N U TR IT ION RE S EA RCH 3 3 ( 2 0 13 ) 58 0 5 85

Available online at www.sciencedirect.com

www.nrjournal.com

The hypocholesterolemic activity of Momordica charantia fruit

is mediated by the altered cholesterol- and bile acidregulating
gene expression in rat liver

Sho Matsui, Takumi Yamane, Toshichika Takita, Yuichi Oishi, Kazuo Kobayashi-Hattori
Department of Nutritional Science, Faculty of Applied Bioscience, Tokyo University of Agriculture, 1-1-1 Sakuragaoka, Setagaya-ku,
Tokyo 156-8502, Japan

ARTI CLE I NFO A BS TRACT

Article history: Although many studies have demonstrated the hypocholesterolemic activity of Momordica
Received 31 October 2012 charantia, also called bitter gourd fruit (BGF), the relative hypocholesterolemic mechanism is
Revised 28 April 2013 not fully understood. In the present study, we hypothesized that BGF alters hepatic gene
Accepted 2 May 2013 expression of cholesterol- and bile acidregulating proteins to improve blood cholesterol
profiles. To clarify the mechanism, we fed 7-week-old male Wistar rats a high-cholesterol
Keywords: (HC) diet containing 5% BGF for 4 weeks and determined the cholesterol levels in the serum,
Bitter gourd fruit liver and feces, concentrations of the fecal total bile acid, and the expression level of
Cholesterol cholesterol- and bile acidregulating genes. The HC diet with BGF supplementation showed
Bile acids a significant serum hypocholesterolemic activity compared with the HC diet without BGF.
Cholesterol 7-hydroxylase BGF intake also significantly increased the levels of fecal total bile acid, suggesting that BGF
Small heterodimer partner inhibited the reabsorption of bile acids into the intestine. Hepatic messenger RNA (mRNA)
Rat levels of small heterodimer partner (SHP) and liver receptor homolog-1, which are both
involved in cholesterol 7-hydroxylase (CYP7A1) regulation, were significantly decreased
and increased, respectively, by BGF intake. In addition, BGF tended to increase the hepatic
CYP7A1 mRNA level. Taken together, these results suggest that BGF not only decreases the
reabsorption of bile acids into the intestine but also increases the conversion of cholesterol
to bile acids by CYP7A1 up-regulation through the down-regulation of the hepatic farnesoid
X receptor/SHP pathway.
2013 Elsevier Inc. All rights reserved.

1. Introduction tension, disorders in glucose metabolism, smoking, aging, and

According to the World Health Organization, the major cause
of death within its member countries that needs to be
overcome is cardiovascular diseases, accounting for approx-
imately 30% of all deaths [1]. Hypercholesterolemia, hyper-
social stress are the main risk factors for cardiovascular
diseases. To date, in the Japanese population, the upper limits
of the reference range for serum levels of total cholesterol (TC)
and low-density lipoprotein cholesterol (LDL-C) are 220 and
140 mg/dL, respectively, and the lower limit of the reference

Abbreviations: ABCG5, ATP-binding cassette subfamily G member 5; ABCG8, ATP-binding cassette subfamily G member 8; BGF, bitter
gourd fruit; CYP7A1, cholesterol-7-hydroxylase; FXR, farnesoid X receptor; HC, high cholesterol; HDL-C, high-density lipoprotein
cholesterol; HMGR, hydroxymethylglutaryl-coenzyme A reductase; LDL-C, low-density lipoprotein cholesterol; LRH-1, liver receptor
homologue-1; LXR, liver X receptor ; mRNA, messenger RNA; NF, normal fat; PCR, polymerase chain reaction; SHP, small heterodimer
partner; TBA, total bile acid; TC, total cholesterol.
Corresponding author. Tel.: +81 3 5477 2443; fax: +81 3 5477 2443.
E-mail address: k2kobaya@nodai.ac.jp (K. Kobayashi-Hattori).

0271-5317/$ see front matter 2013 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.nutres.2013.05.002
 N U TR IT ION RE S E ARCH 3 3 ( 2 0 13 ) 58 0 5 8 5 581

range of high-density lipoprotein cholesterol (HDL-C) is of BGF on the cholesterol level in the serum, liver, and feces
defined as 40 mg/dL [2]. Studies conducted during the 1980s and the level of fecal total bile acid (TBA) in rats that were fed a
showed that the incidence of cardiovascular events increased high-cholesterol (HC) diet. We also investigated the messen-
with increasing serum cholesterol levels [3]. Therefore, the ger RNA (mRNA) expressions of HMGR, CYP7A1, LXR, FXR,
normalization of serum cholesterol levels is important for SHP, and LRH-1, which relate to the modulation of bile acid
preventing cardiovascular diseases. synthesis in the liver.
Certain foods and food components can reduce serum
cholesterol levels and lower the risk of cardiovascular diseases
[4]. Among such foods, Momordica charantia fruit, also known as 2. Methods and materials
bitter gourd fruit (BGF), has a unique bitter taste and
hypocholesterolemic activity. In the intestine, BGF supple- 2.1. Animals and diets
mentation significantly decreased the concentrations of
serum and hepatic TC in rats that were fed diets with or Heated-air dried BGF (commercial preparation), kindly pro-
without cholesterol [6]. A BGF extract decreased the levels of vided by Goyapark Ltd (Okinawa, Japan), was powdered using
TC, triglycerides, and phospholipids in streptozocin-induced a blender (Vita-MIX Blender ABSOLUTE3; Osaka Chemical Co,
diabetic rats [7]. In addition, BGF possesses antidiabetic Ltd, Osaka, Japan). Seven-week-old male Wistar rats (200-220
activity, resulting from the presence of phytochemicals such g; CLEA Japan Inc, Tokyo, Japan) were housed in an individual
as saponins, curbitane triterpenoids, and momordicosides R, wire-bottomed cage at 23C to 25C in a temperature-
S, and T [5]. Although there are many reports on the controlled room with relative humidity (50%-56%) under a
antidiabetic activity of BGF, the ingredient and the mecha- 12-hour light/dark cycle (light on 8:00 AM). Rats were
nism(s) involved in its hypocholesterolemic activity remain acclimated for 1 week on a normal diet based on AIN-76
unclear. Thus, to clarify the mechanism(s) of the hypocho- [12] and then divided into 3 groups (n = 5). During the
lesterolemic activity of BGF, we analyzed the change in the following 4 weeks, one control group (normal fat [NF] group)
gene expression of cholesterol- and bile acidregulating was fed the normal diet based on AIN-76 and another control
proteins after BGF intake. group (HC group) was fed AIN-76 diet containing 15% lard and
Cholesterol homeostasis is achieved through the regula- 0.05% cholesterol. The test group (BGF group) was fed an HC
tion of cholesterol biosynthesis, the conversion of cholesterol diet containing 5% BGF. Table 1 shows the composition of
to bile acids, and their excretion. These aspects of cholesterol each experimental diet. The rats had free access to food and
homeostasis are regulated by hydroxymethylglutaryl-coen- water. The daily consumptions were measured every day,
zyme A reductase (HMGR) and cholesterol 7-hydroxylase and the body weights were recorded twice a week. Feces were
(CYP7A1) [8]. HMGR is the rate-limiting enzyme in the collected for 3 days before euthanization and then lyophi-
synthesis of cholesterol, whereas CYP7A1 is the rate-limiting lized. All rats were dissected on the final day of the
enzyme in the synthesis of bile acid from cholesterol via the experimental period under anesthesia with sodium pento-
classical pathway [9]. Furthermore, CYP7A1 is partially barbital (40 mg/kg body weight). Serum was prepared by
regulated at the transcriptional level by the hepatic liver X centrifuging the blood samples (3000 rpm, 4C, 20 minutes).
receptor (LXR) and farnesoid X receptor (FXR) [10,11]. LXR The liver was washed with physiological saline buffer, rapidly
is a transcription factor activated by the oxidized forms of frozen in liquid nitrogen, and stored at 80C until analysis.
cholesterol (oxysterols), serving as sensor of excessive intra- This experiment was reviewed and approved by the Animal
cellular cholesterol accumulation [10]. FXR is a bile acid Care and Research Ethics Committee of the Tokyo University
receptor and acts as the major hepatic bile acid sensor of Agriculture (Permission No. 090585).
governing bile acid synthesis and transport [11]. Moreover, in
the body, more than 95% of the bile acids is reabsorbed in
the distal ileum and carried back to the liver. Thus, hepatic
LXR and FXR play an important role in regulating choles- Table 1 Ingredient composition of the diets fed to rats a
terol homeostasis through modulation of the biosynthesis of Ingredient NF group HC group BGF group
bile acids. FXR activation induces expression of the small
heterodimer partner (SHP), which, in turn, leads to the Casein 20.00 20.00 20.00
Corn starch 15.00 15.00 15.00
transcriptional repression of the CYP7A1 gene by inhibiting
Sucrose 50.00 39.95 34.95
the action of liver receptor homolog-1 (LRH-1), a nuclear Cellulose 5.00 5.00 5.00
receptor, on the CYP7A1 promoter [11]. However, little Mineral mixture b 3.50 3.50 3.50
information is available on the change in the gene expres- Vitamin mixture b 1.00 1.00 1.00
sion profile of cholesterol- and bile acidregulating proteins DL-Methionine 0.30 0.30 0.30
after BGF intake. Choline bitartrate 0.20 0.20 0.20
Lard 15.00 15.00
In this study, we hypothesized that BGF may modulate
Corn oil 5.00
expression of the genes that are involved in bile acid
Cholesterol 0.05 0.05
homeostasis in the liver, thus leading to a reduction in BGF 5.00
serum and hepatic cholesterol. The objective of the present Total 100.00 100.00 100.00
study was to clarify the hypocholesterolemic mechanism of a
Weight percent.
BGF by analyzing the expression of the genes associated with b
Based on AIN-76 mixture (Oriental Yeast Co, Tokyo, Japan).
bile acid homeostasis. In this study, we investigated the effect
582 N U TR IT ION RE S EA RCH 3 3 ( 2 0 13 ) 58 0 5 85
2.2. Measurement of lipids in the serum, liver, and feces
Serum levels of TC, HDL-C, and LDL-C were measured using an
automatic biochemical analyzer (model 7450; Hitachi Co,
Tokyo, Japan) [13]. Lipid samples from the liver and feces
were prepared according to the Folch method [14]. Briefly, the
largest lobe of the liver (1 g) was homogenized in a mixture of
chloroform/methanol (2:1, vol/vol) with a Polytron device
(International Scientific Instruments Supply Co, Ltd, Osaka,
Japan), and then the homogenate was placed in the dark
overnight. After filtering the homogenate suspension, the
filtrate was stored at 20C until use. To extract the lipids in
the feces, the lyophilized feces (0.5 g) were added to the same
amount of chloroform/methanol solution (2:1, vol/vol) and
incubated at 45C for 10 hours. After filtering the suspension,
the filtrate was stored at 20C until use. The levels of hepatic
and fecal TC in the lipid samples were measured with
Cholescolor Liquid Kit (Toyobo Co, Ltd, Osaka, Japan) [15].
The fecal level of TBA in the lipid samples was measured with
Total Bile Acids Test Wako (Wako Pure Chemical Industries,
Ltd, Osaka, Japan) [13].
2.3. Real-time polymerase chain reaction analyses
Total liver RNA was extracted by using the acidified guanidine
thiocyanate method, as described by Chomczynski and Sacchi
[16]. The total RNA samples were stored at 80C until use.
Complementary DNA was prepared from total RNA (5 g) treated
with DNase I (Promega Co, Madison, WI, USA) using the
SuperScript III RNase H-Reverse Transcriptase kit (Life Technol-
ogies Co, Carlsbad, CA, USA) [17], according to the manufac-
turer's instructions. The primers and probes for -actin and
HMGR were synthesized by Applied Biosystems (Carlsbad, CA,
USA; Table 2). The primers and probes for CYP7A1, LXR, SHP,
and LRH-1 were obtained from Applied Biosystems as Assays-
on-Demand primer/probe gene expression products. Real-time
polymerase chain reaction (PCR) was performed using an ABI
PRISM 7300 Sequence Detection System (Applied Biosystems),
using the reagents, primers, and probes contained in the
TaqMan Universal PCR Master Mix Kit (Applied Biosystems),
according to the manufacturer's instructions. PCR amplifica-
tions were performed in duplicate wells in the same 96-well
plate under the following conditions: 2 minutes at 50C and 10
minutes at 95C, followed by 50 cycles of 15 seconds at 95C and 1
minute at 60C. The mRNA levels of the targets were expressed
as relative values using -actin as a reference.
2.4. Statistical analyses
The data were analyzed using the Tukey's multiple compar-
ison test following 1-way analysis of variance using SPSS 15.0J
Table 2 Primer and probe sequences used for quantification of gene expression
Target gene Primer and probe sequences (5-3)
-Actin Forward primer CCCTGGCTCCTAGCACCAT
Reverse primer GATAGAGCCACCAATCCACACA
Probe VIC-AGATCATTGCTCCTCCTGAGCGCAAGT-TAMRA
HMGR Forward primer AGAGAAAGGTGCGAAGTTCCTTAGT
Reverse primer CCATGAGGGTTTCCAGTTTGTAG
Probe FAM-CAGTTGGTCAATGCTAAGCACATCCCAG-TAMRA
Table 3 Body weight change and average food intake of
rats fed the NF diet and the HC diet with or without BGF
NF group HC group BGF group
Initial body 239.35 2.46 240.40 1.162 41.07 1.78
weight (g)
Final body weight (g) 345.10 7.58 348.38 2.96 345.60 1.88
Body weight gain (g) 105.76 6.33 107.98 3.08 104.52 3.07
Average food intake 20.95 0.40a 18.50 0.02b 18.73 0.16b
(g/rat per day)
Data are mean SE (n = 5). Different letters in the same row show
significant difference at P < .05.
software (SPSS, Chicago, IL, USA). The data were expressed as
means SE. All results with P < .05 were considered
statistically significant.
3. Results and discussion
To examine the hypocholesterolemic activity, the amount of
cholesterol in the diet is an important factor. For the present
study, rats fed a diet containing 0.05% cholesterol and 15% lard
were used. Wang et al. [18] showed that rats fed an HC diet
containing 1% cholesterol and 10% corn oil based on AIN-76
changed the hepatic mRNA expression level of cholesterol-
and bile acidregulating proteins. The changes in that study
were similar to those in the present study, although the
content of cholesterol (0.05%) in our study was lower [18]. Thus,
it is reasonable to use a diet containing 0.05% cholesterol for
elucidating the hypocholesterolemic mechanism.
After the 4-week feeding period, no changes in the body
weight gain and initial and final body weights of the BGF group
were observed as compared with the HC group (Table 3).
Moreover, the addition of BGF did not affect the food intake of
animals fed the HC diet, except the first day (Fig. 1). Thus,
these results showed that BGF did not change the growth and
food intake.
Table 4 shows the effect of BGF feeding on the serum,
hepatic, and fecal parameters in rats. The serum TC level was
not significantly different between the NF group and the HC
group. However, the HC group showed a decrease in HDL-C
and a significant increase in LDL-C, compared with the NF
group. These results are probably caused by the excess
cholesterol in the diet. In contrast, the BGF group had
significantly decreased serum TC, HDL-C, and LDL-C levels
compared with the HC group.
Serum cholesterol levels depend on the cholesterol and
bile acids synthesis in the liver as well as on the absorption of
GenBank accession number
V01217
NM_13134
 N U TR IT ION RE S E ARCH 3 3 ( 2 0 13 ) 58 0 5 8 5 583

30 A HMGR
Dairy average food intake (g/rat)

1.5

ative mRNA level

25 a
a a
a a a a a
20 a
b ab b b ab b ab 1
b
a b b b
b b b b
b NF
15 0.5
HC

Rela
b BGF
10
0
NF HC BGF
5
B CYP7A1
0 4

ative mRNA level

0 5 10 15 20 25 30 a
Days 3
ab
Fig. 1 Changes in the food intake of rats fed an HC diet 2
b
containing BGF. Data are represented as the mean SE (n = 5).
1

Rela
Values with different letters indicate significant differences
(P < .05). 0
NF HC BGF
Groups

the cholesterol and bile acids into the intestine. Thus, plausible
mechanisms for the serum cholesterollowering effect of BGF
include the inhibition of liver cholesterol synthesis, the
blockage of intestinal absorption of bile acids and/or choles-
terol, and activation of bile acids synthesis [4]. The mechanism
of hypocholesterolemic action of BGF has been hypothesized to
be likely caused by a decrease in the cholesterol absorption
from the intestine via increasing the excretion of fecal bile acids
by binding to bile acids [19]. In our study, no change in the fecal
TC level was observed between the BGF group and the HC
group. However, the fecal TBA level in the BGF group was
significantly higher than that in the HC group (Table 4). Hence,
the decreased serum cholesterol level in this study is also
probably caused by the increase in bile acid excretion.
To verify this mechanism, we studied the effect of BGF on
the hepatic mRNA level of HMGR, the rate-limiting enzyme of
cholesterol synthesis [20]. BGF did not alter the HMGR mRNA
level (Fig. 2A), suggesting that the decreased serum choles-
terol level in the BGF group is not related to the regulation of
hepatic cholesterol synthesis.
Next, we focused on the change in fecal excretion of bile
acids that is thought to be a reason for the hypocholester-
olemic activity of BGF. Greater fecal excretion of bile acids
Table 4 Concentration of lipids in the serum, liver, and
feces of rats fed the NF diet and the HC diet with or
without BGF
NF group
Serum
TC (mmol/L) 2.70 0.06a
HDL-C (mmol/L) 1.87 0.05a
LDL-C (mmol/L) 0.38 0.05b
Liver
TC (mol/g) 3.16 0.28b
Feces
TC (mol/3 d) 26.89 0.91b
TBA (mol/3 d) 15.41 1.88b
Data are mean SE (n = 5). Different letters in the same row show
significant difference at P < .05.
Fig. 2 Effect of BGF intake on the mRNA levels of hepatic
HMGR and CYP7A1 in rats. Real-time PCR was performed as
described (see Methods and materials). The mRNA levels of
HMGR (A) and CYP7A1 (B) are expressed relative to those of
-actin. Data are represented as the mean SE (n = 5). Bars
with different letters indicate significant differences (P < .05).
leads to a decreased enterohepatic circulation of bile acids,
followed by an increased conversion from blood cholesterol to
bile acids in the liver [4]. Our results demonstrated that BGF
significantly increased the fecal excretion of bile acids
(Table 4). This increase suggests that BGF suppresses the
reabsorption of bile acids in the intestine and subsequently
enhances the catabolism of cholesterol to bile acids in the
liver. In addition, compared with the HC group, the BGF group
tended to increase CYP7A1 gene expression (Fig. 2B) and
decrease the hepatic TC level (Table 4). These results suggest
that BGF exerts its hypocholesterolemic activity by decreasing
the reabsorption of bile acids in the intestine and facilitating
the conversion of cholesterol to bile acids via up-regulation
of CYP7A1.
The above results raise the question of how BGF induces
the CYP7A1 mRNA up-regulation. LXR, which plays an
important role in cholesterol homeostasis, is a positive
regulator of the gene expression of CYP7A1 [10]. In the present
study, the CYP7A1 mRNA level in the liver was higher in the
BGF group than in the HC group (Fig. 2B), whereas the gene
HC group BGF group expression of hepatic LXR was significantly lower (Fig. 3).
These inconsistent results suggest that the increased gene
2.81 0.05a 2.17 0.08b expression of hepatic CYP7A1 in the BGF group is regulated by
1.51 0.04ab 1.10 0.09c a mechanism that differs from LXR regulation.
0.53 0.04a 0.30 0.04c Next, we focused on the FXR/SHP pathway, which relates
to bile acids synthesis. This pathway is located upstream of
7.39 0.03a 6.58 0.41a
CYP7A1. FXR controls the expression of genes whose
28.85 2.59ab 33.78 0.36a products are critically important in bile acid homeostasis
19.55 0.67b 30.87 1.80a [11]. In the liver, FXR combines with the promoter of SHP
after activation by the binding of bile acid and induces the
mRNA expression of SHP. SHP partner inhibits the function
of LRH-1, which binds to the promoter of CYP7A1 and
584 N U TR IT ION RE S EA RCH 3 3 ( 2 0 13 ) 58 0 5 85

LXR activates the intergenic promoter of ATP-binding cassette

2
ative mRNA level a subfamily G members 5 and 8 (ABCG5 and ABCG8) [21-23].
1.5 b Both ABCG5 and ABCG8 enhance the enterohepatic traffick-
c ing of cholesterol in mammals and promote the excretion of
1 bile acids. In the present study, the BGF group had
significantly higher levels of LRH-1 mRNA than did the HC
0.5 group. It is possible that the increased LRH-1 level enhanced
Rela

the excretion of bile acids via ABCG5 and ABCG8. Such

0
NF HC
Groups
Fig. 3 Effect of BGF intake on the mRNA levels of hepatic
LXR in rats. Real-time PCR was performed as described
(see Methods and materials). The mRNA level of LXR is
expressed relative to that of -actin. Data are represented
as the mean SE (n = 5). Bars with different letters indicate
significant differences (P < .05).
increases its mRNA expression [11]. In the present study, the
BGF group showed hepatic SHP mRNA levels significantly
lower than those in the HC group (Fig. 4A). In addition,
hepatic LRH-1 mRNA expression in the BGF group was
significantly higher than that in the HC group (Fig. 4B).
Therefore, it is possible that BGF attenuates the action of
SHP, and this attenuation enhances the action of CYP7A1
through LRH-1. Consequently, the enhancement may reduce
the level of serum cholesterol by promoting the catabolism
of blood cholesterol to bile acids in the liver. Our study is the
first to show that BGF could be associated with the
regulation of bile acids metabolism through the FXR/SHP
pathway. Moreover, a recent study has shown that LRH-1
A SHP
Relative mRNA level
BGF enhancement of bile acid synthesis and enterohepatic
trafficking of cholesterol by BGF intake may also alter the
serum levels of HDL-C as well as those of LDL-C. The up-
regulation of bile acid synthesis and enterohepatic traffick-
ing of cholesterol by BGF perhaps increases the intake of
cholesterol into the liver and leads to a decreased HDL-C
level. Further investigations on the molecular mechanism for
BGF-induced hypocholesterolemic action are needed.
In conclusion, this study demonstrated that BGF not only
decreased the reabsorption of bile acids but also altered the
hepatic expression of genes associated with bile acids
metabolism to improve blood cholesterol levels. Therefore,
we accepted our hypothesis. Furthermore, our study showed
that the BGF-induced hypocholesterolemic mechanism
could result from promoting the conversion of cholesterol
to bile acids induced by CYP7A1 up-regulation through
down-regulation of the FXR/SHP pathway in the liver. This
study shows that BGF could prevent hypercholesteremia
and cardiovascular diseases and partially provides insight
into the molecular mechanism involved in the cholesterol-
lowering properties of BGF. A description of the hypocho-
lesterolemic mechanisms of BGF would undoubtedly stim-
ulate the use of bitter gourds as functional foods that have
beneficial effects on human health. However, the obvious
limitation of this study is that we only analyzed the gene
profiles of the target proteins. Further studies are needed to
better describe the level and activity of the proteins
involved in the enterohepatic circulation of bile acids in

3 a
the liver and intestine.
2
ab
1 b Acknowledgment

0 This study was supported by Tokyo University of Agriculture.

NF HC BGF

B LRH-1 REFERENCES
Relative mRNA level

1.5
a
a [1] Guilbert JJ. The World Health Report 2002reducing risks,
1 promoting healthy life. Educ Health (Abingdon) 2003;16:230.
b
[2] Teramoto T, Sasaki J, Ueshima H, Egusa G, Kinoshita M,
0.5 Shimamoto K, et al. Executive summary of Japan Athero-
sclerosis Society (JAS) guideline for diagnosis and prevention
0 of atherosclerotic cardiovascular diseases for Japanese.
NF HC BGF J Atheroscler Thromb 2007;14:4550.
Groups [3] Yusuf S, Anand S. Cost of prevention. The case of lipid
lowering. Circulation 1996;93:17746.
Fig. 4 Effect of BGF intake on the mRNA levels of hepatic SHP [4] Chen ZY, Jiao R, Ma KY. Cholesterol-lowering nutraceuticals
and functional foods. J Agric Food Chem 2008;56:876173.
and LRH-1 in rats. Real-time PCR was performed as described
[5] Jayasooriya AP, Sakono M, Yukizaki C, Kawano M, Yamamoto
(see Methods and materials). The mRNA levels of SHP (A) and
K, Fukuda N. Effects of Momordica charantia powder on
LRH-1 (B) are expressed relative to those of -actin. Data are serum glucose levels and various lipid parameters in rats
represented as the mean SE (n = 5). Bars with different fed with cholesterol-free and cholesterol-enriched diets.
letters indicate significant differences (P < .05). J Ethnopharmacol 2000;72:3316.
 N U TR IT ION RE S E ARCH 3 3 ( 2 0 13 ) 58 0 5 8 5
[6] Ahmed I, Lakhani MS, Gillett M, John A, Raza H. Hypotrigly-
ceridemic and hypocholesterolemic effects of anti-diabetic
Momordica charantia (Karela) fruit extract in streptozotocin-
induced diabetic rats. Diabetes Res Clin Pract 2001;51:15561.
[7] Keller AC, Ma J, Kavalier A, He K, Brillantes AM, Kennelly EJ.
Saponins from the traditional medicinal plant Momordica
charantia stimulate insulin secretion in vitro. Phytomedicine
2011;19:327.
[8] Pandak WM, Schwarz C, Hylemon PB, Mallonee D, Valerie K,
Heuman DM, et al. Effects of CYP7A1 overexpression on
cholesterol and bile acid homeostasis. Am J Physiol Gastro-
intest Liver Physiol 2001;281:87889.
[9] Sievanen E. Exploitation of bile acid transport systems in
prodrug design. Molecules 2007;12:185989.
[10] Gupta S, Pandak WM, Hylemon PB. LXR is the dominant
regulator of CYP7A1 transcription. Biochem Biophys Res
Commun 2002;293:33843.
[11] Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore
LB, et al. A regulatory cascade of the nuclear receptors FXR,
SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell
2000;6:51726.
[12] American Institute of Nutrition. Report of the American
Institute of Nutrition ad hoc committee on standards for
nutritional studies. J Nutr 1977;107:13408.
[13] Udagawa H, Kitaoka C, Sakamoto T, Kobayashi-Hattori K,
Oishi Y, Arai S, et al. Increase of serum cholesterol levels by
heat-moisturetreated high-amylose cornstarch in rats fed a
high-cholesterol diet. Lipids 2008;43:695702.
[14] Folch J, Lees M, Sloane SGH. A simple method for the isolation
and purification of total lipids from animal tissues. J Biol
Chem 1957;226:497509.
585
[15] Onoyama I, Suzuki A, Matsumoto A, Tomita K, Katagiri H,
Oike Y, et al. Fbxw7 regulates lipid metabolism and cell fate
decisions in the mouse liver. J Clin Invest 2011;121:34254.
[16] Chomczynski P, Sacchi N. Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-
chloroform extraction. Anal Biochem 1987;162:1569.
[17] Yamane T, Kobayashi-Hattori K, Oishi Y, Takita T. High-fat
diet reduces levels of type I tropocollagen and hyaluronan in
rat skin. Mol Nutr Food Res 2010;54:5361.
[18] Wang YM, Zhang B, Xue Y, Li ZJ, Wang JF, Xue CH, et al. The
mechanism of dietary cholesterol effects on lipids metabo-
lism in rats. Lipids Health Dis 2010;9:4.
[19] Yazdanparast R, Bahramika S. Evaluation of the effect of
Anethum graveolens L. crude extracts on serum lipids and
lipoproteins profiles in hypercholesterolaemic rats. DARU J
Pharm Sci 2008;16:8894.
[20] Istvan ES. Structural mechanism for statin inhibition of 3-
hydroxy-3-methylglutaryl coenzyme A reductase. Am Heart J
2002;144:2732.
[21] Freeman LA, Kennedy A, Wu J, Bark S, Remaley AT,
Santamarina-Fojo S, et al. The orphan nuclear receptor LRH-1
activates the ABCG5/ABCG8 intergenic
promoter. J Lipid Res 2004;45:1197206.
[22] Remaley AT, Bark S, Walts AD, Freeman L, Shulenin S, Annilo
T, et al. Comparative genome analysis of potential regulatory
elements in the ABCG5-ABCG8 gene cluster. Biochem Biophys
Res Commun 2002;295:27682.
[23] Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC,
et al. Overexpression of ABCG5 and ABCG8 promotes biliary
cholesterol secretion and reduces fractional absorption of
dietary cholesterol. J Clin Invest 2002;110:67180.