Overexpression and purification of Mycobacterium

tuberculosis secretory protein, ESAT-6

Dissertation Report Submitted To The

University Of Mumbai

For The Partial Fulfillment of The Degree of

Master of Science In Biotechnology

(By Papers)

By

Miss. ASMITA ARVIND JOGI.

Department of Biotechnology

RamnarainRuia College Of Arts & Science,

Matunga , Mumbai.

Under The Guidance of

DR. (MRS.) SAVITA P. KULKARNI.
Scientific officer G
Radiation medicine centre (BARC)
Parel Division Mumbai 400 012.
2015-2016.
 DECLARATION

I hereby declare that the dissertation entitled Overexpression and purification of

Mycobacterium tuberculosis secretory protein, ESAT-6 is being submitted as partial
fulfillment of the requirements for the Degree of Masters of Science in Biotechnology and is
not substantially the same as one which has already been submitted for a degree or any other
academic qualification in any other university, institute or examination body.

Place: MUMBAI (ASMITA A. JOGI )

Date :
 ACKNOWLEDGEMENT

In the realization of ones goal, man is not an independent identity.It is the encouargement
and guidance of his peer, associates and colleagues that follows him on the road to
success.Keeping this in mind I would like to take the oppurtunity to show my appreciation to
all those who have contributed towards my project, in one way or the other, big or small.

I avail this opportunity to express my deep sense of gratitude to head of radiation medicine
center , BARC, Mumbai ; Dr. M.G.R. Rajan for giving me this opportunity and permission to
commence my project at this esteemed institution and utilize all the required facilities without
reservation.

I express my sincere thanks to my project guide, Dr. (Mrs.) Savita Kulkani. Scientific Officer
G. who monitored my work and subjected to the scrupulous precision. This ensures
successful completion of the project within proviso. Her enthusiasm and love for work have
greatly motivated me. Her contribution to in valuable guidance and stimulating suggestions. I
am very thankful to her for devoting time, guide me to critically evaluate the dissertation to
make it comprehensible and scientifically correct.

I am very thankful to Shri. Muktikant ray, Shri. Kumarswami, Mr. Avik Chakarwarty, Ms.
Megha Sodani and Mr. Pramodkumar Gupta for providing useful insights, help and guidance
during my training period. I have been greatly benefited from their guidance to strengthen
working skill in the laboratory.

I would like to thank Mr. Shaikh for providing me all the necessary requirement without
which poject would not be complete.

I convey special thanks to the Principal, Dr. Suhas Pednekar and Miss. Supriya
Kale,Head of Department of Biotechnology, Ramnarain Ruia College of Arts & Science,
who have given me the golden opportunity to develop this project.

I also specially thank Ms. Rupali Pathanka and all other teachers of Department of
Biotechnology of Ruia College and my co-trainees Rucha, Anushree, Riya, Yashwi for
their support,help and co-operation.
Above all, I thank family for their unwavering inspiration, love and moral support.

Finally, I would like to thank each and every individual who help in making this project a
great learning experience.

(Asmita A. Jogi)
 ABSTACT

Tuberculosis bestows some of the major challenges in diagnosis and treatment. The
major challenge is to find the specific mycobacterial antigens that can provide desired
immunoprophylactic response against infection. Additionally, such antigens are required in
larger amounts for carrying out immunological characterization , but are difficult to getting
larger quantities due to slow growth, inherent pathogenicity and difficulty in biomedical
purification from mycobacterial tuberculosis cell. In such situation, overexpression of such an
antigen after cloning in appropriate vector system by recombinant DNA technology seems to
be an ultimate solution.

ESAT 6 being secretory protein is gradually released during the growth of the bacilli
increasing during the culture period. The protein is then translocate across cytoplasmic
membrane and localized in outer cell wall region to ESAT 6 antigen used in gamma interferon
assay to quantify INF-gamma released by T-cells in response to stimulation by mycobacterium
tuberculosis antigens.

A DNA encoding the 6-kDa early secretory antigenic target (ESAT-6) of

Mycobacterium tuberculosis was inserted into a bacterial expression vector of pQE30 resulting
in a 6x His-ESAT-6 fusion gene construction. This plasmid was transformed into Escherichia
coli strain M15 and effectively expressed. The expressed fusion protein was found almost
entirely in the insoluble form (inclusion bodies) in cell lysate. The inclusion bodies were
solubilized with 8M urea The main aim of the study was to standardize the protein obtained
from over express of ESAT 6 cloned antigen and its confiormation by western blot.
 INTRODUCTION

Tuberculosis is considered as one of the major health problems throughout the world . Nearly
80% of the tuberculosis cases occur in developing countries. Therefore, prompt diagnosis of
patients with tuberculosis is vital for reducing the incidence of this disease.

Genomic analysis of Mycobacterium tuberculosis identified 14 regions of difference named

RD114. These regions are present in the M. tuberculosis H37Rv and are not found in the
vaccine strain ofMycobacterium bovis var BCG . ESAT-6 (6-kD a early secretory antigenic
target or ESXA) and CFP-10 (10-kDa culture filtrate protein or ESXB) genes are located in
Region of Difference 1 (RD1). In RD1 locus, the esx genes are part of a conserved segment
encoding members of five additional protein families The esxA and esxB genes are part of
the esxA-V gene family, with 23 members in M. tuberculosis and code ESAT-6 andCFP-10
proteins.

ESAT-6 andCFP-10 have been described as dominant antigens recognized by T-cells and
consider as virulence factors in M. tuberculosis These two major proteins facilitate
translocation of M. tuberculosisfrom the phagosome into the host cell cytoplasm at later
stages of infection . There are dilemmas in precise, rapid, and cost-effective diagnostic tools
of tuberculosis, therefore evaluation of M. tuberculosisspecific antigens such as ESAT-6
andCFP-10 to achieve targets for accurate diagnosis is recommended. The aim of this study
was to clone, express and purify recombinant ESAT-6 andCFP-10 proteins of M.
tuberculosis in soluble form for future diagnostic purposes by Interferon- Release Assays
(IGRAs) using the ESAT-6/CFP-10 antigens.
 REVIEW OF LITERATURE

Tuberculosis(TB) is the leading cause of death in the world from a bacterial infectious
disease. The disease affects 1.8 billion people/year which is equal to one-third of the entire
world population.

In the United States TB is on the decline. In 2007 a total of 13,293 cases were
reported. The TB rate declined to 4.4 cases per 100,000 population, the lowest recorded rate
since national reporting began in 1953. Despite this overall improvement, progress toward
TB elimination has slowed in recent years; the average annual percentage decline in the TB
rate slowed from 7.3% per year during 1993--2000 to 3.8% during 2000--2007. Also, since
1993 there has been a gradual decline in the number of TB patients with co-infection with
HIV, and the number of cases of multiple drug-resistant TB has gradually dropped.

On the other hand, the proportion of TB cases contributed by foreign-born persons has
increased each year since 1993. In 2007 the TB rate in foreign-born persons in the United
States was 9.7 times higher than in U.S.-born persons. In many states, especially in the West,
the upper Midwest, and the Northeast, most new cases of TB now occur in individuals who
are foreign born.

Fig1 : Mycobacterium tuberculosis scanning electron micrograph. Mag 15549X.

Mycobacterium tuberculosis is the etiologic agent of tuberculosis in humans. Humans

are the only reservoir for the bacterium.Mycobacterium bovis is the etiologic agent of TB in
cows and rarely in humans. Both cows and humans can serve as reservoirs. Humans can also
be infected by the consumption of unpasteurized milk. This route of transmission can lead to
the development of extrapulmonary TB, exemplified in history by bone infections that led to
hunched backs. Other human pathogens belonging to the Mycobacterium genus
includeMycobacterium avium which causes a TB-like disease especially prevalent in AIDS
patients, and Mycobacterium leprae, the causative agent of leprosy.

General Characteristics

Mycobacterium tuberculosis is a fairly large nonmotile rod-shaped bacterium

distantly related to the Actinomycetes. Many non pathogenic mycobacteria are components
of the normal flora of humans, found most often in dry and oily locales. The rods are 2-4
micrometers in length and 0.2-0.5 um in width.
Mycobacterium tuberculosis is an obligate aerobe. For this reason, in the classic case
of tuberculosis, MTB complexes are always found in the well-aerated upper lobes of the
lungs.
The bacterium is a facultative intracellular parasite, usually of macrophages, and has
a slow generation time, 15-20 hours, a physiological characteristic that may contribute to its
virulence. Two media are used to grow MTB Middlebrook's medium which is an agar based
medium and Lowenstein-Jensen medium which is an egg based medium. MTB colonies are
small and buff colored when grown on either medium. Both types of media contain inhibitors
to keep contaminants from out-growing MT. It takes 4-6 weeks to get visual colonies on
either type of media.

Fig 2 :Colonies of Mycobacterium tuberculosis on Lowenstein-Jensen medium.

 Chains of cells in smears made from in vitro-grown colonies often form distinctive
serpentine cords. This observation was first made by Robert Koch who associated cord
factor with virulent strains of the bacterium. MTB is not classified as either Gram-positive or
Gram-negative because it does not have the chemical characteristics of either, although the
bacteria do contain peptidoglycan (murein) in their cell wall. If a Gram stain is performed on
MTB, it stains very weakly Gram-positive or not at all (cells referred to as "ghosts").
Mycobacterium species, along with members of a related genus Nocardia, are classified
as acid-fast bacteria due to their impermeability by certain dyes and stains. Despite this, once
stained, acid-fast bacteria will retain dyes when heated and treated with acidified organic
compounds. One acid-fast staining method forMycobacterium tuberculosis is the Ziehl-
Neelsen stain. When this method is used, the MTB. smear is fixed, stained with carbol-
fuchsin (a pink dye), and decolorized with acid-alcohol. The smear is counterstained with
methylene-blue or certain other dyes. Acid-fast bacilli appear pink in a contrasting
background. In order to detect Mycobacterium tuberculosis in a sputum sample, an excess of
10,000 organisms per ml of sputum are needed to visualize the bacilli with a 100X
microscope objective (1000X mag). One acid-fast bacillus/slide is regarded as "suspicious" of
an MTB infection.

Fig3 :Mycobacterium tuberculosis. Acid-fast stain.

Cell Wall Structure

The cell wall structure of Mycobacterium tuberculosis deserves special attention

because it is unique among procaryotes, and it is a major determinant of virulence for the
bacterium. The cell wall complex contains peptidoglycan, but otherwise it is composed of
complex lipids. Over 60% of the mycobacterial cell wall is lipid. The lipid fraction of MTB's
cell wall consists of three major components, mycolic acids, cord factor, and wax-D. Mycolic
acids are unique alpha-branched lipids found in cell walls of
Mycobacterium and Corynebacterium. They make up 50% of the dry weight of the
mycobacterial cell envelope. Mycolic acids are strong hydrophobic molecules that form a
lipid shell around the organism and affect permeability properties at the cell surface. Mycolic
Acids are thought to be a significant determinant of virulence in MTB. Probably, they prevent
attack of the mycobacteria by cationic proteins, lysozyme, and oxygen radicals in the
phagocytic granule. They also protect extracellular mycobacteria from complement
deposition in serum. Cord Factor is responsible for the serpentine cording mentioned above.
Cord factor is toxic to mammalian cells and is also an inhibitor of PMN migration. Cord
factor is most abundantly produced in virulent strains of MTB.

TB Infection TB disease in lungs

MTB present MTB present

Tuberculin skin test

Tuberculin skin test positive
positive

Chest X-ray usually reveals

Chest X-ray normal
lesion

Sputum smears and Sputum smears and cultures

cultures negative positive

Symptoms such as cough,

No symptoms
fever, weight loss

Often infectious before

Not infectious
treatment

Not defined as a case of

Defined as a case of TB
TB

Table 1: Tuberculosis: Infection vs Disease

Virulence Mechanisms and Virulence Factors

The virulence of Mycobacterium tuberculosis is extraordinarily complicated and

multifaceted. Although the organism apparently does not produce any toxins, it possesses a
huge repertoire of structural and physiological properties that have been recognized for their
contribution to mycobacterial virulence and to pathology of tuberculosis. Some of the general
properties of Mycobacterium tuberculosis that render it virulent are discussed below. This
section is followed by a more specific discussion of the complex array of virulence
determinants exhibited by this pathogen.
This should not surprising for one of the most successful human pathogen to save
evolved Some general properties of Mycobacterium tuberculosis that contributes to its
virulence entry .Special mechanisms for cell entry. The tubercle bacillus can bind directly to
mannose receptors on macrophages via the cell wall-associated mannosylated glycolipid,
LAM, or indirectly via certain complement receptors Intracellular growth. MTB can grow
intracellularly. This is an effective means of evading the immune system. In particular,
antibodies and complement are ineffective. Once MTB is phagocytosed, it can inhibit
phagosome-lysosome fusion by secretion of a protein that modifies the phagosome
membrane. It may remain in the phagosome or escape from the phagosome, in either case,
finding a protected environment for growth in the macrophage.

Detoxification of oxygen radicals. MTB interferes with the toxic effects of reactive oxygen
intermediates produced in the process of phagocytosis by three mechanisms:

1. Compounds including glycolipids, sulfatides and LAM down regulate the oxidative
cytotoxic mechanism.
2. Macrophage uptake via complement receptors may bypass the activation of a respiratory
burst.
3. The oxidative burst may be counteracted by production of catalase and superoxide
dismutase enzymes.

Antigen 85 complex. This complex is composed of a group of proteins secreted by MTB that
are known to bind fibronectin. These proteins may aid in walling off the bacteria from the
immune system and may facilitate tubercle formation.
Slow generation time. Because of MTB's slow generation time, the immune system may not
readily recognize the bacteria or may not be triggered sufficiently to eliminate them. Many
other chronic disease are caused by bacteria with slow generation times, for example, slow-
growing M. leprae causes leprosy,Treponema pallidum causes syphilis, and Borrelia
burgdorferi causes Lyme disease.

High lipid concentration in cell wall. This accounts for impermeability and resistance to
antimicrobial agents, resistance to killing by acidic and alkaline compounds in both the
intracellular and extracellular environment, and resistance to osmotic lysis via complement
deposition and attack by lysozyme

Cord factor. Cord factor (trehalose 6, 6' dimycolate) is a glycolipid found in the cell walls of
mycobacteria, which causes the cells to grow in serpentine cords. It is primarily associated
with virulent strains of MTB. It is known to be toxic to mammalian cells and to be an
inhibitor of PMN migration. Its exact role in MTB virulence is unclear, although it has been
shown to induce granulomatous reactions identical to those seen in TB.
M. tuberculosis virulence is studied both in tissue culture, using macrophages, dendritic cells
or pneumocytes, and in animal models, primarily mice. Tissue culture models are easier and
more humane to work with and give faster results, but they are limited to studying early
stages of infection. Ultimately, only in animal models can all the stages of TB be studied.
Since sequencing the Mycobacterium tuberculosis genome in 1998, genetic methods are more
commonly used to study the bacterium's virulence. The usual genetic approaches to study
virulence are to disrupt, inactivate, modify, delete or complement a gene and assess the
effects in the macrophage or mouse model.

Of approximately 4,000 genes in the Mycobacterium tuberculosis genome, 525 are involved
in cell wall and "cell processes", 188 genes encode regulatory proteins, and 91 genes are
involved in "virulence, detoxification and adaptation". Over 200 genes are identified as
encoding enzymes for the metabolism of fatty acids. This large number of M.
tuberculosis enzymes that putatively use fatty acids may be related to the ability of the
pathogen to grow in the tissues of the infected host, where fatty acids may be the major
carbon source. This is thought to be an important aspect of M. tuberculosis physiology during
infection. The point is that these genes, as well as those from other classes, may be directly or
indirectly involved in virulence.
Some of these genes and their products or activities are described below :

19-kDa protein. The 19-kDa protein is a secreted antigenic protein that is immunologically
recognized by T cells and sera from TB patients. When M. tuberculosis enters macrophages
and other phagocytic cells, this surface-exposed glyco-lipoprotein is thought to cause host
signaling events as it interacts with its receptor, TLR2. There is suggestive but inconclusive
evidence that mutant strains of Mycobacterium tuberculosis deficient in production of the 19-
kDa protein are rapidly cleared from the lungs and spleen of infected mice. Adding back the
wild-type M. tuberculosis gene to these strains allowed growth in lungs that was similar to
the growth of standard wild-type strains, which suggested that the 19-kDa protein is essential
for virulence. It has been reported that addition of the purified 19-kDa protein to human
macrophages causes upregulation of the Th1 cytokine IL-12. Similarly, the 19-kDa protein
can active human neutrophils .

Glutamine synthase. The enzyme is not secreted into culture filtrates during growth but
results from cell leakage and lysis. glnA1 mutations have not been made in M. tuberculosis,
but the specific glutamine synthase inhibitor, L-methionine-SR-sulfoximine (MSO), inhibits
the growth of Mycobacterium tuberculosis in vitro and in macrophages but has no effect on
nonpathogenic mycobacteria. In addition to its essential role in nitrogen metabolism,
glutamine synthase is involved in the synthesis of a poly-L-glutamate-glutamine cell wall
component found in pathogenic mycobacteria. These findings have led to the suggestion that
this enzyme is a possible target for the development of new drugs which have less toxicity
than MSO for humans.

Erp. Erp is a surface-located protein secreted by M. tuberculosis. The protein is similar to an

exported 28kDa antigen (the PLGTS antigen) in M. leprae and is not found in nonpathogenic
mycobacteria is function in virulence is unknown .

Mas. Mas encodes mycocerosic aid synthase, an enzyme that catalyzes the synthesis of long-
chain, multiply methylated branched fatty acids, called mycocerosic acids, that are found
only in pathogenic mycobacteria.

FbpA. Mycobacteria have three mycolyl-transferase enzymes, encoded by three genes, fbpA,
fbpB, and fbpC, that transfer long-chain mycolic acids to trehalose derivatives. The proteins
can also bind the cell matrix protein fibronectin. The Fbp proteins are also found in the
culture filtrate and are known as the antigen 85A, 85B, and 85C complex (Antigen 85
complex). The three fbp genes have been separately inactivated, but only the M.
tuberculosis fbpA mutant showed severely attenuated growth in human and murine
macrophages. The observation that these proteins produce a formidable immunologic
response led to the creation of a new live vaccine that was made by introducing the M.
tuberculosis fbpB gene into M. bovis BCG. This recombinant strain shows better protection
against virulent M. tuberculosis infection than does the parent BCG strain in a guinea pig
model.

OmpA. OmpA is a porin-like protein that can form pores in liposomes, a general property of
porin family proteins. ompA expression is induced by low pH, as well as by engulfment into
macrophages. An ompA mutant demonstrated the following phenotypes: although it showed
delayed growth at acid pH, it ultimately grew at wild-type levels; it could not take up small
molecules like serine at low pH; it showed reduced ability to grow in both human and murine
macrophages. This suggested that the environment encountered by M. tuberculosis during
infection is acidic, and that OmpA played a role in the bacterial response to this condition.

HbhA. HbhA is a heparin-binding hemagglutin protein that is localized on the surface of

virulent mycobacteria. hbhA mutants exhibited wild-type ability to be phagocytosed by and to
grow in murine or human macrophages. They are taken up poorly by pneumocytic cells,
although the bacterial generation time was normal intracellularly. The mutant grew normally
in the lungs of infected mice but had a longer generation time and reached a lower bacterial
load in spleens compared to the wild-type. The properties of this mutant indicate that HbhA is
important for M. tuberculosis interaction with pneumocytes and that this interaction may play
a role in extrapulmonary dissemination.

LAM. LAM is a complex glycolipid that contains repeating arabinose-mannose disaccharide

subunits. It is a major component of the M. tuberculosis cell wall. It is known to be an
immunomodulator analogous to the 19-kDa protein. Addition of LAM to murine
macrophages depresses IFN-gamma production. LAM can also scavenge oxygen radicals, in
vitro, and inhibits the host protein kinase C. It has been suggested that LAM functions to
downregulate host immune responses to M. tuberculosis infection, to protect the bacterium
from potentially lethal mechanisms like the respiratory burst.
MbtB. The mbt operon, consisting of mbtA through mbtJ, encodes enzymes whose function
is to synthesize mycobactin and carboxymycobactin, the major siderophores produced by M.
tuberculosis. The operon is part of a regulon that is repressed in high iron conditions. MbtB is
an enzyme that catalyzes an essential step in mycobactin synthesis.

Like many other bacterial pathogens, during infection, Mycobacterium

tuberculosisrequires an iron acquisition system consisting of siderophores, to obtain iron
from host iron-containing proteins such as transferrin and lactoferrin. Iron is essential for
growth of the bacteria and so the element must be extracted from protein-bound iron in the
host or from largely insoluble ferric salts in the environment. Iron uptake systems are
required to mobilize these forms of iron for transport into the cell. In bacteria, siderophores
usually perform this chelation and solubilization function, and the iron they carry is taken
into cells by high-affinity iron transport systems.

When the mbtB gene of M. tuberculosis is inactivated the resulting mutant strain is
unable to synthesize the two mycobactin-derived siderophores. The mutant showed wild-type
growth in iron-rich media, but grew poorly when iron is limited. It also grew more slowly
than the wild type in human macrophages indicating that the phagosome containing
mycobacteria may be low in iron. Furthermore, excess iron exacerbates the progression of TB
in humans and animal models. These observations suggest that iron availability, made
possible through the activities of siderophores, promotes the growth and virulence of the M.
tuberculosis.

Oxidative stress proteins. Most aerobic organisms have enzymes that degrade peroxides and
superoxide, which are normal byproducts of aerobic respiration, but also are toxic oxygen
radicals. These enzymes, generally superoxide dismutases, catalases and peroxidases, are also
important for the response to various external oxidative stresses. Since phagocytic cells
produce oxygen radicals during the respiratory burst to kill invading bacteria, it is not
surprising that these enzymes may contribute to M. tuberculosis virulence. Enzymes found
inM. tuberculosis that combat oxygen radicals include AhpC, an alkyl hydroperoxide
reductase that detoxifies organic hydroxyperoxides, and SodA and SodC, two species of
superoxide dismutase that degrade superoxides, which are normal by-products of aerobic
respiration and are also produced by the phagocytic respiratory burst.
Nitrate reductase. . M. tuberculosis was originally thought to be an obligate aerobe, but
there are numerous experimental indicators that the bacterium can grow in microareophilic
environments, especially during the later stages of infection, e.g., in lung granulomas. Wild
type M. tuberculosis has been shown to possess an inducible nitrate reductase (NarG encoded
by narG) which allows respiration using NO3 as a final electron acceptor. If anaerobic or
microareophilic growth is an important feature of M. tuberculosis physiology during
infection, the existence of nitrate reductase could be a significant factor in sustaining growth
under these conditions

Adherence

The specific bacterial adhesins involved in the complex interaction between M.

tuberculosis and the human host are largely unknown. Nevertheless, a few potential
adherence factors have been considered, including the heparin-binding hemagglutin (HbhA),
a fibronectin-binding protein, and a polymorphic acidic, glycine-rich protein, called PE-
PGRS. HbhA is a surface-exposed protein that is involved in binding Mycobacterium
tuberculosis to epithelial cells but not to phagocytes. It could be involved in extrapulmonary
spread after the initial long-term colonization of the host. Fibronectin-binding proteins
(FbpA), first identified as the -antigen (Antigen 85 complex), can bind to the extracellular
matrix protein fibronectin in vitro. This property may represent a mechanism of tissue
colonization. The surface-exposed PE-PGRS proteins found in M. tuberculosis
It has been shown recently that Mycobacterium tuberculosis produces pili during
human infection, which could be involved in initial colonization of the host. On the basis of
electron microscopic evidence, M. tuberculosis produces a dense fibrillar meshwork
composed of thin coiled, aggregated fibers resembling pili that extend many microns away
from the bacterial surface. These structures have been named Mycobacterium
tuberculosis pili or MTP. Additionally, biochemical and genetic data demonstrate that M.
tuberculosis produces pili, whose pilin subunit is encoded by the Rv3312A gene. The serum
of tuberculosis patients with active TB has been shown to contain IgG antibodies to MTP,
which suggests that the structures are produced in vivo during human infection. Furthermore,
isolated MTP bind to the extracellular matrix protein laminin in vitro, suggesting that they act
as an adhesin and may be an important host colonization factorof M.tuberculosis.
 Because MTP are produced in vivo, and the M. tuberculosis habitat is the human body
from which it is transmitted directly from person to person, it is likely that pili play an
important role in some aspect of human TB infection. If MTP are proven essential for M.
tuberculosis to establish infection, as in certain other microbes, then the purified MTP could
be considered as a vaccine candidate.

Clinical Identification and Diagnosis of Tuberculosis

The diagnosis of tuberculosis requires detection of acid-fast bacilli in sputum via the
Ziehl-Neelsen method as previously described. The organisms must then be cultured from
sputum. First, the sputum sample is treated with NaOH. This kills other contaminating
bacteria but does not kill the MTB present because cells are resistant to alkaline compounds
by virtue of their lipid layer. Skin Testing is performed as the tuberculin or Mantoux
test. PPD (purified protein derivative) is employed as the test antigen in the Mantoux test.
PPD is generated by boiling a culture of MTB, specifically Old Tuberculin (OT). 5 TU
(tuberculin units), which equals 0.000lmg of PPD, in a 0.1 ml volume is intracutaneously
injected in the forearm. The test is read within 48-72 hours.

Fig4 : Administering The Mantoux Test.

The test is considered positive if the diameter of the resulting lesion is 10 mm or greater. The
lesion is characterized by erythema (redness) and swelling and induration (raised and hard).
90% of people that have a lesion of 10 mm or greater are currently infected with MTB or
have been previously exposed to MTB. 100% of people that have a lesion of 15 mm or
greater are currently infected with MTB or have been previously exposed to MTB. False
positive tests usually manifest themselves as lesser reactions. These lesser reactions could
indicate prior exposure or infection with other mycobacteria or vaccination with BCG.
However, in places were the vaccine is not used, lesser reactions should be regarded as highly
suspicious.

False negatives are more rare than false positives but are especially common in AIDS
patients as they have an impaired CMI response. Other conditions such as malnutrition,
steroids, etc., can rarely result in a false negative reaction.

Tuberculosis Treatment

Because administration of a single drug often leads to the development of a bacterial

population resistant to that drug, effective regimens for the treatment of TB must contain
multiple drugs to which the organisms are susceptible. When two or more drugs are used
simultaneously, each helps prevent the emergence of tubercle bacilli resistant to the others.
However, when the in vitro susceptibility of a patient's isolate is not known, which is
generally the case at the beginning of therapy, selecting two agents to which the patient's
isolate is likely to be susceptible can be difficult, and improper selection of drugs may
subsequently result in the development of additional drug-resistant organisms.

Hence, tuberculosis is usually treated with four different antimicrobial agents The
course of drug therapy usually lasts from 6-9 months. The most commonly used drugs are
rifampin (RIF) isoniazid (INH), pyrazinamide (PZA ) and ethambutol (EMB) or streptomycin
(SM). When adherence with the regimen is assured, this four-drug regimen is highly
effective. Based on the prevalence and characteristics of drug-resistant organisms, at least
95% of patients will receive an adequate regimen (at least two drugs to which their organisms
are susceptible) if this four-drug regimen is used at the beginning of therapy. Furthermore, a
patient who is treated with the four-drug regimen, but who defaults therapy, is more likely to
be cured and not relapse when compared with a patient treated for the same length of time
with a three-drug regimen.

ESAT-6
ESAT-6, an abundantly secreted protein of Mycobacterium tuberculosis (M.
tuberculosis) is an important virulence factor, inactivation of which leads to reduced
virulence of M. tuberculosis. ESAT-6 alone, or in complex with its chaperone CFP-10
(ESAT-6:CFP-10), is known to modulate host immune responses; however, the detailed
mechanisms are not well understood. The structure of ESAT-6 or ESAT-6:CFP-10 complex
does not suggest presence of enzymatic or DNA-binding activities. Therefore, we
hypothesized that the crucial role played by ESAT-6 in the virulence of mycobacteria could
be due to its interaction with some host cellular factors. Using a yeast two-hybrid screening,
we identified that ESAT-6 interacts with the host protein beta-2-microglobulin (2M), which
was further confirmed by other assays, like GST pull down, co-immunoprecipitation and
surface plasmon resonance. The C-terminal six amino acid residues (9095) of ESAT-6 were
found to be essential for this interaction. ESAT-6, in complex with CFP-10, also interacts
with 2M. We found that ESAT-6/ESAT-6:CFP-10 can enter into the endoplasmic reticulum
where it sequesters 2M to inhibit cell surface expression of MHC-I-2M complexes,
resulting in downregulation of class I-mediated antigen presentation. Interestingly, the ESAT-
6:2M complex could be detected in pleural biopsies of individuals suffering from pleural
tuberculosis. Our data highlight a novel mechanism by which M. tuberculosis may undermine
the host adaptive immune responses to establish a successful infection. Identification of such
novel interactions may help us in designing small molecule inhibitors as well as effective
vaccine design against tuberculosis.

ESAT-6 Inhibits Production of IFN- gamma by Mycobacterium tuberculosis-Responsive

Human T Cells

Early secreted antigenic target of 6 kDa (ESAT-6) was originally identified as a

potent T cell Ag in the short-term culturefiltrate of M. tuberculosis. ESAT-6 subunit vaccines
induce protection against challenge with M. tuberculosis in mice, and a vaccine construct that
includes ESAT-6 and Antigen-85 reduces the bacillary burden after challenge with M.
tuberculosis in guinea pigs and nonhuman primates. Although the studies above suggest that
ESAT-6 is a potentialvaccine candidate, substantial evidence indicates that it is also a
virulence factor. The gene encoding ESAT-6, Rv3875, is in the region of difference (RD)1,
which is present in all pathogenic mycobacteria, including M. tuberculosis and M. bovis, but
not in attenuated M. bovis bacillus Calmette-Guerin (BCG). The gene encoding the M.
tuberculosis culture filtrate protein of 10 kDa (CFP10) is cotranscribed with esat-6. ESAT-6
and CFP10 are secreted as a 1:1 dimer by a specialized ESAT-6 secretion system, ESX-1.
 ESAT-6 is produced in the lungs of mice infected With RD1-complemented M. bovis
BCG , and gene deletion studies of M. tuberculosis, combined with reintroduction of RD1
into M. bovis BCG, demonstrated that secretion of ESAT-6 and CFP10 is required for
virulence and pathogenicity of M. tuberculosis, both for growth in macrophages and in mice .
Furthermore, orthologs of ESAT-6 and CFP10 are present in M. leprae, suggesting that they
are essential for pathogenic mycobacteriaThe mechanisms by which ESAT-6 and CFP10
contribute to virulence are not fully defined, but they are believed to include cytolysis of
alveolar epithelial cells and macrophages, favoring intercellular spread of M. tuberculosis .
ESAT-6 dissociates from CFP10 under acidic conditions in the phagosome and can
destabilize liposomes, perhaps allowing M. tuberculosis and its products to eventually escape
the phagosome. It has been shown that M. tuberculosis inhibits IL-12 p40 gene transcription
in infected macrophages, and this may affect the T cell responses to M. tuberculosis
infection. Recent studies with mutant M. tuberculosis strains with defects in proteins
associated with secretion of ESAT-6 and CFP10 suggest that ESAT-6 inhibits macrophage
IL-12 p40 expression and secretion. Further studies demonstrated that recombinant ESAT-6
inhibits secretion of IL-12 induced by multiple TLR agonists via binding to TLR2 and
interfering with the assembly of TLR signaling molecules .Therefore, ESAT-6 may indirectly
inhibit the capacity of T cell IFN-_ production through reduced IL-12 secretion by APC.
IFN-_ is critical for immunity to tuberculosis. Animals with deleted IFN-_ genes have
marked susceptibility to tuberculosis ,and persons with genetic defects in the IFN-_ receptor
or in the IL-12 pathway that leads to IFN-_ production develop severe disease due to M.
tuberculosis and other less virulent mycobacteria . Production of M. tuberculosis-induced
IFN-_ by PBMC from tuberculosis patients is decreased, compared with findings in healthy
tuberculin reactors, and patients with severe disease have the most marked defects in IFN-
gamma production.

E. coli host strain: E. coli M15

Any E. coli host strain containing both the expression (pQE) and the repressor
(pREP4) plasmids can be used for the production of recombinant proteins. The QIAexpress
System uses E. coli strain M15[pREP4] which permits high-level expression and is easy to
handle. E. coli strains that harbor the lacIq mutation, produce enough lac repressor to
efficiently block transcription, and are ideal for storing and propagating pQE plasmids. These
strains can also be used as expression hosts for expressing nontoxic proteins, but they may be
less efficient than the M15[pREP4] strain, and expression is regulated less tightly than in
strains harboring the pREP4 plasmid. If the expressed protein is toxic to the cell, leaky
expression before induction may result in poor culture growth or in the selection of deletion
mutants which grow faster than bacteria containing the correct plasmid. Note that E. coli
strains M15 do not harbour a chromosomal copy of the lacIq mutation, so pREP4 must be
maintained by selection for kanamycin resistance

pQE vectors

These low-copy plasmids (Figure --) have the following features:

Optimized promoteroperator element consisting of phage T5 promoter (recognized by the
E. coli RNA polymerase) and two lac operator sequences which increase lac repressor
binding and ensure efficient repression of the powerful T5 promoter
Synthetic ribosomal binding site, RBSII, for high translation rates
6xHis-tag coding sequence either 5' or 3' to the cloning region
Multiple cloning site and translational stop codons in all reading frames for convenient
preparation of expression constructs
-lactamase gene (bla) confers resistance to ampicillin (Sutcliffe 1979) at 100 g/ml (the
chloramphenicol acetyl transferase gene (CAT) present between t0 and T1 is not expressed)
ColE1 origin of replication
 Fig 5: pQE 30 vector

E. coli host strains

Any E. coli host strain containing both the expression (pQE) and the repressor
(pREP4)plasmids can be used for the production of recombinant proteins. The QIAexpress
Systemuses E. coli strain M15[pREP4] which permits high-level expression and is easy to
handle.. The M15 strain derived from E. coli K12 and have the phenotype NaIS, StrS, RifS,
Thi, Lac, Ara+, Gal+, Mtl, F, RecA+, Uvr+, Lon+. E. coli strains that harbor the lacIq
mutation, such as XL1 Blue, JM109 and TG1, produce enough lac repressor to efficiently
block transcription, and are ideal for storing and propagating pQE plasmids. These strains can
also be used as expression hosts for expressing nontoxic proteins, but they may be less
efficient than the M15[pREP4] strain, and expression is regulated less tightly than in strains
harboring the pREP4 plasmid. If the expressed protein is toxic to the cell, leaky expression
before induction may result in poor culture growth or in the selection of deletion mutants
which grow faster than bacteria containing the correct plasmid. Note that E. coli strain M15
do not harbour a chromosomal copy of the lacIq mutation, so pREP4 must be maintained by
selection for kanamycin resistance.

Polymerase chain reaction (PCR)

PCR amplifies a specific region of a DNA strand (the DNA target). Most PCR
methods typically amplify DNA fragments of between 0.1 and 10 kilo base pairs (kbp),
although some techniques allow for amplification of fragments up to 40 kbp in size. The
 amount of amplified product is determined by the available substrates in the reaction, which
become limiting as the reaction progresses.

A basic PCR set up requires several components and reagents. These components include:

DNA template that contains the DNA region (target) to amplify

Two primers that are complementary to the 3' (three prime) ends of each of the sense and
anti-sense strand of the DNA target
Taq polymerase or another DNA polymerase with a temperature optimum at around
70 C
Deoxynucleoside triphosphates (dNTPs, sometimes called "deoxynucleotide
triphosphates"; nucleotides containing triphosphate groups), the building-blocks from
which the DNA polymerase synthesizes a new DNA strand
Buffer solution, providing a suitable chemical environment for optimum activity and
stability of the DNA polymerase
Bivalent cations, magnesium or manganese ions; generally Mg2+ is used, but Mn2+ can be
used for PCR-mediated DNA mutagenesis, as higher Mn2+ concentration increases the
error rate during DNA synthesis
Monovalent cation potassium ions

The PCR is commonly carried out in a reaction volume of 10200 l in small reaction tubes
(0.20.5 ml volumes) in a thermal cycler. The thermal cycler heats and cools the reaction
tubes to achieve the temperatures required at each step of the reaction . Many modern thermal
cyclers make use of the Peltier effect, which permits both heating and cooling of the block
holding the PCR tubes simply by reversing the electric current. Thin-walled reaction tubes
permit favorable thermal conductivity to allow for rapid thermal equilibration. Most thermal
cyclers have heated lids to prevent condensation at the top of the reaction tube. Older
thermocyclers lacking a heated lid require a layer of oil on top of the reaction mixture or a
ball of wax inside the tube.

Parameters That Affect PCR

Essential components of polymerase chain reactions:

1. A thermostable DNA polymerase to catalyse template-dependent synthesis of DNA:
 Depending on the ability, fidelity, efficiency to synthesize large DNA products, a
wide choice of enzymes is now available. For routine PCRs, Taq polymerase(0.5-2.5 units
per standard 25-50 uL reaction)remains the enzyme of choice. The specific activity of most
commercial preparations of Taq is ~80,000 units/mg of protein. Since the efficiency of
primer extension with Taq polymerase is generally ~0.7, the enzyme becomes limiting when
1.4*1012 to 7*1012 molecules of amplified product have accumulated in the reaction.

2. A pair of synthetic oligonucleotides to prime DNA synthesis:

Design of the oligonucleotide primer being the most important factor that influence
the efficiency and specificity of the amplification reaction, careful designing of primers is
required to obtain the desired products in high yield, to suppress amplification of unwanted
sequences and to facilitate subsequent manipulation of the amplified product. Since the
primers so heavily influence the success or failure of PCR protocols, it is ironic that the
guidelines for their design are largely qualitative and are based more on common sense than
on well understood thermodynamic or structural principles.

3. Deoxynucleoside triphosphates(dNTPs)

Standard PCRs contain equimolar amounts of all four dNTPs. Concentrations of 200-
250M of each dNTP recommended for Taq polymerase in reactions containing1.5 mM
MgCl2. In a 50 uL reaction, these amounts should allow synthesis of ~6-6.5g DNA which
should be sufficient even for multiplex reaction in which eight or more primer pairs are used
at the same time. High concentrations of dNTPs (>4mM) are inhibitory, perhaps because of
sequestering of Mg2+. However, a satisfactory amount of amplified product can be produced
with dNTP concentrations as low as 20M- 0.5-1.0pM of an amplified fragment ~1 kb in
length. To avoid problems, stocks of dNTPs should be stored at -20oC in small aliquots that
should be discarded after the second cycle of freezing or thawing. During long term storage at
-20oC, small amounts of water evaporate and then freeze on the walls of the vial. To
minimize changes in concentration, vials containing dNTP solutions should be centrifuged,
after thawing, for a few seconds in a micro centrifuge.

4. Divalent cations
 All thermostable DNA polymerases require free divalent cations- usually Mg2+ for
activity. Some polymerases will also work, albeit less efficiently with buffers containing
Mn2+. Calcium ions are quite ineffective. Because dNTPs and oligonucleotides bind Mg2+,
the molar concentration of the cation must exceed the molar concentration of phosphate
groups contributed by dNTPs and primers. It is therefore impossible to recommend a
concentration of Mg2+ that is optional in all circumstances. Although a concentration of 1.5
mM of Mg2+ is routinely used, increasing the concentration of Mg2+ to 4.5 mM or 6mM has
been reported to decrease nonspecific priming in some cases and to increase it in others. The
optimal concentration of Mg2+ must therefore must be determined empirically for each
combination of primers and template. The preparations of template DNA should not contain
significant amount of chelating agents (like EDTA or negatively charged ions like PO43-),
which can sequester Mg2+.

5. Monovalent cations

Standard PCR buffer contains 50mM KCl and works well for amplification of
segments of DNA >500bp in length. Raising the KCl concentration to ~70-100mM often
improves the yield of shorter DNA segments.

6. Template DNA:

Template DNA containing target sequences can be added to PCR in single or double
stranded form. Closed circular DNA templates are amplified slightly less efficiently than
linear DNAs. All though the size of the template DNA is not critical, amplification of
sequences embedded in high molecular weight DNA(>10kb) can be improved by digesting
the template with a restriction enzyme that doesn't cleave within the target sequence.

When working at its best, PCR requires only a single copy of target sequence as template.
More typically, however, several thousand copies of the target DNA are seeded into the
reaction. In the case of mammalian genomic DNA,upto 1g of DNA is utilized per reaction,
an amount that contains ~3*105 copies of a single-copy autosomal gene. The typical amounts
of yeast, bacterial and plasmid DNAs used per reaction are 10g, 1g and 1pg respectively.
 The cycling reactions :
There are three major steps in a PCR, which are repeated for 30 or 40 cycles. This is
done on an automated cycler, which can heat and cool the tubes with the reaction mixture in a
very short time.

1. Denaturation at 94C :

During the denaturation, the double strand melts open to single stranded DNA, all enzymatic
reactions stop (for example : the extension from a previous cycle).

2. Annealing at 54C :

The primers are jiggling around, caused by the Brownian motion. Ionic bonds are constantly
formed and broken between the single stranded primer and the single stranded template. The
more stable bonds last a little bit longer (primers that fit exactly) and on that little piece of
double stranded DNA (template and primer), the polymerase can attach and starts copying the
template. Once there are a few bases built in, the ionic bond is so strong between the template
and the primer, that it does not break anymore.

3. extension at 72C :

This is the ideal working temperature for the polymerase. The primers, where there are a few
bases built in, already have a stronger ionic attraction to the template than the forces breaking
these attractions. Primers that are on positions with no exact match, get loose again (because
of the higher temperature) and don't give an extension of the fragment. The bases
(complementary to the template) are coupled to the primer on the 3' side (the polymerase
adds dNTP's from 5' to 3', reading the template from 3' to 5' side, bases are added
complementary to the template)
 Fig 6 : PCR chain reaction

Agarose Gel Electrophoresis

Agarose gel electrophoresis is the easiest and most popular way of separating and
analyzing DNA. Here DNA molecules are separated on the basis of charge by applying an
electric field to the electrophoretic apparatus. Shorter molecules migrate more easily and
move faster than longer molecules through the pores of the gel and this process is called
sieving. The gel might be used to look at the DNA in order to quantify it or to isolate a
particular band. The DNA can be visualized in the gel by the addition of ethidium bromide.

Agarose is a polysaccharide obtained from the red algae Porphyra umbilicalis. Its
systematic name is (14)-3,6-anhydro-a-L-galactopyranosyl-(1 3)--D
galactopyranan. Agarose makes an inert matrix. Most agarose gels are made between 0.7%
and 2% of agarose. A 0.7% gel will show good separation for large DNA fragments (5-10kb)
and a 2% gel will show good resolution for small fragments with size range of 0.2-1kb. Low
percentage gels are very weak (Note:- it may break when you lift them) but high percentage
gels are usually brittle and do not set evenly. The volume of agarose required for a minigel
preparation is around 30-50ml and for a larger gel, it is around 250ml.
 Fig7: Structure of agarose

Factors Affecting the Movement of DNA:

Voltage Applied
The migration rate of the linear DNA fragments through agarose gel is proportional to
the voltage applied to the system. As voltage increases, the speed of DNA also increases. But
voltage should be limited because it heats and finally causes the gel to melt.

Buffers
Several different buffers have been recommended for electrophoresis of DNA. The
most commonly used buffers are Tris-acetate-EDTA (TAE) and Tris-borate-EDTA( TBE).
The migration rate of DNA fragments in both of these buffers is somewhat different due to
the differences in ionic strength. These buffers provide the ions for supporting conductivity.

Staining and visualization

Fig 8:The gel with UV illumination: DNA stained with ethidium bromide appears as glowing
orange bands.

DNA as well as RNA are normally visualized by staining with ethidium bromide,
which intercalates into the major grooves of the DNA and fluoresces under UV light. The
ethidium bromide may be added to the agarose solution before it gels, or the DNA gel may be
stained later after electrophoresis. Destaining of the gel is not necessary but may produce
better images. Other methods of staining are available; examples are SYBR
Green, GelRed, methylene blue, brilliant cresyl blue, Nile blue sulphate, and crystal violet.

SYBR Green, GelRed and other similar commercial products are sold as safer
alternatives to ethidium bromide as it has been shown to be mutagenic in Ames test, although
the carcinogenicity of ethidium bromide has not actually been established. SYBR Green
requires the use of a blue-light transilluminator. DNA stained with crystal violet can be
viewed under natural light without the use of a UV transilluminator which is an advantage,
however it may not produce a strong band.

When stained with ethidium bromide, the gel is viewed with an ultraviolet (UV)
transilluminator. Standard transilluminators use wavelengths of 302/312-nm (UV-B),
however exposure of DNA to UV radiation for as little as 45 seconds can produce damage to
DNA and affect subsequent procedures, for example reducing the efficiency
of transformation, in vitro transcription, and PCR. Exposure of the DNA to UV radiation
therefore should be limited. Using a higher wavelength of 365 nm (UV-A range) causes less
damage to the DNA but also produces much weaker fluorescence with ethidium bromide.
Where multiple wavelengths can be selected in the transillumintor, the shorter wavelength
would be used to capture images, while the longer wavelength should be used when it is
necessary to work on the gel for any extended period of time.

The transilluminator apparatus may also contain image capture devices, such as a digital or
polaroid camera, that allow an image of the gel to be taken or printed.

COMPETENT CELL

Competent cells are E. coli cells that have been specially treated to transform
efficiently. There are two types of competent cells: chemically competent and
electrocompetent. If plasmid is simply added to E. coli, nothing happens! The cells must be
competent.
The transformation storage solution (TSS) buffer method, competence is induced by
polyethylene glycol (PEG). This technique is relatively simple and does not require heat
shock. Competence of bacterial cells is induced by the addition of low concentrations of
divalent cations Mg2+ and dimethyl sulfoxide (DMSO). PEG helps in shielding the negative
charges on the DNA molecule and host cell membrane; thus, repulsion between them is
reduced. The pH of the buffer is maintained at slightly acidic conditions to increase the cells
viability as well as transformation efficiency up to 107108 .
PEG is a polyether compound having many functions. In this case, it helps in
shielding the negative charges present on the DNA and host cell membrane. This results in
lowering of repulsion. In addition, PEG, being a larger molecule, coordinates with the water
molecules present in the bacterial suspension. This results in the increased concentration and
bioavailability of the plasmid DNA to pass through the membrane of a bacterial competent
cell. In other words, a highly effective plasmid concentration results in a more effective DNA
transformation into bacteria.

TRANSFORMATION
Bacterial transformation may be referred to as a stable genetic change brought about
by the uptake of naked DNA to increase DNA quantity; competence refers to the state of
being able to take up exogenous DNA from the environment.
Artificial competence can be induced in laboratory procedures that involve making
the cell passively permeable to DNA by exposing it to conditions that do not normally occur
in nature.
The surface of bacteria such asE. Coli is negatively Charged due to
phospholipids and lipopolysaccharides on its cell surface, and the DNA is also negatively
charged. One function of the divalent cation therefore would be to shield the charges by
coordinating the phosphate groups and other negative charges, thereby allowing a DNA
molecule to adhere to the cell surface.

DNA entry into E. coli cells is through channels known as zones of adhesion or
Bayers junction, with a typical cell carrying as many as 400 such zones. Their role was
established when cobalamine was found to competitively inhibit DNA uptake. Another type
of channel implicated in DNA uptake consists of poly (HB):poly P:Ca. In this poly (HB) is
envisioned to wrap around DNA (itself a polyphosphate), and is carried in a shield formed by
Ca ions. It is suggested that exposing the cells to divalent cations in cold condition may also
change or weaken the cell surface structure, making it more permeable to DNA. The heat-
pulse is thought to create a thermal imbalance across the cell membrane, which forces the
DNA to enter the cells through either cell pores or the damaged cell wall.

Overexoression by IPTG induction

Regulation of gene expression One important consideration in expressing a foreign

gene in bacteria is the fact that the foreign gene product may be toxic to E. coli. If this is the
case, allowing the gene to be constantly transcribed and translated could result in killing the
bacterial cells, which would defeat your purpose. Sometimes, even if the protein is not toxic
to the bacteria, production of large quantities of the protein could lead to the formation of
inclusion bodies, which are structures in the cell that contain aggregates of insoluble protein.
This makes it difficult to recover the protein easily. For these reasons, is a good practice, in
general, to arrange things so that one has control over the production of the protein. To do
this one can use a variety of tricks, the commonest of which relies on using a regulatory
sequence, the lac operator, from a bacterial gene,to control the expression of the foreign gene.
The lac operator is a component of a system which is involved in the control of lactose
metabolism in E. coli. This system operates as follows: When bacteria are grown in the
absence of lactose, they do not make beta galactosidase, an enzyme that metabolizes lactose.
If lactose is added to the medium, the cells very rapidly start to make the enzyme, by
transcribing and translating the lac Z gene, which encodes beta galactosidase. The way in
which this control is achieved is described below:

The lac operator, a sequence downstream of the site where RNA polymerase binds, is
normally occupied by a tetrameric protein called the lac repressor, that is the product of the
lacI gene. This is the state of affairs in the absence of lactose. As long as the repressor is
bound to the operator site, RNA polymerase cannot bind the promoter, and lac Z cannot be
transcribed. If lactose is now added, it binds to the repressor, causing conformational changes
in the latter, so that it no longer binds the operator site. This frees up the promoter for RNA
polymerase binding, leading to transcription of lac Z, and production of beta galactosidase.

In PQE 30, we have inserted the lac operators equence next to the T5 promoter, to
control the expression of the ESAT 6 gene. Instead of lactose, used a chemical analog,
isopropylthiogalactoside(IPTG), that is not metabolized by E. coli, as an inducer. This
inducer binds to the lac repressor, just as lactose would, and turns on the transcription of
ESAT 6. Normal E. Coli cells make some lac repressor, which is encoded by the bacterial lac
I gene. In our experiments we use a strain of E. coli in which the lac I gene has a mutant
promoter that leads to the production of about ten times as much lac repressor as usual.This
mutant lac gene is called lacI q. Strains bearing the lacI q mutation are ideal for expressing
genes under lac operator control, because they make a lot of repressor,thus ensuring that the
operator site is always occupied by the repressor until the inducer is added. For us, this means
that the ESAT 6 gene will remain turned off until we choose to turn it on by adding IPTG.

SDS PAGE

The separation of macromolecules in an electric field is called electrophoresis. A very

common method for separating proteins by electrophoresis uses a discontinuous
polyacrylamide gel as a support medium and sodium dodecyl sulfate (SDS) to denature the
proteins. The method is called sodium dodecyl sulfate polyacrylamide gel electrophoresis
(SDS-PAGE).
SDS (also called lauryl sulfate) is an anionic detergent, meaning that when dissolved
its molecules have a net negative charge within a wide pH range. A polypeptide chain binds
amounts of SDS in proportion to its relative molecular mass. The negative charges on SDS
destroy most of the complex structure of proteins, and are strongly attracted toward an anode
(positively-charged electrode) in an electric field.
Polyacrylamide gels restrain larger molecules from migrating as fast as smaller molecules.
Because the charge-to-mass ratio is nearly the same among SDS-denatured polypeptides, the
final separation of proteins is dependent almost entirely on the differences in relative
molecular mass of polypeptides. In a gel of uniform density the relative migration distance of
a protein (Rf, the f as a subscript) is negatively proportional to the log of its mass. If proteins
of known mass are run simultaneously with the unknowns, the relationship between Rf and
mass can be plotted, and the masses of unknown proteins estimated.

Protein separation by SDS-PAGE can be used to estimate relative molecular mass, to

determine the relative abundance of major proteins in a sample, and to determine the
distribution of proteins among fractions. The purity of protein samples can be assessed and
the progress of a fractionation or purification procedure can be followed. Different staining
methods can be used to detect rare proteins and to learn something about their biochemical
properties.

Silver Staining

Usually Silver Staining has better sensitivity than Coomassie Brilliant Blue Staining
and hence is preferred. It raises the sensitivity from microgram level to nanogram level of
protein.
In silver staining, proteins are first fixed onto the gel in acidic conditions where
protonation occurs. Excess acid is then removed by methanol.The gel is then sensitized using
sodium thiosulphate which exposes various functional groups like COOH, -NH3 etc on the
proteins. Then silver nitrate is added wherein Ag ions go n bind to the protein. After
providing alkaline conditions, Ag ions get reduced to metallic silver and black or brown
colored protein band appear on the gel.The reaction is then stopped by providing acidic
conditions.

The 6xHis tag

The 6xHis affinity tag facilitates binding to Ni-NTA. Using pQE vectors it can be
placed at the C- or N-terminus of the protein of interest. It is poorly immunogenic, and at pH
8.0 the tag is small, uncharged, and therefore does not generally affect secretion,
compartmentalization, or folding of the fusion protein within the cell. In most cases, the
6xHis tag does not interfere with the structure or function of the purified protein as
demonstrated for a wide variety of proteins, including enzymes, transcription factors, and
vaccines.
A further advantage of the 6xHis tag is that it allows the immobilization of the protein
on metalchelating surfaces such as Ni-NTA HisSorb Strips or Plates and therefore simplifies
many types of protein interaction studies. In addition, AntiHis Antibodies can be used for
detection. Ni-NTA technology Immobilized-metal affinity chromatography (IMAC) was first
used to purify proteins in 1975 (Porath et al. 1975) using the chelating ligand iminodiacetic
acid (IDA, Figure 4). IDA was charged with metal ions such as Zn2+, Cu2+, or Ni2+, and
then used to purify a variety of different proteins and peptides (Sulkowski 1985). IDA has
only 3 metal-chelating sites and cannot tightly bind metal ions. Weak binding leads to ion
leaching upon loading with strongly chelating proteins and peptides or during wash steps.
This results in low yields, impure products, and metal-ion contamination of isolated proteins.

Fig: 9

Nitrilotriacetic acid (NTA), exclusively available from QIAGEN, is a tetradentate chelating

adsorbent developed at Hoffmann-La Roche that overcomes these problems. NTA (Figure 9)
occupies four of the six ligand binding sites in the coordination sphere of the nickel ion,
leaving two sites free to interact with the 6xHis tag (Figure 10). NTA binds metal ions far
more stably than other available chelating resins (Hochuli 1989) and retains the ions under a
wide variety of conditions, especially under stringent wash conditions. The unique, patented
NTA matrices can therefore bind 6xHis-tagged proteins more tightly than IDA matrices,
allowing the purification of proteins from less than 1% of the total protein preparation to
more than 95% homogeneity in just one step .
 Fig:10

Reducing nonspecific binding

Since there is a higher potential for binding background contaminants under native
conditions than under denaturing conditions, low concentrations of imidazole in the lysis and
wash buffers (1020 mM) are recommended. The imidazole ring is part of the structure of
histidine (Figure 11). The imidazole rings in the histidine residues of the 6xHis tag bind to
the nickel ions immobilized by the NTA groups on the matrix. Imidazole itself can also bind
to the nickel ions and disrupt the binding of dispersed histidine residues in nontagged
background proteins. At low imidazole concentrations, nonspecific, lowaffinity binding of
background proteins is prevented, while 6xHis-tagged proteins still bind strongly to the Ni-
NTA matrix. Therefore, adding imidazole to the lysis buffer leads to greater purity in fewer
steps. For most proteins, up to 20 mM imidazole can be used without affecting the yield. If
the tagged protein does not bind under these conditions, the amount of imidazole should be
reduced to 15 mM.

Fig :11
Binding of tagged proteins to Ni-NTA resin is not conformation-dependent and is not
affected by most detergents and denaturants (Table 4, page 74). The stability of the 6xHis
Ni-NTA interaction in the presence of low levels of ME (up to 20 mM) in the lysis buffer can
be used to prevent the copurification of host proteins that may have formed disulfide bonds
with the protein of interest during cell lysis. Detergents such as Triton X-100 and Tween 20
(up to 2%), or high salt concentrations (up to 2 M NaCl) ,also have no effect on binding, and
may reduce nonspecific binding to the matrix due to nonspecific hydrophobic or ionic
interactions. Nucleic acids that might associate with certain DNA and RNA-binding proteins
are also removed without affecting the recovery of the 6xHis-tagged protein.

Western blotting

Gel electrophoresis

Western blot uses two different types of agarose gel: stacking and separating gel. The
higher, stacking gel is slightly acidic (pH 6.8) and has a lower acrylamide concentration
making a porous gel, which separates protein poorly but allows them to form thin, sharply
defined bands. The lower gel, called the separating, or resolving gel, is basic (pH 8.8), and
has a higher polyacrylamide content, making the gel's pores narrower. Protein is thus
separated by their size more so in this gel, as the smaller proteins to travel more easily, and
hence rapidly, than larger proteins.

The proteins when loaded on the gel have a negative charge, as they have been denatured by
heating, and will travel toward the positive electrode when a voltage is applied. Gels are
usually made by pouring them between two glass or plastic plates, using the solution
described in the protocol section. The samples and a marker are loaded into the wells, and the
empty wells are loaded with sample buffer. The gel is then connected to the power supply
and allowed to run. The voltage is very important, as a high voltage can overheat and distort
the bands.

Blotting

After separating the protein mixture, it is transferred to a membrane. The transfer is

done using an electric field oriented perpendicular to the surface of the gel, causing proteins
to move out of the gel and onto the membrane. The membrane is placed between the gel
surface and the positive electrode in a sandwich. The sandwich includes a fiber pad (sponge)
at each end, and filter papers to protect the gel and blotting membrane [Figure --]. Here two
things are very important:

(1) the close contact of gel and membrane to ensure a clear image and

(2) the placement of the membrane between the gel and the positive electrode.

The membrane must be placed as such, so that the negatively charged proteins can
migrate from the gel to the membrane. This type of transfer is called electrophoretic transfer,
and can be done in semi-dry or wet conditions. Wet conditions are usually more reliable as it
is less likely to dry out the gel, and is preferred for larger proteins.

Fig12 : Assembly of a sandwich in western Blot

The membrane, the solid support, is an essential part of this process. There are two
types of membrane: nitrocellulose and PVDF. Nitrocellulose is used for its high affinity for
protein and its retention abilities. However, it is brittle, and does not allow the membrane to
be used for reprobing. In this regard, PVDF membranes provide better mechanical support
and allow the blot to be reprobed and stored. However, the background is higher in the PVDF
membranes and therefore, washing carefully is very important.

Washing, blocking and antibody incubation

Blocking is a very important step of western blotting, as it prevents antibodies from

binding to the membrane nonspecifically. Blocking is often made with 5% BSA or nonfat
dried milk diluted in TBST to reduce the background.
 Nonfat dried milk is often preferred as it is inexpensive and widely available.
However, milk proteins are not compatible with all detection labels, so care must be taken to
choose the appropriate blocking solution. For example, BSA blocking solutions are preferred
with biotin and AP antibody labels, and antiphosphoprotein antibodies, since milk contains
casein, which is itself a phosphoprotein and biotin, thus interfering with the assay results. It is
often a good strategy to incubate the primary antibody with BSA since it is usually needed in
higher amounts than the secondary antibody. Putting it in BSA solution allows the antibody
to be reused, if the blot does not give good result.

The concentration of the antibody depends on the instruction by the manufacturer.

The antibody can be diluted in a wash buffer, such as PBS or TBST. Washing is very
important as it minimized background and removes unbound antibody. However, the
membrane should not be left to wash for a really long time, as it can also reduce the signal.

The membrane is then detected using the label antibody, usually with an enzyme such
as horseradish peroxidase (HRP), which is detected by the signal it produces corresponding to
the position of the target protein. This signal is captured on a film which is usually developed
in a dark room.

Quantification

It is very important to be aware that the data produced with a western blot is typically
considered to be semi-quantitative. This is because it provides a relative comparison of
protein levels, but not an absolute measure of quantity. There are two reasons for this; first,
there are variations in loading and transfer rates between the samples in separate lanes which
are different on separate blots. These differences will need to be standardized before a more
precise comparison can be made. Second, the signal generated by detection is not linear
across the concentration range of samples. Thus, since the signal produced is not linear, it
should not be used to model the concentration.
 MATERIALS AND MEATHODS
3.1 Confirmation of presence of ESAT-6 gene insert of M.tuberculosis in
the plasmids by polymerase chain reaction (PCR) :
PCR was carried out to confirm the presence of ESAT-6 insert in the plasmids stored at - 20.
Materials
1. Forward primer of ESAT-6
Sequence of forward primer: -
5'TAACGGAGCAAAGGATCCACAGAGCAGCAG3'
2. Reverse primer of ESAT-6
Sequence of reverse primer:
5'TTCTACGCGAGGATCCAAGCTTCTATGCGAACATCCC3'
3. Master mix :
Taq DNA polymerase ,dNTP's( containing 1 mM of each dATP, dTTP, dCTP,
dGTP) ,MgCl2 ,Buffer
4. Template : Recombinant PQE 30 plasmid with ESAT-6 insert.
5. Positive control DNA:M. tuberculosis H37Rv genomic DNA (500 ng)
6. PCR machine: Cycler Gradient Eppendroff
Set up For 1 reaction
Constituents Amount
Master mix 3 l
Forward primer 1 l
Reverse primer 1 l
Distilled water 19 l
Template 1 l
Total volume 25 l

Methods:
Twenty five micro-liter of reaction mixture prepared as above and was added to 0.2
ml PCR tubes. PCR was carried out in an Eppendorff thermal cycler to amplify the required
fragment from given PQE 30 plasmid with ESAT-6 insert. PCR consisted of 35 cycles,
each cycle comprising of following steps.
PCR program steps were as follows-

Steps Temperature Time

Initial Denaturation 94C 5 min
Denaturation 94C 1 min
Annealing 42C 2 min
Extension 72C 2 min
Cycle Repeat 35 times
Final extension 72C 10 min
End cycle

1.2 Agarose gel electrophoresis of amplicon

Materials:
1. 1 % agarose
2. 10 X TAE buffer ( 1000 ml)
48.4 gm Tris Base + 11.4 ml glycial acetic acid + 0.5 M EDTA ( 20 ml)

3. 6X gel loading dye

0.25% (w/v) Bromophenol blue +0.25% xylene cynol + 40% sucrose in H2O containing
Ceemee flurescent dye
4. Eppendroff tubes
5. Micropipette with tips
6. Agarose gel electrophoresis unit with power pack
7. 1% ethidium bromide: 10mg of ethidium bromide was dissolved in 1ml of D/W. The
solution is stored in amber colored bottle away from light.

Method:
1. Make 1% agarose- 0.8 gm of agarose dissolve in 40 ml of 1X TAE buffer and boil for 30
sec till agar get completely dissolved.
2. Clean the electrophoresis unit and pore agarose into the gel casting tray, having a gel
comb.
3. After the gel is solidified, add 300 ml of 1X TAE Buffer into it and remove the comb
without disturbing gel.
4. Sample preparation- 2 l of gel loading dye + 5 l of amplified DNA sample, was
carefully loaded into the wells.
5. Run the gel at 70 V till band reaches the end of the gel and was observed under UV
transilluminator

1.3 Preparation of competent E. coli cells

Materials:
1. E.coli M15[pREP4] cells preserve as a frozen glycerol stock in liquid nitrogen.
2. LB medium
LB agar 1.75 gm of LB agar in 50 ml of D/W
LB broth- 2 gm of LB broth in 100 ml ofD/W
3. TSS buffer ( 50 ml)
1 PEG 8000 5 gm
2 1M MgCl2 1.5 ml
3 DMSO 2.5 ml
4 LB broth By using LB make total
volume upto 50 ml
Filter sterilized with 0.22 m filter.

4. Kanamycin stock solution

Stock- 100mg/ml
Required- 25 g/ml
25 l of antibiotic from stock for 100 ml media
Use 12.5 l of antibiotic from stock for 50 ml media

5. Crushed ice
 6. 370 C shaker for incubation
7. Centrifuge

Method:-
DAY 1
1. Take a loopful of frozen E. coli M15[pREP4] cells from vial , and streak it out on LB
agar containing 25 g/ml kanamycin.
2. Incubate at 37C overnight.

DAY 2
3. Pick up a single colony and inoculate 10 ml of LB containing kanamycin (25 g/ml).
Grow overnight at 37C in shaker waterbath .

DAY 3
4. Add 0.5 ml overnight culture to 50 ml prewarmed LB broth containing 25 g/ml
kanamycin in a 250 ml flask, and shake at 37C until anOD of 0.6 at 600nm is
reached (approximately 90120 min).
5. Cool the culture on ice for 5 min, and transfer the culture to a sterile, round-bottom
centrifuge tube.
6. Collect the cells by centrifugation at low speed (5 min, 4000 x g, 4C).
7. Discard the supernatant carefully. Always keep the cells on ice.
8. Resuspend the cells gently in cold (4C) TSS buffer (The volume off TSS to use is
10% of the culture volume that is spun down)
9. Prepare aliquots of 100200 l in sterile microcentrifuge tubes and freeze in liquid
nitrogen or a dry-iceethanol mix. Store the competent cells at 70C.

1.4 Transformation of competent M15 cells with recombinant pQE30

Material:
1. An aliquot of frozen competent M15[pREP4] cells
2. Recombinant plasmid PQE 30 contaning ESAT-6gene which was confirmed by PCR
 3. LB medium
LB agar 3.5 gm of LB agar in 100 ml of D/W
LB broth- 0.1 gm of LB broth in 5 ml of D/W
4. Antibiotic preparation
Kanamycin stock solution
Stock- 100mg/ml
Required- 25 g/ml
Use 1.25 l of antibiotic from stock for 5ml of media
Use 25l of antibiotic from stock for 100 ml of media
Ampiciline stock solution
Stock- 100mg/ml
Required- 100 g/ml
Use 5 l of antibiotic from stock for 50 ml of media
Use 100 l of antibiotic from stock for 100 ml of media

Method: -
1. Thaw an aliquot of frozen competent E. coli M15[pREP4] cells on ice.
2. Gently resuspend the cells and transfer 100 l of the cell suspension into the
microcentrifuge tube with the 1 l of recombinant plasmid, mix carefully, and keep it on
ice for 60 min.
3. Add 0.9 ml LB broth to the cells and incubate for 60min at 37C in shaker waterbath
(Shaking increases transformation efficiency).
4. Plate out 50, 100, and 200 l aliquots on LB-agar plates containing 25 g/ml kanamycin
and 100 g/ml ampicillin. Incubate the plates at 37C overnight.

1.5 Plasmid extraction of recombinant PQE 30 containing ESAT-6 gene

Materials :
1. JONAKI ,BRIT, Plasmid extraction kit was used
2. Make buffers:
a. 3 ml of PD buffer( undiluted) + 1 ml of absolute alcohol
b. 1 ml if PE buffer( undiluted) + 2 ml of absolute alcohol
3. Reconstitution of RNAse A:
 a. RNAse should be dissolve in Buffer PE to obtained 10 mg/ml concentration.
The Reconstitution RNAse A should be heated at 100C for 20 minutes, cool
to room temperature and store at -20C .
4. following buffersare kept on ice.
a. Buffer PA
b. Buffer PC

Method:
1. Take 0.1 ml of the overnight culture into a microfuge tube. Centrifuge at 12000 rpm
for 1 min at 4C .
2. Remove medium by aspirations, leaving the pellets as dry as possible.
3. Resuspend the pellet in200 l of ice cold buffer PA by gental vortexing.
4. Add 1 l RNAse A stock to the cell suspension.
5. Add 200 l of buffer PB.
6. Close the tube tightly and mix the contens by inverting the tube slowly 4 times.keep
the tube on ice.
7. Add 300 l of ice cold buffer PC. Close the tube tightly and mix the contents by
inverting the tube slowly for 4 times.
8. Centrifuge at 13000 rpm for 5 min at 4C to get a white pellet aspirate the entire
supernated carefully and load onto spin column in 2 ml collection tube. If pellet get
disturb reapet the step again.
9. Close the cap and centrifuge at 9000 rpm for 1 min.
10. Discard the filtrates and place the column in same collection tube.
11. Add 500 l of PD buffer and centrifuge at 9000 rpm for 1 min. Discard the filtrates
12. Add 500 l of PE buffer and centrifuge at 13000 rpm for 3 min
13. Place the column in claen 1.5 ml microfuge tube and discard the collection tube.
14. Add 50 l of buffer PF prewarm at 65 C, incubate for 2-3 min at room temperature
and centrifuge at 10000 rpm for 3 min.
15. The eluted solution can be used directly for PCR or restriction digestion or can stored
at - 20C for further use.
3.6 Induction for overexpression of ESAT-6 protein using IPTG
Materials:

1. Single transformed colony containg PQE 30 with ESAT-6

2. Medium-
LB broth- 2 gm of LB broth in 100 ml of D/W
3. Antibiotic preparation
Kanamycin stock solution
Stock- 100mg/ml
Required- 25 g/ml
Use 1.25 l of antibiotic from stock for 5ml of media
Use 12.5 l of antibiotic from stock for 50 ml of media

Ampiciline stock solution

Stock- 100mg/ml
Required- 100 g/ml
Use 5 l of antibiotic from stock for 50 ml of media
Use 50 l of antibiotic from stock for 50 ml of media

4. IPTG ( 1M)
238 mg /ml in H2O , sterile filter, store in aliquots at -20C.

Method: -
1. Pick a single colonies of tranformants into 5 ml of LB medium containg ampiciline
(100 ug/ml) and kanamycine ( 25 g/ml).
2. Grow the culture overnight at 37C. Shaking
3. Transfer 0.5 ml overnight culture into 50 ml of LB broth containg ampiciline (100
g/ml) and kanamycine( 25 g/ml).and grow at 37C for approx 2-3 hrs with vigorous
shaking ,until the O.D. 600 is 0.5-0.6 .
4. Before induction remove 1 ml of culture and Mark as control 0 hr.
5. In remaining culture induce expression by adding IPTG to final concentration of 1 mM.
6. Incubate at 37C shaker.
 7. Remove 1 ml of induced culture after each 1 hr time interval ( label as 1 hr , 2hr, 3hr, 4
hr)

3.7 Harvesting and lysis of induced E.coli cells

For harvesting of cells :

For control and IPTG induced culture which is removed-
Cells were harvested by centrifugation ( 4000rpm for 5 mins at 4C) and supernatant
was discarded

For lysis of harvested cells:

Materials
Harvested cells
Lysis buffer

Lysis buffer composition:

Sr. Stock Required Volume/100ml

No composition
1 1% lysozyme (SRL) 0.2% 200 l
2 100mM PMSF 2mM 2.5ml
3 2M TrisHCl ( pH 8.0) 50mM 2.5ml
4 1M DTT (Sigma) (pH 8.0) 1mM 100 l
5 0.5M EDTA (pH 8.0) 2mM 400l

Method:

1. Cell pellet was weighed and was resuspended in lysis buffer ( for 1gm of pellet ,add 4
ml of lysis buffer )
2. Tube was incubated on ice for 20 mins
 3. Suspension was homogenized and sonicated briefly to decrese the viscosity.
4. Lyset was centrifuge ( 4000 rpm at 4C for 5 mins)
5. Supernated was save for SDS PAGE analysis, pellet used for harvested cells under
denaturing condition

3.8 For lysis of harvested cells under denaturing conditions

Materials:
Pellet fraction obtained in above step after lysis.
Lysis buffer containing 8M urea

Method :
1.Lysed cell pellet was weighed and was resuspended in urea containing lysis buffer.
2.Tube was incubated at 4C for 20 mins
3.Lyset was homogenized and centrifuged 4000 rpm at 4C for 5 mins.
4.Supenated was saved for SDS PAGE analysis.6

SDS polyacralamide gel electrophoresis (PAGE)

Materials-
1. 1M tris buffer(pH 8)
24.23 gm tris in 200 ml D/W [adjust the pH with HCl]

2. 1.5 M tris buffer (pH 8.8)

36.34 gm tris in 200 ml D/W [adjust the pH with HC]

3. 5X Tris glycine buffer ( pH 8.3) ( tank buffer)

Tris 6 gm + glycine 28.8 gm in 400ml of D/W [Adjust the pH]
Add SDS 2gm in 400 ml of tank buffer

4. 10% SDS
Add 1gm of SDS in 10 ml of D/W.
 5. 30 % acralamide gel
3 gm of acralamide in 30 ml of D/W

6. 10% APS ( prepare freshly before use)

0.1gm of APS in 1 ml of D/W

7. Vertical gel electrophoretic apparatus with power pack

8. Micropipettes with tips

Method:
Preparation of gel mix
4% stacking gel mix

Composition Amount
Distilled water 3.675 ml
30% acralamide gel 0.65 ml
1 M TrisHCl (pH 6.8) 0.625 ml
10% SDS solution 50 l
10% APS solution 38l
TEMED 7.5l
Total volume 5.0 ml

10% Resolving gel mix

Composition Amount
Distilled water 3.98 ml
30% acralamide gel 3.33 ml
1.5 M Tris HCl (pH 8.8) 2.5ml
10% SDS solution 75 l
10% APS solution 100l
TEMED 7.5l
Total volume 10ml
Sample preparation :
Sample obtained after IPTG induction add lysis buffer contains 8 M urea into it. Sonicate the
sample before use.16l of sample + 4 l of gel loading dye heat it at 70C for 5 min and load on the
gel.

1. Gel casting assembly was set up, leak test was performed and resolving gel mix was
th
poured upto 3/4 of the glass plate.(TEMED and APS being added just before
pouring the gel)
2. A thin layer of water was overlaid.
3. On polymerization of the resolving gel, water was wiped off using a blotting paper.
4. Stacking gel mix was then poured and comb was inserted in place.
5. On polymerization the comb was removed and the gel was transferred to the running
assembly.
6. Tank Buffer was added. Samples and the protein marker were prepared by mixing
with loading dye in ratios as required, boiled for around 3 mins and then loaded into
individual wells.
7. The gel was run at 50 V.

3.9 Silver staining of the PAGE gel

Materials:
1. Fixative (100 ml)
methanol - 45 ml
Glycial acetic acid -10ml
H2O- 45 ml
Formaldehyde- 75 l

2. Washing solution( 100 ml)

20% methanol ( 20 ml of. Methanol dissolve in 80 ml of D/W)

3. Sensitizing solution(100ml)
Na2S2O3 - 0.02gm + 100 ml D/W
 4. Staining solution(100ml)
AgNO3 -0.02 GM + 76l of formaldehyde + 100 ml of D/W

5. Developing solution (100ml)

Add 50 ml D/W + 6 GM sodium carbonate + 5 l of Na2S2O3( 0.02%) + 25ul of
formaldehyde make up the volume till 100 ml with D/W.

6. terminating solution.(100ml)
Glyacial acetic acid 12ml + D/W 88 ml

Method:

1. Wash the gel with distilled water twice ( 10 mins each on shaker)
2. Keep the gel in 20% Methanol(washing solution) ( on shaker at R.T. for 20 min)
3. Add sensitizing solution for 2 min.
4. Wash the gel twice with D/W for 2 Min
5. Add chilled staining solution and incubate in dark for 20 mins.
6. Wash with D/W twice (1 min each)
7. Add developing solution on it till bands are developed
8. After developing the band add terminating solution (12%) on it to terminate the
reaction.

3.10 . Ni NTA Column purification

Material
Lysis buffer (1 liter):
50 mM NaH2PO4 = 6.90 g NaH2PO4H2O (MW 137.99 g/mol)
300 mMNaCl = 17.54 g NaCl (MW 58.44 g/mol)
10 mM imidazole = 0.68 g imidazole (MW 68.08 g/mol)
Adjust pH to 8.0 using NaOH.

Wash buffer (1 liter):

50 mM NaH2PO4 = 6.90 g NaH2PO4H2O (MW 137.99 g/mol)
 300 mMNaCl = 17.54 g NaCl (MW 58.44 g/mol)
20 mM imidazole = 1.36 g imidazole (MW 68.08 g/mol)
Adjust pH to 8.0 using NaOH.

Elution buffer (1 liter):

50 mM NaH2PO4 = 6.90 g NaH2PO4H2O (MW 137.99 g/mol)
300 mMNaCl = 17.54 g NaCl (MW 58.44 g/mol)
250 mMimidazole =17.00 g imidazole (MW 68.08 g/mol)
Adjust pH to 8.0 using NaOH.

Method:

1. Wash Ni-NTA column with lysis buffer add 2 ml Ni-NTA slurry with lysis buffer.
2. Add cells which is suspended in lysis buffer after IPTG induction
3. Mix it with Ni-NTA slurry and keep on rotary shaker at RT for 2 hrs
4. After incubation add slurry into column containing filter disc and collect flow
through.
5. After selling the slurry into the column. Add 2ml if washing solution onto it and
collect the wash through.
6. Elute the solution with elution buffer , Collect the filtrates and subjected to SDS
7. PAGE for analysis of purified protein.
8. And gel further subjected to silver staining and Western blotting.

3.11 Western Blotting

Materials:

1. SDS page gel containing all filtrates

2. Transfer buffer(10X)
Tris 30gm + glycine 144gm
Dissolved in D/W and make volume up to 100Oml and store at 4C

To make 1X from 10 X=
 50 ml of 1X transfer buffer + 100 ml Methanol + 300 ml of D/W

3. 10X TBST buffer

Tris 15.125gm + NaCl 21.9 GM
Adjust pH to 7.5 with conc. HCl
Add 1% Tween 20 solution
Make up the final volume up to 250 ml
Store at 4C. Before use make its as 1X and use.

4. Blocking solution ( 5% skimmed milk in 1X TBST

5. primary antibody( anti his antibody)
6. Secondary antibody ( anti mouse HRP conjugate antibody)

Miscellaneous
1. Nitrocellulose membrane
2. 3 MM Whatmann paper
3. Western blotting electrophoretic apparatus
4. Transfer chember
5. Power pack
6. Shaker
7. X- ray developing system

Method :

1. The nitrocellulose membrane (0.2m) and 3MM Whatmann paper were cut according
to the gel size and soaked in 1X transfer buffer
2. The assembly was arranged: sponge- Whatmann paper- gel nitrocellulose membrane
Whatmann paper sponge.
3. It was place in transfer chamber filled with transfer buffer.
4. Transfer was carried out at 90V for 1 hour.
5. The assembly was removed. The nitrocellulose membrane was wash with 1X TBS-T
6. Membrane was stained with ponceau S solution ( 0.1% ponceay S(w/v) in 5% acetic
acid (w/v).to check whether the transfer occur or not.
7. The membrane was wash with the 1X TBS-T till the stain is removed.
8. It was put in blocking solution( 5% skimmed milk ) n shaker for 15-30 mins.
9. Then it was wash with 1X TBS-T for 2 mins
10. 1:2000diluted primary antibody in 1X TBS-T with 2.5% skimmed milk was added
and it was incubated for 5 hrs.
11. The membrane wash with 1XTBS-T on shaker at R.T 3 times ( 15 min each)
12. Add 1:4000 diluted secondayantibody in 1X TBS-T with 2.5% skimmed milk was
added and it was incubated for 2 hrs.
13. The membrane was wash with the 1X TBS-T onshaker at R.T 3 times( 15 mis each)
14. Membrane was developed using chemi-luminescence kit.
 RESULTS

4.1 Confirmation of presence of ESAT-6 gene insert of M.tuberculosis in

the plasmids by polymerase chain reaction (PCR)followed by agarose gel
electrophoresis :
Agarose gel electrrophoesis of PCR amplicons for ESAT-6 gene obtained when
recombinant plasmids clones were used as templates. Clone 1showed negative whereas
clone 2 and 3 showed positive PCR indicating absence and presence of inserts respectively.

Amplified ESAT -6 gene

Fig.1 Agarose gel electrophoresis of ESAT-6 gene amplified by PCR in recombinant

plasmids
Lane 1 : ladder
Lane 2 : negative control
Lane 4 :posive control ( template -500ng of std. Mycobacterium tuberculosisDNA)
Lane 5: template - Recombinant plasmid 1
Lane 6: template - Recombinant plasmid 2
Lane 7: template - Recombinant plasmid 2

4.2 Transformation of recombinant PQE 30 in competent cells

Competent cells of E. coli M15 were prepared using TSS method and transformation of
recombinant PQE 30 was carried out. To check the viability of the compitant cells,
aliquots were spread onto LB agar plate with Kanamycine. Fig 2__ shows that the
competence celss are live and are not dead due to treatment.
 Fig 2 : Competence cells formed using TSS method

The competent cells were further subjected to transformation with plasmids which showed
positive results and thus presence of ESAT-6 gene. To confirm the transformation,
aliquots were spread on LB plate containing kanamycine and ampicilline.

Fig 3 . E. Coli containing the recombinant plasmid (ESAT-6 gene insert in PQE 30
plasmid)

4.3 Plasmid extraction of recombinant PQE 30 containing ESAT-6 gene

Plasmids from different colonies of recombinant E.coli M15 5 grown on LB +
kanamycine + ampiciline plate were extracted using plasmid extraction kit. PCR of
extracted plasmid was carried out using designed ESAT-6 primers, after 35 cycle .agarose
gel electrophoresis of amplicons were carried out and gel observed under U.V.
transilluminator and image was capture using gel DOC system. Fig 4___ shows
 amplification of ESAT-6 gene from plasmids using ESAT-6 gene specific primers from
isolated colony indicating that presence of gene.

Amplified ESAT -6 gene

Fig 4 : Agarose gel electrophoresis of ESAT-6 gene amplified by PCR in plasmids

extracted from transformed colonies

4.4 Induction for overexpression of recombinant ESAT-6 protein using

IPTG
E.coli M15 M15 cells containing recombinant plasmid were induced for
overexpression by using 1mM IPTG for 4 hours after O.D.600wasriched to 0.6 . cells were
centrifuged and separated pellet and supernatant both were suspended inlysis buffer pellet
subjected to sonicate and denature it with 8M uria containg lysisbuffer. Both supernatant and
pellet were check for presence of recombinant protein. fig 5 illustrates SDS-PAGE showing
recombinant ESAT-6 in pellet, thus indicating its presence in inclusion bodies.

Fig 5 : SDS PAGE gel showing the unininduced and IPTG induced E.coli M15 lysate
Lane 1:IPTC induced pellet ( 3 hours )
Lane 2: IPTG induced supernatant ( 3 hours )
Lane 3 :IPTC induced pellet( 2 hours )
Lane 4 :IPTG induced supernatant( 2 hours )
Lane 5 : protein ladder
Lane 6 : IPTG induced supernatant( 4 hours )
Lane 7 :IPTC induced pellet( 4 hours )
Lane 8 : non induced lysate
Lane 9 :IPTC induced pellet( 1hour)
Lane 10: IPTG induced supernatant( 1hour )

4. 5 Purification of recombinant ESAT-6 protien using Ni-NTA column

After confirming presence of ESAT-6 protein in lysate by SDS- PAGE and silver
staining method,recombinant protein was bulk purified using Ni-NTA column
chromatography. Oveexpresssed protein was eluted using appropriate elution buffer
containing imidizole SDS-PAGE of eluted samples on 15% gel was carried out in order to
analyze the purity of the eluted fractions . Fig 6 and 7 shows presence of single bands
indicating presence of ESAT-6 antigen.

Fig 6 : Ni- NTA purified fraction of ESAT-6 protein

Lane 1 : protein marker
Lane 2 : flow through
Lane 3 : eluted protine fraction
 Fig 7 : Ni-NTA purified fraction of ESAT-6 protein
Lane 1: protein ladder
Lane 2:flow through
Lane 3:washing solution 1
Lane 4:washing solution 2
Lane 5:elutin buffer 1
Lane 6:elution buffer 2 ( showing band for ESAT-6)

4.6 Western blotting

Purified ESAT-6 were subjected to SDS-PAGE. After the run, proteins from gel were
transferred onto a nitrocellulose membrane. The membrane was stained with ponceau S solution to
confirm the successful transfer of proteins After washing off the stain blot was reacted with anti- his
antibody which was used as a primary antibody and leater with anti-mouse HRP conjugated antibody
(secondary antibody ) and the blot was developed using chemi-luminescence kit. Fig8 shows ponceau
S staining and Fig 9 shiows that the purified ESAT-6 react with anti His antibody and hence is
recombinant antigen.
Fig 8. Westrn bloted nitrocellulose stained with ponceau S solution showing purified
ESAT-6 protein
Lane 1,2,3,4 : purified ESAT-6 fractions
Lane 5 : protein ladder.

Fig 9 : Western blot developed with chemi-luminescence showing presence of recombinant

purified ESAT-6 protein

Lane 1,2,3,4 : purified ESAT-6 fractions

 DISCUSSION AND CONCLUSION

Tuberculosis (TB) remains a major global health problem. Human Tb is the most frequent
cause of death from a single infectious agent , being responcible for 8 million new cases and
approximately 1.6 million death annually. Given the infectious nature of pulmonary
tuberculosis fast and accurate diagnosis is an important element of TB treatment and control.

Current serological test for diagnosis of tuberculosis Are simple and inexpensive but have
certain limitations with respect to sensitivity and specificity. Sensitivity of these sero-
diagnostic test can be improved only with the use of purified antigens. These purified
antigens can also prove as potential candidates for useas subunit vaccines. Thus,
identification of such purified antigens of mycobacterial tuberculosis which are involved in
recognition by host immune system is required to improve the efficiency of serodiagnostic
test.

The main aim of the study was to overexpress and purification of recombinant protein and its
confirmation of Western Blot. This antigen is abundant and constitutes a major component in
culture filtrate as wall as in cell wall preparation. CFP 10 and ESAT 6 are interesting
candidates for the diagnostics of tuberculosis. These protein elicit a strong T-Cell response in
animal models of TB and human active TB infection. The ability of a protein to detect
antibody present during subclinical disease is an important as the sensitivity of the protein in
detecting antibody formed during active tuberculosis , since therapy for it can prevent the
development of active disease . the gene coding ESAT 6 is located in the RD1 region of the
M.TB which is responsible for virulence. During the course of passaging to obtained
attenuated strain, this region is lost as a result of which required immunity against TB is not
conferred by the conventional BCG vaccine.

Our object in this study was to overexpress early secretary antigenic target protein of M
tuberculosis in E.coli M15. The DNA segment corresponding to gene encoding ESAT 6
protein of M. tuberculosis was successfully amplified by PCR, cloned and reconbinat clones
were screened by PCR for confirmation of the insert. the cloned ESAT 6 were induced with
IPTG for overexpression of recombinant protein and SDS pahe followed by silver staing of
the gel was performed these expressed protein were purified by affinity chromatography in
Ni-NTA column run the gel and performed western blottingand then reacted with anti-
penta- his antibody followd by rabbit antimous antibody HRP conjugate for confiomation.
After purification and its cobfirmation the prurified antigen can be used further for the
detection of antibody against it in sera of Tb patient and also can be used after immunological
characteristics in the basic research for understanding the host parasite infection.
 REFERENCE
1. Forrellad MA, Klepp LI, Gioffre A, Sabio YGJ, Morbidoni HR, Santangelo MD, et al.
Virulence factors of the Mycobacterium tuberculosis complex. Virulence.
2012;17:4366.

2. Parkash O, Singh BP, Pai M. Regions of differences encoded antigens as targets for
immunodiagnosis of tuberculosis in humans. Scand J Immunol. 2009;70:345
357. [PubMed]

3. Pym AS, Brodin P, Majlessi L, Brosch R, Demangel C, Williams A, et al.

Recombinant BCG exporting ESAT-6 confers enhanced protection against
tuberculosis. Nat Med. 2003 May;9:5339. [PubMed]

4. van der Wel N, Hava D, Houben D, Fluitsma D, van Zon M, Pierson J, et al. M.
tuberculosis and M. leprae translocate from the phagolysosome to the cytosol in
myeloid cells. Cell. 2007;129:12871298.[PubMed]

5. Andersen, P., A. B. Andersen, A. L. Sorensen, and S. Nagai. 1995. Recall of long-

lived immunity to Mycobacterium tuberculosis infection in mice. J. Immunol.
154: 33593372

6. Sorensen, A. L., S. Nagai, G. Houen, P. Andersen, and A. B. Andersen. 1995.

Purification and characterization of a low-molecular-mass T-cell antigen secreted by
Mycobacterium tuberculosis. Infect. Immun. 63: 17101717.

7. Dietrich, J., R. Billeskov, T. M. Doherty, and P. Andersen. 2007. Synergistic effect of

bacillus calmette guerin and a tuberculosis subunit vaccine in cationic

8. liposomes: increased immunogenicity and protection. J. Immunol. 178: 37213730.

9. Pym, A. S., P. Brodin, L. Majlessi, R. Brosch, C. Demangel, A. Williams, K. E.

Griffiths, G. Marchal, C. Leclerc, and S. T. Cole. 2003. Recombinant BCG exporting
ESAT-6 confers enhanced protection against tuberculosis. Nat. Med. 9: 533539.

10. Olsen, A. W., A. Williams, L. M. Okkels, G. Hatch, and P. Andersen. 2004.

Protective effect of a tuberculosis subunit vaccine based on a fusion of antigen 85B
and ESAT-6 in the aerosol guinea pig model. Infect. Immun. 72: 61486150.

11. Langermans, J. A., T. M. Doherty, R. A. Vervenne, T. van der Laan, K. Lyashchenko,

R. Greenwald, E. M. Agger, C. Aagaard, H. Weiler, D. van Soolingen, et al. 2005.
Protection of macaques against Mycobacterium tuberculosis infection by a subunit
vaccine based on a fusion protein of antigen 85B and ESAT-6. Vaccine 23: 2740
2750.

12. Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon,

K. Eiglmeier, S. Gas, C. E. Barry, 3rd, et al. 1998. Deciphering the biology of
Mycobacterium tuberculosis from the complete genome sequence. Nature 393: 537
544.
13. Harboe, M., T. Oettinger, H. G. Wiker, I. Rosenkrands, and P. Andersen. 1996.
Evidence for occurrence of the ESAT-6 protein in Mycobacterium tuberculosis and
virulent Mycobacterium bovis and for its absence in Mycobacterium bovis BCG.
Infect. Immun. 64: 1622.

14. DiGiuseppe Champion, P. A., and J. S. Cox. 2007. Protein secretion systems in
mycobacteria. Cell. Microbiol. 9: 13761384.

15. Behr, M. A., and D. R. Sherman. 2007. Mycobacterial virulence and specialized
secretion: same story, different ending. Nat. Med. 13: 286287.

16. Abdallah, A. M., N. C. Gey van Pittius, P. A. Champion, J. Cox, J. Luirink, C. M.

Vandenbroucke-Grauls, B. J. Appelmelk, and W. Bitter. 2007. Type VII

17. secretionmycobacteria show the way. Nat. Rev. Microbiol. 5: 883891.

18. 13. Majlessi, L., P. Brodin, R. Brosch, M. J. Rojas, H. Khun, M. Huerre, S. T. Cole,
and C. Leclerc. 2005. Influence of ESAT-6 secretion system 1 (RD1) of
Mycobacterium tuberculosis on the interaction between mycobacteria and the host
immune system. J. Immunol. 174: 35703579.

19. Hsu, T., S. M. Hingley-Wilson, B. Chen, M. Chen, A. Z. Dai, P. M. Morin, C. B.

Marks, J. Padiyar, C. Goulding, M. Gingery, et al. 2003.

20. The primarymechanism of attenuation of bacillus Calmette-Guerin is a loss of

secreted lytic function required for invasion of lung interstitial tissue. Proc. Natl.
Acad. Sci.USA 100: 1242012425.

21. Pym, A. S., P. Brodin, R. Brosch, M. Huerre, and S. T. Cole. 2002. Loss of RD1
contributed to the attenuation of the live tuberculosis vaccines Mycobacterium bovis
BCG and Mycobacterium microti. Mol. Microbiol. 46: 709717.

22. Bartlett, J. M. S.; Stirling, D. (2003). "A Short History of the Polymerase Chain
Reaction".PCR Protocols. Methods in Molecular Biology 226 (2nd ed.). pp. 3
6. doi:10.1385/1-59259-384-4:3. ISBN 1-59259-384-4.

23. Carr AC, Moore SD (2012). Lucia, Alejandro, ed. "Robust quantification of
polymerase chain reactions using global fitting". PLOS ONE 7 (5):
e37640.doi:10.1371/journal.pone.0037640. PMC 3365123. PMID 22701526.

24. ^ :a b Joseph Sambrook and David W. Russel (2001). Molecular Cloning: A

Laboratory Manual (3rd ed.). Cold Spring Harbor, N.Y.: Cold Spring Harbor
Laboratory Press. ISBN 0-879-69576-5. Chapter 8: In vitro Amplification of DNA by
the Polymerase Chain Reaction

25. Pavlov, A. R.; Pavlova, N. V.; Kozyavkin, S. A.; Slesarev, A. I. (2004). "Recent
developments in the optimization of thermostable DNA polymerases for efficient
applications". Trends in Biotechnology 22 (5): 253
260.doi:10.1016/j.tibtech.2004.02.011. PMID 15109812.
26. Rychlik W, Spencer WJ, Rhoads RE (1990). "Optimization of the annealing
temperature for DNA amplification in vitro". Nucl Acids Res 18 (21): 6409
6412.doi:10.1093/nar/18.21.6409. PMC 332522. PMID 2243783.

27. ^ Jump up to:a b Sharkey, D. J.; Scalice, E. R.; Christy, K. G.; Atwood, S. M.; Daiss,
J. L. (1994). "Antibodies as Thermolabile Switches: High Temperature Triggering for
the Polymerase Chain Reaction". Bio/Technology 12 (5): 506
509. doi:10.1038/nbt0594-506.

28. :a b Chien A, Edgar DB, Trela JM (1976). "Deoxyribonucleic acid polymerase from
the extreme thermophile Thermus aquaticus". J. Bacteriol 127 (3): 1550
1557.PMC 232952. PMID 8432.

29. ^ :a b Lawyer, F.; Stoffel, S.; Saiki, R.; Chang, S.; Landre, P.; Abramson, R.; Gelfand,
D. (1993). "High-level expression, purification, and enzymatic characterization of
full-length Thermus aquaticus DNA polymerase and a truncated form deficient in 5' to
3' exonuclease activity". PCR methods and applications 2 (4): 275
287. doi:10.1101/gr.2.4.275.PMID 8324500.

30. Campbell Biology,7th edition

31. PCR from problematic templates. Focus 22:1 p.10 (2000).

32. Helpful tips for PCR. Focus 22:1 p.12 (2000).

33. vlab.amrita.edu,. (2012). Agarose Gel Electrophoresis (AGE). Retrieved 6 March

2016, from vlab.amrita.edu/?sub=3&brch=77&sim=1375&cnt=1

34. Chung, C. T. et al. (1989) One-step preparation of competent E. coli: Transformation

and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. USA
86:2172-2175.

35. Sisco, K. L.; Smith, H. O. (1979). "Sequence-specific DNA uptake in Haemophilus

transformation". Proceedings of the National Academy of Sciences of the United
States of America 76(2):
972976. doi:10.1073/pnas.76.2.972. PMC 383110. PMID 311478.

36. Donahue RA, Bloom FR (July 1998). "Large-volume transformation with high-
throughput efficiency chemically competent cells" (PDF). Focus 20 (2): 54
56. OCLC 12352630.

37. David Freifelder (1982). Physical Biochemistry: Applications to Biochemistry and

Molecular Biology (2nd ed.). WH Freeman. pp. 292293. ISBN 978-0716714446.
38. "Section III: Loading and Running DNA in Agarose Gels" (PDF). Lonza
Group. "DNA revealed" (PDF). National Centre for Biotechnology education.
University of Reading.

39. Grndemann D, Schmig E. (1996). "Protection of DNA during preparative agarose

gel electrophoresis against damage induced by ultraviolet
light" (PDF). Biotechniques 21 (5): 898903. PMID 8922632.

40. Corley RB. (2005). A Guide to Methods in the Biomedical Sciences. Springer.
p. 11.ISBN 978-0-387-22844-0.

41. Ambroz K. (2006-09-20). "Improving quantification accuracy for western

blots" (PDF).Image Analysis.

42. Stennert, E; Arold, R (1973). "The double external auditory canal (author's
transl)". HNO21 (10): 2936. PMID 4769330.

43. Gilda, J. E.; Gomes, A. V. (2013). "Stain-Free total protein staining is a superior
loading control to -actin for Western blots". Analytical Biochemistry 440 (2): 186
8.doi:10.1016/j.ab.2013.05.027. PMC 3809032. PMID 23747530.