Journal of Research in Biology - Volume 4 Issue 2

Journal of Research in Biology ISSN No: Print: 2231 6280; Online: 2231- 6299.
An International Scientific Research Journal

Original Research
Associations of Arbuscular Mycorrhizal (AM) fungi in the

Phytoremediation of Trace Metal (TM) Contaminated Soils.
Authors: ABSTRACT:
Journal of Research in Biology
Dhritiman Chanda 1,
Sharma GD2, Jha DK3 and
Hijri M4. Arbuscular mycorrhizal fungi (AM) are integral, functioning parts of plant
roots, widely recognized as plant growth enhancing beneficial mycobionts and
Institution: tolerance to variety of stresses such as nutrient, drought, salinity and trace metals
1. Microbiology Laboratory,
(TM). A study was undertaken to access the influence of paper mill effluents on
Department of Life Science
and Bioinformatics, Assam mycorrhizal colonization and mycorrhizal spore count. Plants grown in metal
University, Silchar, Assam, contaminated site were found less mycotrophic than their counterparts on the non-
India. polluted one. Regression analyses revealed that the mycorrhizal colonization and
mycorrhizal spore count are significantly and positively correlated with various soil
2. Bilaspur University, physio-chemical properties in the polluted and non-polluted site. Glomus was the
Bilaspur, India. most frequently isolated mycorrhizal species from the polluted site. The isolated
3. Department of Botany, indigenous strains of AM can be used for inoculation of plant species that might be
Gauhati University, Assam, used for rehabilitation of contaminated site. The study highlights the potential use of
India. AM as bioremediation agent of polluted soils and as bioindicator of pollution for
4. Institut de Recherche en future research priorities.
Biologie Vegetale,
University de Montreal,
Montreal, Canada.
Corresponding author: Keywords:

Dhritiman Chanda. Arbuscular Mycorrhiza, Heavy metals, Phytoremediation, Glomus, Paper mill
effluents.
Email Id: Article Citation:

Dhritiman Chanda, Sharma GD, Jha DK and Hijri M.
Associations of Arbuscular Mycorrhizal (AM) fungi in the Phytoremediation of Trace
Metal (TM) Contaminated Soils.
Journal of Research in Biology (2014) 4(2): 1247-1263
Web Address:
http://jresearchbiology.com/ Dates:
documents/RA0416.pdf. Received: 17 Jan 2014 Accepted: 22 March 2014 Published: 23 April 2014
This article is governed by the Creative Commons Attribution License (http://creativecommons.org/

licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and
reproduction in all medium, provided the original work is properly cited.
1247-1263 | JRB | 2014 | Vol 4 | No 2

An International
Scientific Research Journal www.jresearchbiology.com
Chanda et al., 2014
INTRODUCTION: AM fungi could prove beneficial in

Arbuscualr mycorrhizal (AM) fungi are phytoremediation system as they can increase the rate of
ubiquitous obligate mycobionts forming symbiosis with plant survival and establishment, reduce plant stress and
the terrstrial plant communities (Barea and Jeffries increase plant nutrients acquisition, increase carbon and
1995). They are essential components of soil biota and nitrogen deposition into soil, thereby contributing to
are found in almost all ecological situations particularly bacterial growth and increase the volume of soil being
those supporting plant communities with high species remediated (Almas et al., 2004).Trace metals
diversity. AM are known to enhance plant tolerance to a concentration may decrease the number and vitality of
variety of stresses including nutrients, drought, metal AM as a result of HM toxicity. Metal transporters and
toxicity, salinity and pathogens all of which may affect plant-encoded transporters are involved in the tolerance
plants success in a contaminated or polluted soil (Olexa and uptake of TM (Glassman and Casper 2012;
et al., 2000; Zarei et al., 2010). AM can help alleviate Rahmanian et al., 2011).
metal toxicity to plants by reducing metal translocation In recent times, one of the challenges facing the
from root to shoot (Leyval et al., 1997). Therefore they mankind is the degradation and pollution of soil by
may contribute to plant establishment and survival in industrial effluents, sludge and solid waste. The pulp and
trace metals polluted sites and could be used as a paper mill which has been categorized as one of the
complement to immobilization strategies. In the last few twenty most polluting industries in India discharge huge
years, research interest has been focused on the diversity quantities of coloured and waste water (effluent) into the
and tolerance of AM in trace metals contaminated soil. environment and are responsible for soil pollution
To understand the basis underlying adaptation and consequently the hazardous chemicals enter into surface
tolerance of AM to trace metals in soils,since this could or ground water and poison the soil or crops. The decline
facilitate and manage these soil microoraganisms for of plant diversity is due to the soil toxicity generated by
restoration and bioremediation programs (Khan et al., dumping of solid paper mill wastes in the area. Several
2000; Shah et al., 2010). AM constitute an important researches have been carrying out to understand the role
functional component of the soil plant system that is of AM fungi in plant interaction with toxic metal for
critical for sustainable productivity in stressed soils and promoting plant growth and the bioavailibility in stressed
promote plant growth to reduce or eliminate the soils. In order to develop the restoration protocol for
bioavilibility of plants as studied by Joner and Leyval disturbed habitats, it is necesaary to study benificial
(2003). The variation in metal accumulation and inter- rhizosphere fungi like AM fungi that are tolerant to
plant translocation depends on the different factors like various stresses. This will help us develop a protocol by
host-plant, root density, soil characteristics, metals and studying the association of arbuscular mycorrhizal fungi
their availibility. Metal tolerant AM isolates can decrease in plants growing in soils polluted with paper mill
metal absorption capacity of these fungi, which could effluents.
filter metal ions during uptake as described (Val et al.,
1999; Andrew et al., 2013 and Martina and Vosatka MATERIAL AND METHODS:
(2005)). AM increases its hosts uptake of nutrients and Location of the study area:
can improve the growth and resistance to environmental The study was conducted at two sites i.e. one
stresses (Biro et al., 2005; Smith and Read, 2008). polluted with paper mill effluents and another non-
polluted site. The first site was effluent dumping site
1248 Journal of Research in Biology (2014) 4(2): 1247-1263
Chanda et al., 2014
inside the campus of Hindustan Paper Corporation described by Phillips and Hayman (1970).
Limited, HPC, Assam, India. The two sites were Isolation of Mycorrhizal spores:
approximately 2 Km apart. The study area was located at Spore extraction from the soil was carried out
an altitude of 116mMSL between 24052`N and 92036`E using the Wet Sieving and Decanting Technique by
longitides. Gerdemann and Nicolson (1963). The isolated spores
Collection of soil Sample: were mounted on glass slide using Polyvinyl Alcohol-
From the polluted and non-polluted site,10 Lactic acid Glycerol (PVLG) and observed under
dominant plant species were selected for the study of compound microscope (100-1000X). Spores were
mycorrhizal association. The rhizosphere soil samples of identified according to the manual of identification of
these individuals of a species were collected. The VAM fungi by Schenck and Perez (1990). The INVAM
rhizospheric soil samples were randomly selected and worksheet was used for diagnosing the spores.
then mixed together to obtain a composite representative Additional spores not included in the manual were
sample. The soil samplings were done trimonthly from identified as per the description given in the INVAM
April 2010 to January 2012. The soil samples were website (http://invam.caf.wvu.edu/).
brought to the laboratory in sterile condition and stored Soil Physico-chemical analysis:
in a refrigerator at 4C until they were processed. The physical chracteristics of soil i.e., Moisture
Collection of root samples: content, soil pH and soil temperature were recorded in
Fine roots from ten dominant different plants of both polluted and non-polluted sites.
the same species were randomly collected and mixed The chemical chracteristic i.e., N, P, K, Ca, Mg
properly and a composite root sample was obtained for etc of the soil samples were estimated using the
each plant species. Trypan blue method was followed for technique in the polluted and non-polluted site
the determination of the intensity of root colonization as (Jackson,1985). Concentration of trace metalss i.e., Zn,
Caesalpinia pulcherrima
Fig 1: Monthly variation in Mycorrhizal spore population 50gm-1soil of different plant

species growing in the polluted site.
Journal of Research in Biology (2014) 4(2): 1247-1263 1249

Chanda et al., 2014
Ni and Cu were determined by Atomic Absorption malabathricum (54, 50 gm-1 soil) followed by Samanea
Spectrophotometer (VARIAN Spectra AA 220). saman (52, 50 gm-1 soil) and Caesalpinia pulcherrima
Statistical analysis: (49, 50 gm-1 soil) in the polluted site and in the non-
Statistical analysis was carried out by following polluted site Melastoma malabathricum (123, 50 gm-1
the techniques of Gomez and Gomez (1984). Linear soil) harboured maximum number of mycorrhizal spores
Regression analyses and correlation-coefficient values followed by Samanea saman (109,50 gm-1 soil) ,Cassia
were calculated to find out the influence and association sophera (109,50 gm-1 soil) and Caesalpinia pulcherrima
of various edaphic factors with mycorrhizal spore (98, 50 gm-1 soil) (Figures-1 and 2).
population and mycorrhizal root colonization (%) in the The maximum root colonization was obtained in
both polluted and non-polluted site. July and found decreased gradually until January and
again increased in April studied among the different
RESULTS AND DISCUSSION: plant species studied in the both polluted and non-
The plants were more mycotrophic in the non- polluted site. In the polluted site the maximum root
polluted site than those growing in the polluted site. The colonization was estimated in Melastoma malabathricum
maximum root colonization was obtained in July both in (44%) followed by Caesalpinia pulcherrima (43%) and
the polluted and non-polluted site. The mycorrhizal root Mimosa pudica (41%) and the minimum percentage
colonization were estimated maximum in the month of colonization was obtained in Colocasia esculenta (35%)
July and decreased gradually from October to January and Axonopus compressus (32%). In the non-polluted
and again increased from April. The rhizosphere soil of site the maximum root colonization was estimated in
the non-polluted site harboured more mycorrhizal spores Melastoma malabathricum (68%) followed by
in all the selected plants than the non-polluted site. Caesalpinia pulcherrima (64%), Samanea saman (62%)
Among the different plant species studied, maximum and Axonopus compressus (61%) and the minimum root
mycorrhizal spore count was estimated in Melastoma
Fig 2: Monthly variation in mycorrhizal spore population 50gm-1soil of different plant

species growing in the non-polluted site.
Chanda et al., 2014
colonization was estimated in Eupatorium odoratum content of polluted site was found less than the non-
(54%) and Mimosa pudica (52%) (Figures- 3 and 4). polluted site. The soil calcium and magnesium content
Inter relationship of mycorrhizal association with soil were also found more in the polluted site than the non-
Physio-chemical factors polluted site. The various trace metals like Cu, Ni and Zn
The different soil parameters like N, P, K, were also estimated and found gradually decreased from
Organic C (%), Ca and Mg were estimated in the July to January and then slightly increased from the
polluted and non-polluted site. The polluted soil was less month of April (Tables- 2 and 3).
moist than the non-polluted one. The rhizosphere soil Liner regression analyses were calculated to find
from polluted site was more alkaline than the non- out the influence of various edaphic factors on
polluted one. Likewise more temperature was recorded mycorrhizal colonization and mycorrhizal spore
in the polluted site and less temperature was recorded in population. The results of regression analysis showed a
the non-polluted site. All physical parameters were positive and significant correlation coefficient(R) values
recorded maximum in the month of July that gradually between mycorrhizal spore population with soil moisture
decreased from October till April except soil pH content (r = 0.95; P < 0.01; Fig. 5(a)), soil temperature
(Table- 1). (r = 0.86; P < 0.01; Fig. 5(b)), Nitrogen (r = 0.81;
The soil samples from polluted and non-polluted P < 0.01;Fig. 5(d)), Organic carbon (r = 0.82; P < 0.01;
site showed marked monthly variation in their chemical Fig. 5(g)), Calcium (r = 0.84; P < 0.01; Fig. 5(h)), Zinc
properties. Nitrogen, phosphorous and organic carbon (r = 0.59; P < 0.01; Fig. 5(k)), Cu (r = 0.97;P < 0.01; Fig.
(%) content of the rhizosphere soil gradually decreased 5(i)) and Ni (r = 0.92; P < 0.01; Fig. 5(j)). The
from July to January and slightly increased in April. correlation coefficient with soil pH (r = 0.75; P < 0.01;
A similar trend of monthly variation was also observed Fig 5(c)) and soil phosphorus (r = 0.75; P < 0.01; Fig. 5
in the non-polluted site as well. The soil phosphorus (e)) were however, negative and significant.
Fig 3: Monthly variation in mycorrhizal colonization (%) of different plant

species growing in the polluted site.

Chanda et al., 2014
Fig 4: Monthly variation in mycorrhizal colonization (%) of different plant spe-

cies growing in the non-polluted site.
The positive and significant correlation 0.39; P < 0.01; Fig. 7(k)) in the polluted site. The
coefficient values were between mycorrhizal correlation coefficient with soil Mg and soil pH was
colonization and soil moisture content (r = 0.86; however found negative and significant.
P < 0.01; Fig. 7(a)), soil temperature (r = 0.70; P < 0.01; In the non-polluted site, a significant correlation
Fig. 7(b)), Nitrogen (r = 0.85;P < 0.01; Fig. 7(d)), coefficient values were estimated between mycorrhizal
phosphorus (r = 0.90;P < 0.01; Fig. 7(e)), soil organic spore population soil pH (r = 0.67; P<0.01; Fig. 6(b)),
carbon (r = 0.64; P < 0.01; Fig. 7(f)), Calcium (r = 0.97;P soil moisture content (r = 0.82;P < 0.01; Fig. 6(a)), soil
< 0.01; Fig. 7(g)), copper (r = 0.78; P < 0.01; Fig. 7(i)) organic carbon (r = 0.82; P < 0.01; Fig. 6(f)), soil
and Nickel (r = 0.82; P < 0.01; Fig. 7(j)) and Zinc (r = nitrogen (r = 0.94; P<0.01; Fig. 6(d)), soil phosphorus
Table 1: Monthly Variation in the physical properties of polluted & non-polluted soils.
Sampling Period Physical parameters
Months Moisture Content (%) pH Soil Temperature (C0)

April,10 7.8 0.08 (16.3 0.05) 6.9 0.08 (4.10 0.05) 23.1 0.08 (15.2 0.03)
July,10 14.4 0.12 (24.8 0.05) 6.1 0.05 (4.80 0.06) 27.5 0.03 (21.5 0.05)
October,10 11.3 0.05 (18.8 0.03) 6.7 0.03 (4.30 0.03) 22.8 0.03 (17.8 0.08)
January,11 5.7 0.03 ( 8.2 0.08) 7.1 0.03 (4.48 0.13) 19.8 0.06 (14.6 0.03)
April,11 8.1 0.03 (14.2 0.06) 6.9 0.05 (4.00 0.05) 22.8 0.03 (15.4 0.08)
July,11 16.5 0.05 (23.8 0.05) 6.5 0.03 (5.30 0.03) 28.2 0.06 (21.0 0.03)
October,11 12.5 0.03 (18.2 0.03) 6.9 0.03 (4.60 0.03) 23.0 0.05 (18.2 0.08)
January,12 6.2 0.03 ( 8.4 0.05) 7.2 0.03 (4.40 0.05) 18.7 0.06 (15.1 0.05)
Data are represented in mean SE; Value in parentheses represents the data from non-polluted site

Table 2: Monthly Variation in the chemical properties of polluted and non-polluted soil.
Chemical parameters
Sampling periods
Months
Chanda et al., 2014
N (mg/g) P (mg/g) K (mg/g) Organic C% Mg (mg/g) Ca (mg/g) Cu (ppm) Ni (ppm) Zn (ppm)
0.31250.080 0.00570.06 0.210.02 1.780.08 3.240.05 4.760.03 0.0340.02 0.013 0.05 0.3170.04
April,10
(0.02170.050) (0.00270.03) (0.0500.03) (0.4130.03) (0.1320.03) (0.120.05) BDL BDL BDL
0.42700.060 0.00160.05 0.380.05 2.170.06 1.890.06 5.790.06 0.0750.05 0.0340.03 0.3580.06

July,10
(0.07400.030) (0.00620.06) (0.0460.06) (0.6150.05) (0.0810.08) (0.070.03) BDL BDL BDL
0.41000.050 0.00350.07 0.260.05 1.860.07 2.240.07 5.310.02 0.0470.07 0.0220.06 0.2970.05

October,10
(0.03800.030) (0.00470.03) (0.0320.03) (0.5780.03) (0.1180.05) (0.0680.06) BDL BDL BDL

0.36300.060 0.00470.05 0.180.06 1.230.05 2.080.03 4.860.08 0.0230.08 0.0080.02 0.2780.03
January,11
(0.02400.050) (0.00200.03) (0.0170.05) (0.4390.06) (0.1270.06) (0.0790.07) BDL BDL BDL
0.32900.070 0.00620.06 0.310.07 1.820.07 3.190.07 4.670.05 0.0410.06 0.0160.03 0.3240.04

April,11
(0.02600.030) (0.00340.05) (0.0800.04) (0.4240.03) (0.1410.05) (0.170.03) BDL BDL BDL
0.45100.050 0.00210.03 0.460.05 2.340.07 1.750.57 5.630.05 0.0870.03 0.0410.05 0.3490.03

July,11
(0.08700.030) (0.00710.05) (0.0570.03) (0.6480.03) (0.1050.38) (0.110.06) BDL BDL BDL
0.0520.06
October,11 0.38000.057 0.00310.06 0.370.05 1.890.06 2.150.03 5.370.03 0.0290.06 0.2850.06
BDL
(0.04200.060) (0.00390.03) (0.0370.06) (0.5800.05) (0.1200.04) (0.070.05) BDL BDL
0.0290.05
0.32000.030 .00490.07 0.220.03 1.280.03 2.010.05 4.770.06 0.0060.07 0.2750.04
January,12 BDL
(0.02800.028) (0.00510.03) (0.0220.06) (0.4470.02) (0.1290.06) (0.0820.02) BDL BDL
Data are represented in mean SE; BDL=Below Detectable Limit; Value in parentheses represents the data from non-polluted site
1253
Chanda et al., 2014
Table 3: Monthly Variation in the Mycorrhizal spore population and Mycorrhizal root colonization (%) in
50gm-1 soil of polluted and non-polluted sites
Sampling Periods
Endogonaceous Spore Population(50gm-1) Mycorrhizal colonization (%)
Months
April,10 24 0.6 ( 52 0.8) 21 0.8 (32 0.6)
July,10 54 0.5 (118 0.8) 44 0.3 (68 0.4)
October,10 39 0.3 ( 75 0.8) 34 0.5 (53 0.3)
January,11 18 0.5 ( 46 0.5) 21 0.5 (26 0.3)
April,11 26 0.5 ( 49 0.8) 19 0.5 (34 0.6)
July,11 61 0.5 (124 0.5) 39 0.3 (61 0.5)
October,11 35 0.5 ( 68 0.8) 32 0.3 (48 0.8)
January,12 20 0.5 ( 40 0.5) 18 0.3 (28 0.4)
Data are represented in mean SEM; Value in parentheses represents the data from non-polluted site
(r = 0.85; P < 0.01; Fig. 6(e)) and soil magnesium (r = the same decreased as the pH increased. The presence of
0.77; P < 0.01; Fig. 6(g)). trace metals in the polluted soil may be responsible for
In the non-polluted site, the mycorrhizal less percentage of root colonization in the polluted site.
colonization was found significantly and positively AM spore population decreased with increased amount
correlated with soil moisture content (r = 0.80; P < 0.01; of trace metals in the soil (Val et al., 1999; Hayes et al.,
Fig. 8(a)), soil temperature (r = 0.94; P < 0.01; Fig. 8(c)), 2003).The negative correlation with soil Phosphorous,
soil pH (r = 0.54; P < 0.01; Fig. 8(b)) soil Nitrogen (r = Magnesium and pH is may be responsible for the less
0.79; P < 0.01; Fig. 8(d)), phosphorus (r = 0.92; P < 0.01; percentage of root colonization in the plants. High
Fig. 8(e)), soil organic carbon (r = 0.90; P < 0.01; Fig. 8 alkalinity in the soil was also responsible for decrease in
(f)), Magnesium (r = 0.85; P < 0.01; Fig. 8(h)). The the number of spores as well as root colonization in the
correlation coefficient with soil Calcium was however polluted soil. The spore population and mycorrhizal root
found negative and significant. colonization of AMF fungi were found decreased by the
The present experimental findings revealed the higher levels of heavy metals in the soil. Our results also
relationship of mycorrhizal spore population and supports the findings of (Shah et al., (2010); Biro et al.,
mycorrhizal colonization with various physio-chemical (2005); Ghre and Paszkowski (2006); Mathur et al.,
properties of soil polluted with trace metals. The low (2007)).
intensity of root colonization and low spore count in the Among the isolated genera of AM fungi, Glomus
polluted site may be attributed to the sensitivity of was the most dominant AM genus isolated during the
endomycorrhizal fungi to various soil pollutants. This present investigation followed by Gigaspora and
may be due to the alkaline pH, higher soil temperature Scutellospora sp. Dominance of Glomus sp in the
due to the deposition of more amounts of Calcium and polluted soil may be due to its higher metal tolerance
trace metals that might have adversely affected the capacity as reported earlier by various workers (Martina
sporulation and colonization ability of the mycorrhizal and Vosatka 2005; Carrasco et al., 2011; Chen et al.,
fungi as reported by Schenck and Smith (1982). Rohyadi 2007; Zaefarian et al., 2010). The decline of AM fungal
et al., (2004) also observed that the relative growth occurance (propagule density) and infectivity in trace
improvement by mycorrhizas was highest at pH 4.7 and metal polluted site which can be used as bioindicators of

Chanda et al., 2014
soil contamination (Citterio et al., 2005; Liao et al., efficiently to colonize plant roots in trace metal-stressed
2003). environments by significantly correlated with various
physic-chemical properties of the soil. It is therefore of
CONCLUSION: great importance that we combine selected plants with
Our study suggests that the effluents and the specific AM fungal isolates adapted to high
solid wastes dumped by the paper mill have high concentrations of trace metal in future research for
concentration of trace metals that changed the other phytoremediation programes. Thus, the isolated strains
physical and chemical properties of the soil. The of AM fungi can be of great interest since they can be
indigenous AM isolates existing naturally which are used for inoculation of the plant species and the present
isolated from trace metal polluted soils are reported study provides evidences for the potential use of the
(a) (b)
(c) (d)
(e) (f)

Chanda et al., 2014
(g) (h)
(i) (j)
(k)
Figure 5: Mycorrhizal spore population 50gm-1 soil (X) expressed as a function of soil physio-chemical
factors (Y) in the polluted site.Regression is drawn only for statistically significant relationship (p < 0.01).
(MC=Moisture Content; Soil temp(C0),soil pH,Nitrogen (N), Potassium (K), Phosphorus (K),Organic
Carbon (%),Calcium (Ca),Copper (Cu), Nickel (Ni) and Zinc (Zn)).

Chanda et al., 2014
(a) (b)
(c) (d)
(e) (f)
(g)
Figure 6: Mycorrhizal spore population 50gm-1 soil (X) expressed as a function of soil physio-chemical factors (Y) in the
non-polluted site.Regression is drawn only for statistically significant relationship (p < 0.01). (MC=Moisture Content;
Soil temp(C0),Soil pH, Nitrogen(N), Potassium(K),Phosphorus(P),Organic Carbon (%),Magnesium(Mg)).

Chanda et al., 2014
(a) (b)
(c) (d)
(e) (f)

Chanda et al., 2014
(g) (h)
(i) (j)
(k)
Figure 7: Mycorrhizal colonization (X) expressed as a function of soil physio-chemical factors (Y) in
the polluted site.Regression is drawn only for statistically significant relationship (p < 0.01).
MC=Moisture Content; Soil temp(C0),Nitrogen (N), Phosphorous (P),Organic Carbon (%),Calcium
(Ca),Magnesium (Mg),Copper (Cu),Nickel (Ni) and Zinc (Zn)).

Chanda et al., 2014
(a) (b)
(c) (d)
(e) (f)
(k)
(g) (h)

Chanda et al., 2014
(i)
Figure 8: Mycorrhizal colonization (X) expressed as a function of soil physio-chemical factors (Y) in
the non-polluted site.Regression is drawn only for statistically significant relationship (p < 0.01).
(MC = Moisture Content; Soil temp(C0),Soil pH, Nitrogen(N), Potassium (K),Phosphorus (P),Organic
Carbon (%),Magnesium (Mg) and Calcium (Ca)).
plant species in combination with AM fungi in the paper Function, Molecular Biology and biotechnology.
mill polluted with paper mill effluents contaminated with Springer-Verlag, Heidelberg. 521-559.
various trace metals.
Bir B, Posta K, Fzy A, Kdr I and Nmeth T.
2005. Mycorrhizal Functioning as part of the Survival
ACKNOWLEDGEMENT:
Mechanisms of Barley (Hordeum vulgare L.) at Long-
The authors are grateful to the Department of
term Heavy Metal Stress, Acta Biol.Szegedien. 49 (1-2):
Life Science, Microbiology Laboratory, Assam
65-67.
University (Silchar), India for providing the laboratory
facilities. Carrasco L, Azcon R, Kohler J, Roldn A and
Caravaca F. 2011. Comparative effects of native
REFERENCES: filamentous and arbuscular mycorrhizal fungi in the
Almas AR, Bakken LR and Jan Mulder. 2004. establishment of an autochthonous, leguminous shrub
Changes in tolerance of soil microbial communities in growing in a metal-contaminated soil. Sci Total
Zn and Cd contaminated soils. Soil Biol Biochem. 36(5): Environ., 409(6): 1205-1209.
805813.
Chen BD, Zhu Y.-G, Duan J, Xiao XY and Smith SE.
Andrew B, Brown MV, Steven DS and Peter HT. 2007. Effects of the arbuscular mycorrhizal
2013. Microbial community responses to fungus Glomus mosseae on growth and metal uptake by
anthropogenically induced environmental change: four plant species in copper mine tailings. Environ
towards a systems approach. Ecol Lett. 16 (Supplement Pollut. 147(2): 374-380.
S1): 128-139.
Citterio S, Prato N, Fumagalli P. Aina R, Massa N,
Barea JM and Jeffries P. 1995. Arbuscular Santagostino A, Sgorbati S and Berta G. 2005. The
mycorrhizas in sustainable soil plant systems. In: B. arbuscular mycorrhizal fungus Glomus mosseae induces
Hock and A. Varma (eds) Mycorrhiza, structure, growth and metal accumulation changes in Cannabis

Chanda et al., 2014
sativa L. Chemosphere. 59(1): 21-29. colonization and function: physiological, ecological and
applied aspects. Mycorrhiza. 7(3): 139-153.
Glassman SI and Casper BB. 2012. Biotic contexts
alter metal sequestration and AMF effects on plant Liao JP, Lin XG, Cao ZH, Shi YQ and Wong MH.
growth in soils polluted with heavy metals. Ecology. 2003. Interactions between arbuscular mycorrhizae and
93(7): 1550-1559. heavy metals under sand culture experiment.
Chemosphere. 50(6): 847-853.
Gerdemann JW and Nicolson TH. 1963. Spores of
mycorrhizal Endogone species extracted from soil by wet Mathur N, Bohra JSS, Quaizi A and Vyas A. 2007.
sieving and decanting. Trans Br Mycol Soc., 46(2): Arbuscular Mycorrhizal Fungi: A Potential Tool for
235-244. Phytoremediation, J Plant Sci., 2(2): 127-140.
Ghre V and Paszkowski U. 2006. Contribution of the Martina J and Vosatka M. 2005. Response to
Arbuscular Mycorrhizal Symbiosis to Heavy Metal Cadmium of Daucus carota hairy roots dual cultures
Phytoremediation. Planta. 223(6): 1115-1122. with Glomus intraradices or Gigaspora margarita.
Mycorrhiza. 15(3): 217-224.
Gomez KA and Gomez AA. 1984. Statistical
Procedures for Agricultural Research (2nd edn), An Olexa TJ, Gentry TJ, Hartel PG. Wolfb DC,
International Rice Research Institute book, A Wiley- Fuhrmannc JJ and Reynoldsd CM. 2000.
Interscience Publication, John Willey and Sons, New Mycorrhizal Colonization and microbial community
York. structure in the rhizosphere of annual ryegrass grown in
pyrene-amended soils. Int J Phytol., 2(3): 213-231.
Hayes WJ, Chaudhry TM, Buckney RT and Khan
AG. 2003. Phytoaccumulation of Trace Metals at the Phillips JM and Hayman DS. 1970. Improved
Sunny Corner Mine, New South Wales with Suggestions procedures for cleaning and staining parasitic and
for a Possible Remediation Strategy, Aust J Toxicol., vesicular-arbuscular mycorrhizal fungi for rapid
9(1):69-82. assessment of infection. Trans Br Mycol Soc., 55(1):
158-161.
Jackson ML. 1985. Soil chemical analysis, 2nd edition,
Madison, WI, USA. Rahmanian M, Khodaverdiloo H, Rezaee DY and
Rasouli SMH. 2011. Effects of Heavy Metal Resistant
Joner EJ and Leyval C. 2003. Phytoremediation of
Soil Microbes Inoculation and Soil Cd Concentration on
organic pollutants using mycorrhizal plants: a new aspect
Growth and Metal Uptake of Millet, Couch Grass and
of rhizosphere interactions. Agronomie. 23(5-6):
Alfalfa. Afr J Microbiol Res., 5(4): 403-410.
495-502.
Rohyadi A, Smith FA, Murray RS and Smith SE.
Khan AG, Kuek C, Chaudhry TM, Khoo CS and
2004. Effects of pH on mycorrhizal colonisation and
Hayes WJ. 2000. Role of plants,mycorrhizae and
nutrient uptake in cowpea under conditions that minimise
phytochelators in heavy metal contaminated land
confounding effects of elevated available aluminium.
remediation. Chemosphere. 41(1-2):197-207.
Plant Soil. 260(1-2): 283-290.
Leyval C, Turnau K and Haselwandter K. 1997.
Shah FR, Ahmad N, Masood KR. Peralta-Videa JR
Effect of heavy metal pollution on mycorrhizal
and Ahmad FuD. 2010. Heavy Metal Toxicity in Plants.

Chanda et al., 2014
In: Ashraf, M. Ozturk M. and S.A. Ahmad (eds) Plant

Adaptation and Phytoremediation, Springer Dordrecht
Heidelberg London, New York.71-98.
Schenck NC and Smith GS. 1982. Responses of six

species of vesicular arbuscular mycorrhizal fungi and
their effects on soybean at four-soil temperatures. New
Phytol., 92(2):193-201.
Schenck, NC and Perez Y. 1990. Manual for the

Identification of VA Mycorrhizal Fungi. (3rd edn).
Gainesville, Florida, Synergistic Publications.
Smith SE and Read DJ. 2008. Mycorrhizal Symbiosis

Academic press London.
Val CD, Barea, JM and Azcon-Aguilar C. 1999.

Diversity of arbuscular mycorrhizal fungus populations
in heavy- metal- contaminated soils. Appl Environ.
Microbiol., 65(2): 718-723.
Zaefarian F, Rezvani M, Rejali F, Ardakani MR and

Noormohammadi G. 2010 Ability of Glomus mosseae-
Alfalfa (Medicago sativa L.) Association for Heavy
Metal Phytoextraction from Soil. Environ Sci., 7(3):
77-90.
Zarei M, Hempel S, Wubet T, Schfer SH,

Savaghebi G, Jouzani GS, Nekouei MK and Buscot F.
2010. Molecular diversity of arbuscular mycorrhizal
fungi in relation to soil chemical properties and heavy
metal contamination. Environ. Pollu., 158(8): 2757-
2765.
Submit your articles online at www.jresearchbiology.com
Advantages
Easy online submission
Complete Peer review
Affordable Charges
Quick processing
Extensive indexing
You retain your copyright
submit@jresearchbiology.com
www.jresearchbiology.com/Submit.php.

Journal of Research in Biology ISSN No: Print: 2231 6280; Online: 2231 - 6299.
Original Research
Biometry and fouling study of intertidal black-lip pearl oyster, Pinctada margaritifera
(Linnaeus, 1758) to determine their eligibility in the pearl culture industry
Authors: ABSTRACT:
Jha S and Mohan PM. The present study on the biometry and fouling load of black-lip pearl oyster,
Pinctada margaritifera (Linnaeus, 1758), was conducted to understand the
eco-biology of these intertidal oysters so that their eligibility in the pearl culture
industry could be determined. Biometric parameters viz., Anteroposterior
measurement (APM), hinge length (HL), thickness (THK) and total weight (TWT) of
each oyster were checked for their correlation with dorsoventral measurement (DVM)
and fouling load (F) separately by regression analysis. Shell length of collected
Institution:
Department of Ocean specimens ranged between 16 3.7- 88.2 6.5 mm. Most of the P. margaritifera from
Studies and Marine Biology, intertidal regions of Andaman were confined to 61-80 mm size group. The average
Pondicherry University size of all the shell dimensions and TWT increased with increase in the shell length.
(Brookshabad Campus), The rate of increase of all the biometric parameters except TWT, declined in size range
Chakkargaon Post, Port >41-60 mm. Maximum and minimum fouling load was observed during September
Blair, 744112, 2011 (27.8 5.1 g) and July 2012 (3.2 3.7 g), respectively. Lower size groups showed
Andaman and Nicobar maximum correlation indicating isometric growth but in higher size range, allometry
Islands, India. was observed as the rate of increase of biometric parameters varied with increasing
size range. On the basis of this study it could be concluded that if transferred to
suspended culture at an early stage, these intertidal oysters, adapted to survive in
harsh environmental conditions, would acclimatize more easily to the new
environment and would cross the 61-80 mm size range becoming larger and thicker, a
parameter favourable for pearl production.

Jha S. Black-lip pearl oyster, Allometry, Biofouling, Intertidal Limiting factors,
Reproductive maturity, Pearl culture.

Jha S and Mohan PM.
Biometry and fouling study of intertidal black-lip pearl oyster, Pinctada margaritifera
(Linnaeus, 1758) to determine their eligibility in the pearl culture industry.
Web Address: Dates:

http://jresearchbiology.com/ Received: 19 Feb 2014 Accepted: 01 Apr 2014 Published: 14 May 2014
documents/RA0423.pdf.
1264-1275| JRB | 2014 | Vol 4 | No 2

An International
Jha and Mohan, 2014
INTRODUCTION the correlation of biometric parameter of all the oysters

Pearl oyster Pinctada margaritifera (Linnaeus, without dividing them into any size group. None of these
1758) is commonly known as the black-lip pearl oyster authors studied the correlation between DVM and the
due to dark colouration of the nacre of its inner shell fouling load (F).
towards the distal rim (Saville-Kent, 1893). This In the natural habitat, several environmental
exclusively marine, sedentary bivalve is distributed along factors such as availability of food and space, nature of
the tropic belt within the Indo-Pacific Ocean (Pouvreau substratum, fouling, competition, predation etc., affect
and Prasil, 2001; El-Sayed et al., 2011). the biometric growth of black pearl oysters
P. margaritifera are cultured around the world (Alagarswami, 1991; Gervis and Sims, 1992; Mohamed
for the production of black pearls, designer mabe (Kripa et al., 2006). Fouling on the sedentary organism plays a
et al., 2008), and for their lustrous inner shell known as major role in adversely affecting their growth and
mother of pearl which is used in the ornamental and development as more the fouling more is the energy
button industry (Kimani and Mavuti, 2002; Fletcher required for oysters to open its valve for food filtration
et al., 2006). A thorough knowledge of the biometry of and respiration (Alagarswami and Chellam, 1976;
pearl oyster is of prime importance in the pearl culture Mohammad, 1976; Alagarswami, 1987; Taylor et al.,
industry. Thickness and wet weight of the pearl oyster 1997; Mohammed, 1998; Pit and Southgate, 2003).
helps in predicting the nuclei size (Mohamed et al., The main objective of the present study was to
2006; Abraham et al., 2007). Kripa et al., (2008) determine the eligibility of intertidal P. margaritifera in
considered shell size to be an important criteria for mabe the pearl culture industry by understanding their
production. biometry as well as month-wise variation in the fouling
In different parts of the world, research is being load at natural habitat. A novel aspect of pearl oyster
carried out to understand the biometric relationship of ecology explored in this study was the correlation
black pearl oysters in natural and cultured conditions. between DVM-F, which shall be the first known
Friedman and Southgate (1999) studied the biometric reference available from Andaman and elsewhere.
relationship of these oysters in Solomon Islands.
Pouvreau et al., (2000a) reported the isometric relation MATERIALS AND METHODS
between their length and thickness in French Polynesia. Study Area
El-Sayed (2011) studied the concept of allometric growth Preliminary surveys were conducted in 10
in P. margaritifera from the Egyptian coastal waters. intertidal regions of South Andaman, out of which only
In India P. margaritifera is the most abundant in three regions viz. Burmanallah (113419 N; 924439
Andaman and Nicobar Islands (Alagarswami, 1983). E), Carbyn (113849 N; 924481 E) and Marina Jetty
Alagarswami (1983) and Abraham et al., (2007) studied area (114016 N; 924453 E) showed natural
the biometric relationship between various shell availability of P. margaritifera and hence were selected
dimensions viz., hinge length (HL), thickness (THK) and as the study area for the present study conducted during
total weight (TWT) with the dorsoventral measurement July 2011 to July 2012.
(DVM) or the shell length of the black-lip pearl oyster in Sampling Method
Andaman and Nicobar Islands. But the size range and For studying the relationship between various
total number of specimens studied by them were shell dimensions during different growth size of the
different from the present study. Alagarswami studied oysters, 151 specimens of P. margaritifera were
Jha and Mohan, 2014
collected and brought to the laboratory in a bucket filled Statistical Analysis

with raw sea water. The average value of biometric dimensions,
The individual morphometric parameters viz. fouling load and their rate of increment for five different
shell length or the dorsoventral measurement (DVM), size groups were obtained by calculating the mean and
anteroposterior measurement (APM), hinge length (HL) standard deviation. Month-wise average fouling load was
and shell thickness (THK) were measured with the help also calculated using the same method. Pearsons
of a digital vernier calliper (Aerospace, accuracy = 0.01 Correlation Coefficient between biometric relationships
mm) using the method of Hynd (1955) and then grouped viz., DVM-APM, DVM-HL, DVM-THK and the
into five length classes with a class interval of 20 mm correlation between F with biometric parameters
viz., 1-20, 21-40, 41-60, 61-80 and 81-100 mm. DVM (DVM, APM, HL, THK and TWT) were calculated by
and APM were measured excluding the growth process. fitting the least square method equation, y = a+bx, of
To minimize any error during the measurement linear regression.
of total weight (TWT), oysters were taken out from the The length-weight relationship was determined
bucket and kept outside in a tray covered with wet cloth by following the method of Abraham et al., (2007) where
for 15 minutes to remove the water trapped inside the the length measurements were expressed in centimeters
oyster as described in Moullac et al., (2012). Once most and the weight was expressed in grams. Exponential
of the in-held water had seeped out, weight of the fouled curvi-linear regression models were prepared for the
oysters were measured by using digital balance estimation of correlation between DVM-TWT, as their
(Professional Digital Scale, accuracy = 0.01 g). relationship was non-linear. The correlation values were
The attached foulers on the shells of the oysters tested for significance with one-way ANOVA adopting
were then scrapped off and oysters were washed with Hynd (1955).
filtered sea water to clean all the epiphytic growth. The
cleaned oysters were weighed again to determine their RESULTS
actual total weight (foul free weight). The fouling load Trend of biometric growth and fouling
(F) was calculated by comparing the individual weight The DVM of the 151 collected specimens ranged
of each fouled oyster with their respective weight after between 16 3.7- 88.2 6.5 mm. The average values of
cleaning. biometric dimensions of all the size groups and their

fouling load have been graphically represented in Fig.1,
Fig. 1 Average biometric dimensions (SE) of 5 size groups of

Pinctada margaritifera.

Jha and Mohan, 2014
along with their standard deviation values. DVM-HL (r2 = 0.550, P > 0.05, n = 18) were moderate to
From the observation it was found that as the low.
DVM increased the average size of all other shell In the size group of 21-40 mm, higher degree of
dimensions also increased, though not at a constant rate correlation was observed between DVM-APM
(Fig. 2). F also increased with the DVM except for the (r = 0.802, P > 0.05, n = 24) and DVM-HL (r2 = 0.808,
2
largest size group (81-100 mm) where F was lesser P < 0.001, n = 24). DVM-THK (r2 = 0.673, P < 0.001,
than 61-80 mm group. The size group, 61-80 mm was n = 24) and DVM-TWT (r2 = 0.304, P > 0.05, n = 24)
the most heavily fouled of all the other size ranges. The showed moderate and poor correlation, respectively.
monthly average fouling load on an individual specimen The value of correlation between DVM-TWT
2
of P. margaritifera has been graphically shown in Fig.3. (r = 0.725, P < 0.001, n = 33) was highest for the 41-60
It can be inferred that F showed a changing trend over a mm size group. However, it showed moderate correlation
span of one year. Maximum fouling load was observed between DVM-APM (r2 = 0.577, P = 0.002, n = 33) and
during the month of September 2011 (27.8 5.1 g) DVM-HL (r2 = 0.523, P < 0.001, n = 33).
followed by February 2012 (19.5 13.5 g) and June Maximum number of individuals collected
2012 (15.0 3.6 g). during the study belonged to the size group 61-80 mm.
Fouling load was minimal during July 2012 (3.2 The regression analysis of this size group showed
3.7 g) followed by November 2011 (4.6 6.9 g) and moderate to low correlation between DVM and all the
December 2011 (4.7 14.1 g). other parameters, with the exception of DVM-APM
Correlation of DVM with other biometric parameters (r2 = 0.721, P < 0.001, n = 52).
The size-wise correlation of biometric In the largest size group of 81-100 mm (n = 24),
dimensions with the DVM (at 99.5% significance level) all the parameters showed poor correlation with the
has been presented in Table 1. DVM. The regression coefficient for most of
In the lower size group of 1-20 mm, the the parameters of the above mentioned size ranges
maximum correlation was observed between DVM-APM when tested against DVM with one-way ANOVA,
2
(r = 0.876, P > 0.05, n = 18). Correlation coefficient showed significant value except for a few as mentioned
2
values of DVM-THK (r = 0.673, P < 0.001, n = 18) and in Table 1.
Fig. 2 Average increment (SE) in the biometric dimensions of 5 size groups

of Pinctada margaritifera.

Jha and Mohan, 2014
Correlation of F with biometric parameters investment of body energy in reproduction rather than
The regression analysis of biometric parameters shell growth (Pouvreau et al., 2000b), etc., might have
with F showed poor correlation in all the size groups consequently resulted in the slow allometric growth rate
except for a moderate correlation between TWT-F (Gimin et al., 2004; El-Sayed et al., 2011) and hence
2
(r = 0.619, P < 0.001, n = 33) for the 41-60 mm size poor correlation between DVM and other shell
group (Table 2). dimensions in the higher size groups of black-lip pearl
oyster of intertidal region of South Andaman.
DISCUSSION Shell Dimensional Relationship
Maximum value of correlation coefficient for The smaller oysters showed more increment in
most of the shell dimensions was seen in small size shell dimension than in total weight. It might be due to
oysters hinting towards isometric growth of the oyster at the fact that in the initial stages of the oysters
this stage. The site of attachment selected by settling development, the body energy is mainly utilized towards
larval stage plays a pivotal role in the biometric growth the shell growth when compared to the tissue growth or
of these sessile organisms, as the Pediveliger larvae settle reproductive development (Chellam, 1987; Dharmaraj
in the crevices of rocks during the juvenile stage and it et al., 1987b; Gimin et al., 2004).
has enough space available for growth in all the A good correlation between DVM-APM was
dimensions. Optimum space availability and lesser food observed between smaller size groups, 1-20 mm
requirement could be a possible reason for such type of (r2 = 0.876, P > 0.05, n = 18) and 21-40 mm, (r2 = 0.802,
growth. P > 0.05, n = 24) indicating comparable increase in the
Harsh environmental conditions viz. atmospheric growth rate of the two variables. Low regression value
and respiratory stress due to exposure during low tide, for higher size groups could have been due to the
limited food availability (Bartol et al., 1999), water investment of energy for tissue development or
temperature and turbidity (Pouvreau and Prasil, 2001), reproductive maturity.
competition between foulers with oyster (Zhenxia et al., The correlation values for DVM-HL in
2007), limited space for growth (Abraham et al., 2007), the present study were slightly better (highest
2
decrease in growth rate with age due to progressive being r = 0.808, P = 0.001, n = 24, 21-40 mm) than that
Fig. 3 Month-wise average fouling load (SE) on Pinctada margaritifera.

Jha and Mohan, 2014
Table 1. Estimates of biometric relationship between DVM and other shell parameters in different size
groups of Pinctada margaritifera, along with the results of one-way ANOVA.
Size Group (mm) N Variables a Value b value r2 value P value- S/NS
DVM- APM 0.848 0.878 0.876* 0.370 - NS
DVM-HL 1.547 0.793 0.550 0.180 - NS
1-20 18
DVM-THK 2.402 0.430 0.673* < 0.001 - S
DVM-TWT 0.275 1.218 0.218 < 0.001 - S
DVM-APM 1.113 0.955 0.802* 0.120 - NS
DVM-HL 3.006 0.926 0.808* 0.001 - S
21-40 24
DVM-THK 3.113 0.402 0.673* < 0.001 - S
DVM-TWT 0.304 2.236 0.304 0.110 - NS
DVM-APM 1.525 0.936 0.577* 0.002 - S
DVM-HL 3.664 0.666 0.523* < 0.001 - S
41-60 33
DVM-THK 2.076 0.380 0.372 < 0.001 - S
DVM-TWT 0.144 3.015 0.725* < 0.001 - S
DVM-APM 20.16 1.182 0.721* < 0.001 - S
DVM-HL 1.911 0.554 0.378* < 0.001 - S
61-80 52
DVM-THK 2.158 0.355 0.343* < 0.001 - S
DVM-TWT 0.127 3.026 0.412* < 0.001 - S
DVM-APM 48.46 0.351 0.210 0.001 - S
DVM-HL 30.68 0.191 0.101 < 0.001 - S
81-100 24
DVM-THK 12.82 0.148 0.106 < 0.001 - S
DVM-TWT 1.878 1.786 0.180 < 0.001 - S
N= Number of individuals, a= Slope, b= Intercept, r 2= Correlation coefficient, *Pearsons correlation coefficient

significance level= 99.5%, P= Significance value, S= Significant, NS= Non-Significant.

Jha and Mohan, 2014
Table 2. Estimates of biometric relationship between F and other shell parameters in different size groups
of Pinctada margaritifera, along with the results of one-way ANOVA.
Size Group (mm) N Variables a Value b value r2 value P value- S/NS
DVM - F 0.019 2.032 0.293 <0.001- S
APM - F 0.020 2.232 0.325 <0.001- S
HL - F 0.029 1.592 0.292 <0.001- S

1-20 18
THK - F 0.076 0.429 0.236 <0.001- S
TWT - F 0.167 0.018 0.293 <0.001- S
DVM - F 0.005 4.402 0.243 <0.001- S
APM - F 0.030 2.938 0.142 <0.001- S
HL - F 0.056 2.569 0.120 <0.001- S

21-40 24
THK - F 0.786 2.196 0.190 <0.001- S
TWT - F 0.235 0.111 0.331 <0.001- S
DVM - F 0.012 3.649 0.300 <0.001- S
APM - F 0.034 3.248 0.412 <0.001- S
HL - F 0.646 1.890 0.211 <0.001- S

41-60 33
THK - F 1.790 1.981 0.341 <0.001- S
TWT - F 0.495 4.893 0.619* <0.001- S
DVM - F 0.031 3.035 0.088 <0.001- S
APM - F 0.286 2.017 0.091 <0.001- S
61-80 52 HL - F 1.214 1.61 0.063 0.002- S

THK - F 5.468 0.924 0.029 <0.001- S
TWT - F 0.150 7.487 0.066 <0.001- S
DVM - F 7.363 1.940 0.046 <0.001- S
APM - F 1.717 2.450 0.057 <0.001- S
HL - F 10.81 0.134 0.038 <0.001- S

81-100 24
THK - F 1.949 1.802 0.096 <0.001- S
TWT - F 0.015 11.300 0.004 <0.001- S
N= Number of individuals, a= Slope, b= Intercept, r 2= Correlation coefficient, * Pearsons correlation coefficient

significance level= 99.5%, P= Significance value, S= Significant, NS= Non-Significant.

Jha and Mohan, 2014
obtained by Abraham et al., 2007 (highest being rate of increase in the individual TWT with respect to the
2 2
r = 0.31, n = 22, 36-55 mm) and the value (r = 0.79, increase in individual DVM is not uniform amongst the
n = 106, 34.0-109.5 mm) obtained by Alagarswami specimen belonging to the same size class.
(1983). The site of collection of specimen may also have In the size group of 1-20 mm (r2 = 0.218,
an impact on this observation because oysters in the P < 0.001, n = 18) and 21-40 mm (r2 = 0.304, P > 0.05,
present study were collected exclusively from intertidal n = 24) the correlation between DVM-TWT was poor
area where they are attached to the crevices of rocks indicating gonadal development might still be in the
having limited space for growth whereas in case of other nascent stages accounting for slower rate of increase in
authors sub tidal and deep water specimens were also their tissue weight (Chellam, 1987). However, good and
studied. moderate correlation was observed in the size group
The values obtained for coefficient of correlation 41-60 mm (r2 = 0.725, P < 0.001, n = 33) and 61-80 mm
between DVM-THK in the present study was moderate (r2 = 0.412, P < 0.001, n = 52), respectively, indicating
for size range 1-20 mm (r2 = 0.673, P < 0.001, n = 18) that the concentration of body energy was beginning to
2
and 21-40 mm (r = 0.673, P < 0.001, n = 24). But was direct more towards tissue growth rather than shell
2
slightly lower (r = 0.372, P < 0.001, n = 33) for size growth which finally concluded with low correlation
range 41-60mm) than those obtained by Abraham, values in the 81-100 mm group (r2 = 0.180, P < 0.001,
(2007) (r2 = 0.82 for size range 36-55 mm). In larger n = 24), where most of the body energy was directed
oysters, a poor correlation existed between DVM-THK towards tissue growth indicated by a higher rate of
2 2
(r = 0.343, P < 0.001, n = 52 and r = 0.106, P < 0.001, increase in TWT when the rate of increase of all the
n = 24 for 61-80 mm and 81-100 mm size group other biometric parameters declined.
respectively). This could be explained by the report of In the present study, the lower degree of
Sims (1993) which stated that, in the larger oysters the correlation between DVM-TWT compared to
rate of increase of DVM becomes very slow and the Alagarswami (1983), Friedman and Southgate (1999)
subsequent growth consists mainly of increase in shell and Pouvreau (2000) who obtained very good correlation
thickness with continuous secretion of nacre throughout between these two variables (r2 = 0.96, 0.86 and 0.97
its life. respectively) could be due to the fact that in the other
As the size range and total number of specimen studies specimen were either cultured in farm (Friedman
in biometry study by other authors (34-109.5 mm, and Southgate, 1999; Pouvreau, 2000a) or collected
n = 106, Alagarswami, 1983; 40.18-132.72 mm, n = 458, mostly from sub tidal or deep waters (Alagarswami,
Abraham et al., 2007) were different from the present 1983; Abraham et al., 2007).
study (7.06-99.01 mm, n = 151) the correlation value In those habitats isometric growth can take place
between shell dimensions also differed and only few size due to less stress per unit area in terms of availability of
ranges could be compared. food and space, protection from direct sunlight and
Length Weight Relationship desiccation, predators, low turbidity and continuous
Similar to the observation of Abraham et al., oxygen supplies as opposed to the harsh intertidal
(2007), there was an increase in the average total weight condition in this study.
with respect to increase in the average shell length Shell Dimensions and Fouling Load
(Fig. 1). Hence, the low value of correlation between Biofouling caused by the settlement of fouling
these two variables in the present study suggests that the organisms on the shell surface adversely affects the

Jha and Mohan, 2014
wellbeing of pearl oysters. It leads to retarded growth 9.9 g, n = 52) expressed in Fig. 1.
(Southgate and Beer, 2000), deformation and Occurrence of lesser F in 81-100 mm size
deterioration of the shell (Taylor et al., 1997b; Doroudi, group (12.8 7.1 g, n = 24) as compared to its preceding
1996) and even mortality of the oyster in extreme cases length group could be attributed to the attachment of
(Alagarswami and Chellam, 1976; Mohammad, 1976). these specimens in area having oligotrophic waters with
Maximum fouling load observed during the less fouling activity, lesser competition for available
month of September 2011 (27.8 5.1 g) followed by resources and lower risk of predators which could be the
February 2012 (19.5 13.5 g) and June 2012 (15.0 3.6 reason for their large size in the first place.
g) could be attributed to the settlement of heavy foulers A poor correlation in general was observed
(weight-wise) such as predatory mussel, tube forming between F and other shell dimensions for all the size
polychaetes, barnacles, sponges and ascidians found to groups except 41-60 mm (r2 = 0.619, P < 0.001, n = 33)
be dominant during these months. Such settlement may in Table 2. The variation in the growth rate of shell and
have caused the increase in the fouling load (Dharmaraj rate of fouling in different size groups could be the
1987a) and in turn might have influenced the recruitment reason for their poor correlation.
of other foulers. The Critical Size Group, 41-60 mm
Minimal fouling load during July 2012 Contrary to all the other size groups, 41-60 mm
(3.2 3.7 g), November 2011 (4.6 6.9 g) and size group showed the best correlation between DVM-
December 2011 (4.7 14.1 g) could be due to the fact TWT with r2 corresponding to 0.725. However, the
that these months are peak period of spawning of the correlation between other biometric dimensions was
above foulers, no attachment of heavy foulers occurred moderate to low (Table 1). Amongst all the size classes,
during this period. Similar results were reported by F showed better correlation with other shell dimensions
Alagarswami and Chellam (1976), Dev and Muthuraman in this size class (Table 2). The above observations
(1987) and Velayudhan (1988) in their studies on suggest that the P. margaritifera of the intertidal regions
biofouling of Akoya pearl oyster Pinctada fucata. of Andaman, attains initial sexual maturity in this size
Scardino et al., (2003) and Aji (2011) in their group with the beginning of their gonad development
respective studies on pearl oysters reported that the rate and complete reproductive development takes place as
of fouling is lower in the smaller oysters due to the the oyster reaches 61-80 mm size group and becomes
presence of periostracum layer (a physical defence fully mature. This justifies their increased tissue weight
against fouling) which wears off with aging in larger and retarded growth of other shell dimensions with
oysters. An increase in the shell surface area also respect to DVM (Fig. 2). The body energy at this stage
facilitates higher settlement of biofoulers (Mohammed, gets distributed more towards tissue growth than shell
1998). growth (Bayne and Newell, 1983; Dharmaraj, 1987b).
This explains the lower values of fouling load in Gervis and Sims (1992) also stated that full
size groups 1-20 mm (0.1 0.1 g, n = 18) and 21-40 mm maturity occurs in P. margaritifera in 2nd year at size
(1.0 1.0 g, n = 24). Availability of more surface area >70 mm. Pouvreau et al., (2000b) and Kimani and
for settlement of foulers and wearing off of the Mavuti (2002) in their respective studies on black-lip
periostracum layer could be responsible for multifold pearl oyster of French Polynesia and Kenya reported that
time increment in the fouling load in the size groups the initial sexual maturity, corresponding to the smallest
41-60 mm (7.3 5.3 g, n = 33) and 61-80 mm (14.9 individual with mature gonads occur at the end of 1 st

Jha and Mohan, 2014
year at size <40 mm. Chellam (1987) in his study on its effect on their biometry. 3) It shall also throw some
Indian Pinctada fucata also reported that cultured oysters light on the importance of these intertidal oysters in the
became sexually mature in 9 months (size <47 mm). This pearl culture industry.
difference in size at sexual maturity of both the species
in India is possible as P. margaritifera in comparison to ACKNOWLEDGEMENT
P. fucata is a larger and late maturing species (Pouvreau The authors are thankful to the Vice Chancellor,
et al., 2000b). Pondicherry University for providing infrastructural
From the present study it can be concluded that, support for this study at the Department of Ocean Studies
1) Smaller oysters show isometric growth pattern but in and Marine Biology, Pondicherry University, Port Blair
larger oysters, allometry is observed as the rate of campus. The first author is also obliged to the University
increase of biometric parameters vary with increasing Grants Commission (UGC), New Delhi for providing
size range. 2) September, February and June months financial aid in the form of Research Fellowship in
witness settlement of heavy foulers whereas fouling load Science for Meritorious Student (RFSMS).
is minimal during the month of July, November and
December, 3) Even though F did not show any REFERENCES
significant correlation with the DVM, biofouling could Abraham KJ, Libini CL, Basak R, Madhupal P,
Kripa V, Velayudhan TS, Mohamed KS and Modayil
also be a possible factor responsible for restricting the
MJ. 2007. Biometric relationships of the black-lip pearl
maximum size attained by these oysters or in extreme
oyster Pinctada margaritifera (Linnaeus, 1758) from the
cases even mortality of the oyster by competing for Andaman and Nicobar waters. Indian J Fish. 54(4):409-
resources required for their growth, 4) 41-60 mm size 415.
group is a critical stage in the life cycle of these Aji L. 2011. An overview of the method, management,
specimen when sexual maturity initiates, 5) Harsh problem and their solution in the pearl oyster (Pinctada
intertidal environment could be responsible for margaritifera) culture. J Coast Develop., 14(3):181-190.
difference in growth pattern and also for confining most Alagarswami K. 1991. Production of cultured pearls.
of the P. margaritifera from intertidal regions of ICAR, New Delhi.15-21.
Andaman, to the size group of 61-80 mm, 6) The Alagarswami K. 1983. The black-lip pear oyster
intertidal P. margaritifera which are adapted to survive resource and pearl culture potential. In: Mariculture
in tough environmental conditions would more easily potential of Andaman and Nicobar Islands-An indicative
acclimatize to a new environment such as in the case of survey (K. Alagarswami, Ed.). Bulletin of Central
Marine Fisheries Research Institute, CMFRI, Cochin.
suspended or raft culture, if transferred at an early stage,
34:72-78.
they could cross the 61-80 mm size range and become
Alagarswami K. 1987. Pearl culture. Bulletin of Central
larger and thicker, a parameter favourable for pearl
production.
39:136 p.
The present biometric study of P. margaritifera
Alagarswami K and Chellam A. 1976. On fouling and
will be helpful in 1) Understanding the correlation
boring organisms and mortality of pearl oysters in the
existing between length and other shell dimensions of farm at Veppalodai, Gulf of Mannar. Indian J Fish. 23
different size groups in intertidal rocky habitat and the (1-2):10-22.
factors responsible for it, 2) Observing the trend of
Bartol IK, Mann R and Luckenbach M. 1999. Growth
biofouling on various size ranges of P. margaritifera and and mortality of oysters (Crassostrea virginica) on

Jha and Mohan, 2014
constructed intertidal reefs: effects of tidal height and Islands. J Shellfish Res., 18:451-458.
substrate level. J Expt Mar Boil Ecol., 237(2):157-184.
Gervis MH and Sims NA. 1992. The biology and
Bayne BL and Newell RCA. 1983. Physiological culture of pearl oysters (Bivalvia: Pteriidae). Manila
energetics of marine molluscs. In: The Mollusca, (Philippines). ICLARM Stud. Rev., 21:1-49.
Volume 4, Physiology, part 1 (eds: S. M. Saleuddin, Karl
Gimin R, Mohan R, Thinh LV and Griffiths AD.
Milton Wilbur), Academic Press, London. p.407-515.
2004. The relationship of shell dimensions and shell
Chellam A. 1987. Biology of pearl oyster. In: Pearl volume to live weight and soft tissue weight in the
culture (K. Alagarswami, Ed.). Bulletin of Central mangrove clam, Polymesoda erosa (Solander, 1786)
Marine Fisheries Research Institute, CMFRI, Cochin. from Northern Australia. NAGA, World Fish Center
39:13-20. Quarterly. 27(3 and 4): 32-35.
Dev DS and Muthuraman AI. 1987. Observation on Hynd JS. 1955. A revision of Australian pearl- shells,
the biofouling in pearl oyster farm at Krusadai Island, genus Pinctada (Lamelli-branchia). Aust J Mar
Gulf of Mannar. In: National seminar on shellfish Freshwater Res., 6(1):98-138.
resources and farming sessions-II-IV (eds: Mahadevan S,
Kimani EN and Mavuti KM. 2002. Abundance and
Narasimham KA, Satya Narayana Rao K, Ameer Hamsa
population structure of the black-lip pearl oyster,
KMS and Muthiah P). Bulletin of Central Marine
Pinctada margaritifera L. 1758 (Bivalvia: Pteriidae), in
Fisheries Research Institute, CMFRI, Cochin. 42(2): 306
coastal Kenya. Western Indian Ocean J Mar Sci.,
-310.
1(2):169-179.
Dharmaraj S, Chellam A and Velayudhan TS. 1987a.
Kripa V, Abraham KJ, Libini CL, Velayudhan TS,
Biofouling, boring and predation of pearl oyster. In:
Radhakrishnan P, Mohamed KS and Modayil MJ.
Pearl culture (K. Alagarswami, Ed.). Bulletin of Central
2008. Production of designer Mabe Pearls in the black-
Marine Fisheries Research Institute, CMFRI, Cochin, p.
lipped pearl oyster, Pinctada margaritifera, and the
39: 92-97.
winged pearl oyster, Pteria penguin, from Andaman and
Dharmaraj S, Kandasami D and Alagarswami K. Nicobar Islands, India. J World Aquacult Soc., 39(1):131
1987b. Some aspects of physiology of Indian pearl -137.
oyster. In: Pearl culture (K. Alagarswami, Ed.). Bulletin
Mohamed KS, Kripa V, Velayudhan TS and
of Central Marine Fisheries Research Institute, CMFRI,
Appukuttan KK. 2006. Growth and biometric
Cochin. 39: 21-28.
relationships of the pearl oyster Pinctada fucata (Gould)
Doroudi MS. 1996. Infestation of pearl oysters by on transplanting from the Gulf of Mannar to the Arabian
boring and fouling organisms in the northern Persian sea. Aquaculture Research. 37(7):725-741.
Gulf. Indian J. Mar. Sci., 25(2):168169.
Mohammad MBM. 1976. Relationship between
El-Sayed AEH, Razek FAA, Abou-Zaid MM and biofouling and growth of the pearl oyster Pinctada
Taha SM. 2011. Measures of allometric growth of black fucata (Gould) in Kuwait, Arabian Gulf. Hydrobiologia.
-lip pearl oyster Pinctada margaritifera (Linnaeus, 1758) 51(2):129-138.
Red Sea, Egypt. Int J Zool Res., 7(2):201-211.
Mohammed SZ. 1998. On the epifouling of pearl oyster
Fletcher W, Friedman K, Weir V, McCrea J and (Pinctada radiata) in Qatari water Arabian Gulf and its
Clark R. 2006. Pearl oyster fishery. Department of influence on the flesh growth. Egyptain J Aquat Biol and
Fisheries, Western Australia. Fish. 2(2):73-85.
Friedman KJ and Southgate PC. 1999. Grow-out of Moullac GL, Tiapari J, Teissier H, Martinez E and
black-lip pearl oysters, Pinctada margaritifera (Linnaeus Cochard JC. 2012. Growth and gonad development of
1758) on chaplets in suspended culture in Solomon the tropical black-lip pearl oyster, Pinctada

Jha and Mohan, 2014
margaritifera (L.), in the Gambier archipelago (French maxima (Jameson), held in suspended nursery culture.
Polynesia). Aquac Internat. 20(2): 305-315. Aquaculture. 153(1-2): 41-49.
Pit JH and Southgate PC. 2003. Fouling and predation; Velayudhan TS. 1988. Studies on the settlement
how do they affect growth and survival of the black-lip of barnacles at different depths in the pearl oyster farm
pearl oyster, Pinctada margaritifera, during nursery at Tuticorin. In: National seminar on shellfish resources
culture? Aquac Internat. 11(6): 545 555. and farming sessions-II-IV (eds: Mahadevan S,
Narasimham KA, Satya Narayana Rao K, Ameer
Pouvreau S, Gangnery A, Tiapari J, Lagarde F,
Hamsa KMS and Muthiah P). Bulletin of Central
Garnier M and Bodoy A. 2000b. Gametogenic cycle
and reproductive effort of the tropical black- lip pearl
42(2): 301-305.
oyster, Pinctada margaritifera (Bivalvia: Pteriidae),
cultivated in Takapoto atoll (French Polynesia). Aquat Zhenxia SU, Yan Y and Liangmin H. 2007. Effect of
Living Resour., 13(1): 37-48. Fouling on Feeding, Oxygen Consumption and Waste
Excretion of Pearl Oyster Pinctada martensii in Daya
Pouvreau S and Prasil V. 2001. Growth of the black-lip
Bay Cultivation. Mar Sci Bull., 9(2): 34-42.
pearl oyster, Pinctada margaritifera, at nine culture sites
of French Polynesia: synthesis of several sampling
designs conducted between 1994 and 1999. Aquat Living
Resour., 14(3): 155-163.
Pouvreau S, Tiapari J, Gangnery A, Lagarde F,

Garnier M, Teissier H, Haumani G, Buestel D and
Bodoy A. 2000a. Growth of the black-lip pearl oyster,
Pinctada margaritifera, in suspended culture under
hydrobiological conditions of Takapoto lagoon (French
Polynesia). Aquaculture. 184(1-2):133-154.
Saville-Kent W. 1893. The great barrier reef of

Australia: its products and potentialities, W.H. Allen and
Co., London, p. 204-224.
Scardino A, Nys RD, Ison O, Connor WO and

Steinberg P. 2003. Microtopography and antifouling
properties of the shell surface of the bivalve molluscs
Mytilus galloprovincialis and Pinctada imbricata.
Biofouling. 19(Supplement 1): 221-230.
Sims NA. 1993. Size, age and growth of the black-lip

pearl oyster, Pinctada margaritifera (L.) (Bivalvia: Submit your articles online at www.jresearchbiology.com
Pteriidae). J Shellfish Res., 12:223-228. Advantages

Southgate PC and Beer A. 2000. Growth of black-lip Complete Peer review
pearl oyster (Pinctada margaritifera) juveniles using Affordable Charges
different nursery culture techniques. Aquaculture. 187 Quick processing
(1-2): 97-104. Extensive indexing
Taylor JJ, Rose RA, Southgate PC and Taylor CE.
1997. Effects of stocking density on growth and survival www.jresearchbiology.com/Submit.php.
of early juvenile silver-lip pearl oysters, Pinctada


Original Research
Genetics characterization, nutritional and phytochemicals potential of gedi leaves

(Abelmoschus manihot (L.) Medik) growing in the North Sulawesi of Indonesia as a
candidate of poultry feed
Authors: ABSTRACT:
Jet S Mandey1*, Gedi, local name of Abelmoschus manihot (L.) Medik was used by local
Hendrawan Soetanto2, people in Northern Sulawesi-Indonesia as vegetable, because of its medicinal
Osfar Sjofjan2 and properties. The potency of gedi leaves in broiler diet has not been reported in
Bernat Tulung1. literatures. The objective of this research was to investigate a genetic diversity of gedi
commonly consumed as a gourmet cuisine in the North Sulawesi of Indonesia, and
exploring the potential of this plant as a herb plant for a candidate of poultry
Institution: feedstuff. Eight morphologically different gedi leaves (GH1, GH2, GH3, GH4, GH5, GH6,
1. Animal Husbandry GM1 and GM2) that grow in Manado area, North Sulawesi of Indonesia were collected
Faculty, Sam Ratulangi and identified. The leaves were extracted for DNA isolation followed by PCR and DNA
University, Manado, sequencing analysis. During DNA isolation, 3 of 6 GH (GH4, GH5, GH6) were
The North Sulawesi, discontinued because of difficulty in separating the mucilage properties. Following
Indonesia . PCR analysis, GH2 and GH3 did not produce bands and consequently were excluded
from further analysis. In addition to that, chemical analysis was also performed to
2. Animal Nutrition
determine the phytochemical and nutritional contents .The results indicated that all
Department, Animal
gedi leaf samples showed similarity (99%) to species member of Abelmoschus
Husbandry Faculty,
Brawijaya University, manihot, and tribe of Malvaceae. In terms of proximate analysis, gedi leaves showed
Malang, The East Java, high crude protein (18.76 - 24.16%) and calcium (2.92-3.70%) content. Also, showed
Indonesia. high crude fibre (13.06-17.53%). Together with the presence of alkaloid and steroidal
saponin gedi leaves may offer beneficial effects as poultry feedstuff to a special
production trait such as cholesterol-less meat.

Jet S Mandey. Abelmoschus manihot, genetic characterization, nutritional analysis,
phytochemical constituents.
Article Citation:
Email Id:
Jet S Mandey, Hendrawan Soetanto, Osfar Sjofjan and Bernat Tulung.
Genetics characterization, nutritional and phytochemicals potential of gedi leaves
(Abelmoschus manihot (L.) Medik) growing in the North Sulawesi of Indonesia as a
candidate of poultry feed.
Web Address: Dates:

http://jresearchbiology.com/ Received: 06 Mar 2014 Accepted: 22 Mar 2014 Published: 19 May 2014
1276-1286 | JRB | 2014 | Vol 4 | No 2

An International
Mandey et al., 2014
INTRODUCTION information of Abelmoschus manihot derived from the

Abelmoschus manihot (L.) Medik is a native studies carried out in the polynesian pacific regions
plant which is 1.2 1.8 m height and is widely (Preston, 1998).
distributed in the tropical regions. This plant has various Gedi as a culinary herb and medicinal herb may
local names such as aibika. It was hypothesized that the have beneficial effects in animals. The phytochemical
origin of this plant from the survey of literature the local and nutritional compounds of leaf material may affect to
names of Abelmoschus manihot (L.) Medik varies and poultry health and productivity. Cross et al., (2007)
the data available were largely derived from studies reported that culinary herbs in diets affect chick
carried out in the polynesian-pacific regions (Preston, performance, gut health and endogenous secretions.
1998). In North Sulawesi of Indonesia this plant is called Al-Sultan and Gameel (2004) suggests that feeding
gedi and its leaves provide essential ingredient for Curcuma longa (turmeric) to chicken through diet can
cooking porridge as a special gourmet food among the induce hepatic changes and that these changes are not
North Sulawesi cuisine. According to Jain and Bari dose or time dependent. Windisch et al., (2008) cited
(2010), gedi leaves contain polysaccharides and protein several research, i.e. that phytogenic product also
containing mucilage (gum) that enables the porridge to reduced activities of intestinal and fecal urease enzyme
have a special viscosity. Morphologically, gedi plants in broilers.
vary in shape, color and other properties regardless of Ashayerizadeh et al., (2009) reported that garlic
geographical differences suggesting some genetic powder and turmeric powder in diet significantly reduced
variation may occur after a long period of adaptation. abdominal fat percent, LDL and VLDL concentration in
Gedi plants have been reported to posses serum of broiler. Moreover, Yang et al., (2003) reported
medicinal properties that may benefit to human health. that green tea by product affect the reduction of body
Puel et al., (2005) reported that the female wistar rat weight gain and meat cholesterol in broilers. Khatun
which feeding 15 % of gedi leaves prevent osteopenia et al., (2010) observed using in vitro model that viscous
that was attributable to the calcium content of gedi water-soluble portion of the fruit of Abelmoschus
leaves. Other authors, Jain et al., (2009) reported that esculentus (L.) Moench has significant capacity to
woody stem of gedi plant contain stigmasterol and reduce the glucose diffusion form the dietary fiber-
-sitosterol, and also contain isoquercitrin, hyperoside, glucose systems.
hibifolin, quercetin and isohamnetin that have anti The study was undertaken to investigate the
consulvant and anti depressant-like activity (Guo et al., compositional characterization of gedi. The samples
2011; Wang et al., 1981; Wang et al., 2004). Gedi leaves were an alysed for the molecular characterization and
have active pharmacological properties against analgesic identification, the proximate composition of the leaf part,
effect (Jain et al., 2011). Sarwar et al., (2011) stated that energy content and the phytochemical composition, in
Abelmoschus manihot has a profound anti-inflammatory order to get some useful information to be used in the
and anti-diabetic effect. From these reports it can be preparation of poultry feed. Because there are no major
concluded that gedi plants posses herbal medicine reports in the literature, this would be an information for
properties that can be used to manipulate the human and the detailed utilization of gedi to poultry feed.
animal health. In spite of its phytopharmaceutical
benefits there is paucity in information dealing with
genetic diversity of gedi plant in Indonesia. Most
Mandey et al., 2014
MATERIAL AND METHODS were initially screened for amplification in PCR, they are
Plant Identification Primer ndhF-F1 with product description 5-GAA-TAT-
Eight accessions of gedi (Abelmoschus manihot) GCA-TGG-ATC-ATA-CC-3 (length 20) dan primer
collected from Manado, the North Sulawesi, Indonesia ndhF-R1318 with product description 5-CGA-AAC-
were used for this study. Herbarium specimens were ATA-TAA-AAT-GCR-GTT-AAT-CC-3 (length 26).
identified for plant species at the Research Center for PCR conditions were pre-hot 94C (5 minutes),
Biology, Indonesian Institute of Sciences, Bogor, denaturation 94C (45 seconds), annealing 54C (45
Indonesia. seconds), primerization 72C (1 minute 30 seconds) in
DNA extraction, quantification, and sequencing 35 cycles and hold at 72C (5 minutes). All PCR
DNA was extracted from 80-100 mg of fresh leaf products were separated by electrophoresis in 1%
tissue from each of the 5 randomly selected samples agarose gel in 1 x TBE ran for 2 hours followed by
using a protocol of AxyPrep Multisource Genomic DNA ethidium bromide staining (5 g ethidium bromide/ml).
Miniprep Kit (Axygen Biosciences, The gel was then stained and rinsed in water for about 10
www.axygenbio.com). Three samples were scored as minutes, and after that visualized under UV-light in trans
missing because of unable to isolate the mucilage. The -illuminator.
final DNA supernatant were diluted for DNA All PCR products were sequenced. Sequence
quantifications with PCR technique. PCR analysis were data were identified at First Base Laboratories Sdn, Bhd
performed using a Thermocycler machine, and in 50 l (1st base), Taman Serdang Perdana, Selangor, Malaysia.
reaction mixture containing 2 l template of DNA, 2 x Sequences were aligned using BLAST programme, and
master Mix Vivantis 25 l (Vi Buffer A 1 x; Taq the building of a phylogenetic tree was established by
Polimerase 1,25 unit), Primer F1 (10 pmol/l) 1 l (0,2 Bioedit 7.19 and Mega 5 programme (http://
mM), Primer R1318 (10 pmol/l) 1 l (0,2 mM), MgCl 2 megasoftware.net).
(50 mM) 1,5 l (3 mM dNTPs 0,4 mM), H2O 20,5 l, Phytochemical Screening
sample 1 l.Initial trial was run on 5 samples and Taq Chemical tests were carried out to evaluate the
quantity was Taq Polimerase 1,25 unit. Two primers presence of the phytochemicals such as alkaloids,
Table 1: Identification/Determination of Gedi Leaves from Manado, North Sulawesi
No Place of Collection Species Tribe

1 (1) (GH4) Abelmoschus manihot (L.) Medik Malvaceae
4 (4) (GM2) Abelmoschus manihot (L.) Medik Malvaceae
6 (8) (GM1) Abelmoschus manihot (L.) Medik Malvaceae
Notes: GH = green leaf; GM = reddish green leaf; GH1= Bumi Nyiur; GH2 = Wanea; GH3 = Bumi
Beringin; GH4 = Teling; GH5 = Bahu; GH6 = Kleak; GM1 = Tingkulu; GM2 = Wanea.

Mandey et al., 2014
flavonoids, saponins, tannins, triterpenoids/steroids, and Test for phenolic

hydroquinone in five selected samples; using standard Approximately 5 g powder was shaken and then
procedures described by Harborne (1987), and one of the heated to boil and filtered. For testing the presence of
five samples was performed for total flavonoid analysis. flavonoids, filtrate was added with Mg powder,
Test for alkaloids HCl:EtOH (1:1) and amyl alcohol. A yellow solution that
One gram of sample was homogenized, added turned colorless within few minutes indicated the
with chloroform and then with 3 ml of ammonia. presence flavonoids. For the evaluation of saponins,
Chloroform fraction was separated and acidified using filtrate was shaken with distilled water. The presence of
H2SO4 2M for two minutes. The filtrate was separated saponins was indicated by the appearance of bubbles. For
and added with few drops of Mayer, Wagner, and the evaluation of tannins availability, filtrate was added
Dragendorffs reagent. The sample was contained with three drops of FeCl3 10%. The dark green solution
alkaloid if produced white sediment using Mayer indicated the presence of tannins.
reagent, orange sediment using Dragendorff reagent, and Test for steroids/triterpenoids
brown sediment using Wagner reagent. Four grams of sample were added with 2 ml hot
ethanol. Filtered and heated, and homogenized with 1 ml
Table 2: Nutrients composition and energy values of gedi leaf (dry weight basis)
Types of Gedi
Nutrients
GH1 GH2 GH3 GM1 GM2
Dry Matter (%) 81.72 87.33 87.14 86.70 84.76
Ash (%) 11.78 13.22 11.45 12.29 14.27
Crude Protein (%) 20.18 18.76 19.89 22.62 24.16
Crude Fiber (%) 17.53 14.37 15.68 14.37 13.06
Crude Fat (%) 1.06 3.80 2.96 1.63 4.51
N-free extract (%) 31.17 37.18 37.16 35.79 28.76
Ca (%) 3.29 3.70 2.92 3.33 3.36
P (%) 0.39 0.50 0.55 0.48 0.85
GE (Kkal/kg) 3419 3859 3850 3654 3699
Component of Fiber (%):

NDF 20.78 21.72 25.02 34.09 23.51
ADF 18.44 19.11 16.23 20.10 17.30
Hemicellulose 2.34 2.61 8.79 13.99 6.21
Cellulose 11.39 15.25 11.02 5.50 10.62
Lignin 5.88 3.02 4.54 13.17 6.50
Silica 1.15 0.84 0.66 1.18 0.16
Notes: GH = green leaf; GM = reddish green leaf

Mandey et al., 2014
GH1 GH2
GH3 GH4
GH5 GH6
GM1 GM2
Figure 1: Eight accessions of gedi leaf collected from Manado, North Sulawesi. GH1= Bumi Nyiur area, GH2 =
Wanea area, GH3 = Bumi Beringin area, GH4 = Teling area, GH5 = Bahu area, GH6 = Kleak area, GM1 = Ting-
kulu area, GM2 = Wanea area

Mandey et al., 2014
diethyl ether. It is added with one drop of H 2SO4 and one plant identification of eight accessions of gedi leaf were
drop of CH3COOH anhydrate. The presence of steroids summarized in Table 1. Those have been recognized that
was indicated by the alteration of violet to blue or green all of eight accessions of gedi leaf in this research were
color. The formation of reddish violet color to the species of Abelmoschus manihot (L.) Medik, tribe
interface was formed that indicating positive sign for Malvaceae. Breen (2012) reported that leaves are often
triterpenoids. the basis for identifying plants since they are so easily
Test for hydroquinons observed.
One gram sample was boiled with methanol for The boundaries of the eight accessions of gedi
few minutes. The filtrate was allowed to cool and then from the different locations of Manado area were based
added with 3 drops of NaOH 10%. The appearance of on morphological features of the species. The
red color indicated the presence of hydroquinone. phylogenetic hypotheses were tested using chloroplast
Nutritional Analysis DNA sequence of ndhF. Total genomic DNA were
The proximate analysis were carried out in extracted from eight accessions of fresh leaf material,
duplicates and the results obtained were the average and the ndhF gene was amplified in PCR using primer.
values. The proximate analysis (protein, crude fiber, In this research, DNA fragments of the expected
crude fat, carbohydrate and ash) of five types of gedi leaf size were amplified from five samples to obtain the
were determined by using the Association of Official of isolation product of electrophoresis, as shown
Analytical Chemists (AOAC) methods (1980). Nutrient at Figure 2. Based on DNA fragments, according to their
contents were valued in percentage. The energy value molecular weights those products indicated that there
was determined by bomb calorie meter. were no different chloroplast type of gedi leaf color
characteristics between green leaf (GH) and reddish
RESULTS AND DISCUSSION green leaf (GM) with bands of 1.3 kb (Figure 2).
Plant Identification Moreover, profile (external shape) of gedi leaf from the
Two typical colors of gedi leaves (green and two color types were analysed as shown in Figure 2. Two
reddish green leaves) growing at eight locations in samples of reddish green leaf (GM) and one sample of
Manado area were presented in Figure 1. All leaves of green leaf (GH) were used in the analysis of gedi leaf
this plant do not have the same size or even appearance. profile (Figure 3).
They vary in size, color, and even shape. The results of
Figure 2: Electrophoresis of 5 samples of gedi Figure 3: PCR amplification and electrophoresis product
leaf isolation product for profiles of gedi leaf obtained from 3 samples
Mandey et al., 2014
> gb|AF384639.1| Abelmoschus manihot NADH dehydrogenase component NdhF (ndhF)gene, partial cds;
chloroplast gene for chloroplast product
Length=1257
Score = 2242 bits (1214), Expect = 0.0
Identities = 1223/1229 (99%), Gaps = 2/1229 (0%)
Strand=Plus/Plus
Query 29 CTACTTTTTCCGACGGCAACAAAAAATCTTCGTCGTAGGTGGGCTTTTCCCAATATTTTA 88
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 CTACTTTTTCCGACGGCAACAAAAAATCTTCGTCGTAGGTGGGCTTTTCCCAATATTTTA 60
Query 89 TTGTTAAGTATAGTTATGATTTTTTCGGTCGATCTGTCTATTCAACAAATAAATGGAAGT 148

||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 TTGTTAAGTATAGNTATGATTTTTTCGGTCGATCTGTCTATTCAACAAATAAATGGAAGT 120
Query 149 TCTATCTATCAATATGTATGGTCTTGGACCATCAATAATGATTTTTCTTTCGAGTTTGGC 208

|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct 121 TCTATCTATCAATATGTATGGTCTTGGACCATCAATAATGATTTTTCTTTCGAGNTTGGC 180
Query 209 TACTTTATTGATTCACTTACCTCTATTATGTCAATATTAATCACTACTGTTGGAATTTTT 268

|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct 181 TACTTTATTGATTCACTTACCTCTATTATGNCAATATTAATCACTACTGTTGGAATTTTT 240
Query 269 GTTCTTATTTATAGTGACAATTATATGTCTCATGATCAAGGCTATTTGAGATTTTTTGCT 328

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 GTTCTTATTTATAGTGACAATTATATGTCTCATGATCAAGGCTATTTGAGATTTTTTGCT 300
Query 329 TATATGAGTTTGTTCAATACTTCAATGTTGGGATTAGTTACTAGTTCGAATTTGATACAA 388

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 TATATGAGTTTGTTCAATACTTCAATGTTGGGATTAGTTACTAGTTCGAATTTGATACAA 360
Query 389 ATTTATATTTTTTGGGAATTAGTTGGAATGTGTTCTTATCTATTAATAGGGTTTTGGTTC 448

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 ATTTATATTTTTTGGGAATTAGTTGGAATGTGTTCTTATCTATTAATAGGGTTTTGGTTC 420
Query 449 ACACGACCCGCTGCGGCAAACGCTTGTCAAAAAGCGTTTGTAACTAATCGGATAGGCGAT 508

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 ACACGACCCGCTGCGGCAAACGCTTGTCAAAAAGCGTTTGTAACTAATCGGATAGGCGAT 480
Query 509 TTTGGTTTATTATTAGGAATTTTAGGTTTTTATTGGATAACGGGAAGTTTCGAATTTCAA 568

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 TTTGGTTTATTATTAGGAATTTTAGGTTTTTATTGGATAACGGGAAGTTTCGAATTTCAA 540
Query 569 GATTTGTTCGAAATATTTAATAACTTGATTTATAATAATGAGGTTCATTTTTTATTTGTT 628

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GATTTGTTCGAAATATTTAATAACTTGATTTATAATAATGAGGTTCATTTTTTATTTGTT 600
Query 629 ACTTTATGTGCCTCTTTATTATTTGCCGGCGCCGTTGCTAAATCTGCGCAATTTCCTCTT 688
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 601 ACTTTATGTGCCTCTTTATTATTTGCCGGCGCCGTTGCTAAATCTGCGCAATTTCCTCTT 660
Query 689 CATGTATGGTTACCTGATGCCATGGAGGGGCCTACTCCTATTTCGGCTCTTATACATGCT 748

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 661 CATGTATGGTTACCTGATGCCATGGAGGGGCCTACTCCTATTTCGGCTCTTATACATGCT 720
Query 749 GCCACTATGGTAGCAGCGGGAATTTTTCTTGTAGCCCGCCTTCTTCCTCTTTTCATAGTT 808
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Mandey et al., 2014
Sbjct 721 GCCACTATGGTAGCAGCGGGAATTTTTCTTGTAGCCCGCCTTCTTCCTCTTTTCATAGTT 780
Query 809 ATACCTTACATAATGAATCTAATATCTTTGATAGGTATAATAACGGTATTATTAGGGGCT 868

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 781 ATACCTTACATAATGAATCTAATATCTTTGATAGGTATAATAACGGTATTATTAGGGGCT 840
Query 869 ACTTTAGCTCTTGCTCAAAAAGATATTAAGAGGGGGTTAGCCTATTCTACAATGTCCCAA 928

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 841 ACTTTAGCTCTTGCTCAAAAAGATATTAAGAGGGGGTTAGCCTATTCTACAATGTCCCAA 900
Query 929 CTGGGTTATATGATGTTAGCTTTAGGTATGGGGTCTTATCGAACCGCTTTATTTCATTTG 988

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 901 CTGGGTTATATGATGTTAGCTTTAGGTATGGGGTCTTATCGAACCGCTTTATTTCATTTG 960
Query 989 ATTACTCATGCTTATTCGAAAGCATTGTTGTTTTTAGGATCCGGATCAATTATTCATTCC 1048

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 961 ATTACTCATGCTTATTCGAAAGCATTGTTGTTTTTAGGATCCGGATCAATTATTCATTCC 1020
Query 1049 ATGGAAGCTGTTGTTGGGTATTCCCCAGAGAAAAGCCAGAATATGGTTTTGATGGGCGGT 1108

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1021 ATGGAAGCTGTTGTTGGGTATTCCCCAGAGAAAAGCCAGAATATGGTTTTGATGGGCGGT 1080
Query 1109 TTAAGAAAGCATGCACCTATTACACAAATTGCTTTTTTAATAGGTACGCTTTCTCTTTGT 1168

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1081 TTAAGAAAGCATGCACCTATTACACAAATTGCTTTTTTAATAGGTACGCTTTCTCTTTGT 1140
Query 1169 GGTATTCCACCCCTTGCTTGTTTTTGGTCCAAAGATGAAATTCTTAGTGACAGTTGGCTG 1228

||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct 1141 GGTATTCCACCCCTTGCTTGTTTTTGGTCCAAAGATGAAATTCTTAGTGACAGNTGGCTG 1200
Query 1229 TATTCACCGATTT--GCAATAATAGCTTG 1255

||||||||||||| ||||||||||||||
Sbjct 1201 TATTCACCGATTTTTGCAATAATAGCTTG 1229
Figure 4: DNA Sequence Alignment with BLAST Method
Based on DNA bands, the gedi leaf color type of Abelmoschus manihot (L.) Medik, tribe Malvaceae, and
GH and GM had the same positions of bands of 1.3 bp the sample GH1 was 96% similar to Abelmoschus
indicating the similar profiles. By sequencing the PCR manihot.(L.) Medik.
product, additional useful taxonomic and genome Nutritional Analysis
information were successfully obtained from three The proximate concentration of five samples of
samples. The ndhF data sets have aligned lengths gedi were expressed on dry basis listed in Table 2. The
of 1257 bases, and the sequence data were shown in proximate analysis showed that the gedi leaves contained
Figure 4. ash (11.45-14.27%), crude protein (18.76-24.16%), crude
Comparisons were done with a few selected fibre (13.06-17.53%), crude fat (1.06-4.51), N-free
DNA sequences, using closest relationship in a BLAST extract (28.76-37.18%) and gross energy (3419-3859
search. Analysis showed that this sequence was very Kkal/kg), and minerals were calcium (2.92-3.70%) and
similar to Abelmoschus manihot (L.) Medik (99%), as phosphorous (0.39-0.85%). In terms of proximate
shown in Figure 4. The phylogenetic analysis was done analysis, gedi leaves showed high crude protein (18.76 -
based on ndhF sequences from each of the available 24.16 %) and calcium (2.92-3.70%) content. Also, it
three sample accessions of gedi (Figure 5). The three showed high crude fiber (13.06-17.53%). In addition, the
samples were clearly obtained asa member of the species component of fiber were NDF (20.78-34.09), ADF

Mandey et al., 2014
Table 3: Phytochemical screening of gedi leaf
Qualitative
Quantitative (%)
Reddish (w/w) (n=3)
Phytochemicals Green
green
GH1 GH2 GH3 GM1 GM2 GH1
Wagner + + + - -
Alkaloid Meyer + - + - -
Dragendorf - + - - ++
Hidroquinon - - - - -
Tannin - - - - -
Flavonoid ++ ++ - + + 0.48
Saponin + ++ + - +
Steroid +++ +++ +++ +++ +++
Triterpenoid - - - - -
Notes: - = nothing; + = weak positive; ++ = positive; +++ = strong positive
(16.23-20.10%), hemicellulose (2.34-13.99%), cellulose depicted that all samples had rich steroid but had no
(5.50-15.25%), lignin (3.02-13.17%), and silica (0.16- tannin. Four samples contained saponin and flavonoid,
1.18%). Prasad, et al., (2010) reported that the while three samples contained alkaloid. The result of this
biological effects of estimated proximate components study indicated that Abelmoschus manihot (L.) Medik
(moisture, protein, fiber, fat, ash, and energy) in living from Manado is a good alternative source of
system strongly depend on their concentration. phychemical steroid, flavonoid and saponin.
Therefore, it should be carefully controlled when herbs The phytochemical steroid was detected in all
are used as food component. Energy and nutrient values types of gedi leaf, and this phytochemical was found in
of herb plant samples are mainly used to translate herb maximum content. Alkaloids were detected with Wagner
samples intakes as intakes of food components.The result reagent only in green leaves GH1, GH2, and GH3.
of this study indicated that Abelmoschus manihot (L.) Flavonoids were found at the adequate amount in green
Medik from The North Sulawesi might be the best leaf GH1 and GH2 while flavonoids in reddish green leaf
alternative source of nutrient. High protein and fiber were at the minimum amount. Quantification of total
obtained in this study confirms that Abelmoschus phenolic content from sample GH1 showed its phenolic
manihot can be used as good alternative source of protein content as 0.48% (w/w). The results suggested that all
and crude fiber. samples of gedi had the potential in steroid, flavonoid
These results recommended high rank for the and saponin, and free of anti nutritional tannin.
leaves of Abelmoschus manihot as the best in terms of Flavonoids had been reported in rat brain, and might
essential nutrients composition if compared with those of represent the potential bioactive component of
other edible leaves in the literature. A. manihot and contributed to its anticonsulvant and anti
The results of phytochemical screening of five depressant-like activity in vivo (Guo et al., 2011). Jain
types of gedi leaf were summarized in Table 3. Result et al., (2011) reported that the phytochemical analysis

Mandey et al., 2014
who rely upon them as poultry feed or supplements to

poultry diet. The next step is to assess the bioavailability
of the essential nutrients and phytochemicals in these
plants. Further study have to focus on the digestibility of
protein, fibre, and lipid, and phytochemicals.
REFERENCES
Association of Official of Analytical Chemist
(AOAC). 1980. Official methods of analysis of the
Association of Official Analytical Chemists. 13th Ed.
Washington DC., USA.
Al-Sultan SI and Gameel AA. 2004. Histopathological

changes in the livers of broiler chicken supplemented
with Turmeric (Curcuma longa).Intern. J. of Poult. Sci.,
3(5):333-336.
Ashayerizadeh O, Dastar B, Shams Shargh M,

Rahmatnejad E and Ashayerizadeh A. 2009. Influence
of prebiotic and two herbal additives on interior organs
and hematological indices of broilers. J. of Animal and
Veterinary Advances. 8(9):1851-1855.
Breen P. 2012. Plant Identification: Examining Leaves.

Orego n Sta te Un iver sit y Dep art men t o f
Figure 5: The phylogenetic tree of gedi leaves based
on ndhF-gen with Kimura-2 model parameter. Data Horticulture.http://oregonstate.edu/dept/Idplants/PlantID
on the branch are bootstrap maximum likelihood -leaves.htm.
values
Cross DE, McDevitt RM, Hillman K and Acamovic T.
2007. The effect of herbs and their associated essential
showed the presence of steroids, triterpenoids and
oils on performance, dietary digestibility and gut
flavonoids in petroleum ether and methanol extract, microflora in chickens from 7 to 28 days of age. British
respectively which possesses analgesic, antioxidant and Poult. Sci., 48(4):496-506.URL:http://
anti-inflammatory activity. Saponins that were steroid or mc.manuscriptcentral.co./cbps.
triterpenoid glycosides are important in animal nutrition. Francis G, Kerem Z, Makkar HPS, Becker K. 2002.
Some saponins increase the permeability of intestinal The biological action of saponins in animal systems: a
mucosal cells in vitro, inhibit active mucosal transport review. British J. of Nutrition. 88(6):587-605. DOI:
10.1079/BJN2002725.
and facilitate uptake of substances that are normally not
absorbed (Francis et al., 2002). Guo J, Xue C, Duan Jin-ao, Qian D, Tang Y and
You Y. 2011. Anticonvulsant, antidepressant-like
activity of Abelmoschus manihot ethanol extract and its
CONCLUSION
potential active components in vivo. Phytomedicine:
The characterization, nutritional analysis and Intern. J. of Phytotherapy & Phytopharmacology.
phytochemical analysis of Abelmoschus manihot leaf by 18(14):1250-1254.DOI: 10.1016/ j. phymed.
genetical and chemical analysis recommended the 2011.06.012.
potential value of these feedstuff to those populations

Mandey et al., 2014
Harborne JB. 1987. Metode Fitokimia, Penuntun Cara Wang XR, Wang ZQ, Li Y. 1981. Studies on the
Modern Menganalisis Tumbuhan.Translater: chemical constituents of Abelmoschus manihot L. Medic.
Padmawinata K dan I. Sudiro I. Institut Teknologi Acta Bot. Sin., 23(3):222-227.
Bandung, Bandung.
Wang XR, Zhou ZH, Du AQ, Huang ZM. 2004.
Jain PS, Bari SB and Surana SJ. 2009. Isolation of Studies on the flavonol constituents of
stigmasterol and -sitosterol from petroleum ether Abelmoschusmanihot L. Medic. Chin. J. Nat. Med.,
extract of woody stem of Abelmoschus manihot.Asian J. 2(2):91-93.
of Biological Sci. 2(4):112-117, from http://
Windisch W, Schedle K, Plitzner C, Kroismayr A.
www.scialert.net/qdirect.php?/
2008. Use of phytogenic products as feed additives for
doi=ajbs.2009.112.117&linkid=pdf.
swine and poultry. J. of Animal Sci.86(14Suppl.):E140-
Jain PS and Bari SB. 2010. Anti-inflammatory activity E 1 4 8 . h t t p : / / w w w. j o u r n a l o f a n i m a l s c i e n c e . o r g /
of Abelmoschus manihot extracts. Intern. J. content/86/14Suppl/E140.
ofPharmacology. 6 (4):505-509. http://www.scialert.net/
Yang CJ, Yang IY, Oh DH, Bae IH, Cho SG, Kong
qdirect.php?.doi=ijp. 2010.505.509&linkid=pdf.
IG, Uuganbayar D , Nou IS, Choi KS. 2003. Effect of
Jain PS, Todarwal AA.Bari SB, Sanjay JS. 2011.. green tea by-product on performance and body
Analgesic activity of Abelmoschus manihot extracts. composition in broiler chicks. Asian-Australian J. of
Intern. J. of Pharmacology. 7(6):716-720.http:// Anim. Sci., 16(6):867-872. From http://www.ajas.info/
w w w . s c i a l e r t . n e t / f u l l t e x t / ? Editor/manuscript/upload/16_128.pdf.
doi=ijp.2011.716.720&org=11.
Khatun MH, Rahman MA, Biswas M, Ul Islam MA.

2010. In vitro study of the effects of viscous soluble
dietary fibers of Abelmoschus esculentus L in lowering
intestinal glucose absorption. Bangladesh Pharmaceutical
J., 13(2):35-40.
Prasad K, Janve B, Sharma RK, Prasad KK. 2010.

Compositional characterization of traditional medicinal
plants: Chemo-metric approach. Archives of Applied
Sci. Research. 2(5):1-10.
Preston SR. 1998. Aibika/Bele. Abelmoschus manihot

(L.) Medik. International Plant Genetic Resources
Institute. Rome, Italy.97 pages.
Puel C, Mathey J, Kati-Coulibaly S, Davicco MJ,

Lebecque P, Chanteranne B, Horcajada MN,
Coxam V. 2005. Preventive effect of Abelmoschus Advantages
manihot (L.) Medik. on bone loss in the ovariectomised
rats. J. Ethnobotanical. 99(1):55-60. Affordable Charges
Quick processing
Sarwar M, Attitallia IH, Abdollahi M. 2011. A review
Extensive indexing
on the recent advances in pharmacological studies on You retain your copyright
medicinal plants; animal studies are done but clinical
studies needs completing. Asian J. of Animal and
Veterinary Advances. 6(8):867-883.

Journal of Research in Biology ISSN No: Print: 2231 6280; Online: 2231 - 6299
Original Research
The growth performance of Clarias gariepinus fries raised in varying

coloured receptacles.
Authors: ABSTRACT:
Ekokotu Paterson1 This study was conducted to access the effect of various background colors of
Adogbaji and Nwachi cultured vessel on growth performance and response in the production of Clarias
Oster Francis2. gariepinus fry. A total of two female (800 g) and one male (1 kg) of test fish was used.
During the eight weeks of the experimental period, the C. gariepinus fry were reared
in three tanks in duplicates with different background colors (green, blue and white).
Body weight and total length of C. gariepinus were recorded for the eight weeks and
mean variance of the collected data were analyzed for significant difference. Mean
weight and Mean length values were separated using Duncan multiple range test
(DMRTS). Background color did not significantly affect the growth performance of
Institution: C. gariepinus fry. The length and weight of the sample were measured weekly. Data
Department of Fisheries, collected were used to determine the specific growth rate. at week one green tank
Delta State University, was 0.19 g with a length of 1.02 cm with a survival rate, mean weight and length of
Asaba Campus, Nigeria. 86%, 0.56 g and 4.26 cm, blue tank was 0.14 g with a length of 1.02 cm with a survival
rate, mean weight and length of 84%, 0.64 g and 4.38 cm and white tank 0.16 g with a
length of 1.02 with a survival rate, mean weight and length of 82%, 0.53 g and 3.38 cm
and general hatchability rate 82% respectively. At the final week (8) of the experiment
blue tank had the highest weight and length 0.78 g and 5.9 cm respectively while
green tank has 0.74 g and 5.2 cm, white tank has the least 0.69 g and 4.4 cm at a
significant difference of 0.05.

Nwachi Oster Francis. Receptacle, growth coloured, cultured, vessel and Clarias gariepinus.

fish2rod@yahoo.com Ekokotu Paterson Adogbaji and Nwachi Oster Francis.
The growth performance of Clarias gariepinus fries raised in varying coloured
receptacles.
Web Address:
http://jresearchbiology.com/ Dates:
documents/RA0392.pdf. Received: 29 Nov 2013 Accepted: 17 Dec 2013 Published: 20 May 2014

1287-1292 | JRB | 2014 | Vol 4 | No 2

An International
Ekokotu and Nwachi, 2014
INTRODUCTION vegetation which again diminishes light intensity.

Fresh water fishes have the ability to vary their Lam and Soh (1995) carried out experiment on
growth rate in the present of changing environmental the effect of photoperiod on gonadal maturation in the
conditions (Dahle et al., 2000). This suggests that rabbit fish Siganus canaliculates and discovered that a
characteristics pattern of growth exist whose analysis long photoperiod of 18 hours light alternation with
may provide a better understanding of their adaptation to 6 hours darkness (18L, 6D), retarded gonadal
the environment. An analysis of this kind must be development in contrast with the normal photoperiod of
accompanied by an appreciation of the fact that growth 12 hours light and 12 hours darkness (12L, 12D). Thus a
pattern may change throughout the life history of the fish long photoperiod may be used to delay the breeding
Light acting through photoperiodicity is becoming season of this fish. Histophysiological studies linking
accepted as playing a major role in influencing the external factor with gonadal development have been
timing of seasonal reproductive activating, feeding body reported by Hyder (1990) that light intensity are
coloration, survival and specific growth rate rather than probably the primary cause of the great intensity of
other factors such as temperature, pH etc. The African reproductive activity. According to Lofts (1970) light
catfish, Clarias gariepinus is one of the most important can affect the reproductive organs of fishes in terms of
species of the family Clariidae which is commonly ability to reproduce and the size of the organ it can
farmed in Nigeria. Clarias gariepinus is a native of course degeneration of the organ on continuous exposure
tropical and sub-tropical waters outside its natural range of gonads. The main purpose of every culturist is to
(Hecht and Appelbaum, 1988). Clarias gariepinus is a produce fingerlings that would attract farmers;
well sort fish for the people of tropical and subtropical experience has shown that farmers sometimes based the
region it has the ability to live and thrive in fresh water choice of fish seed to be purchased on the colour of the
lakes and tropical swamp, it has the ability to take in air seed which is mainly influenced by the colour of the
from the atmosphere with a remarkable ability to resist receptacle used in raising the fish. This work is aimed at
endemic disease prevailing in the region, its ability to examining the effect of different type of colour on the
reproduce in confine water with the aid of insemination fries cum fingerlings of Clarias gariepinus.
increases the ease in which the fingerlings can be made
available (Van de Nieuwegiessen et al., 2009). Catfishes MATERIAL AND METHODS
also have the unique characteristics of consuming both This research work was conducted at the wet
plant and animal matter. They can feed on insects laboratory of the Teaching and Research farm of Delta
plankton and even snail found in the water, they can also State University Abraka Asaba campus, between the
cannibalize on smaller fishes depending on its ability months of October and January, 2013. Data was
hence is known to feed on any available palatable feed. collected for a period of eight weeks.
The reproductive activity of Clarias gariepinus Spawning of fish
in its natural environment increases during the period of Spawning refers to the natural procedure the
heavy rains in West Africa (June and July) again in fishes go through in order to give birth to their fry. The
October and November produces deeper and more turbid broodstock used for the spawning was procured from a
water which has the effect of reducing illumination well-established farm. After the procurement, the
breeding activity. Also due to flooding of the lowland broodstock was disinfected using saline solution (30 g of
coastal areas, the fish spread into waters with dense Nacl per 10 liters of water). The sexes were kept
separately to avoid indiscriminate spawning, and were taken while stripping to guard the egg and the milt that
allowed to acclimatize for 24 hours not to get contact with water.
Broodstock Selection Fertilization
The male broodstock selected weigh 1.5-2 kg at Milt solution was prepared by macerating milt
the age of 13-15 months, the reproductive organ of the with mortar and pestle, and mixing the extract with
male extend to the anterior papilla and the fish shows saline solution (0.09% salt). The milt solution was mixed
element of aggressiveness. The female fish selected with the eggs and mechanically shaken for a minute. The
weigh 2-2.5 kg at the age of 13-15 months of age, the eggs were then spread on the hatching mat
female fish has swollen soft stomach, reddish to pinkish Hatching
reproductive organ with the ability to release egg on Hatching involve breaking the eggs shell and the
slight touch. releasing of the larvae. Hatchings of the eggs occurred
Administration of Hormone after a fertilization process of about 26 hours after
Reproductive hormone (ovaprim) was injected incubation. The hatchling has the yolk sac attached to it
intramuscularly above the lateral line just below the for a period of 4 days when they became swim up fry.
dorsal fin at the rate of 0.5 ml to 1 kg of body weight of They were kept for 10 days in the nursery and fed with
test fish. All the broodstock were returned to solitary artemia
confinement for a latency period of 9 hrs at a room Experimental design
temperature (25) The already acclimatized fish were counted (200) and
Stripping stocked in duplicates in colored receptacles of 100 litres
The male fish was sacrificed and dissected to get capacity of color blue, white and green (B1, B2, W1,
the milt. After a latency period of nine hours and at a W2, G1 and G2). The fishes were fed with artemia for
time egg were freely oozing out on slight touch. The 7 days.
eggs were stripped into a clean receptacle and care was
Table 1: Mean variation of weekly Body Weight of Table 2: Mean variation of weekly Total Length of
(twenty) Clarias gariepinus species per tank twenty Clarias gariepinus species per tank under
reared under different colour. different tank colour
Week Green Blue White Week Green Tank Blue Tank White Tank
a a a a a
Week 1 0.190.00 0.140.00 0.160.00 Week 1 1.020.00 1.020.00 1.020.01a
Week 2 0.050.01a 0.070.01a 0.060.01a Week 2 2.000.00a 1.820.00a 2.440.00b
Week 3 0.060.01a 0.070.01a 0.110.00a Week 3 1.960.00a 1.990.01a 1.910.01a
Week 4 1.900.00a 1.980.00a 2.010.01a Week 4 1.910.00a 1.980.00a 2.010.01a
Week 5 0.680.01b 0.120.01a 0.720.00a Week 5 4.500.01b 2.400.00a 2.570.00a
Week 6 0.680.00a 0.670.00a 0.500.00a Week 6 5.120.00b 4.660.00ab 4.300.00a
Week 7 0.650.00a 0.890.01a 0.660.00a Week 7 5.010.00ab 5.140.00b 4.550.01ab
Week 8 0.740.00a 0.780.01a 0.690.01a Week 8 5.280.00b 5.900.01b 4.400.01a
Mean: Mean SE (standard Error of mean) Mean: Mean SE (standard Error of mean)
X = 0.05 (95% level of significant) X = 0.05 (95% level of significant)

Fish sampling T1 = Initial time

The initial mean weight and total length of the Survival rate
fry were taken using a sensitive analytical balance and At the end of each trial (14 days), all the survived
meter rule before commencement of feeding. fish were harvested totally, counted and divided by the
Subsequently, weight and total length of experimental total number stocked.
fishes were observed at weekly basis throughout the No of fish harvested
culture period of two weeks. Percentage survival =
No of fish stocked. 100
Weight determination
Samples to be weighed were randomly removed Determination of water quality parameters.
from each experimental bowls and kept alive in a small Water quality data collected during the study
plastic bowl and weighed collectively on weighing days, include temperature, dissolved oxygen (DO) hydrogen
fish were not fed until the whole exercise was completed. concentration (pH) and other physiochemical
After measurements, the fish were put in fresh water and requirement were monitored and stabilized. These were
then returned to the rearing bowls while subsequent observed routinely, Water temperature was maintained at
weighing were done individually and mean weight gain 28 30C, pH at 7.5 7.8 and dissolved oxygen (DO) at
were determined. 7.5 8.8 mg\l.
W1Wf Statistical Analysis
Weight gain (WG) =
One-way ANOVA was used to compute
d
collected data while Duncan Multiple Range Test
Where: (DMRT) was used to separate the mean the at 5% level
Wf = final mean weight gain (mg) of significance.
W1 = initial mean weight gain (mg) A total of twenty fish was sample from the
d = nursing period in days. culture tank on a weekly basis.
Specific Growth Rate. The effect of fish environment is important in
The logarithm of difference in final and initial fish culture fish react positively or negatively to its the
mean weights test fish was determined by: natural habitats of fish may negatively affect fish also on
LogW2/T2 - Log W1 fish response under the effect of acute or feeding
SGR =
activity, health, welfare and growth. (Papoutsoglou et al.,
T1.100
2000, and Green and Baker et al., 1991) The effect of
Where; this stressors may affect the performance of the fish.
W2 = Final weight of fry According Strand et al., (2007). Fishes maintained in the
W1 = Initial weight of fry blue tanks shows a positive increase in both size and
T2 = Final time weight this opinion was expressed by Sumner and
Table 3: Mean Weight
Treatment Initial weight (g) Final weight (g) Survival rate (%) Mean weight (g)
Green (T1) 0.19 0.74 86 0.56
Blue (T2) 0.14 0.78 84 0.64
White (T3) 0.16 0.69 82 0.53

Table 4: Mean Length
Treatment Initial length (g) Final length (g) Hatchability (%) Mean lenght (g)
Green (T1) 1.02 5.3 82 4.26
Blue (T2) 1.02 5.4 82 4.38
White (T3) 1.02 4.4 82 3.38
Doudoroff (1938). In the present study, no contrast was Institute of Marine Research and University of Bergen.
observed as there was no specific significant disparities Norway, July 4-9 1999. P 336.
in the growth reaction to background colour.
Green JA and Baker BI. 1991. The influence of
Performance was observed for three colors and the
repeated stress on the release of melanin-concentrating
mean growth rate of fish in the three treatment was
hormone in the rainbow trout. J Endocrinol., 128(2):
obtained as 0.78 0.01 (g) for blue tank, 0.74 (g) 0.0
261-266.
for Green tank and 0.69 0.01 for white tank. (Table-1).
This finding was similar to the study of Martinez Hecht T and Appelbaum S. 1988. Observations on
and Purser, (2007). In clear, white, green tanks expressed intra-specific aggression and coeval sibling cannibalism
no Support for the latter metabolic effect of background by larval and juvenile Clarias gariepinus (Clariidae
color differences in growth performance of fry Clarias pisces) under controlled conditions. Journal of zoology.
gariepinus, as the length of fish ranges from 4.00 to 214(1): 21-44.
7.50 cm for blue tank, 4.00 to 6.50 cm for Green tank
Hyder M. 1990. Endocrine regulation of reproduction
and 2.80 to 6.50 cm for White tank. (Table-2).
in Tilapia. Gen comp: Endocine 3(Supplement):729-740.
The hatchability rate was uniform for the three
colure tanks due to the fact that the incubator was in one Lam TJ and Soh CL. 1995. Effect of photoperiod on
receptacle the hatching rate of 82% (Table-4) was gonadal maturation in the rabbit fish. Signanus
observed for the three tanks but there was significance canaliculatus, park 1797. aquaculture. 5 (4): 407-4 10.
difference in the survival rate of fish across the three
Lofts B. 1970. Animal photoperiodism; Edward Arnold
tank as 86% was observed in green tank and 84% rate
publishers limited p. 62
was observed in Blue tank and 82% rate in white Tank.
(Table-3). The high survival rate of Clarias gariepinus Martinez-Cardenas L and Purser GJ. 2007. Effect of
fry could be due to proper water management during the tank colour on Artemia ingestion, growth and survival in
period of study. cultured early juvenile pot-bellied seahorses
(Hippocampus abdominalis). Aquaculture. 264(1-4):
REFERENCES 92-100.
Dahle R, Taranger GL and Norberg B. 2000. Sexual
Papoutsoglou SE, Mylonakis G, Miliou H,
maturation and Growth of Atlantic cod (Gadus morhua
KaraKatsouli NP and Chadio S. 2000. Effects of
L) reared at different light intensities. In Norberg B;
background color on growth performances and
Kjesbu OS; Taranger GL; Anderson E; Stefansson SO.
physiological responses of scaled carp (Cyprinus carpio
(Eds)(2000) proceeding of the sixth International
L.) reared in a closed circulated system. Aquacult. Eng.
Symposium on the Reproductive Physiology of Fish.

22(4): 309-318.
Strand A, Alanara A, Staffan F and Magnhagen C.

2007. Effects of tank colour and light intensity on feed
intake, growth rate and energy expenditure of juvenile
Eurasian perch, Perca fluviatilis L. Aquaculture.
272(1-4): 312-318.
Sumner FB and Doudoroff P. 1938. The effects of light

and dark backgrounds upon the incidence of a seemingly
infectious disease in fishes. Proceedings of National
Academy of Science of the United States of America. 24
(10): 463-466.
Van de Nieuwegiessen PG, Olwo J, Khong S, Verreth

JAJ and Schrama JW. 2009. Effects of age and
stocking density on the welfare of African catfish
Clarias gariepinus. Burchell aquaculture. 288(1-2):69-
75.
Advantages
Affordable Charges
Quick processing
Extensive indexing


Original Research
High adaptability of Blepharis sindica T. Anders seeds towards moisture scarcity: A

possible reason for the vulnerability of this medicinal plant from the
Indian Thar desert
Authors: ABSTRACT:
Purushottam Lal1,
Sher Mohammed2* and The seeds of Blepharis sindica T. Anders (Acanthaceae) are the official part of
Pawan K. Kasera3. the plant for its medicinal values and also as the promise of its future. Dunes of the
Thar desert with high percolation capabilities are the most preferred habitat of this
vulnerable medicinal plant. It produces 1337.26 seeds/plant as an average and shows
high viability and germination percentage under in-vitro conditions, but efficiency of
Institution: seedling establishment was observed poor at natural sites. Occurrence of seed coat
1,2. Department of Botany, layers as sheath of hygroscopic hairs is a sign of its extreme capabilities to initiate life
Government Lohia PG under lesser soil moisture availabilities in desert. Seeds with 0.5 to 1.0 ml distilled
College, Churu-331001, water were observed most suitable for the production of maximum shoot and root
Rajasthan, India. lengths under controlled conditions. Maximum biomass of shoot and root modules
were observed in 0.5 ml distilled water. Maximum amount of non-soluble sugar was
3. Department of Botany, found in intact seeds devoid of any imbibition. Seeds with 0.5 ml distilled water
J.N.V. University, Jodhpur-
produced maximum amount of shoot biomass and soluble sugar, while seedlings with
342 033, Rajasthan, India.
1.0 ml had maximum root biomass. Seedlings treated with >1.5 ml of distilled water
showed a decreasing trend in all parameters. Excessive water always found to cause
seedling collapse and failure of its establishment.

Sher Mohammed. Thar desert, medicinal plant, vulnerable, hygroscopic hairs, moisture, seedling
collapse.

Purushottam Lal, Sher Mohammed and Pawan K. Kasera.
High adaptability of Blepharis sindica T. Anders seeds towards moisture scarcity: A
possible reason for the vulnerability of this medicinal plant from the Indian Thar desert
Web Address: Dates:
http://jresearchbiology.com/
Received: 02 Jan 2014 Accepted: 04 Feb 2014 Published: 22 May 2014

1293-1300 | JRB | 2014 | Vol 4 | No 2

An International
Lal et al., 2014
INTRODUCTION: B. sindica is a lignified annual plant with

Indian Thar desert is characterised by scanty characteristically dichotomously branching habit. It is
rainfall and long dry periods throughout the year, which locally known as Billi khojio, Bhangara and Unt-katalo
pushes the typical scrub vegetation to firm adopt specific (Bhandari, 1990). It grows on loose soils, along the crop
life sustaining adaptabilities (Sen, 1982). In desert fencings and much especially on dune slopes. Sandy soil
ecosystems, long dry periods and scanty rainfall impose with heavy percolation is much preferred by this plant.
severe water deficit in natural vegetation (Sen, 1982; After a successful completion of life cycle (July to
Raghav and Kasera, 2012). Biodiversity of desert areas is December), capsules loaded spikes remain attached to
a better reflection of highly synchronised life patterns of the dried plant and provide a special distinguishable
living beings against the environmental entities which appearance to the species. Seeds within capsules remain
always restrict the life to express beyond their biotic open to face the extreme of winter and summer
potentials. The Indian Thar desert has a unique temperatures till their first imbibition. Habitat limitation
vegetation cover as compared to other deserts around the plays an excellent role for this species as sand shifting
world. Besides harsh climatic conditions and much and eolian deposition cause to bury the spikes which
constrains on growth potentials, the plant species of arid trigger microbial decomposition of lignified bracts. The
zone synthesise and accumulate a variety of bioactive plant emerge through seeds after first rain as soon as fruit
compounds which have different values to serve wall split explosively from distal tapered end and release
mankind. Due to their medicinal as well as economic seeds to imbibe (Fig. 1).
importance, the medicinal plants and their different parts Compressed seeds with densely clothed
are being exploited largely from natural habitats. Habitat hygroscopic hairs are used in the preparation of herbal
destruction, unscientific collection, ecological medicines and it is used as aphrodisiac (Shekhawat,
limitations, etc. are crucial factors to push valuable 1986; Singh et al., 1996; Mathur, 2012). Its roots are
medicinal plants under verge of extinction. UNDP used for urinary discharge and dysmenorrhoea.
(2010) have published Red List Categories for 39 Powdered plant is applied locally on the infections of
medicinal plants of Rajasthan State, of which Blepharis genitals and on the burns (Khare, 2007). Seeds contain
sindica is considered as Vulnerable. Thus, it is quite flavonoides (apigenin, blepharin, prunine-6-O-
important to know its adaptability to conserve in natural coumarate, and terniflorin), steroid (-sitosterol) and
habitat. triterpinoide-oleanolic acid (Ahmad et al., 1984).
a b c d
Fig. 1: Blepharis sindica: One-year-old plant after first rains, showing spreading of seeds to initiate
germination (a), freshly fallen seed after moisture uptake by hygroscopic hairs at sandy surface of
dune (b), single young seedling (c), and seedlings in association (d).

Lal et al., 2014
Hence in the present study, an attempt has been of a graph paper. Shoot and root biomass values of
made to identify a correlation between availed moisture seedlings against different moisture regimes were
and seedling establishment in B. sindica germplasm estimated by oven-dried weight basis. Amount of sugars
collected from different localities of the Churu district, a in seedlings after varied doses of distilled water was
part of Indian Thar desert. estimated by using anthrone reagent method (Plummer,
1971). Differences in biomass & sugar contents of
MATERIALS AND METHODS: seedlings from various moisture regimes were compared
The germplasm of this species was collected with the values for intact seeds and measured in
during 2011-2012 from two different sites, viz., percentage basis. The relation between total biomass %
Shyampura village (Site-I; 12 km away towards west- and total sugars % in comparison to intact seeds were
south direction from the College Campus) and Buntia expressed as metabolic efficiencies of seedlings at
village (Site-II; 10 km towards north-east), a part of the particular moisture regime. The pooled data of entire
Indian Thar desert. The seed size was measured with the season were analyzed statistically as per the methods of
help of vernier caliper and graph paper. Seed volume and Gomez and Gomez (1984), presented in tabular and
density estimations were based on water displacement figure forms.
method (Misra, 1968). Values were calculated for 100
seeds in triplicate and confirmed twice. Arithmetic mean RESULTS:
and standard deviation were computed for each The data on various morphological parameters,
parameter. Seed viability was tested by T.T.C. method viz. weight, size, volume, density and viability of seeds
(Porter et al., 1947). The seed germination experiments collected from different sites are given in Table 1.
were performed in seed germinator at 28C. Seeds were Morphological variations provide understanding about
placed in the sterilized petri dishes lined with single layer germplasm variability, which is an important adaptation
of filter paper to evaluate germination behaviour. To skill of desert plants. Seed length and density values
evaluate moisture response, the filter paper in each were observed higher at site-I, whereas other parameters
experiment was moistened with 0.5, 1.0, 1.5, 2.0, 5.0 and at site-II.
10.0 ml volume of distilled water separately. Each petri Morphological parameters revealed that higher
dish containing 10 seeds in triplicate was used and (5.73 x 4.13 x 0.10 mm) values of seed size were
experiment was repeated for two times for the observed at site-II, while lower (5.75 x 4.11 x 0.07 mm)
confirmation of results. After one week of setting the at site-I. Weight of 100 seeds was greater (1.33 g) at site-
experiments, germination percentage (%) and root & II than site-I (1.16 g). Volume of 100 seeds was more
shoot lengths of seedlings were measured with the help (1.57 ml) at site-II, whereas less (1.13 ml) at site-I.
Table 1. Variation in morphological parameters of B. sindica seeds collected from sites- I & II.
Parameters
Seed size (mm) Volume of
Sites Weight of 100 seeds Density
100 seeds (g) Length Breadth Thickness (g ml-1) Viability (%)
(ml)
I 1.160.015 5.750.010 4.110.006 0.070.0004 1.130.028 1.020.057 100.000.00
II 1.330.022 5.730.010 4.130.006 0.100.0004 1.570.028 0.850.021 100.000.00
= Standard deviation

Lal et al., 2014
Freshly collected seeds from both sites exhibited cent (Fig. 2). The expression of comparative relation between
percent viability. shoot and root lengths as R/S ratio was found significant
To evaluate the significance of moisture regimes at 1.0, 1.5 & 2.0 ml regimes. It was observed maximum
on germination process, 0.5 ml to 10.0 ml range of (45.23) at 1.0 ml moisture for both sites, while minimum
distilled water was provided to seeds. Under controlled (0.82) at 10.0 ml for site-I. Seedlings from site-I showed
laboratory conditions, cent percent germination was a rapid decline in R/S ratio along with increasing
observed in 0.5, 1.0, 1.5 and 2.0 ml moisture regimes for moisture levels as compared to site-II.
both sites. 5.0 and 10.0 ml moisture regimes caused Anabolic efficacy of germinating seeds was
deterioration for seed germination. measured in the form of over-dried biomass of seedlings.
Shoot length parameter was found to have Shoot biomass was found more as compared to root
increasing trend from 0.5 ml to 2.0 ml range, afterwards ones. Maximum (0.28 g d. wt.) shoot biomass was
it gets decreased (Table 2). Maximum shoot length estimated at 0.5 ml moisture for site-II, while minimum
(10.47 mm) was observed at 2.0 ml moisture for site-II, (0.09 g d. wt.) at 10.0 ml for site-II. Maximum extension
while at 0.5 ml moisture slight expansion in cotyledons of root axis was observed at 1.0 ml levels, while
was occured without shoot development for both sites. maximum (0.05 g d. wt.) root biomass were found at 1.0,
Higher values of root length were observed at 1.0 ml 1.5 & 2.0 ml levels for site-II. Total biomass was
moisture for both sites, being maximum (61.97 mm) for increased after seeds were permitted to imbibing and
site-I. found maximum (0.31 g d. wt.) with 0.5 ml and 1.0 ml
At 0.5 ml level, only radicle emerged out moisture for site-II. Total biomass values exhibited
without any shoot elongation; whereas at 5.0 & 10.0 ml declining trend along with increasing moisture regimes
levels shoot and root axies collapsed after a short growth (Fig. 3).
Table 2. Effect of different amount of distilled water on seed germination (%), seedling growth (mm), seedling biomass
(g) and sugar contents (mg g-1 d. wt.) during seedling establishment in B. sindica seeds under laboratory conditions at
sites- I & II (Observations taken after 7 days).
Amount of distilled water provided (moisture regime)
Site-I Seed 0.5 ml 1.0 ml 1.5 ml 2.0 ml 5.0 ml 10.0 ml CD
Germination - 100.00 100.00 100.00 100.00 36.67 6.67 1.4684 ns
Shoot length - 0.00 1.37 4.60 8.20 2.53 1.67 0.1457ns
Root length - 8.73 61.97 44.53 50.73 5.90 1.37 0.7204*
R/S ratio - # 45.23 9.68 6.19 2.33 0.82 1.3604ns
Shoot biomass - 0.26 0.23 0.23 0.22 0.13 0.11 0.0071ns
Root biomass - 0.02 0.04 0.04 0.04 0.01 0.01 0.0021ns
Total biomass 0.12 0.28 0.27 0.27 0.26 0.14 0.12 0.0047ns
Soluble sugar 28.87 29.12 28.87 28.25 27.08 18.61 5.62 0.6669*
Non-soluble sugar 2.34 1.91 1.92 1.78 1.91 1.59 1.21 0.1132*
Site-II
Germination - 100.00 100.00 100.00 100.00 50.00 50.00 1.5604ns
Shoot length - 0.00 1.50 8.77 10.47 7.53 6.27 0.0092ns
Root length - 13.77 51.03 50.93 46.60 11.63 8.60 0.4439 ns
R/S ratio - # 34.02 5.81 4.45 1.54 1.37 1.2667ns
Shoot biomass - 0.28 0.26 0.25 0.25 0.17 0.09 0.0054ns
Root biomass - 0.03 0.05 0.05 0.05 0.02 0.01 0.0026ns
Total biomass 0.13 0.31 0.31 0.30 0.30 0.19 0.10 0.0065ns
Soluble sugar 29.12 29.75 29.27 28.42 26.42 17.87 7.87 0.1553ns
Non-soluble sugar 2.41 2.03 2.02 1.81 2.06 1.81 1.38 0.1307ns
- = Values are not applicable, # = Values are infinitive, *= Significant at (P < 0.05) level, and ns = non-significant

Lal et al., 2014
Fig.2: In-vitro seedlings of B. sindica after 07 days response against varied amount of moisture
regimes (0.5 to 10.0 ml distilled water per petridish) from site-I (a) and site-II (b). Fully expand
hygroscopic hairs at 0.5 & 1.0 ml and collapsed seedlings at 5.0 & 10.0 ml.
Amounts of soluble and non-soluble sugars were moisture regimes during seed germination. Metabolic
estimated in oven-dried seedlings obtained after response fluctuations (percentage sugar loss & percentage biomass
of varied moisture regimes. Soluble sugar was maximum growth in comparison to intact seeds) and metabolic
-1
(29.75 mg g d. wt.) at 0.5 ml moisture level for site-II, efficiency values against various moisture regimes were
-1
while minimum (5.62 mg g d. wt.) at 10.0 ml for site-I. found non-significant (P > 0.05) for both sites.
Amount of non-soluble sugar was more in intact seeds as
compared to seedlings. Its maximum (2.41 mg g-1 d. wt.) DISCUSSION:
value was estimated in seeds from site-II. Seedlings with Seed germination is a crucial step of life cycle in
10.0 ml moisture exhibited minimum values for site-I. In higher plants as it determines the future of the species as
this species, intact seeds were found to have maximum well as it offers the availability of plant resources for all
amount of total sugars (soluble & non-soluble) and living beings. Most of arid plants produce seeds with
showed a decreasing trend with increasing moisture hard seed coats that enable the species to cope drought
regime. On using intact seeds as reference, the total constrains (Sen et al., 1988). In this species, seeds
sugars loss occurred on different moisture regimes are completely lacking of hard coverings and embryos found
expressed on percentage basis (Fig. 3). As compared to directly encapsulated within hygroscopic membrane
site-I, seedlings from site-II exhibited more sugar loss which further extends in hygroscopic hairs. The seeds
percentage at all moisture regimes, except in 10.0 ml. collected from both sites showed morphological
Maximum (78.12 %) sugar loss was occurred at 0.5 ml variability, which influenced the response of seeds
moisture for site-II, whereas minimum (0.58 %) at 10.0 against different moisture regimes during in-vitro
ml for site-I. Production of total biomass (g d. wt.) in germination. Freshly collected seeds exhibited cent
-1
relation to total sugars loss (% mg g d. wt.) can be used percent viability without any dormancy barrier.
-1
to express the metabolic efficiency (% d. wt. / % mg g Germplasm tolerance against extreme aridity of
d. wt.) of seedling establishment (Fig. 4). Highest (229) the area is solely paid by its hard capsule (fruit)
value for metabolic efficiency of germinating seeds were coverings whereas the hygroscopic sheath (seed coat
observed at 0.5 ml moisture level for site-I, whereas layer) has the most prominent contribution for rapid
minimum (-0.32) at 10.0 ml for site-II. A decline in uptake of soil moisture and subsequent imbibitions. The
metabolic efficiency was observed on increasing present investigation reveals that this part,

Lal et al., 2014
a
Fig. 4: Metabolic efficiency of germinating seeds under
varied amount of availed moisture levels (% d. wt.
total biomass / % total sugar loss) from sites- I & II
(Data are average of three replicates).
moisture amount in seed germination process; this

unique experiment was designed and the results illustrate
the comparative effect of different levels of moisture in
b sense of seedling growth, biomass production,
Fig. 3: Total sugar loss (a) and total biomass growth consumption rate of reserve food contents and
(b) in seedlings against varied amount of moisture comparative efficiency of seedling establishment.
regimes as compared to intact seeds for sites- I & II.
Higher values of seedling length and biomass
i.e. hygroscopic sheath has some short of limitations in production (shoot & root modules) were observed in 0.5
sense of its carrying capacity of soil moisture contents. to 2.0 ml moisture regimes. Seed germination percentage
Field study of the area revealed that in spite of as well as seedling vigour (length & biomass) values
having cent percent viability and germination percentage, showed a clear decline on excessive moisture contents
a limited number of seedlings develop in-vivo at its (5.0 & 10.0 ml). The values for biomass growth (%) in
preferred sand dune surfaces during early monsoon comparison to dry weight of intact seeds were found
period. Observations are in the record that mucilaginous highest at minimum moisture level, i.e. 0.5 ml. Amount
sheathing on seeds and its other parts which provide of soluble sugars, a part of nourishment ready to
adequate water, leds to improved germination in Cactus consume during germinating seedlings; also estimated
(Bregman and Graven, 1997; Gorai et al., 2014). maximum at 0.5 ml moisture level. Metabolic efficiency
Excessive moisture was found to inhibit seed of germinating seeds (dry weight increase per unit
germination in B. sindica, as observed by Mathur (2012) reserve food loss) was also estimated highest at
but the present investigations point out that at particular minimum moisture regimes, while its negative value was
stage of early seed germination physiology, water estimated at highest regimes of the performed
amount works as a master factor but interestingly it is experiment.
positive for a very short range, i.e. 0.5 to 1.0 ml. The
amount of first rain fall over detached seeds and the rate CONCLUSIONS:
by which rain water get percolated through inter-particle Seeds of B. sindica are highly adjusted structures
spaces, which determine the value of availed moisture toward moisture limitations in arid habitat. The seeds
for seeds to imbibe. For better understanding the role of exhibited absolute requirement of 0.5 ml moisture level
Lal et al., 2014
for the better establishment of in-vitro seedlings. Chem. Soc. Pak., 6(4): 217-223.
Primarily, the species has high biotic potential (1337.26
Bhandari MM. 1990. Flora of the Indian Desert. MPS
seeds / plant with 100 percent viability and germination
REPROS, Jodhpur, p. 435.
efficiencies) and secondly the species has absolutely free
from any type of grazing & fruit collection pressures. In Bregman R and Graven P. 1997. Subcuticular secretion
spite of this, the number of well established seedlings by cactus seeds improves germination by means of rapid
and consequent mature plants were found restricted at uptake and distribution of water. Annals of Botany. 80
both sites. This condition marks a clear threat at the point (4): 525-531.
when its life moulds from seed to seedling phase.
Gomez KA and Gomez AA. 1984. Statistical
Metabolic diagnosis of germinating seeds, i.e. total sugar
Procedures for Agricultural Research, 2 nd ed. John Wiley
loss (%), total biomass growth (%) and the rate of
& Sons, New York, p. 294.
metabolic efficiency (% d. wt. total biomass /% total
sugars loss) provides ample insight into compensation Gorai M, El Aloui W, Yang X and Neffati M. 2014.
efficacy of germinating seeds against a particular Toward understanding the ecological role of mucilage in
moisture level. Seedling collapsing at 5.0 & 10.0 ml seed germination of desert shrub Henophyton deserti:
regimes indicates the seed tissue incompatibility at interactive effects of temperature, salinity and osmotic
excessive moisture regimes. Our results could make an stress. Plant Soil 374 (1-2): 727-738.
excellent way to define this natural problem with this
Khare CP. 2007. Indian Medicinal Plants - An
species and assessment of threat in the arid habitats of
Illustrated Dictionary. Springer-Verlag, Berlin, New
Indian desert. The entire cascade of this pioneer work
York, USA, p. 812.
justifies the esteem love of B. sindica seeds with that of
Thar desert aridity. Such type of findings may also be Mathur M. 2012. Phytosterol composition in seeds of
helpful for conservation strategies related to different Blepharis sindica and its relation with bottom up, top
plant species of the area. down and plant metabolites factors. Medicinal plants -
International Journal of Phytomedicines and Related
ACKNOWLEDGEMENTS: Industries 4(3): 126-132.
Financial assistance received from CSIR, New
Mathur M and Sundaramoorthy S. 2012. Studies on
Delhi in the form of SRF-NET (File No.: 08/544
distribution patterns for an endangered semi-arid plant-
(0001)/2009-EMR-I, 27.06.2009) to first author is
Blepharis sindica. Vegetos 25(2): 66-75.
gratefully acknowledged. Thanks are due to the
Principal, Govt. Lohia PG College, Churu for providing Misra R. 1968. Ecology Work Book. IBH Publishing
necessary facilities. The authors are also thankful to Dr. Company, Oxford, New Delhi, p. 242.
David N. Sen (Retd. Professor & Head), Department of
Plummer DT. 1971. An Introduction to Practical
Botany, J.N.V. University, Jodhpur for valuable
Biochemistry. Tata McGraw Hill Publishing Co Ltd,
suggestions in improvement of this paper.
New Delhi, p. 369.
REFERENCES: Porter RH, Durrell M and Romm HJ. 1947. The use
Ahmad VU, Burki AM, Mahmood I and Smith DL. of 2, 3, 5-triphenyl tetrazolium chloride as a measure of
1984. Chemical constituents of Blepharis sindica seeds. seed germinability. Plant Physiol., 22(2): 149-159.

Lal et al., 2014
Raghav A and Kasera PK. 2012. Seed germination

behaviour of Asparagus racemosus (Shatavari) under in-
vivo and in-vitro conditions. Asian Journal of Plant
Science & Research. 2 (4): 409-413.
Sen DN. 1982. Environment and Plant Life in Indian

Desert. Geobios International, Jodhpur, p. 249.
Sen DN, Mohammed S and Kasera PK. 1988. Report

on weed seed longevity in arid zone-Test of seed bank.
Geobios new Reports. 7: 98-100.
Shekhawat GS. 1986. Ethnobotanical survey of desert

area of Rajasthan. Ph D Thesis, University of Jodhpur,
Jodhpur, India.
Singh U, Wadhwani AM and Johri BM. 1996.

Dictionary of Economic Plants in India. ICAR, New
Delhi, p. 288.
UNDP 2010. Rajasthan Red Listed Medicinal Plants,

http://envis.frlht.org/documents/rajasthan-medicinal-
plants-conservation.pdf
Advantages
Affordable Charges
Quick processing
Extensive indexing

Journal of Research in Biology - Volume 4 Issue 2

Hochgeladen von

Dokumentinformationen

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

Journal of Research in Biology - Volume 4 Issue 2

Hochgeladen von

Copyright:

Verfügbare Formate

Journal of Research in Biology ISSN No: Print: 2231 6280; Online: 2231- 6299.

An International Scientific Research Journal

Associations of Arbuscular Mycorrhizal (AM) fungi in the

Corresponding author: Keywords:

Email Id: Article Citation:

This article is governed by the Creative Commons Attribution License (http://creativecommons.org/

1247-1263 | JRB | 2014 | Vol 4 | No 2

INTRODUCTION: AM fungi could prove beneficial in

Fig 1: Monthly variation in Mycorrhizal spore population 50gm-1soil of different plant

Journal of Research in Biology (2014) 4(2): 1247-1263 1249

Fig 2: Monthly variation in mycorrhizal spore population 50gm-1soil of different plant

Fig 3: Monthly variation in mycorrhizal colonization (%) of different plant

Journal of Research in Biology (2014) 4(2): 1247-1263 1251

Fig 4: Monthly variation in mycorrhizal colonization (%) of different plant spe-

Sampling Period Physical parameters

Months Moisture Content (%) pH Soil Temperature (C0)

1252 Journal of Research in Biology (2014) 4(2): 1247-1263

N (mg/g) P (mg/g) K (mg/g) Organic C% Mg (mg/g) Ca (mg/g) Cu (ppm) Ni (ppm) Zn (ppm)

0.42700.060 0.00160.05 0.380.05 2.170.06 1.890.06 5.790.06 0.0750.05 0.0340.03 0.3580.06

0.41000.050 0.00350.07 0.260.05 1.860.07 2.240.07 5.310.02 0.0470.07 0.0220.06 0.2970.05

Journal of Research in Biology (2014) 4(2): 1247-1263

0.32900.070 0.00620.06 0.310.07 1.820.07 3.190.07 4.670.05 0.0410.06 0.0160.03 0.3240.04

0.45100.050 0.00210.03 0.460.05 2.340.07 1.750.57 5.630.05 0.0870.03 0.0410.05 0.3490.03

1254 Journal of Research in Biology (2014) 4(2): 1247-1263

Journal of Research in Biology (2014) 4(2): 1247-1263 1255

1256 Journal of Research in Biology (2014) 4(2): 1247-1263

Journal of Research in Biology (2014) 4(2): 1247-1263 1257

1258 Journal of Research in Biology (2014) 4(2): 1247-1263

Journal of Research in Biology (2014) 4(2): 1247-1263 1259

1260 Journal of Research in Biology (2014) 4(2): 1247-1263

Journal of Research in Biology (2014) 4(2): 1247-1263 1261

1262 Journal of Research in Biology (2014) 4(2): 1247-1263

In: Ashraf, M. Ozturk M. and S.A. Ahmad (eds) Plant

Schenck NC and Smith GS. 1982. Responses of six

Schenck, NC and Perez Y. 1990. Manual for the

Smith SE and Read DJ. 2008. Mycorrhizal Symbiosis

Val CD, Barea, JM and Azcon-Aguilar C. 1999.

Zaefarian F, Rezvani M, Rejali F, Ardakani MR and

Zarei M, Hempel S, Wubet T, Schfer SH,

Journal of Research in Biology (2014) 4(2): 1247-1263 1263

An International Scientific Research Journal

Corresponding author: Keywords:

Email Id: Article Citation:

Web Address: Dates:

1264-1275| JRB | 2014 | Vol 4 | No 2

INTRODUCTION the correlation of biometric parameter of all the oysters

collected and brought to the laboratory in a bucket filled Statistical Analysis

cleaning. biometric dimensions of all the size groups and their

Fig. 1 Average biometric dimensions (SE) of 5 size groups of

Journal of Research in Biology (2014) 4(2): 1264-1275 1266

Fig. 2 Average increment (SE) in the biometric dimensions of 5 size groups

1267 Journal of Research in Biology (2014) 4(2): 1264-1275

Fig. 3 Month-wise average fouling load (SE) on Pinctada margaritifera.

Journal of Research in Biology (2014) 4(2): 1264-1275 1268

Size Group (mm) N Variables a Value b value r2 value P value- S/NS

DVM- APM 0.848 0.878 0.876* 0.370 - NS

DVM-HL 1.547 0.793 0.550 0.180 - NS

DVM-TWT 0.275 1.218 0.218 < 0.001 - S

DVM-APM 1.113 0.955 0.802* 0.120 - NS

DVM-HL 3.006 0.926 0.808* 0.001 - S

DVM-TWT 0.304 2.236 0.304 0.110 - NS

DVM-APM 1.525 0.936 0.577* 0.002 - S

DVM-HL 3.664 0.666 0.523* < 0.001 - S

DVM-TWT 0.144 3.015 0.725* < 0.001 - S