21. Ernst, R. K., Hajjar, A. M., Tsai, J. H., Moskowitz, S. M., Wilson, C. B. & Miller, S. I.
(2003) Pseudomonas aeruginosa lipid A diversity and its recognition by Toll-like receptor 4.
J Endotoxin Res 9: 395-400.

22. Ajuwon, K. M. & Spurlock, M. E. (2005) Palmitate activates the NF-kappaB

transcription factor and induces IL-6 and TNFalpha expression in 3T3-L1 adipocytes. J Nutr
135: 1841-1846.

23. Song, M. J., Kim, K. H., Yoon, J. M. & Kim, J. B. (2006) Activation of Toll-like receptor
4 is associated with insulin resistance in adipocytes. Biochem Biophys Res Commun 346:
739-745.
 55

24. Suganami, T., Mieda, T., Itoh, M., Shimoda, Y., Kamei, Y. & Ogawa, Y. (2007)
Attenuation of obesity-induced adipose tissue inflammation in C3H/HeJ mice carrying a
Toll-like receptor 4 mutation. Biochem Biophys Res Commun.

25. Shi, H., Kokoeva, M. V., Inouye, K., Tzameli, I., Yin, H. & Flier, J. S. (2006) TLR4 links
innate immunity and fatty acid-induced insulin resistance. J Clin Invest 116: 3015-3025.

26. Lee, J. Y., Zhao, L., Youn, H. S., Weatherill, A. R., Tapping, R., Feng, L., Lee, W. H.,
Fitzgerald, K. A. & Hwang, D. H. (2004) Saturated fatty acid activates but polyunsaturated
fatty acid inhibits Toll-like receptor 2 dimerized with Toll-like receptor 6 or 1. J Biol Chem
279: 16971-16979.

27. Thomas, G. P., Hemmrich, K., Abberton, K. M., McCombe, D., Penington, A. J.,
Thompson, E. W. & Morrison, W. A. (2007) Zymosan-induced inflammation stimulates neo-
adipogenesis. Int J Obes (Lond).

28. Ogden, C. L., Carroll, M. D., Curtin, L. R., McDowell, M. A., Tabak, C. J. & Flegal, K.
M. (2006) Prevalence of overweight and obesity in the United States, 1999-2004. Jama 295:
1549-1555.

29. Wang, Y. & Beydoun, M. A. (2007) The obesity epidemic in the United States--gender,
age, socioeconomic, racial/ethnic, and geographic characteristics: a systematic review and
meta-regression analysis. Epidemiol Rev 29: 6-28.

30. Wang, Y. C., Colditz, G. A. & Kuntz, K. M. (2007) Forecasting the obesity epidemic in
the aging U.S. population. Obesity (Silver Spring) 15: 2855-2865.

31. Fontaine, K. R., Redden, D. T., Wang, C., Westfall, A. O. & Allison, D. B. (2003) Years
of life lost due to obesity. Jama 289: 187-193.

32. Mokdad, A. H., Ford, E. S., Bowman, B. A., Dietz, W. H., Vinicor, F., Bales, V. S. &
Marks, J. S. (2003) Prevalence of obesity, diabetes, and obesity-related health risk factors,
2001. Jama 289: 76-79.

33. Thorpe, K. E., Florence, C. S., Howard, D. H. & Joski, P. (2004) The impact of obesity
on rising medical spending. Health Aff (Millwood) Suppl Web Exclusives: W4-480-486.

34. Finkelstein, E. A., Fiebelkorn, I. C. & Wang, G. (2003) National medical spending
attributable to overweight and obesity: how much, and who's paying? Health Aff (Millwood)
Suppl Web Exclusives: W3-219-226.

35. Finkelstein, E., Fiebelkorn, C. & Wang, G. (2005) The costs of obesity among full-time
employees. Am J Health Promot 20: 45-51.

36. Berry, L. (2004) Where to invest healthcare dollars. Diabetes an example of how
spending on prevention can save lives, costs. Mod Healthc 34: 25.

37. Ford, E. S., Giles, W. H. & Dietz, W. H. (2002) Prevalence of the metabolic syndrome
among US adults: findings from the third National Health and Nutrition Examination Survey.
Jama 287: 356-359.
 56

38. Bonora, E., Kiechl, S., Willeit, J., Oberhollenzer, F., Egger, G., Targher, G., Alberiche,
M., Bonadonna, R. C. & Muggeo, M. (1998) Prevalence of insulin resistance in metabolic
disorders: the Bruneck Study. Diabetes 47: 1643-1649.

39. Cefalu, W. T. (2001) Insulin resistance: cellular and clinical concepts. Exp Biol Med
(Maywood) 226: 13-26.

40. Reaven, G. & Tsao, P. S. (2003) Insulin resistance and compensatory hyperinsulinemia:
the key player between cigarette smoking and cardiovascular disease? J Am Coll Cardiol 41:
1044-1047.

41. Kohrt, W. M., Kirwan, J. P., Staten, M. A., Bourey, R. E., King, D. S. & Holloszy, J. O.
(1993) Insulin resistance in aging is related to abdominal obesity. Diabetes 42: 273-281.

42. Lee, C. C., Glickman, S. G., Dengel, D. R., Brown, M. D. & Supiano, M. A. (2005)
Abdominal adiposity assessed by dual energy X-ray absorptiometry provides a sex-
independent predictor of insulin sensitivity in older adults. J Gerontol A Biol Sci Med Sci
60: 872-877.

43. Brochu, M., Tchernof, A., Dionne, I. J., Sites, C. K., Eltabbakh, G. H., Sims, E. A. &
Poehlman, E. T. (2001) What are the physical characteristics associated with a normal
metabolic profile despite a high level of obesity in postmenopausal women? J Clin
Endocrinol Metab 86: 1020-1025.

44. Goodpaster, B. H., Krishnaswami, S., Harris, T. B., Katsiaras, A., Kritchevsky, S. B.,
Simonsick, E. M., Nevitt, M., Holvoet, P. & Newman, A. B. (2005) Obesity, regional body
fat distribution, and the metabolic syndrome in older men and women. Arch Intern Med 165:
777-783.

45. Kuk, J. L., Church, T. S., Blair, S. N. & Ross, R. (2006) Does measurement site for
visceral and abdominal subcutaneous adipose tissue alter associations with the metabolic
syndrome? Diabetes Care 29: 679-684.

46. Smith, S. R. & Zachwieja, J. J. (1999) Visceral adipose tissue: a critical review of
intervention strategies. Int J Obes Relat Metab Disord 23: 329-335.

47. Vohl, M. C., Sladek, R., Robitaille, J., Gurd, S., Marceau, P., Richard, D., Hudson, T. J.
& Tchernof, A. (2004) A survey of genes differentially expressed in subcutaneous and
visceral adipose tissue in men. Obes Res 12: 1217-1222.

48. Wajchenberg, B. L. (2000) Subcutaneous and visceral adipose tissue: their relation to the
metabolic syndrome. Endocr Rev 21: 697-738.

49. Festa, A., D'Agostino, R., Jr., Howard, G., Mykkanen, L., Tracy, R. P. & Haffner, S. M.
(2000) Chronic subclinical inflammation as part of the insulin resistance syndrome: the
Insulin Resistance Atherosclerosis Study (IRAS). Circulation 102: 42-47.

50. Plutzky, J. (2001) Inflammatory pathways in atherosclerosis and acute coronary

syndromes. Am J Cardiol 88: 10K-15K.
 57

51. Brand, K., Page, S., Rogler, G., Bartsch, A., Brandl, R., Knuechel, R., Page, M.,
Kaltschmidt, C., Baeuerle, P. A. & Neumeier, D. (1996) Activated transcription factor
nuclear factor-kappa B is present in the atherosclerotic lesion. J Clin Invest 97: 1715-1722.

52. Ishikawa, S., Kayaba, K., Gotoh, T., Nakamura, Y. & Kajii, E. (2007) Metabolic
syndrome and C-reactive protein in the general population: JMS Cohort Study. Circ J 71: 26-
31.

53. Han, T. S., Sattar, N., Williams, K., Gonzalez-Villalpando, C., Lean, M. E. & Haffner, S.
M. (2002) Prospective study of C-reactive protein in relation to the development of diabetes
and metabolic syndrome in the Mexico City Diabetes Study. Diabetes Care 25: 2016-2021.

54. Laaksonen, D. E., Niskanen, L., Nyyssonen, K., Punnonen, K., Tuomainen, T. P.,
Valkonen, V. P., Salonen, R. & Salonen, J. T. (2004) C-reactive protein and the development
of the metabolic syndrome and diabetes in middle-aged men. Diabetologia 47: 1403-1410.

55. Temelkova-Kurktschiev, T., Siegert, G., Bergmann, S., Henkel, E., Koehler, C., Jaross,
W. & Hanefeld, M. (2002) Subclinical inflammation is strongly related to insulin resistance
but not to impaired insulin secretion in a high risk population for diabetes. Metabolism 51:
743-749.

56. Florez, H., Castillo-Florez, S., Mendez, A., Casanova-Romero, P., Larreal-Urdaneta, C.,
Lee, D. & Goldberg, R. (2006) C-reactive protein is elevated in obese patients with the
metabolic syndrome. Diabetes Res Clin Pract 71: 92-100.

57. Cao, J. J., Arnold, A. M., Manolio, T. A., Polak, J. F., Psaty, B. M., Hirsch, C. H., Kuller,
L. H. & Cushman, M. (2007) Association of carotid artery intima-media thickness, plaques,
and C-reactive protein with future cardiovascular disease and all-cause mortality: the
Cardiovascular Health Study. Circulation 116: 32-38.

58. Wannamethee, S. G., Shaper, A. G. & Lennon, L. (2004) Cardiovascular disease

incidence and mortality in older men with diabetes and in men with coronary heart disease.
Heart 90: 1398-1403.

59. Gilgore, S. G., Drew, W. L. & Rupp, J. J. (1963) The effect of salicylate on plasma
nonesterified fatty acids. Am J Med Sci 245: 456-458.

60. Gilgore, S. G. & Rupp, J. J. (1962) The long-term response of diabetes mellitus to
salicylate therapy: report of a case. Jama 180: 65-66.

61. Baron, S. H. (1982) Salicylates as hypoglycemic agents. Diabetes Care 5: 64-71.

62. de Zentella, P. M., Vazquez-Meza, H., Pina-Zentella, G., Pimentel, L. & Pina, E. (2002)
Non-steroidal anti-inflammatory drugs inhibit epinephrine- and cAMP-mediated lipolysis in
isolated rat adipocytes. J Pharm Pharmacol 54: 577-582.

63. Micossi, P., Pontiroli, A. E., Baron, S. H., Tamayo, R. C., Lengel, F., Bevilacqua, M.,
Raggi, U., Norbiato, G. & Foa, P. P. (1978) Aspirin stimulates insulin and glucagon secretion
and increases glucose tolerance in normal and diabetic subjects. Diabetes 27: 1196-1204.
 58

64. (1989) Final report on the aspirin component of the ongoing Physicians' Health Study.
Steering Committee of the Physicians' Health Study Research Group. N Engl J Med 321:
129-135.

65. Sacco, M., Pellegrini, F., Roncaglioni, M. C., Avanzini, F., Tognoni, G. & Nicolucci, A.
(2003) Primary prevention of cardiovascular events with low-dose aspirin and vitamin E in
type 2 diabetic patients: results of the Primary Prevention Project (PPP) trial. Diabetes Care
26: 3264-3272.

66. Lee, S. W., Park, S. W., Kim, Y. H., Yun, S. C., Park, D. W., Lee, C. W., Hong, M. K.,
Kim, H. S., Ko, J. K., Park, J. H., Lee, J. H., Choi, S. W., Seong, I. W., Cho, Y. H., Lee, N.
H., Kim, J. H., Chun, K. J. & Park, S. J. (2008) Drug-eluting stenting followed by cilostazol
treatment reduces late restenosis in patients with diabetes mellitus the DECLARE-
DIABETES Trial (A Randomized Comparison of Triple Antiplatelet Therapy with Dual
Antiplatelet Therapy After Drug-Eluting Stent Implantation in Diabetic Patients). J Am Coll
Cardiol 51: 1181-1187.

67. Hundal, R. S., Petersen, K. F., Mayerson, A. B., Randhawa, P. S., Inzucchi, S., Shoelson,
S. E. & Shulman, G. I. (2002) Mechanism by which high-dose aspirin improves glucose
metabolism in type 2 diabetes. J Clin Invest 109: 1321-1326.

68. Yuan, M., Konstantopoulos, N., Lee, J., Hansen, L., Li, Z. W., Karin, M. & Shoelson, S.
E. (2001) Reversal of obesity- and diet-induced insulin resistance with salicylates or targeted
disruption of Ikkbeta. Science 293: 1673-1677.

69. Sartipy, P. & Loskutoff, D. J. (2003) Monocyte chemoattractant protein 1 in obesity and
insulin resistance. Proc Natl Acad Sci U S A 100: 7265-7270.

70. Fernandez-Real, J. M., Broch, M., Vendrell, J., Gutierrez, C., Casamitjana, R., Pugeat,
M., Richart, C. & Ricart, W. (2000) Interleukin-6 gene polymorphism and insulin sensitivity.
Diabetes 49: 517-520.

71. Fernandez-Real, J. M., Broch, M., Vendrell, J., Richart, C. & Ricart, W. (2000)
Interleukin-6 gene polymorphism and lipid abnormalities in healthy subjects. J Clin
Endocrinol Metab 85: 1334-1339.

72. Kubaszek, A., Pihlajamaki, J., Punnonen, K., Karhapaa, P., Vauhkonen, I. & Laakso, M.
(2003) The C-174G promoter polymorphism of the IL-6 gene affects energy expenditure and
insulin sensitivity. Diabetes 52: 558-561.

73. Goyenechea, E., Parra, D. & Martinez, J. A. (2007) Impact of interleukin 6 -174G>C
polymorphism on obesity-related metabolic disorders in people with excess in body weight.
Metabolism 56: 1643-1648.

74. Cesari, M., Penninx, B. W., Newman, A. B., Kritchevsky, S. B., Nicklas, B. J., Sutton-
Tyrrell, K., Tracy, R. P., Rubin, S. M., Harris, T. B. & Pahor, M. (2003) Inflammatory
markers and cardiovascular disease (The Health, Aging and Body Composition [Health
ABC] Study). Am J Cardiol 92: 522-528.

75. Bahrami, H., Bluemke, D. A., Kronmal, R., Bertoni, A. G., Lloyd-Jones, D. M., Shahar,
E., Szklo, M. & Lima, J. A. (2008) Novel metabolic risk factors for incident heart failure and
 59

their relationship with obesity: the MESA (Multi-Ethnic Study of Atherosclerosis) study. J
Am Coll Cardiol 51: 1775-1783.

76. Thorand, B., Baumert, J., Kolb, H., Meisinger, C., Chambless, L., Koenig, W. & Herder,
C. (2007) Sex differences in the prediction of type 2 diabetes by inflammatory markers:
results from the MONICA/KORA Augsburg case-cohort study, 1984-2002. Diabetes Care
30: 854-860.

77. Harris, T. B., Ferrucci, L., Tracy, R. P., Corti, M. C., Wacholder, S., Ettinger, W. H., Jr.,
Heimovitz, H., Cohen, H. J. & Wallace, R. (1999) Associations of elevated interleukin-6 and
C-reactive protein levels with mortality in the elderly. Am J Med 106: 506-512.

78. Rush, E. C., Plank, L. D. & Yajnik, C. S. (2007) Interleukin-6, tumour necrosis factor-
alpha and insulin relationships to body composition, metabolism and resting energy
expenditure in a migrant Asian Indian population. Clin Endocrinol (Oxf) 66: 684-690.

79. Herder, C., Schneitler, S., Rathmann, W., Haastert, B., Schneitler, H., Winkler, H.,
Bredahl, R., Hahnloser, E. & Martin, S. (2007) Low-grade inflammation, obesity, and insulin
resistance in adolescents. J Clin Endocrinol Metab 92: 4569-4574.

80. Rotter, V., Nagaev, I. & Smith, U. (2003) Interleukin-6 (IL-6) induces insulin resistance
in 3T3-L1 adipocytes and is, like IL-8 and tumor necrosis factor-alpha, overexpressed in
human fat cells from insulin-resistant subjects. J Biol Chem 278: 45777-45784.

81. Senn, J. J., Klover, P. J., Nowak, I. A., Zimmers, T. A., Koniaris, L. G., Furlanetto, R. W.
& Mooney, R. A. (2003) Suppressor of cytokine signaling-3 (SOCS-3), a potential mediator
of interleukin-6-dependent insulin resistance in hepatocytes. J Biol Chem 278: 13740-13746.

82. Weigert, C., Hennige, A. M., Lehmann, R., Brodbeck, K., Baumgartner, F., Schauble,
M., Haring, H. U. & Schleicher, E. D. (2006) Direct cross-talk of interleukin-6 and insulin
signal transduction via insulin receptor substrate-1 in skeletal muscle cells. J Biol Chem 281:
7060-7067.

83. Klover, P. J., Zimmers, T. A., Koniaris, L. G. & Mooney, R. A. (2003) Chronic exposure
to interleukin-6 causes hepatic insulin resistance in mice. Diabetes 52: 2784-2789.

84. Lagathu, C., Bastard, J. P., Auclair, M., Maachi, M., Capeau, J. & Caron, M. (2003)
Chronic interleukin-6 (IL-6) treatment increased IL-6 secretion and induced insulin
resistance in adipocyte: prevention by rosiglitazone. Biochem Biophys Res Commun 311:
372-379.

85. Ueki, K., Kondo, T. & Kahn, C. R. (2004) Suppressor of cytokine signaling 1 (SOCS-1)
and SOCS-3 cause insulin resistance through inhibition of tyrosine phosphorylation of
insulin receptor substrate proteins by discrete mechanisms. Mol Cell Biol 24: 5434-5446.

86. Hotamisligil, G. S., Budavari, A., Murray, D. & Spiegelman, B. M. (1994) Reduced
tyrosine kinase activity of the insulin receptor in obesity-diabetes. Central role of tumor
necrosis factor-alpha. J Clin Invest 94: 1543-1549.

87. Susa, S., Daimon, M., Sakabe, J., Sato, H., Oizumi, T., Karasawa, S., Wada, K., Jimbu,
Y., Kameda, W., Emi, M., Muramatsu, M. & Kato, T. (2008) A functional polymorphism of
 60

the TNF-alpha gene that is associated with type 2 DM. Biochem Biophys Res Commun 369:
943-947.

88. Shiau, M. Y., Wu, C. Y., Huang, C. N., Hu, S. W., Lin, S. J. & Chang, Y. H. (2003)
TNF-alpha polymorphisms and type 2 diabetes mellitus in Taiwanese patients. Tissue
Antigens 61: 393-397.

89. Fontaine-Bisson, B., Wolever, T. M., Chiasson, J. L., Rabasa-Lhoret, R., Maheux, P.,
Josse, R. G., Leiter, L. A., Rodger, N. W., Ryan, E. A. & El-Sohemy, A. (2007) Tumor
necrosis factor alpha -238G>A genotype alters postprandial plasma levels of free fatty acids
in obese individuals with type 2 diabetes mellitus. Metabolism 56: 649-655.

90. Ohmura, E., Hosaka, D., Yazawa, M., Tsuchida, A., Tokunaga, M., Ishida, H.,
Minagawa, S., Matsuda, A., Imai, Y., Kawazu, S. & Sato, T. (2007) Association of free fatty
acids (FFA) and tumor necrosis factor-alpha (TNF-alpha) and insulin-resistant metabolic
disorder. Horm Metab Res 39: 212-217.

91. Moon, Y. S., Kim, D. H. & Song, D. K. (2004) Serum tumor necrosis factor-alpha levels
and components of the metabolic syndrome in obese adolescents. Metabolism 53: 863-867.

92. Banks, W. A., Willoughby, L. M., Thomas, D. R. & Morley, J. E. (2007) Insulin
resistance syndrome in the elderly: assessment of functional, biochemical, metabolic, and
inflammatory status. Diabetes Care 30: 2369-2373.

93. Tam, L. S., Tomlinson, B., Chu, T. T., Li, T. K. & Li, E. K. (2007) Impact of TNF
inhibition on insulin resistance and lipids levels in patients with rheumatoid arthritis. Clin
Rheumatol 26: 1495-1498.

94. Friedman, J. E., Kirwan, J. P., Jing, M., Presley, L. & Catalano, P. M. (2008) Increased
skeletal muscle tumor necrosis factor-alpha and impaired insulin signaling persist in obese
women with gestational diabetes mellitus 1 year postpartum. Diabetes 57: 606-613.

95. Plomgaard, P., Bouzakri, K., Krogh-Madsen, R., Mittendorfer, B., Zierath, J. R. &
Pedersen, B. K. (2005) Tumor necrosis factor-alpha induces skeletal muscle insulin
resistance in healthy human subjects via inhibition of Akt substrate 160 phosphorylation.
Diabetes 54: 2939-2945.

96. Kroder, G., Bossenmaier, B., Kellerer, M., Capp, E., Stoyanov, B., Muhlhofer, A., Berti,
L., Horikoshi, H., Ullrich, A. & Haring, H. (1996) Tumor necrosis factor-alpha- and
hyperglycemia-induced insulin resistance. Evidence for different mechanisms and different
effects on insulin signaling. J Clin Invest 97: 1471-1477.

97. Li, G., Barrett, E. J., Barrett, M. O., Cao, W. & Liu, Z. (2007) Tumor necrosis factor-
alpha induces insulin resistance in endothelial cells via a p38 mitogen-activated protein
kinase-dependent pathway. Endocrinology 148: 3356-3363.

98. del Aguila, L. F., Claffey, K. P. & Kirwan, J. P. (1999) TNF-alpha impairs insulin
signaling and insulin stimulation of glucose uptake in C2C12 muscle cells. Am J Physiol
276: E849-855.
 61

99. Gronning, L. M., Cederberg, A., Miura, N., Enerback, S. & Tasken, K. (2002) Insulin
and TNF alpha induce expression of the forkhead transcription factor gene Foxc2 in 3T3-L1
adipocytes via PI3K and ERK 1/2-dependent pathways. Mol Endocrinol 16: 873-883.

100. Nguyen, M. T., Satoh, H., Favelyukis, S., Babendure, J. L., Imamura, T., Sbodio, J. I.,
Zalevsky, J., Dahiyat, B. I., Chi, N. W. & Olefsky, J. M. (2005) JNK and tumor necrosis
factor-alpha mediate free fatty acid-induced insulin resistance in 3T3-L1 adipocytes. J Biol
Chem 280: 35361-35371.

101. Herder, C., Haastert, B., Muller-Scholze, S., Koenig, W., Thorand, B., Holle, R.,
Wichmann, H. E., Scherbaum, W. A., Martin, S. & Kolb, H. (2005) Association of systemic
chemokine concentrations with impaired glucose tolerance and type 2 diabetes: results from
the Cooperative Health Research in the Region of Augsburg Survey S4 (KORA S4).
Diabetes 54 Suppl 2: S11-17.

102. Piemonti, L., Calori, G., Mercalli, A., Lattuada, G., Monti, P., Garancini, M. P.,
Costantino, F., Ruotolo, G., Luzi, L. & Perseghin, G. (2003) Fasting plasma leptin, tumor
necrosis factor-alpha receptor 2, and monocyte chemoattracting protein 1 concentration in a
population of glucose-tolerant and glucose-intolerant women: impact on cardiovascular
mortality. Diabetes Care 26: 2883-2889.

103. Simeoni, E., Hoffmann, M. M., Winkelmann, B. R., Ruiz, J., Fleury, S., Boehm, B. O.,
Marz, W. & Vassalli, G. (2004) Association between the A-2518G polymorphism in the
monocyte chemoattractant protein-1 gene and insulin resistance and Type 2 diabetes
mellitus. Diabetologia 47: 1574-1580.

104. Jemaa, R., Rojbani, H., Kallel, A., Ben Ali, S., Feki, M., Chabrak, S., Elasmi, M., Taieb,
S. H., Sanhaji, H., Souheil, O., Mechmeche, R. & Kaabachi, N. (2008) Association between
the -2518G/A polymorphism in the monocyte chemoattractant protein-1 (MCP-1) gene and
myocardial infarction in Tunisian patients. Clin Chim Acta 390: 122-125.

105. Bjarnadottir, K., Eiriksdottir, G., Aspelund, T. & Gudnason, V. (2006) Examination of
genetic effects of polymorphisms in the MCP-1 and CCR2 genes on MI in the Icelandic
population. Atherosclerosis 188: 341-346.

106. Weisberg, S. P., Hunter, D., Huber, R., Lemieux, J., Slaymaker, S., Vaddi, K., Charo, I.,
Leibel, R. L. & Ferrante, A. W., Jr. (2006) CCR2 modulates inflammatory and metabolic
effects of high-fat feeding. J Clin Invest 116: 115-124.

107. Hemmrich, K., Thomas, G. P., Abberton, K. M., Thompson, E. W., Rophael, J. A.,
Penington, A. J. & Morrison, W. A. (2007) Monocyte chemoattractant protein-1 and nitric
oxide promote adipogenesis in a model that mimics obesity. Obesity (Silver Spring) 15:
2951-2957.

108. Biswas, S. K., Sodhi, A. & Paul, S. (2001) Regulation of nitric oxide production by
murine peritoneal macrophages treated in vitro with chemokine monocyte chemoattractant
protein 1. Nitric Oxide 5: 566-579.

109. Kissebah, A. H., Sonnenberg, G. E., Myklebust, J., Goldstein, M., Broman, K., James,
R. G., Marks, J. A., Krakower, G. R., Jacob, H. J., Weber, J., Martin, L., Blangero, J. &
Comuzzie, A. G. (2000) Quantitative trait loci on chromosomes 3 and 17 influence
phenotypes of the metabolic syndrome. Proc Natl Acad Sci U S A 97: 14478-14483.
 62

110. Vionnet, N., Hani El, H., Dupont, S., Gallina, S., Francke, S., Dotte, S., De Matos, F.,
Durand, E., Lepretre, F., Lecoeur, C., Gallina, P., Zekiri, L., Dina, C. & Froguel, P. (2000)
Genomewide search for type 2 diabetes-susceptibility genes in French whites: evidence for a
novel susceptibility locus for early-onset diabetes on chromosome 3q27-qter and independent
replication of a type 2-diabetes locus on chromosome 1q21-q24. Am J Hum Genet 67: 1470-
1480.

111. Hara, K., Boutin, P., Mori, Y., Tobe, K., Dina, C., Yasuda, K., Yamauchi, T., Otabe, S.,
Okada, T., Eto, K., Kadowaki, H., Hagura, R., Akanuma, Y., Yazaki, Y., Nagai, R.,
Taniyama, M., Matsubara, K., Yoda, M., Nakano, Y., Tomita, M., Kimura, S., Ito, C.,
Froguel, P. & Kadowaki, T. (2002) Genetic variation in the gene encoding adiponectin is
associated with an increased risk of type 2 diabetes in the Japanese population. Diabetes 51:
536-540.

112. Jang, Y., Lee, J. H., Chae, J. S., Kim, O. Y., Koh, S. J., Kim, J. Y., Cho, H., Lee, J. E. &
Ordovas, J. M. (2005) Association of the 276G->T polymorphism of the adiponectin gene
with cardiovascular disease risk factors in nondiabetic Koreans. Am J Clin Nutr 82: 760-767.

113. Shin, M. J., Jang, Y., Koh, S. J., Chae, J. S., Kim, O. Y., Lee, J. E., Ordovas, J. M. &
Lee, J. H. (2006) The association of SNP276G>T at adiponectin gene with circulating
adiponectin and insulin resistance in response to mild weight loss. Int J Obes (Lond) 30:
1702-1708.

114. Stefan, N., Machicao, F., Staiger, H., Machann, J., Schick, F., Tschritter, O., Spieth, C.,
Weigert, C., Fritsche, A., Stumvoll, M. & Haring, H. U. (2005) Polymorphisms in the gene
encoding adiponectin receptor 1 are associated with insulin resistance and high liver fat.
Diabetologia 48: 2282-2291.

115. Vasseur, F., Helbecque, N., Dina, C., Lobbens, S., Delannoy, V., Gaget, S., Boutin, P.,
Vaxillaire, M., Lepretre, F., Dupont, S., Hara, K., Clement, K., Bihain, B., Kadowaki, T. &
Froguel, P. (2002) Single-nucleotide polymorphism haplotypes in the both proximal
promoter and exon 3 of the APM1 gene modulate adipocyte-secreted adiponectin hormone
levels and contribute to the genetic risk for type 2 diabetes in French Caucasians. Hum Mol
Genet 11: 2607-2614.

116. Arita, Y., Kihara, S., Ouchi, N., Takahashi, M., Maeda, K., Miyagawa, J., Hotta, K.,
Shimomura, I., Nakamura, T., Miyaoka, K., Kuriyama, H., Nishida, M., Yamashita, S.,
Okubo, K., Matsubara, K., Muraguchi, M., Ohmoto, Y., Funahashi, T. & Matsuzawa, Y.
(1999) Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem
Biophys Res Commun 257: 79-83.

117. Ogawa, Y., Kikuchi, T., Nagasaki, K., Hiura, M., Tanaka, Y. & Uchiyama, M. (2005)
Usefulness of serum adiponectin level as a diagnostic marker of metabolic syndrome in
obese Japanese children. Hypertens Res 28: 51-57.

118. Weyer, C., Funahashi, T., Tanaka, S., Hotta, K., Matsuzawa, Y., Pratley, R. E. &
Tataranni, P. A. (2001) Hypoadiponectinemia in obesity and type 2 diabetes: close
association with insulin resistance and hyperinsulinemia. J Clin Endocrinol Metab 86: 1930-
1935.
 63

119. Hulthe, J., Hulten, L. M. & Fagerberg, B. (2003) Low adipocyte-derived plasma protein
adiponectin concentrations are associated with the metabolic syndrome and small dense low-
density lipoprotein particles: atherosclerosis and insulin resistance study. Metabolism 52:
1612-1614.

120. Xydakis, A. M., Case, C. C., Jones, P. H., Hoogeveen, R. C., Liu, M. Y., Smith, E. O.,
Nelson, K. W. & Ballantyne, C. M. (2004) Adiponectin, inflammation, and the expression of
the metabolic syndrome in obese individuals: the impact of rapid weight loss through caloric
restriction. J Clin Endocrinol Metab 89: 2697-2703.

121. Hotta, K., Funahashi, T., Bodkin, N. L., Ortmeyer, H. K., Arita, Y., Hansen, B. C. &
Matsuzawa, Y. (2001) Circulating concentrations of the adipocyte protein adiponectin are
decreased in parallel with reduced insulin sensitivity during the progression to type 2
diabetes in rhesus monkeys. Diabetes 50: 1126-1133.

122. Ouchi, N., Ohishi, M., Kihara, S., Funahashi, T., Nakamura, T., Nagaretani, H.,
Kumada, M., Ohashi, K., Okamoto, Y., Nishizawa, H., Kishida, K., Maeda, N., Nagasawa,
A., Kobayashi, H., Hiraoka, H., Komai, N., Kaibe, M., Rakugi, H., Ogihara, T. &
Matsuzawa, Y. (2003) Association of hypoadiponectinemia with impaired vasoreactivity.
Hypertension 42: 231-234.

123. Bruun, J. M., Lihn, A. S., Verdich, C., Pedersen, S. B., Toubro, S., Astrup, A. &
Richelsen, B. (2003) Regulation of adiponectin by adipose tissue-derived cytokines: in vivo
and in vitro investigations in humans. Am J Physiol Endocrinol Metab 285: E527-533.

124. Ouchi, N., Kihara, S., Funahashi, T., Nakamura, T., Nishida, M., Kumada, M.,
Okamoto, Y., Ohashi, K., Nagaretani, H., Kishida, K., Nishizawa, H., Maeda, N., Kobayashi,
H., Hiraoka, H. & Matsuzawa, Y. (2003) Reciprocal association of C-reactive protein with
adiponectin in blood stream and adipose tissue. Circulation 107: 671-674.

125. Sell, H., Dietze-Schroeder, D., Eckardt, K. & Eckel, J. (2006) Cytokine secretion by
human adipocytes is differentially regulated by adiponectin, AICAR, and troglitazone.
Biochem Biophys Res Commun 343: 700-706.

126. Wulster-Radcliffe, M. C., Ajuwon, K. M., Wang, J., Christian, J. A. & Spurlock, M. E.
(2004) Adiponectin differentially regulates cytokines in porcine macrophages. Biochem
Biophys Res Commun 316: 924-929.

127. Fasshauer, M., Kralisch, S., Klier, M., Lossner, U., Bluher, M., Klein, J. & Paschke, R.
(2003) Adiponectin gene expression and secretion is inhibited by interleukin-6 in 3T3-L1
adipocytes. Biochem Biophys Res Commun 301: 1045-1050.

128. Kim, K. Y., Kim, J. K., Jeon, J. H., Yoon, S. R., Choi, I. & Yang, Y. (2005) c-Jun N-
terminal kinase is involved in the suppression of adiponectin expression by TNF-alpha in
3T3-L1 adipocytes. Biochem Biophys Res Commun 327: 460-467.

129. Simons, P. J., van den Pangaart, P. S., van Roomen, C. P., Aerts, J. M. & Boon, L.
(2005) Cytokine-mediated modulation of leptin and adiponectin secretion during in vitro
adipogenesis: evidence that tumor necrosis factor-alpha- and interleukin-1beta-treated human
preadipocytes are potent leptin producers. Cytokine 32: 94-103.
 64

130. Wulster-Radcliffe, M. C. & Spurlock, M. E. (2005) Adiponectin Supresses Proliferation

and Proinflammatory Cytokine Production in THP-1 Monocytes, and Induces Caspase 3/7
Activity. Adipocytes 1: 35-42.

131. Yokota, T., Oritani, K., Takahashi, I., Ishikawa, J., Matsuyama, A., Ouchi, N., Kihara,
S., Funahashi, T., Tenner, A. J., Tomiyama, Y. & Matsuzawa, Y. (2000) Adiponectin, a new
member of the family of soluble defense collagens, negatively regulates the growth of
myelomonocytic progenitors and the functions of macrophages. Blood 96: 1723-1732.

132. Ouchi, N., Kihara, S., Arita, Y., Nishida, M., Matsuyama, A., Okamoto, Y., Ishigami,
M., Kuriyama, H., Kishida, K., Nishizawa, H., Hotta, K., Muraguchi, M., Ohmoto, Y.,
Yamashita, S., Funahashi, T. & Matsuzawa, Y. (2001) Adipocyte-derived plasma protein,
adiponectin, suppresses lipid accumulation and class A scavenger receptor expression in
human monocyte-derived macrophages. Circulation 103: 1057-1063.

133. Maeda, N., Shimomura, I., Kishida, K., Nishizawa, H., Matsuda, M., Nagaretani, H.,
Furuyama, N., Kondo, H., Takahashi, M., Arita, Y., Komuro, R., Ouchi, N., Kihara, S.,
Tochino, Y., Okutomi, K., Horie, M., Takeda, S., Aoyama, T., Funahashi, T. & Matsuzawa,
Y. (2002) Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nat Med 8:
731-737.

134. Nawrocki, A. R., Rajala, M. W., Tomas, E., Pajvani, U. B., Saha, A. K., Trumbauer, M.
E., Pang, Z., Chen, A. S., Ruderman, N. B., Chen, H., Rossetti, L. & Scherer, P. E. (2006)
Mice lacking adiponectin show decreased hepatic insulin sensitivity and reduced
responsiveness to peroxisome proliferator-activated receptor gamma agonists. J Biol Chem
281: 2654-2660.

135. Streeper, R. S., Koliwad, S. K., Villanueva, C. J. & Farese, R. V., Jr. (2006) Effects of
DGAT1 deficiency on energy and glucose metabolism are independent of adiponectin. Am J
Physiol Endocrinol Metab 291: E388-394.

136. Berg, A. H., Combs, T. P., Du, X., Brownlee, M. & Scherer, P. E. (2001) The
adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat Med 7: 947-953.

137. Zhou, H., Song, X., Briggs, M., Violand, B., Salsgiver, W., Gulve, E. A. & Luo, Y.
(2005) Adiponectin represses gluconeogenesis independent of insulin in hepatocytes.
Biochem Biophys Res Commun 338: 793-799.

138. Pajvani, U. B., Hawkins, M., Combs, T. P., Rajala, M. W., Doebber, T., Berger, J. P.,
Wagner, J. A., Wu, M., Knopps, A., Xiang, A. H., Utzschneider, K. M., Kahn, S. E., Olefsky,
J. M., Buchanan, T. A. & Scherer, P. E. (2004) Complex distribution, not absolute amount of
adiponectin, correlates with thiazolidinedione-mediated improvement in insulin sensitivity. J
Biol Chem 279: 12152-12162.

139. Peake, P. W., Kriketos, A. D., Campbell, L. V., Shen, Y. & Charlesworth, J. A. (2005)
The metabolism of isoforms of human adiponectin: studies in human subjects and in
experimental animals. Eur J Endocrinol 153: 409-417.

140. Waki, H., Yamauchi, T., Kamon, J., Ito, Y., Uchida, S., Kita, S., Hara, K., Hada, Y.,
Vasseur, F., Froguel, P., Kimura, S., Nagai, R. & Kadowaki, T. (2003) Impaired
multimerization of human adiponectin mutants associated with diabetes. Molecular structure
and multimer formation of adiponectin. J Biol Chem 278: 40352-40363.
 65

141. Wang, Y., Lam, K. S., Chan, L., Chan, K. W., Lam, J. B., Lam, M. C., Hoo, R. C., Mak,
W. W., Cooper, G. J. & Xu, A. (2006) Post-translational modifications of the four conserved
lysine residues within the collagenous domain of adiponectin are required for the formation
of its high molecular weight oligomeric complex. J Biol Chem 281: 16391-16400.

142. Fruebis, J., Tsao, T. S., Javorschi, S., Ebbets-Reed, D., Erickson, M. R., Yen, F. T.,
Bihain, B. E. & Lodish, H. F. (2001) Proteolytic cleavage product of 30-kDa adipocyte
complement-related protein increases fatty acid oxidation in muscle and causes weight loss
in mice. Proc Natl Acad Sci U S A 98: 2005-2010.

143. Chen, M. B., McAinch, A. J., Macaulay, S. L., Castelli, L. A., O'Brien P, E., Dixon, J.
B., Cameron-Smith, D., Kemp, B. E. & Steinberg, G. R. (2005) Impaired activation of AMP-
kinase and fatty acid oxidation by globular adiponectin in cultured human skeletal muscle of
obese type 2 diabetics. J Clin Endocrinol Metab 90: 3665-3672.

144. Bruce, C. R., Mertz, V. A., Heigenhauser, G. J. & Dyck, D. J. (2005) The stimulatory
effect of globular adiponectin on insulin-stimulated glucose uptake and fatty acid oxidation is
impaired in skeletal muscle from obese subjects. Diabetes 54: 3154-3160.

145. Tomas, E., Tsao, T. S., Saha, A. K., Murrey, H. E., Zhang Cc, C., Itani, S. I., Lodish, H.
F. & Ruderman, N. B. (2002) Enhanced muscle fat oxidation and glucose transport by
ACRP30 globular domain: acetyl-CoA carboxylase inhibition and AMP-activated protein
kinase activation. Proc Natl Acad Sci U S A 99: 16309-16313.

146. Yamauchi, T., Kamon, J., Waki, H., Imai, Y., Shimozawa, N., Hioki, K., Uchida, S., Ito,
Y., Takakuwa, K., Matsui, J., Takata, M., Eto, K., Terauchi, Y., Komeda, K., Tsunoda, M.,
Murakami, K., Ohnishi, Y., Naitoh, T., Yamamura, K., Ueyama, Y., Froguel, P., Kimura, S.,
Nagai, R. & Kadowaki, T. (2003) Globular adiponectin protected ob/ob mice from diabetes
and ApoE-deficient mice from atherosclerosis. J Biol Chem 278: 2461-2468.

147. Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida, S., Yamashita, S.,
Noda, M., Kita, S., Ueki, K., Eto, K., Akanuma, Y., Froguel, P., Foufelle, F., Ferre, P.,
Carling, D., Kimura, S., Nagai, R., Kahn, B. B. & Kadowaki, T. (2002) Adiponectin
stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein
kinase. Nat Med 8: 1288-1295.

148. Wu, X., Motoshima, H., Mahadev, K., Stalker, T. J., Scalia, R. & Goldstein, B. J. (2003)
Involvement of AMP-activated protein kinase in glucose uptake stimulated by the globular
domain of adiponectin in primary rat adipocytes. Diabetes 52: 1355-1363.

149. Berlett, B. S. & Stadtman, E. R. (1997) Protein oxidation in aging, disease, and
oxidative stress. J Biol Chem 272: 20313-20316.

150. Brownlee, M. (2001) Biochemistry and molecular cell biology of diabetic

complications. Nature 414: 813-820.

151. Witztum, J. L. & Steinberg, D. (1991) Role of oxidized low density lipoprotein in
atherogenesis. J Clin Invest 88: 1785-1792.
 66

152. Griendling, K. K., Sorescu, D. & Ushio-Fukai, M. (2000) NAD(P)H oxidase: role in
cardiovascular biology and disease. Circ Res 86: 494-501.

153. Gopaul, N. K., Anggard, E. E., Mallet, A. I., Betteridge, D. J., Wolff, S. P. & Nourooz-
Zadeh, J. (1995) Plasma 8-epi-PGF2 alpha levels are elevated in individuals with non-insulin
dependent diabetes mellitus. FEBS Lett 368: 225-229.

154. Furukawa, S., Fujita, T., Shimabukuro, M., Iwaki, M., Yamada, Y., Nakajima, Y.,
Nakayama, O., Makishima, M., Matsuda, M. & Shimomura, I. (2004) Increased oxidative
stress in obesity and its impact on metabolic syndrome. J Clin Invest 114: 1752-1761.

155. Keaney, J. F., Jr., Larson, M. G., Vasan, R. S., Wilson, P. W., Lipinska, I., Corey, D.,
Massaro, J. M., Sutherland, P., Vita, J. A. & Benjamin, E. J. (2003) Obesity and systemic
oxidative stress: clinical correlates of oxidative stress in the Framingham Study. Arterioscler
Thromb Vasc Biol 23: 434-439.

156. Cardona, F., Tunez, I., Tasset, I., Montilla, P., Collantes, E. & Tinahones, F. J. (2008)
Fat overload aggravates oxidative stress in patients with the metabolic syndrome. Eur J Clin
Invest.

157. Cardona, F., Tunez, I., Tasset, I., Garrido-Sanchez, L., Collantes, E. & Tinahones, F. J.
(2008) Circulating antioxidant defences are decreased in healthy people after a high-fat meal.
Br J Nutr: 1-5.

158. Kocic, R., Pavlovic, D., Kocic, G. & Pesic, M. (2007) Susceptibility to oxidative stress,
insulin resistance, and insulin secretory response in the development of diabetes from
obesity. Vojnosanit Pregl 64: 391-397.

159. Mohora, M., Virgolici, B., Paveliu, F., Lixandru, D., Muscurel, C. & Greabu, M. (2006)
Free radical activity in obese patients with type 2 diabetes mellitus. Rom J Intern Med 44:
69-78.

160. Virgolici, B., Mohora, M., Stoian, I., Lixandru, D., Gaman, L. & Paveliu, F. (2005) A
comparative oxidative stress study--obesity with and without diabetes mellitus. Rom J Intern
Med 43: 261-268.

161. Kumashiro, N., Tamura, Y., Uchida, T., Ogihara, T., Fujitani, Y., Hirose, T.,
Mochizuki, H., Kawamori, R. & Watada, H. (2008) Impact of Oxidative Stress and
Peroxisome Proliferator-Activated Receptor gamma Co-activator-1alpha in Hepatic Insulin
Resistance. Diabetes.

162. Lastra, G., Whaley-Connell, A., Manrique, C. M., Habibi, J., Gutweiler, A., Appesh, L.,
Hayden, M. R., Wei, Y., Ferrario, C. M. & Sowers, J. R. (2008) Low-Dose Spironolactone
Reduces Reactive Oxygen Species Generation and Improves Insulin Stimulated Glucose
Transport in Skeletal Muscle in the TG(mRen2)27 Rat. Am J Physiol Endocrinol Metab.

163. Dokken, B. B., Saengsirisuwan, V., Kim, J. S., Teachey, M. K. & Henriksen, E. J.
(2008) Oxidative stress-induced insulin resistance in rat skeletal muscle: role of glycogen
synthase kinase-3. Am J Physiol Endocrinol Metab 294: E615-621.

164. Kozlovsky, N., Rudich, A., Potashnik, R. & Bashan, N. (1997) Reactive oxygen species
activate glucose transport in L6 myotubes. Free Radic Biol Med 23: 859-869.
 67

165. Rudich, A., Tirosh, A., Potashnik, R., Hemi, R., Kanety, H. & Bashan, N. (1998)
Prolonged oxidative stress impairs insulin-induced GLUT4 translocation in 3T3-L1
adipocytes. Diabetes 47: 1562-1569.

166. Rudich, A., Kozlovsky, N., Potashnik, R. & Bashan, N. (1997) Oxidant stress reduces
insulin responsiveness in 3T3-L1 adipocytes. Am J Physiol 272: E935-940.

167. Houstis, N., Rosen, E. D. & Lander, E. S. (2006) Reactive oxygen species have a causal
role in multiple forms of insulin resistance. Nature 440: 944-948.

168. Tanaka, T., Nakatani, K., Morioka, K., Urakawa, H., Maruyama, N., Kitagawa, N.,
Katsuki, A., Araki-Sasaki, R., Hori, Y., Gabazza, E. C., Yano, Y., Wada, H., Nobori, T.,
Sumida, Y. & Adachi, Y. (2003) Nitric oxide stimulates glucose transport through insulin-
independent GLUT4 translocation in 3T3-L1 adipocytes. Eur J Endocrinol 149: 61-67.

169. Lin, Y., Berg, A. H., Iyengar, P., Lam, T. K., Giacca, A., Combs, T. P., Rajala, M. W.,
Du, X., Rollman, B., Li, W., Hawkins, M., Barzilai, N., Rhodes, C. J., Fantus, I. G.,
Brownlee, M. & Scherer, P. E. (2005) The hyperglycemia-induced inflammatory response in
adipocytes: the role of reactive oxygen species. J Biol Chem 280: 4617-4626.

170. Talior, I., Yarkoni, M., Bashan, N. & Eldar-Finkelman, H. (2003) Increased glucose
uptake promotes oxidative stress and PKC-delta activation in adipocytes of obese, insulin-
resistant mice. Am J Physiol Endocrinol Metab 285: E295-302.

171. Lin, Y., Rajala, M. W., Berger, J. P., Moller, D. E., Barzilai, N. & Scherer, P. E. (2001)
Hyperglycemia-induced production of acute phase reactants in adipose tissue. J Biol Chem
276: 42077-42083.

172. Haber, C. A., Lam, T. K., Yu, Z., Gupta, N., Goh, T., Bogdanovic, E., Giacca, A. &
Fantus, I. G. (2003) N-acetylcysteine and taurine prevent hyperglycemia-induced insulin
resistance in vivo: possible role of oxidative stress. Am J Physiol Endocrinol Metab 285:
E744-753.

173. Schenk, H., Klein, M., Erdbrugger, W., Droge, W. & Schulze-Osthoff, K. (1994)
Distinct effects of thioredoxin and antioxidants on the activation of transcription factors NF-
kappa B and AP-1. Proc Natl Acad Sci U S A 91: 1672-1676.

174. Liu, J., Zhao, D., Liu, J., Liu, S., Qin, L. P. & Wu, Z. S. (2005) [Association between
the metabolic syndrome and free fatty acid]. Zhonghua Xin Xue Guan Bing Za Zhi 33: 653-
657.

175. Heptulla, R., Smitten, A., Teague, B., Tamborlane, W. V., Ma, Y. Z. & Caprio, S.
(2001) Temporal patterns of circulating leptin levels in lean and obese adolescents:
relationships to insulin, growth hormone, and free fatty acids rhythmicity. J Clin Endocrinol
Metab 86: 90-96.

176. Punyadeera, C., van der Merwe, M. T., Crowther, N. J., Toman, M., Immelman, A. R.,
Schlaphoff, G. P. & Gray, I. P. (2001) Weight-related differences in glucose metabolism and
free fatty acid production in two South African population groups. Int J Obes Relat Metab
Disord 25: 1196-1205.
 68

177. Reinehr, T., Kiess, W. & Andler, W. (2005) Insulin sensitivity indices of glucose and
free fatty acid metabolism in obese children and adolescents in relation to serum lipids.
Metabolism 54: 397-402.

178. Zucker, L. M. (1972) Fat mobilization in vitro and in vivo in the genetically obese
Zucker rat "fatty". J Lipid Res 13: 234-243.

179. Bray, G. A., Mothon, S. & Cohen, A. S. (1970) Mobilization of fatty acids in
genetically obese rats. J Lipid Res 11: 517-521.

180. Abdul-Ghani, M. A., Molina-Carrion, M., Jani, R., Jenkinson, C. & Defronzo, R. A.
(2008) Adipocytes in subjects with impaired fasting glucose and impaired glucose tolerance
are resistant to the anti-lipolytic effect of insulin. Acta Diabetol.

181. Landin, K., Lonnroth, P., Krotkiewski, M., Holm, G. & Smith, U. (1990) Increased
insulin resistance and fat cell lipolysis in obese but not lean women with a high waist/hip
ratio. Eur J Clin Invest 20: 530-535.

182. Robinson, C., Tamborlane, W. V., Maggs, D. G., Enoksson, S., Sherwin, R. S., Silver,
D., Shulman, G. I. & Caprio, S. (1998) Effect of insulin on glycerol production in obese
adolescents. Am J Physiol 274: E737-743.

183. Hellstrom, L., Reynisdottir, S., Langin, D., Rossner, S. & Arner, P. (1996) Regulation
of lipolysis in fat cells of obese women during long-term hypocaloric diet. Int J Obes Relat
Metab Disord 20: 745-752.

184. Buthelezi, E. P., van der Merwe, M. T., Lonnroth, P. N., Gray, I. P. & Crowther, N. J.
(2000) Ethnic differences in the responsiveness of adipocyte lipolytic activity to insulin.
Obes Res 8: 171-178.

185. Boden, G. (1997) Role of fatty acids in the pathogenesis of insulin resistance and
NIDDM. Diabetes 46: 3-10.

186. Mook, S., Halkes Cj, C., Bilecen, S. & Cabezas, M. C. (2004) In vivo regulation of
plasma free fatty acids in insulin resistance. Metabolism 53: 1197-1201.

187. Lee, K. U., Lee, H. K., Koh, C. S. & Min, H. K. (1988) Artificial induction of
intravascular lipolysis by lipid-heparin infusion leads to insulin resistance in man.
Diabetologia 31: 285-290.

188. Li, L., Yang, G., Li, Q., Tang, Y. & Li, K. (2006) High-fat- and lipid-induced insulin
resistance in rats: the comparison of glucose metabolism, plasma resistin and adiponectin
levels. Ann Nutr Metab 50: 499-505.

189. Pankow, J. S., Duncan, B. B., Schmidt, M. I., Ballantyne, C. M., Couper, D. J.,
Hoogeveen, R. C. & Golden, S. H. (2004) Fasting plasma free fatty acids and risk of type 2
diabetes: the atherosclerosis risk in communities study. Diabetes Care 27: 77-82.

190. Armstrong, K. A., Hiremagalur, B., Haluska, B. A., Campbell, S. B., Hawley, C. M.,
Marks, L., Prins, J., Johnson, D. W. & Isbel, N. M. (2005) Free fatty acids are associated
with obesity, insulin resistance, and atherosclerosis in renal transplant recipients.
Transplantation 80: 937-944.
 69

191. Perseghin, G., Ghosh, S., Gerow, K. & Shulman, G. I. (1997) Metabolic defects in lean
nondiabetic offspring of NIDDM parents: a cross-sectional study. Diabetes 46: 1001-1009.

192. Paolisso, G., Tataranni, P. A., Foley, J. E., Bogardus, C., Howard, B. V. & Ravussin, E.
(1995) A high concentration of fasting plasma non-esterified fatty acids is a risk factor for
the development of NIDDM. Diabetologia 38: 1213-1217.

193. Wilding, J. P. (2007) The importance of free fatty acids in the development of Type 2
diabetes. Diabet Med 24: 934-945.

194. Carlsson, M., Wessman, Y., Almgren, P. & Groop, L. (2000) High levels of
nonesterified fatty acids are associated with increased familial risk of cardiovascular disease.
Arterioscler Thromb Vasc Biol 20: 1588-1594.

195. Cusi, K., Kashyap, S., Gastaldelli, A., Bajaj, M. & Cersosimo, E. (2007) Effects on
insulin secretion and insulin action of a 48-h reduction of plasma free fatty acids with
acipimox in nondiabetic subjects genetically predisposed to type 2 diabetes. Am J Physiol
Endocrinol Metab 292: E1775-1781.

196. Santomauro, A. T., Boden, G., Silva, M. E., Rocha, D. M., Santos, R. F., Ursich, M. J.,
Strassmann, P. G. & Wajchenberg, B. L. (1999) Overnight lowering of free fatty acids with
Acipimox improves insulin resistance and glucose tolerance in obese diabetic and
nondiabetic subjects. Diabetes 48: 1836-1841.

197. van Raalte, D. H., Li, M., Pritchard, P. H. & Wasan, K. M. (2004) Peroxisome
proliferator-activated receptor (PPAR)-alpha: a pharmacological target with a promising
future. Pharm Res 21: 1531-1538.

198. (2000) Secondary prevention by raising HDL cholesterol and reducing triglycerides in
patients with coronary artery disease: the Bezafibrate Infarction Prevention (BIP) study.
Circulation 102: 21-27.

199. Keech, A., Simes, R. J., Barter, P., Best, J., Scott, R., Taskinen, M. R., Forder, P., Pillai,
A., Davis, T., Glasziou, P., Drury, P., Kesaniemi, Y. A., Sullivan, D., Hunt, D., Colman, P.,
d'Emden, M., Whiting, M., Ehnholm, C. & Laakso, M. (2005) Effects of long-term
fenofibrate therapy on cardiovascular events in 9795 people with type 2 diabetes mellitus
(the FIELD study): randomised controlled trial. Lancet 366: 1849-1861.

200. Frick, M. H., Elo, O., Haapa, K., Heinonen, O. P., Heinsalmi, P., Helo, P., Huttunen, J.
K., Kaitaniemi, P., Koskinen, P., Manninen, V. & et al. (1987) Helsinki Heart Study:
primary-prevention trial with gemfibrozil in middle-aged men with dyslipidemia. Safety of
treatment, changes in risk factors, and incidence of coronary heart disease. N Engl J Med
317: 1237-1245.

201. Haluzik, M. M., Lacinova, Z., Dolinkova, M., Haluzikova, D., Housa, D., Horinek, A.,
Vernerova, Z., Kumstyrova, T. & Haluzik, M. (2006) Improvement of insulin sensitivity
after peroxisome proliferator-activated receptor-alpha agonist treatment is accompanied by
paradoxical increase of circulating resistin levels. Endocrinology 147: 4517-4524.

202. Anderlova, K., Dolezalova, R., Housova, J., Bosanska, L., Haluzikova, D., Kremen, J.,
Skrha, J. & Haluzik, M. (2007) Influence of PPAR-alpha agonist fenofibrate on insulin
 70

sensitivity and selected adipose tissue-derived hormones in obese women with type 2
diabetes. Physiol Res 56: 579-586.

203. Randle, P. J., Garland, P. B., Hales, C. N. & Newsholme, E. A. (1963) The glucose
fatty-acid cycle. Its role in insulin sensitivity and the metabolic disturbances of diabetes
mellitus. Lancet 1: 785-789.

204. Randle, P. J. (1998) Regulatory interactions between lipids and carbohydrates: the
glucose fatty acid cycle after 35 years. Diabetes Metab Rev 14: 263-283.

205. McGarry, J. D. (1998) Glucose-fatty acid interactions in health and disease. Am J Clin
Nutr 67: 500S-504S.

206. Anonymous (1994) Disordered metabolism in diabetes: have we underemphasized the

fat component? J Cell Biochem 55 Suppl: 29-38.

207. Ruderman, N. B., Saha, A. K., Vavvas, D. & Witters, L. A. (1999) Malonyl-CoA, fuel
sensing, and insulin resistance. Am J Physiol 276: E1-E18.

208. Schmitz-Peiffer, C. (2000) Signalling aspects of insulin resistance in skeletal muscle:

mechanisms induced by lipid oversupply. Cell Signal 12: 583-594.

209. Unger, R. H. & Orci, L. (2001) Diseases of liporegulation: new perspective on obesity
and related disorders. Faseb J 15: 312-321.

210. Guo, W., Wong, S., Xie, W., Lei, T. & Luo, Z. (2007) Palmitate modulates intracellular
signaling, induces endoplasmic reticulum stress, and causes apoptosis in mouse 3T3-L1 and
rat primary preadipocytes. Am J Physiol Endocrinol Metab 293: E576-586.

211. van Herpen, N. A. & Schrauwen-Hinderling, V. B. (2007) Lipid accumulation in non-

adipose tissue and lipotoxicity. Physiol Behav.

212. Ruderman, N. & Prentki, M. (2004) AMP kinase and malonyl-CoA: targets for therapy
of the metabolic syndrome. Nat Rev Drug Discov 3: 340-351.

213. Lee, J. S., Pinnamaneni, S. K., Eo, S. J., Cho, I. H., Pyo, J. H., Kim, C. K., Sinclair, A.
J., Febbraio, M. A. & Watt, M. J. (2006) Saturated, but not n-6 polyunsaturated, fatty acids
induce insulin resistance: role of intramuscular accumulation of lipid metabolites. J Appl
Physiol 100: 1467-1474.

214. Chavez, J. A., Knotts, T. A., Wang, L. P., Li, G., Dobrowsky, R. T., Florant, G. L. &
Summers, S. A. (2003) A role for ceramide, but not diacylglycerol, in the antagonism of
insulin signal transduction by saturated fatty acids. J Biol Chem 278: 10297-10303.

215. Chavez, J. A. & Summers, S. A. (2003) Characterizing the effects of saturated fatty
acids on insulin signaling and ceramide and diacylglycerol accumulation in 3T3-L1
adipocytes and C2C12 myotubes. Arch Biochem Biophys 419: 101-109.

216. Itani, S. I., Ruderman, N. B., Schmieder, F. & Boden, G. (2002) Lipid-induced insulin
resistance in human muscle is associated with changes in diacylglycerol, protein kinase C,
and IkappaB-alpha. Diabetes 51: 2005-2011.
 71

217. Lennie, T. A., Chung, M. L., Habash, D. L. & Moser, D. K. (2005) Dietary fat intake
and proinflammatory cytokine levels in patients with heart failure. J Card Fail 11: 613-618.

218. Han, S. N., Leka, L. S., Lichtenstein, A. H., Ausman, L. M., Schaefer, E. J. & Meydani,
S. N. (2002) Effect of hydrogenated and saturated, relative to polyunsaturated, fat on immune
and inflammatory responses of adults with moderate hypercholesterolemia. J Lipid Res 43:
445-452.

219. Mozaffarian, D., Pischon, T., Hankinson, S. E., Rifai, N., Joshipura, K., Willett, W. C.
& Rimm, E. B. (2004) Dietary intake of trans fatty acids and systemic inflammation in
women. Am J Clin Nutr 79: 606-612.

220. Aeberli, I., Molinari, L., Spinas, G., Lehmann, R., l'Allemand, D. & Zimmermann, M.
B. (2006) Dietary intakes of fat and antioxidant vitamins are predictors of subclinical
inflammation in overweight Swiss children. Am J Clin Nutr 84: 748-755.

221. Monge-Rojas, R., Campos, H. & Fernandez Rojas, X. (2005) Saturated and cis- and
trans-unsaturated fatty acids intake in rural and urban Costa Rican adolescents. J Am Coll
Nutr 24: 286-293.

222. Ebbesson, S. O., Tejero, M. E., Nobmann, E. D., Lopez-Alvarenga, J. C., Ebbesson, L.,
Romenesko, T., Carter, E. A., Resnick, H. E., Devereux, R. B., MacCluer, J. W., Dyke, B.,
Laston, S. L., Wenger, C. R., Fabsitz, R. R., Comuzzie, A. G. & Howard, B. V. (2007) Fatty
acid consumption and metabolic syndrome components: the GOCADAN study. J
Cardiometab Syndr 2: 244-249.

223. Esmaillzadeh, A., Kimiagar, M., Mehrabi, Y., Azadbakht, L., Hu, F. B. & Willett, W. C.
(2007) Dietary patterns and markers of systemic inflammation among Iranian women. J Nutr
137: 992-998.

224. Fernandez-Real, J. M., Vendrell, J. & Ricart, W. (2005) Circulating adiponectin and
plasma fatty acid profile. Clin Chem 51: 603-609.

225. Lopez-Garcia, E., Schulze, M. B., Manson, J. E., Meigs, J. B., Albert, C. M., Rifai, N.,
Willett, W. C. & Hu, F. B. (2004) Consumption of (n-3) fatty acids is related to plasma
biomarkers of inflammation and endothelial activation in women. J Nutr 134: 1806-1811.

226. Pischon, T., Hankinson, S. E., Hotamisligil, G. S., Rifai, N., Willett, W. C. & Rimm, E.
B. (2003) Habitual dietary intake of n-3 and n-6 fatty acids in relation to inflammatory
markers among US men and women. Circulation 108: 155-160.

227. Rallidis, L. S., Paschos, G., Liakos, G. K., Velissaridou, A. H., Anastasiadis, G. &
Zampelas, A. (2003) Dietary alpha-linolenic acid decreases C-reactive protein, serum
amyloid A and interleukin-6 in dyslipidaemic patients. Atherosclerosis 167: 237-242.

228. Fito, M., Cladellas, M., de la Torre, R., Marti, J., Munoz, D., Schroder, H., Alcantara,
M., Pujadas-Bastardes, M., Marrugat, J., Lopez-Sabater, M. C., Bruguera, J. & Covas, M. I.
(2008) Anti-inflammatory effect of virgin olive oil in stable coronary disease patients: a
randomized, crossover, controlled trial. Eur J Clin Nutr 62: 570-574.

229. Estruch, R., Martinez-Gonzalez, M. A., Corella, D., Salas-Salvado, J., Ruiz-Gutierrez,
V., Covas, M. I., Fiol, M., Gomez-Gracia, E., Lopez-Sabater, M. C., Vinyoles, E., Aros, F.,
 72

Conde, M., Lahoz, C., Lapetra, J., Saez, G. & Ros, E. (2006) Effects of a Mediterranean-
style diet on cardiovascular risk factors: a randomized trial. Ann Intern Med 145: 1-11.

230. Cacicedo, J. M., Yagihashi, N., Keaney, J. F., Jr., Ruderman, N. B. & Ido, Y. (2004)
AMPK inhibits fatty acid-induced increases in NF-kappaB transactivation in cultured human
umbilical vein endothelial cells. Biochem Biophys Res Commun 324: 1204-1209.

231. Staiger, H., Staiger, K., Stefan, N., Wahl, H. G., Machicao, F., Kellerer, M. & Haring,
H. U. (2004) Palmitate-induced interleukin-6 expression in human coronary artery
endothelial cells. Diabetes 53: 3209-3216.

232. Joshi-Barve, S., Barve, S. S., Amancherla, K., Gobejishvili, L., Hill, D., Cave, M., Hote,
P. & McClain, C. J. (2007) Palmitic acid induces production of proinflammatory cytokine
interleukin-8 from hepatocytes. Hepatology 46: 823-830.

233. Weigert, C., Brodbeck, K., Staiger, H., Kausch, C., Machicao, F., Haring, H. U. &
Schleicher, E. D. (2004) Palmitate, but not unsaturated fatty acids, induces the expression of
interleukin-6 in human myotubes through proteasome-dependent activation of nuclear factor-
kappaB. J Biol Chem 279: 23942-23952.

234. Sinha, S., Perdomo, G., Brown, N. F. & O'Doherty, R. M. (2004) Fatty acid-induced
insulin resistance in L6 myotubes is prevented by inhibition of activation and nuclear
localization of nuclear factor kappa B. J Biol Chem 279: 41294-41301.

235. Gao, Z., Zhang, X., Zuberi, A., Hwang, D., Quon, M. J., Lefevre, M. & Ye, J. (2004)
Inhibition of insulin sensitivity by free fatty acids requires activation of multiple serine
kinases in 3T3-L1 adipocytes. Mol Endocrinol 18: 2024-2034.

236. Sanyal, A. J., Campbell-Sargent, C., Mirshahi, F., Rizzo, W. B., Contos, M. J., Sterling,
R. K., Luketic, V. A., Shiffman, M. L. & Clore, J. N. (2001) Nonalcoholic steatohepatitis:
association of insulin resistance and mitochondrial abnormalities. Gastroenterology 120:
1183-1192.

237. Klover, P. J., Clementi, A. H. & Mooney, R. A. (2005) Interleukin-6 depletion

selectively improves hepatic insulin action in obesity. Endocrinology 146: 3417-3427.

238. DeFronzo, R. A., Jacot, E., Jequier, E., Maeder, E., Wahren, J. & Felber, J. P. (1981)
The effect of insulin on the disposal of intravenous glucose. Results from indirect
calorimetry and hepatic and femoral venous catheterization. Diabetes 30: 1000-1007.

239. Jove, M., Planavila, A., Laguna, J. C. & Vazquez-Carrera, M. (2005) Palmitate-induced
interleukin 6 production is mediated by protein kinase C and nuclear-factor kappaB
activation and leads to glucose transporter 4 down-regulation in skeletal muscle cells.
Endocrinology 146: 3087-3095.

240. Jove, M., Planavila, A., Sanchez, R. M., Merlos, M., Laguna, J. C. & Vazquez-Carrera,
M. (2006) Palmitate induces tumor necrosis factor-alpha expression in C2C12 skeletal
muscle cells by a mechanism involving protein kinase C and nuclear factor-kappaB
activation. Endocrinology 147: 552-561.

241. Coll, T., Jove, M., Rodriguez-Calvo, R., Eyre, E., Palomer, X., Sanchez, R. M., Merlos,
M., Laguna, J. C. & Vazquez-Carrera, M. (2006) Palmitate-mediated downregulation of
 73

peroxisome proliferator-activated receptor-gamma coactivator 1alpha in skeletal muscle cells

involves MEK1/2 and nuclear factor-kappaB activation. Diabetes 55: 2779-2787.

242. Crunkhorn, S., Dearie, F., Mantzoros, C., Gami, H., da Silva, W. S., Espinoza, D.,
Faucette, R., Barry, K., Bianco, A. C. & Patti, M. E. (2007) Peroxisome proliferator activator
receptor gamma coactivator-1 expression is reduced in obesity: potential pathogenic role of
saturated fatty acids and p38 mitogen-activated protein kinase activation. J Biol Chem 282:
15439-15450.

243. Miller, T. A., LeBrasseur, N. K., Cote, G. M., Trucillo, M. P., Pimentel, D. R., Ido, Y.,
Ruderman, N. B. & Sawyer, D. B. (2005) Oleate prevents palmitate-induced cytotoxic stress
in cardiac myocytes. Biochem Biophys Res Commun 336: 309-315.

244. Manna, S. K. & Aggarwal, B. B. (1998) Alpha-melanocyte-stimulating hormone

inhibits the nuclear transcription factor NF-kappa B activation induced by various
inflammatory agents. J Immunol 161: 2873-2880.

245. Tran-Thi, T. A., Decker, K. & Baeuerle, P. A. (1995) Differential activation of

transcription factors NF-kappa B and AP-1 in rat liver macrophages. Hepatology 22: 613-
619.

246. Dietze, D., Koenen, M., Rohrig, K., Horikoshi, H., Hauner, H. & Eckel, J. (2002)
Impairment of insulin signaling in human skeletal muscle cells by co-culture with human
adipocytes. Diabetes 51: 2369-2376.

247. Goodpaster, B. H., Theriault, R., Watkins, S. C. & Kelley, D. E. (2000) Intramuscular
lipid content is increased in obesity and decreased by weight loss. Metabolism 49: 467-472.

248. Malenfant, P., Joanisse, D. R., Theriault, R., Goodpaster, B. H., Kelley, D. E. &
Simoneau, J. A. (2001) Fat content in individual muscle fibers of lean and obese subjects. Int
J Obes Relat Metab Disord 25: 1316-1321.

249. Sell, H., Dietze-Schroeder, D. & Eckel, J. (2006) The adipocyte-myocyte axis in insulin
resistance. Trends Endocrinol Metab 17: 416-422.

250. Sell, H., Eckel, J. & Dietze-Schroeder, D. (2006) Pathways leading to muscle insulin
resistance--the muscle--fat connection. Arch Physiol Biochem 112: 105-113.

251. Boden, G. & Shulman, G. I. (2002) Free fatty acids in obesity and type 2 diabetes:
defining their role in the development of insulin resistance and beta-cell dysfunction. Eur J
Clin Invest 32 Suppl 3: 14-23.

252. Hausman, D. B., DiGirolamo, M., Bartness, T. J., Hausman, G. J. & Martin, R. J. (2001)
The biology of white adipocyte proliferation. Obes Rev 2: 239-254.

253. Cinti, S. (2005) The adipose organ. Prostaglandins Leukot Essent Fatty Acids 73: 9-15.

254. Fruhbeck, G., Gomez-Ambrosi, J., Muruzabal, F. J. & Burrell, M. A. (2001) The
adipocyte: a model for integration of endocrine and metabolic signaling in energy
metabolism regulation. Am J Physiol Endocrinol Metab 280: E827-847.
 74

255. Cinti, S. (2006) The role of brown adipose tissue in human obesity. Nutr Metab
Cardiovasc Dis 16: 569-574.

256. Klaus, S., Casteilla, L., Bouillaud, F. & Ricquier, D. (1991) The uncoupling protein
UCP: a membraneous mitochondrial ion carrier exclusively expressed in brown adipose
tissue. Int J Biochem 23: 791-801.

257. Cancello, R., Zingaretti, M. C., Sarzani, R., Ricquier, D. & Cinti, S. (1998) Leptin and
UCP1 genes are reciprocally regulated in brown adipose tissue. Endocrinology 139: 4747-
4750.

258. Himms-Hagen, J., Melnyk, A., Zingaretti, M. C., Ceresi, E., Barbatelli, G. & Cinti, S.
(2000) Multilocular fat cells in WAT of CL-316243-treated rats derive directly from white
adipocytes. Am J Physiol Cell Physiol 279: C670-681.

259. Garaulet, M., Perez-Llamas, F., Perez-Ayala, M., Martinez, P., de Medina, F. S., Tebar,
F. J. & Zamora, S. (2001) Site-specific differences in the fatty acid composition of
abdominal adipose tissue in an obese population from a Mediterranean area: relation with
dietary fatty acids, plasma lipid profile, serum insulin, and central obesity. Am J Clin Nutr
74: 585-591.

260. Prins, J. B. & O'Rahilly, S. (1997) Regulation of adipose cell number in man. Clin Sci
(Lond) 92: 3-11.

261. Bjorntorp, P. (1974) Size, number and function of adipose tissue cells in human obesity.
Horm Metab Res Suppl 4: 77-83.

262. Butterwith, S. C. (1994) Molecular events in adipocyte development. Pharmacol Ther

61: 399-411.

263. Gregoire, F. M., Smas, C. M. & Sul, H. S. (1998) Understanding adipocyte

differentiation. Physiol Rev 78: 783-809.

264. Avram, M. M., Avram, A. S. & James, W. D. (2007) Subcutaneous fat in normal and
diseased states 3. Adipogenesis: from stem cell to fat cell. J Am Acad Dermatol 56: 472-492.

265. Pairault, J. & Green, H. (1979) A study of the adipose conversion of suspended 3T3
cells by using glycerophosphate dehydrogenase as differentiation marker. Proc Natl Acad Sci
U S A 76: 5138-5142.

266. Brook, C. G., Lloyd, J. K. & Wolf, O. H. (1972) Relation between age of onset of
obesity and size and number of adipose cells. Br Med J 2: 25-27.

267. Ramsay, T. G., White, M. E. & Wolverton, C. K. (1989) Insulin-like growth factor 1
induction of differentiation of porcine preadipocytes. J Anim Sci 67: 2452-2459.

268. Smith, P. J., Wise, L. S., Berkowitz, R., Wan, C. & Rubin, C. S. (1988) Insulin-like
growth factor-I is an essential regulator of the differentiation of 3T3-L1 adipocytes. J Biol
Chem 263: 9402-9408.

269. Wright, J. T. & Hausman, G. J. (1995) Insulinlike growth factor-1 (IGF-1)-induced

stimulation of porcine preadipocyte replication. In Vitro Cell Dev Biol Anim 31: 404-408.
 75

270. Wheatcroft, S. B., Kearney, M. T., Shah, A. M., Ezzat, V. A., Miell, J. R., Modo, M.,
Williams, S. C., Cawthorn, W. P., Medina-Gomez, G., Vidal-Puig, A., Sethi, J. K. &
Crossey, P. A. (2007) IGF-binding protein-2 protects against the development of obesity and
insulin resistance. Diabetes 56: 285-294.

271. Wang, Y., Kim, K. A., Kim, J. H. & Sul, H. S. (2006) Pref-1, a preadipocyte secreted
factor that inhibits adipogenesis. J Nutr 136: 2953-2956.

272. Harp, J. B. (2004) New insights into inhibitors of adipogenesis. Curr Opin Lipidol 15:
303-307.

273. Wang, M. Y., Grayburn, P., Chen, S., Ravazzola, M., Orci, L. & Unger, R. H. (2008)
Adipogenic capacity and the susceptibility to type 2 diabetes and metabolic syndrome. Proc
Natl Acad Sci U S A 105: 6139-6144.

274. Olson, R. E. (1998) Discovery of the lipoproteins, their role in fat transport and their
significance as risk factors. J Nutr 128: 439S-443S.

275. Mead, J. R., Irvine, S. A. & Ramji, D. P. (2002) Lipoprotein lipase: structure, function,
regulation, and role in disease. J Mol Med 80: 753-769.

276. Tacken, P. J., Hofker, M. H., Havekes, L. M. & van Dijk, K. W. (2001) Living up to a
name: the role of the VLDL receptor in lipid metabolism. Curr Opin Lipidol 12: 275-279.

277. Eckel, R. H. (1989) Lipoprotein lipase. A multifunctional enzyme relevant to common

metabolic diseases. N Engl J Med 320: 1060-1068.

278. Kitajima, S., Morimoto, M., Liu, E., Koike, T., Higaki, Y., Taura, Y., Mamba, K.,
Itamoto, K., Watanabe, T., Tsutsumi, K., Yamada, N. & Fan, J. (2004) Overexpression of
lipoprotein lipase improves insulin resistance induced by a high-fat diet in transgenic rabbits.
Diabetologia 47: 1202-1209.

279. Kim, J. K., Fillmore, J. J., Chen, Y., Yu, C., Moore, I. K., Pypaert, M., Lutz, E. P.,
Kako, Y., Velez-Carrasco, W., Goldberg, I. J., Breslow, J. L. & Shulman, G. I. (2001)
Tissue-specific overexpression of lipoprotein lipase causes tissue-specific insulin resistance.
Proc Natl Acad Sci U S A 98: 7522-7527.

280. Bonen, A., Tandon, N. N., Glatz, J. F., Luiken, J. J. & Heigenhauser, G. J. (2006) The
fatty acid transporter FAT/CD36 is upregulated in subcutaneous and visceral adipose tissues
in human obesity and type 2 diabetes. Int J Obes (Lond) 30: 877-883.

281. Gertow, K., Pietilainen, K. H., Yki-Jarvinen, H., Kaprio, J., Rissanen, A., Eriksson, P.,
Hamsten, A. & Fisher, R. M. (2004) Expression of fatty-acid-handling proteins in human
adipose tissue in relation to obesity and insulin resistance. Diabetologia 47: 1118-1125.

282. Diraison, F. & Beylot, M. (1998) Role of human liver lipogenesis and reesterification in
triglycerides secretion and in FFA reesterification. Am J Physiol 274: E321-327.

283. Diraison, F., Dusserre, E., Vidal, H., Sothier, M. & Beylot, M. (2002) Increased hepatic
lipogenesis but decreased expression of lipogenic gene in adipose tissue in human obesity.
Am J Physiol Endocrinol Metab 282: E46-51.
 76

284. Large, V., Peroni, O., Letexier, D., Ray, H. & Beylot, M. (2004) Metabolism of lipids in
human white adipocyte. Diabetes Metab 30: 294-309.

285. Marin, P., Hogh-Kristiansen, I., Jansson, S., Krotkiewski, M., Holm, G. & Bjorntorp, P.
(1992) Uptake of glucose carbon in muscle glycogen and adipose tissue triglycerides in vivo
in humans. Am J Physiol 263: E473-480.

286. Letexier, D., Pinteur, C., Large, V., Frering, V. & Beylot, M. (2003) Comparison of the
expression and activity of the lipogenic pathway in human and rat adipose tissue. J Lipid Res
44: 2127-2134.

287. Maassen, J. A., Romijn, J. A. & Heine, R. J. (2007) Fatty acid-induced mitochondrial
uncoupling in adipocytes as a key protective factor against insulin resistance and beta cell
dysfunction: a new concept in the pathogenesis of obesity-associated type 2 diabetes
mellitus. Diabetologia 50: 2036-2041.

288. Coppack, S. W., Fisher, R. M., Gibbons, G. F., Humphreys, S. M., McDonough, M. J.,
Potts, J. L. & Frayn, K. N. (1990) Postprandial substrate deposition in human forearm and
adipose tissues in vivo. Clin Sci (Lond) 79: 339-348.

289. Loncar, D., Afzelius, B. A. & Cannon, B. (1988) Epididymal white adipose tissue after
cold stress in rats. II. Mitochondrial changes. J Ultrastruct Mol Struct Res 101: 199-209.

290. Maassen, J. A., Romijn, J. A. & Heine, R. J. (2008) Fatty acid-induced mitochondrial
uncoupling in adipocytes as a key protective factor against insulin resistance and beta cell
dysfunction: do adipocytes consume sufficient amounts of oxygen to oxidise fatty acids?
Diabetologia 51: 907-908.

291. Raz, I., Eldor, R., Cernea, S. & Shafrir, E. (2005) Diabetes: insulin resistance and
derangements in lipid metabolism. Cure through intervention in fat transport and storage.
Diabetes Metab Res Rev 21: 3-14.

292. Rossmeisl, M., Flachs, P., Brauner, P., Sponarova, J., Matejkova, O., Prazak, T.,
Ruzickova, J., Bardova, K., Kuda, O. & Kopecky, J. (2004) Role of energy charge and AMP-
activated protein kinase in adipocytes in the control of body fat stores. Int J Obes Relat
Metab Disord 28 Suppl 4: S38-44.

293. Rossmeisl, M., Syrovy, I., Baumruk, F., Flachs, P., Janovska, P. & Kopecky, J. (2000)
Decreased fatty acid synthesis due to mitochondrial uncoupling in adipose tissue. Faseb J 14:
1793-1800.

294. Hattori, Y., Nakano, Y., Hattori, S., Tomizawa, A., Inukai, K. & Kasai, K. (2008) High
molecular weight adiponectin activates AMPK and suppresses cytokine-induced NF-kappaB
activation in vascular endothelial cells. FEBS Lett 582: 1719-1724.

295. Kola, B., Grossman, A. B. & Korbonits, M. (2008) The role of AMP-activated protein
kinase in obesity. Front Horm Res 36: 198-211.

296. Lafontan, M. & Berlan, M. (1993) Fat cell adrenergic receptors and the control of white
and brown fat cell function. J Lipid Res 34: 1057-1091.
 77

297. Lonnroth, P. & Smith, U. (1986) The antilipolytic effect of insulin in human adipocytes
requires activation of the phosphodiesterase. Biochem Biophys Res Commun 141: 1157-
1161.

298. Large, V. & Arner, P. (1998) Regulation of lipolysis in humans. Pathophysiological

modulation in obesity, diabetes, and hyperlipidaemia. Diabetes Metab 24: 409-418.

299. Arner, P. (1988) Control of lipolysis and its relevance to development of obesity in man.
Diabetes Metab Rev 4: 507-515.

300. Hotamisligil, G. S., Arner, P., Caro, J. F., Atkinson, R. L. & Spiegelman, B. M. (1995)
Increased adipose tissue expression of tumor necrosis factor-alpha in human obesity and
insulin resistance. J Clin Invest 95: 2409-2415.

301. Fain, J. N., Bahouth, S. W. & Madan, A. K. (2004) TNFalpha release by the nonfat cells
of human adipose tissue. Int J Obes Relat Metab Disord 28: 616-622.

302. Ross, S. E., Erickson, R. L., Gerin, I., DeRose, P. M., Bajnok, L., Longo, K. A., Misek,
D. E., Kuick, R., Hanash, S. M., Atkins, K. B., Andresen, S. M., Nebb, H. I., Madsen, L.,
Kristiansen, K. & MacDougald, O. A. (2002) Microarray analyses during adipogenesis:
understanding the effects of Wnt signaling on adipogenesis and the roles of liver X receptor
alpha in adipocyte metabolism. Mol Cell Biol 22: 5989-5999.

303. Uysal, K. T., Wiesbrock, S. M., Marino, M. W. & Hotamisligil, G. S. (1997) Protection
from obesity-induced insulin resistance in mice lacking TNF-alpha function. Nature 389:
610-614.

304. Uysal, K. T., Wiesbrock, S. M. & Hotamisligil, G. S. (1998) Functional analysis of

tumor necrosis factor (TNF) receptors in TNF-alpha-mediated insulin resistance in genetic
obesity. Endocrinology 139: 4832-4838.

305. Ofei, F., Hurel, S., Newkirk, J., Sopwith, M. & Taylor, R. (1996) Effects of an
engineered human anti-TNF-alpha antibody (CDP571) on insulin sensitivity and glycemic
control in patients with NIDDM. Diabetes 45: 881-885.

306. Ruan, H. & Lodish, H. F. (2003) Insulin resistance in adipose tissue: direct and indirect
effects of tumor necrosis factor-alpha. Cytokine Growth Factor Rev 14: 447-455.

307. Ruan, H., Hacohen, N., Golub, T. R., Van Parijs, L. & Lodish, H. F. (2002) Tumor
necrosis factor-alpha suppresses adipocyte-specific genes and activates expression of
preadipocyte genes in 3T3-L1 adipocytes: nuclear factor-kappaB activation by TNF-alpha is
obligatory. Diabetes 51: 1319-1336.

308. Ruan, H., Miles, P. D., Ladd, C. M., Ross, K., Golub, T. R., Olefsky, J. M. & Lodish, H.
F. (2002) Profiling gene transcription in vivo reveals adipose tissue as an immediate target of
tumor necrosis factor-alpha: implications for insulin resistance. Diabetes 51: 3176-3188.

309. Gloire, G., Legrand-Poels, S. & Piette, J. (2006) NF-kappaB activation by reactive
oxygen species: fifteen years later. Biochem Pharmacol 72: 1493-1505.
 78

310. Lopez-Soriano, J., Llovera, M., Carbo, N., Garcia-Martinez, C., Lopez-Soriano, F. J. &
Argiles, J. M. (1997) Lipid metabolism in tumour-bearing mice: studies with knockout mice
for tumour necrosis factor receptor 1 protein. Mol Cell Endocrinol 132: 93-99.

311. Memon, R. A., Feingold, K. R., Moser, A. H., Fuller, J. & Grunfeld, C. (1998)
Regulation of fatty acid transport protein and fatty acid translocase mRNA levels by
endotoxin and cytokines. Am J Physiol 274: E210-217.

312. Ryden, M., Dicker, A., van Harmelen, V., Hauner, H., Brunnberg, M., Perbeck, L.,
Lonnqvist, F. & Arner, P. (2002) Mapping of early signaling events in tumor necrosis factor-
alpha -mediated lipolysis in human fat cells. J Biol Chem 277: 1085-1091.

313. Hu, E., Kim, J. B., Sarraf, P. & Spiegelman, B. M. (1996) Inhibition of adipogenesis
through MAP kinase-mediated phosphorylation of PPARgamma. Science 274: 2100-2103.

314. Adams, M., Reginato, M. J., Shao, D., Lazar, M. A. & Chatterjee, V. K. (1997)
Transcriptional activation by peroxisome proliferator-activated receptor gamma is inhibited
by phosphorylation at a consensus mitogen-activated protein kinase site. J Biol Chem 272:
5128-5132.

315. Mohamed-Ali, V., Goodrick, S., Rawesh, A., Katz, D. R., Miles, J. M., Yudkin, J. S.,
Klein, S. & Coppack, S. W. (1997) Subcutaneous adipose tissue releases interleukin-6, but
not tumor necrosis factor-alpha, in vivo. J Clin Endocrinol Metab 82: 4196-4200.

316. Fain, J. N., Madan, A. K., Hiler, M. L., Cheema, P. & Bahouth, S. W. (2004)
Comparison of the release of adipokines by adipose tissue, adipose tissue matrix, and
adipocytes from visceral and subcutaneous abdominal adipose tissues of obese humans.
Endocrinology 145: 2273-2282.

317. Sopasakis, V. R., Sandqvist, M., Gustafson, B., Hammarstedt, A., Schmelz, M., Yang,
X., Jansson, P. A. & Smith, U. (2004) High local concentrations and effects on
differentiation implicate interleukin-6 as a paracrine regulator. Obes Res 12: 454-460.

318. Mohamed-Ali, V., Pinkney, J. H. & Coppack, S. W. (1998) Adipose tissue as an

endocrine and paracrine organ. Int J Obes Relat Metab Disord 22: 1145-1158.

319. Hoene, M. & Weigert, C. (2008) The role of interleukin-6 in insulin resistance, body fat
distribution and energy balance. Obes Rev 9: 20-29.

320. Febbraio, M. A., Hiscock, N., Sacchetti, M., Fischer, C. P. & Pedersen, B. K. (2004)
Interleukin-6 is a novel factor mediating glucose homeostasis during skeletal muscle
contraction. Diabetes 53: 1643-1648.

321. Faldt, J., Wernstedt, I., Fitzgerald, S. M., Wallenius, K., Bergstrom, G. & Jansson, J. O.
(2004) Reduced exercise endurance in interleukin-6-deficient mice. Endocrinology 145:
2680-2686.

322. Greenberg, A. S., Nordan, R. P., McIntosh, J., Calvo, J. C., Scow, R. O. & Jablons, D.
(1992) Interleukin 6 reduces lipoprotein lipase activity in adipose tissue of mice in vivo and
in 3T3-L1 adipocytes: a possible role for interleukin 6 in cancer cachexia. Cancer Res 52:
4113-4116.
 79

323. Petersen, E. W., Carey, A. L., Sacchetti, M., Steinberg, G. R., Macaulay, S. L.,
Febbraio, M. A. & Pedersen, B. K. (2005) Acute IL-6 treatment increases fatty acid turnover
in elderly humans in vivo and in tissue culture in vitro. Am J Physiol Endocrinol Metab 288:
E155-162.

324. Trujillo, M. E., Sullivan, S., Harten, I., Schneider, S. H., Greenberg, A. S. & Fried, S. K.
(2004) Interleukin-6 regulates human adipose tissue lipid metabolism and leptin production
in vitro. J Clin Endocrinol Metab 89: 5577-5582.

325. Sell, H., Eckardt, K., Taube, A., Tews, D., Gurgui, M., van Echten-Deckert, G. & Eckel,
J. (2008) Skeletal muscle insulin resistance induced by adipocyte-conditioned medium:
underlying mechanisms and reversibility. Am J Physiol Endocrinol Metab.

326. Charriere, G., Cousin, B., Arnaud, E., Andre, M., Bacou, F., Penicaud, L. & Casteilla,
L. (2003) Preadipocyte conversion to macrophage. Evidence of plasticity. J Biol Chem 278:
9850-9855.

327. Geissmann, F., Jung, S. & Littman, D. R. (2003) Blood monocytes consist of two
principal subsets with distinct migratory properties. Immunity 19: 71-82.

328. Lumeng, C. N., Bodzin, J. L. & Saltiel, A. R. (2007) Obesity induces a phenotypic
switch in adipose tissue macrophage polarization. J Clin Invest 117: 175-184.

329. Curat, C. A., Miranville, A., Sengenes, C., Diehl, M., Tonus, C., Busse, R. &
Bouloumie, A. (2004) From blood monocytes to adipose tissue-resident macrophages:
induction of diapedesis by human mature adipocytes. Diabetes 53: 1285-1292.

330. Murdoch, C., Giannoudis, A. & Lewis, C. E. (2004) Mechanisms regulating the
recruitment of macrophages into hypoxic areas of tumors and other ischemic tissues. Blood
104: 2224-2234.

331. Cinti, S., Mitchell, G., Barbatelli, G., Murano, I., Ceresi, E., Faloia, E., Wang, S.,
Fortier, M., Greenberg, A. S. & Obin, M. S. (2005) Adipocyte death defines macrophage
localization and function in adipose tissue of obese mice and humans. J Lipid Res 46: 2347-
2355.

332. Neels, J. G., Thinnes, T. & Loskutoff, D. J. (2004) Angiogenesis in an in vivo model of
adipose tissue development. Faseb J 18: 983-985.

333. Nishimura, S., Manabe, I., Nagasaki, M., Hosoya, Y., Yamashita, H., Fujita, H., Ohsugi,
M., Tobe, K., Kadowaki, T., Nagai, R. & Sugiura, S. (2007) Adipogenesis in obesity requires
close interplay between differentiating adipocytes, stromal cells, and blood vessels. Diabetes
56: 1517-1526.

334. Sunderkotter, C., Goebeler, M., Schulze-Osthoff, K., Bhardwaj, R. & Sorg, C. (1991)
Macrophage-derived angiogenesis factors. Pharmacol Ther 51: 195-216.

335. Cursiefen, C., Chen, L., Borges, L. P., Jackson, D., Cao, J., Radziejewski, C., D'Amore,
P. A., Dana, M. R., Wiegand, S. J. & Streilein, J. W. (2004) VEGF-A stimulates
lymphangiogenesis and hemangiogenesis in inflammatory neovascularization via
macrophage recruitment. J Clin Invest 113: 1040-1050.
 80

336. Pang, C., Gao, Z., Yin, J., Zhang, J., Jia, W. & Ye, J. (2008) Macrophage Infiltration
into Adipose Tissue May Promote Angiogenesis for Adipose Tissue Remodeling in Obesity.
Am J Physiol Endocrinol Metab.

337. Lacasa, D., Taleb, S., Keophiphath, M., Miranville, A. & Clement, K. (2007)
Macrophage-secreted factors impair human adipogenesis: involvement of proinflammatory
state in preadipocytes. Endocrinology 148: 868-877.

338. Constant, V. A., Gagnon, A., Landry, A. & Sorisky, A. (2006) Macrophage-conditioned
medium inhibits the differentiation of 3T3-L1 and human abdominal preadipocytes.
Diabetologia 49: 1402-1411.

339. Kim, C. S., Kawada, T., Yoo, H., Kwon, B. S. & Yu, R. (2003) Macrophage
inflammatory protein-related protein-2, a novel CC chemokine, can regulate preadipocyte
migration and adipocyte differentiation. FEBS Lett 548: 125-130.

340. Arkan, M. C., Hevener, A. L., Greten, F. R., Maeda, S., Li, Z. W., Long, J. M.,
Wynshaw-Boris, A., Poli, G., Olefsky, J. & Karin, M. (2005) IKK-beta links inflammation to
obesity-induced insulin resistance. Nat Med 11: 191-198.

341. Ueno, M., Sonoda, Y., Funakoshi, M., Mukaida, N., Nose, K. & Kasahara, T. (2000)
Differential induction of JE/MCP-1 in subclones from a murine macrophage cell line, RAW
264.7: role of kappaB-3 binding protein. Cytokine 12: 207-219.

342. Rimbach, G., Valacchi, G., Canali, R. & Virgili, F. (2000) Macrophages stimulated with
IFN-gamma activate NF-kappa B and induce MCP-1 gene expression in primary human
endothelial cells. Mol Cell Biol Res Commun 3: 238-242.

343. Christiansen, T., Richelsen, B. & Bruun, J. M. (2005) Monocyte chemoattractant

protein-1 is produced in isolated adipocytes, associated with adiposity and reduced after
weight loss in morbid obese subjects. Int J Obes (Lond) 29: 146-150.

344. Westerbacka, J., Corner, A., Kolak, M., Makkonen, J., Turpeinen, U., Hamsten, A.,
Fisher, R. M. & Yki-Jarvinen, H. (2008) Insulin regulation of MCP-1 in human adipose
tissue of obese and lean women. Am J Physiol Endocrinol Metab 294: E841-845.

345. Uematsu, S. & Akira, S. (2006) Toll-like receptors and innate immunity. J Mol Med 84:
712-725.

346. Akira, S., Uematsu, S. & Takeuchi, O. (2006) Pathogen recognition and innate
immunity. Cell 124: 783-801.

347. Kawai, T. & Akira, S. (2007) TLR signaling. Semin Immunol 19: 24-32.

348. Cario, E., Rosenberg, I. M., Brandwein, S. L., Beck, P. L., Reinecker, H. C. &
Podolsky, D. K. (2000) Lipopolysaccharide activates distinct signaling pathways in intestinal
epithelial cell lines expressing Toll-like receptors. J Immunol 164: 966-972.

349. Frantz, S., Kelly, R. A. & Bourcier, T. (2001) Role of TLR-2 in the activation of nuclear
factor kappaB by oxidative stress in cardiac myocytes. J Biol Chem 276: 5197-5203.
 81

350. Schreiner, B., Voss, J., Wischhusen, J., Dombrowski, Y., Steinle, A., Lochmuller, H.,
Dalakas, M., Melms, A. & Wiendl, H. (2006) Expression of toll-like receptors by human
muscle cells in vitro and in vivo: TLR3 is highly expressed in inflammatory and HIV
myopathies, mediates IL-8 release and up-regulation of NKG2D-ligands. Faseb J 20: 118-
120.

351. Sukkar, M. B., Xie, S., Khorasani, N. M., Kon, O. M., Stanbridge, R., Issa, R. & Chung,
K. F. (2006) Toll-like receptor 2, 3, and 4 expression and function in human airway smooth
muscle. J Allergy Clin Immunol 118: 641-648.

352. Akira, S. & Takeda, K. (2004) Toll-like receptor signalling. Nat Rev Immunol 4: 499-
511.

353. Huang, Q., Yang, J., Lin, Y., Walker, C., Cheng, J., Liu, Z. G. & Su, B. (2004)
Differential regulation of interleukin 1 receptor and Toll-like receptor signaling by MEKK3.
Nat Immunol 5: 98-103.

354. Yamamoto, M., Okamoto, T., Takeda, K., Sato, S., Sanjo, H., Uematsu, S., Saitoh, T.,
Yamamoto, N., Sakurai, H., Ishii, K. J., Yamaoka, S., Kawai, T., Matsuura, Y., Takeuchi, O.
& Akira, S. (2006) Key function for the Ubc13 E2 ubiquitin-conjugating enzyme in immune
receptor signaling. Nat Immunol 7: 962-970.

355. Kawai, T. & Akira, S. (2007) Signaling to NF-kappaB by Toll-like receptors. Trends
Mol Med 13: 460-469.

356. Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O.,
Sugiyama, M., Okabe, M., Takeda, K. & Akira, S. (2003) Role of adaptor TRIF in the
MyD88-independent toll-like receptor signaling pathway. Science 301: 640-643.

357. Kawai, T., Adachi, O., Ogawa, T., Takeda, K. & Akira, S. (1999) Unresponsiveness of
MyD88-deficient mice to endotoxin. Immunity 11: 115-122.

358. Davis, R. J. (1999) Signal transduction by the c-Jun N-terminal kinase. Biochem Soc
Symp 64: 1-12.

359. Shaulian, E. & Karin, M. (2002) AP-1 as a regulator of cell life and death. Nat Cell Biol
4: E131-136.

360. Raetz, C. R. & Whitfield, C. (2002) Lipopolysaccharide endotoxins. Annu Rev

Biochem 71: 635-700.

361. Poltorak, A., He, X., Smirnova, I., Liu, M. Y., Van Huffel, C., Du, X., Birdwell, D.,
Alejos, E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi-Castagnoli, P., Layton, B. &
Beutler, B. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations
in Tlr4 gene. Science 282: 2085-2088.

362. da Silva Correia, J., Soldau, K., Christen, U., Tobias, P. S. & Ulevitch, R. J. (2001)
Lipopolysaccharide is in close proximity to each of the proteins in its membrane receptor
complex. transfer from CD14 to TLR4 and MD-2. J Biol Chem 276: 21129-21135.
 82

363. Shimazu, R., Akashi, S., Ogata, H., Nagai, Y., Fukudome, K., Miyake, K. & Kimoto,
M. (1999) MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like
receptor 4. J Exp Med 189: 1777-1782.

364. Ulevitch, R. J. & Tobias, P. S. (1995) Receptor-dependent mechanisms of cell

stimulation by bacterial endotoxin. Annu Rev Immunol 13: 437-457.

365. Kiechl, S., Lorenz, E., Reindl, M., Wiedermann, C. J., Oberhollenzer, F., Bonora, E.,
Willeit, J. & Schwartz, D. A. (2002) Toll-like receptor 4 polymorphisms and atherogenesis.
N Engl J Med 347: 185-192.

366. Illig, T., Bongardt, F., Schopfer, A., Holle, R., Muller, S., Rathmann, W., Koenig, W.,
Meisinger, C., Wichmann, H. E. & Kolb, H. (2003) The endotoxin receptor TLR4
polymorphism is not associated with diabetes or components of the metabolic syndrome.
Diabetes 52: 2861-2864.

367. Netea, M. G., Hijmans, A., van Wissen, S., Smilde, T. J., Trip, M. D., Kullberg, B. J., de
Boo, T., Van der Meer, J. W., Kastelein, J. J. & Stalenhoef, A. F. (2004) Toll-like receptor-4
Asp299Gly polymorphism does not influence progression of atherosclerosis in patients with
familial hypercholesterolaemia. Eur J Clin Invest 34: 94-99.

368. Holloway, J. W., Yang, I. A. & Ye, S. (2005) Variation in the toll-like receptor 4 gene
and susceptibility to myocardial infarction. Pharmacogenet Genomics 15: 15-21.

369. Kolek, M. J., Carlquist, J. F., Muhlestein, J. B., Whiting, B. M., Horne, B. D., Bair, T.
L. & Anderson, J. L. (2004) Toll-like receptor 4 gene Asp299Gly polymorphism is
associated with reductions in vascular inflammation, angiographic coronary artery disease,
and clinical diabetes. Am Heart J 148: 1034-1040.

370. Edfeldt, K., Bennet, A. M., Eriksson, P., Frostegard, J., Wiman, B., Hamsten, A.,
Hansson, G. K., de Faire, U. & Yan, Z. Q. (2004) Association of hypo-responsive toll-like
receptor 4 variants with risk of myocardial infarction. Eur Heart J 25: 1447-1453.

371. Arbour, N. C., Lorenz, E., Schutte, B. C., Zabner, J., Kline, J. N., Jones, M., Frees, K.,
Watt, J. L. & Schwartz, D. A. (2000) TLR4 mutations are associated with endotoxin
hyporesponsiveness in humans. Nat Genet 25: 187-191.

372. Frost, R. A., Nystrom, G. J. & Lang, C. H. (2002) Lipopolysaccharide regulates

proinflammatory cytokine expression in mouse myoblasts and skeletal muscle. Am J Physiol
Regul Integr Comp Physiol 283: R698-709.

373. Anonymous (2003) Lipopolysaccharide and proinflammatory cytokines stimulate

interleukin-6 expression in C2C12 myoblasts: role of the Jun NH2-terminal kinase. Am J
Physiol Regul Integr Comp Physiol 285: R1153-1164.

374. Portoles, M. T., Pagani, R., Ainaga, M. J., Diaz-Laviada, I. & Municio, A. M. (1989)
Lipopolysaccharide-induced insulin resistance in monolayers of cultured hepatocytes. Br J
Exp Pathol 70: 199-205.

375. Cani, P. D., Amar, J., Iglesias, M. A., Poggi, M., Knauf, C., Bastelica, D., Neyrinck, A.
M., Fava, F., Tuohy, K. M., Chabo, C., Waget, A., Delmee, E., Cousin, B., Sulpice, T.,
Chamontin, B., Ferrieres, J., Tanti, J. F., Gibson, G. R., Casteilla, L., Delzenne, N. M.,
 83

Alessi, M. C. & Burcelin, R. (2007) Metabolic endotoxemia initiates obesity and insulin
resistance. Diabetes 56: 1761-1772.

376. Poggi, M., Bastelica, D., Gual, P., Iglesias, M. A., Gremeaux, T., Knauf, C., Peiretti, F.,
Verdier, M., Juhan-Vague, I., Tanti, J. F., Burcelin, R. & Alessi, M. C. (2007) C3H/HeJ mice
carrying a toll-like receptor 4 mutation are protected against the development of insulin
resistance in white adipose tissue in response to a high-fat diet. Diabetologia.

377. Tsukumo, D. M., Carvalho-Filho, M. A., Carvalheira, J. B., Prada, P. O., Hirabara, S.
M., Schenka, A. A., Araujo, E. P., Vassalo, J., Curi, R., Velloso, L. A. & Saad, M. J. (2007)
Loss-of-function mutation in TLR4 prevents diet-induced obesity and insulin resistance.
Diabetes.

378. Kim, F., Pham, M., Luttrell, I., Bannerman, D. D., Tupper, J., Thaler, J., Hawn, T. R.,
Raines, E. W. & Schwartz, M. W. (2007) Toll-like receptor-4 mediates vascular
inflammation and insulin resistance in diet-induced obesity. Circ Res 100: 1589-1596.

379. Wright, S. D., Burton, C., Hernandez, M., Hassing, H., Montenegro, J., Mundt, S., Patel,
S., Card, D. J., Hermanowski-Vosatka, A., Bergstrom, J. D., Sparrow, C. P., Detmers, P. A.
& Chao, Y. S. (2000) Infectious agents are not necessary for murine atherogenesis. J Exp
Med 191: 1437-1442.

380. Xu, X. H., Shah, P. K., Faure, E., Equils, O., Thomas, L., Fishbein, M. C., Luthringer,
D., Xu, X. P., Rajavashisth, T. B., Yano, J., Kaul, S. & Arditi, M. (2001) Toll-like receptor-4
is expressed by macrophages in murine and human lipid-rich atherosclerotic plaques and
upregulated by oxidized LDL. Circulation 104: 3103-3108.

381. Seong, S. Y. & Matzinger, P. (2004) Hydrophobicity: an ancient damage-associated

molecular pattern that initiates innate immune responses. Nat Rev Immunol 4: 469-478.

382. Zahringer, U., Lindner, B., Inamura, S., Heine, H. & Alexander, C. (2008) TLR2 -
promiscuous or specific? A critical re-evaluation of a receptor expressing apparent broad
specificity. Immunobiology 213: 205-224.

383. Kirschning, C. J., Wesche, H., Merrill Ayres, T. & Rothe, M. (1998) Human toll-like
receptor 2 confers responsiveness to bacterial lipopolysaccharide. J Exp Med 188: 2091-
2097.

384. Hellman, J., Tehan, M. M. & Warren, H. S. (2003) Murein lipoprotein, peptidoglycan-
associated lipoprotein, and outer membrane protein A are present in purified rough and
smooth lipopolysaccharides. J Infect Dis 188: 286-289.

385. Hirschfeld, M., Weis, J. J., Toshchakov, V., Salkowski, C. A., Cody, M. J., Ward, D. C.,
Qureshi, N., Michalek, S. M. & Vogel, S. N. (2001) Signaling by toll-like receptor 2 and 4
agonists results in differential gene expression in murine macrophages. Infect Immun 69:
1477-1482.

386. Werts, C., Tapping, R. I., Mathison, J. C., Chuang, T. H., Kravchenko, V., Saint Girons,
I., Haake, D. A., Godowski, P. J., Hayashi, F., Ozinsky, A., Underhill, D. M., Kirschning, C.
J., Wagner, H., Aderem, A., Tobias, P. S. & Ulevitch, R. J. (2001) Leptospiral
lipopolysaccharide activates cells through a TLR2-dependent mechanism. Nat Immunol 2:
346-352.
 84

387. Netea, M. G., van Deuren, M., Kullberg, B. J., Cavaillon, J. M. & Van der Meer, J. W.
(2002) Does the shape of lipid A determine the interaction of LPS with Toll-like receptors?
Trends Immunol 23: 135-139.

388. Ozinsky, A., Underhill, D. M., Fontenot, J. D., Hajjar, A. M., Smith, K. D., Wilson, C.
B., Schroeder, L. & Aderem, A. (2000) The repertoire for pattern recognition of pathogens
by the innate immune system is defined by cooperation between toll-like receptors. Proc Natl
Acad Sci U S A 97: 13766-13771.

389. Wyllie, D. H., Kiss-Toth, E., Visintin, A., Smith, S. C., Boussouf, S., Segal, D. M.,
Duff, G. W. & Dower, S. K. (2000) Evidence for an accessory protein function for Toll-like
receptor 1 in anti-bacterial responses. J Immunol 165: 7125-7132.

390. Merx, S., Neumaier, M., Wagner, H., Kirschning, C. J. & Ahmad-Nejad, P. (2007)
Characterization and investigation of single nucleotide polymorphisms and a novel TLR2
mutation in the human TLR2 gene. Hum Mol Genet 16: 1225-1232.

391. Mrabet-Dahbi, S., Dalpke, A. H., Niebuhr, M., Frey, M., Draing, C., Brand, S., Heeg,
K., Werfel, T. & Renz, H. (2008) The Toll-like receptor 2 R753Q mutation modifies
cytokine production and Toll-like receptor expression in atopic dermatitis. J Allergy Clin
Immunol 121: 1013-1019.

392. Park, Y., Park, S., Yoo, E., Kim, D. & Shin, H. (2004) Association of the polymorphism
for Toll-like receptor 2 with type 1 diabetes susceptibility. Ann N Y Acad Sci 1037: 170-
174.

393. Favre, J., Musette, P., Douin-Echinard, V., Laude, K., Henry, J. P., Arnal, J. F.,
Thuillez, C. & Richard, V. (2007) Toll-like receptors 2-deficient mice are protected against
postischemic coronary endothelial dysfunction. Arterioscler Thromb Vasc Biol 27: 1064-
1071.

394. Murakami, K., Bujo, H., Unoki, H. & Saito, Y. (2007) High fat intake induces a
population of adipocytes to co-express TLR2 and TNFalpha in mice with insulin resistance.
Biochem Biophys Res Commun 354: 727-734.

395. Aderem, A. & Ulevitch, R. J. (2000) Toll-like receptors in the induction of the innate
immune response. Nature 406: 782-787.

396. Munford, R. S. & Hall, C. L. (1986) Detoxification of bacterial lipopolysaccharides

(endotoxins) by a human neutrophil enzyme. Science 234: 203-205.

397. Kitchens, R. L., Ulevitch, R. J. & Munford, R. S. (1992) Lipopolysaccharide (LPS)

partial structures inhibit responses to LPS in a human macrophage cell line without inhibiting
LPS uptake by a CD14-mediated pathway. J Exp Med 176: 485-494.

398. Brightbill, H. D., Libraty, D. H., Krutzik, S. R., Yang, R. B., Belisle, J. T., Bleharski, J.
R., Maitland, M., Norgard, M. V., Plevy, S. E., Smale, S. T., Brennan, P. J., Bloom, B. R.,
Godowski, P. J. & Modlin, R. L. (1999) Host defense mechanisms triggered by microbial
lipoproteins through toll-like receptors. Science 285: 732-736.
 85

399. Lee, J. Y., Sohn, K. H., Rhee, S. H. & Hwang, D. (2001) Saturated fatty acids, but not
unsaturated fatty acids, induce the expression of cyclooxygenase-2 mediated through Toll-
like receptor 4. J Biol Chem 276: 16683-16689.

400. Lee, J. Y., Ye, J., Gao, Z., Youn, H. S., Lee, W. H., Zhao, L., Sizemore, N. & Hwang,
D. H. (2003) Reciprocal modulation of Toll-like receptor-4 signaling pathways involving
MyD88 and phosphatidylinositol 3-kinase/AKT by saturated and polyunsaturated fatty acids.
J Biol Chem 278: 37041-37051.

401. Nguyen, M. T., Favelyukis, S., Nguyen, A. K., Reichart, D., Scott, P. A., Jenn, A., Liu-
Bryan, R., Glass, C. K., Neels, J. G. & Olefsky, J. M. (2007) A subpopulation of
macrophages infiltrates hypertrophic adipose tissue and is activated by free fatty acids via
Toll-like receptors 2 and 4 and JNK-dependent pathways. J Biol Chem 282: 35279-35292.

402. Reyna, S. M., Ghosh, S., Tantiwong, P., Meka, C. S., Eagan, P., Jenkinson, C. P.,
Cersosimo, E., Defronzo, R. A., Coletta, D. K., Sriwijitkamol, A. & Musi, N. (2008)
Elevated TLR4 Expression and Signaling in Muscle from Insulin Resistant Subjects.
Diabetes.

403. Senn, J. J. (2006) Toll-like receptor-2 is essential for the development of palmitate-
induced insulin resistance in myotubes. J Biol Chem 281: 26865-26875.

404. Suganami, T., Tanimoto-Koyama, K., Nishida, J., Itoh, M., Yuan, X., Mizuarai, S.,
Kotani, H., Yamaoka, S., Miyake, K., Aoe, S., Kamei, Y. & Ogawa, Y. (2006) Role of the
Toll-like Receptor 4/NF-{kappa}B Pathway in Saturated Fatty Acid-induced Inflammatory
Changes in the Interaction Between Adipocytes and Macrophages. Arterioscler Thromb Vasc
Biol.

405. Lee, J. Y., Plakidas, A., Lee, W. H., Heikkinen, A., Chanmugam, P., Bray, G. & Hwang,
D. H. (2003) Differential modulation of Toll-like receptors by fatty acids: preferential
inhibition by n-3 polyunsaturated fatty acids. J Lipid Res 44: 479-486.
 86

CHAPTER 3. TLR4 DEFICIENCY SELECTIVELY PROTECTS AGAINST

OBESITY INDUCED BY DIETS HIGH IN SATURATED FAT
(Published in Obesity)

Abstract

Toll-like receptor-4 (Tlr4), a key pattern recognition receptor involved in innate

immune response, is activated by saturated fatty acids (SFAs). To investigate the

involvement of this receptor in obesity caused by consumption of diets high in fat, we

utilized male Tlr4-deficient 10ScN mice and 10J controls. Mice were fed either low fat (low-

fat control (LFC)), high unsaturated fat (high-fat control (HFC)), or high saturated fat +

palmitate (HFP) diets ad libitum for 16 weeks. Relative to the LFC diet, the HFC diet

resulted in greater epididymal fat pad weights and adipocyte hypertrophy in both Tlr4-

deficient and normal mice. However, the 10ScN mice were completely protected against the

obesigenic effects of the HFP diet. Moreover, macrophage infiltration and monocyte

chemotactic protein-1 transcript abundance were lower in adipose tissue of 10ScN mice fed

the HFP diet, and the hyperinsulinemic response was negated. Tlr4-deficient mice also had

markedly lower circulating concentration of MCP-1 and much less nuclear factor-B protein

in nuclear extracts prepared from adipose tissue, irrespective of diet. In contrast, Tlr4

deficiency did not attenuate the induction of tumor necrosis factor- or interleukin-6

expression in adipose tissue. These data indicate that Tlr4 deficiency selectively protects

against the obesigenic effects of SFA by selectively altenatings obesity-related inflammatory

responses in adipose tissue.

Introduction

Obesity is associated with chronic low-grade inflammation (1-4) that is characterized by

increased circulating concentrations of proinflammatory cytokines (5-7) and acute phase

 87

proteins (8,9), and decreased concentrations of the anti-inflammatory protein adiponectin

(10). Although the mechanisms underlying the onset and progression of this inflammatory

state remain somewhat ambiguous, two recent findings have strongly implicated the adipose

tissue itself as a major contributor. First, genetic and diet-induced obesity models have not

only shown increased expression of proinflammatory cytokines in the adipose tissue

(1,3,11,12), but also a marked adipose-specific infiltration of macrophages that show gene

expression profiles consistent with inflammation (13-15). Secondly, the adipocyte itself is

capable of mounting a classical innate immune response initiated by ligand activation of

Toll-like receptor-4 (Tlr4), followed by activation of nuclear factor-B (NFB), increases in

proinflammatory gene expression and the release of these cytokines from cultured adipocytes

(16-18). Furthermore, both Tlr2 and Tlr4 expression are increased in adipose tissue in

association with obesity and Type 2 diabetes mellitus (DM) (19).

It is clear from multiple obesity models that adipocytes and macrophages, localized in

adipose tissue, produce proinflammatory mediators, the mechanistic links among adipocyte

hypertrophy, dietary fat, inflammation, and macrophage recruitment and activation have not

been delineated. However, direct regulation of Tlr4 by certain saturated fatty acids (SFA) is

a likely component of this process because palmitate and other SFA act directly to stimulate

proinflammatory cytokine expression and NFB activation in cultured adipocytes and

macrophages (20,21). Furthermore, Suganami and colleagues (21) recently determined that

free fatty acids (FFA) released from hypertrophic adipocytes can signal macrophages through

Tlr4 and stimulate release of tumor necrosis factor (TNF). Additional studies by other

groups (20,22-24) have shown that Tlr4 deficient mice are less susceptible to fat-induced
 88

inflammation and insulin resistance, and that C3H/HeJ mice are protected against

hyperglycemia and inflammation in adipose tissue when Tlr4 signaling is blunted (22).

Although the link between a functional Tlr4 receptor and obesity-induced

inflammation in adipose tissue seems quite clear, whether this receptor contributes to the

onset and progression of obesity is controversial. Elegant in vivo studies with a Tlr4

knockout mouse model have shown blunted inflammation, yet a greater adiposity in females

(23). In contrast, Tsukomo et al. (25) recently reported evidence that a loss of function

mutation in Tlr4 protects against high fat, diet-induced obesity. Albeit, there is currently a

paucity of data that address the possibility that dietary SFA vs. unsaturated fatty acids (UFA)

influence the ability of Tlr4 to promote adipose accretion. Consequently, we used the 10ScN

mouse strain, which has a 74 kb deletion from chromosome 4 that precludes expression and

production of Tlr4, to test the hypothesis that Tlr4 specifically mediates obesity and

inflammation associated with a diet high in saturated fat.

Materials and Methods

Animals and animal care. Male Tlr4 deficient C57BL/10ScN mice (Cat No. 003752)

derived from the C57BL/10 subline and corresponding control male C57BL/10J mice (Cat

No. 000665), were obtained from Jackson Laboratories (Bar Harbor, ME) at 6-8 weeks of

age. Subsequently, lack of Tlr4 mRNA was confirmed with real time PCR. Animals were

housed individually in stainless steel wire-mesh cages at 21 C in a room with an

automatically controlled 12-hour light:dark cycle. Mice were acclimated to the environment

and provided unlimited access to food and water. Animals from each genotype were then

randomly assigned to one of three experimental diets (n = 25/genotype/diet): 1) low fat

control (LFC), high fat control (HFC), or high fat palmitate (HFP) for 16 weeks. Both high
 89

fat diets were semi-purified, powdered diets based on American Institute of Nutrition

recommendations (26) that were modified to induce obesity by providing 60% of calories

from lipid (Table 1). The high fat diets were identical except the source of fat used was either

soybean oil in the HFC (Harlan Teklad) or a mixture of lard (Harlan Teklad) and purified

palmitate (Nu-Check Prep, Inc.) in the HFP. The LFC diet contained 12% of calories from

lipid. Food intake was measured daily and used to calculate total energy intake. Mice were

fasted overnight (6-8 h) and euthanized by CO2 asphyxiation for all blood and tissue

collections. Blood was collected by heart puncture, placed on ice, and serum was collected

by centrifugation and frozen at -80oC until analyzed. Animals were weighed and abdominal

fat pads and liver were removed and weighed. All extracted tissues were immediately frozen

in liquid nitrogen and stored at -80C prior to RNA extraction and immuno-histochemical

analysis. All experimental protocols for animal care and use were approved by the

Institutional Animal Care and Use Committee at Iowa State University, Ames, IA, USA.

Analysis of Metabolic Parameters. Serum concentration of glucose (Biovision) and

insulin (Linco) were measured using commercial assay kits. Leptin, monocyte chemotactic

protein-1 (MCP-1), adiponectin (ADN), and interleukin-6 (IL-6) serum concentrations were

measured using ELISA kits (R&D Systems). Serum FFA was measured with NEFA-C

(Wako Pure Chemical Industries, Inc.) kit.

Quantitative real-time PCR. Total RNA was extracted from frozen adipose tissue

using a commercially available acid-phenol reagent (TRIzol, Invitrogen Corp.). Potential

DNase contamination was removed with DNase-freeTM (Ambion, Inc.). First-strand cDNA

was synthesized using SuperScript III First-Strand Synthesis System for RT-PCR

(Invitrogen Corp.). Primer sequences for mouse sense and anti-sense primers are listed in
 90

Table 2. Thermal cycling conditions for PCR reactions were 95C for 3 min followed by 40

cycles of 95C for 15 s, 60C for 30 s, and 72C for 30 s. Polymerase reaction products

amplified by these primers were cloned into pGEMT vector (Promega) and sequenced for

verification. Real-time reactions were carried out on an iCycler real time machine (BioRad)

using the IQTM SYBR Green Supermix kit (BioRad). The abundance of each gene product

was calculated by regressing against the standard curve generated in the same reaction with

their respective plasmid. All genes of interest were normalized to beta actin and expressed as

log starting quantity.

Immunohistochemistry. Frozen adipose tissue was fixed overnight at room

temperature in 10% zinc-formalin solution and embedded in paraffin. Five micron sections

were cut at 50 m intervals and mounted on glass slides, deparaffinized in xylene, and

stained for expression of F4/80 with monoclonal antibody (Serotec) as previously described

(14). For each mouse, four different fields were selected and adipocyte area was determined

using AxioVision v4.5.0.0 (Carl Zeiss, Germany). F4/80-positive macrophages were then

counted at 40X magnification and divided by total cell number to obtain percent F4/80-

positive cells.

Tissue and plasma fatty acid profile. Lipids from adipose and serum samples were

extracted by the method of Lepage and Roy (27) with minor modifications. Briefly, 0.5 g of

tissue was homogenized in 2.5 mL 4:1 methanol:hexane and 200 L of 3.7 mmol

heptadecanoic acid/L methanol was added to each sample as an internal standard. Fatty acid

methyl esters were analyzed by gas chromatography on a Hewlett-Packard model 6890

(Hewlett-Packard, Palo Alto, CA) fitted with an Omegawax 320 (30 m x 0.32 mm ID, 0.25

m) capillary column (Sigma-Aldrich, St Louis, MO USA). Hydrogen was the carrier gas.
 91

The temperature program ranged from 80C to 250C with a temperature rise of 5C/min.

The injector and detector temperatures were 250C and 1 L of sample was injected and run

splitless. Fatty acids were identified by their retention times on the column with respect to

appropriate standards.

EMSA and Activated NFB p65 ELISA. Adipose tissue nuclear extracts and mobility

shift assay were prepared and validated as previously described (16). The consensus NF-B

oligonucleotides (Santa Cruz) were end-labeled with [-32P]ATP (PerkinElmer) using T4

polynucleotide kinase (Santa Cruz). Binding of nuclear proteins to the labeled probe was

done by incubating 50 g nuclear proteins with 50,000 cpm of labeled probe for 30 min at

room temperature in a binding buffer [2 mM HEPES, 50 mM KCl, 2 mM EDTA, 10%

glycerol, and 1% BSA (wt/vol)] in the presence of 2 g poly(dI-dC) (Sigma) in a final

reaction volume of 40 L. For quantitative NFB p65 DNA binding, 10g of nuclear protein

was assayed for the presence of activated p65 by ELISA using antibodies specific for

activated p65 following binding to NFB consensus sequence (TransAM Active Motif).

Statistical analyses. Data were tested for normality and analyzed using the mixed-

model analysis with diet and genotype considered fixed effects, and the time dietary

treatments were implemented for subgroups as a random effect. Significant interactions of

main effects are indicated as Diet*Genotype effects. All indicated P-values were two-tailed

and Bonferroni corrected. Differences were considered significant at P < 0.05 and a tendency

at P < 0.10. Values are presented as least squares (LS) means SEM.

Results

Tlr4 deficiency protects mice from increased adiposity caused by consumption of a

diet high in saturated fat, without reducing caloric intake. We examined whether the fatty
 92

acid composition of the diet influenced the obesigenic effect of high fat diets in male Tlr4

mutant (10ScN) and normal (10J) mice. Regardless of diet, 10ScN mice weighed on average

3.8 g less than 10J mice after 16 weeks on the experimental diets (Genotype, P<0.0001,

Figure 3A). Furthermore, the HFC diet increased body weight in both genotypes (Diet,

P<0.0001), but average weekly energy intake (Figure 3B) was reduced by the HFC diet

(Diet, P<0.0001). Additionally, epididymal fat pad weight was increased by the HFC diet in

both genotypes. However, only the mice lacking Tlr4 were protected against the obesigenic

effect of the HFP diet (Figure 3C, Diet*Genotype, P=0.05). Similar results were obtained for

epididymal adipocyte size (Figure 3D) in that all mice fed the HFC diet had larger cells, but

only the normal strain fed the HFP diet had enlarged cells vs. the LFC (Diet*Genotype,

P=0.05).

To confirm diet-induced changes in fatty acid profiles of epididymal adipose tissue,

we measured SFA, n-3, and n-6 fatty acid contents (Table 3). As expected, relative to the

LFC and HFP diets, both palmitate and total SFA were reduced in mice fed the HFC diet

(Diet, P<0.002), and n-3 fatty acids (docosahexaenoic acid and eicosapentaenoic acid) were

lower in mice fed the HFP diet (Diet, P<0.002). Furthermore, the n-6 fatty acid content was

higher in mutant mice (Genotype, P<0.005) and was also reduced by the HFP diet (Diet,

P<0.03). However, the effects of diet and genotype on n-3 and n-6 fatty acid contents were

not sufficient to alter the n-6 to n-3 ratio in this particular adipose depot.

Tlr4 deficiency improved markers of insulin sensitivity and inflammation. To gain

insight into the effect of high fat intake on insulin sensitivity in Tlr4 deficient mice, we

measured fasting serum glucose (Figure 4A) and insulin (Figure 4B) following 16 weeks on

experimental diets. Glucose concentrations were lower in the mutant strain (Genotype,
 93

P=0.0068), and were reduced in both genotypes fed either high fat diet (Diet, P=0.0014).

Insulin concentrations were also lower in Tlr4 mutant mice (Genotype, P<0.0001).

Alternatively, the HFC diet nearly doubled serum insulin in these mice, but this response

only approached significance (Diet, P=0.111), and there was no effect on the normal strain

(Diet*Genotype, P=0.15). However, these differences resulted in lower glucose to insulin

ratios (GIR) in mutant mice fed the HFC diet as compared with the LFC or HFP diets, and

the normal 10J mice had similar GIR, regardless of diet (Diet*Genotype, P=0.028).

We then measured several markers of inflammation that have been associated with

obesity. The serum concentration of leptin was greater in all mice fed the HFC diet (Diet,

P=0.0004, Figure 4D), and serum adiponectin was lower in the mutant strain (Genotype,

P=0.043, Figure 4E). Additionally, the HFC diet increased serum adiponectin relative to the

control and HFP diets, but only in the mutant strain (Genotype*Diet, P=0.031). Serum MCP-

1 was seven-fold higher in 10J vs. mutant mice (Genotype, P<0.0001, Figure 4F), but was

not influenced by diet in either genotype.

Obesity-induced inflammation in adipose tissue was differentially regulated by

dietary SFA vs. UFA, and was partly ameliorated by Tlr4 deficiency. To determine if

inflammatory markers were related to changes in adipose tissue, we quantified macrophage

infiltration and measured several inflammatory markers in adipose tissue. The percentage of

F4/80-positive cells (i.e., macrophages) in adipose tissue of 10J control mice was greater in

mice fed either HF diet (Diet P<0.0001, Figure 5A). Alternatively, Tlr4 deficiency

attenuated the SFA-induced, but not HFC-mediated, macrophage accumulation in 10ScN

mice (Genotype*Diet interaction P=0.0002). Furthermore, the greater percentage of F4/80

 94

positive cells was associated with the formation of distinct crown-like structures (CLS)

(Figure 4B).

We then examined the mRNA abundance of selected proinflammatory chemokines

and cytokines. MCP-1 expression was increased in the epididymal adipose tissue of 10J mice

fed the high fat diets (Genotype*Diet, P=0.021, Figure 6A). There was also a trend for

increased CCR2 transcript abundance in mice fed either HF diet (Diet, P=0.089, Figure 6B).

Expression of the proinflammatory cytokines, TNF (Figure 6C) and IL-6 (Figure 6D), were

increased by over 2- and 3-fold in adipose tissue of mice fed the HFP diet (Diet, P=0.013 and

P<0.0001, respectively). Furthermore, the magnitude of the increase in IL-6 was greater in

mutant vs. normal mice fed the HFP diet (Genotype*Diet, P=0.074). Tlr2 expression was

increased over 2-fold with diet-induced obesity, irrespective of genotype (Diet Effect,

P=0.035, Figure 6E).

To determine if the proinflammatory transcription factor NFB may be involved in

adipose-specific inflammation, we utilized electrophoretic mobility shift assays as a

qualitative assessment of NFB translocation. There was a marked reduction in the nuclear

localization of NFB in Tlr4-deficient mice regardless of diet (Figure 7A). Similar

quantitative results were obtained using a NFB p65 DNA binding ELISA, which indicated

adipose tissue nuclear NFB concentration in mutant mice was 50% less than that in 10J

mice (Genotype, P=0.0015, Figure 7B).

Discussion

The data presented herein establish a novel relationship between obesity and Tlr4.

The absence of a functional Tlr4 due to the 74 kb deletion on chromosome 4 in the 10ScN

strain selectively protects against the obesigenic effect of a diet high in SFA, but not that of
 95

an isocaloric diet high in UFA in male 10ScN mice. Although we did not quantify total body

fat mass in this study, adipocyte size mirrored epididymal fat pad weights, and thus reinforce

our conclusion that the absence of Tlr4 protected against diet-induced obesity (DIO), but

only when the diet was based on SFA. It is also important to note that this resistance to

adipocyte hypertrophy occurred without a corresponding reduction in energy consumption,

and is thus of metabolic origin, rather than a simple limitation in energy intake. These

findings may implicate energy expenditure, and this possibility and potential underlying

mechanisms are currently under investigation. Additionally, it is intriguing that recent

findings indicated that the gut microbial population influences adipose accretion through

effects on energy availability and regulation of the fasting-induced adipocyte factor (Fiaf).

The Fiaf protein is a circulating lipoprotein lipase inhibitor expressed by the intestinal

epithelium and adipocyte, and knockout models have shown that the absence of Fiaf

protected against over accumulation of adipose tissue caused by introduction of a normal

microbiota in germ-free mice (28). Consequently, it seems possible that the absence of Tlr4

precludes changes in the gut microbiota in response to SFA that would alter Fiaf expression

and thereby influence triglyceride storage in adipocytes.

Recent reports (22-25) have indicated mixed results with regards to DIO in Tlr4

mutant or knockout mice. Our results are consistent with those of Tsukumo et al. (25), who

also used males, but from the C3H/HeJ model. In contrast, Shi et al. (23) used females from

a Tlr4 knockout model backcrossed with C57BL6J for six generations, and determined that

these mice succumbed to DIO when fed a high-fat diet containing lard. Furthermore, Poggi et

al. (24) reported heavier epididymal adipose weights and adipocyte hypertrophy in male

C3H/HeJ mice consuming a high fat diet based on anhydrous milk fat, which likely varies
 96

considerably in fatty acid composition. Although the mechanisms underlying these disparate

results are not yet apparent, Tsukumo et al. (25) suggested that metabolic and physiologic

differences relating to strain and background are likely to be important factors, and our data

clearly indicate a strong linkage between Tlr4 function, dietary fat source, and DIO. Equally

important, Cani et al. (29) provided convincing evidence that mice consuming a high fat diet

containing both corn oil and lard had increased circulating concentration of bacterial

lipopolysaccharide that triggered obesity and inflammation. Because mice lacking the CD14

co-receptor for Tlr4, which precludes formation of a functional Tlr4 complex, were resistant

to this phenomenon, these researchers suggested that endotoxemia facilitated by dietary fat

intake largely mediates the effects of a high fat diet on obesity and inflammation via a Tlr4-

mediated signaling pathway. Collectively, the data substantiate the possibility that SFA

promote obesity post-absorptively by direct activation of Tlr4, and (or) promote the uptake of

gut-derived endotoxin, which also activates Tlr4 signaling. Consequently, it will be of

utmost importance in the future to establish the effects of specific Tlr4 mutations and

knockout models on obesity with respect to specific dietary fat sources and fatty acid

profiles.

Chronic inflammation in adipose tissue is a co-morbidity of obesity that is strongly

associated with the onset and progression of insulin resistance, and ultimately the transition

to frank diabetes. We have shown previously that treating cultured adipocytes with palmitate

results in activation of NFB and proinflammatory cytokine expression and release into the

culture media (30). Furthermore, using in vivo and in vitro experiments, Shi et al. (23)

determined that a functional Tlr4 is a requisite component of the proinflammatory effects of

palmitate or SFA on adipocytes. With respect to the present data, several points are notable.
 97

First of all, the only inflammatory marker attenuated by the absence of Tlr4 was MCP-1.

Whereas the high fat diets, irrespective of whether saturated or unsaturated in composition,

resulted in increased MCP-1 expression in epididymal adipose tissue of normal mice, neither

diet altered expression in mutant mice. Furthermore, the expression of both IL-6 and TNF

were markedly increased by the HFP diet, irrespective of genotype, and chemokine (C-C

motif) receptor 2 (CCR2) expression was increased by the high fat diets in both genotypes.

These results indicate not only that some inflammatory responses to high fat diets may be

mediated independently of Tlr4, at least at the mRNA level, but also that some responses to

high fat intake occur whether the fat is comprised predominantly of SFA or UFA. It should

also be noted that even in the absence of epididymal adipose expansion and adipocyte

hypertrophy in the mutant mice fed the HFP diet, both IL-6 and TNF expression were

increased. This possibly indicated a metabolic component to the proinflammatory effects of

saturated fatty acids in adipocytes, as we have suggested previously, because inhibition of

fatty acyl Co-A synthase attenuates the activation of NFB by palmitate, but exacerbates IL-

6 release into the culture media (30). Finally, the absence of a functional Tlr4 not only

precluded the adipocyte hypertrophy in mice fed the HFP diet, but also blocked infiltration of

adipose tissue with macrophages. This is consistent with the hypothesis that it is adipocyte

hypertrophy that ultimately signals macrophage recruitment, and it is clear that this response

does not depend on a functional Tlr4.

The serum MCP-1 and adipose NFB data show a striking effect of genotype in that

both were markedly depressed in the mutant mice, and were largely unresponsive to diet.

Although serum MCP-1 concentration was barely measurable in mutant mice, MCP-1

adipose tissue expression differed little from that of normal mice. This perhaps indicated
 98

that adipose tissue contributed little to circulating MCP-1 in these mice, but we cannot

discount the possibility that the adipose concentration was sufficient to be of physiological

significance. In regard to nuclear localization of adipose NFB, both qualitative and

quantitative assessments indicated that the nuclear content of this important transcription

factor is significantly lower in mutant vs. normal mice with little effect of diet. We have

shown previously that the transcriptional activity of NFB in adipocytes can be uncoupled

from proinflammatory cytokine responses (30), but it is perhaps important that Shi et al. (23)

noted a marked effect of dietary fat on NFB activity in a knockout model.

In summary, our study indicated that the Tlr4 mutation in male 10ScN mice

selectively blocked SFA-induced obesity, and that this response was associated with an

absence of adipose infiltration with macrophages and improved markers of insulin sensitivity

as reflected in the lower ratios of glucose to insulin. These results point to a unique

relationship between Tlr4 and saturated fatty acids, and underscore the potential for

interactions between specific dietary fatty acids and Tlr4 mutations to impact the

development of obesity and the associated inflammation.

Acknowledgements

This work was supported by a grant from the Center for Designing Foods to Improve

Nutrition (CDFIN), and Nutrition and Wellness Research Center at Iowa State University.

References

1. Greenberg, A. S. & Obin, M. S. (2006) Obesity and the role of adipose tissue in
inflammation and metabolism. Am J Clin Nutr 83: 461S-465S.

2. Neels, J. G. & Olefsky, J. M. (2006) Inflamed fat: what starts the fire? J Clin Invest 116:
33-35.
 99

3. Wellen, K. E. & Hotamisligil, G. S. (2003) Obesity-induced inflammatory changes in

adipose tissue. J Clin Invest 112: 1785-1788.

4. Anonymous (2005) Inflammation, stress, and diabetes. J Clin Invest 115: 1111-1119.

5. Hotamisligil, G. S., Shargill, N. S. & Spiegelman, B. M. (1993) Adipose expression of

tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science
259: 87-91.

6. Mantzoros, C. S., Moschos, S., Avramopoulos, I., Kaklamani, V., Liolios, A.,
Doulgerakis, D. E., Griveas, I., Katsilambros, N. & Flier, J. S. (1997) Leptin
concentrations in relation to body mass index and the tumor necrosis factor-alpha
system in humans. J Clin Endocrinol Metab 82: 3408-3413.

7. Roytblat, L., Rachinsky, M., Fisher, A., Greemberg, L., Shapira, Y., Douvdevani, A. &
Gelman, S. (2000) Raised interleukin-6 levels in obese patients. Obes Res 8: 673-675.

8. Bluher, M., Fasshauer, M., Tonjes, A., Kratzsch, J., Schon, M. R. & Paschke, R. (2005)
Association of interleukin-6, C-reactive protein, interleukin-10 and adiponectin
plasma concentrations with measures of obesity, insulin sensitivity and glucose
metabolism. Exp Clin Endocrinol Diabetes 113: 534-537.

9. Shimomura, I., Funahashi, T., Takahashi, M., Maeda, K., Kotani, K., Nakamura, T.,
Yamashita, S., Miura, M., Fukuda, Y. et al. (1996) Enhanced expression of PAI-1 in
visceral fat: possible contributor to vascular disease in obesity. Nat Med 2: 800-803.

10. Pietilainen, K. H., Kannisto, K., Korsheninnikova, E., Rissanen, A., Kaprio, J.,
Ehrenborg, E., Hamsten, A. & Yki-Jarvinen, H. (2006) Acquired obesity increases
CD68 and tumor necrosis factor-alpha and decreases adiponectin gene expression in
adipose tissue: a study in monozygotic twins. J Clin Endocrinol Metab 91: 2776-
2781.

11. Trayhurn, P. (2005) Adipose tissue in obesity--an inflammatory issue. Endocrinology

146: 1003-1005.

12. Juge-Aubry, C. E., Somm, E., Giusti, V., Pernin, A., Chicheportiche, R., Verdumo, C.,
Rohner-Jeanrenaud, F., Burger, D., Dayer, J. M. & Meier, C. A. (2003) Adipose
tissue is a major source of interleukin-1 receptor antagonist: upregulation in obesity
and inflammation. Diabetes 52: 1104-1110.

13. Cinti, S., Mitchell, G., Barbatelli, G., Murano, I., Ceresi, E., Faloia, E., Wang, S., Fortier,
M., Greenberg, A. S. & Obin, M. S. (2005) Adipocyte death defines macrophage
localization and function in adipose tissue of obese mice and humans. J Lipid Res 46:
2347-2355.
 100

14. Xu, H., Barnes, G. T., Yang, Q., Tan, G., Yang, D., Chou, C. J., Sole, J., Nichols, A.,
Ross, J. S. et al. (2003) Chronic inflammation in fat plays a crucial role in the
development of obesity-related insulin resistance. J Clin Invest 112: 1821-1830.

15. Weisberg, S. P., McCann, D., Desai, M., Rosenbaum, M., Leibel, R. L. & Ferrante, A.
W., Jr. (2003) Obesity is associated with macrophage accumulation in adipose tissue.
J Clin Invest 112: 1796-1808.

16. Ajuwon, K. M., Jacobi, S. K., Kuske, J. L. & Spurlock, M. E. (2004) Interleukin-6 and
interleukin-15 are selectively regulated by lipopolysaccharide and interferon-gamma
in primary pig adipocytes. Am J Physiol Regul Integr Comp Physiol 286: R547-553.

17. Ajuwon, K. M. & Spurlock, M. E. (2005) Adiponectin inhibits LPS-induced NF-kappaB

activation and IL-6 production and increases PPARgamma2 expression in adipocytes.
Am J Physiol Regul Integr Comp Physiol 288: R1220-1225.

18. Lin, Y., Lee, H., Berg, A. H., Lisanti, M. P., Shapiro, L. & Scherer, P. E. (2000) The
lipopolysaccharide-activated toll-like receptor (TLR)-4 induces synthesis of the
closely related receptor TLR2 in adipocytes. J Biol Chem 275: 24255-24263.

19. Creely, S. J., McTernan, P. G., Kusminski, C. M., Fisher, F. M., Khanolkar, M., Evans,
M., Harte, A. L. & Kumar, S. (2006) Lipopolysaccharide activates an innate immune
system response in human adipose tissue in obesity and type 2 diabetes. Am J Physiol
Endocrinol Metab.

20. Song, M. J., Kim, K. H., Yoon, J. M. & Kim, J. B. (2006) Activation of Toll-like receptor
4 is associated with insulin resistance in adipocytes. Biochem Biophys Res Commun
346: 739-745.

21. Suganami, T., Tanimoto-Koyama, K., Nishida, J., Itoh, M., Yuan, X., Mizuarai, S.,
Kotani, H., Yamaoka, S., Miyake, K. et al. (2006) Role of the Toll-like Receptor
4/NF-{kappa}B Pathway in Saturated Fatty Acid-induced Inflammatory Changes in
the Interaction Between Adipocytes and Macrophages. Arterioscler Thromb Vasc
Biol.

22. Suganami, T., Mieda, T., Itoh, M., Shimoda, Y., Kamei, Y. & Ogawa, Y. (2007)
Attenuation of obesity-induced adipose tissue inflammation in C3H/HeJ mice
carrying a Toll-like receptor 4 mutation. Biochem Biophys Res Commun.

23. Shi, H., Kokoeva, M. V., Inouye, K., Tzameli, I., Yin, H. & Flier, J. S. (2006) TLR4 links
innate immunity and fatty acid-induced insulin resistance. J Clin Invest 116: 3015-
3025.

24. Poggi, M., Bastelica, D., Gual, P., Iglesias, M. A., Gremeaux, T., Knauf, C., Peiretti, F.,
Verdier, M., Juhan-Vague, I. et al. (2007) C3H/HeJ mice carrying a toll-like receptor
 101

4 mutation are protected against the development of insulin resistance in white

adipose tissue in response to a high-fat diet. Diabetologia.

25. Tsukumo, D. M., Carvalho-Filho, M. A., Carvalheira, J. B., Prada, P. O., Hirabara, S. M.,
Schenka, A. A., Araujo, E. P., Vassalo, J., Curi, R. et al. (2007) Loss-of-function
mutation in TLR4 prevents diet-induced obesity and insulin resistance. Diabetes.

26. Reeves, P. G., Nielsen, F. H. & Fahey, G. C., Jr. (1993) AIN-93 purified diets for
laboratory rodents: final report of the American Institute of Nutrition ad hoc writing
committee on the reformulation of the AIN-76A rodent diet. J Nutr 123: 1939-1951.

27. Lepage, G. & Roy, C. C. (1986) Direct transesterification of all classes of lipids in a one-
step reaction. J Lipid Res 27: 114-120.

28. Backhed, F., Ding, H., Wang, T., Hooper, L. V., Koh, G. Y., Nagy, A., Semenkovich, C.
F. & Gordon, J. I. (2004) The gut microbiota as an environmental factor that regulates
fat storage. Proc Natl Acad Sci U S A 101: 15718-15723.

29. Cani, P. D., Amar, J., Iglesias, M. A., Poggi, M., Knauf, C., Bastelica, D., Neyrinck, A.
M., Fava, F., Tuohy, K. M. et al. (2007) Metabolic endotoxemia initiates obesity and
insulin resistance. Diabetes 56: 1761-1772.

30. Ajuwon, K. M. & Spurlock, M. E. (2005) Palmitate activates the NF-kappaB

transcription factor and induces IL-6 and TNFalpha expression in 3T3-L1 adipocytes.
J Nutr 135: 1841-1846.
 102

Table 1. Diet Composition

Ingredient Low-Fat Control (LFC)1 High-Fat Control (HFC)1 High-Fat Palmitate (HFP)1
________________________ g/kg_______________________________
Casein2 140 196 196
Sucrose2 100 100 100
Corn Starch2 455.692 88.192 88.192
Maltodextrin2 155 155 155
Soybean Oil2 50 360
Saturated 7.2 51.9
Palmitate 5.2 37.1
MUFA 11.7 83.9
PUFA 28.9 208.1
Lard2 235
Saturated 92.2
Palmitate 55.9
MUFA 106
PUFA 26.4
Palmitate3 125
Cholesterol2 1.5 1.5
Cellulose2 50 50 50
Vitamin Mix2 10 10 10
Mineral Mix2 35 35 35
Choline Bitartrate2 2.5 2.5 2.5
L-Cysteine2 1.8 1.8 1.8
THBQ2 0.008 0.008 0.008
Total (g) 1000 1000 1000
Protein (kcal) 567.2 791.2 791.2
CHO (kcal) 2842.768 1372.768 1372.768
Fat (kcal) 450 3240 3240
Saturated (kcal) 64.8 467.1 1954.8
Palmitate (kcal) 46.8 333.9 1628.1
MUFA (kcal) 105.3 755.1 954
PUFA (kcal) 260.1 1872.9 237.6
Density (kcal/g) 3.86 5.40 5.40
1.
2. Adapted from AIN-93M Diet
Harlan Teklad, Madison, WI"
3.
Nu-Check Prep, Inc., Elysian, MN"
 103

Table 2. Primer Sequences for Quantitative Real-Time Polymerase Chain Reaction

Target Forward Primer Reverse Primer

Beta-Actin TGAGAGGGAAATCGTGCGTGACAT ACCGCTCGTTGCCAATAGTGATGA

Toll-like receptor-4 CCGCTCTGGCATCATCTTCATTGT TCCTCCCATTCCAGGTAGGTGTTT
Toll-like receptor-2 TCCCTTGACATCAGCAGGAACACT GCAGCCGAGGCAAGAACAAAGAA
Monocyte CCAAGAAGGAATGGGTCCAGACAT ACAGAAGTGCTTGAGGTGGTTGTG
Chemoattractant Protein-1
Chemokine (C-C Motif) ACTGCATCTGCCCTAAGGTCTTCA GAAGTGCTTGAGGTGGTTGTGGAA
Receptor 2
Tumor necrosis factor- CCAACGGCATGGATCTCAAAGACA AGATAGCAAATCGGCTGACGGTGT
Interleukin-6 TCCAGTTGCCTTCTTGGGACTGAT AGCCTCCGACTTGTGAAGTGGTAT
 104

Table 3. Adipose tissue fatty acid profiles in normal and Tlr4 mutant mice fed low fat
control, high fat control, and high fat-palmitate diets for 16 weeks
Diet Genotype n Palmitate SFA n3 FA n6 FA n6:n3 Ratio

________________________g/100g________________________
LFCa 10ScN 6 31.35 3.47 33.68 3.38 0.49 1.00 41.56 6.19 60.40 28.22
HFCa 10ScN 6 18.10 3.22 19.84 3.16 2.23 0.98 49.51 5.58 77.63 27.05
HFPa 10ScN 6 28.45 3.18 30.61 3.10 n.d. 36.59 5.63 85.99 26.36
LFCa 10J 6 24.02 2.94 26.53 2.88 2.17 0.95 31.05 5.18 27.88 24.67
HFCa 10J 6 17.64 3.13 19.75 3.06 2.16 0.96 32.42 5.57 66.68 25.77
HFPa 10J 6 29.76 3.19 32.15 3.12 0.53 0.99 15.18 5.53 35.62 26.92

Main Effects
Genotype P = 0.48 P = 0.52 P = 0.18 P = 0.0055 P = 0.48
Diet P = 0.0026 P = 0.0014 P = 0.0025 P = 0.033 P = 0.21

Interaction
Diet*Genotype P = 0.32 P = 0.29 P = 0.22 P = 0.61 P = 0.67
a
Low Fat Control (LFC), High Fat Control (HFC), and High Fat Palmitate (HFP) diets
 105

Figure 3. Tlr4 deficiency protects mice from increased adiposity due to consumption of a
diet high in saturated fat.
All measures were taken after 16 weeks on experimental diets (n = 25 unless noted
otherwise). (A) Body weight of 10ScN (white bars) and 10J (black bars) mice (Diet effect
P<0.0001, Genotype effect, P<0.0001, Diet*Genotype interaction P=0.84). (B) Average
weekly energy intake (kcal/week) of 10ScN and 10J mice (Diet effect P<0.0001, Genotype
effect P=0.34, Diet*Genotype interaction P=0.94). (C) Epididymal fat pad weight of 10ScN
and 10J mice (Diet effect P<0.0001, Genotype effect P<0.0001, Diet*Genotype interaction
P=0.058). (D) Adipocyte size (m2) of 10ScN and 10J mice (n = 6, Diet effect P=0.0079,
Genotype effect P<0.0001, Diet*Genotype interaction P=0.052). All displayed values
represent LS means SEM for Diet*Genotype interaction. When interaction term was
P<0.15, Bonferroni correction was used to determine significant difference between means as
indicated by different letters. Significant main effects (Genotype and Diet) were also
indicated by * (Genotype effect) and # (Diet effect) over LS means.
 106

Figure 4. Tlr4 deficiency improved markers of insulin sensitivity and inflammation in mice
fed a diet high in saturated fat.

All measures were taken after 16 weeks on experimental diets (n = 10 unless noted
otherwise). (A) Serum glucose (Diet effect P=0.0014, Genotype effect P=0.0068,
Diet*Genotype interaction P=0.57), (B) serum insulin (Diet effect P=0.111, Genotype effect
P<0.0001, Diet*Genotype interaction P=0.15), (C) glucose to insulin ratio (Diet effect
P=0.038, Genotype effect P<0.0001, Diet*Genotype interaction P=0.028), (D) serum leptin
(Diet effect P=0.0004, Genotype effect P=0.50, Diet*Genotype interaction P=0.15), (E)
serum adiponectin (Diet effect P=0.25, Genotype effect P=0.043, Diet*Genotype interaction
P=0.11), and (F) serum MCP-1 (Diet effect P=0.96, Genotype effect P<0.0001,
Diet*Genotype interaction P=0.78) were measured in 10ScN (white bars) and 10J (black
bars) mice following 16 weeks on diet. All displayed values represent LS means SEM for
Diet*Genotype interaction. When interaction term was P<0.15, Bonferroni correction was
used to determine significant difference between means as indicated by different letters.
Significant main effects (genotype and diet) were also indicated by * (genotype effect) and #
(diet effect) over LS means.
 107

Figure 5. Accumulation of F4/80-positive macrophages is attenuated in adipose tissue of

high Tlr4 deficient (10ScN) mice fed the HFP diet.

Five micron sections were cut at 50m intervals and mounted on glass slides, deparaffinized
in xylene, and stained for expression of F4/80 with monoclonal antibody. Adipose sections
were visualized under 40X magnification. (A) Percent F4/80 positive cells (n = 5, genotype
effect P=0.65, diet effect P=0<0.0001, genotype*diet interaction P=0.0002), were measured
in 10ScN (white bars) and 10J (black bars) mice following 16 weeks on diet. All displayed
values represent LS means SEM for Diet*Genotype interaction. When interaction term was
P<0.15, Bonferroni correction was used to determine significant difference between means as
indicated by different letters. Significant main effects (genotype and diet) were also indicated
by * (genotype effect) and # (diet effect) over LS means.
(B) Representative images from 10ScN and 10J mice fed low fat (LFC), high fat (HFC), or
HFP diet.
 108

Figure 6. Adipose tissue inflammatory gene expression in Tlr4 deficient (10ScN) mice is
differentially regulated in response to the HFP diet.

All measures were taken after 16 weeks on experimental diets (n = 6 unless noted otherwise).
(A) MCP-1 (Diet effect P=0.70, Genotype effect P=0.31, Diet*Genotype interaction
P=0.021), (B) CCR2 (Diet effect P=0.089, Genotype effect P=0.33, Diet*Genotype
interaction P=0.35), (C) TNF (Diet effect P=0. 013, Genotype effect P=0.56,
Diet*Genotype interaction P=0.93), (D) IL-6 (Diet effect P<0.0001, Genotype effect P=0.98,
Diet*Genotype interaction P=0.074), and (E) Tlr2 (Diet effect P=0. 035, Genotype effect
P=0.45, Diet*Genotype interaction P=0.65) were measured in 10ScN (white bars) and 10J
(black bars) mice following 16 weeks on diet. All displayed values represent LS means
SEM for Diet*Genotype interaction. When interaction term was P<0.15, Bonferroni
correction was used to determine significant difference between means as indicated by
different letters. Significant main effects (genotype and diet) were also indicated by *
(genotype effect) and # (diet effect) over LS means.
 109

Figure 7. Tlr4 deficiency attenuates NFB activation in adipose tissue of Tlr4 deficient
(10ScN) mice.
Animals were fasted 6-8h and epididymal fat pad was collected. Nuclear extracts were
obtained from adipose tissue and subsequently used for (A) NFB EMSA, each lane
represents an individual sample (n = 2). (B) NFB p65 DNA binding ELISA. Nuclear
extracts were used to quantify NFB DNA binding; 10ScN (white bars) and 10J (black bars)
(n = 4, Diet effect P=0.39, Genotype effect P=0.0015, Diet*Genotype interaction P=0.43).
All displayed values represent LS means SEM for Diet*Genotype interaction. When
interaction term was P<0.15, Bonferroni correction was used to determine significant
difference between means as indicated by different letters. Significant main effects (genotype
and diet) were also indicated by * (genotype effect) and # (diet effect) over LS means.
 110

CHAPTER 4. THE C-JUN N-TERMINAL KINASE MEDIATES THE INDUCTION

OF OXIDATIVE STRESS AND INSULIN RESISTANCE BY PALMITATE AND
TOLL-LIKE RECEPTOR 2 AND 4 LIGANDS IN 3T3-L1 ADIPOCYTES
(Submitted to Hormone & Metabolic Research)

Abstract

Saturated fatty acids (SFAs) are known to induce inflammation and insulin resistance

in adipocytes through toll-like receptor-4 (Tlr4) signaling, but the mechanisms are not well

delineated. Furthermore, the potential roles of Tlr2 and the c-jun N-terminal kinase (JNK) in

inflammation in adipocytes have not been investigated. We demonstrated that palmitate,

lipopolysaccharide (LPS), and the toll-like receptor-2 (Tlr2) agonist, zymosan A (ZymA),

induced insulin resistance in a time-and dose-dependent manner in 3T3-L1 adipocytes.

Corresponding with the reduction of insulin sensitivity was an increased expression of IL-6,

as well as activation of the proinflammatory transcription factors, nuclear factor kappa B

(NFB) and activator protein-1 (AP-1). Reactive oxygen species (ROS) accumulation was

also observed in palmitate and Tlr agonist treated adipocytes. The JNK inhibitor, SP600125,

attenuated insulin resistance mediated by SFA and Tlr agonists, which corresponded with a

diminished proinflammatory response and reduced ROS accumulation. Collectively, these

results demonstrated Tlr2 involvement in adipocyte inflammation and therefore implicated

the receptor as a potential target for SFA. Moreover, activation of JNK also appeared to be

essential to Tlr2-, as well as Tlr4-, induced insulin resistance and oxidative stress.

Introduction

Adipose tissue (AT) from obese individuals shows activation of several distinct

inflammatory pathways, including those of NFB and JNK (1,2). These proinflammatory

signals stimulate production of cytokines and chemokines, including interleukin-6 (IL-6) and
 111

monocyte chemotactic protein-1 (MCP-1), and thereby contribute to the systemic

inflammation common in obesity (3,4). Importantly, obesity-induced inflammation in

humans is associated with insulin resistance and an increased risk of diabetes mellitus (DM)

(1,2,5). These strong associations between obesity, inflammation, and insulin resistance

implicate the adipocyte as an important link in the development of DM.

Saturated fatty acids (SFA) activate inflammatory pathways and cause insulin resistance in

myocytes (6-9), macrophages (10), and adipocytes (11). Furthermore, increased lipolytic

rates in hypertrophied adipocytes result in greater release of non-esterified fatty acids

(NEFAs), which can augment the inflammatory response of AT through the activation of

neighboring macrophages and adipocytes (10). NEFAs are also implicated in the production

of ROS and the ensuing oxidative stress (12). In the obese state, this increased flux of NEFA

stimulates ROS production, which leads to impaired insulin signaling (13,14).

The molecular mechanisms involved in NEFA-induced inflammation, oxidative

stress, and insulin resistance may involve several distinct pathways. In primary myocytes

and hepatocytes, NFB and AP-1 signaling are critical (9,15). Tlr4 activation was also

implicated in SFA-induced inflammation and insulin resistance (3,16-20). LPS, a potent

ligand for Tlr4, induces inflammation through JNK/AP-1 and NFB signaling pathways in

several cell types (21-25). Recently, Shi and colleagues (3) reported an attenuation of lipid-

induced NFB activation and insulin resistance in AT of Tlr4 knockout mice. Several

additional studies (18,19,26,27) have confirmed that Tlr4 deficiency protects animals from

obesity-induced inflammation and insulin resistance. Moreover, we recently demonstrated

that Tlr4 deficient 10ScN mice, were specifically protected from SFA-induced adiposity and

that they have reduced macrophage accumulation in AT (28). In contrast, the pro-
 112

inflammatory cytokines IL-6 and TNF were elevated in AT of 10ScN mice fed the same

SFA-diet. These data suggest that whereas Tlr4 signaling plays a considerable role in SFA-

induced inflammation and adiposity, pro-inflammatory pathways independent of Tlr4 must

also exist.

Like Tlr4, the Tlr2 receptor is increased in AT of obese and diabetic individuals

(22,29). Adipocytes of mice fed a high fat diet have greater expression of this pattern

recognition receptor (30). It is known that SFA signal through Tlr2 and activate IKK/NFB

and JNK/AP-1 pathways in myotubes and epithelial cells, respectively (31-33). Additionally,

Senn (31) reported that palmitate-induced insulin resistance in C2C12 myotubes is attenuated

when Tlr2 signaling is blocked by either siRNA or a neutralizing antibody. ROS

accumulation after vascular injury is also blunted in Tlr2 knockout mice (34). Thus,

considering the recognized involvement of Tlr2 in oxidative stress and insulin resistance in

multiple cell types, we hypothesized that Tlr2 agonists Zymosan A (ZymA) and palmitate

would activate inflammatory signaling in the adipocyte and thereby promote inflammation,

oxidative stress, and insulin resistance as observed in obesity.

The data presented herein indicated clearly that ZymA and palmitate activate JNK

and cause NFB and AP-1 nuclear translocation and proinflammatory cytokine production.

Furthermore, inhibition of JNK blocked Tlr2 and Tlr4 agonist-induced ROS and insulin

resistance in adipocytes. These data also provide novel evidence supporting a potential role

for Tlr2 in dietary SFA-induced inflammation and insulin resistance.

 113

Materials and Methods

Cells and Reagents. 3T3-L1 preadipocytes were obtained from American Type

Culture Collection (Manassas, VA, USA). All reagents were obtained from Sigma-Aldrich

(St. Louis, MO, USA) unless otherwise specified.

Cell Culture and Treatment. 3T3-L1 preadipocytes were grown in 5% CO2 in low

glucose (5.5 mM) DMEM containing 10% fetal bovine serum (FBS; Atlanta Biologicals,

GA, USA) in the presence of a 1% penicillin/streptomycin mixture (growth media). At 2 d

post-confluence (0 d), cells were induced to differentiate with medium containing 10% FBS,

1.7 M insulin, 0.4 mM biotin, 1.0 M dexamethasone, and 1.5 mM isobutylmethylxanthine

for 48 h. Thereafter, fresh growth media supplemented with 1.7 M insulin was added for 2-

3 d followed by insulin-free growth media for the remaining culture period. At 10-12 d, cells

were cultured in medium containing 10% FBS, 0.3 M bovine serum albumin (BSA), and

0.1% methanol with one or a combination of the following treatments: 0.5 mM sodium

palmitate, 10 g/mL LPS from Escherichia coli 055:B5, 20 g/mL ZymA from

Saccharomyces cerevisiae, and 20 M SP600125. At 24 h, medium was collected and fresh

medium with 0.1% FBS was added with indicated treatments.

Quantitative real-time PCR. Total RNA was extracted from cells using a

commercially available acid-phenol reagent (TRIzol, Invitrogen, Carlsbad, CA, USA).

Potential DNase contamination was removed with DNase-freeTM (Ambion, Foster City, CA,

USA). First-strand cDNA was synthesized using SuperScript III First-Strand Synthesis

System for RT-PCR (Invitrogen, Carlsbad, CA, USA). Primer sequences used to detect -

actin, Tlr4, Tlr2, MCP-1, and IL-6 are described elsewhere (28). Thermal cycling conditions

for PCR reactions were 95C for 3 min followed by 40 cycles of 95C for 15 s, 60C for 30
 114

s, and 72C for 30 s. Products amplified by these primers were cloned into pGEMT vector

(Promega, Madison, WI, USA) and sequenced to confirm transcript identity. Real-time PCR

reactions were carried out with an iCycler using the IQTM SYBR Green Super Mix kit (Bio-

Rad, Hercules, CA, USA). The abundance of each transcript was calculated by regression

against the standard curve generated on the same plate with the respective plasmid.

Expression levels of genes of interest were normalized to -actin and are reported as fold

change based on log starting quantity.

Analysis of Metabolic Parameters. Total nitrite and IL-6 concentrations in medium

were determined using commercially available ELISA kits (Biovision, Mountain View, CA,

USA and R&D Systems, Minneapolis, MN, USA, respectively). Glycerol release was

measured as previously described (35).

Western Blot Analysis. Cells were grown in 6 well tissue culture plates, and treated as

described above. To harvest protein for analysis, media from cells was aspirated, and cells

were rinsed once with ice cold PBS. Lysis buffer (10 mM Hepes pH 2.5, 20 mM Tris-HCl

pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium

pyrophosphate, 1 mM -glycerolphosphate, 1 mM sodium orthovandate, 1 g/mL leupetin, 1

g/mL aprotinin, 1 g/mL pepstatin, and 1 mM PMSF) was added to each well of cells,

which were then scraped from the plate. Cell protein lysates were resolved by electrophoresis

using 10% SDSpolyacrylamide gels and transferred to a nitrocellulose membrane for

western blot analyses. The membrane was blocked with 5% skim milk in tris buffered saline

(TBS) for 1 h at room temperature, and then incubated with phospho-SAPK/JNK or

SAPK/JNK monoclonal antibody (Cell Signaling Technology, Danvers, MA, USA)

overnight at 4C. After washing three times with TBST (0.05% Tween 20, 50 mM TrisHCl,
 115

pH 7.5, and 150 mM NaCl) for 15 min, the membrane was incubated for 1 h with anti-rabbit

IgG secondary antibody conjugated with horseradish peroxidase. The signal was detected

using the Phototope-HRP Western Blot Detection System (Cell Signaling Technology,

Danvers, MA, USA).

NFB and AP-1 Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts for

mobility shift assay reagents were prepared and validated as previously described (36).

Briefly, the consensus NF-B and AP-1 oligonucleotides (Santa Cruz, CA, USA) were end-

labeled with [-32P] ATP (PerkinElmer, Waltham, MA, USA) using T4 polynucleotide kinase

(Santa Cruz, Santa Cruz, CA, USA). 10-30 g of nuclear proteins were incubated with

50,000 cpm of labeled probe for 30 min at room temperature in binding buffer [2 mM

HEPES, 50 mM KCl, 2 mM EDTA, 10% glycerol, and 1% BSA (wt/vol)] with 2 g poly(dI-

dC) in a total reaction volume of 40 L. Probe-protein complexes were resolved by

electrophoresis, and the gel was transferred to nitrocellulose and dried.

Intracellular ROS Accumulation Assay. 30 M of carboxy-H2DCFDA (DCF;

Invitrogen, Carlsbad, CA, USA) was added to 1X Krebs Ringer Buffer (KRB; 12 mM

HEPES, pH 7.4, 121 mM NaCl, 4.9 mM KCl, 1.2 mM MgSO4, 0.33 mM CaCl2). Cells were

then incubated for 45 min at 37C, after which medium was aspirated and cells washed three

times with warm phosphate buffered saline (PBS). Culture plates were immediately read

using a fluorescent plate reader (SpectraMax M5, Molecular Devices, Sunnyvale, CA, USA)

with 435 nm excitation and 550 nm emission wavelengths, respectively. Fluorescence was

normalized to total protein as determined with the bicinchoninic acid assay (BCA; Pierce,

Rockford, IL, USA). Data are presented as percent of control.

 116

2-Deoxyglucose (DG) Uptake. Cells were incubated with or without 5 M

cytochalasin B and with 100 nM insulin for 30 or 10 min at 37C, respectively, in 1X Krebs

Ringer buffer (KRB). Non-insulin stimulated control cells were treated identically. Cell

media was then supplemented with 0.5 Ci/mL [3-H]-2-DG and 120 M non-labeled 2-DG

and cells were incubated for an additional 25 min. Glucose uptake was terminated by

aspiration of media. Thereafter, the cells were washed with 1X KRB and lysed with 0.1 N

NaOH. Cell lysates were used to determine 2-DG uptake via scintillation counting. Uptake

was normalized to total lysate protein as determined by BCA assay. Data are presented as

fold change of insulin-stimulated controls.

Statistical analyses. Data were tested for normality and analyzed using the mixed-

model analysis. Treatment was considered the fixed effect and experimental repetition the

random effect. The main effects (treatment and replicate) were tested against the treatment x

replicate interaction term. When protected by a significant F-test, mean separation was

accomplished using the least-squares mean separation (pdiff) procedure. Differences were

considered significant at P < 0.05. Tendencies were defined at P < 0.10.

Results

Time dependent induction of insulin resistance by palmitate, ZymA, and LPS in 3T3-

L1 adipocytes. Based on previous data, we investigated the ability of LPS and palmitate

compounds (at previously studied doses) to mediate insulin resistance in a time dependent

manner. Here we demonstrated that palmitate treatment reduced insulin-stimulated 2-DG

uptake beginning at 12 h and continuing through 48 h (Fig. 8, P<0.05). Alternatively, ZymA

and LPS only inhibited insulin-stimulated 2-DG uptake following 48 h of treatment

(P=0.0022 and P=0.0048, respectively). Therefore, we treated adipocytes for 48 h with

 117

palmitate, ZymA, or LPS in order to study mechanisms involved in the development of

insulin resistance.

ZymA induced inflammation and oxidative stress in adipocytes in a manner similar to

that caused by palmitate and (or) LPS. As shown in Table 4, the Tlr2 agonist, ZymA also

caused a 2-fold increase in IL-6 gene expression (P=0.05) which corresponded with a greater

than 10-fold increase in media IL-6 content (P<0.0001, Table 4). Consistent with prior

findings, palmitate resulted in an approximate 4-fold increase in IL-6 gene expression

(P<0.0001) and 30-fold increase in IL-6 media content (P<0.0001). We further evaluated the

inflammatory response in adipocytes by quantifying the expression of the pro-inflammatory

chemokine, MCP-1. As with palmitate and LPS, ZymA increased MCP-1 expression vs.

control cells (P<0.0001, Table 4) with a near 2-fold greater transcript abundance. The

expression of Tlr2 and Tlr4 were evaluated to assess potential feedback regulation of Tlr

ligands on their respective receptors. Although Tlr2 expression was induced by all treatments

(P<0.0001, Table 4), Tlr4 was largely unresponsive to these pro-inflammatory mediators

(Table 4), with the exception that LPS tended to reduce expression of Tlr4 (P=0.09). To

investigate the roles that Tlr ligands play in the accumulation of ROS, we measured several

markers of oxidative stress and ROS production. First, we quantified expression of the

inducible nitric oxide synthase gene, and found that palmitate, LPS, and ZymA all caused a

5-fold increase in iNOS expression (P<0.0001, Table 5). Next, we assessed ROS

accumulation, and demonstrated that all three ligands caused a 50% increase in intracellular

ROS (P<0.01, Table 5). However, an increase in media nitrite concentrations (25%, P=0.008,

Table 5), indicative of extracellular oxidative stress, was apparent only in response to

palmitate.
 118

NFB, AP-1, and JNK were activated by palmitate, ZymA and LPS in adipocytes. We

next studied potential mechanisms underlying the pro-inflammatory effects of palmitate and

the classic Tlr ligands. JNK has been implicated previously in proinflammatory signaling in

adipocytes (37,38), and consequently, we quantified phosphorylation of JNK1 (Thr183, 46

kDa) and JNK2 (Tyr185, 54 kDa) as an indicator of activation in cells treated with palmitate,

LPS, and ZymA. All three pro-inflammatory mediators significantly increased JNK

phosphorylation (P<0.05, Fig. 9A-B). Activation of JNK is known to stimulate the activity of

the pro-inflammatory transcription factors, NFB and AP-1. After 48 h, there was increased

activation of NFB by palmitate, LPS, and ZymA (Fig. 9C). Consistent with previous results,

the LPS treatment had the most pronounced effect on NFB activation under the applied

experimental conditions. Likewise, AP-1 activation was also increased by all of the pro-

inflammatory mediators (Fig. 9D), and was greatest in cells exposed to ZymA.

Inhibition of JNK attenuated palmitate- and Tlr ligand-induced inflammation,

oxidative stress, and insulin resistance in adipocytes. Our findings indicated that palmitate,

LPS, and ZymA all induced JNK activation. Hence, we sought to determine whether

inhibition of JNK would attenuate the inflammatory, oxidative, and insulin resistance

responses in adipocytes. We first confirmed that there was a reduction of JNK

phosphorylation by SP600125 in our adipocyte model. As compared with the non-inhibitor

control cells, there was a 22% (P=0.045), 45% (P=0.0005), and 33% (P=0.0045) reduction in

palmitate-, LPS- and ZymA-induced JNK activation, respectively, when cells were also

incubated with the SP600125 inhibitor (Fig. 10A-B). Furthermore, as shown in Fig. 10C,

inhibition of JNK completely abrogated the effect of palmitate on IL-6 expression

(P<0.0001), and attenuated the induction by LPS and ZymA. In contrast, inhibition of JNK
 119

did not alter the effects of LPS or ZymA on MCP-1, Tlr2, or Tlr4 expression (Fig. 10D).

However, there was a small (approximately 20%), but significant, decrease in palmitate-

induced MCP-1 (P=0.023), Tlr2 (P<0.0001, Fig. 10E), and Tlr4 (P=0.0014, Fig. 10F).

To establish whether the blunted inflammatory responses caused by inhibition of JNK

were associated with changes in NFB and AP-1 activation, adipocytes were treated with

LPS, palmitate, or ZymA in the presence or absence of SP600125. The JNK inhibitor

reduced the induction of NFB by all three pro-inflammatory mediators (Fig. 10A), but this

was qualitatively more pronounced for palmitate. Conversely, inhibition of JNK only

reduced activation of AP-1 in cells stimulated with palmitate or ZymA (Fig. 10B).

JNK mediated the insulin resistance caused by palmitate and Tlr ligands. There was

only a small (non-significant) reduction in LPS- and ZymA-induced iNOS expression in the

presence of the JNK inhibitor (Fig. 10C). Conversely, palmitate-induced iNOS expression

was dramatically reduced (over 60%, P<0.0001) with inhibitor. Furthermore, ROS

accumulation (Fig. 10D), as measured by DCF fluorescence, was reduced by 50-60%

(P<0.0001) for cells stimulated with palmitate or Tlr agonist. To determine if the attenuated

ROS accumulation impacted insulin sensitivity, we assessed glucose uptake using 2-DG

(Fig. 10E). Insulin-stimulated glucose uptake was improved over 40% in cells stimulated

with palmitate (P=0.0026), LPS (P=0.0018), or ZymA (P<0.0001) when JNK was blocked by

the inhibitor.

Discussion

The data presented herein indicated several important points regarding the regulation

of inflammation and insulin sensitivity in adipocytes by palmitate and Tlr ligands. First of

all, we showed that activation of Tlr2 resulted in a pro-inflammatory response and insulin
 120

resistance that bore marked similarity to responses caused by palmitate or activation of Tlr4

by LPS. Palmitate and both Tlr agonists resulted in increased nuclear localization of the

NFB and AP1 transcription factors, and caused increased expression of MCP-1, Tlr2, and

iNOS, as well as increased ROS accumulation. Furthermore, as with palmitate and LPS,

activation of Tlr2 by ZymA activated JNK and attenuated the ability of insulin to stimulate

glucose uptake (as determined with 2-DG).

The importance of Tlr2 activation as a contributor to inflammation in adipose tissue

in vivo has not yet been established, but Nguyen et al. (39) recently demonstrated that NEFA

activation of JNK involves both Tlr2 and Tlr4 in RAW 264.7 macrophages. The fact that

Tlr2 is upregulated by palmitate, LPS, or ZymA, whereas Tlr4 is not, underscores the

potential importance of signaling in adipose tissue via this receptor to obesity-linked

inflammation. Furthermore, these receptors have a synergistic relationship in terms of

activation of proinflammatory signaling. For instance, stimulation of Tlr4 leads to increased

expression of Tlr2 and thus amplification of the inflammatory response (40). Moreover, the

ability of these receptors to recognize similar ligands, including SFAs, suggests that Tlr2 and

Tlr4 are major mediators of obesity-induced inflammation. In the present study, the more

pronounced effect of palmitate may result from a combination of signaling through both of

these innate immune receptors.

Our second major finding pertains to the importance of JNK activity to ROS

accumulation and insulin-stimulated glucose uptake. Obesity-linked inflammation and

oxidative stress contribute to the development of insulin resistance (12,37,41,42). Although

the exact mechanism is not yet known, NEFA were associated with the generation of ROS in

adipocytes (12). Lee and colleagues (43) recently demonstrated that a Tlr-JNK pathway
 121

regulated ROS signaling in macrophages. Furthermore, Kaneto and colleagues (44)

suggested that JNK mediates insulin resistance through generation of oxidative stress. Our

data show that palmitate, LPS, and ZymA all induce JNK phosphorylation (activation), iNOS

expression and ROS accumulation in adipocytes. Furthermore, the inhibitor used to disrupt

activation of JNK not only blocked or attenuated the ability of palmitate, LPS and ZymA to

stimulate phosphorylation of JNK, it also precluded the induction of ROS and the diminution

in insulin-stimulated 2DG uptake by these pro-inflammatory factors.

We recognize the inherent limitations of kinase inhibitors, including their low

specificity. However, it should be noted that SP600125 is shown to have >20-fold selectivity

for JNK compared to a range of other kinases (45). Future experiments utilizing Tlr

knockdown models will be necessary to further validate the specificity of SP6 to JNK. The

redundancy of proinflammatory signals downstream of Tlr also suggest additional kinases

may be involved in palmitate-, ZymA-, or LPS-induced inflammation. Regardless, our data

strongly implicate JNK as a major determinant of ROS production in adipocytes, and

confirm prior evidence (46) detailing the importance of ROS as determinants of insulin

sensitivity in murine adipocytes.

Finally, we have identified the activation of AP-1 transcription factor as a

component of the inflammatory response to palmitate, LPS, and ZymA, and presented initial

evidence that activation of JNK may be required for activation of AP-1 by palmitate and

ZymA, but not LPS. The fact that we showed a limited effect of JNK inhibition on LPS-

induced AP-1 activation may relate to distinct differences between Tlr4 and Tlr2 signaling

(47). For instance, LPS and other Tlr4 agonists are capable of signaling through both

MyD88-dependent and independent pathways, whereas Tlr2 ligands require the MyD88
 122

adaptor protein in order to generate an effective proinflammatory response (48,49). In this

study, activation of NFB was induced by palmitate and both Tlr agonists. Moreover, the

Tlr4 agonist, LPS, had the greatest increase in NFB activation (Fig. 3C), whereas the Tlr2

agonist, ZymA, had the greatest induction of AP-1 (Fig. 3D). Involvement of LPS in NFB

activation in adipocytes has been well documented (21,36). However, we have established

herein that the Tlr2 agonist, ZymA, not only activates NFB, but also induces AP-1 in

adipocytes. The reduced ability of JNK inhibitor to fully inhibit LPS activation of AP-1 also

suggested that JNK may be more involved in Tlr2 activation of AP-1.

The in vivo activation of AP1 and NFB in AT is likely a concerted process involving

macrophages, preadipocytes, and adipocytes. The contribution of mature adipocytes to this

process is unclear, but may be paramount as activation of these proinflammatory

transcription factors promotes lipolysis (41), leading to increased NEFA and activation of Tlr

signaling within adipocytes and neighboring cells. However, elucidating the contribution of

different AT-based cells to Tlr2 and Tlr4 mediated inflammation will require further

investigation.

In conclusion, this study demonstrated involvement of Tlr2 agonists, ZymA, and

palmitate, in adipocyte inflammation, oxidative stress, and insulin resistance. These data also

indicated that JNK activation is essential to ZymA agonist induced NFB and AP-1

activation. Based on these data, we believe that Tlr2, in addition to Tlr4, is an important

mediator of obesity-induced inflammation. Further insight into this relationship may provide

potential therapeutic strategies to inhibit Tlr agonists for alleviating obesity-associated health

complications.
 123

References

1. Neels, J. G. & Olefsky, J. M. (2006) Inflamed fat: what starts the fire? J Clin Invest 116:
33-35.

2. Shoelson, S. E., Lee, J. & Goldfine, A. B. (2006) Inflammation and insulin resistance. J
Clin Invest 116: 1793-1801.

3. Shi, H., Kokoeva, M. V., Inouye, K., Tzameli, I., Yin, H. & Flier, J. S. (2006) TLR4 links
innate immunity and fatty acid-induced insulin resistance. J Clin Invest 116: 3015-
3025.

4. Takahashi, K., Yamaguchi, S., Shimoyama, T., Seki, H., Katsuta, H., Miyokawa, K.,
Tanaka, T., Yoshimoto, K., Ohno, H. et al. (2008) JNK- and I{kappa}B-dependent
pathways regulate MCP-1, not 123ignaling123n, release from artificially
hypertrophied 3T3-L1 adipocytes preloaded with palmitate in vitro. Am J Physiol
Endocrinol Metab.

5. Wellen, K. E. & Hotamisligil, G. S. (2005) Inflammation, stress, and diabetes. J Clin

Invest 115: 1111-1119.

6. Jove, M., Planavila, A., Laguna, J. C. & Vazquez-Carrera, M. (2005) Palmitate-induced

interleukin 6 production is mediated by protein kinase C and nuclear-factor kappaB
activation and leads to glucose transporter 4 down-regulation in skeletal muscle cells.
Endocrinology 146: 3087-3095.

7. Jove, M., Planavila, A., Sanchez, R. M., Merlos, M., Laguna, J. C. & Vazquez-Carrera, M.
(2006) Palmitate induces tumor necrosis factor-alpha expression in C2C12 skeletal
muscle cells by a mechanism involving protein kinase C and nuclear factor-kappaB
activation. Endocrinology 147: 552-561.

8. Sinha, S., Perdomo, G., Brown, N. F. & ODoherty, R. M. (2004) Fatty acid-induced
insulin resistance in L6 myotubes is prevented by inhibition of activation and nuclear
localization of nuclear factor kappa B. J Biol Chem 279: 41294-41301.

9. Weigert, C., Brodbeck, K., Staiger, H., Kausch, C., Machicao, F., Haring, H. U. &
Schleicher, E. D. (2004) Palmitate, but not unsaturated fatty acids, induces the
expression of interleukin-6 in human myotubes through proteasome-dependent
activation of nuclear factor-kappaB. J Biol Chem 279: 23942-23952.

10. Suganami, T., Nishida, J. & Ogawa, Y. (2005) A paracrine loop between adipocytes and
macrophages aggravates inflammatory changes: role of free fatty acids and tumor
necrosis factor alpha. Arterioscler Thromb Vasc Biol 25: 2062-2068.
 124

11. Ajuwon, K. M. & Spurlock, M. E. (2005) Palmitate activates the NF-kappaB

transcription factor and induces IL-6 and TNFalpha expression in 3T3-L1 adipocytes.
J Nutr 135: 1841-1846.

12. Subauste, A. R. & Burant, C. F. (2007) Role of FoxO1 in FFA-induced oxidative stress in
adipocytes. Am J Physiol Endocrinol Metab 293: E159-164.

13. Furukawa, S., Fujita, T., Shimabukuro, M., Iwaki, M., Yamada, Y., Nakajima, Y.,
Nakayama, O., Makishima, M., Matsuda, M. & Shimomura, I. (2004) Increased
oxidative stress in obesity and its impact on metabolic syndrome. J Clin Invest 114:
1752-1761.

14. Houstis, N., Rosen, E. D. & Lander, E. S. (2006) Reactive oxygen species have a causal
role in multiple forms of insulin resistance. Nature 440: 944-948.

15. Joshi-Barve, S., Barve, S. S., Amancherla, K., Gobejishvili, L., Hill, D., Cave, M., Hote,
P. & McClain, C. J. (2007) Palmitic acid induces production of proinflammatory
cytokine interleukin-8 from hepatocytes. Hepatology 46: 823-830.

16. Song, M. J., Kim, K. H., Yoon, J. M. & Kim, J. B. (2006) Activation of Toll-like receptor
4 is associated with insulin resistance in adipocytes. Biochem Biophys Res Commun
346: 739-745.

17. Suganami, T., Mieda, T., Itoh, M., Shimoda, Y., Kamei, Y. & Ogawa, Y. (2007)
Attenuation of obesity-induced adipose tissue inflammation in C3H/HeJ mice
carrying a Toll-like receptor 4 mutation. Biochem Biophys Res Commun.

18. Suganami, T., Tanimoto-Koyama, K., Nishida, J., Itoh, M., Yuan, X., Mizuarai, S.,
Kotani, H., Yamaoka, S., Miyake, K. et al. (2006) Role of the Toll-like Receptor
4/NF-{kappa}B Pathway in Saturated Fatty Acid-induced Inflammatory Changes in
the Interaction Between Adipocytes and Macrophages. Arterioscler Thromb Vasc
Biol.

19. Tsukumo, D. M., Carvalho-Filho, M. A., Carvalheira, J. B., Prada, P. O., Hirabara, S. M.,
Schenka, A. A., Araujo, E. P., Vassalo, J., Curi, R. et al. (2007) Loss-of-function
mutation in TLR4 prevents diet-induced obesity and insulin resistance. Diabetes.

20. Lee, J. Y., Sohn, K. H., Rhee, S. H. & Hwang, D. (2001) Saturated fatty acids, but not
unsaturated fatty acids, induce the expression of cyclooxygenase-2 mediated through
Toll-like receptor 4. J Biol Chem 276: 16683-16689.

21. Ajuwon, K. M. & Spurlock, M. E. (2005) Adiponectin inhibits LPS-induced NF-kappaB

activation and IL-6 production and increases PPARgamma2 expression in adipocytes.
Am J Physiol Regul Integr Comp Physiol 288: R1220-1225.
 125

22. Creely, S. J., McTernan, P. G., Kusminski, C. M., Fisher, F. M., Khanolkar, M., Evans,
M., Harte, A. L. & Kumar, S. (2006) Lipopolysaccharide activates an innate immune
system response in human adipose tissue in obesity and type 2 diabetes. Am J Physiol
Endocrinol Metab.

23. Frost, R. A., Nystrom, G. J. & Lang, C. H. (2002) Lipopolysaccharide regulates

proinflammatory cytokine expression in mouse myoblasts and skeletal muscle. Am J
Physiol Regul Integr Comp Physiol 283: R698-709.

24. Tran-Thi, T. A., Decker, K. & Baeuerle, P. A. (1995) Differential activation of

transcription factors NF-kappa B and AP-1 in rat liver macrophages. Hepatology 22:
613-619.

25. Frost, R. A., Nystrom, G. J. & Lang, C. H. (2003) Lipopolysaccharide and

proinflammatory cytokines stimulate interleukin-6 expression in C2C12 myoblasts:
role of the Jun NH2-terminal kinase. Am J Physiol Regul Integr Comp Physiol 285:
R1153-1164.

26. Poggi, M., Bastelica, D., Gual, P., Iglesias, M. A., Gremeaux, T., Knauf, C., Peiretti, F.,
Verdier, M., Juhan-Vague, I. et al. (2007) C3H/HeJ mice carrying a toll-like receptor
4 mutation are protected against the development of insulin resistance in white
adipose tissue in response to a high-fat diet. Diabetologia.

27. Kim, F., Pham, M., Luttrell, I., Bannerman, D. D., Tupper, J., Thaler, J., Hawn, T. R.,
Raines, E. W. & Schwartz, M. W. (2007) Toll-like receptor-4 mediates vascular
inflammation and insulin resistance in diet-induced obesity. Circ Res 100: 1589-
1596.

28. Davis, J. E., Gabler, N. K., Walker-Daniels, J. & Spurlock, M. E. (2007) Tlr4 deficiency
selectively protects against obesity induced by diets high in saturated fat. Obesity
(Silver Spring) In Press.

29. Mohammad, M. K., Morran, M., Slotterbeck, B., Leaman, D. W., Sun, Y., Grafenstein,
H., Hong, S. C. & McInerney, M. F. (2006) Dysregulated Toll-like receptor
expression and signaling in bone marrow-derived macrophages at the onset of
diabetes in the non-obese diabetic mouse. Int Immunol 18: 1101-1113.

30. Murakami, K., Bujo, H., Unoki, H. & Saito, Y. (2007) High fat intake induces a
population of adipocytes to co-express TLR2 and TNFalpha in mice with insulin
resistance. Biochem Biophys Res Commun 354: 727-734.

31. Senn, J. J. (2006) Toll-like receptor-2 is essential for the development of palmitate-
induced insulin resistance in myotubes. J Biol Chem 281: 26865-26875.
 126

32. Adhikary, G., Sun, Y. & Pearlman, E. (2008) C-Jun NH2 terminal kinase (JNK) is an
essential mediator of Toll-like receptor 2-induced corneal inflammation. J Leukoc
Biol.

33. Lee, J. Y., Zhao, L., Youn, H. S., Weatherill, A. R., Tapping, R., Feng, L., Lee, W. H.,
Fitzgerald, K. A. & Hwang, D. H. (2004) Saturated fatty acid activates but
polyunsaturated fatty acid inhibits Toll-like receptor 2 dimerized with Toll-like
receptor 6 or 1. J Biol Chem 279: 16971-16979.

34. Shishido, T., Nozaki, N., Takahashi, H., Arimoto, T., Niizeki, T., Koyama, Y., Abe, J.,
Takeishi, Y. & Kubota, I. (2006) Central role of endogenous Toll-like receptor-2
activation in regulating inflammation, reactive oxygen species production, and
subsequent neointimal formation after vascular injury. Biochem Biophys Res
Commun 345: 1446-1453.

35. Ajuwon, K. M. & Spurlock, M. E. (2004) Direct regulation of lipolysis by interleukin-15

in primary pig adipocytes. Am J Physiol Regul Integr Comp Physiol 287: R608-611.

36. Ajuwon, K. M., Jacobi, S. K., Kuske, J. L. & Spurlock, M. E. (2004) Interleukin-6 and
interleukin-15 are selectively regulated by lipopolysaccharide and interferon-gamma
in primary pig adipocytes. Am J Physiol Regul Integr Comp Physiol 286: R547-553.

37. Nguyen, M. T., Satoh, H., Favelyukis, S., Babendure, J. L., Imamura, T., Sbodio, J. I.,
Zalevsky, J., Dahiyat, B. I., Chi, N. W. & Olefsky, J. M. (2005) JNK and tumor
necrosis factor-alpha mediate free fatty acid-induced insulin resistance in 3T3-L1
adipocytes. J Biol Chem 280: 35361-35371.

38. Nozaki, M., Fukuhara, A., Segawa, K., Okuno, Y., Abe, M., Hosogai, N., Matsuda, M.,
Komuro, R. & Shimomura, I. (2007) Nitric oxide dysregulates adipocytokine
expression in 3T3-L1 adipocytes. Biochem Biophys Res Commun 364: 33-39.

39. Nguyen, M. T., Favelyukis, S., Nguyen, A. K., Reichart, D., Scott, P. A., Jenn, A., Liu-
Bryan, R., Glass, C. K., Neels, J. G. & Olefsky, J. M. (2007) A subpopulation of
macrophages infiltrates hypertrophic adipose tissue and is activated by free fatty
acids via Toll-like receptors 2 and 4 and JNK-dependent pathways. J Biol Chem 282:
35279-35292.

40. Lin, Y., Lee, H., Berg, A. H., Lisanti, M. P., Shapiro, L. & Scherer, P. E. (2000) The
lipopolysaccharide-activated toll-like receptor (TLR)-4 induces synthesis of the
closely related receptor TLR2 in adipocytes. J Biol Chem 275: 24255-24263.

41. Xu, H., Barnes, G. T., Yang, Q., Tan, G., Yang, D., Chou, C. J., Sole, J., Nichols, A.,
Ross, J. S. et al. (2003) Chronic inflammation in fat plays a crucial role in the
development of obesity-related insulin resistance. J Clin Invest 112: 1821-1830.
 127

42. Rudich, A., Kozlovsky, N., Potashnik, R. & Bashan, N. (1997) Oxidant stress reduces
insulin responsiveness in 3T3-L1 adipocytes. Am J Physiol 272: E935-940.

43. Lee, J. G., Lee, S. H., Park, D. W., Lee, S. H., Yoon, H. S., Chin, B. R., Kim, J. H., Kim,
J. R. & Baek, S. H. (2008) Toll-like receptor 9-stimulated monocyte chemoattractant
protein-1 is mediated via JNK-cytosolic phospholipase A2-ROS signaling. Cell
Signal 20: 105-111.

44. Kaneto, H., Xu, G., Fujii, N., Kim, S., Bonner-Weir, S. & Weir, G. C. (2002)
Involvement of c-Jun N-terminal kinase in oxidative stress-mediated suppression of
insulin gene expression. J Biol Chem 277: 30010-30018.

45. Bennett, B. L., Sasaki, D. T., Murray, B. W., OLeary, E. C., Sakata, S. T., Xu, W.,
Leisten, J. C., Motiwala, A., Pierce, S. et al. (2001) SP600125, an anthrapyrazolone
inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci U S A 98: 13681-13686.

46. Lin, Y., Berg, A. H., Iyengar, P., Lam, T. K., Giacca, A., Combs, T. P., Rajala, M. W.,
Du, X., Rollman, B. et al. (2005) The hyperglycemia-induced inflammatory response
in adipocytes: the role of reactive oxygen species. J Biol Chem 280: 4617-4626.

47. Takeda, K. & Akira, S. (2004) TLR signaling pathways. Semin Immunol 16: 3-9.

48. Kawai, T. & Akira, S. (2007) TLR signaling. Semin Immunol 19: 24-32.

49. Akira, S. & Takeda, K. (2004) Toll-like receptor 127ignaling. Nat Rev Immunol 4: 499-
511.
 128

Table 4. Palmitate, ZymA, and LPS induced inflammation in 3T3-L1 adipocytes

Treatment IL-6 IL-6 MCP-1 Tlr2 Tlr4
Protein Transcript Transcript Transcript Transcript
____________________________Fold Change___________________________
Control 1.00 0.94a 1.19 0.27a 1.12 0.05a 1.16 0.05a 1.29 0.09ab
Palmitate 29.5 0.94c 4.02 0.18c 1.42 0.03b 1.54 0.03b 1.48 0.06b
LPS 2.10 0.94a 1.63 0.21ab 1.59 0.04c 1.68 0.04c 1.04 0.07a
ZymA 13.1 0.94b 1.93 0.18b 1.80 0.03d 1.70 0.03c 1.31 0.06b

Treatment Effect P < 0.0001 P < 0.0001 P < 0.0001 P < 0.0001 P = 0.0009

a, b, c, d
Significant difference between LS means indicated by different letters (P<0.05)
 129

Table 5. Palmitate, ZymA, and LPS induced inflammation in 3T3-L1 adipocytes

Treatment Total NOS2 ROS
Nitrite Transcript Accumulation
______________________Fold Change____________________a
Control 1.00 0.06a 0.82 0.23a 1.16 0.16
Palmitate 1.05 0.06b 3.15 0.19b 1.89 0.13b
LPS 1.25 0.06a 2.97 0.19b 1.70 0.16b
a b
ZymA 0.91 0.06 2.96 0.16 1.54 0.15b

Treatment Effect P = 0.0036 P < 0.0001 P = 0.0027

a, b, c
Significant difference between LS means indicated by different letters (P<0.05)
 130

Figure 8. Palmitate, ZymA, and LPS induced insulin resistance in 3T3-L1 adipocytes.

10-12 d post-differentiated 3T3-L1 adipocytes were treated with 0.5 mM sodium palmitate,
10 g/mL LPS, or 20 g/mL ZymA for 3, 6, 8, 12, 24, and 48 h. Insulin-stimulated 2-DG
uptake was then determined (n = 8, Treatment effect P<0.0001, Time effect P<0.0001,
Treatment*Diet effect P<0.0001). A non-insulin stimulated contol was included for
reference. Results are expressed as fold change versus insulin stimulated control and
represent LS means SEM. When Treatment effect was significant (P<0.05), post-hoc t-test
was used to determine significant difference between LS means as indicated by different
letters.
 131

Figure 9. Palmitate, ZymA, and LPS induced JNK phosphorylation and NFB and AP-1
nuclear translocation in 3T3-L1 adipocytes.

10-12 d post-differentiated 3T3-L1 adipocytes were treated with 0.5 mM sodium palmitate,
10 g/mL LPS, or 20 g/mL ZymA for 48 h (n= 4 unless noted otherwise). (A)
Representative western blot showing phosphorylation of JNK (top panel) and total JNK
levels (bottom panel). (B) Quantification of phosphorylated JNK by densitometry and
expressed as fold change versus control (Treatment effect P=0.0089). Representative EMSA
blot showing nuclear protein binding to labeled (C) NFB and (D) AP-1 consensus
sequences.
 132

Figure 10. JNK inhibitor, SP600125, attenuated palmitate, ZymA, and LPS induced JNK
phosphorylation and inflammation in 3T3-L1 adipocytes.

10-12 d post-differentiated 3T3-L1 adipocytes were treated with 0.5 mM sodium palmitate,
10 g/mL LPS, or 20 g/mL ZymA for 48 h (n=6-8 unless noted otherwise). (A)
Representative western blot showing phosphorylation of JNK (top panel) and total JNK
levels (bottom panel). (B) Quantification of phosphorylated JNK by densitometry (Treatment
effect P<0.0001). (C) IL-6 gene expression (Treatment effect P<0.0001). (D) MCP-1 gene
expression (Treatment effect P<0.0001). (E) Tlr2 gene expression (Treatment effect
P<0.0001). (F) Tlr4 gene expression (Treatment effect P=0.0002). All displayed were
expressed as fold change versus control and represent LS means SEM. When Treatment
effect was significant (P<0.05), post-hoc t-test was used to determine significant difference
between LS means as indicated by different letters.
 133

Figure 11. JNK inhibitor, SP600125, attenuated palmitate, ZymA, and LPS induced NFB
and AP-1 nuclear translocation, oxidative stress, and insulin resistance in 3T3-L1
adipocytes.

10-12 d post-differentiated 3T3-L1 adipocytes were treated with 0.5 mM sodium palmitate,
10 g/mL LPS, or 20 g/mL ZymA for 48 h (n= 6-8 unless noted otherwise). Representative
EMSA blot showing nuclear protein binding to labeled (A) NFB and (B) AP-1 consensus
sequences. (C) iNOS gene expression (Treatment effect P<0.0001). (D) DCF fluorescence
(Treatment effect P<0.0001). (E) Insulin-stimulated 2-DG uptake (Treatment effect
P<0.0001). All displayed values represent LS means SEM for Treatment effect. When
Treatment effect was significant (P<0.05), post-hoc t-test was used to determine significant
difference between LS means as indicated by different letters.
 134

CHAPTER 5. ABSENCE OF TLR2 AND TLR4 HIGH FAT DIET-INDUCED

OBESITY AND ADIPOSE-SPECIFIC INFLAMMATION AND INSULIN
RESISTANCE
(To be submitted to Obesity)

Abstract

We previously demonstrated the involvement of toll-like receptor-4 (Tlr4) in saturated fatty

acid (SFA)-induced inflammation and insulin resistance. However, less is known about toll-

like receptor-2 (Tlr2), which also recognizes SFA. To investigate the involvement of this

receptor in diet-induced obesity, we utilized male Tlr2-/- mice and C57BL6J controls. We

also compared 10Scn mice lacking functional Tlr4 and their respective control 10J. Mice

were fed a low fat (low-fat control (LFC)), high unsaturated fat (high-fat control (HFC)), or

high saturated fat + palmitate (HFP) diet ad libitum for 16 weeks. Tlr2-/- mice were protected

from DIO. However, unlike Tlr4 deficient 10ScN mice, there were no significant changes in

body weight, energy intake, or lipid profile in Tlr2-/- mice fed any of the three diets as

compared to their control. Serum markers of inflammation, including C-reactive protein,

endotoxin, and monocyte chemotactic protein-1 (MCP-1) were lower in 10ScN mice fed

HFP diet, whereas only MCP-1 levels were reduced in high fat fed Tlr2-/- mice. Transcript

abundance of adipose markers of inflammation and oxidative stress, including tumor necrosis

factor-, interleukin-6, MCP-1, F4/80, and nitric oxide synthase-2, were attenuated by Tlr2

and Tlr4 deficiency. Furthermore, these effects were more striking in HFP-fed mice. Blood

glucose and serum insulin were lower in 10ScN mice, but not in Tlr2-/- mice. However,

stromal vascular (SV) cells isolated from AT of Tlr2-/- had a marked increase in insulin

sensitivity. These data indicated that Tlr2, as well as Tlr4, play a significant role in the
 135

development of obesity-induced inflammation and insulin resistance, specifically in mice fed

a HFP diet.

Introduction

Obesity-induced inflammation is associated with insulin resistance and an increased

risk for diabetes mellitus (DM) (1-3). Obese individuals exhibit activation of several distinct

inflammatory pathways, including nuclear factor kappa B (NFB) and c-jun N-terminal

kinase (JNK) (1,2), which are associated with macrophage infiltration in AT and stimulation

of proinflammatory cytokines, such as monocyte chemotactic protein-1 (MCP-1) and

interleukin-6 (IL-6). In addition, the incidence of DM is higher in obese versus healthy

weight patients. The strong association between obesity, inflammation, and insulin

resistance suggests that adipose tissue (AT) plays a prominent role in their development.

The underlying mechanism contributing to the proinflammatory response seen in AT

of the obese is not fully elucidated, but may involve signaling through specific Tlrs. Shi and

colleagues (4) reported attenuation of fatty acid (FA)-induced NFB activation and insulin

resistance in AT of Tlr4 null mice. Additional studies (5-8) have confirmed that Tlr4

deficiency improved insulin sensitivity and lowered inflammation in diet-induced obesity

(DIO). We previously demonstrated that 10ScN mice, which have a 74 kb deletion from

chromosome 4 that precludes expression and production of Tlr4, were specifically protected

from saturated fatty acid (SFA)-induced adiposity and AT-specific inflammation (9).

However, Tlr-4 deficiency did not fully attenuate high fat diet-induced inflammation in AT.

These data suggested that pathways independent of Tlr4 may also mediate obesity-induced

inflammation and insulin resistance.

 136

One potential candidate pathway is that of Tlr2, which is increased in AT of obese

and diabetic individuals (10,11). Since SFA are reported to contribute to activation of Tlr2, it

is a likely mediator of obesity-induced inflammation (12). Thus, the goal of this study was to

test the hypothesis that the absence of Tlr2 expression attenuates systemic inflammation,

improves insulin sensitivity, and decreases SFA-induced AT inflammation in DIO mice.

Materials and Methods

Animals and animal care. Male and female B6.129-Tlr2tm1Kir/J (Cat No. 004650;

Tlr2-/-) mice and C57BL/10ScN mice (Cat No. 003752; 10ScN) derived from the C57BL/6J

and C57BL/10J sublines, respectively, were obtained from Jackson Laboratories (Bar

Harbor, ME), along with corresponding control male and female C57BL/6J (Cat No. 000664)

and C57BL/10J (Cat No. 000665) mice. Breeding colonies were established for each

genotype. Aberrant Tlr2 and Tlr4 expression was confirmed by real time PCR. At 6-8 weeks

of age, male offspring were housed individually in a room with an automatically controlled

12-hour light:dark cycle. Mice were acclimated to the cages and provided unlimited access to

food and water.

Animals from each genotype were randomly assigned to one of three experimental

diets (n = 15/genotype/diet): 1) low fat control (LFC), high fat control (HFC), or high fat

palmitate (HFP) for 16 weeks. Both high fat diets were semi-purified, powdered diets based

on American Institute of Nutrition recommendations (13) that were modified to induce

obesity by providing 60% of calories from lipids (Table 6). The high fat diets were identical

except the source of fat used was either soybean oil in the HFC (Harlan Teklad) or a mixture

of lard (Harlan Teklad) and purified palmitate (Nu-Check Prep, Inc.) in the HFP diet. The

LFC diet contained 12% of calories from lipid. Food intake was measured daily and used to
 137

calculate total energy intake. Mice were fasted overnight (6-8 h) and euthanized by CO2

asphyxiation for blood and tissue collections. Blood was collected by heart puncture, placed

on ice, and serum was collected by centrifugation and frozen at -80oC until analyzed.

Animals were weighed and abdominal fat pads were removed and weighed. Extracted tissues

and carcasses were immediately frozen in liquid nitrogen and stored at -80C prior to RNA

extraction and immuno-histochemical analysis. All experimental protocols for animal care

and use were approved by the Institutional Animal Care and Use Committee at Iowa State

University, Ames, IA, USA.

Analysis of metabolic parameters. Blood glucose, total cholesterol, and

triacylglycerides (TAG) were measured using CardioChek PA system (Polymer

Technology Systems, Inc.). Serum insulin (Linco), C-reactive protein (CRP) (Immunology

Consultants Laboratory, Inc.), and MCP-1 (R&D Systems) were measured using commercial

assay kits. Non-esterified fatty acids (NEFA) were measured with NEFA-C kit (Wako Pure

Chemical Industries, Inc.). Serum endotoxin determinations were performed using a kit

based upon a Limulus amaebocyte extract (LAL kit; Hycult Biotechnology). Samples were

diluted 1:40. Internal control of recovery calculation was included in the assessment.

Quantitative real-time PCR. Total RNA was extracted and cDNA synthesized as

described previously (9). Primer sequences are listed in Table 7. The abundance of each gene

product was calculated by regressing against the standard curve generated in the same

reaction with their respective plasmid. All genes of interest were normalized to beta actin and

expressed as log starting quantity.

Serum fatty acid profile. Lipid from serum samples were extracted by the method of

Lepage and Roy (15) with minor modifications as described previously (9).
 138

Stromal vascular cell (SVC) isolation and culture. Male Tlr2-/- or 6J mice were

euthanized by CO2 asphyxiation. Epidydimal fat pads were removed, trimmed, and diced

before adding to sterile digestion cocktail (1X Krebs Ringer buffer (KRB) and 200 U/ml

collagenase) for 1 h in 37C shaking water bath. Inter-phase liquid, absent of floating

adipocytes and debris, was centrifuged at 800 x g for 4 min. The resulting pellet was

resuspended in red blood cell lysis buffer (pH 7.2; 155 mM HH4Cl, 5.7 mM K2HPO4, and 0.1

mM EDTA) for 5-6 min and then diluted with 1X PBS and centrifuged for 800 x g for 15

min. Following a second PBS wash, the pellet was resuspended in low glucose DMEM

containing 10% FBS and 5% streptomycin/penicillin mixture. Growth media was changed

after 4 h and then again at 24 h, after which media was replaced every 48 h. Cells were split

twice before being frozen in media containing 15% DMSO. These stocks were subsequently

used for all experiments.

When cells reached 70-80% confluence, adipocyte differentiation cocktail (growth

media containing 1.5 mM IBMX, 1.0 M dexamethasone, 1.7 M insulin, and 0.4 mM

biotin) was added for 48 h. Following an additional 48 h with differentiation cocktail, cells

were cultured in growth media with insulin. At 14 d post-differentiation, approximately 40%

of SVC exhibited adipocyte phenotype (e.g., lipid accumulation). Cells were then treated

with 0.5 mM sodium palmitate, 10 g/mL LPS from Escherichia coli 055:B5, or 20 g/mL

ZymA from Saccharomyces cerevisiae for 48 h and used thereafter for analysis of glucose

uptake.

2-Deoxyglucose (DG) Uptake. SV cells were treated as described and glucose uptake

was measured as previously described (16).

 139

Statistical analyses. Data were tested for normality and analyzed using the mixed-

model analysis with diet and genotype considered fixed effects, and the time dietary

treatments were implemented for subgroups as a random effect. Significant interactions of

main effects are indicated as Diet*Genotype effects. All indicated P-values were two-tailed

and Bonferroni corrected. Differences were considered significant at P < 0.05 and a tendency

at P < 0.10. Values are presented as least squares (LS) means SEM.

Results

Tlr2-/- and 10ScN mice are protected from diet-induced obesity independent of caloric

intake. Unlike 10ScN mice, Tlr2-/- mice did not exhibit a reduction in body weight (Fig.

12A) or weight gain (Fig. 12B) compared to 6J controls (Genotype, P= 0.68). In contrast,

10ScN mice had on average 2.9 g lower body weight relative to 10J mice (Genotype,

P=0.0018). This relationship was especially evident in HFP fed 10ScN mice (Diet*Genotype,

P=0.0076) and is consistent with our previous findings (9). To further evaluate the level of

adiposity, we measured epidydimal fat pad weight (Fig. 12C) and observed that both Tlr2-/-

and 10ScN mice had approximately 20% and 30% lower fat pad weight compared to their

controls, respectively (Genotype, P<0.0001). Epidydimal fat pad weight was higher in high

fat diet fed mice (Diet Effect, P=0.032) relative to LFC fed mice. These effects on fat pad

weight were independent of energy intake as there were no intake differences between Tlr2-/-

and 6J mice (Fig. 12D, Genotype, P=0.58). However, 10ScN mice actually exhibited greater

energy intake than 10J mice (Genotype, P=0.0097), which was especially evident in HFC fed

mice (Diet*Genotype, P=0.0007).

Tlr4 deficiency, but not Tlr2 deficiency, improved markers of insulin sensitivity,

particularly in mice fed a high saturated fat diet. In the present study, we measured fasting
 140

blood glucose (Fig. 13A) and serum insulin (Fig. 13B) to determine if Tlr2-/- mice might also

exhibit modification of insulin sensitivity. We have shown that blood glucose concentration

was over 10% lower in 10ScN mice versus 10J controls (Genotype, P=0.019). However, we

observed no significant difference in blood glucose or serum insulin between Tlr2-/- and 6J

controls (Genotype, P=0.12 and P=0.66, respectively). Dietary treatment also had no effect

on blood glucose regardless of genotype (Diet, P=0.93). In contrast, serum insulin was

approximately 30% higher in mice fed HFP compared to HFC (Diet, P=0.035) suggesting

that a diet rich in SFA is more insulinemic compared to a diet rich in unsaturated FA. One

caveat to this was that 10ScN mice had a tendency toward lower insulin concentration when

fed the HFP diet compared to 10J controls (Diet*Genotype, P=0.10).

Absence of Tlr2 and Tlr4 expression differentially modified markers of systemic

inflammation. We measured several proinflammatory markers in serum, including CRP (Fig.

13C), endotoxin (Fig. 13D), and MCP-1 (Fig. 13E). Circulating CRP concentration was

greater in mice fed a saturated versus unsaturated fat diet (P=0.031), but this effect was

blunted in Tlr4 deficient mice fed HFP diet (Diet*Genotype, P=0.0034). Furthermore, Tlr4

deficient mice showed a nearly 30% reduction in serum endotoxin regardless of diet

(Genotype, P=0.048). In contrast, there was no detectable difference in serum CRP or

endotoxin between Tlr2-/- and 6J mice (P=0.46 and P=0.79, respectively). Serum

concentration of the proinflammatory chemokine, MCP-1, was approximately 55% lower in

10ScN mice versus 10J controls (Genotype, P=0.0035). The reduction in MCP-1

concentration was more evident in Tlr4 deficient mice fed either high fat diet

(Diet*Genotype, P=0.035 (HFC) and P=0.05 (HFP), respectively). Tlr2-/- mice were also

protected from the HFP diet-induced MCP-1 increase (Diet*Genotype, P=0.0038), but not
 141

from the HFC diet (Diet*Genotype, P=0.58). Therefore, it appeared that Tlr2, in addition to

Tlr4, was involved in the stimulation of the SFA diet-induced serum MCP-1.

Tlr2 and Tlr4 deficiencies differentially modified circulating lipid profiles in

response to high fat diets. We measured both the concentration and composition of serum

lipids in order to determine their relationship with obesity-induced inflammation. We have

shown that mice fed either high fat diet had a near 20% higher serum total cholesterol (Table

8, Diet, P=0.0075 (HFC) and P<0.0001 (HFP), respectively), whereas serum TAG (Table 8)

was elevated in LFC fed mice regardless of genotype (Diet, P< 0.0001). Furthermore, 10ScN

mice exhibited approximately 20% greater serum TAG compared to 10J controls (Genotype,

P=0.0049), which was more apparent in 10ScN mice fed LFC diet (Diet*Genotype,

P<0.0001). Similarly, circulating NEFA (Table 8) were higher in 10ScN mice fed the LFC

diet (Diet*Genotype, P<0.01). There were no observed differences in serum TAG or NEFA

between Tlr2-/- mice and 6J controls (Genotype P=0.97 and P=0.85, respectively).

We next analyzed the composition of serum FA (Table 9). Total SFA, palmitate, and

stearate content were all 21%, 14%, and 35% higher in serum of mice fed HFP and LFC

compared to HFC diet, respectively (Diet, P<0.0001). In contrast, total omega-6 and omega-

3 FA content were approximately 18% and 25% greater in serum of mice fed HFC than HFP

diet (Diet, P<0.0001), which corresponds with higher serum linoleate, -linolenate, and DHA

(Diet, P<0.0001). Polyunsaturated FA (PUFA) content was also different between LFC and

HFP fed mice. Total omega-3 FA was greater in mice fed LFC (Diet, P<0.0001), whereas

total omega-6 FA was greater in mice fed HFP (Diet, P=0.0029), which is consistent with the

observed DHA (Diet, P<0.0001) and -linoleate concentrations (Diet, P<0.01), respectively.

Genotype had a minimal impact on FA composition. However, Tlr2-/- mice exhibited higher
 142

circulating stearate (Genotype, P=0.0003) with a trend toward an increase in total SFA

(Genotype, P=0.083) compared to 6J controls. Conversely, 10ScN mice had higher -

linolenate (Genotype, P=0.0067) and linoleate (Genotype, P=0.0960) versus 10J controls.

These data indicated that the circulating lipid profile was more closely related to dietary lipid

content than genotype, thus indicating that the anti-inflammatory effects of Tlr2 or Tlr4

deficiency were not due to alterations in FA profile.

Obesity-induced inflammation in adipose tissue was differentially regulated by high

saturated and unsaturated fat diets, and was partly ameliorated by Tlr2 and Tlr4 deficiency.

We first confirmed that Tlr4 (Fig. 14A) and Tlr2 (Fig. 14B) gene expression were deficient

in AT of 10ScN and Tlr2-/- mice, respectively (Genotype, P<0.0001). Transcript abundance

of Tlr4 was 2-fold greater in mice fed either high fat diet (Diet, P=0.0068 (HFP) and P=0.020

(HFC), respectively). SFA fed mice also exhibited a 3-fold increase in Tlr2 transcript levels

compared to LFC diet fed mice (Diet, P=0.0009).

To determine whether Tlr2 or Tlr4 deficiency corresponded with changes in

inflammation, we measured transcript abundance of TNF (Fig. 14C), IL-6 (Fig. 14D), and

MCP-1 (Fig. 14E) in AT of Tlr2-/-, 10ScN, and the respective control mice. Tlr2-/- mice had

2-fold lower TNF and MCP-1 transcript levels in AT compared to 6J mice (Genotype,

P<0.0001 and P=0.0087, respectively). Similarly, TNF transcript abundance was 2-fold

lower in 10ScN mice versus 10J controls (Genotype, P=0.0269). Tlr2-/- mice were

specifically protected from HFP diet-induced TNF, IL-6, and MCP-1 expression in AT

(Diet*Genotype, P=0.0010, P=0.051, and P<0.0001, respectively). Tlr4 deficiency lowered

IL-6 and MCP-1 transcript abundance by 2-fold in AT of HFP fed mice (Diet*Genotype,

P=0.045 and P=0.046). These findings indicated that the ability of a high saturated fat diet to
 143

induce expression of proinflammatory cytokines was significantly blunted without either

functional Tlr2 or Tlr4.

We have shown that transcript abundance of macrophage marker, F4/80, was over 2-

fold lower in Tlr2-/- and 10ScN mice relative to respective controls (Genotype, P=0.025 and

P=0.032). Absence of Tlr2, as well as Tlr4, specifically attenuated F4/80 transcript

abundance in HFP fed mice F4/80 (Diet*Genotype, P=0.0014 and P=0.0045, respectively).

In the present study, nitric oxide synthase-2 (NOS2) transcript abundance was 5.2-

and 5.9-fold lower in both Tlr2-/- and 10ScN mice compared to 6J and 10J controls

(Genotype, P<0.0001). This effect was more prominent with either high fat diet (Diet,

P<0.0001), but the highest level of NOS2 transcript was in HFP fed mice (Diet, P=0.030).

The ability of Tlr2 or Tlr4 deficiency to attenuate HFC-induced NOS2 was similar

(Diet*Genotype, P<0.0001). However, only 10ScN mice exhibited a protective effect against

the HFP diet (Diet*Genotype, P<0.0001). Overall, these results indicated that Tlr2 and Tlr4

were important mediators of macrophage accumulation and oxidative stress in AT of mice

fed either high fat diet.

Tlr2 deficient SV cells were protected from FFA-induced inflammation and insulin

resistance. We observed a limited effect of Tlr2 deficiency on blood glucose and serum

insulin. These findings may reflect an increased susceptibility to DIO on the 6J background,

which was clearly demonstrated by the greater body weight, adiposity, and energy intake in

mice on 6J background (Tlr2-/- and 6J), relative to 10J background (10ScN and 10J)

(Genotype, P<0.0001). Thus, we investigated if insulin sensitivity in Tlr2-/- mice was

improved at the cellular level. To do this we isolated and cultured primary SV cells from AT
 144

of Tlr2-/- and 6J mice. Confluent cells were then treated with adipocyte differentiation media

(~40% of cells exhibited lipid accumulation) and used for determination of 2-DG uptake.

We demonstrated that Tlr2-/- SV cells exhibited greater insulin sensitivity than 6J

cells, regardless of treatment (Fig. 15, Genotype, P<0.0001). Furthermore, Tlr2 deficient SV

cells treated with palmitate, LPS, or ZymA for 48 hr had improved insulin sensitivity

compared to 6J cells (Treatment, P<0.0001). However, only ZymA-induced insulin

resistance was completely attenuated in Tlr2-/- SV cells compared to insulin-stimulated

controls (Treatment*Genotype, P<0.0001). The inability of Tlr2 deficiency to fully block

palmitate mediated insulin resistance indicated an alternative pathway. Tlr4 represents a

potential candidate, as LPS-induced insulin resistance was unaffected by Tlr2 deficiency

(Treatment*Genotype, P<0.0001). These data indicated that absence of functional Tlr2

improved insulin sensitivity in SV cells isolated from AT, but failed to completely block

SFA-induced insulin resistance due to Tlr2-independent pathways, such as Tlr4.

Discussion

Obesity is associated with chronic low grade inflammation, which contributes to the

development of insulin resistance (17). The molecular mechanisms involved are not fully

elucidated but may involve activation of Tlr2 and Tlr4 signaling pathways in AT. Several

recent studies (4,6,7,20) have identified a role of Tlr4 in obesity and FA-induced

inflammation. Herein, we demonstrate that Tlr2-/- mice were protected from DIO without

significant changes in energy intake or lipid profile. These mice also exhibited a dramatic

attenuation of systemic and AT inflammation. Moreover, SV cells isolated from AT of Tlr2-/-

mice had a marked increase in insulin sensitivity. These data indicated that Tlr2 is involved

in obesity-induced inflammation and insulin resistance.

 145

Diets high in SFA are associated with increased inflammation (21). We have

previously reported that Tlr4 deficiency specifically protected against a high SFA diet-

induced adiposity and inflammation (9). In this study, we confirmed this effect in 10ScN

mice, but also demonstrated that absence of functional Tlr2 blunted the high SFA diet-

induced inflammation. Moreover, the attenuated inflammatory response in Tlr2-/- and 10ScN

mice suggests that the absence of these receptors protects against the elevated serum SFA

observed in HFP-fed control mice. The ability of SFA to induce inflammation through Tlr4 is

well documented in vitro (5,22). However, only a few studies (12,23) have implicated Tlr2 as

a potential target for SFA, including Senn (23), who reported that Tlr2 siRNA reversed

palmitate-induced activation of IKK/NFB in C2C12 myotubes. These data herein confirm

the idea that Tlr2 is an endogenous target for SFA, and thus promotes obesity-induced

inflammation.

AT inflammation, as evidenced by macrophage infiltration and proinflammatory gene

expression, contributes to the development of insulin resistance (17,18). Impaired insulin

signaling in AT often precedes the onset of systemic insulin resistance (24). We previously

reported that Tlr4 deficient mice exhibited lower macrophage infiltration in AT (9). In the

present study, we observed that transcript abundance of the macrophage specific marker,

F4/80 was markedly reduced in Tlr2 and Tlr4 deficient mice. This reduction was more

apparent in HFP-fed mice, and corresponded with lower expression levels of multiple

proinflammatory genes (e.g. TNF, IL-6, and MCP-1). Additionally, the high fat diet-

induced NOS2 transcript was reduced in Tlr2-/- and 10ScN mice, which supports our

previous findings that Tlr2 and Tlr4 ligands induce ROS in 3T3-L1 adipocytes (16). Thus,
 146

Tlr2 and Tlr4 deficiency protected against AT inflammation and oxidative stress, especially

when fed a high SFA diet.

Several investigations (4,6-8) reported Tlr4 involvement in obesity and FA-induced

insulin resistance. Alternatively, Caricilli et al. (25) showed that injection of Tlr2 antisense

oligonuleotide attenuated insulin resistance as measured by an insulin tolerance test.

Furthermore, inhibition of Tlr2 also improved insulin sensitivity in AT and muscle of DIO

mice. Our data showed that only 10ScN mice exhibited improved serum markers of insulin

sensitivity. However, to determine if insulin sensitivity was improved in AT, we studied

insulin sensitivity in primary SV cells from Tlr2-/- mice. Although we observed a marked

improvement in insulin sensitivity in the Tlr2-/- mice, the absence of Tlr2 failed to fully

protect against palmitate-induced insulin resistance. These findings indicate that Tlr2 does

mediated AT specific inflammation, and may be as involved in obesity-induced insulin

resistance as is Tlr4. In summary, our study demonstrates a requisite role of Tlr2 and Tlr4 in

obesity-induced inflammation and insulin resistance. The absence of these receptors protects

against systemic and AT specific inflammation, especially in mice fed a high SFA diet. We

therefore assert that both Tlr2 and Tlr4 represent potential dietary and pharmaceutical targets

for reducing inflammation and insulin resistance associated with obesity.

References

1. Neels, J. G. & Olefsky, J. M. (2006) Inflamed fat: what starts the fire? J Clin Invest 116:
33-35.

2. Shoelson, S. E., Lee, J. & Goldfine, A. B. (2006) Inflammation and insulin resistance. J
Clin Invest 116: 1793-1801.

3. Wellen, K. E. & Hotamisligil, G. S. (2005) Inflammation, stress, and diabetes. J Clin

Invest 115: 1111-1119.
 147

4. Shi, H., Kokoeva, M. V., Inouye, K., Tzameli, I., Yin, H. & Flier, J. S. (2006) TLR4 links
innate immunity and fatty acid-induced insulin resistance. J Clin Invest 116: 3015-
3025.

5. Suganami, T., Tanimoto-Koyama, K., Nishida, J., Itoh, M., Yuan, X., Mizuarai, S., Kotani,
H., Yamaoka, S., Miyake, K., Aoe, S., Kamei, Y. & Ogawa, Y. (2006) Role of the
Toll-like Receptor 4/NF-{kappa}B Pathway in Saturated Fatty Acid-induced
Inflammatory Changes in the Interaction Between Adipocytes and Macrophages.
Arterioscler Thromb Vasc Biol.

6. Poggi, M., Bastelica, D., Gual, P., Iglesias, M. A., Gremeaux, T., Knauf, C., Peiretti, F.,
Verdier, M., Juhan-Vague, I., Tanti, J. F., Burcelin, R. & Alessi, M. C. (2007)
C3H/HeJ mice carrying a toll-like receptor 4 mutation are protected against the
development of insulin resistance in white adipose tissue in response to a high-fat
diet. Diabetologia.

7. Tsukumo, D. M., Carvalho-Filho, M. A., Carvalheira, J. B., Prada, P. O., Hirabara, S. M.,
Schenka, A. A., Araujo, E. P., Vassalo, J., Curi, R., Velloso, L. A. & Saad, M. J.
(2007) Loss-of-function mutation in TLR4 prevents diet-induced obesity and insulin
resistance. Diabetes.

8. Kim, F., Pham, M., Luttrell, I., Bannerman, D. D., Tupper, J., Thaler, J., Hawn, T. R.,
Raines, E. W. & Schwartz, M. W. (2007) Toll-like receptor-4 mediates vascular
inflammation and insulin resistance in diet-induced obesity. Circ Res 100: 1589-
1596.

9. Davis, J. E., Gabler, N. K., Walker-Daniels, J. & Spurlock, M. E. (2008) Tlr-4 deficiency
selectively protects against obesity induced by diets high in saturated fat. Obesity
(Silver Spring) 16: 1248-1255.

10. Creely, S. J., McTernan, P. G., Kusminski, C. M., Fisher, F. M., Khanolkar, M., Evans,
M., Harte, A. L. & Kumar, S. (2006) Lipopolysaccharide activates an innate immune
system response in human adipose tissue in obesity and type 2 diabetes. Am J Physiol
Endocrinol Metab.

11. Mohammad, M. K., Morran, M., Slotterbeck, B., Leaman, D. W., Sun, Y., Grafenstein,
H., Hong, S. C. & McInerney, M. F. (2006) Dysregulated Toll-like receptor
expression and signaling in bone marrow-derived macrophages at the onset of
diabetes in the non-obese diabetic mouse. Int Immunol 18: 1101-1113.

12. Lee, J. Y., Zhao, L., Youn, H. S., Weatherill, A. R., Tapping, R., Feng, L., Lee, W. H.,
Fitzgerald, K. A. & Hwang, D. H. (2004) Saturated fatty acid activates but
polyunsaturated fatty acid inhibits Toll-like receptor 2 dimerized with Toll-like
receptor 6 or 1. J Biol Chem 279: 16971-16979.
 148

13. Reeves, P. G., Nielsen, F. H. & Fahey, G. C., Jr. (1993) AIN-93 purified diets for
laboratory rodents: final report of the American Institute of Nutrition ad hoc writing
committee on the reformulation of the AIN-76A rodent diet. J Nutr 123: 1939-1951.

14. Lepage, G. & Roy, C. C. (1986) Direct transesterification of all classes of lipids in a one-
step reaction. J Lipid Res 27: 114-120.

15. Davis, J. E., Gabler, N. K., Walker-Daniels, J. & Spurlock, M. E. (2008) The c-jun N-
terminal kinase mediates the induction of oxidative stress and insulin resistance by
palmitate and toll-like receptor 2 and 4 ligands in 3T3-L1 adipocytes. Horm Metab
Res (In Submission).

16. Xu, H., Barnes, G. T., Yang, Q., Tan, G., Yang, D., Chou, C. J., Sole, J., Nichols, A.,
Ross, J. S., Tartaglia, L. A. & Chen, H. (2003) Chronic inflammation in fat plays a
crucial role in the development of obesity-related insulin resistance. J Clin Invest
112: 1821-1830.

17. Suganami, T., Mieda, T., Itoh, M., Shimoda, Y., Kamei, Y. & Ogawa, Y. (2007)
Attenuation of obesity-induced adipose tissue inflammation in C3H/HeJ mice
carrying a Toll-like receptor 4 mutation. Biochem Biophys Res Commun.

18. Lennie, T. A., Chung, M. L., Habash, D. L. & Moser, D. K. (2005) Dietary fat intake and
proinflammatory cytokine levels in patients with heart failure. J Card Fail 11: 613-
618.

19. Lee, J. Y., Ye, J., Gao, Z., Youn, H. S., Lee, W. H., Zhao, L., Sizemore, N. & Hwang, D.
H. (2003) Reciprocal modulation of Toll-like receptor-4 signaling pathways
involving MyD88 and phosphatidylinositol 3-kinase/AKT by saturated and
polyunsaturated fatty acids. J Biol Chem 278: 37041-37051.

20. Senn, J. J. (2006) Toll-like receptor-2 is essential for the development of palmitate-
induced insulin resistance in myotubes. J Biol Chem 281: 26865-26875.

21. Weisberg, S. P., McCann, D., Desai, M., Rosenbaum, M., Leibel, R. L. & Ferrante, A.
W., Jr. (2003) Obesity is associated with macrophage accumulation in adipose tissue.
J Clin Invest 112: 1796-1808.

22. Apovian, C. M., Bigornia, S., Mott, M., Meyers, M. R., Ulloor, J., Gagua, M.,
McDonnell, M., Hess, D., Joseph, L. & Gokce, N. (2008) Adipose macrophage
infiltration is associated with insulin resistance and vascular endothelial dysfunction
in obese subjects. Arterioscler Thromb Vasc Biol 28: 1654-1659.
 149

23. Caricilli, A., Nascimento, P., Pauli, J., Tsukumo, D., Velloso, L., Carvalheira, J. B. &
Saad, M. (2008) Inhibition of TLR2 expression improves insulin sensitivity and
signaling in muscle and white adipose tissue of mice fed a high-fat diet. J Endocrinol.
 150

Table 6. Diet Composition

Ingredient Low-Fat Control (LFC)1 High-Fat Control (HFC)1 High-Fat Palmitate (HFP)1
________________________ g/kg_______________________________
Casein2 140 196 196
Sucrose2 100 100 100
Corn Starch2 455.692 88.192 88.192
Maltodextrin2 155 155 155
Soybean Oil2 50 360
Saturated 7.2 51.9
Palmitate 5.2 37.1
MUFA 11.7 83.9
PUFA 28.9 208.1
Lard2 235
Saturated 92.2
Palmitate 55.9
MUFA 106
PUFA 26.4
Palmitate3 125
Cholesterol2 1.5 1.5
Cellulose2 50 50 50
Vitamin Mix2 10 10 10
Mineral Mix2 35 35 35
Choline Bitartrate2 2.5 2.5 2.5
L-Cysteine2 1.8 1.8 1.8
THBQ2 0.008 0.008 0.008
Total (g) 1000 1000 1000
Protein (kcal) 567.2 791.2 791.2
CHO (kcal) 2842.768 1372.768 1372.768
Fat (kcal) 450 3240 3240
Saturated (kcal) 64.8 467.1 1954.8
Palmitate (kcal) 46.8 333.9 1628.1
MUFA (kcal) 105.3 755.1 954
PUFA (kcal) 260.1 1872.9 237.6
Density (kcal/g) 3.86 5.40 5.40
1.
2. Adapted from AIN-93M Diet
Harlan Teklad, Madison, WI"
3.
Nu-Check Prep, Inc., Elysian, MN"
 151

Table 7. Primer sequences for quantitative real-time polymerase chain reaction

Target Forward Primer Reverse Primer

Beta-Actin TGAGAGGGAAATCGTGCGTGACAT ACCGCTCGTTGCCAATAGTGATGA

Tlr2 TCCCTTGACATCAGCAGGAACACT GCAGCCGAGGCAAGAACAAAGAAA
Tlr4 CCGCTCTGGCATCATCTTCATTGT TCCTCCCATTCCAGGTAGGTGTTT
MCP-1 CCAAGAAGGAATGGGTCCAGACAT ACAGAAGTGCTTGAGGTGGTTGTG
TNF- CCAACGGCATGGATCTCAAAGACA AGATAGCAAATCGGCTGACGGTGT
IL-6 TCCAGTTGCCTTCTTGGGACTGAT AGCCTCCGACTTGTGAAGTGGTAT
NOS2 TCTTTGACGCTCGGAACTGTAGCA CGACCTGATGTTGCCATTGTTGGT
F4/80+ TGCCACAACACTCTCGGAAGCTAT TCCTGGAGCACTCATCCACATCTT
 152

Table 8. Lipid profiles in Tlr2 and Tlr4 deficient mice and wild type controls fed LFC, HFC,
or HFP diet for 16 weeks
Genotype Diet Serum Serum Serum
Cholesterol Triacylglyceride NEFA

________________________mmol/L______________________
10ScN LFC 5.00 0.59c 1.53 0.08a 2.48 0.29a
bc c
10ScN HFC 6.39 0.53 0.73 0.07 1.51 0.30b
bc bc
10ScN HFP 6.17 0.51 0.75 0.07 1.48 0.39b

10J LFC 5.41 0.63c 0.96 0.09b 1.65 0.32b

10J HFC 5.18 0.63c 0.71 0.09c 1.38 0.28b
10J HFP 6.75 0.63b 0.75 0.09bc 1.30 0.35b

Tlr2-/- LFC 6.69 0.54b 0.92 0.08bc 1.84 0.27ab

Tlr2-/- HFC 9.20 0.69a 0.76 0.09c 2.02 0.27a
Tlr2-/- HFP 8.46 0.67a 0.92 0.09bc 2.33 0.32a

6J LFC 6.23 0.64bc 1.01 0.09b 1.89 0.28ab

6J HFC 7.07 0.58b 0.69 0.08c 2.08 0.27a
6J HFP 9.02 0.64a 0.92 0.09bc 2.10 0.29a

Main Effects
Genotype P < 0.0001 P = 0.0302 P = 0.019
Diet P = 0.0001 P < 0.0001 P = 0.36
Interaction
Diet*Genotype P = 0.13 P < 0.0001 P = 0.052
a, b, c, d
Significant difference between LS means indicated by different letters (P<0.05)
 153

Table 9. Serum fatty acid profiles in Tlr2 and Tlr4 deficient mice and wild type controls fed
LFC, HFC, and HFP diet for 16 weeks

a, b, c, d
Significant difference between LS means indicated by different letters (P<0.05)
 154

Figure 12. Tlr2-/- and 10ScN mice were protected against DIO.

All measures were taken after 16 weeks of LFC (white bars), HFC (black bars), or HFP (grey
bars) diet (n = 15 unless noted otherwise). (A) Body weight of 6J, Tlr2-/-, 10ScN, and 10J
mice (Diet effect P= 0.58, Genotype effect, P<0.0001, Diet*Genotype interaction P=0.0085).
(B) Total weight gain of 6J, Tlr2-/-, 10ScN, and 10J mice (Diet effect P= 0.58, Genotype
effect, P<0.0001, Diet*Genotype interaction P=0.0085). (C) Epididymal fat pad weight of
6J, Tlr2-/-, 10ScN, and 10J mice (Diet effect P=0.032, Genotype effect P<0.0001,
Diet*Genotype interaction P=0.040). (D) Total energy intake (kcal) of 6J, Tlr2-/-, 10ScN, and
10J mice (Diet effect P=0.82, Genotype effect P<0.0001, Diet*Genotype interaction
P=0.013). All displayed values were adjusted for initial body weight and represent LS means
SEM for Diet*Genotype interaction. When main effects (diet and genotype) or interaction
term were P<0.15, Bonferroni correction was used to determine significant difference
between means as indicated by different letters.
 155

Figure 13. Absence of Tlr2 and Tlr4 expression differentially modified markers of systemic
insulin sensitivity and inflammation.

All measures were taken after 16 weeks of LFC (white bars), HFC (black bars), or HFP (grey
bars) diet. (A) Blood glucose from 6-8 h fasted 6J, Tlr2-/-, 10ScN, and 10J mice (n = 15, Diet
effect P= 0.81, Genotype effect, P=0.066, Diet*Genotype interaction P=0.65). (B) Serum
insulin (n = 5, Diet effect P=0.096, Genotype effect P=0.0002, Diet*Genotype interaction
P=0.15). (C) Serum CRP from 6J, Tlr2-/-, 10ScN, and 10J mice (n = 5, Diet effect P=0.095,
Genotype effect, P<0.0001, Diet*Genotype interaction P=0.066). (D) Serum endotoxin (n =
5, Diet effect P=0.57, Genotype effect P<0.0001, Diet*Genotype interaction P=0.34). E)
Serum MCP-1 (n = 5, Diet effect P=0.42, Genotype effect P=0.0002, Diet*Genotype
interaction P=0.090). All displayed values were adjusted for initial body weight and
represent LS means SEM for Diet*Genotype interaction. When main effects (diet and
genotype) or interaction term were P<0.15, Bonferroni correction was used to determine
significant difference between means as indicated by different letters.
 156

Figure 14. Absence of Tlr2 and Tlr4 expression protected against SFA-induced inflammation
in AT.

All measures were taken after 16 weeks of LFC (white bars), HFC (black bars), or HFP (grey
bars) diet. (A) Tlr4 transcript abundance in AT of 6J, Tlr2-/-, 10ScN, and 10J mice (n = 6,
Diet effect P=0.014, Genotype effect, P<0.0001, Diet*Genotype interaction P=0.24). (B)
Tlr2 transcript abundance in AT of 6J, Tlr2-/-, 10ScN, and 10J mice (n = 6, Diet effect
P=0.0031, Genotype effect P<0.0001, Diet*Genotype interaction P=0.073). (C) TNF
transcript abundance in AT of 6J, Tlr2-/-, 10ScN, and 10J mice (n = 6, Diet effect P=0.66,
Genotype effect P<0.0001, Diet*Genotype interaction P=0.040). (D) IL-6 transcript
abundance in AT of 6J, Tlr2-/-, 10ScN, and 10J mice (n = 6, Diet effect P=0.34, Genotype
effect P=0.0005, Diet*Genotype interaction P=0.015). (E) MCP-1 transcript abundance in
AT of 6J, Tlr2-/-, 10ScN, and 10J mice (n = 6, Diet effect P=0.13, Genotype effect P<0.0001,
Diet*Genotype interaction P=0.14). (F) F4/80 transcript abundance in AT of 6J, Tlr2-/-,
10ScN, and 10J mice (n = 6, Diet effect P=0.19, Genotype effect P<0.0001, Diet*Genotype
interaction P=0.084). (G) NOS2 transcript abundance in AT of 6J, Tlr2-/-, 10ScN, and 10J
mice (n = 6, Diet effect P<0.0001, Genotype effect P<0.0001, Diet*Genotype interaction
P<0.0001). All displayed values were adjusted for initial body weight and beta actin
transcript level. Values represent LS means SEM for Diet*Genotype interaction. When
main effects (diet and genotype) or interaction term were P<0.15, Bonferroni correction was
used to determine significant difference between means as indicated by different letters.
 157

Figure 15. SV cells isolated from Tlr2-/- exhibit improved insulin sensitivity, but were not
fully protected against FA-induced insulin resistance.

14 d post-differentiated SV cells, in which approximately 40% exhibited an adipocyte

phenotype (e.g. lipid accumulation), were treated with 0.5 mM sodium palmitate, 10 g/mL
LPS, or 20 g/mL ZymA for 48 h. Insulin-stimulated 2-DG uptake was then determined (n =
6-8, Treatment effect P<0.0001, Genotype effect P<0.0001, Treatment*Diet effect
P=0.0007). A non-insulin stimulated control was included for reference. Results are
expressed as fold change versus insulin stimulated 6J control and represent LS means
SEM. When Treatment effect was significant (P<0.05), post-hoc t-test was used to determine
significant difference between LS means as indicated by different letters.
 158

CHAPTER 6. SUMMARY

The rise in obesity corresponds to the development of DM and CVD (1,2). The

molecular mechanism linking obesity to these inflammatory diseases is not fully elucidated

but may involve AT-specific inflammation (3). Adipocyte hypertrophy is associated

increased release of proinflammatory cytokines, as well as accumulation of macrophages in

AT (4,5). Corresponding to obesity-induced inflammation is an increased release of FFA

from adipocytes, which signals neighboring or downstream cells (6). The ability of FFA,

especially SFA, to mediate inflammation may be dependent on the presence of specific

innate immune receptors, Tlr2 and Tlr4. Several studies (7-9) have implicated the

involvement of these receptors in the development of inflammation and insulin resistance in

various cell populations. However, little is known about the relationship of these receptors in

DIO, more specifically, the role of AT inflammation in the development of systemic

inflammation and insulin resistance.

We demonstrated that 10ScN mice, with a 74 kb deletion from chromosome 4 that

precludes expression of Tlr4, were protected against DIO. This effect was more prominent in

mice fed a high SFA diet. Moreover, these mice exhibited a specific reduction in AT

inflammation as evidenced by the reduction in proinflammatory transcription factor

activation and subsequent gene expression. There was also a decrease in macrophage

accumulation in AT of mice fed the HFP diet. These data indicated that Tlr4 was involved in

high fat diet-induced adiposity and inflammation in AT. However, Tlr4 deficiency did not

fully attenuate TNF and IL-6 transcript abundance in AT of high saturated diet fed mice.

Corresponding to these findings was an increase in Tlr2 expression, which because of its
 159

ability to recognize SFA, represented an additional mechanism mediating obesity-induced

inflammation.

To determine involvement of Tlr2 in AT inflammation, we then utilized 3T3-L1

adipocytes to investigate the ability of the Tlr2 agonist, ZymA, to mediate inflammation and

insulin resistance. Our data showed that ZymA induced proinflammatory gene expression

similarly to palmitate and LPS treatment. Furthermore, the Tlr2 agonist stimulated NFB

nuclear translocation, although not to the same extent as the Tlr4 agonist, LPS. We also

demonstrated for the first time in adipocytes that ZymA caused nuclear translocation of the

proinflammatory transcription factor, AP-1. Thus, Tlr2 involvement in adipocyte

inflammation was apparent. Along with the proinflammatory response observed with ZymA,

LPS, and palmitate treated cells was an increased accumulation of ROS, which closely

paralleled expression of NOS2 transcript abundance. The ability of inflammation and

oxidative stress to mediate insulin resistance is well documented (6,10,11). Therefore, we

evaluated insulin-stimulated glucose uptake in adipocytes treated with SFA or Tlr agonist

and showed a significant reduction in insulin sensitivity with these treatments.

Activation of the intracellular kinase, JNK, is associated with Tlr signaling (7,12)

thus, we investigated the ability of a highly specific JNK inhibitor to reduce inflammation

and oxidative stress, as well as improve insulin sensitivity. There was a marked attenuation

of insulin resistance in ZymA, LPS, and palmitate treated adipocytes, which corresponded to

a reduction in NFB and AP-1 activation, proinflammatory gene expression, and ROS

accumulation. From these data we concluded that Tlr2 is likely involved in obesity-induced

inflammation and oxidative stress in AT, as well as insulin resistance in adipocytes.

 160

Additionally, it appeared that JNK activation was essential to the SFA and Tlr agonist

mediated effects.

Based on our studies with Tlr4 deficient mice and cultured adipocytes, we then

investigated the role of Tlr2 in obesity-induced inflammation and insulin resistance.

Moreover, we wanted to determine whether the dietary source of FA (saturated vs.

unsaturated) differentially modified inflammation and insulin resistance. Our data showed

that Tlr2-/- mice were protected from DIO. However, unlike Tlr4 deficient 10ScN mice, there

were no significant changes in body weight, energy intake, or lipid profile. These findings

indicated that Tlr2 deficiency significantly modified body composition, which may reflect

metabolic changes in energy metabolism. For instance, reduced adiposity in Tlr2-/- mice

associated with energy uncoupling could mediate lower AT accumulation.

We also demonstrated that serum markers of inflammation, including CRP,

endotoxin, and MCP-1 were lower in 10ScN mice fed a HFP diet, whereas only MCP-1 was

reduced in the Tlr2-/- mice fed a high fat diet. The disparity in these data may be due to

distinct genetic differences in background strain. The 6J background is more susceptible to

DIO, which in our studies was indicated by higher body weight and adiposity compared to

mice on 10J background. Therefore, the higher propensity toward obesity in Tlr2-/- mice may

mask potential changes in markers of systemic inflammation. Despite differences in

background, both Tlr2 and Tlr4 deficiency improved AT markers of inflammation and

oxidative stress including TNF, IL-6, MCP-1, F4/80, and NOS2 transcript abundance.

Similar to our previous findings, the protective effect of Tlr deficiency was more apparent in

mice fed the high SFA diet. In Tlr2-/- mice, attenuation of AT inflammation did not correlate

with improved circulating glucose or insulin concentration. However, SV cells isolated from
 161

AT of Tlr2-/- mice had a marked increase in insulin sensitivity, demonstrating the potential

involvement of Tlr2 in obesity-induced inflammation and insulin resistance.

The ability of both Tlr2 and Tlr4 to recognize FA and initiate proinflammatory

signaling in adipocytes, and other cell types, demonstrated the tremendous overlap of

inflammatory pathways. In order to completely understand the importance of these receptors

in obesity and FA-induced inflammation, it will be necessary to target each receptor

simultaneously either with siRNA or generation of double knockout mice. Furthermore, to

fully elucidate the impact of Tlr2 and Tlr4 on adiposity and insulin resistance, energy

expenditure will need to be evaluated, as well as more sensitive measures of insulin

sensitivity, such as the euglycemic-hyperinsulinemic clamp. Our studies also demonstrated

that Tlr2-/- and 10ScN mice had a greater protective effect when fed diet high SFA.

Therefore, future studies need to address the ability of various FA to induce an inflammatory

response through Tlr2 and Tlr4.

Overall, we have presented evidence that Tlr2 and Tlr4 were involved in obesity-

induced inflammation, as well as insulin resistance. Furthermore, the absence of these

receptors in AT attenuated inflammation, oxidative stress, and insulin resistance at the

cellular level (i.e., adipocytes), which in turn reduced systemic inflammation and insulin

resistance. The underlying mechanism involved recognition of specific FA by Tlr2 and Tlr4,

and more specifically interaction with SFA. Based on these studies, Tlr2 and Tlr4 may

represent ideal targets for pharmaceutical, as well as dietary, intervention designed to

attenuate obesity and related co-morbidities, including DM and CVD.

 162

References

1. Greenberg, A. S. & Obin, M. S. (2006) Obesity and the role of adipose tissue in
inflammation and metabolism. Am J Clin Nutr 83: 461S-465S.

2. Wellen, K. E. & Hotamisligil, G. S. (2005) Inflammation, stress, and diabetes. J Clin

Invest 115: 1111-1119.

3. Anonymous (2003) Obesity-induced inflammatory changes in adipose tissue. J Clin Invest

112: 1785-1788.

4. Cinti, S., Mitchell, G., Barbatelli, G., Murano, I., Ceresi, E., Faloia, E., Wang, S., Fortier,
M., Greenberg, A. S. & Obin, M. S. (2005) Adipocyte death defines macrophage localization
and function in adipose tissue of obese mice and humans. J Lipid Res 46: 2347-2355.

5. Takahashi, K., Yamaguchi, S., Shimoyama, T., Seki, H., Katsuta, H., Miyokawa, K.,
Tanaka, T., Yoshimoto, K., Ohno, H. et al. (2008) JNK- and I{kappa}B-dependent pathways
regulate MCP-1, not adiponectin, release from artificially hypertrophied 3T3-L1 adipocytes
preloaded with palmitate in vitro. Am J Physiol Endocrinol Metab.

6. Xu, H., Barnes, G. T., Yang, Q., Tan, G., Yang, D., Chou, C. J., Sole, J., Nichols, A.,
Ross, J. S. et al. (2003) Chronic inflammation in fat plays a crucial role in the development
of obesity-related insulin resistance. J Clin Invest 112: 1821-1830.

7. Senn, J. J. (2006) Toll-like receptor-2 is essential for the development of palmitate-

induced insulin resistance in myotubes. J Biol Chem 281: 26865-26875.

8. Nguyen, M. T., Favelyukis, S., Nguyen, A. K., Reichart, D., Scott, P. A., Jenn, A., Liu-
Bryan, R., Glass, C. K., Neels, J. G. & Olefsky, J. M. (2007) A subpopulation of
macrophages infiltrates hypertrophic adipose tissue and is activated by free fatty acids via
Toll-like receptors 2 and 4 and JNK-dependent pathways. J Biol Chem 282: 35279-35292.

9. Song, M. J., Kim, K. H., Yoon, J. M. & Kim, J. B. (2006) Activation of Toll-like receptor
4 is associated with insulin resistance in adipocytes. Biochem Biophys Res Commun 346:
739-745.

10. Kaneto, H., Matsuoka, T. A., Nakatani, Y., Kawamori, D., Matsuhisa, M. & Yamasaki,
Y. (2005) Oxidative Stress and the JNK Pathway in Diabetes. Curr Diabetes Rev 1: 65-72.

11. Dokken, B. B., Saengsirisuwan, V., Kim, J. S., Teachey, M. K. & Henriksen, E. J. (2008)
Oxidative stress-induced insulin resistance in rat skeletal muscle: role of glycogen synthase
kinase-3. Am J Physiol Endocrinol Metab 294: E615-621.
 163

12. Tsukumo, D. M., Carvalho-Filho, M. A., Carvalheira, J. B., Prada, P. O., Hirabara, S. M.,
Schenka, A. A., Araujo, E. P., Vassalo, J., Curi, R. et al. (2007) Loss-of-function mutation in
TLR4 prevents diet-induced obesity and insulin resistance. Diabetes.