Mol Breeding (2015) 35:142
DOI 10.1007/s11032-015-0339-9
Multiple loss-of-function putative aminotransferase alleles
contribute to low pungency and capsinoid biosynthesis
in Capsicum chinense
Yoshiyuki Tanaka . Tomomi Sonoyama . Yuji Muraga .
Sota Koeda . Tanjuro Goto . Yuichi Yoshida . Kenichiro Yasuba
Received: 20 March 2015 / Accepted: 1 June 2015
Springer Science+Business Media Dordrecht 2015
Abstract Capsicum chinense is a domesticated hot
pepper species in the Capsicum genus that originated in
the Amazon and is consumed in USA, the Caribbean
and South America. Although a characteristic of this
species is high pungency, some non-pungent or low-
pungent strains, called Aji Dulce (sweet pepper in
Spanish), exist in the Caribbean region. In the present
study, low-pungent C. chinense accessions were ana-
lyzed in order to elucidate the genetic mechanisms
responsible for low pungency. All low-pungent C.
chinense accessions in this study carried non-func-
tional alleles of putative aminotransferase (pAMT),
which catalyzes the formation of vanillylamine from
vanillin in the capsaicinoid biosynthetic pathway.
These low-pungent accessions produced capsinoids,
low-pungent capsaicinoid analogs. The pamt mutation
in each strain was characterized using allele-specific
markers, and one novel pamt allele (pamt7) was
identified. The pamt7 had a new hAT family transposon
Electronic supplementary material The online version of
this article (doi:10.1007/s11032-015-0339-9) contains supple-
mentary material, which is available to authorized users.
Y. Tanaka (&)  T. Sonoyama  Y. Muraga 
T. Goto  Y. Yoshida  K. Yasuba
Graduate School of Environmental and Life Science,
Okayama University, Okayama 700-8530, Japan
e-mail: yoshi-tanaka@cc.okayama-u.ac.jp
S. Koeda
Faculty of Agriculture, Kinki University, Nara 631-8505,
Japan
insertion in the second exon region, which caused the
loss of pAMT expression. pamt7 is apparently an
ancestral allele for pamt6 because the 7-bp insertion in
pamt6 can be regarded as a footprint of the transposon.
A phylogenetic analysis of pamt alleles was performed
to examine their relationships. Combined with previ-
ously reported pamt alleles, the Tcc family transposon
insertion and its excision were involved in the gener-
ation of various pamt alleles in C. chinense. A
phylogenetic analysis of pamt alleles showed that at
least five occurred within C. chinense after speciation
of the Capsicum genus. In conclusion, the results of the
present study identified pamt as the main and most
frequent gene controlling low pungency in C. chinense.
Allelic variations in loss-of function pamt and their
wide distribution demonstrated the potential of C.
chinense bioresources for genetic improvements to
pungency and metabolic profiles in hot pepper breed-
ing programs.
Keywords Hot pepper  Capsicum chinense 
Capsaicinoid  Capsinoid  Low pungency
Introduction
Hot pepper (Capsicum) is widely used worldwide as a
spicy seasoning and vegetable. The pungency of hot
pepper fruits has been attributed to the alkaloid
capsaicin and its analogs, called capsaicinoids (re-
viewed in Aza-Gonzalez et al. 2011). Its basic
123
142 Page 2 of 13
chemical structure is an acid amide of vanillylamine
combined with a fatty acid. The absence or small
amount of capsaicinoids is desirable when using
peppers as a vegetable, while the presence of capsai-
cinoids is preferred for their use as a spice or hot food.
Capsaicinoids are synthesized through the combi-
nation of two biosynthetic pathways: the phenyl-
propanoid pathway and branched fatty acid pathway
(Aza-Gonzalez et al. 2011). These pathways provide
vanillylamine from phenylalanine, and branched fatty
acids from valine or leucine. In the final step,
capsaicinoids are formed by the condensation of
vanillylamine and branched fatty acids. Mutations in
Pun1 have been identified as a qualitative genetic
factor causing non-pungency (Stewart et al. 2005).
Pun1 encodes an acyltransferase that acylates vanil-
lylamine with a fatty acid to form capsaicinoid. The
recessive allele pun1 (pun11) has a 2.5-kb deletion
between the promoter region and first exon, which
prevents transcription and translation of the gene and
leads to reduced capsaicinoid synthesis (Stewart et al.
2005). Previous studies on various pepper varieties
reported that pun11 was widely distributed among
non-pungent C. annuum varieties, which is econom-
ically the most important domesticated species world-
wide (Lee et al. 2005). To date, three loss-of-function
alleles of pun1 (pun113) have been identified in
Capsicum (Stewart et al. 2005, 2007; Stellari et al.
2010; Wyatt et al. 2012). In spite of the qualitative
effects of Pun1 on pungency, the content of capsai-
cinoids has been controlled by quantitative trait loci
(QTLs) (Blum et al. 2003; Ben-Chaim et al. 2006).
Therefore, challenges are associated with controlling
the content of capsaicinoids in pepper breeding
programs.
We recently demonstrated that a loss-of-function of
the putative aminotransferase gene (pAMT) caused
low pungency (Lang et al. 2009; Tanaka et al. 2010a).
pAMT encodes aminotransferase, which produces
vanillylamine, a precursor of capsaicinoids, from
vanillin (Curry et al. 1999). A mutation in pAMT was
previously shown to significantly decrease the content
of capsaicinoids, while simultaneously leading to the
accumulation of capsinoids instead of capsaicinoids.
Capsinoids are low-pungent capsaicinoid analogs that
were first isolated from the low-pungent strain CH-
19 Sweet (Yazawa et al. 1989; Kobata et al. 1998;
Lang et al. 2009). They share a similar structure to
capsaicinoids, but have an ester group instead of
123
Mol Breeding (2015) 35:142
amide group. The pungency of capsinoids was found
to be approximately 1/1000 that of capsaicinoids. In
spite of their low pungency, capsinoids exhibit similar
bioactivities to capsaicinoids (Luo et al. 2011; Sasa-
hara et al. 2010). Therefore, capsinoids are more
favorable as an ingredient in vegetables and supple-
ments. The pamt allele may become a useful gene for
controlling pungency and capsinoid contents in pep-
per breeding programs. However, in contrast to the
wide distribution of pun11, pamt mutations have only
been reported in two C. annuum strains, which have
different pamt alleles (pamt12) (Lang et al. 2009;
Tanaka et al. 2010a; Suppl. Fig. 1).
Capsicum chinense is another domesticated species
in the Capsicum genus that originated from the
Amazon and is consumed in USA, the Caribbean
and South America (Bosland and Votava 2000; Moses
et al. 2014). Although two of the characteristics of this
species are high pungency and a distinct aroma, some
non-pungent or low-pungent strains, called Aji
Dulce (sweet pepper in Spanish), also exist in the
Caribbean region. In C. chinense, one pun1 allele
(pun12) was identified in a non-pungent strain (Stewart
et al. 2007). However, pun12 is not widely distributed
among C. chinense. We previously reported that some
low-pungent C. chinense strains had the loss-of-
function alleles of pamt and produced capsinoids
(Tanaka et al. 2010b). In addition, each strain has
distinct pamt alleles. The four mutant alleles of pamt
have been identified in C. chinense (pamt36) (Tanaka
et al. 2010b; Koeda et al. 2014; Suppl. Fig. 1). C.
chinense appears to be a good genetic source for low
pungency and capsinoid breeding. However, it
remains unclear whether low pungency is caused by
pamt in all low-pungent C. chinense. In addition,
variations in pamt mutant alleles have not yet been
completely elucidated.
In the present study, low-pungent C. chinense
accessions, which were randomly selected from the
germplasm, were analyzed in order to elucidate the
genetic mechanisms underlying low pungency. All
low-pungent strains had pamt mutations, which
caused capsinoid biosynthesis. The pamt mutation in
each strain was characterized using allele-specific
markers, and one novel pamt allele was identified. In
addition, a phylogenetic analysis of pamt alleles was
performed to examine their relationships. We herein
attempted to elucidate the mechanisms by which
general pamt contributed to low pungency in C.
Mol Breeding (2015) 35:142 Page 3 of 13 142

chinense and also how allelic variations in pamt
occurred within C. chinense after speciation of the
Capsicum genus.
Materials and methods
low-pungent C. chinense accessions were chosen
based on their character descriptions provided by the
seed company. All plants were grown at the experi-
mental farm of Okayama University in 2013 and 2014.
All C. chinense strains used in this study were distinct
based on fruit shapes and colors.

Plant materials HPLC analysis for capsaicinoid and capsinoid

As shown in Table 1, 24 C. chinense accessions were
used in the present study, including 12 low-pungent
accessions. The accessions were purchased from
heirloom seed companies (Reimer Seeds, USA, and
Semillas La Palma, Spain). Possible non-pungent or
contents
Three immature fruits approximately 30 days after
flowering were used to determine capsaicinoid and
capsinoid contents. The fresh fruits were lyophilized
by a freeze drier for 3 days and then grounded in a

Table 1 Capsaicinoid and capsinoid content and loss-of-functional pamt type in C. chinense accessions
Accession lg/gDW fruit Capsinoid pamt Reference
ratioa allelesb
Capsaicinoid Capsinoid

7-Pot 23,303 1560.4 915 39.8 0.04

Trinidad scorpion moruga yellow 19,853 2404.6 754 26.0 0.04
Devils toungue 16,858 4754.5 610 140.8 0.03
Red Habanero 15,008 786.1 296 54.3 0.02
Bhut Jolokia 7751 928.3 308 53.5 0.04
Habanero hot 5063 159.8 151 5.9 0.03
Rocotillo 3376 150.0 347 178.3 0.09
Devils yellow 1966 158.4 231 21.2 0.11
Belize Sweet 95 18.6 852 141.6 0.90 pamt3 Tanaka et al. 2010b
LP1 57 9.7 513 97.1 0.90 pamt3
LP2 63 7.8 1047 30.8 0.94 pamt3
LP7 41 15.9 788 121.3 0.95 pamt3
LP8 152 23.8 1204 54.0 0.89 pamt3
LP9 124 23.5 1182 49.7 0.91 pamt3
LP10 16 6.5 415 21.7 0.96 pamt3
Zavory 46 7.6 1030 54.5 0.96 pamt4 Tanaka et al. 2010b
LP11 20 4.5 1281 151.8 0.98 pamt4
Aji Dulce strain2 16 1.6 2438 89.1 0.99 pamt5 Tanaka et al. 2010b
LP3 41 7.8 2004 277.1 0.98 pamt5
LP4 138 38.8 1485 170.1 0.91 pamt5
LP5 118 16.6 1595 173.5 0.93 pamt5
No. 80 40 1.9 1761 146.5 0.98 pamt6 Koeda et al. 2014
7
LP6 54 8.4 680 26.9 0.93 pamt This study
LP12 20 2.2 1189 27.7 0.98 pamt7
Mean standard error (n = 3)
a
Capsinoid ratio = {capsinoid contents/(capsaicinoid ? capsinoid contents)}
b
pamt alleles were determined by PCR analysis according to Supplemental Fig. 2

123
142 Page 4 of 13
blender. Capsaicinoids and capsinoids were extracted
from 200 mg of dry fruit powder in 4 mL acetone. The
supernatant was filtered into a 1.5-mL tube through a
filter (DISMIC 13HP, ADVANTEC) and then used for
the HPLC analysis.
The HPLC analysis was performed using the JASCO
PU-2080 Plus pump equipped with a UVVis detector
SPD-10A (Shimadzu, Kyoto, Japan) and Shimadzu CR-
6A integrator. Separation was performed on a Nucleosil
5 C18 column (250 9 4.6 mm i.d.). The eluent was a
mixture of methanol/water (75:25) at a flow rate of
1.0 mL/min. The UVVis detector was set at 280 nm.
The injection volume, run time, and temperature were
10 lL, 30 min, and 40 C, respectively. The capsinoid
content was considered as the sum of capsiate and
dihydrocapsiate, while the capsaicinoid content was
calculated as the sum of capsaicin and dihydrocapsaicin.
Standard mixtures of capsaicinoid (Merck) and capsi-
noid extracted from Himo (C. annuum) fruits were used
for retention time verification and quantification by
HPLC (Tanaka et al. 2010a).
DNA extraction
Genomic DNA was extracted from leaf tissues using
Nucleon PhytoPure (GE Healthcare, UK).
PCR-based markers to differentiate pamt alleles
PCR-based allele-specific markers were used to dis-
tinguish pamt alleles. The primers were designed
based on structural differences in pamt alleles, and
primer sequences were shown in Table 2. PCR
conditions and visualization were described in Suppl.
Fig. 2.
Genomic sequence analysis of novel pamt alleles
The genomic sequence of pamt was determined for
LP6. The genomic sequences covering the full-length
open reading frame (ORF) were amplified using four
sets of primers (F1: TCTTTCTCTTTCCTTAG-
CAAT and R282: GCAGCTTCAACAAGTCGAG
TC, 3rd_intron_F: CCCCCTCTTATGGGTGAAAC
and F-9th_intron_R: TCCAATCCTTATGCGCTA
CA, pamt3-fwd: CCTGTCCGTTTTATTTTGCAG
and 16th_intron_R: GCAACCAAAAGAGGAAC-
GAC, 16th_intron_F: GTCGTTCCTCTTTTGGTT
GC and 30 _of_stop_R: GCAAAGTTGCAAGGAGA
123
Mol Breeding (2015) 35:142
ACA). The genomic PCR consisted of 0.4 lL of
KOD FX neo (TOYOBO, Japan), 10 lL of buffer
(provided with the polymerase), 4 lL of dNTPs
(2 mM), and 0.5 lL of forward and reverse primers
(10 pmol) and was then adjusted to 20 lL with
superdistilled water. The PCR procedure was as
follows: 1 cycle of 2 min at 96 C; 30 cycles of 10 s
at 98 C, 30 s at 55 C, and 5 min at 68 C; and a
final extension of 15 min at 68 C. PCR products
were separated on a 1.0 % agarose gel and stained
with GelRed (Biotium) to confirm their amplifica-
tions. The PCR products were then purified with the
Exo Star kit (GE Healthcare), and nucleotide
sequencing was performed by the Eurofins sequenc-
ing service (Eurofins, Tokyo, Japan).ATGC (GENE-
TYX, JAPAN) was applied to analyze nucleotide
sequences. The sequence of novel pamt was depos-
ited in a database (DDBJ) under Accession No.
LC032110, together with wild pAMT allele
(LC032106) and other loss-of-function pamt alleles
(LC032107LC032109).
RT-PCR analysis for capsaicinoid biosynthetic
genes
A RT-PCR analysis was conducted to investigate
capsaicinoid biosynthesis-related gene expression in
low-pungent LP6 (pamt7/pamt7) and compare it with
pungent accession Habanero and non-pungent acces-
sion Kyo-Midori (pun11/pun11). Pepper fruits were
harvested 30 days after flowering, and the placenta
was separated for RNA extraction. Total RNA was
extracted using Sepasol-RNA I Super G (Nacalai,
Japan) and the RNeasy Mini spin column (Qiagen).
All RNA used for RT-PCR was treated with DNase I
prior to cDNA synthesis to remove DNA contamina-
tion. The RT reaction was performed using ReverTra
Ace (TOYOBO, Japan). The expression of capsaici-
noid biosynthesis-related genes (pAMT, Pun1, and
Kas) was analyzed by RT-PCR. The following primers
were used for RT-PCR; pAMT F (TCT TTCTCTTT
CCTTAGCAAT), pAMT R (ATAAACAAGCTTTC
GCCGTGA), Pun1 F (ATGGCTTTTGCATTAC-
CATCA), Pun1 R (TTTCGTAAAATCCCTCTCTCT
TC), Kas F (CCACCCTAGTGTTCCCACTT), and
Kas R (CCACAAAACATGAAGTTATGGAAA).
The primer sequences were designed based on the
nucleotide sequence for pAMT (GenBank Accession
No. AF085149), Pun1 (AY819027), and Kas
Mol Breeding (2015) 35:142 Page 5 of 13 142

Table 2 Primers used to determine loss-of-function pamt alleles

pamt Primer Primer sequence (50 30 ) Wild Mutant Target feature
allele name

pamt3 pamt3-fwd CCTGTCCGTTTTATTTTGCAG 122 bp 127 bp 5 pp (TGGGC) insertion in 8th exon

pamt3-rev TCAATGTTTTACCTGGCAAGTG
pamt4 pamt4-fwd GCCATTTTATCATTCATTTTGGA 1.5 kb 3.8 kb 2.3 kb insertion in 5th intron
pamt4-rev AAATGATCATGTTATGTTCAAAAA
pamt5 pamt5-fwd TGGTATTACAATAATGCCCTTGG 164 bp 172 bp 8 pp(GCCACACC) insertion in 6th
pamt5-rev TGTTTGAAGGTAACAAACATGAA exon
pamt6 pamt6-fwd AGATTTATGGGACATGATATGTTGG 107 bp 114 bp 7 bp (CTTTACT) insertion in 2nd
pamt6-rev CGAAAATAAGACAAAAATCTAACCTC exon
pamt7 F1 TCTTTCTCTTTCCTTAGCAAT 0.9 kb 3.7 kb 2.8 kb insertion in 2nd exon
R246 GTTGCGCACCATAAACCAGATA

(AF085148). Actin (AY572427) was used as an
internal control. The PCR consisted of 0.4 lL of
KOD FX neo (TOYOBO, Japan), 10 lL of buffer
(provided with the polymerase), 4 lL of dNTPs
(2 mM), and 0.5 lL of forward and reverse primers
(10 pmol) and was then adjusted to 20 lL with
superdistilled water. The PCR procedure was as
follows: 1 cycle of 2 min at 96 C; 35 cycles of 10 s
at 98 C, 30 s at 55 C, and 2 min at 68 C; and a final
extension of 4 min at 68 C. PCR products were
separated on a 1 % agarose gel, stained with GelRed,
and visualized using a UV transilluminator.
2 min at 68 C; and a final extension of 4 min at
68 C. The purification of PCR products and nucleo-
tide sequencing were carried out as described above.
ATGC (GENETYX, JAPAN) was applied to analyze
nucleotide sequences. A phylogenetic tree was con-
structed by using MEGA program (http://www.
megasoftware.net). In addition to 24 C. chinense
(Table 1), three C. frutescens and eight C. annuum
accessions were included to construct a phylogenetic
tree.
Results

Phylogenetic analysis of pamt alleles All low-pungent C. chinense accessions

The phylogenetic relationship between pamt alleles
was investigated based on intron sequences. The 16th
intron of pamt was amplified by genomic PCR using
primer sets (pAMT F1270: CGGTACATATTTTG-
GAGCACAA and pAMT R1481: ATAAACAAGCT
TTCGCCGTGA) and was then sequenced. Primer
sequences were designed on the basis of the pAMT
sequence of Habanero (GenBank Accession No.
AF085149). The PCR consisted of 0.4 lL of KOD
FX neo (TOYOBO, Japan), 10 lL of buffer (provided
with the polymerase), 4 lL of dNTPs (2 mM), and
0.5 lL of forward and reverse primers (10 pmol) and
was then adjusted to 20 lL with superdistilled water.
The PCR procedure was as follows: 1 cycle of 2 min at
96 C; 30 cycles of 10 s at 98 C, 30 s at 55 C, and
preferentially produced capsinoids
over capsaicinoids
Twelve low-pungent strains (LP1-12) were newly selected
from the C. chinense genetic bioresource, and the contents
of capsaicinoids and capsinoids were analyzed. Capsaici-
noid contents were less than 152 lg/gDW in all low-
pungent accessions (Table 1) and ranged between 16 and
152 lg/gDW among the accessions. Pungent C. chinense
strains contained higher contents of capsaicinoids with
various content ranges (196623,303 lg/gDW). All low-
pungent C. chinense accessions preferentially produced
capsinoids over capsaicinoids (Table 1). Capsinoid con-
tents ranged between 415 and 2438 lg/gDW in low-
pungent accessions. Pungent C. chinense preferentially
produced capsaicinoids over capsinoids.

123
142 Page 6 of 13
We previously reported that loss-of-function pamt
alleles caused low pungency and this was accompa-
nied by capsinoid biosynthesis (Lang et al. 2009).
Therefore, low pungency in LP1-12 may be related to
mutations in pamt. We conducted a molecular analysis
of pamt in low-pungent accessions.
Classification of pamt alleles based on PCR-based
markers
To date, four alleles of pamt have been identified in C.
chinense, (Tanaka et al. 2010b; Koeda et al. 2014). In
the present study, loss-of-function pamt alleles were
identified by PCR on the basis of their key mutational
features in order to examine allelic variations
(Table 2, Suppl. Fig. 1). pamt3 has a 5-bp insertion
in the 8th exon, which led to a frameshift mutation in
pAMT (Tanaka et al. 2010b). The 5-bp insertion was
detected with the primers pamt3-fwd and pamt3-rev.
The 127-bp band was amplified in seven low-pungent
accessions (Belize Sweet, LP1-2,7-10), while the
122-bp band was amplified in the other accessions
(Suppl. Fig. 2a). This result indicated that the seven
accessions had pamt3-type alleles. pamt4 has a trans-
posable element in the 5th intron, which caused the
aberrant expression of pAMT mRNA (Tanaka et al.
2010b). The 2.3-kb insertion was detected in Zavory
Hot and LP11 (Suppl. Fig. 2b), indicating that LP11
possessed a pamt4-type allele. pamt5 has an 8-bp
insertion in the 6th exon (Tanaka et al. 2010b). This
feature was detected in four low-pungent accessions
(Aji Dulce strain2 and LP3-5) (Suppl. Fig. 2c), which
showed that these accessions had pamt5. pamt6 has a
7-bp insertion in the 2nd exon, which caused a
frameshift mutation (Koeda et al. 2014). While the
114-bp product was amplified with pamt6-fwd and
pamt6-rev in reference Accession No. 80, the 107-bp
band was observed in other accessions, except for LP6
and LP12 (Suppl. Fig. 2d). No bands were amplified in
LP6 and LP12.
In summary, we identified four known alleles from
12 low-pungent cultivars; however, two accessions
(LP6 and LP12) could not be classified into any known
pamt types. Each pamt allele appears to have been
used to breed multiple low-pungent heirloom C.
chinense.
We also confirmed that the pamt mutation changed
the ratio of capsaicinoid and capsinoid contents. We
123
Mol Breeding (2015) 35:142
calculated the capsinoid ratio in each accession as
described below.
Capsinoid ratio fcapsinoid content=capsaicinoid
capsinoid contentsg
The ratio was \10 % in pungent accessions, while
pamt mutants had an inverse ratio ([90 %). No
difference was observed in ratios between loss-of-
function pamt alleles (Table 1). However, capsinoid
contents varied even among the same pamt accessions.
For example, the capsinoid content of LP8 was
threefold higher than that of LP10 even though both
accessions had the pamt3-type alleles (Table 1). This
result indicated that some genetic factors other than
pamt determined capsinoid contents.
The novel loss-of-function pamt allele had
a transposon insertion in the 2nd exon region
LP6 and LP12 were not classified into any type of
known pamt. We expected these accessions to have
some novel loss-of-function mutation in pAMT.
Therefore, we determined the complete genomic
sequence of pAMT in LP6.
In pungent C. chinense, pAMT consisted of 17
exons separated by 16 introns, which extended to
approximately 11 kb (Tanaka et al. 2010b). A BLAST
analysis revealed that pAMT was located on chromo-
some 3 in the pepper genome. pAMT cDNA has a
1377-bp ORF and encodes a peptide of 459 amino
acids.
When the genomic region between the 1st and 3rd
exons was amplified, a 0.9-kb fragment was obtained
from all accessions other than LP6 and LP12. In
contrast, a 3.7-kb fragment was amplified in LP6 and
LP12 (Fig. 1a). The sequence analysis revealed that
2.8 kb was inserted within the exon2 region (Fig. 1b).
The large insertion in the 2nd exon disrupted func-
tional pAMT. We named the novel allele pamt7. We
determined the complete sequence of pamt7 and
compared it with functional pAMT. Apart from the
2.8-kb insertion, other significant mutations were not
observed (Fig. 1b).
The 2.8-kb sequence present in pamt7 contained an
8-bp target site duplication and a 22- to 23-bp terminal
inverted repeat (TIR) (Fig. 2a). These characteristics
indicated that the 2.8-kb sequence was a member of
the hAT family of transposons. We previously
Mol Breeding (2015) 35:142
Fig. 1 Novel pamt allele found in LP6 and LP12. a A genomic
PCR analysis of pAMT to examine the region between the 1st
and 3rd exons. Primers F1 (TCTTTCTCTTTCCTTAGCAAT)
and R246 (GTTGCGCACCATAAACCAGATA) were used.
The size of the amplicon is indicated to the left. The
underlined accession indicates that the accession possessed
pamt7. M k/HindIII marker, 1 Af-erect, 2 Red Habanero, 3
identified two pamt alleles, pamt4 and pamt5, that were
caused by the insertion of a hAT family transposon,
which we named Tcc (transposon of C. chinense)
(2.3 kb) (Tanaka et al. 2010b). In this study, the
transposon in pamt7 showed high similarity to Tcc
(Fig. 2a). Therefore, we named the transposon in
pamt7 Tcc2. TIR sequences were conserved better in
Tcc2 than in Tcc, except that both elements generated
distinct 8-bp or 9-bp duplications at the target sites
(Fig. 2a). Tcc2 appeared to be non-autonomous,
similar to Tcc, because it did not encode transposase.
While Tcc encoded a short ORF, which exhibited
similarity to transposes, Tcc2 did not contain any ORF
(Tanaka et al. 2010b).
We found that the pamt7 structure was similar to
that of pamt6. While pamt7 contained a 2.8-kb
transposon in exon2, pamt6 had a 7-bp insertion in
exon2, which caused frameshift mutations (Koeda
et al. 2014). Comparisons of allelic structures between
pamt6 and pamt7 revealed that the locations of the
insertions were identical (Fig. 2b). This result indi-
cated that the 7-bp insertion was a footprint generated
by the excision of Tcc2. Thus, during the evolutionary
history of Capsicum, Tcc2 was inserted into the exon2
Page 7 of 13 142
Belize Sweet, 4 LP1, 5 LP2, 6 Zavory, 7 Aji Dulce strain2, 8
LP3, 9 LP4, 10 LP5, 11 LP6, 12 LP7, 13 LP8, 14 LP9, 15 LP10,
16 LP11, 17 LP12. b A schematic representation of the genomic
organization of the novel pamt, which was designated as pamt7.
The pamt7 allele contained Tcc2 in the 2nd exon region. Tcc2 is
a member of the hAT transposon super family and is 2.8 kb in
length
of pAMT, which disrupted gene function and resulted
in pamt7. When Tcc2 was excised from the region, it
left a 7-bp footprint, which resulted in pamt6 (Fig. 2c).
Therefore, the insertion and subsequent excision of
Tcc2 resulted in allelic variations in loss-of-function
pamt. In pamt3 or pamt5, a short nucleotide insertion in
the exon region caused frameshift mutations, which
disrupted pAMT function (Suppl. Fig. 1). These short
insertions were also likely to be a footprint of the
transposon.
The expression of pAMT was absent in the pamt7
mutant
We investigated the expression of capsaicinoid
biosynthesis-related genes in the fruits of low-pungent
LP6 (pamt7/pamt7) and compared it with that in
pungent accession and non-pungent accession (pun11/
pun11). Pepper fruits were collected at the mature
green stage, and RT-PCR was performed using pAMT,
Pun1, and Kas primers. These genes were previously
shown to be related to capsaicinoid biosynthesis
(Stewart et al. 2005; Abraham-Juarez et al. 2008).
The expression of Pun1 and Kas was confirmed in
123
142 Page 8 of 13 Mol Breeding (2015) 35:142

LP6. Although the expression of pAMT was observed

in Habanero, it was absent in LP6 (pamt7/pamt7)
(Fig. 3). This result indicated that the expression of
pAMT was disrupted by the Tcc2 insertion event at the
transcriptional level. This is in contrast to previous
findings on the pamt4 or pamt5 mutation in C. chinense
Zavory Hot and Aji Dulce strain2. pAMT was
expressed in these accessions, but aberrant splicing
variants of pAMT mRNA occurred (Tanaka et al.
2010b). This different transcriptional pattern between
pAMT alleles may be determined by the position of the
transposon insertion. In non-pungent accession
(pun11/pun11), the expression of pAMT and Kas as
well as Pun1 was absent (Fig. 3).

Phylogenetic analysis of pAMT alleles

in the Capsicum genus

In order to determine the evolutionary relationship

between pAMT alleles, a phylogenetic tree was
constructed based on the 16th intron sequence of
pAMT. The length of the intron sequence was
conserved in all 35 accessions (24 C. chinense, 3 C.
frutescens, 8 C. annuum), and an indel mutation was
not observed.
pAMT alleles were classified into five clusters. C.
chinense alleles were distinct from other Capsicum
species alleles (Fig. 4). All C. chinense alleles
belonged to clusters I or II. C. annuum alleles
belonged to cluster IV or V. C. frutescens alleles were
designated to cluster III. This result indicated that

Fig. 2 hAT family transposons associated with loss-of-function

mutations in pAMT. a A comparison of Tcc and Tcc2 structures.
pamt4 contained Tcc (2.3 kb) in the 5th intron region. pamt5 also
contained the Tcc (2.3 kb) insertion in the 3rd intron region.
pamt7, which was identified in this study, contained Tcc2 (2.8 kb)
in the 2nd exon. Underlined and red letters represent target site-
duplicated sequences. The arrows indicate terminal inverted
repeats. The 30 and 50 regions of Tcc2 had high similarity to those
of Tcc, but the center region lacked similarity to that of Tcc. The
center region of Tcc encodes 104aa ORF, which has similarity to
the hAT dimerization domain. b Comparison of gene structures
between pamt6 and pamt7. pamt6 contained a 7-bp insertion
(CTTTACT) in the 2nd exon, which led to a frameshift mutation.
pamt7 contained a hAT family transposon Tcc2 (2.8 kb) insertion
in an identical position. c The predicted generation process of
pamt6 and pamt7 via transposon mobilization. Tcc2 had been
inserted in exon2 of pAMT, which disrupted gene function and Fig. 3 RT-PCR analysis for capsaicinoid biosynthesis-related
resulted in pamt7 during the evolutionary process of Capsicum. genes. 1. Habanero (pungent), 2. LP6 (low-pungent, pamt7/
When Tcc2 was excised from the region, it left a 7-bp footprint, pamt7) 3. Kyo-midori (non-pungent, pun11/pun11). Actin was
which generated pamt6. (Color figure online) used as an internal control

123
Mol Breeding (2015) 35:142 Page 9 of 13 142

123
 142 Page 10 of 13
b Fig. 4 A phylogenetic tree of pAMT alleles based on the 16th
intron sequence (approximately 1.5 kb). The numbers at the
nodes are the bootstrap confidence values (%) with 1000
replicates. The scale bar indicates nucleotide substitutions per
site. The pAMT alleles were classified into five clusters. The
black box represents low-pungent accession, which has loss-of-
function pamt. a, c, f mean that the accession belongs to C.
annuum, C. chinense, and C. frutescens, respectively
alleles were not frequently exchanged between species
and also that alleles varied intraspecifically.
In C. annuum, two loss-of-function pamt alleles
(pamt1 and pamt2) have been reported in CH-19 Sweet
and Himo. CH-19 Sweet is a selected mutant from a
pungent strain native to Thailand (Yazawa et al. 1989).
Himo is a low-pungent landrace in Japan (Tanaka et al.
2010a). The two pamt alleles were classified into
clusters IV and V, respectively. This result indicated
that the pamt1 and pamt2 mutations occurred inde-
pendently in the lineage of C. annuum breeding.
The phylogenetic tree showed that the loss-of-
function mutation of pamt occurred at least five times
within C. chinense. Loss-of-function pamt alleles were
located in a distinct cluster with the exception that
pamt6 was genetically close to pamt7. Functional pamt
alleles and a loss-of-function allele were detected in the
same clusters. This result showed that pamt mutations
created low-pungent individuals from a pungent pop-
ulation several times during the evolutionary process of
C. chinense. While pamt3 was classified into cluster II,
the four remaining pamt alleles were designated to
cluster I. The pamt mutation appears to be more
frequent in cluster I than in cluster II.
Discussion
Capsicum chinense is the most widely cultivated hot
pepper in the Caribbean region, while C. annuum is an
economically important Capsicum species worldwide
(Bosland and Votava 2000). Although C. chinense is
well known for its higher pungency than that of other
domesticated species (Bosland and Baral 2007; Canto-
Flick et al. 2008), low-pungent C. chinense accessions,
called Aji Dulce, also exist (Votava and Bosland 2004).
Our previous study on several low-pungent accessions
showed that loss-of-function pamt mutations caused low
pungency and capsinoid biosynthesis (Tanaka et al.
2010b; Koeda et al. 2014). pamt mutations led to the
123
Mol Breeding (2015) 35:142
accumulation of vanillyl alcohol from vanillin, instead
of vanillylamine. Capsinoids are then synthesized by the
condensation of fatty acid moieties and vanillyl alcohol
(Sutoh et al. 2006; Han et al. 2013). Six non-functional
pamt alleles, two C. annuum alleles, and four C.
chinense alleles were previously identified (Lang et al.
2009; Tanaka et al. 2010a, 2010b; Koeda et al. 2014).
However, the mechanisms by which general pamt cause
low pungency in C. chinense and allelic variations in
pamt currently remain unknown.
In the present study, we determined the chemical
profiles of capsaicinoids and capsinoids in 12 low-
pungent heirloom accessions randomly selected from
C. chinense bioresources (Table 1). All low-pungent
accessions contained a higher content of capsinoids
with a trace amount of capsaicinoids. This result
indicated that pamt was the main and most frequent
genetic factor contributing to low pungency in C.
chinense. PCR-based markers identified pamt alleles
in each accession. Ten accessions had four known
pamt, while two accessions had a novel pamt allele
(Table 1). The novel pamt, named pamt7, contained a
transposon insertion in 2nd exon, which disrupted
pAMT function (Fig. 1). pamt7 is apparently an
ancestral allele for pamt6 because the 7-bp insertion
in pamt6 can be regarded as a footprint of Tcc2, i.e.,
pamt6 originated from pamt7 through the excision of
Tcc2 (Fig. 2b, c).
Although we did not identify all allelic variations,
most of the loss-of-function pamt allelic variations in C.
chinense were covered in this study. These five pamt
alleles have contributed to the breeding of low-pungent
C. chinense, and various low-pungent cultivars have
been developed in C. chinense. The distribution of these
alleles and their sequence information in this study will
provide fundamental information for the development
of allele-specific DNA markers, tracking the origin of
low pungency, and the effective utilization of C.
chinense bioresources in pepper breeding programs.
pAMT and its function in capsaicinoid biosynthesis
Capsaicinoids are synthesized through the combina-
tion of two biosynthetic pathways: the phenyl-
propanoid pathway and branched fatty acid pathway
(Aza-Gonzalez et al. 2011). Most of the structural
genes involving in this pathway have already been
isolated, with some of them being characterized in
detail including Pun1 and pAMT.
Mol Breeding (2015) 35:142
Pun1 encodes acyltransferase, the last enzyme
responsible for the condensation of vanillylamine and
fatty acids. Previous studies showed that loss-of-func-
tion pun1 led to the complete absence of capsaicinoids in
pepper fruits. The pAMT might be involved in the
conversion of vanillin to vanillylamine(Curry et al.
1999). We have identified and characterized a total of
seven pamt mutational alleles (Lang et al. 2009; Tanaka
et al. 2010a, b; Koeda et al. 2014). While the pun1
mutant showed the complete absence of pungency, all
pamt mutants still produced capsaicinoids in trace
amounts (Table 1). The remaining capsaicinoids in the
pamt mutant may have been due to another pAMT
paralog because a total of three pAMT paralogs have
been identified in pepper genome chromosomes 3 and 7
(Mazourek et al. 2009). Even though multiple copies of
pAMT were observed in the pepper genome, the
phenotypes of the pamt mutant indicated that pAMT
markedly contributed to capsaicinoid biosynthesis
among the paralogs in the present study.
pamt and pun1 appeared to have had different
effects on the expression of other structural genes. In
the pun1 mutants, the expression of Pun1 and most
other structural genes in the capsaicinoid pathway
were not detectable or significantly lower than that in
the pungent strain (Stewart et al. 2005, 2007). On the
other hand, the pamt mutation did not appear to have
an effect on the expression of other structural genes.
For example, pamt7/pamt7 showed the normal expres-
sion of Pun1 and Kas, and the capsaicinoid biosyn-
thesis pathway still functioned normally (Fig. 3). This
result is consistent with that obtained when the pamt
mutation occurred; an abundant amount of the
capsaicinoid analog capsinoid was produced through
the condensation of vanillyl alcohol and fatty acids.
Occurrence of the pamt mutation in Capsicum
chinense
In order to elucidate the relationship between pAMT
alleles and the origin of loss-of-function pamt alleles,
a phylogenetic tree was constructed based on intron
sequences. The results of a phylogenetic analysis
suggested that C. chinense pamt evolved indepen-
dently of C. annuum or C. frutescens. Five mutational
alleles of pamt occurred within C. chinense after
speciation of the Capsicum genus.
The comparison of pamt sequences suggested that
the Tcc family transposon insertion or its footprint
Page 11 of 13 142
after its excision was involved in the occurrence of C.
chinense pamt alleles (Fig. 2, Suppl. Fig. 1). Several
studies revealed that hAT family transposon insertions
inactivated gene function and determined agronomic
traits such as seed amylose content in maize or starch
in pea (Wessler et al. 1986; Bhattacharyya et al. 1990;
Vitte et al. 2014). A transposon insertion was also
shown to change the secondary metabolite pathway
such as anthocyanin (Nakatsuka et al. 2006).
While pamt alleles are widely distributed in C.
chinense, pamt alleles are likely to be restricted in C.
annuum. In C. annuum, most non-pungent peppers
have a loss-of-function mutation in the Pun1 gene
(Lee et al. 2005), and only two pamt accessions of C.
annuum have been reported to date. Their pamt alleles
resulted from one nucleotide insertion or SNP (Lang
et al. 2009; Tanaka et al. 2010a, b). One explanation
for the difference between two domesticated species is
that the Tcc family transposon was in an active state in
C. chinense only, which induced mutations in pAMT
(Grappin et al. 1996; Moon et al. 2006). Another
explanation is that pamt was selected based on human
preference for aromatic fruits. One of the distinct
characteristics of C. chinense is its aromatic fruit
(Koeda et al. 2014). A previous study reported that
variations in aromatic compounds, especially
branched fatty acid esters, corresponded well to
differences in pungency between accessions
(Wahyuni et al. 2013). pun1 accessions not only
lacked capsaicinoids, but were also low in volatiles
including branched fatty acid esters because of the
entire pathway leading to capsaicinoids being down-
regulated. In contrast, the expression of the structural
genes, Pun1 and Kas, remained unchanged in pamt
mutants, while that of pAMT was absent (Fig. 3).
These results suggested that even though pungency
decreased, pamt mutants maintained the capsaicinoid
pathway and production of volatiles. However, the
reason why pamt alleles are widely distributed in C.
chinense remains unclear. Further analyses that com-
pare transposon insertions and volatile profiles
between accessions are needed in order to more
clearly understand the wide distribution of pamt.
pamt is useful for the quantitative control
of capsaicinoid contents
While pungent accessions in this study contained high
amounts of capsaicinoids, pamt accessions contained
123
142 Page 12 of 13
only trace amounts of capsaicinoids (Table 1). Thus, a
marked difference was observed in capsaicinoid
contents between pAMT and pamt accessions. We
may be able to manipulate capsaicinoid contents easily
through the single gene introduction of pamt. There-
fore, pamt may be useful when pepper breeders
attempt to develop low-pungent cultivars. In addition,
the pamt mutation increases capsinoid contents by
switching the capsaicinoid pathway to the capsinoid
pathway. Capsinoids have similar beneficial bioactiv-
ities to those of capsaicinoids, but with very low
pungency (Sasahara et al. 2010; Haramizu et al. 2011;
reviewed in Luo et al. 2011). Due to the characteristic
of low pungency, capsinoids have been attracting
increasing attention from pepper breeders. Therefore,
pamt may become an important tool for manipulating
the pungency and functional value of pepper fruits.
The pamt accessions identified in this study or their
allelic variations may provide useful information for
pepper breeding.
A significant difference was observed in capsinoid
contents between the same pamt allele accessions
(Table 1). This result indicated that some genetic
factors determined capsinoid content quantitatively.
Thus, the content of capsinoid is controlled by
multiple genes in a complex manner. It has been
reported that Pun1 is indispensable for not only
capsaicinoid production but also capsinoid production
(Han et al. 2013). However, the control of capsinoid
contents has not yet been examined in detail. Several
QTL analyses identified many QTL related to capsai-
cinoid contents (Blum et al. 2003; Ben-Chaim et al.
2006; Yarnes et al. 2012). These QTL also would be
involved in capsinoid content.
In conclusion, the results of the present study
identified pamt as the main and most frequent gene
controlling low pungency in C. chinense. All low-
pungent C. chinense accessions in this study carried
non-functional pamt and produced capsinoids, low-
pungent capsaicinoid analogs. Multiple loss-of-func-
tion alleles were observed in C. chinense bioresources,
including one novel pamt. The novel pamt had a new
hAT family transposon insertion in the 2nd exon
region (Fig. 1). Combined with previously reported
pamt alleles, the Tcc family transposon insertion and
its excision were involved in the occurrence of various
pamt in C. chinense. A phylogenetic analysis of pamt
alleles showed that at least five pamt alleles had
occurred within C. chinense after speciation of the
123
Mol Breeding (2015) 35:142
Capsicum genus (Fig. 4). Allelic variations in loss-of-
function pamt and their wide distribution demon-
strated the potential of C. chinense bioresources for
genetic improvements to pungency and metabolic
profiles. The pamt accessions identified in the present
study can be used not only for C. chinense, but also for
C. annuum breeding because interspecific crossing
between C. annuum and C. chinense is possible
(Voorrips et al. 2004).
Acknowledgments This study was supported in part by
Grant-in-Aid for Research Activity Start-up (No. 25892020),
JAPAN, and a Grant (PGRAsia Project) from the Ministry of
Agriculture, Forestry, and Fisheries of Japan.
Conflict of interest The authors declare that they have no
conflict of interest.
References
Abraham-Juarez MD, Rocha-Granados MD, Lopez MG, Riv-
era- Bustamante RF, Ochoa-Alejo N (2008) Virus-induced
silencing of Comt, pAmt and Kas genes results in a
reduction of capsaicinoid accumulation in chili pepper
fruits. Planta 227:681695
Aza-Gonzalez C, Nunez-Palenius HG, Ochoa-Alejo N (2011)
Molecular biology of capsaicinoid biosynthesis in chili
pepper (Capsicum spp.). Plant Cell Rep 30:695706
Ben-Chaim A, Borovsky Y, Falise M, Mazourek M, Kang BC,
Paran I, Jahn M (2006) QTL analysis for capsaicinoid
content in Capsicum. Theor Appl Genet 113:14811490
Bhattacharyya MK, Smith AM, Ellis THN et al (1990) The
wrinkled-seed character of pea described by Mendel is
caused by a transposon-like insertion in a gene encoding
starch-branching enzyme. Cell 60:115122
Blum E, Mazourek M, OConnell M, Curry J, Thorup T, Liu
KD, Jahn M, Paran I (2003) Molecular mapping of cap-
saicinoid biosynthesis genes and quantitative trait loci
analysis for capsaicinoid content in Capsicum. Theor Appl
Genet 108:7986
Bosland PW, Baral JB (2007) Bhut JolokiaThe worlds
hottest known chile pepper is a putative naturally occurring
interspecific hybrid. HortScience 42:222224
Bosland PW, Votava EJ (2000) Peppers: vegetable and spice
capsicums. CABI Publishing, New York
Canto-Flick A, Balam-Uc E, Bello-Bello JJ, Lecona-Guzman C,
Sols-Marroquin D, Aviles-Vinas S, Gomez-Uc E, Lopez-
Puc G, Santana-Buzzy N, Iglesias-Andreu LG (2008)
Capsaicinoids content in Habanero pepper (Capsicum
chinense Jacq.): hottest known cultivars. HortScience
43:13441349
Curry J, Aluru M, Mendoza M, Nevarez J, Melendrez M,
OConnell MA (1999) Transcripts for possible capsaici-
noid biosynthetic genes are differentially accumulated in
pungent and non-pungent Capsicum spp. Plant Sci
148:4757
Mol Breeding (2015) 35:142
Grappin P, Audeon C, Chupeau MC, Grandbastien MA (1996)
Molecular and functional characterization of slide, anAc-
like autonomous transposable element from tobacco. Mol
Gen Genet 252:386397
Han K, Jeong HJ, Sung J, Keum YS, Cho MC, Kim JH, Kwon
JK, Kim BD, Kang BC (2013) Biosynthesis of capsinoid is
controlled by the Pun1 locus in pepper. Mol Breed
31:537548
Haramizu S, Kawabata F, Masuda Y, Ohnuki K, Watanabe T,
Yazawa S, Fushiki T (2011) Capsinoids, non-pungent
capsaicin analogs, reduce body fat accumulation without
weight rebound unlike dietary restriction in mice. Biosci
Biotechnol Biochem 75:9599
Kobata K, Todo T, Yazawa S, Iwai K, Watanabe T (1998) Novel
capsaicinoid-like substances, capsiate and dihydrocapsiate,
from the fruits of a nonpungent cultivar, CH-19 Sweet, of
pepper (Capsicum annuum L.). J Agric Food Chem
46:16951697
Koeda S, Sato K, Tomi K, Tanaka Y, Takisawa R, Hosokawa M,
Doi M, Nakazaki T, Kitajima A (2014) Analysis of non-
pungency, aroma, and origin of a Capsicum chinense cul-
tivar from a Caribbean island. J Jpn Soc Hortic Sci
83:244251
Lang YQ, Kisaka H, Sugiyama R, Nomura K, Morita A,
Watanabe T, Tanaka Y, Yazawa S, Miwa T (2009) Func-
tional loss of pamt results in biosynthesis of capsinoids,
capsaicinoid analogs, in Capsicum annuum cv. CH-19
Sweet. Plant J 59:953961
Lee CJ, Yoo EY, Shin JH, Lee J, Hwang HS, Kim BD (2005)
Non-pungent Capsicum contains a deletion in the capsai-
cinoid synthetase gene, which allows early detection of
pungency with SCAR markers. Mol Cells 19:262267
Luo XJ, Peng J, Li YJ (2011) Recent advances in the study on
capsaicinoids and capsinoids. Eur J Pharmacol 650:17
Mazourek M, Pujar A, Borovsky Y, Paran I, Mueller L, Jahn
MM (2009) A dynamic interface for capsaicinoid systems
biology. Plant Physiol 150:18061821
Moon S, Jung KH, Lee D, Jiang WZ, Koh HJ, Heu MH, Lee DS,
Suh HS, An G (2006) Identification of active transposon
dTok, a member of the hAT family, in rice. Plant Cell
Physiol 47:14731483
Moses M, Umaharan P, Dayanandan S (2014) Microsatellite
based analysis of the genetic structure and diversity of
Capsicum chinense in the Neotropics. Genet Resour Crop
Evol 61:741755
Nakatsuka T, Nishihara M, Mishiba K, Hirano H, Yamamura S
(2006) Two different transposable elements inserted in
flavonoid 30 ,50 -hydroxylase gene contribute to pink flower
coloration in Gentian scabra. Mol Genet Genomics
275:231241
Sasahara I, Furuhata Y, Iwasaki Y, Inoue N, Sato H, Watanabe
T, Takahashi M (2010) Assessment of the biological sim-
ilarity of three capsaicin analogs (Capsinoids) found in
non-pungent chili pepper (CH-19 Sweet) fruits. Biosci
Biotechnol Biochem 74:274278
Page 13 of 13 142
Stellari GM, Mazourek M, Jahn MM (2010) Contrasting modes
for loss of pungency between cultivated and wild species of
Capsicum. Heredity 104:460471
Stewart C, Kang BC, Liu K, Mazourek M, Moore SL, Yoo EY,
Kim BD, Paran I, Jahn MM (2005) The Pun1 gene for
pungency in pepper encodes a putative acyltransferase.
Plant J 42:675688
Stewart C, Mazourek M, Stellari GM, OConnell M, Jahn M
(2007) Genetic control of pungency in C. chinense via the
Pun1 locus. J Exp Bot 58:979991
Sutoh K, Kobata K, Yazawa S, Watanabe T (2006) Capsinoid is
biosynthesized from phenylalanine and valine in a non-
pungent pepper, Capsicum annuum L. cv. CH-19 Sweet.
Biosci Biotechnol Biochem 70:15131516
Tanaka Y, Hosokawa M, Miwa T, Watanabe T, Yazawa S
(2010a) Newly mutated putative-aminotransferase in
nonpungent pepper (Capsicum annuum) results in biosyn-
thesis of capsinoids, capsaicinoid analogues. J Agric Food
Chem 58:17611767
Tanaka Y, Hosokawa M, Miwa T, Watanabe T, Yazawa S
(2010b) Novel loss-of-function putative aminotransferase
alleles cause biosynthesis of capsinoids, non-pungent
capsaicinoid analogues, in mildly pungent chili peppers
(Capsicum chinense). J Agric Food Chem 58:1176211767
Vitte C, Fustier MA, Alix K, Tenaillon MI (2014) The bright
side of transposons in crop evolution. Funct. Genomics,
Brief. doi:10.1093/bfgp/elu002
Voorrips RE, Finkers R, Sanjaya L, Groenwold R (2004) QTL
mapping of anthracnose (Colletotrichum spp.) resistance in
a cross between Capsicum annuum and C. chinense. Theor
Appl Genet 109:12751282
Votava EJ, Bosland PW (2004) NuMex suave red and NuMex
suave orange mild Capsicum chinense cultivars. HortS-
cience 39:627628
Wahyuni Y, Ballester AR, Tikunov Y, de Vos RCH, Pelgrom
KTB, Maharijaya A, Sudarmonowati E, Bino RJ, Bovy AG
(2013) Metabolomics and molecular marker analysis to
explore pepper (Capsicum sp.) biodiversity. Metabolomics
9:130144
Wessler SR, Baran G, Varagona M, Dellaporta SL (1986)
Excision of Ds produces waxy proteins with a range of
enzymatic activities. EMBO J 5:24272432
Wyatt LE, Eannetta NT, Stellari GM, Mazourek M (2012)
Development and application of a suite of non-pungency
markers for the Pun1 gene in pepper (Capsicum spp.). Mol
Breeding 30:15251529
Yarnes SC, Ashrafi H, Reyes-Chin-Wo S, Hill TA, Stoffel KM,
Van Deynze A, Gulick P (2012) Identification of QTLs for
capsaicinoids, fruit quality, and plant architecture-related
traits in an interspecific Capsicum RIL population. Gen-
ome 56:6174
Yazawa S, Suetome N, Okamoto K, Namiki T (1989) Content of
capsaicinoids and capsaicinoid-like substances in fruit of
pepper (Capsicum annuum L.) hybrids made with CH-19
Sweet as a parent. J Jpn Soc Hortic Sci 58:601607
123