HHS Public Access

Author manuscript
Neonatology. Author manuscript; available in PMC 2016 April 18.
Author Manuscript

Published in final edited form as:

Neonatology. 2013 ; 103(2): 105111. doi:10.1159/000343097.

Effects of Bilirubin on Neutrophil Responses in Newborn Infants

Barry Weinbergera, Faith E. Archera, Suganya Kathiravana, Daniel S. Hirscha, Alan M.
Kleinfeldb, Anna M. Vetranoa, and Thomas Hegyia
aDivisionof Neonatology, Department of Pediatrics, University of Medicine and Dentistry of New
Jersey Robert Wood Johnson Medical School, New Brunswick, N.J
bTorrey Pines Institute for Molecular Studies, San Diego, Calif., USA
Author Manuscript

Abstract
BackgroundNewborns are susceptible to inflammatory diseases due to defects in clearing
activated immune cells from tissues. Therefore, mechanisms have likely evolved to protect
neonates from leukocyte-mediated cytotoxicity. Bilirubin has antioxidant activity, and it is possible
that it also exerts effects on cellular immune responses in jaundiced infants.

ObjectivesWe hypothesize that bilirubin increases expression of antioxidant genes and

decreases production of inflammatory proteins in neonatal neutrophils.

MethodsNeutrophils were isolated from umbilical cord blood, and from adults for comparison,
and treated with bilirubin (10300 mol/l, equivalent to unbound bilirubin 340 nmol/l), in the
presence or absence of lipopolysaccharide (LPS). Expression of genes for antioxidant enzymes
Author Manuscript

[superoxide dismutase (SOD), heme-oxygenase-1 (HO-1)] and heme-dependent enzymes involved

in inflammation [NADPH oxidase-1 (NOX-1), cyclooxygenase-2 (COX-2)] was measured by
PCR. Inflammatory cytokines were measured by bead array analysis using flow cytometry.

ResultsWe found that LPS induced production of interleukin (IL)-8, IL-1, and macrophage
inhibitory protein-1 (MIP-1). Bilirubin increased basal production of IL-8 and IL-1, but
downregulated LPS-induced generation of IL-8 and MIP-1. It also upregulated SOD and HO-1
gene expression. We observed an unexpected bilirubin-induced increase in gene expression of
NOX-1 in LPS-activated cells, and of COX-2 in both resting and activated cells.

ConclusionsThese findings suggest that bilirubin suppresses inflammation and increases

antioxidant enzyme generation in activated neonatal neutrophils. The unexpected increases in
NOX-1 and COX-2 expression may represent an early response, with physiologic effects mitigated
Author Manuscript

by increased antioxidant activity. Further studies will be needed to define levels of bilirubin that
optimize its protective effects, while minimizing potential inflammatory toxicity.

Keywords
Bilirubin; Neutrophils; Inflammation; Neonatal neutrophils

Thomas Hegyi, MD, Division of Neonatology, Department of Pediatrics, UMDNJ-Robert Wood Johnson Medical School, 1 Robert
Wood Johnson Place, New Brunswick, NJ 08903 (USA), hegyith@umdnj.edu.
 Weinberger et al. Page 2

Introduction
Author Manuscript

Neonatal jaundice caused by hyperbilirubinemia occurs in 6070% of newborns. Though

some degree of hyperbilirubinemia is considered physiologic and possibly neuroprotective
because of bilirubins antioxidant properties [1], the modulating effects of bilirubin on
inflammation in neonates have not been critically examined. The aim of these investigations
was to define the dose-dependent effects of bilirubin on neutrophil function, which is a key
determinant of health and disease in the neonatal period. Neutrophils are the main effector
cells in early inflammation, producing reactive oxygen intermediates via enzymes such as
NADPH oxidase-1 (NOX-1), and eicosanoids via cyclooxygenase-2 (COX-2). In vitro
studies have demonstrated that purified human neutrophils are metabolically active,
expressing mRNA for proteins mediating inflammation, both constitutively and after
activation with bacterial lipopolysaccharide (LPS) or other stimulants [2, 3]. Neonatal
neutrophils exhibit delayed apoptosis and prolonged survival under inflammatory
Author Manuscript

conditions. It has recently been shown that neutrophils surviving >24 h generate increased
quantities of inflammatory cytokines, including interleukin (IL)-8 and macrophage
inhibitory protein-1 (MIP-1), possibly contributing to tissue injury [4].

Bilirubin, one of the principal metabolic end-products of heme catabolism, is generated by

the sequential action of heme oxygenase and biliverdin reductase [1]. It has been shown to
exert anti-inflammatory effects, such as decreasing NOX-1 activation by regulating p47
phox-dependent activity [5]. Bilirubin prevents the oxidant-mediated vasoconstrictive
actions of tumor necrosis factor (TNF) and angiotensin II [1]. In addition, low
concentrations of bilirubin scavenge reactive oxygen intermediates (ROS), potentially
reducing oxidant-induced cellular injury and attenuating oxidant stress in vivo [6, 7].
Bilirubin also prevents endothelial cell damage and sloughing in conditions such as diabetes
Author Manuscript

and hypertension by up-regulating extracellular superoxide dismutase (EC-SOD) and plasma

catalase activity, and decreasing superoxide production [8]. Consistent with this, we have
previously demonstrated that higher bilirubin levels in preterm infants are associated with a
lower incidence of inflammatory diseases, including bronchopulmonary dysplasia and
necrotizing enterocolitis [9]. In the current studies, we hypothesized that bilirubin: (1)
decreases inflammatory cytokine production, (2) increases expression of antioxidant genes
[heme-oxygenase-1 (HO-1), SOD], and (3) decreases expression of heme-dependent
enzymes (NOX-1, COX-2) associated with oxidant activity in neonatal neutrophils.

Materials and Methods

Reagents
Author Manuscript

Dulbeccos modified Eagles medium (DMEM), PBS, dextran, RNAase A, and bacterial-
derived LPS were purchased from Sigma Chemical Co. (St. Louis, Mo., USA). Ficoll-Paque
was from GE Healthcare (Piscataway, N.J., USA). RNA purification kits were purchased
from Qiagen (Chatsworth, Calif., USA). Primers for real-time PCR were obtained from
Integrated DNA Technologies (Coralville, Iowa, USA). Nucleotides and reagents for PCR
were from Applied Biosystems (Foster City, Calif., USA). Cytometric bead array flex sets
were from BD Biosciences (San Jose, Calif., USA). Bilirubin was obtained from
Calbiochem (San Diego, Calif., USA).

Neonatology. Author manuscript; available in PMC 2016 April 18.

 Weinberger et al. Page 3

Bilirubin Preparation
Author Manuscript

A 5-mmol/l stock solution of bilirubin was prepared immediately before use in 0.1 mol/l
NaOH. Prior to treatment, pH was restored to 7.4 by addition of equal amounts of 0.1 mol/l
HCl [10, 11]. Treatments (10, 30, 100, 300 mol/l) were added in the dark, incubated and
protected from light for 424 h. The range of 0300 mol/l (018 mg/dl), equivalent to
unbound bilirubin of between 3 and 40 nmol/l in the neutrophil culture media, was chosen
for these experiments because it corresponds to the range of levels that are commonly
observed in neonates under conditions of both physiologic and pathologic
hyperbilirubinemia.

Subjects and Neutrophil Isolation

Studies were approved by the Institutional Review Board of UMDNJ-Robert Wood Johnson
Medical School, and informed consent was obtained from participants. Umbilical cord blood
Author Manuscript

was obtained from healthy term infants (37 weeks gestation) delivered by elective
cesarean section prior to labor between January 2010 and January 2011. Subjects were
excluded with clinical evidence of chorioamnionitis or other perinatal bacterial or viral
infections, e.g. maternal fever, uterine tenderness, or foul-smelling amniotic fluid.
Neutrophils were isolated by dextran sedimentation, followed by Ficoll gradient
centrifugation and hypotonic lysis of erythrocytes, as previously described [12]. Isolated
neutrophils were suspended in DMEM with 10% fetal bovine serum (FBS), in the presence
of LPS (1 g/ml) or medium control. Bilirubin was added in concentrations of 10, 30 100
and 300 mol/l.

RNA Expression
Neutrophils were incubated with control, LPS (1 g/ml), and/ or bilirubin (10, 30, 100, 300
Author Manuscript

mol/l) for 4 h. RNA was isolated using an RNeasy Mini Kit (Qiagen). cDNA was
synthesized using a high-capacity cDNA reverse transcription kit (Applied Biosystems).
Real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems)
and amplified on an ABI Prism 7900 sequence detection system, using GAPDH as standard.
Full-length coding sequences were obtained from GenBank. Primers were designed using
Primer Express software (Applied Biosystems). Forward and reverse primers used were: -
actin, aaagacctgtacgccaacac and gtcatactcctgcttgctgat; SOD, gtcgtagtctcctgcagcgtc and
ctggttccgaggactgcaa; HO-1, gctcaaaaagattgcccaga and gcggtagagctgcttgaact; NOX-1,
ccttgcaccggtcattcttt and cggtaaaaccggaggatcct, and COX-2, gcctgatgattgcccgact and
gctggccctcgcttatgatct.

Inflammatory Proteins
Author Manuscript

Culture supernatants were incubated with premixed flex set beads coated with antibodies to
IL-1, IL-8, MIP-1, IL-6, and VEGF for 1 h in 96-well filtration plates. Premixed
phycoery-thrin-labeled detection reagent was then added to the wells. The plates were
incubated at room temperature in the dark for 2 h. Bead/protein complexes were then
washed and analyzed for fluorescence intensity using a BD FACS Array Bioanalyzer. Data
were analyzed using BD FCAP software (version 2.0) with 5-parameter curve fitting.

Neonatology. Author manuscript; available in PMC 2016 April 18.

 Weinberger et al. Page 4

Measurement of Unbound Bilirubin

Author Manuscript

Neutrophils from 3 representative subjects were incubated for 4 h in medium containing

10% FBS and bilirubin concentrations of 10, 30, 100, and 300 mol/l. Culture supernatants
were analyzed for unbound bilirubin using the bilirubin probe BL22P1B11-Rh, a
combination of mutated fatty acid binding protein labeled with the fluorescent molecule
acrylodan and Rhodamine B as we have previously described [13]. BL22P1B11-Rh
responds to binding bilirubin by reducing its ratio of 525575 nm fluorescence (excitation =
375 nm) with a Kd for bilirubin at 22C of 16 nmol/l. The bilirubin probe was added to the
culture media and unbound bilirubin concentrations quantified.

Statistical Analysis
Experiments were repeated 614 times. Data were analyzed using Statistica 5.5 (StatSoft,
Inc., Tulsa, Okla., USA). The effects of treatments were compared pairwise using t tests.
Author Manuscript

Results
Levels of unbound (free) bilirubin in the neutrophil culture media were correlated with total
bilirubin levels, with 300 mol/l total corresponding to about 40 nmol/l unbound (fig. 1).
First, we examined the effects of bilirubin on mRNA expression of antioxidant genes SOD
and HO-1, which are known to play a role in protecting against cytotoxicity and tissue
damage. Bilirubin increased SOD and HO-1 gene expression in LPS-activated neutrophils.
These effects were dose-dependent, with statistically significant increases at bilirubin
concentrations of 300 mol/l (fig. 2). There was also a trend towards increased expression of
SOD and HO-1 genes in response to increasing concentrations of bilirubin in unstimulated
neutrophils. We next compared the effects of bilirubin on mRNA expression of NOX-1 and
COX-2 genes. These enzymes catalyze the generation of oxidative and pro-inflammatory
Author Manuscript

mediators, including prostaglandins and superoxide anion. They are heme-dependent and
inducible, with rapid turnover [14]. Bilirubin was found to upregulate expression of NOX-1
in LPS-activated neutrophils in a dose-dependent manner, with statistically significant
increases at bilirubin concentration of 300 mol/l. Bilirubin also upregulated COX-2 gene
expression in both resting and LPS-activated cells, with significant effects at 100 and 300
mol/l of bilirubin in unstimulated neutrophils, and 300 mol/l in LPS-activated cells (fig.
3).

We then analyzed the effects of bilirubin on neutrophil production of inflammatory proteins

and chemotactic cytokines. Production of IL-1, IL-8 and MIP-1 was significantly
increased in LPS-activated cells compared to resting neutrophils. Bilirubin increased the
production of IL-1 and IL-8 at concentrations between 10 and 300 mol/l in unstimulated
Author Manuscript

cells. In contrast, bilirubin (300 mol/l) downregulated the production of MIP-1 and IL-8 in
LPS-activated cells (fig. 4). No significant effects of bilirubin were noted on the production
of IL-6 and VEGF (not shown).

Discussion
Bilirubin formation results from the catabolism of heme-containing proteins such as
hemoglobin, myoglobin, cytochromes, catalases, and tryptophan pyrrolase. The microsomal

Neonatology. Author manuscript; available in PMC 2016 April 18.

 Weinberger et al. Page 5

enzyme heme oxygenase catalyzes the first step of this process, resulting in the generation of
Author Manuscript

biliverdin and the release of carbon monoxide. Neonates have a high heme load, as well as
developmental immaturity in the metabolism and transport of bilirubin. Consequently, they
exhibit transient hyperbilirubinemia, or physiologic jaundice. This condition is
characterized, in the term infant, by a progressive rise in serum bilirubin concentrations to a
peak of approximately 100 mol/l by the third day of life, followed by a drop to 35 mol/l
by the end of the first week of life [15]. At physiologic levels, bilirubin has been shown to
have antioxidant and cyto-protective effects. For example, it suppresses postischemic
myocardial dysfunction [16], protects against LPS-induced liver injury [17], and ameliorates
skin inflammation [18]. In these studies, we also investigated the effects of pathologic levels
of exposure (up to 300 mol/l, equivalent to 40 nmol/l unbound bilirubin in the neutrophil
culture media), to which many infants are exposed, often as a result of hemolysis or
dehydration.
Author Manuscript

Neutrophils accumulate in tissues in response to chemotactic factors generated at sites of

infection or injury. Inflammatory cytokines and bacterial-derived products also trigger the
generation of reactive oxygen intermediates, which are key in bacterial killing but may also
play a role in tissue injury. In association with its antioxidant properties, bilirubin may
suppress neutrophil phagocytosis and bacterial killing [19]. In these studies, we found that
bilirubin upregulated constitutive expression of SOD and HO-1 in neonatal neutrophils.
These antioxidant enzymes are key to protecting tissues from reactive oxygen species
generated in the fetal and maternal circulation. HO-1 is associated with decreased
endothelial cell injury and sloughing in conditions such as diabetes and hypertension [20]. It
is induced by physiologic and pathologic stimuli including oxidative stress signals,
cytokines, bacterial compounds and growth factors [21]. A growing number of
pharmacologic compounds, such as statins [22] and 5-ASA [23], have been shown to
Author Manuscript

provide anti-inflammatory protection via the induction of HO-1. Similarly, increased SOD
may exert protective anti-inflammatory effects by decreasing superoxide anion. This reduces
cytotoxicity and also allows levels of nitric oxide in tissues to remain stable, promoting
endothelial cell progenitor function [8, 16, 20]. Our finding that bilirubin increases
expression of HO-1 and SOD in neonatal neutrophils suggests that these protective
mechanisms may occur in the neonatal period, which is characterized by the oxidative stress
of birth and postnatal adaptation. Neonatal jaundice may have an important anti-
inflammatory effect via induction of these enzymes.

In contrast to these antioxidant effects, we found that bilirubin increased the expression of
NOX-1 in LPS-activated neutrophils, and COX-2 in both resting and activated cells. NOX-1
is the major enzymatic mediator of superoxide anion generation in neutrophils [24].
Author Manuscript

Previous studies have shown that neonatal neutrophils produce robust quantities of
superoxide anion and inflammatory eicosanoids after stimulation with inflammatory stimuli
such as LPS [25]. Our findings suggest that bilirubin induces these oxidative and
inflammatory responses in neonatal neutrophils at early time points. Consistent with this,
bilirubin has been shown to trigger the induction of COX-2 and inflammatory cytokines in
mononuclear cells [26]. The upregulation of COX-2 in neonatal neutrophils by bilirubin
observed in our studies could be a time-dependent response, with physiologic effects
mitigated by the subsequent activity of HO-1 [14]. Of note, significant effects of bilirubin on

Neonatology. Author manuscript; available in PMC 2016 April 18.

 Weinberger et al. Page 6

expression of both pro- and antioxidant enzymes were observed only at bilirubin levels >100
Author Manuscript

mol/l (unbound bilirubin >17 nmol/l), which are considered pathologic rather than
physiologic.

Previous studies have yielded conflicting results regarding the effects of bilirubin on the
production of inflammatory cytokines. For example, bilirubin induces IL-1 and TNF-
production, but suppresses IL-6, in astrocytes [27]. Bilirubin has also been shown to induce
release of TNF-, IL-1 and IL-6 in microglia [28]. However, previous studies have not
examined the effects of bilirubin on resting and activated neonatal neutrophils. We found
that bilirubin increased constitutive production of IL-1 and IL-8 in resting neonatal
neutrophils, but suppressed IL-8 and MIP-1 in LPS-activated cells. Downregulation of
these mediators under inflammatory conditions, in the presence of LPS, suggests that
bilirubin may play a protective role under conditions of infection or oxidative stress in
newborns.
Author Manuscript

The portion of circulating bilirubin that is not bound to serum proteins (unbound or free) is
thought to be responsible for its biologic actions [29]. We found that free bilirubin levels in
the culture media, which contained 10% FBS, correlated directly with total bilirubin levels,
with 300 mol/l total corresponding to about 40 nmol/l free. This is comparable to previous
measurements of free bilirubin in neonatal serum, including a large cohort of newborns
>2,500 g birth weight who were shown to have a mean level of 21.5 with a range of 0.9130
nmol/l [30]. These findings suggest that total bilirubin measurements are an acceptable
surrogate for free bilirubin in these experiments.

In conclusion, bilirubin may exert protective effects by upregulating antioxidant production

and downregulating cytokine production in activated neonatal neutrophils. Bilirubin may
Author Manuscript

also activate resting neutrophils, and the significance of this activity is not known.
Hyperbilirubinemia may represent a protective adaptation, with beneficial effects given the
oxidative and inflammatory stress that can occur in the perinatal period. Further studies will
be required to define levels that optimize these effects while minimizing potential
cytotoxicity resulting from bilirubin-induced upregulation of NOX-1 and COX-2 in
neutrophils.

Acknowledgments
This study was supported by NIH grants HD058019 and ES005022.

References
1. Stocker R, Yamamoto Y, McDonagh AF, Glazer AN, Ames BN. Bilirubin is an antioxidant of
Author Manuscript

possible physiological importance. Science. 1987; 235:10431046. [PubMed: 3029864]

2. Cassatella MA. The production of cytokines by polymorphonuclear neutrophils. Immunol Today.
1995; 16:2126. [PubMed: 7880385]
3. Kasama T, Strieter RM, Standiford TJ, Burdick MD, Kunkel SL. Expression and regulation of
human neutrophil-derived macrophage inflammatory protein 1. J Exp Med. 1993; 178:6372.
[PubMed: 8315395]
4. Nguyen CN, Schnulle PM, Chegini N, Luo X, Koenig JM. Neonatal neutrophils with prolonged
survival secrete mediators associated with chronic inflammation. Neonatology. 2010; 98:341347.
[PubMed: 20551711]

Neonatology. Author manuscript; available in PMC 2016 April 18.

 Weinberger et al. Page 7

5. Jiang F, Roberts SJ, Datla S, Dusting GJ. NO modulates NADPH oxidase function via heme
oxygenase-1 in human endothelial cells. Hypertension. 2006; 48:950957. [PubMed: 16982957]
Author Manuscript

6. Dore S, Takahashi M, Ferris CD, Zakhary R, Hester LD, et al. Bilirubin, formed by activation of
heme oxygenase-2, protects neurons against oxidative stress injury. Proc Natl Acad Sci USA. 1999;
96:24452450. [PubMed: 10051662]
7. Stocker R, Glazer AN, Ames BN. Antioxidant activity of albumin-bound bilirubin. Proc Natl Acad
Sci USA. 1987; 84:59185922. [PubMed: 3475708]
8. Kruger AL, Peterson S, Turkseven S, Kaminski PM, Zhang FF, et al. D-4F induces heme
oxygenase-1 and extracellular superoxide dismutase, decreases endothelial cell sloughing, and
improves vascular reactivity in rat model of diabetes. Circulation. 2005; 111:31263134. [PubMed:
15939814]
9. Hegyi T, Goldie E, Hiatt M. The protective role of bilirubin in oxygen-radical diseases of the
preterm infant. J Perinatol. 1994; 14:296300. [PubMed: 7965225]
10. Dolphin, D. The Porphyrins. New York: Academic Press; 1978.
11. Chang FY, Lee CC, Huang CC, Hsu KS. Un-conjugated bilirubin exposure impairs hippocampal
long-term synaptic plasticity. PLoS One. 2009; 4:e5876. [PubMed: 19517010]
Author Manuscript

12. Ferrante A, Thong YH. Optimal conditions for simultaneous purification of mononuclear and
polymorphonuclear leucocytes from human blood by the Hypaque-Ficoll method. J Immunol
Methods. 1980; 36:109117. [PubMed: 7430646]
13. Huber AH, Zhu B, Kwan T, Kampf JP, Hegyi T, et al. Fluorescence sensor for the quantification of
unbound bilirubin concentrations. Clin Chem. 2012; 58:869876. [PubMed: 22395024]
14. Abraham NG, Drummond G. CD163-Mediated hemoglobin-heme uptake activates macrophage
HO-1, providing an anti-inflammatory function. Circ Res. 2006; 99:911914. [PubMed:
17068296]
15. Maisels MJ. Bilirubin; on understanding and influencing its metabolism in the newborn infant.
Pediatr Clin North Am. 1972; 19:447501. [PubMed: 4555453]
16. Clark JE, Foresti R, Sarathchandra P, Kaur H, Green CJ, et al. Heme oxygenase-1-derived bilirubin
ameliorates postischemic myocardial dysfunction. Am J Physiol Heart Circ Physiol. 2000;
278:H643H651. [PubMed: 10666097]
17. Wang WW, Smith DL, Zucker SD. Bilirubin inhibits iNOS expression and NO production in
Author Manuscript

response to endotoxin in rats. Hepatology. 2004; 40:424433. [PubMed: 15368447]

18. Freitas A, Alves-Filho JC, Secco DD, Neto AF, Ferreira SH, et al. Heme oxygenase/carbon
monoxide-biliverdin pathway downregulates neutrophil rolling, adhesion and migration in acute
inflammation. Br J Pharmacol. 2006; 149:345354. [PubMed: 16953189]
19. Thong YH, Ferrante A, Ness D. Neutrophil phagocytic and bactericidal dysfunction induced by
bilirubin. Aust Paediatr J. 1977; 13:287289. [PubMed: 614015]
20. Abraham NG, Kushida T, McClung J, Weiss M, Quan S, et al. Heme oxygenase-1 attenuates
glucose-mediated cell growth arrest and apoptosis in human microvessel endothelial cells. Circ
Res. 2003; 93:507514. [PubMed: 12933701]
21. Paine A, Eiz-Vesper B, Blasczyk R, Immenschuh S. Signaling to heme oxygenase-1 and its anti-
inflammatory therapeutic potential. Biochem Pharmacol. 2010; 80:18951903. [PubMed:
20643109]
22. Grosser N, Hemmerle A, Berndt G, Erdmann K, Hinkelmann U, et al. The antioxidant defense
protein heme oxygenase 1 is a novel target for statins in endothelial cells. Free Radic Biol Med.
2004; 37:20642071. [PubMed: 15544924]
Author Manuscript

23. Horvath K, Varga C, Berko A, Posa A, Laszlo F, et al. The involvement of heme oxygenase-1
activity in the therapeutic actions of 5-aminosalicylic acid in rat colitis. Eur J Pharmacol. 2008;
581:315323. [PubMed: 18215658]
24. Lambeth JD, Kawahara T, Diebold B. Regulation of Nox and Duox enzymatic activity and
expression. Free Radic Biol Med. 2007; 43:319331. [PubMed: 17602947]
25. Weinberger B, Vetrano AM, Syed K, Murthy S, Hanna N, et al. Influence of labor on neonatal
neutrophil apoptosis, and inflammatory activity. Pediatr Res. 2007; 61:572577. [PubMed:
17413861]

Neonatology. Author manuscript; available in PMC 2016 April 18.

 Weinberger et al. Page 8

26. Silva SL, Vaz AR, Barateiro A, Falcao AS, Fernandes A, et al. Features of bilirubin-induced
reactive microglia: from phagocytosis to inflammation. Neurobiol Dis. 2010; 40:663675.
Author Manuscript

[PubMed: 20727973]
27. Fernandes A, Silva RF, Falcao AS, Brito MA, Brites D. Cytokine production, glutamate release
and cell death in rat cultured astrocytes treated with unconjugated bilirubin and LPS. J
Neuroimmunol. 2004; 153:6475. [PubMed: 15265664]
28. Gordo AC, Falcao AS, Fernandes A, Brito MA, Silva RF, et al. Unconjugated bilirubin activates
and damages microglia. J Neurosci Res. 2006; 84:194201. [PubMed: 16612833]
29. Kaplan M, Bromiker R, Hammerman C. Severe neonatal hyperbilirubinemia and kernicterus: are
these still problems in the third millennium? Neonatology. 2011; 100:354362. [PubMed:
21968213]
30. Ahlfors CE, Wennberg RP, Ostrow JD, Tiribelli C. Unbound (free) bilirubin: improving the
paradigm for evaluating neonatal jaundice. Clin Chem. 2009; 55:12881299. [PubMed: 19423734]
Author Manuscript
Author Manuscript
Author Manuscript

Neonatology. Author manuscript; available in PMC 2016 April 18.

 Weinberger et al. Page 9
Author Manuscript
Author Manuscript

Fig. 1.
Association of unbound bilirubin levels with total bilirubin. Neonatal neutrophils were
incubated in the presence of bilirubin (10, 30, 100 and 300 mol/l) for 4 h. Culture
supernatants were analyzed for unbound bilirubin using a mutated fatty acid binding protein
Author Manuscript

labeled with the fluorescent molecule acrylodan. Each point represents mean SE (n = 3).
Author Manuscript

Neonatology. Author manuscript; available in PMC 2016 April 18.

 Weinberger et al. Page 10
Author Manuscript

Fig. 2.
Effects of bilirubin on expression of antioxidant genes (SOD, HO-1). Neonatal neutrophils
were incubated in the presence (grey bars) or absence (black bars) of LPS (1 g/ml) and
Author Manuscript

bilirubin [0 (medium control), 10, 30, 100 and 300 mol/l] for 4 h. mRNA expression of the
SOD (a) and HO-1 (b) genes was quantified by real-time PCR. Results were normalized to
-actin expression. Each bar represents the mean SE (n = 89). ** Significantly different
(p < 0.05) from control + LPS.
Author Manuscript
Author Manuscript

Neonatology. Author manuscript; available in PMC 2016 April 18.

 Weinberger et al. Page 11
Author Manuscript

Fig. 3.
Effects of bilirubin on expression of heme-dependent enzymes (NOX-1, COX-2). Neonatal
neutrophils were incubated in the presence (grey bars) or absence (black bars) of LPS (1
Author Manuscript

g/ml) and bilirubin [0 (medium control), 10, 30, 100 and 300 mol/l] for 4 h. mRNA
expression of the NOX-1 (a) and COX-2 (b) genes was quantified by real-time PCR. Results
were normalized to -actin expression. Each bar represents the mean SE (n = 812). *
Significantly different (p < 0.05) from control. ** Significantly different (p < 0.05) from
control + LPS.
Author Manuscript
Author Manuscript

Neonatology. Author manuscript; available in PMC 2016 April 18.

 Weinberger et al. Page 12
Author Manuscript
Author Manuscript

Fig. 4.
Effects of bilirubin on inflammatory cytokine production. Neonatal neutrophils were
incubated in the presence (grey bars) or absence (black bars) of LPS (1 g/ml) and bilirubin
[0 (medium control), 10, 30, 100 and 300 mol/l] for 24 h. The inflammatory mediators IL-8
(a), IL-1(b), and MIP-1 (c) were measured in culture supernatants using cytometric bead
array analysis. Each bar represents the mean SE (n = 814). * Significantly different (p <
0.05) from control. ** Significantly different (p < 0.05) from control + LPS.
Author Manuscript
Author Manuscript

Neonatology. Author manuscript; available in PMC 2016 April 18.