Assignm MLS 405 Introduction to

ent 1A Molecular Diagnostics

Please answer the following questions. ** Remember, if I request a
specific format (such as answer in paragraph form, you must follow these
directions or points will be deducted from your total score.

QUESTIONS

1. Name the four nitrogen bases that are contained in nucleotides of DNA.
Adenine
Guanine
Cytosine
Thymine

2. Explain the differences between a nucleoside and a nucleotide.

Nucleoside contains a nitrogen base and a sugar
Nucleotide contains a nitrogen base, sugar, and phosphate
group

3. What does the term complementary refer to in the forming of

nucleotide bonds? Come up with a unique way that you will remember
which nucleotides bond together.
(For example: my personal way to remember it was A T Greene
County, because that is where I am from) Explain to me how you will
remember it.
Complementary means only A binds with T and G binds with C
Always Take Giant Cupcakes

4. What is the difference between a purine and a pyrimidine, and what

nitrogen bases are included in these groups?
Purine double rings
o Guanine
o Adenine
Pyrimidine single rings
o Thymine
o Cytosine

5. How many hydrogen bonds do the base pairs have?

A & T are held together by 2 hydrogen bonds
C & G are held together by 3 hydrogen bonds

6. What are the full names of Watson and Crick? What are they best
known for discovering?
James Watson

pg 1 50 points total
Assignm MLS 405 Introduction to
ent 1A Molecular Diagnostics
Francis Crick
Helical Structure

7. Who is credited for the discovery of DNA?

Johann Fredrich Miescher

8. Differentiate between the leading strand and the lagging strand in DNA
replication. (Answer in paragraph form, at least three sentences long,
but more if you need.)
The leading strand is a replicated strand of DNA which
grows continuously without any gaps. Its template opens in a 3
5 direction. The Lagging strand a replicated in short segments
called Okazaki fragments and its growth is discontinuous. The
lagging strands templates opens in a 5 3 direction.

9. In the DNA double helix formation, what does antiparallel orientation

mean?
Each strand runs in opposite directions

10. Which direction does DNA polymerase read the template?

3 to 5

11. Describe DNA polymerase and its function. (Please make your
answer at least 50 words long)
DNA polymerase is an enzyme found in all living
organisms. Every time a cell divides, DNA polymerase works with
nucleotides to duplicate a cells DNA, so that a copy of the
original DNA molecule can be passed to each daughter cell. The
enzyme is critical to the transmission of genetic information from
generation to generation. DNA polymerase proofreads the
strands for mutations and is able to correct some mistakes in the
genetic code.

12. Look at question number 3 at the end of chapter 1. The question

is:

Write the complementary sequence to the following:

5AGGTCACGTCTAGCTAGCTAGA3
The answer is (from page 475): 5TCTAGCTAGCTAGACGTGACCT3
Explain to me why the answer is written this way? Why did the author
write the 5 end first?

pg 2 50 points total