Sie sind auf Seite 1von 1838

1

2013
H2 BIOLOGY
1 ANGLO - CHINESE 2013
2 ANDERSON 2013
3 CATHOLIC JC 2013
4 DUNMAN 2013
5 ST. ANDREW'S 2013
6 HWA CHONG INSTITUTION 2013
7 INNOVA JC 2013
8 JURONG JC 2013
9 MILLENNIA INSTITUTE 2013
10 MERIDIAN 2013
11 NATIONAL JC 2013
12 NANYANG 2013
13 PIONEER 2013
14 RAFFLES INSTITUTION 2013
15 RIVER VALLEY 2013
16 SERANGOON 2013
17 TAMPINES 2013
18 YISHUN 2013
2
3

ANGLO-CHINESE JUNIOR COLLEGE


Preliminary Examination 2013

BIOLOGY 9648/01

HIGHER 2 20 September 2013

Paper 1 Multiple Choice 1 hour 15 minutes

Additional Material: Multiple Choice Answer Sheet

READ THESE INSTRUCTIONS FIRST

Write in soft pencil.


Do not use staples, pencil clips, highlighters, glue or correction fluid.
Write your name, Centre number and index number on the Answer Sheet provided.

There are forty questions in this paper. Answer all questions. For each question there are four
possible answers, A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate
answer sheet.

Read the instructions on the Answer Sheet very carefully.

Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.

Calculators may be used.

This question paper consists of 23 printed pages.

ACJC 9648/01/Prelim 2013 [Turn Over


4
2

1 If the cell shown below has been cultured in an environment where the source of nitrogen
provided is labelled radioactively, in which of the following labelled regions would we
expect to find high radioactivity?
S

A S and T only
B T and U only
C S, T and U only
D S, T, U and V

2 Which row of molecules found in the cell surface membrane have their corresponding roles
listed?

Act as receptor Form hydrogen Allow passage Cell to cell


sites for bonds with water of ions adhesion and
hormones recognition
Glycoproteins and Phospholipids Glycoproteins Glycoproteins
A
glycolipids and glycoproteins and glycolipids and glycolipids
Glycoproteins Phospholipids Glycoproteins Glycoproteins
B
and proteins and glycoproteins and proteins and glycolipids
Glycoproteins Glycoproteins Glycoproteins Glycoproteins
C
and phospholipids and glycolipids and glycolipids and cholesterol
Glycoproteins Glycoproteins Glycoproteins Glycoproteins
D and glycolipids and cholesterol and and cholesterol
phospholipids

ACJC 9648/01/Prelim 2013 [Turn Over


5
3

3 During the production of fruit juice, enzymes are used to break down the components of
cell walls. Which carbohydrate will be produced by this hydrolysis?

A Sucrose
B Maltose
C - glucose
D - glucose

4 Two enzyme experiments were carried out. The first, experiment X, was carried out at a
constant temperature of 37oC. During the second experiment, Y, the temperature was
increased from 37oC to 80oC.

Which graph shows the results?

ACJC 9648/01/Prelim 2013 [Turn Over


6
4

5 A cell in the G1 phase has two homologous pairs of chromosomes. It then undergoes a
mitotic division, followed by meiosis. At the end of meiosis II, what is the total number of
chromosomes and gene loci found in all the daughter cells formed?

A 8 chromosomes and 4 times as many gene loci as the original parent cell
B 8 chromosomes and 8 times as many gene loci as the original parent cell
C 16 chromosomes and 4 times as many gene loci as the original parent cell
D 16 chromosomes and 8 times as many gene loci as the original parent cell

6 The graph represents the changes in the DNA content within a cell at different stages in the
cell cycle.

DNA
content in
a cell/
arbitrary
unit

Name the events occurring at P, Q and R, and identify the stage where meiosis is
occurring.

P Q R Meiosis occurring
at
A S phase Fertilisation Cytokinesis Y

B Fertilisation Interphase Cytokinesis Z

C S phase Prophase Telophase Y

D Fertilisation Metaphase Telophase Z

ACJC 9648/01/Prelim 2013 [Turn Over


7
5

7 The RNA triplet UAG acts as a stop codon terminating the synthesis of a polypeptide. The
diagram shows a template strand of DNA which codes for four amino acids.

Where would a mutation, introducing a thymine nucleotide, result in the termination of


translation?

3 T C C A C A C G A T G C 5

A B C D

8 Part of the amino acid sequences in normal and sickle cell haemoglobin are shown.

Normal haemoglobin sickle cell haemoglobin


-thr-pro- glu-glu -thr-pro-val-glu

Possible mRNA codons for these amino acids are

glutamine (glu) GAA GAG proline (pro) CCU CCC


threonine (thr) ACU ACC valine (val) GUA GUG

Which tRNA molecule is not involved in the formation of this part of the sickle cell
haemoglobin?

9 Haemoglobin is a globular protein consisting of four polypeptide chains two alpha chains
and two beta chains. In normal individuals, the gene for beta chain codes for glutamic acid
at the sixth triplet.

In individuals with sickle cell anaemia, this base triplet is changed and codes for valine.

Which aspect of the haemoglobin molecule does this mutation directly affect?

A the iron content


B the primary structure
C the quaternary structure
D the secondary structure

ACJC 9648/01/Prelim 2013 [Turn Over


8
6

10 Which of the following statements about the HIV is not true?

A The viral nucleotides contain ribose.


B HIV contains uracil, not thymine.
C gp 120 and gp 41 enable HIV to enter host by fusion.
D HIV makes the host cell produce reverse transcriptase.

11 How do viruses cause disease in animals?

I They inhibit normal host cell DNA, RNA or protein synthesis.

II They disrupt and inactivate the tumor suppressor genes of the host cell causing
uncontrolled cell division.

III They disrupt and inactivate the oncogenes of the host cell causing uncontrolled cell
division.

IV Their viral proteins and glycoproteins on the surface membrane of host cells cause
them to be recognized and destroyed by the bodys immune system.

V They deplete the host cell of cellular materials essential for metabolic functions.

A I, II and V
B I, II, III and V
C I, II, IV and V
D All of the above

12 A bacterial cell can transfer DNA during conjugation when it

A contains an F factor.
B has been infected by a bacteriophage.
C is virulent.
D integrates into host chromosome.

ACJC 9648/01/Prelim 2013 [Turn Over


9
7

13 When the lac operon for lactose metabolism is switched off, which of the following genes
would still be expressed?

I -galactosidase gene

II RNA polymerase gene

III CAP gene

IV Repressor gene

A I and II
B I and III
C II, III and IV
D All of the above

14 Which of the following statements correctly describes the control of transcription for genes
in a lac operon?

A The genes are transcribed as a single transcription unit, with each gene having its own
promoter.
B Methylation of DNA causes the DNA to be tightly packed, hence RNA polymerase will
not have access to the promoter region.
C The genes have control elements such as enhancers that enable activators to bind,
hence affecting the rate of transcription.
D The genes are found next to one another on the same chromosome, and repressor
proteins act as a form of transcriptional control.

15 Housekeeping genes are expressed all the time in all cells, whereas other non-essential
genes are expressed only when needed. Under certain conditions, gene expression of
selected genes can be increased.

Which of the following will increase gene expression in a eukaryotic cell?

A A chemical is added which will increase the activity of enzyme poly-A polymerase.
B Alternative splicing links different combinations of exons together in mRNA.
C Histone methylation results in the formation of heterochromatin.
D Activator proteins will bind to silencers to speed up the rate of transcription.

ACJC 9648/01/Prelim 2013 [Turn Over


10
8

16 Gene expression in eukaryotes can be regulated at the translational level.

Which combination of statements correctly describes eukaryotic translational control?

Condition Effect
Lack of translation initiation factor Inhibition of translation of selected
A
proteins mRNA
Presence of repressor proteins binding Prevents small ribosomal subunit
B
to 5-UTR of selected mRNA from binding
Presence of repressor proteins to distal
C mRNA is translationally-repressed
control elements
mRNA is degraded slowly by
D mRNA with a long poly-A tail
restriction endonuclease

17 A human papillomavirus (HPV) infection may cause cervical cancer in women. Which of the
following is not a reasonable explanation for cancer development caused by HPV infection?

A HPV integrates its viral genes into host cells genome.

B HPV may carry oncogenes that promote cell division.


C HPV may induce apoptosis of host cells.
D HPV promotes ubiquitination of p53 protein.

ACJC 9648/01/Prelim 2013 [Turn Over


11
9

18 After explaining about cell structure, DNA, chromosomes, telomeres and centromeres in
great detail during lectures and tutorials, a teacher decided to conduct a simple test to
determine the level of understanding in students. The following statements were observed in
the students scripts.

I Telomeres shorten after every cell division as a result of the end-replication


problem in eukaryotic cells.

II Telomeres are only found in eukaryotic chromosomes, since the prokaryotic


chromosome is circular and not linear.

III Centromeres are the protein molecules found at right angles to each other
in centrosomes, and they are absent in plant cells.

IV Telomerase is the enzyme that degrades telomeres, hence telomerase


gene is switched off in adult somatic cells.

Which of the students statements are correct?

A I and II only
B III and IV only
C I, II and IV only
D All of the above

ACJC 9648/01/Prelim 2013 [Turn Over


12
10

19 A genetic disorder causes degeneration of muscle tissue in humans. The diagram shows
the inheritance of such a genetic disorder in one family.

affected male

affected female

Which of the following statements can be concluded based on the diagram above?

A Individual 5 was affected with the genetic disorder as a result of genetic mutation
during his lifetime.
B Individual 10 should be an affected male too, since his brother (individual 11) was
affected with the genetic disorder.
C This genetic disorder is a sex-linked recessive trait.
D This genetic disorder is due to an autosomal dominant allele.

ACJC 9648/01/Prelim 2013 [Turn Over


13
11

20 A plant researcher tried to investigate a cross between two heterozygous Snapdragon


plants that produced red flowers. She predicted three possible phenotypic outcomes,
namely plants with white flowers, pink flowers and red flowers, with a phenotypic ratio of
4:3:9 respectively. When the cross was performed, she found 50 plants with white flowers
only, 41 plants with pink flowers, and 85 plants with red flowers. A chi-squared test was
performed, and the chi-squared value was calculated to be 4.74.

Probability, P
Degree of
freedom
0.10 0.05 0.02 0.01 0.001
1 2.71 3.84 5.41 6.64 10.83
2 4.61 5.99 7.82 9.21 13.82
3 6.25 7.82 9.84 11.35 16.27
4 7.78 9.49 11.67 13.28 18.47

Which of the following statements is correct?

A The degree of freedom is 3.


B The calculated chi-squared value is greater than the critical chi-squared value.
C There is a high probability that the difference between the observed and expected
values is due to chance.
D The probability that the difference between observed and expected values is due to
chance is less than 5%.

21 A PhD student performed a cross between a pure-breeding plant that bore white flowers,
and another pure-breeding plant that also bore white flowers. All the F1 plants obtained
bore purple flowers. Upon selfing the F1 plants, a F2 phenotypic ratio of 9 purple flowers: 7
white flowers was obtained. Gene A codes for the production of enzyme A, and gene B
codes for enzyme B. The diagram below shows the metabolic pathway involved.

Enzyme A Enzyme B
White pigment White pigment Purple pigment

Which of the following statements cannot be deduced from the above information?

A The parental pure-breeding plants must have the genotype AAbb and aaBB.
B Gene A is epistatic to gene B.
C Genes A and B are found on the same chromosome.
D All the F1 plants have the genotype AaBb.

ACJC 9648/01/Prelim 2013 [Turn Over


14
12

22 A genetic cross was performed between two heterozygous Drosophila fruit flies with normal
wings and red eyes. The allele for normal wings is dominant to the allele for vestigial wings,
and the allele for red eyes is dominant to the allele for white eyes.

What is the probability of obtaining offspring that are pure-breeding?

A 1 out of 16
B 3 out of 16
C 4 out of 16
D 9 out of 16

23 Which of the following statement(s) is/are correct?

I Polygenic inheritance is when a single phenotype is controlled by two or more sets


of alleles.

II The effect of environment has minimal influence in the expression of phenotype in


polygenic inheritance.

III Polygenic inheritance results in distribution of phenotypes that follow a normal


distribution curve.

A I only
B I and II only
C I and III only
D All of the above

24 Which of the following statements correctly compares oxidative phosphorylation and non-
cyclic photophosphorylation?

A Both types of phosphorylation produce ATP and oxygen as end products.


B Both types of phosphorylation produce ATP and the reduced form of a redox reagent.
C Oxidative phosphorylation is involved in the conversion of one form of chemical energy
to another while non-cyclic photophosphorylation is involved in converting light energy
to chemical energy.
D Water is an electron donor in non-cyclic photophosphorylation while it is an electron
acceptor in oxidative phosphorylation.

ACJC 9648/01/Prelim 2013 [Turn Over


15
13

25 14
C-labelled carbon dioxide was supplied to photosynthesising algae. The relative amounts
of three organic compounds were measured. The diagram shows the results.

Relative amount
of substance /
arbitrary units

Which of the following are correct explanations for the graph above?

I GP level falls as shown in graph 2 due to the absence of reduced NADP when light is
switched off.
II GP level rises as shown in graph 1 due to the absence of ATP when light is switched
off.
III Levels of RuBP and GP are constant during periods of light as they serve as
intermediates in the Calvin cycle.
IV RuBP level falls as carboxylation of RuBP is independent of light as shown in graph 3.
V Sucrose level falls as shown in graph 3 due to the absence of ATP and reduced
NADP.

A I, II and V only
B I, II and III only
C II, III and IV only
D III, IV and V only

ACJC 9648/01/Prelim 2013 [Turn Over


16
14

26 The diagram below represents a cell surface membrane.

Which biomolecules shown above are amphipathic?

A 1, 2 and 4 only
B 1, 2 and 3 only
C 2 and 3 only
D 3 and 4 only

27 The diagram below shows the cell signalling pathway involving a growth factor receptor.

From the given diagram, which step is involved in the role of signal amplification?

A Binding of L1 to Re1 and Re2


B Cross phosphorylation of Re1 and Re2
C Phosphorylation of ERK by MEK
D Dephosphorylation by protein phosphatase

ACJC 9648/01/Prelim 2013 [Turn Over


17
15

28 The diagram below shows the events of an action potential.

Which of the following statements are correct?

I. Events 1 to 5 occur in the synaptic knob during the transmission of an action potential
across the synapse.
II. Event 3, 4 and 5 are critical to ensure that the action potential travels unidirectionally
across a synapse.
III. Event 5 prevents a weak signal from initiating an action potential.
IV. Event 1 is necessary for an impulse to be transmited along an axon.

A I and II only
B I and III only
C II and IV only
D III and IV only

29 Which of the following statements does not correctly compare the neutral theory of
molecular evolution and natural selection?

A Neutral theory of molecular evolution accounts for most of the differences that we
observe at the phenotypic level as compared to natural selection.
B Neutral theory of molecular evolution accounts for most of the differences that we
observe at the genotypic level as compared to natural selection.
C The rate of change in the nucleotide sequence brought about by neutral theory of
molecular evolution occurs at a constant rate due to random chance events while the
rate of change brought about by natural selection can be fast or slow depending on the
strength of the selection pressure.
D Neutral theory of molecular evolution is largely responsible for the RFLP that we
observe between species as compared to natural selection.

ACJC 9648/01/Prelim 2013 [Turn Over


18
16

30 The figure below shows the alignment of amino acid residues of the alpha haemoglobin
chain of the cow and the sheep. There are a total of 142 amino acid residues in both the
alpha chain of the cow and sheep. Regions of polypeptide that form an alpha helix are
underlined while positions where amino acid residues differ between the cow and the
sheep alpha haemoglobin chain are marked with an arrow.

Amino Amino
acid acid
position position
Cow
Sheep

Cow
Sheep

Cow
Sheep

Which of the following statements can be concluded from the diagram shown above?

I. Differences between the amino acid residues between the 2 polypeptides are due to
neutral mutation brought about by the degeneracy of the genetic code.
II. Differences between the amino acid residues between the 2 polypeptides are due to
neutral mutation brought about by mutations in the introns.
III. Natural selection is one of the main driving forces that bring about the differences
between the 2 polypeptides.
IV. Differences between the amino acid sequences did not change the secondary
structure of protein.

A I and II only
B I and III only
C II and IV only
D III and IV only

ACJC 9648/01/Prelim 2013 [Turn Over


19
17

31 The diagram below shows the blood glucose concentration of two persons after eating a
meal.

How can the levels of blood glucose concentrations in Jack and Jill be best explained?

I. Jack and Jill both had insulin released into their bloodstream by their pancreas after
the meal.
II. The number of glucose transporter in the cell surface membrane of the muscle cells
increased in Jill but not in Jack.
III. Lowering of blood glucose level in Jack is brought about by utilisation of glucose in
respiration and excretion through urine.
IV. Jack must have type II diabetes while Jill is a healthy individual.

A I and II only
B II and III only
C I and IV only
D II, III and IV only

ACJC 9648/01/Prelim 2013 [Turn Over


20
18

32 The figure below shows the phylogeny of selected primates and their lice which live on
them. The dotted lines indicate the host of the respective lice.

Which of the following statement(s) can be concluded from diagram above?

I. The common ancestor of Pediculus humanus and Pediculus schaeffi underwent


allopatric speciation after the divergence of chimpanzee and humans.
II. Pithrus pubis and Pediculus humanus underwent sympatric speciation on the human
host.
III. Pithrus pubis and Pediculus humanus are reproductively isolated from each other due
to their ecological niches.
IV. Gorillas and humans once stayed in close physical proximity, allowing pubic lice to
change host.

A I only
B I and II only
C II and III only
D I, III and IV only

ACJC 9648/01/Prelim 2013 [Turn Over


21
19

33 The figure below shows how a metalmark moth mimics a jumping spider. It does so by
having hairs on both its hind wings and forewings.

Which of the following statements best explains the evolution of spider mimicry in
metalmark moth?

A Moths mutate their genes to grow hairs on their wings in order to escape predation.
B Moths develop hairs on their wings to mimic spiders.
C Moths with hairs on their wings leave behind a higher proportion of offspring than
moths without hairy wings.
D Moths with hairy wings experience a higher selection pressure than moth without hairy
wings.

34 During the process of polymerase chain reaction (PCR), the amount of DNA synthesised
can be traced using fluorescent probes and the measurements are shown in the following
plot. The process initially goes through an exponential phase, followed by a plateau phase
eventually.

Amount
of DNA/
arbitrary
units

Number of cycles
Which of the following statements is true?

A During the exponential phase, the number of DNA molecules synthesized after 15
cycles is 152.
B During the exponential phase, the temperature is always maintained at the optimum
temperature of 72oC hence there is rapid amplification.
C During the plateau phase, the reaction mixture is being depleted of ribonucleotides.
D During the plateau phase, Taq polymerase may be denatured.

ACJC 9648/01/Prelim 2013 [Turn Over


22
20

35 The insulin hormone is made up of two different polypeptide chains, A-chain and B-chain,
joined together by disulphide bonds. The human insulin gene codes for both polypeptide
chains. To produce the insulin hormone using E. coli, cDNA coding for each polypeptide
chain are inserted into separate plasmids and used to transform separate batches of
bacteria. The synthesised polypeptide chains are then mixed together to form the hormone.

Disulphide bond

Which one of the following reasons explains why the two chains have to be produced
separately?

A Bacterial RNA polymerases cannot recognise eukaryotic promoters.


B Bacterial cells are not able to carry out post-translational modification of insulin.
C Bacterial cells are unable to excise introns from eukaryotic RNA.
D Bacterial ribosomes can only translate polycistronic mRNA.

ACJC 9648/01/Prelim 2013 [Turn Over


23
21

36 A family with a history of a genetic disease is studied using restriction fragment length
polymorphism (RFLP) analysis. The mutation responsible for the disease allele produces a
RFLP which can be detected by Southern blotting using an appropriate probe. The
pedigree chart of the family is aligned with the autoradiogram obtained from Southern
blotting. (Shaded symbols in the pedigree chart indicate individuals affected by disease.)

Pedigree
chart

Autoradiogram

Based on the information given, which of the following can be deduced?

A The disease allele is dominant to the normal allele.


B The mutation creates a new restriction site in the affected gene.
C One of the parents in generation I is a carrier.
D The offspring in generation II is a carrier.

37 The Human Genome Project (HGP) has brought about great advancements in health and
medicine. Which of the following applications is not a result of the knowledge gained from
the HGP?

A Designing of new antibody-based medicines which target proteins coded for by


oncogenes.
B Determining whether an individual is a suitable candidate for working in a nuclear
power plant due to a genetic predisposition to cancer.
C Predicting whether an individual may suffer adverse side effects from taking a
particular medicine due to the individuals inability to break down the medicine.
D Testing the gender of a fetus by detecting the presence or absence of the fetal Y
chromosome in maternal blood.

ACJC 9648/01/Prelim 2013 [Turn Over


24
22

38 The following diagram shows how a stem cell can differentiate into different specialized cell
types.

Which of these statements is false with regards to the stem cells shown?

A The stem cells are multipotent.


B The stem cells can be found in both a fetus and an adult body.
C The stem cells can differentiate into the three germ layers in the adult body.
D The stem cells may be used in a bone marrow transplant to treat a patient with
leukemia, a form of blood cancer.

39 Cholera is a disease caused by the bacteria Vibrio cholerae and is characterised by


incessant diarrhoea and vomiting. Scientists have discovered a way to genetically modify
rice plants such that these plants can produce part of the cholera toxin, which acts as a
vaccine when consumed. Which statement is not a valid social or ethical implication of
such edible vaccines?

A The mass production of edible vaccines by rice plants lowers production costs
compared to traditional pharmaceutical vaccines.
B The genes coding for the cholera toxin may spread to wild plant species through cross-
pollination, causing the development of superweeds.
C Antibiotic resistance marker genes used in the process of cloning the cholera toxin
gene may lead to the development of antibiotic resistance in gut bacteria.
D The insertion of a foreign gene into the rice plant genome may lead to the production
of unknown toxic components.

ACJC 9648/01/Prelim 2013 [Turn Over


25
23

40 The following diagram shows one method where gene therapy can be used to treat cystic
fibrosis. Inactivated adeno-associated virus (AAV) is used to introduce the normal gene into
lung epithelial cells.

Which statement correctly describes the procedure shown?

A An ex vivo mode of therapy is used.


B Effects of the treatment by the inserted gene will not be permanent.
C Somatic stem cells are specifically targeted by the virus.
D Introduction of the normal gene into the host cell is less efficient using this method
compared to using a liposomal vector.

End of Paper

ACJC 9648/01/Prelim 2013 [Turn Over


26

ACJC Prelim 2013


H2 Biology Paper 1 (9648/01) Answers

Question Answer Question Answer

1 B 21 C

2 B 22 C

3 D 23 C

4 A 24 C

5 C 25 C

6 B 26 C

7 B 27 C

8 D 28 D

9 B 29 A

10 D 30 D

11 C 31 B

12 A 32 D

13 C 33 C

14 D 34 D

15 A 35 B

16 B 36 A

17 C 37 D

18 A 38 C

19 C 39 B

20 C 40 B
27

Subject
Name Class Class Index Number
2BI

ANGLO-CHINESE JUNIOR COLLEGE


Preliminary Examination 2013

BIOLOGY 9648/03

Applications Paper and Planning Question


3 Sept 2013
PAPER 3 2 hours

Additional Materials: Writing Paper

READ THESE INSTRUCTIONS FIRST

Write your name, subject class, form class and index number on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagrams, graphs or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.

Answer all questions.

At the end of the examination, fasten your work securely together.


The number of marks is given in brackets [ ] at the end of each question or part question.

FOR EXAMINERS USE

TOTAL
72

This document consists of 16 printed pages.

ACJC 9648/03 Prelim 2013


28
2 For
Examiners
Use

1. Embryonic stem (ES) cells are highly regarded in research because their pluripotency offers the
potential for a wide range of therapeutic and research applications. However, ethical concerns
have been raised with regards to the source of ES cells.
Scientists have come up with an alternative method of generating pluripotent cells, which is to
genetically reprogramme adult cells to an embryonic stem cell-like state. Genetic reprogramming
is carried out by using deactivated retroviruses to introduce the genes of four transcription factors
into adult cells from a patient (Fig. 1.1).The reprogrammed cells, called induced pluripotent stem
(iPS) cells, are specific to the patient from which the adult cells were taken.

Fig. 1.1

(a) (i) Describe what is meant by the term pluripotent.

It describes the potential of a cell to become/differentiate into any cell type in the

adult body but not those of the extra-embryonic membranes; @ 1m [1]

(ii) Suggest one reason why the use of iPS cells evades the ethical concerns regarding the
source of ES cells.

Ref. to iPS uses adult cells, whereas obtaining ES cells involves the destruction

of embryos; @ 1m [1]

ACJC 9648/03 Prelim 2013 [Turn over


29
3 For
Examiners
Use

(iii) Give three reasons why deactivated retroviruses are used for genetic reprogramming of
the adult cells rather than active retroviruses or liposomes.

*1. deactivated because they will not cause disease/will not become virulent;
2. retoviruses allow for integration of genes into host genome while liposomes
do not;
3. retroviruses are more efficient at delivering genes into the host cell than
liposomes because they target specific cells;

*required for full marks


[3]

(iv) Suggest how the expression of such a small number of transcription factors in adult cells
could genetically reprogramme these adult cells to an embryonic stem cell-like state.

1. Each transcription factor can activate the transcription of multiple genes;


2. Each gene in turn could code for a transcription factor which activates other
genes;

3. The genes switched on are those expressed in pluripotent/ES cells;


4. e.g. telomerase gene/ genes which promote cell division/ genes which cause
the cell to revert to undifferentiated state;
5. resulting in the synthesis of proteins which are found in ES cells;
6. The transcription factor could also inhibit gene expression;
7. e.g. genes which result in specialisation (are repressed);
@ 1m, max 3 [3]

ACJC 9648/03 Prelim 2013 [Turn over


30
4 For
Examiners
Use

Patient-specific iPS cells can be induced to differentiate into the affected diseased tissue as this
will allow the patient's disease to be modelled in vitro. Using this diseased tissue, potential drugs
to treat the disease can be screened for, aiding in the discovery of new drugs.

Scientists have managed to obtain iPS cells from cystic fibrosis (CF) patients with a mutation at
amino acid position 508 (F508). They have caused these iPS cells to differentiate into diseased
human lung tissue, which is now being used to screen for potential drugs to treat cystic fibrosis
caused by the F508 mutation (Fig. 1.2).

Fig. 1.2

Previously, a cell line comprising rat cells expressing recombinant human mutant CFTR protein
was used for screening purposes. This cell line was successfully used to identify a drug to treat
cystic fibrosis.

(b) (i) Explain the effect of the F508 mutation on the function of the CFTR protein.

1. Mutation results in the deletion of phenylalanine from CFTR protein;

2. resulting in change in tertiary/overall 3D shape change in structure;


3. The CFTR protein is unable to transport chloride ions across the
membrane/out of the cell;

[3]

ACJC 9648/03 Prelim 2013 [Turn over


31
5 For
Examiners
Use

(ii) Suggest and explain one advantage of using a drug to treat CF rather than to use
liposomes to deliver a functional copy of a CFTR gene.
1. easier to regulate dosage of drug/avoid using high concentrations of
liposomes which could be toxic;
2. using the drug avoids the problem that the CFTR gene may not be properly
expressed (to form the CFTR protein); [1]

(iii) Suggest and explain one advantage of using diseased lung tissue derived from human
iPS cells to screen for CF drugs rather than the use of rat cells expressing recombinant
human CFTR.
1. ref. to iPS cells are (human cells and are) more representative of the actual
diseased cell than rat cells e.g. rat cells may have different biochemical
2. ref. to iPS cells are patient-specific and could be used to screen for drugs
specific to that patient; [1]

[Total: 13]

ACJC 9648/03 Prelim 2013 [Turn over


32
6 For
Examiners
Use

2. Cysteine proteinase (CP) is an enzyme that is coded by the mir-1 gene, which is found in plants
that are naturally resistant to attacks by Lepidopteran larvae. Lepidopteran larvae feeding on the
Black Mexican Sweet (BMS) maize leaf tissue cause crop losses. In an attempt to increase the
yield of BMS maize, plant biologists have used genetic technology to transform the wild-type BMS
maize callus with mir-1 gene. The growth of larvae feeding on transformed and non-transformed
BMS maize calli was studied for seven days, and the experiment was repeated. The results are
shown in Fig. 2.1.

Fig. 2.1

(a) (i) Suggest one delivery method that could be used to introduce the mir-1 gene into BMS
maize callus.

[1]

(ii) With reference to Fig. 2.1, describe and explain the effectiveness of genetically engineered
BMS maize with mir-1 gene on larvae growth.

[3]

ACJC 9648/03 Prelim 2013 [Turn over


33
7 For
Examiners
Use

(b) An in vitro experimental study was performed to investigate the effects of transformed BMS
plant cells expressing both cysteine proteinase (CP) and Bacillus thuringiensis (Bt) toxin on
Lepidopteran larvae. Table 2.1 shows the relative growth rate and percentage mortality of
Lepidopteran larvae fed with maize cell lines containing CP, Bt-toxin and a combination of CP
and Bt-toxin.

Table 2.1

CP Bt-toxin CP+ Bt-toxin


Relative Growth Rate/ Arbitrary Units 0.333 0.568 0.220
Percentage Mortality/% 38.0 4.0 50.0

With reference to Table 2.1, describe the effects of maize plant cells expressing CP together
with Bt-toxin on the percentage mortality of Lepidopteran larvae.

[2]

(c) Both CP and Bt-toxin target the mid-gut lumen. Fig. 2.2 shows a cross section of mid-gut. CP is
known to damage the peritrophic protein matrix of mid-gut lumen in the larvae, a structure that
protects the mid-gut from microbial infection.

The mechanism of damage by Bt-toxin is different compared to that of CP. Bt-toxin is


converted to its active form in the alkaline mid-gut environment, which then binds to the
specific mid-gut receptors on the brush border membrane of mid-gut cells with very high
affinity, forming lytic pores that result in cell death.

Fig. 2.2

ACJC 9648/03 Prelim 2013 [Turn over


34
8 For
Examiners
Use

(i) With reference to Table 2.1, Fig. 2.2 and the information given, suggest how CP may
enhance the effect of Bt-toxin on Lepidopteran larvae.

[3]

(ii) Over many generations, laboratory populations of Lepidopteran larvae have evolved
resistance against Bt-toxins. Suggest and explain how this resistance is developed.

[2]

[Total: 11]

ACJC 9648/03 Prelim 2013 [Turn over


35
9 For
Examiners
Use

3. Fig. 3.1 below shows a schematic diagram of targeted gene replacement in a mammalian cell
involving the gene Ig M. Targeted Ig M gene replacement is a method of replacing Ig M mutated
allele (Fig. 3.1a) in the genome in a cell with wildtype allele (Fig. 3.1b) via crossing over, giving
rise to the recombinant DNA (Fig. 3.1c). The wildtype allele is carried by a linearised plasmid (Fig.
3.1b) and introduced into the cell.

As shown in Fig. 3.1b, the linearised plasmid contains an antibiotic resistance gene (Neo gene),
wildtype alllele with the exons represented by the black boxes, as well as several restrictions sites
in between the exons. In this technique, the enhancer of the Neo gene on the linearised plasmid
was removed prior to the therapy.

Ig M mutated alleleNhe1
Ava1
Sca1

Afl1

Enhancer Genomic Fig. 3.1 a


fragment
F primer
Region of crossing over
Hpa1
Ecor1

Aat1
Dra1
Kpn1

Neo gene
Linearized Fig. 3.1 b
Ig M wildtype allele plasmid
R primer
Hpa1
Aat1
Ava1

Dra1
Sca1

Enhancer Neo gene


Recombinant
Fig. 3.1 c
DNA

Fig. 3.1

Legend
Exon
Restriction sites on mutated allele Ava1, Sca1, Afl1, Nhe1
Restriction sites on wildtype allele Kpn1, Ecor1, Dra1, Aat1
Naturally occurring restriction site on Hpa1
linearised plasmid

(a) (i) Explain the significance of restriction enzyme in bacteria.

[1]

(ii) Although the mutated and wildtype alleles are homologous regions, different restriction
sites are present in them. Explain the presence of these different restriction sites.

[2]
ACJC 9648/03 Prelim 2013 [Turn over
36
10 For
Examiners
Use

(iii) With reference to Fig. 3.1, explain how the Neo gene allows the transformed cells with
recombinant DNA to be distinguished from the transformed cells which did not undergo
recombination in their DNA.

[4]

(iv) With reference to Fig. 3.1a and Fig. 3.1b, briefly describe another method how Hpa1 can
be used to verify the identity of cells with recombinant DNA.

[4]

(v) The wildtype IgM allele was isolated from a genomic DNA library and not a cDNA library
before being introduced into the linearised plasmid. With reference to Fig. 3.1, state one
evidence which suggests this.

[1]

ACJC 9648/03 Prelim 2013 [Turn over


37
11 For
Examiners
Use

(b) In the gene replacement therapy shown in Fig. 3.1, the site of DNA breakage occurred
between restriction sites Sca1 and Afl1 as shown in Fig. 3.1a. In another case of therapy, the
site of DNA breakage along the mutated allele was unknown. To determine the exact site of
crossing over between the genomic DNA and the linearised plasmid, RFLP analysis was
carried out on the recombinant DNA. The recombinant DNA was isolated from the
transformed cell and amplified using PCR via the forward and reverse primers as shown in Fig.
3.1a and Fig. 3.1b. The amplified DNA products were separated into eight tubes and digested
using eight restriction enzymes respectively: Ava1, Sca1, Afl1, Nhe1, Kpn1, Ecor1, Dra1, Aat1.
The products of digestions were separated using gel electrophoresis and the results are
shown in Fig. 3.2.

Ava1 Sca1 Afl1 Nhe1 Kpn1 Ecor1 Dra1 Aat1

Fig. 3.2

(i) With reference to Fig. 3.1 and 3.2, describe and explain the band pattern of the restriction
digest for the recombinant cell.

[3]

(ii) Hence identify the site of DNA breakage where crossing over took place in the mutated
allele.

[1]

[Total: 16]

ACJC 9648/03 Prelim 2013 [Turn over


38
12 For
Examiners
Use

Planning Question
4. Electroporation is a method which is routinely used to introduce foreign DNA into E. coli cells. This
involves subjecting a mixture of bacteria and plasmid to a brief electric pulse. You are required to
plan, but not carry out, an investigation into the effect of voltage on the efficiency of transformation
by electroporation.
In this investigation, the recombinant plasmid used to transform the E. coli cells is made up of two
components: the plasmid vector and the gene of interest. pGFP is a plasmid with two marker
genes, GFP and AmpR, and a number of restriction sites throughout the plasmid as shown in Fig.
4.1 below. GFP is a marker gene coding for the green fluorescent protein. Expression of GFP in
bacteria will cause bacteria to fluoresce under UV light. The gene of interest is the ras proto-
oncogene, which has been inserted into the plasmid using the restriction enzyme BmtI.

Fig. 4.1
An electroporator is a machine used to carry out electroporation. It is possible to vary the voltage
and length of the electrical pulse with this machine. The range of voltage used is typically 1400
2000 V and the length of electrical impulse between 4-6 ms. A voltage which is too high will cause
irreversible changes in membrane permeability. The mixture of bacteria and recombinant plasmid,
which must be kept on ice prior to electroporation, is put into a cuvette (Fig. 4.2) which is then
placed into a chamber in the electroporator (Fig. 4.3).
After electroporation, the mixture of bacteria must be quickly resuspended in SOC broth (a type of
growth medium) and incubated at 37C for 1 hour for the surviving cells to recover. This is then
followed by plating the bacteria on agar and incubation at 37C for 16-24 hours. The plates can
then be examined to calculate transformation efficiency.

Fig. 4.2
ACJC 9648/03 Prelim 2013 [Turn over
39
13 For
Examiners
Use

Fig. 4.3

Transformation efficiency can be calculated using the following equation: -

Transformation efficiency / cfu g1 = Total number of colonies on agar plate

[cfu: colony forming unit] Amount of DNA plated (in g)

Your planning must be based on the assumption that you have been provided with the following
equipment and materials which you must use:
Microcentrifuge tubes of 100 l E. coli cells in electroporation buffer
Microcentrifuge tubes of 1 l recombinant DNA (concentration of 0.1 g / l)
Microcentrifuge tubes of 1 l sterile water
Ice bucket with ice
Electroporator
Sterile cuvettes for electroporation (max. volume of 150l)
Agar plates with ampicillin
Sterile spreader for spreading bacterial culture on agar plate
SOC broth
Incubator
UV transilluminator (a device which emits UV light)
UV shields which provide protection from UV light
A variety of micropipettes, sterile micropipette tips and sterile 2 ml microcentrifuge tubes

Your plan should have a clear and helpful structure to include


an explanation of the theory to support your practical procedure
a description of the method used, including the scientific reasoning behind the method, a
control experiment and any recommended safety measures
an explanation of the dependent and independent variables involved
relevant, clearly labelled diagram/s showing selection of the recombinant bacteria on plates
how you will record your results and ensure that they are as accurate and reliable as possible
proposed layout of results tables and graphs with clear headings and labels
the correct use of technical and scientific terms

[Total: 12]

ACJC 9648/03 Prelim 2013 [Turn over


40
14 For
Examiners
Use

ACJC 9648/03 Prelim 2013 [Turn over


41
15 For
Examiners
Use

ACJC 9648/03 Prelim 2013 [Turn over


42
16 For
Examiners
Use

Free-response question

Write your answers to this question on the separate paper provided.

Your answer:

should be illustrated by large, clearly labelled diagrams, where appropriate.


must be in continuous prose, where appropriate.
must be set out in sections (a), (b) etc., as indicated in the question.

5. (a) Describe and explain how bacteria can be used to mass produce human insulin without the
use of any DNA libraries. [7]

(b) Discuss the advantages and the limitations of the Polymerase Chain Reaction. [5]

(c) Discuss the implications of the Human Genome Project, including the benefits and difficult
ethical concerns for humans. [8]

[Total: 20]

ACJC 9648/03 Prelim 2013 [Turn over


43

1 (a) Fig 1.1 shows the protein structure of the enzyme cellulase, which is found in animals
feeding on grass such that they can digest the cellulose found in grass.

Fig. 1.1

(i) Name structure A and describe how it is formed.


1. -pleated sheet;

2. is made up of different sections of the polypeptide chain that run alongside


each other/ are antiparallel;
3. Adjacent strands are held together by hydrogen bonds formed between CO
and NH groups (of the polypeptide backbone) to form the sheet; @1m [3]

(ii) State two differences between the structures of cellulase and its substrate.
1. Made up of amino acids vs -glucose;

2. Peptide bond vs (1-4) glycosidic bond between monomers;

3. Ionic bonds, hydrophobic interactions and disulphide bonds(any 2 of 3) found


in the structure of cellulase but not its substrate;

4. No rotation of amino acids vs alternate -glucose rotated 180;

5. No crosslinks vs crosslinks between cellulose;

6. Globular vs fibrous; @ 1m, max 2


[2]

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


44
2 For
examiners
(iii) Briefly describe the mode of action of cellulase. use

1. Enzyme lowers activation energy;

2. Ref to acting as orientation surfaces/ ref to strain effect/ proximity effect/


microenvironment effect/ acid-base catalysis;

3. The (3D conformation of) substrate (e.g., cellulose) is complementary to the


active site of the enzyme, thus forming enzyme-substrate complexes;

E
4. With ref. to change in 3D conformation of enzyme for a better fit/ tighter
binding between substrate and enzyme;

5. Resulting in cleaving of glycosidic bond between -glucose;


[4]
@ 1m, max 4

(b) Collagen is a protein found extensively in connective tissue, bones, cartilage, dermis (skin),
blood vessels and teeth. It is a fibrous protein, and has a very distinct structure and function
from cellulase.

Describe two differences between the primary structures of collagen and cellulase.
1. Amino acid sequence in collagen is highly regular with repeating tripeptide
sequence while amino acid sequence in cellulase rarely shows regularity;
2. Amino acid sequence in collagen may vary between two samples of collagen;
while amino acid sequence in cellulase is highly specific;
3. Length of polypeptide chain varies in collagen while length of polypeptide chain For
seldom varies in cellulase; Examiner's
Use
4. More amino acids make up collagen while less amino acids make up cellulase; For
5. Modified amino acids such as hydroxylysine and hydroxyproline are found in Examiner's
Use
collagen but not cellulase;

@ 1 m per comparison, max 2 [2]

[Total: 11]

2 Matrix metalloproteinase-13 (MMP-13) gene is found on chromosome 11 in humans. It codes for


MMP-13, an enzyme that is involved in the breakdown of extracellular matrix proteins such as
collagen, in normal physiological processes. During inflammation, a protein, AP1, is activated
and binds to a conserved DNA sequence about 20kb (kilobases) upstream of the MMP-13 gene
(Fig. 2.1) to increase (up-regulate) its expression. Histone modification is found to occur at the
stretch of DNA from the conserved DNA region to the transcribed region of the MMP-13 gene.
The AP1-bound conserved DNA region is also found to come into close proximity to the MMP-13
transcription start site.

Conserved DNA MMP-13 Gene

AP1 binding site

Fig. 2.1

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


45
3 For
examiners
(a) A gene is a region along a DNA molecule that codes for a specific sequence of amino use
acids in a polypeptide chain. Describe the structure of DNA.
1. Polymer of deoxyribonucleotides/composed of 4 types of deoxyribonucleotide
containing base thymine, cytosine, adenine and guanine;
2. two antiparallel polynucleotide strands/double helix;
3. ref to complementary base-pairing by hydrogen bonds / 3 H bonds bet G-C and
2 H bonds bet A-T/purine with pyrimidine/ref to 1:1 ratio;
4. width betw sugar-phosphate backbone constant and equals to the width of a

E
purine and a pyrimidine/2 nm wide;
5. One complete turn has 10 base pairs with length of 3.4 nm;
6. Phosphodiester bonds between adjacent deoxyribonucleotides; [3]
Any 3 @ 1m each

(b) Describe the role of the AP-1 protein in increasing the expression of the MMP-13 gene.
1. AP1 act as the activator (R! repressor) and binds to the conserved DNA region,
the enhancer (R! silencer);
2. DNA bends to bring the AP1 protein and conserved DNA region to close
proximity to the promoter/transcription initiation complex/MMP-13 gene;
3. Ref. to mediator proteins and transcription factors binding at promoter/AP-1
protein;
4. Increases the affinity of RNA polymerase to the promoter of the MMP13
gene/ enhances formation of the transcription initiation complex; @1m [3]

(c) Describe one type of histone modification that can occur in the presence of the activated
AP1 protein.
For
Examiner's
1. *Acetylation of histones; Use
2. neutralises the positively-charged R groups on histones / decreases the affinity For
Examiner's
of the histone tails for DNA; Use
OR
4. *De-methylation of histones;
5. proteins that bind to methylated histones removed;
@1m [2]

(d) MMP-13 is secreted as an inactive form. It is activated once the pro-domain is cleaved,
leaving an active enzyme that participates in collagen degradation. State this level at
which the expression of MMP-13 gene is controlled.

1. post-translational; [1]

(e) MMP-13 is involved in the degradation of the basement membrane where cells are
anchored. Tumour cells have elevated MMP-13 production and secretion. Suggest how
the elevated secretion of MMP-13 contributes to the malignant properties of the tumour
cells.

1. Metastasis/metastasizing;

2. Tumour cells freed/no longer bound/not anchored;

3. Released into bloodstream;

4. Resulting in formation of other/secondary tumours; @ 1 m, max 3 [3]


[Total: 12]

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


46
4 For
examiners
3. Fig. 3.1 below is a diagram of a dividing animal cell. use

E
Fig 3.1
(a) Name the structures labelled A and B.

A: Centrioles; R: Asters
For
B: Nucleolus; @1/2 m [1] Examiner's
Use
For
Examiner's
(b) State one visible feature in Fig 3.1 that enables you to identify that the cell is at Use

(i) Prophase of (ii) Meiosis II.

(i) Presence of nuclear envelope/separating centrioles/absence of


spindle/formation of spindle fibres/

Condensed chromosomes but not aligned at equatorial plane; any 1

(ii) Absence of homologous pairs of chromosomes/bivalents/1 of each type of [2]


chromosome/presence of odd number of chromosomes; @1m

(c) Discuss the significance of meiosis II.

1. Separation of sister chromatids of each chromosome (into 2 daughter nuclei);

2. Results in haploid cells/each with only one of each type of


chromosomes/halving the number of chromosomes;

3. Diploid number of organism will be restored/prevents doubling of


chromosomes upon fertilisation;
4. Daughter cells are genetically different (due to crossing over and
independent Segregation); @1 m [3]

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


47
5 For
examiners
(d) Describe the event(s) that could possibly take place following prophase of Meiosis II, use
resulting in the formation of a zygotic cell with diploid number of 7 upon fertilisation.

1. * Non-disjunction;

2. One pair of sister chromatids fail to separate at anaphase II;

3. Due to failure of attachment to spindle fiber/ of centromere dividing;

E
4. One daughter cell with (n+1/4) and the other (n-1/2) chromosomes/OWTTE;

5. Fusion of (n+1/4) gamete with normal gamete (3) to form 2n = 7 zygote; [3]
@ 1 m, * point essential to get full mark

[Total: 9]

4 Fig. 4.1 shows the components of the lac operon and its regulatory gene which is some
distance away.
lacO lacZ lacY IacA
lacI
Promoter (Operator)

mRNA mRNA

For
Examiner's
repressor -galactosidase lactose transacetylase Use
protein For
permease Examiner's
Use
Fig. 4.1
(a) (i) Describe what will happen to the repressor protein if lactose is present.

1. Allolactose/lactose binds to ( allosteric site of) repressor protein and


2. Alters configuration/3D conformation/tertiary structure of repressor

3. repressor detaches / cannot bind to operator @1m [2]

lacI+ lacO- lacZ+ lacY- lacA+


- - + - +
(ii) Explain how a bacterial cell with a diploid genotype lacI lacO lacZ lacY lacA
will respond in the presence of lactose (+: wild type allele; - : loss of function allele)

1. (lacI+ is dominant over lacI-) hence repressor protein is produced;

2. both copies of operator are defective;

3. (Normal) repressor cannot bind to operator

4. structural genes will be constitutively/continuously expressed

5. LacY gene for lactose permase not expressed/ lack of lactose


permease/non- functional lactose permease

6. Functional -galactosidase and transcetylase formed;


7. lactose not transported into cell (and metabolised); @1m [5]

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


48
6 For
examiners
use
(b) 5-capping and 3-polyadenylation are two kinds of post-transcriptional modifications that are
present in eukaryotes but absent in prokaryotes. Describe another post-transcriptional
modification necessary to produce mature mRNA in eukaryotes.

1. Spliceosome recognises/binds splice site;


2. Bring about the removal of introns/ spliced exons together to form
mature mRNA @1m [2]

(c) Human DNA has been analysed and details of certain genes are shown in Table 4.1.

Gene
Insulin
Albumin
Phenyalanine
Gene size / kb
1.7
25.0
90.0
Table 4.1

mRNA size / kb
0.4
2.1
2.4
Number of introns
2
14
12
E
hydroxylase
Dystrophin 2000.0 17.0 50

(i) Calculate the average size of the introns for the albumin gene (show your workings.)

25.0 2.1
= 1.6 kb;
14 For
Examiner's
Use
[1] For
Examiner's
Use
(ii) With reference to Table 4.1, describe the relationship(s) between the gene size and the
number of introns.

1. Generally bigger the gene size, the larger number of introns

2. Correct ref to data comparison of gene size and number of introns;

3. Ref to exceptions in trend as shown by phenylalanine hydroxylase / [3]


albumin gene @1m

[Total: 13]

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


49
7 For
examiners
5 CoffinLowry Syndrome (CLS) is a sex-linked dominant genetic disease that causes severe use
mental disability in humans. This disorder is caused by mutations in gene R. The normal
protein coded for by this gene is required for the formation of long-term memory, and the
survival of nerve cells. Lack of this protein hence affects mental development. Patients with
CLS experience brief episodes of collapse when they are excited or startled by a loud noise.

(a) A phenotypically normal woman married a CLS sufferer. Using a genetic diagram,
illustrate this cross and determine the probability of the couple having a male child

E
suffering from CLS. [3]

Penalise once for symbol other than XR and Xr used;

Parental phenotype: Normal female x CLS male 1. 1m for both genotype


and gametes correct
Parental genotype: XrXr x XRY

Gametes Xr XR Y
2. 1m for both F1
genotype and F1
phenotypic ratio correct
F1 genotype: XRXr XrY
F1 phenotypic ratio: 1 CLS female : 1 normal male
0 3. 1m for correct answer
Probability of a male child suffering from CLS: ___________________

For
The Canine Genome Sequencing Project was successfully completed in year 2005. Examiner's
During the project, researchers needed to investigate two particular genes in dogs. The Use
For
genes were the amino-methyl-transferase (AMT) gene (which codes for AMT enzyme to Examiner's
degrade excess glycine), and the T-cell leukemia translocation-associated (TCTA) gene Use
(which codes for TCTA protein involved in osteoclastogenesis, the formation of osteoclasts
for the breakdown of bone tissue).

(b) To increase sample size for statistical reliability, scientists selected several
heterozygous female poodles for normal AMT phenotype and normal TCTA phenotype,
and conducted test crosses on them. The following results were observed in the
offspring.

Normal AMT, normal TCTA dogs 96


Normal AMT, mutant TCTA dogs 18
Mutant AMT, normal TCTA dogs 20
Mutant AMT, mutant TCTA dogs 94

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


50
8 For
examiners
(i) Using A and a to represent the alleles for the AMT gene, and T and t to represent use
the alleles for the TCTA gene, illustrate the above cross with the use of a genetic
diagram. [4]

R: Linkage not indicated by brackets

Parental phenotype: normal AMT, normal TCTA x mutant AMT, mutant TCTA

E
1. 1m for P genotype, with
Parental genotype: (AT) (at) x (at) (at)
brackets indicating linked
genes;

Gametes (AT) (at) (At) (aT) (at)


2. 1m for circled
gametes;

F1 genotype:

(AT) (at) (at) (at) (At) (at) (aT) (at)

F1 phenotype: 3. 1m for F1 genotype;

Normal AMT, Mutant AMT, Normal AMT, Mutant AMT,


normal TCTA mutant TCTA mutant TCTA normal TCTA
4. 1m for corresponding
phenotype; For
Examiner's
Use
For
Examiner's
Use
(ii) Calculate the recombinant frequency between the AMT gene and TCTA gene. [1]

C.O.V. = [20+18] /228 x 100 = 16.67%

R: fraction

@1 mark

(iii) The recombinant frequency between the AMT gene and the canine DAG1 gene
was found to be 8.4%, and the recombinant frequency between the TCTA gene
and DAG1 gene was found to be 8.3%. On the diagram of a chromosome below,
indicate the relative positions of the AMT, TCTA and DAG1 genes. [1]

Ans: AMT gene, DAG1 gene, TCTA gene

OR TCTA gene, DAG1 gene, AMT gene

[Total: 9 marks]

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


51
9 For
examiners
6 Other than activating adenylyl cyclase, activated G-protein-coupled-receptors (GPCRs) can use
activate another signalling pathway. Fig. 6.1 below shows how the activation of GPCR
eventually leads to the activation of protein kinase C.

E
Fig. 6.1

(a) Describe how G protein is activated upon binding of the signal molecule to GPCR.

1. GPCR changes conformation/3D shape; For


Examiner's
Use
2. Binds to G protein, and causes the displacement of GDP with GTP; For
Examiner's
Use
@ 1m [2]

(b) With reference to Fig. 6.1, describe how the activated phospholipase C- results in the
activation of protein kinase C.

1. Activated phospholipase C- cleaves PIP2 into IP3 and DAG;


2. IP3 binds causes the IP3-gated Ca2+ channel to open, allowing efflux of Ca2+ from
SER (into cytoplasm)/ increasing [Ca2+] in the cytoplasm;

3. Ca2+ and DAG bind to protein kinase C (and activate it);

@ 1m

[3]

(c) Explain what is meant by the term phosphorylation cascade.


1. Phosphorylation cascade refers to a series of protein kinases which
phosphorylate other proteins/ in sequence/series;

2. Ref. to signal amplification; @ 1m [2]

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


52
10 For
examiners
(d) Other than through the phosphorylation cascade, explain how the signal is amplified in the use
pathway shown in Fig. 6.1.
1. amplification occurs when (one) signal molecule/activated GPCR activates many
G proteins;
2. when (one) activated phospholipase C-converts many molecules of PIP2 into IP3
and DAG;
3. and when (one) IP3 molecule results in many Ca2+ ions entering the cytoplasm/
activation of many protein kinase C; @ 1m [2]

E
(e) Besides storing Ca2+, describe two other functions of the smooth endoplasmic reticulum.

1. synthesis of lipids/steroids/triglycerides/phospholipids;

2. detoxification of drugs/poisons (in liver cells);

3. carbohydrate metabolism/breakdown of glycogen (in liver cells); any 2 @ 1m [2]

Some types of protein kinase C do not require presence of Ca2+ for activation. Protein kinase C
is known to be involved in cell signalling pathways which promote cell division.

(f) Phorbol esters are plant compounds which mimic the action of DAG. Phorbol esters are
known to promote the formation of tumours. With reference to Fig. 6.1, suggest and explain
how phorbol esters can promote tumour formation.

1. Phorbol esters bind to/activate protein kinase C; For


Examiner's
2. (activated) protein kinase C activates proteins/genes/cell signal pathways Use
which promote cell division / prevent apoptosis; @ 1m [2] For
Examiner's
Use
[Total: 13]

7 The mechanisms of speciation in ferns have been studied in temperate and tropical habitats.
One group of three species from the genus Polypodium lives in rocky areas in temperate
forests in North America. Members of this group have similar morphology (form and
structure). Another group of four species from the genus Pleopeltis live at different altitudes
in tropical mountains in Mexico and Central America. Members of this group are
morphologically distinct.
Data from the different species within each group was compared in order to study the
mechanisms of speciation.
Genetic identity was determined by comparing the similarities of certain proteins and genes
in each species. Values between 0 and 1 were assigned to pairs of species to indicate the
degree of similarity in genetic identity. A value of 1 would mean that all the genetic factors
studied were identical between the species being compared.

Fig. 7.1 shows the approximate distribution in North America of the first group comprising
three species of Polypodium (Po.) and a summary of genetic identity.

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


53
11 For
examiners
use

IRS1

p110
E
Fig. 7.1

Fig. 7.2 shows the approximate distribution in Central America and Mexico of the second group
comprising four species of Pleopeltis (Pl.) and a summary of genetic identity.
For
Examiner's
Use
For
Examiner's
Use

Fig. 7.2

(a) State, with reasons which group, Polypodium or Pleopeltis, has most probably been
genetically isolated for a longer period of time.
1. Polypodium;

2. it has lower genetic identity values of 0.338 0.608/the highest genetic value of

0.608 in Polypodium is still lower than those of Pleopeltis/ the lowest genetic

value of Pleopeltis is still higher than those of Polypodium;

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


54
12 For
examiners
use
3. takes time to accumulate mutations / genetic changes;

4. Isolation due to geographical barrier limiting gene flow;

@ 1m [4]

E
(b) Describe the distributions of the two groups of ferns within their respective geographical
locations.
1. The Polypodium species are (completely) found in different parts of the

continent/geographically separated;

2. The Pleopeltis species are much closer together / physically overlapping / share

same habitats; @ 1m
[2]

(c) Suggest how the process of speciation could have occurred in Polypodium.
1. Allopatric speciation;

2. The three species of Polypodium are geographically isolated (on different parts of
the continent);
For
3. Inherited variation is present in the (original) population of Polypodium; Examiner's
Use
4. Different habitats exert different selection pressures; For
Examiner's
Use
5. Only those with favourable traits are selected for and survive to pass on their
alleles to their offspring;

6. No interbreeding/gene flow between the different populations;


7. Separation of gene pools of isolated populations/change in allele frequencies
over time; @ 1m, max 5 [5]

(d) According to neutralists, when one compares the genomes of existing species, the vast
majority of molecular differences, which arises from gene mutations, are selectively neutral.
Describe the effect of changing the selection pressure on populations of species which have
these neutral mutations.
1. These mutations do not affect fitness/reproductive success;

2. These organisms do not come under selection pressure/changing selection


pressure has no effect;
3. Neutral mutations would either become fixed in all of its members, or be lost
entirely due to genetic drift. @ 1m [2]

[Total: 13]

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


55
13 For
examiners
Section B use
8 (a) Describe the roles of organelles involved in the synthesis and transport of proteins destined
to be embedded on the cell surface membrane. [8]

1. Ref to gene coding for membrane protein transcribed in nucleus;


2. Ref. to export of mRNA to cytoplasm via nuclear pores;
3. mRNA attaches to ribosome at RER surface for translation;
4. Ref to formation of translation initiation complex involving methionyl-tRNA,

E
ribosomes at the 5-end of mRNA;
5. Ref to complementary base pairing between anti-codon of tRNA with codons of
mRNA;
6. Ref to (elongation via) peptidyl transferase catalyzing the formation of peptide bond
between amino acids;
7. As ribosome moves along mRNA in 5 to 3 direction till stop codon;
8. polyribosomes may form to increase the rate of protein synthesis;
9. Completed polypeptide released into and embedded into membrane of RER;
10. Transport vesicles with polypeptide (embedded) moved towards and fused with (cis
face of) Golgi apparatus;
11. Proteins undergo post-translational modifications in RER/GA;
12. Membrane (with embedded proteins) pinches off as secretory vesicles;
13. Vesicles travel along microtubules;
14. And fuse with plasma membrane/ cell surface membrane;
@ 1m , max 8

(b) Compare the process in which ATP molecules are synthesised during respiration with that in
photosynthesis. [6]
Similarities: For
1. Both processes involved chemiosmotic synthesis/proton gradient across Examiner's
membrane surfaces; Use
For
2. Both processes involved hydrogen carriers, ETC and ATP synthase (any 2 of 3); Examiner's
Use
Differences:
Respiration Photosynthesis
3. ATP synthesized via both substrate- ATP synthesized via
level and oxidative phosphorylation; photophosphorylation only;

4. ATP produced in cytoplasm as well as ATP produced only in chloroplasts;


inside mitochondria;

5. Energy/(H+ and) electrons used for Energy/H+ and electrons used for ATP
ATP synthesis from chemical synthesis from light absorbed by
reactions/oxidation involving organic photosynthetic pigments/photolysis of
compounds; water;

6. Proton pool maintained in Proton pool maintained in thylakoid


intermembrane space in mitochondria / space in chloroplasts;
Ref to direction of proton
movement/location of ATP
synthase/ETC;
7. ATP formation during aerobic ATP formation during photosynthesis
respiration leads to the formation of leads to the formation of reduced NADP
water using O2 as final electron and release of O2 during non-cyclic
acceptor; photophosphorylation;
8. while lactic acid (in mammalian cells)
and ethanol + CO2 (in plant and
yeasts) formed during anaerobic
respiration;

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


56
14 For
examiners
9. ATP produced continuously/both in ATP production only in the presence of use
presence or absence of light/in all light/cells with chloroplasts;
cells;
10. Hydrogen carriers involved are NAD+ Hydrogen carriers involved are NADP+;
and FAD;
11. Process results in oxidation of Process results in reduction of NADP+;
reduced NAD+ and FAD;

E
@ 1 m max 5

(c) Describe how a phylogenetic tree is constructed. [6]

1. Involves a comparison of nucleotide sequences / amino acid sequences of


different groups of organisms;
2. Ref to the method of DNA hybridization to compare nucleotide differences;
3. Genes / proteins being compared must be homologous;
4. Grouped according to degree of similarities / with highest similarity index/closely
related species are grouped/ clustered together;
5. Branch length represents the number / degree of changes that have occurred;
6. Common ancestor between species is represented by the nodes in the
phylogenetic tree;
7. A common ancestor together with all its descendants are organized into a clade
8. Ref to use of molecular clock to elucidate time of divergence;
9. Ref to use of radiometric dating/stratigraphy/index fossils to find age of fossils;
10. Ref. to use of transition fossils to verify/support phylogeny;
@1m, max 6
For
Examiner's
Use
9 (a) With reference to the control of blood glucose concentration, explain the principles of For
homeostasis in terms of receptors, effectors, and negative feedback. [8] Examiner's
Use

1 Homeostasis is the maintenance of a constant internal environment;


2 Blood glucose concentration is maintained at 80-90 mg/100 ml blood;

Receptor
3 / cells of Islets of Langerhans are the receptors (which detect the
increase/decrease/deviation in blood glucose concentration);
4 Resulting in the (increased) secretion of insulin/glucagon;

Effector
5 The effectors are liver, fat and muscle (any 2 of 3 for insulin) / liver (for glucagon);
6 Any e.g. of corrective mechanism by effector i.e. insulin causes increase in
glycogenesis in liver/muscle cells / increase in glucose carriers in the plasma
membrane / increase in glucose uptake in fat/muscle cells / increase in rate of
respiration/ATP synthesis/ DNA/RNA synthesis OR glucagon causes increase in
glycogenolysis/gluceoneogenesis / decrease in glycogenolysis in liver cells ;
7 Insulin/glucagon brings about a decrease/increase in blood glucose levels (back to
norm);

Negative feedback
8 Ref. to negative feedback e.g. a disturbance in the system sets in motion a sequence
of events which counteracts the disturbance and brings the system to its original
state/ Negative feedback brings about change in the opposite direction restoring
stability / Negative feedback is seen when the initial increase in blood glucose
concentration brings about the subsequent decrease in blood glucose concentration
/ OWTTE;

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


57
15 For
examiners
9 (Negative feedback mechanism is also involved in inhibiting) further secretion of use
insulin/glucagon as receptor/ / cells of Islets of Langerhans detects that blood
glucose concentration is back to norm;

10 Ref. made to the opposite scenario when blood glucose concentration


decreases/increases below/above set point, resulting in the release of the other
hormone (glucagon / insulin;
11 Ref. to self-regulating nature of homeostasis;

E
Note: students need to have at 1 point from 3-5 (receptor section) AND 5-6 (effector
section) AND 8-9 (negative feedback section) to score full marks.

@1m, max 8

(b) Describe how the uni-directional transmission of nerve impulses is ensured along a
neuron and across a synapse. [6]

Along a neuron (max 3)


1. Ref to AP/repolarisation phase, prolonged efflux of K+ results in hyperpolarisaton;
2. Leading to refractory period;
3. where the membrane cannot respond to another normal stimulus/be depolarised;
4. Absolute refractory period (when no stimulus, however strong, can initiate another
AP) and relative refractory period (when another AP can only be initiated if the
stimulus is stronger than normally required);
5. Ensures that the AP is propagated towards the synaptic terminal; For
Examiner's
Use
Across a synapse (max 3) For
6. Synaptic vesicles/neurotransmitter present only in pre-synaptic terminals; Examiner's
Use

7. Neurotransmitter receptors / ligand-gated ion channels are present only on the


post-synaptic membrane / dendrites / cell body of the post-synaptic neuron;
8. Acetylcholinesterase present in cleft/at post-synaptic membrane to hydrolyse
neurotransmitter to maintain diffusion gradient;
9. Hence impulse/neurotransmitter is transmitted only from pre-synaptic terminal to
post-synaptic neuron;

@ 1m

(c) With reference to sickle-cell anemia, explain how gene mutation may affect the
phenotype of a person. [6]

1. The mutation in sickle-cell anemia involves the substitution of one base, from
thymine to adenine in haemoglobin;
2. (Alteration in nucleotide sequence) changes the codon of mRNA(from GAA to GUA
and thus the amino acid sequence in a polypeptide);
3. Mutated beta-globin/haemoglobin has hydrophilic amino acid glutamic acid
replaced by hydrophobic valine;
4. Affects the conformation/tertiary structure of protein (may result in loss of protein
activity/change in function/ non-functional protein, leading to a change in
phenotype of a person);
5. At low oxygen concentrations, (the hydrophobic portion of HbS molecules stick
together, causing) the haemoglobin (HbS) molecules (to) polymerize into fibres.

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


58
16 For
examiners
(This in turn causes) the red blood cells (to) change (from a circular biconcave use
shape) to a sickle-shape;
6. Sickle-shaped red blood cells may obstruct blood capillaries, hence, (multiple)
organs deprived of oxygen/resulting in their damage.
7. These cells (more rigid and fragile than normal red blood cells) haemolyse readily
resulting in anaemia.
8. They also accumulate in spleen for destruction leading to an enlargement of the

E
spleen.
Points 5 to 8 (phenotype) max 3 m

@1m, max 6

For
Examiner's
Use
For
Examiner's
Use

ACJC 9648/02/Prelim 2012 (Mark Scheme Post-Standardization v1) [Turn over


59

Subject
Name Class Class Index Number
2BI

ANGLO-CHINESE JUNIOR COLLEGE


Preliminary Examination 2013

BIOLOGY 9648/03

Applications Paper and Planning Question


3 Sept 2013
PAPER 3 2 hours

Additional Materials: Writing Paper

READ THESE INSTRUCTIONS FIRST

Write your name, subject class, form class and index number on all the work you hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagrams, graphs or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.

Answer all questions.

At the end of the examination, fasten your work securely together.


The number of marks is given in brackets [ ] at the end of each question or part question.

FOR EXAMINERS USE

TOTAL
72

This document consists of 16 printed pages.

ACJC 9648/03 Prelim 2013


60
2 For
Examiners
Use

1. Embryonic stem (ES) cells are highly regarded in research because their pluripotency offers the
potential for a wide range of therapeutic and research applications. However, ethical concerns
have been raised with regards to the source of ES cells.
Scientists have come up with an alternative method of generating pluripotent cells, which is to
genetically reprogramme adult cells to an embryonic stem cell-like state. Genetic reprogramming
is carried out by using deactivated retroviruses to introduce the genes of four transcription factors
into adult cells from a patient (Fig. 1.1).The reprogrammed cells, called induced pluripotent stem
(iPS) cells, are specific to the patient from which the adult cells were taken.

Fig. 1.1

(a) (i) Describe what is meant by the term pluripotent.

It describes the potential of a cell to become/differentiate into any cell type in the

adult body but not those of the extra-embryonic membranes; @ 1m [1]

(ii) Suggest one reason why the use of iPS cells evades the ethical concerns regarding the
source of ES cells.

Ref. to iPS uses adult cells, whereas obtaining ES cells involves the destruction

of embryos; @ 1m [1]

ACJC 9648/03 Prelim 2013 [Turn over


61
3 For
Examiners
Use

(iii) Give three reasons why deactivated retroviruses are used for genetic reprogramming of
the adult cells rather than active retroviruses or liposomes.

*1. deactivated because they will not cause disease/will not become virulent;
2. retoviruses allow for integration of genes into host genome while liposomes
do not;
3. retroviruses are more efficient at delivering genes into the host cell than
liposomes because they target specific cells;

*required for full marks


[3]

(iv) Suggest how the expression of such a small number of transcription factors in adult cells
could genetically reprogramme these adult cells to an embryonic stem cell-like state.

1. Each transcription factor can activate the transcription of multiple genes;


2. Each gene in turn could code for a transcription factor which activates other
genes;

3. The genes switched on are those expressed in pluripotent/ES cells;


4. e.g. telomerase gene/ genes which promote cell division/ genes which cause
the cell to revert to undifferentiated state;
5. resulting in the synthesis of proteins which are found in ES cells;
6. The transcription factor could also inhibit gene expression;
7. e.g. genes which result in specialisation (are repressed);
@ 1m, max 3 [3]

ACJC 9648/03 Prelim 2013 [Turn over


62
4 For
Examiners
Use

Patient-specific iPS cells can be induced to differentiate into the affected diseased tissue as this
will allow the patient's disease to be modelled in vitro. Using this diseased tissue, potential drugs
to treat the disease can be screened for, aiding in the discovery of new drugs.

Scientists have managed to obtain iPS cells from cystic fibrosis (CF) patients with a mutation at
amino acid position 508 (F508). They have caused these iPS cells to differentiate into diseased
human lung tissue, which is now being used to screen for potential drugs to treat cystic fibrosis
caused by the F508 mutation (Fig. 1.2).

Fig. 1.2

Previously, a cell line comprising rat cells expressing recombinant human mutant CFTR protein
was used for screening purposes. This cell line was successfully used to identify a drug to treat
cystic fibrosis.

(b) (i) Explain the effect of the F508 mutation on the function of the CFTR protein.

1. Mutation results in the deletion of phenylalanine from CFTR protein;

2. resulting in change in tertiary/overall 3D shape change in structure;


3. The CFTR protein is unable to transport chloride ions across the
membrane/out of the cell;

[3]

ACJC 9648/03 Prelim 2013 [Turn over


63
5 For
Examiners
Use

(ii) Suggest and explain one advantage of using a drug to treat CF rather than to use
liposomes to deliver a functional copy of a CFTR gene.
1. easier to regulate dosage of drug/avoid using high concentrations of
liposomes which could be toxic;
2. using the drug avoids the problem that the CFTR gene may not be properly
expressed (to form the CFTR protein); [1]

(iii) Suggest and explain one advantage of using diseased lung tissue derived from human
iPS cells to screen for CF drugs rather than the use of rat cells expressing recombinant
human CFTR.
1. ref. to iPS cells are (human cells and are) more representative of the actual
diseased cell than rat cells e.g. rat cells may have different biochemical
2. ref. to iPS cells are patient-specific and could be used to screen for drugs
specific to that patient; [1]

[Total: 13]

ACJC 9648/03 Prelim 2013 [Turn over


64
6 For
Examiners
Use

2. Cysteine proteinase (CP) is an enzyme that is coded by the mir-1 gene, which is found in plants
that are naturally resistant to attacks by Lepidopteran larvae. Lepidopteran larvae feeding on the
Black Mexican Sweet (BMS) maize leaf tissue cause crop losses. In an attempt to increase the
yield of BMS maize, plant biologists have used genetic technology to transform the wild-type BMS
maize callus with mir-1 gene. The growth of larvae feeding on transformed and non-transformed
BMS maize calli was studied for seven days, and the experiment was repeated. The results are
shown in Fig. 2.1.

Fig. 2.1

(a) (i) Suggest one delivery method that could be used to introduce the mir-1 gene into BMS
maize callus.

[1]

(ii) With reference to Fig. 2.1, describe and explain the effectiveness of genetically engineered
BMS maize with mir-1 gene on larvae growth.

[3]

ACJC 9648/03 Prelim 2013 [Turn over


65
7 For
Examiners
Use

(b) An in vitro experimental study was performed to investigate the effects of transformed BMS
plant cells expressing both cysteine proteinase (CP) and Bacillus thuringiensis (Bt) toxin on
Lepidopteran larvae. Table 2.1 shows the relative growth rate and percentage mortality of
Lepidopteran larvae fed with maize cell lines containing CP, Bt-toxin and a combination of CP
and Bt-toxin.

Table 2.1

CP Bt-toxin CP+ Bt-toxin


Relative Growth Rate/ Arbitrary Units 0.333 0.568 0.220
Percentage Mortality/% 38.0 4.0 50.0

With reference to Table 2.1, describe the effects of maize plant cells expressing CP together
with Bt-toxin on the percentage mortality of Lepidopteran larvae.

[2]

(c) Both CP and Bt-toxin target the mid-gut lumen. Fig. 2.2 shows a cross section of mid-gut. CP is
known to damage the peritrophic protein matrix of mid-gut lumen in the larvae, a structure that
protects the mid-gut from microbial infection.

The mechanism of damage by Bt-toxin is different compared to that of CP. Bt-toxin is


converted to its active form in the alkaline mid-gut environment, which then binds to the
specific mid-gut receptors on the brush border membrane of mid-gut cells with very high
affinity, forming lytic pores that result in cell death.

Fig. 2.2

ACJC 9648/03 Prelim 2013 [Turn over


66
8 For
Examiners
Use

(i) With reference to Table 2.1, Fig. 2.2 and the information given, suggest how CP may
enhance the effect of Bt-toxin on Lepidopteran larvae.

[3]

(ii) Over many generations, laboratory populations of Lepidopteran larvae have evolved
resistance against Bt-toxins. Suggest and explain how this resistance is developed.

[2]

[Total: 11]

ACJC 9648/03 Prelim 2013 [Turn over


67
9 For
Examiners
Use

3. Fig. 3.1 below shows a schematic diagram of targeted gene replacement in a mammalian cell
involving the gene Ig M. Targeted Ig M gene replacement is a method of replacing Ig M mutated
allele (Fig. 3.1a) in the genome in a cell with wildtype allele (Fig. 3.1b) via crossing over, giving
rise to the recombinant DNA (Fig. 3.1c). The wildtype allele is carried by a linearised plasmid (Fig.
3.1b) and introduced into the cell.

As shown in Fig. 3.1b, the linearised plasmid contains an antibiotic resistance gene (Neo gene),
wildtype alllele with the exons represented by the black boxes, as well as several restrictions sites
in between the exons. In this technique, the enhancer of the Neo gene on the linearised plasmid
was removed prior to the therapy.

Ig M mutated alleleNhe1
Ava1
Sca1

Afl1

Enhancer Genomic Fig. 3.1 a


fragment
F primer
Region of crossing over
Hpa1
Ecor1

Aat1
Dra1
Kpn1

Neo gene
Linearized Fig. 3.1 b
Ig M wildtype allele plasmid
R primer
Hpa1
Aat1
Ava1

Dra1
Sca1

Enhancer Neo gene


Recombinant
Fig. 3.1 c
DNA

Fig. 3.1

Legend
Exon
Restriction sites on mutated allele Ava1, Sca1, Afl1, Nhe1
Restriction sites on wildtype allele Kpn1, Ecor1, Dra1, Aat1
Naturally occurring restriction site on Hpa1
linearised plasmid

(a) (i) Explain the significance of restriction enzyme in bacteria.

[1]

(ii) Although the mutated and wildtype alleles are homologous regions, different restriction
sites are present in them. Explain the presence of these different restriction sites.

[2]
ACJC 9648/03 Prelim 2013 [Turn over
68
10 For
Examiners
Use

(iii) With reference to Fig. 3.1, explain how the Neo gene allows the transformed cells with
recombinant DNA to be distinguished from the transformed cells which did not undergo
recombination in their DNA.

[4]

(iv) With reference to Fig. 3.1a and Fig. 3.1b, briefly describe another method how Hpa1 can
be used to verify the identity of cells with recombinant DNA.

[4]

(v) The wildtype IgM allele was isolated from a genomic DNA library and not a cDNA library
before being introduced into the linearised plasmid. With reference to Fig. 3.1, state one
evidence which suggests this.

[1]

ACJC 9648/03 Prelim 2013 [Turn over


69
11 For
Examiners
Use

(b) In the gene replacement therapy shown in Fig. 3.1, the site of DNA breakage occurred
between restriction sites Sca1 and Afl1 as shown in Fig. 3.1a. In another case of therapy, the
site of DNA breakage along the mutated allele was unknown. To determine the exact site of
crossing over between the genomic DNA and the linearised plasmid, RFLP analysis was
carried out on the recombinant DNA. The recombinant DNA was isolated from the
transformed cell and amplified using PCR via the forward and reverse primers as shown in Fig.
3.1a and Fig. 3.1b. The amplified DNA products were separated into eight tubes and digested
using eight restriction enzymes respectively: Ava1, Sca1, Afl1, Nhe1, Kpn1, Ecor1, Dra1, Aat1.
The products of digestions were separated using gel electrophoresis and the results are
shown in Fig. 3.2.

Ava1 Sca1 Afl1 Nhe1 Kpn1 Ecor1 Dra1 Aat1

Fig. 3.2

(i) With reference to Fig. 3.1 and 3.2, describe and explain the band pattern of the restriction
digest for the recombinant cell.

[3]

(ii) Hence identify the site of DNA breakage where crossing over took place in the mutated
allele.

[1]

[Total: 16]

ACJC 9648/03 Prelim 2013 [Turn over


70
12 For
Examiners
Use

Planning Question
4. Electroporation is a method which is routinely used to introduce foreign DNA into E. coli cells. This
involves subjecting a mixture of bacteria and plasmid to a brief electric pulse. You are required to
plan, but not carry out, an investigation into the effect of voltage on the efficiency of transformation
by electroporation.
In this investigation, the recombinant plasmid used to transform the E. coli cells is made up of two
components: the plasmid vector and the gene of interest. pGFP is a plasmid with two marker
genes, GFP and AmpR, and a number of restriction sites throughout the plasmid as shown in Fig.
4.1 below. GFP is a marker gene coding for the green fluorescent protein. Expression of GFP in
bacteria will cause bacteria to fluoresce under UV light. The gene of interest is the ras proto-
oncogene, which has been inserted into the plasmid using the restriction enzyme BmtI.

Fig. 4.1
An electroporator is a machine used to carry out electroporation. It is possible to vary the voltage
and length of the electrical pulse with this machine. The range of voltage used is typically 1400
2000 V and the length of electrical impulse between 4-6 ms. A voltage which is too high will cause
irreversible changes in membrane permeability. The mixture of bacteria and recombinant plasmid,
which must be kept on ice prior to electroporation, is put into a cuvette (Fig. 4.2) which is then
placed into a chamber in the electroporator (Fig. 4.3).
After electroporation, the mixture of bacteria must be quickly resuspended in SOC broth (a type of
growth medium) and incubated at 37C for 1 hour for the surviving cells to recover. This is then
followed by plating the bacteria on agar and incubation at 37C for 16-24 hours. The plates can
then be examined to calculate transformation efficiency.

Fig. 4.2
ACJC 9648/03 Prelim 2013 [Turn over
71
13 For
Examiners
Use

Fig. 4.3

Transformation efficiency can be calculated using the following equation: -

Transformation efficiency / cfu g1 = Total number of colonies on agar plate

[cfu: colony forming unit] Amount of DNA plated (in g)

Your planning must be based on the assumption that you have been provided with the following
equipment and materials which you must use:
Microcentrifuge tubes of 100 l E. coli cells in electroporation buffer
Microcentrifuge tubes of 1 l recombinant DNA (concentration of 0.1 g / l)
Microcentrifuge tubes of 1 l sterile water
Ice bucket with ice
Electroporator
Sterile cuvettes for electroporation (max. volume of 150l)
Agar plates with ampicillin
Sterile spreader for spreading bacterial culture on agar plate
SOC broth
Incubator
UV transilluminator (a device which emits UV light)
UV shields which provide protection from UV light
A variety of micropipettes, sterile micropipette tips and sterile 2 ml microcentrifuge tubes

Your plan should have a clear and helpful structure to include


an explanation of the theory to support your practical procedure
a description of the method used, including the scientific reasoning behind the method, a
control experiment and any recommended safety measures
an explanation of the dependent and independent variables involved
relevant, clearly labelled diagram/s showing selection of the recombinant bacteria on plates
how you will record your results and ensure that they are as accurate and reliable as possible
proposed layout of results tables and graphs with clear headings and labels
the correct use of technical and scientific terms

[Total: 12]

ACJC 9648/03 Prelim 2013 [Turn over


72
14 For
Examiners
Use

ACJC 9648/03 Prelim 2013 [Turn over


73
15 For
Examiners
Use

ACJC 9648/03 Prelim 2013 [Turn over


74
16 For
Examiners
Use

Free-response question

Write your answers to this question on the separate paper provided.

Your answer:

should be illustrated by large, clearly labelled diagrams, where appropriate.


must be in continuous prose, where appropriate.
must be set out in sections (a), (b) etc., as indicated in the question.

5. (a) Describe and explain how bacteria can be used to mass produce human insulin without the
use of any DNA libraries. [7]

(b) Discuss the advantages and the limitations of the Polymerase Chain Reaction. [5]

(c) Discuss the implications of the Human Genome Project, including the benefits and difficult
ethical concerns for humans. [8]

[Total: 20]

ACJC 9648/03 Prelim 2013 [Turn over


75
ACJC H2 Bio P3 Mark Scheme 2013

1 Embryonic stem (ES) cells are highly regarded in research because their pluripotency offers the
potential for a wide range of therapeutic and research applications. However, ethical concerns
have been raised with regards to the source of ES cells.
Scientists have come up with an alternative method of generating pluripotent cells, which is to
genetically reprogramme adult cells to an embryonic stem cell-like state. Genetic reprogramming
is carried out by using deactivated retroviruses to introduce the genes of four transcription factors
into adult cells from a patient (Fig. 1.1).The reprogrammed cells, called induced pluripotent stem
(iPS) cells, are specific to the patient from which the adult cells were taken.

Fig. 1.1

(i) Describe what is meant by the term pluripotent.

It describes the potential of a cell to become/differentiate into any cell type in the

adult body but not those of the extra-embryonic membranes; @ 1m [1]

(ii) Suggest one reason why the use of iPS cells evades the ethical concerns regarding the
source of ES cells.

Ref. to iPS uses adult cells, whereas obtaining ES cells involves the destruction /
endangering / risk of embryos;
A! pts
@ 1m
[1]

ACJC 9648/03 Prelim 2013


76
2 For
Examiners
Use

(iii) Give three reasons why deactivated retroviruses are used for genetic reprogramming of
the adult cells rather than active retroviruses or liposomes.

*1. deactivated because they will not cause disease/infect other cells /will not
become virulent;
2. retoviruses allow for integration of genes into host genome while liposomes
do not;
3. retroviruses are more efficient at delivering genes into the host cell than
liposomes because they target specific cells while liposome does not fuse with
target cell;

R! ref. to toxicity of liposomes as liposomes not administered in vivo.


Both side of ans must be given to award 1 mark except for pt 1.
R! Lysozyme;
*required for full marks
[3]

(iv) Suggest how the expression of such a small number of transcription factors in adult cells
could genetically reprogramme these adult cells to an embryonic stem cell-like state.

1. Each transcription factor can activate the transcription of multiple genes;


2. Each gene in turn could code for a transcription factor which
activates/inactivate other genes;
3. transcription factors switched on are those expressed in (pluripotent/ES cells)
/ transcription factor could also inhibit gene expression;
4. e.g. telomerase gene/ genes which promote cell division/ genes which cause
the cell to revert to undifferentiated state;
5. resulting in the synthesis of proteins which are found in ES cell;

6. e.g. genes which result in specialisation (are repressed);


@ 1m, max 3 [3]

ACJC 9648/03 Prelim 2013 [Turn over


77
3 For
Examiners
Use

Patient-specific iPS cells can be induced to differentiate into the affected diseased tissue as
this will allow the patient's disease to be modelled in vitro. Using this diseased tissue, potential
drugs to treat the disease can be screened, aiding in the discovery of new drugs.

Scientists have managed to obtain iPS cells from cystic fibrosis (CF) patients with a mutation
at amino acid position 508 (F508). They have caused these iPS cells to differentiate into
diseased human lung tissue, which is now being used to screen for potential drugs to treat
cystic fibrosis caused by the F508 mutation (Fig. 1.2)

Fig. 1.2

Previously, a cell line comprising of rat cells expressing recombinant human mutant CFTR
was used for screening purposes. This cell line was successfully used to identify a drug to
treat cystic fibrosis.

(v) Explain the effect of the F508 mutation on the function of the CFTR protein.

1. Mutation results in the deletion of 3 bases / phenylalanine from CFTR protein;

2. resulting in change in tertiary/overall 3D shape change in structure;


3. The CFTR protein is unable to transport chloride ions across the
membrane/out of the cell;

[3]

ACJC 9648/03 Prelim 2013 [Turn over


78
4 For
Examiners
Use

(vi) Suggest and explain one advantage of using a drug to treat CF rather than to use
liposomes to deliver a functional copy of a CFTR gene.
1. easier to regulate dosage of drug/avoid using high concentrations of
liposomes which could be toxic;
2. using the drug avoids the problem that the CFTR gene may not be properly
expressed (to form the CFTR protein); [1]
3. Drug is able to travel to many/most parts of body and treat all affected parts
whereas liposomes are able to treat only localised areas; (note: liposomes can
be injected into the blood stream but the e.g. in the notes relates to the
treatment of a localised area)
4. Drug with (specific 3D config) can bind to specific cells while liposome are
not specific in targeting cell

Award when either side of point given.


R! Ref. to easier to administer drug than liposomes to patient e.g. drug can be
taken orally/by inhaler because liposomes can be administered by inhaler too.
R! Drugs are cheaper than using liposomes to deliver CFTR gene

(vii) Suggest and explain one advantage of using diseased lung tissue derived from human
iPS cells to screen for CF drugs rather than the use of rat cells expressing recombinant
human CFTR.
1. ref. to iPS cells are (human cells and are) more representative of the actual
diseased cell than rat cells e.g. rat cells may have different biochemical
pathways (which affect CFTR protein or drug)/ OWTTE;
2. ref. to iPS cells are patient-specific and could be used to screen for drugs
specific to that patient (i.e. personalised treatment); [1]

[Total: 13]

ACJC 9648/03 Prelim 2013 [Turn over


79
5 For
Examiners
Use

2 (a) Cysteine proteinase (CP) is an enzyme that is coded by mir-1 gene, which is found in plants
that are naturally resistant to attacks by Lepidopteran larvae. Lepidopteran larvae feeding on
the Black Mexican Sweet (BMS) maize leaf tissue causes crop losses. In an attempt to
increase the yield of BMS maize, plant biologists have used genetic technology to transform
the wild-type BMS maize callus with mir-1 gene. The growth of larvae feeding on transformed
and non-transformed BMS maize calli was studied for seven days, and the experiments were
repeated twice. The results are shown in Fig. 2.1.

Fig. 2.1

(i) Suggest one delivery method that could be used to introduce the mir-1 gene into BMS maize
callus.
1. Ref. to the use of gene gun/soil bacterium/ Agrobacterium/Electroporation; @ 1m

R! liposome (due to presence of plant cell wall) [1]

(ii) With reference to Fig. 2.1, describe and explain the effectiveness of genetically engineered
BMS maize with mir-1 gene on larvae growth.
1. Larvae feeding on transformed BMS maize have a decreased larvae growth /
lower weight (as compared to that of the untransformed BMS maize);
2. Ref. to 140 mg as shown in exp. 1 as compared to 25 mg for larvae feeding on
transformed maize callus
OR
(85 - 86) mg as shown in exp. 2 for larvae feeding on untransformed maize callus
compared to (28-30) mg as shown for larvae feeding on transformed maize
callus; @ 1m
3. CP/mir-1 protein was expressed in transformed BMS maize callus and
ingested/eaten/consumed by larvae (which slows down/reduces/stunts their
growth);

[3]

ACJC 9648/03 Prelim 2013 [Turn over


80
6 For
Examiners
Use

(b) An in vitro experimental study was performed to investigate the effects of transformed BMS
plant cells expressing both cysteine proteinase (CP) and Bacillus thuringiensis (Bt) toxin on
Lepidopteran larvae. Table 2.1 shows the relative growth rate and percentage mortality of
Lepidopteran larvae fed with maize cell lines containing CP, Bt-toxin and a combination of CP
and Bt-toxin.

Table 2.1

CP Bt-toxin CP+ Bt-toxin


Relative Growth Rate/ Arbitrary Units 0.333 0.568 0.220
Percentage Mortality/% 38.0 4.0 50.0

With reference to Table 2.1, describe the effects of maize plant cells expressing CP together
with Bt-toxin on the percentage mortality of Lepidopteran larvae.

1. Highest/higher/significant percentage mortality as compared to that of larvae


feeding on CP or Bt-toxin maize cells;

2. Ref. to figs 50% vs 4 % vs 38 % in table with appropriate units; @ 1 m

[2]

(c) Both CP and Bt-toxin target the mid-gut lumen. Fig 2.2 shows a section of mid-gut. CP is
known to damage the peritrophic protein matrix of mid-gut lumen in the larvae, a structure that
protects the mid-gut from microbial infection.

The mechanism of damage by Bt-toxin is different compared to that of CP. Bt-toxin is


converted to its active form in the alkaline mid-gut environment, which then binds to the
specific mid-gut receptors on the brush border membrane of midgut cells with very high affinity,
forming lytic pores that result in cell death.

Fig. 2.2

ACJC 9648/03 Prelim 2013 [Turn over


81
7 For
Examiners
Use

(i) With reference to Table 2.1 and information given above, suggest how CP may enhance
the effect of Bt-toxin on Lepidopteran larvae.

1. ref. to 4% mortality (relative growth rate 0.568 A.U.) due to Bt toxin alone;

2. CP digests/breakdown proteins found in peritrophic protein matrix, (therefore


more porous);
3. Ref. to facilitate the movement of Bt-toxin through the membrane into the
brush border membrane of mid-gut lumen /higher accessibility for Bt toxin; [3]

(ii) Over many generations, laboratory populations of Lepidopteran larvae have evolved
resistance against Bt-toxins. Suggest and explain how the resistance is developed.

*1. Ref. to mutation in genes


2. The alteration of Bt-toxin binding site on the mid-gut receptors e.g. decreased
affinity or reduction in the number of binding sites;
3. Changes in mid-gut environment such that Bt-toxin is not converted to its
active form;
4. Rapid regeneration of the damaged mid-gut epithelium; @ 1m
Either pt 1 and 2/3/4

5. (Genotypic/ phenotypic) variation in resistance and selection pressure due


to Bt toxin ; [2]
6. Differential reproductive success/fitness;
7. Change in allele frequency (over time);

[Total: 11]

ACJC 9648/03 Prelim 2013 [Turn over


82
8 For
Examiners
Use

3. Fig. 3.1 below shows a schematic diagram of targeted gene replacement in a mammalian cell
involving the gene Ig M. Targeted Ig M gene replacement is a method of replacing Ig M mutated
allele (Fig. 3.1a) in the genome in a cell with wildtype allele (Fig. 3.1b) via crossing over, giving
rise to the recombinant DNA (Fig. 3.1c). The wildtype allele is carried by a linearised plasmid (Fig.
3.1b) and introduced into the cell.

As shown in Fig. 3.1b, the linearised plasmid contains an antibiotic resistance gene (Neo gene),
wildtype alllele with the exons represented by the black boxes, as well as several restrictions sites
in between the exons. In this technique, the enhancer of the Neo gene on the linearised plasmid
was removed prior to the therapy.

Ig M mutated alleleNhe1
Ava1
Sca1

Afl1

Enhancer Genomic Fig. 3.1 a


fragment
F primer
Region of crossing over
Hpa1
Ecor1

Aat1
Dra1
Kpn1

Neo gene
Linearized Fig. 3.1 b
Ig M wildtype allele plasmid
R primer
Hpa1
Aat1
Ava1

Dra1
Sca1

Enhancer Neo gene


Recombinant
Fig. 3.1 c
DNA

Fig. 3.1

Legend
Exon
Restriction sites on mutated allele Ava1, Sca1, Afl1, Nhe1
Restriction sites on wildtype allele Kpn1, Ecor1, Dra1, Aat1
Naturally occurring restriction site on Hpa1
linearised plasmid

i. Explain the significance of the restriction enzyme in bacteria.

1.To (protect) against foreign DNA by digesting/cutting it ; @1m

A! destroy, degrade [1]

ii. Although the mutated and wildtype alleles are homologous regions, different restriction
sites are present on them. Explain the presence of these different restriction sites.
1. (Single) DNA polymorphism / changes in DNA sequences between individual /
mutation;

2. Creates / destroy / changes restriction sites @1m

R! RFLP [2]
ACJC 9648/03 Prelim 2013 [Turn over
83
9 For
Examiners
Use

iii. With reference to Fig 3.1, explain how the Neo gene allows the transformed cells with
recombinant DNA to be distinguished from transformed cells which did not undergo
recombination in their DNA.
1. Cells that were transformed with subsequent recombination in the
chromosome/DNA would survive in the presence of neomycin;
A! Neo antibiotic or just a/the antibiotic. R! antibiotics.
2. Transformed cell without recombination event would not survive
3. Neo gene from vector would come under the control of an active enhancer
4. High expression of neo gene confers resistance against neomycin. A!
comparison.
5. No /low expression of neo gene due to absence of enhancer in linearized
plasmid / absence of Neo gene on genomic fragment;

[4]

iv. With reference to Fig 3.1a and Fig.3.1 b, briefly describe another method how Hpa1 can be
used to verify the identity of cells with recombinant DNA.

(Replica plating of cells with recombinant DNA)


*1. (lyse cell) followed by cutting/digesting it with restriction enzyme Hpa1
R! restriction enzyme added to cells, DNA treated with restriction enzyme
2. separate DNA fragment via gel electrophoresis;
3. stain / Intercalate with ethidium bromide and visualised under UV light;
4. recombinant DNA will show 2 bands while non-recombinant DNA will show
band; A! more bands
OR
[4]
*1. (lyse cell) followed by cutting it with restriction enzyme hpa1
2. separate DNA fragment via gel electrophoresis;
5.Ref to southern blotting / transfer to nitrocellulose membrane;
6.Radioactive probe binds to enhancer
A! any other reasonable specified area or sequence;
7.1 (probe targeting enhancer) short band (recombinant DNA) vs 1 long band
(genomic DNA) vs no band (linearised plasmid)
A! other logical patterns depending on the specified probe
Compulsory pt 1

v. The wildtype IgM allele was isolated from a genomic DNA library and not a cDNA library
before being introduced into the linearized plasmid. With reference to Fig. 3.1 state one
evidence which suggest so.

1. allele shown contain introns / non-coding DNA;


R! enhancer
[1]

ACJC 9648/03 Prelim 2013 [Turn over


84
10 For
Examiners
Use

b) In the gene replacement therapy shown in Fig. 3.1, the site of DNA breakage occurred
between restriction sites Sca1 and Afl1 as shown in Fig. 3.1a. In another case of therapy, the
site of DNA breakage along the mutated allele was unknown. To determine the exact site of
crossing over between the genomic DNA and the linearised plasmid, RFLP analysis was
carried out on the recombinant DNA. The recombinant DNA was isolated from the
transformed cell and amplified using PCR via the forward and reverse primers as shown in Fig.
3.1a and Fig. 3.1b. The amplified DNA products were separated into eight tubes and digested
using eight restriction enzymes respectively: Ava1, Sca1, Afl1, Nhe1, Kpn1, Ecor1, Dra1, Aat1.
The products of digestions were separated using gel electrophoresis and the results are
shown in Fig. 3.2.

Ava1 Sca1 Afl1 Nhe1 Kpn1 Ecor1 Dra1 Aat1

Fig .3.2

(i) With reference to Fig.3.1 and 3.2, describe and explain the band pattern of the restriction
digest for the recombinant cell.
1. presence of 2 restriction fragments each using Ava1, Ecor1, Dra1 and Aat1
digest;
2. Indicates presence of restriction sites on recombinant DNA.
3. digest with Sca1, Afl1, Nhe1 and Kpn1 yields no bands,
4. indicating absence of restriction sites;
5. Ref. to explanation linking action of named restriction enzyme/position of a
named restriction site (Ava1, Ecor1, Dra1 and Aat1) on the size of the fragments
produced;

[3]

(ii) Hence identify the site of DNA breakage where crossing over took place in the mutated
allele.

Between Ava1 and Sca1;

[1]

[Total: 16]

ACJC 9648/03 Prelim 2013 [Turn over


85
11 For
Examiners
Use

Planning Question

4 Electroporation is a method which is routinely used to introduce foreign DNA into E. coli cells. This
involves subjecting a mixture of bacteria and plasmid to a brief electric pulse. You are required to
plan, but not carry out, an investigation into the effect of voltage on the efficiency of transformation
by electroporation.

In this investigation, the recombinant plasmid used to transform the E. coli cells is made up of two
components: the plasmid vector and the gene of interest. pGFP is a plasmid with two marker
genes, GFP and AmpR, and a number of restriction sites throughout the plasmid as shown in Fig.
4.1 below. GFP is a marker gene coding for the green fluorescent protein. Expression of GFP in
bacteria will cause bacteria to fluoresce under UV light. The gene of interest is the ras proto-
oncogene, which has been inserted into the plasmid using the restriction enzyme BmtI.

Fig. 4.1

An electroporator is a machine used to carry out electroporation. It is possible to vary the voltage
and length of the electrical pulse with this machine. The range of voltage used is typically 1400
2000 V and the length of electrical impulse between 4-6 ms. A voltage which is too high will cause
irreversible changes in membrane permeability. The mixture of bacteria and recombinant plasmid,
which must be kept on ice prior to electroporation, is put into a cuvette (Fig. 4.2) which is then
placed into a chamber in the electroporator (Fig. 4.3).

After electroporation, the mixture of bacteria must be quickly resuspended in SOC broth (a type of
growth medium) and incubated at 37C for 1 hour for the surviving cells to recover. This is then
followed by plating the bacteria on agar and incubation at 37C for 16-24 hours. The plates can
then be examined to calculate transformation efficiency.

ACJC 9648/03 Prelim 2013 [Turn over


86
12 For
Examiners
Use

Fig. 4.2

Fig. 4.3
Transformation efficiency can be calculated using the following equation: -

Transformation efficiency / cfu g1 = Total number of colonies on agar plate

[cfu: colony forming unit] Amount of DNA plated (in g)

Your planning must be based on the assumption that you have been provided with the following
equipment and materials which you must use:
Microcentrifuge tubes of 100 l E. coli cells in electroporation buffer
Microcentrifuge tubes of 1 l recombinant DNA (concentration of 0.1 g / l)
Microcentrifuge tubes of 1 l sterile water
Ice bucket with ice
Electroporator
Sterile cuvettes for electroporation (max. volume of 150l)
Agar plates with ampicillin
Sterile spreader for spreading bacterial culture on agar plate
SOC broth
Incubator
UV transilluminator (a device which emits UV light)
UV shields which provide protection from UV light
A variety of micropipettes, sterile micropipette tips and sterile 2 ml microcentrifuge tubes

Your plan should have a clear and helpful structure to include


an explanation of the theory to support your practical procedure
a description of the method used, including the scientific reasoning behind the method, a
control experiment and any recommended safety measures
an explanation of the dependent and independent variables involved
relevant, clearly labelled diagram/s showing selection of the recombinant bacteria on plates
how you will record your results and ensure that they are as accurate and reliable as possible
proposed layout of results tables and graphs with clear headings and labels

ACJC 9648/03 Prelim 2013 [Turn over


87
13 For
Examiners
Use

the correct use of technical and scientific terms


[Total:12]
Mark Scheme
1 Theoretical consideration or rationale of the plan to justify the practical procedure
(a) As voltage increases, transformation efficiency increases up to a point where membrane is
irreversibly damaged, leading a drop in transformation efficiency as voltage further
increases /
At voltages which are too high or too low, the bacteria's ability to take up DNA by
transformation becomes reduced, and at high voltages, many/most bacteria will die.
(b) Only transformed bacteria will be able to grow/form colonies on the agar plates with
ampicillin. These colonies should also fluoresce under UV light.

2 At least 5 different voltages (between 1400 to 2000 V), regular spacing between intervals
3 (a) Constant volume of E. coli cells (eg. 100l) and
(b) constant volume of recombinant DNA (eg. 1l)
4 Specify time for incubation of bacteria and recombinant plasmid in ice (1 - 20 minutes). A!
incubate together or separately.
5 Specify fixed time for electroporation (4 6 ms)
6 Specify fixed vol of SOC (>2ml ) and incubate at 37C for 1 hr
7 (a) Incubate the plates at 37C
(b) for fixed no. of hours between 16-24hr R! overnight
8 Control experiment (a) E. coli cells + sterile water subjected to electroporation (no
colonies observed)
(b) subjected to same conditions as mixtures with plasmid / repeat exp/ OWTTE
9 Count number of colonies which fluoresce under UV light
10 (a) Replicates
(b) At least two repeats
11 Tabulation:
(a) Ref to colony count
(c) Average transformation efficiency/cfu g1 under different voltages/V tabulated with correct
headings and units
12 Plot graph (with trend line) of ave. transformation efficiency/ cfu g1 against voltage/ V A!
ECF for colonies and units.
13 Drawing of Petri dish with fluorescent colonies labelled
14 Two safety precautions / risk hazards identified
(a) Wear gloves when handling E. coli to avoid contact with microorganisms
(b) Wipe table with antiseptic solution (such as ethanol/chlorox) to prevent growth of harmful
microorganisms
(c) Use the UV shields to cut down on exposure to UV light
(d) Proper disposal/treatment of contaminated materials or equipment using sterilizer/
autoclave to prevent growth of harmful microorganisms
(e) Handle (plug of) electroporator with dry hands to prevent electrocution.
Max 10 for 2 14

15 The correct use of technical and scientific terms


(a) transient pores
(b) ref. to transformed cells being resistant to ampicillin/being able to grow on ampicillin

ACJC 9648/03 Prelim 2013 [Turn over


88
14 For
Examiners
Use

Free-response question

5 (a) Describe and explain how a bacteria can be used to mass produce human insulin without the
use of any DNA libraries. [7]

1. using isolated mRNA for insulin ( from human pancreatic cells as template) forming
cDNA using reverse transcriptase/reverse transcribe / OWTTE
2. DNA linkers (containing the restriction site) added to cDNA using (DNA ligase)
3. digest plasmids (containing lacZ and ampR or any antibiotic marker genes) and the
cDNA with the a/same RE to produce sticky ends. (A! reference to plasmids cut within
lacZ by RE)
4. mix the cDNA and the plasmids together and let the sticky ends anneal by H bonds by
complementary base pairing
5. Add DNA ligase to covalently join the fragments with phosphodiester bonds (covalent
bond to form recombinant plasmids)
6. transform bacteria / electroporation / heat shock
7. plate the transformed bacterial cells onto nutrient agar plate with ampicillin and X-gal
added into the medium
8. select colonies which are white in colour as these are the ones with recombinant
plasmid (R! bacteria appears white)
9. due to inactivation of Lac z gene
*10. selected bacteria grown (in large quantities) in a suitable medium and bacteria
secrete insulin which is extracted, (purified and packaged for use)

@1m (pt 1 9 max 6; pt 10 needed for full marks)

(b) Discuss the advantages and the limitations of the Polymerase Chain Reaction. [5]

Advantages: (@1m, max 4)

1. Produces large numbers of copies in a relatively short span of time;


2. Cell-free method of DNA replication/requires no cleanup of unwanted cellular
debris or vector DNA;
3. Shown to (efficiently) amplify targets up to 35kb in length;
4. A specific process that targets only the desired DNA to be copied, (hence
starting material does not have to be purified DNA)
5. Only requires a trace amount of DNA;

Limitations: (@1m)

6. Need to first know the nucleotide sequence of at least one short DNA sequence
on each side of the region of interest in order to synthesise the PCR primers;
7. Some errors can be introduced into the amplified DNA copies at low but
significant frequencies / Due to lack of a built-in proofreading activity in Taq
polymerase, PCR produces a higher than normal frequency of replication errors;

ACJC 9648/03 Prelim 2013 [Turn over


89
15 For
Examiners
Use

(c) Discuss the implications of the Human Genome Project, including the benefits and difficult
ethical concerns for humans. [ 8]

Benefits max 4

Genetic testing (max 1)


1 The HGP has allowed for discovery of genes/alleles/polymorphisms associated with
human diseases/ understanding genetics basis of disease;
2 This allows for improved diagnosis of disease / genetic testing;
3 Earlier detection of genetic predispositions to disease (eg. breast cancer, cystic fibrosis,
Alzheimers disease);
4 It also allows scientists to design drugs to target a specific gene/protein (ie. rational
drug design) ;

Pharmacogenetics (max 1)
5 The HGP allows scientists/doctors to know which genes/alleles/polymorphisms affect a
persons response to a drug / genetic differences affect the way we react to a drug;
6 It is (theoretically) possible to tailor drugs/treatments to fit patients genome for greater
efficacy / avoiding dangerous side effects / personalized medicine based on personal
genotype;

Gene therapy
7 (Since gene sequences are now readily available and we better understand which
genes/alleles/polymorphisms are associated with which diseases,) it is possible to use
gene therapy to treat certain diseases;

Risk assessment of individuals upon exposure to toxic agents


8 (The HGP has allowed for discovery of genes/alleles/polymorphisms associated with
resistance/susceptibility to radiation/carcinogens, and hence) an individuals
genome/polymorphisms can be used as a means of risk assessment to evaluate health
risks of individuals who may be exposed to radiation or carcinogens;

Understanding human evolution (max 1)


9 (The HGP allows for the discovery of alleles/polymorphisms that can be) used to study
evolution through germline mutations in lineages ;
10 Migration/lineage of different population groups can be studied based on female genetic
inheritance (using alleles/polymorphisms in mitochondrial DNA) or male genetic
inheritance (using alleles/polymorphisms on Y chromosome);
11 (The HGP allows for the discovery of alleles/polymorphisms that can be) used to
compare breakpoints in the evolution of mutations with ages of populations and
historical events;

DNA forensics (max 1)


(The HGP allows for the discovery of alleles/polymorphisms that can be used to:)
12 Identify potential suspects whose DNA may match evidence left at crime scenes /
Exonerate persons wrongly accused of crimes ;
13 Identify crime / catastrophe victims ;
14 Establish paternity and other family relationships ;
15 Identify endangered /protected species (as an aid to wildlife officials) (could be used for
prosecuting poachers) ;
16 Match organ donors with recipients in transplant programs ;
17 Detect bacteria/other organisms that may pollute air/water/ soil/ food ;
18 Determine pedigree for seed/livestock breeds ;
19 Authenticate consumables such as caviar/wine/fish ;

ACJC 9648/03 Prelim 2013 [Turn over


90
16 For
Examiners
Use

Concerns max 4
Ethical and social concerns
i) Privacy and confidentiality of genetic information.
20 The issue of who owns (and controls) genetic information individual or
company/researcher/government;

ii) Fairness in the use of genetic information by insurers, employers, courts, schools,
adoption agencies, and the military, among others.
21 The issue of how insurers/employers/courts/schools/adoption agencies/military may
request for/use DNA testing/have access to personal genetic information to
discriminate people based on their genomes;

iii) Psychological impact and stigmatization due to an individual's genetic differences.


22 It is unclear how personal genetic information affects an individual/society's
perceptions of that individual / how genomic information affect members of minority
communities/ref to Psychological impact and stigmatization due to an individual's
genetic differences;

iv) Reproductive issues (max 1)


23 There is an issue of whether healthcare personnel are properly counseling parents
about the risks and limitations of genetic technology
24 The reliability/usefulness of fetal genetic testing has not been verified (in many cases);
25 To-be parents may have to make difficult decisions of whether to terminate pregnancy
due to presence of genetic disorder (especially one for which there is currently no cure
or treatment for) ;

v) Uncertainties associated with gene tests (max 1)


26 The issue of whether testing should be performed when no treatment is
available/treatment is extremely expensive and the patient cannot afford it;
27 The issue of whether parents have the right to have their children tested for adult-onset
diseases, (as there is potential for conflict between a parent's choice and a child's
welfare);
28 There is also the related issue of who has the right to determine whether
newborns/others who are incapable of valid consent (eg. mentally incapacitated) should
undergo genetic screening;
29 The genetic tests may only indicate a probability/chance/not a certainty of a particular
polymorphism/allele being associated with a disease or condition/disease developing;

vi) Conceptual and philosophical implications regarding human responsibility, free will vs
genetic determinism, and concepts of health and disease. (Max 1)
30 The issue of to what extent is a persons behaviour influenced by his genome (instead
of the environment/choices)
31 The issue of defining what is considered a disorder and what is within the limits of
normality.

vii) Commercialization of products including property rights (patents, copyrights, and


trade secrets) and accessibility of data and materials. (Max 1)
32 The issue of whether genes/DNA sequences can be patented by companies/individuals;
33 Patents could impede the development of diagnostics (tests)/therapeutics (treatments)
by third parties because of the costs associated with using patented research data;
34 Designer drugs developed through pharmocogenomics / genetic tests / treatments
discriminates against the poor as they may be expensive/unaffordable;
@1 mk, max 4

pt24/ 29 mark once


[Total: 20]
ACJC 9648/03 Prelim 2013 [Turn over
91
1

H2 ANDERSON JUNIOR COLLEGE


HIGHER 2

CANDIDATE
NAME

PDG
PDG INDEX NUMBER

BIOLOGY 9648/01
Paper 1 Multiple Choice 4 September 2013

1 hour 15 mins

Additional Materials: Multiple Choice Answer Paper 40 marks

READ THESE INSTRUCTIONS FIRST


Write in soft pencil.
Do not use staples, paper clips, highlighters, glue or correction fluid.
Write your name, PDG and identification number on the Answer Sheet.

There are forty questions on this paper. Answer all questions. For each question there are four
possible answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer
Sheet.

Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.

Calculators may be used.

This document consists of 26 printed pages


92
2

1 Which row is correct for each of the components found on the cell surface membrane?

ion pump glycoprotein phospholipid cholesterol


A restrains the
a carrier protein has sugar chain contains 2 fatty acid
phospholipids
involves in active attached to the chains and a
movements at high
transport protein phosphate head only
temperatures
B contributes to the
pumps ions against is a receptor site for contains 4
fluidity of the
concentration gradient the signal ligand interconnecting rings
membrane
C cannot move freely may be saturated or
use ATP with the unsaturated fatty acid is a steroid
phospholipids chains
D unsaturated
has a hydrophilic hydrocarbon tails have is a lipid that does
for cell-to-cell
channel to allow ions kinks that allow the not contain fatty
recognition
to diffuse through molecules to pack acids
closely together
93
3
2 The electron micrograph shows two adjacent plant mesophyll cells with structures W to Z labeled.

Which of the following structure to function relationships is/ are correct?

Structure Function
I W Manufactures carbohydrates
II X Manufactures rRNA
III Y Regulates the movement of substances
IV Z Separates the cell from the external environment

A II only
B III only
C I and IV only
D II, III and IV only
94
4

3 Which molecule is found in glycogen?

4 The diagram represents molecules involved in protein synthesis.

Molecules 1,2 and 3 are formed as a result of

A dehydrogenation
B condensation
C enzymatic hydrolysis
D oxidation
95
5

5 An enzyme is completely denatured at 50 C. A fixed concentration of this enzyme is added to a fixed


concentration of its substrate. The time taken for completion of the reaction is measured at different
temperatures.

Which graph shows the results?


96
6
6 In an effort to identify allosteric inhibitors of caspases, close to 8,000 compounds were screened for
their ability to bind to a possible allosteric binding site in caspase 1 and inhibit the enzymes activity.
Each compound was designed to form a disulfide bond with a cysteine near the site in order to
stabilize the low-affinity interaction that is expected of an allosteric inhibitor.

Fig. 6.1.

X-ray diffraction analysis was used to determine the structure of caspase 1 when bound to one of the
inhibitors and to compare it with the active and inactive structures. The enzymes shape when one
such inhibitor was bound resembled the inactive caspase 1 more than the active form as shown in
Fig. 6.1.

Which of the following explains how the allosteric inhibitory site on caspase 1 controls enzymatic
activity?

A The inhibitor locks the enzyme in its inactive form.


B The inhibitor binds reversibly at a site other than the active site.
C The inhibitor binds to the active form and makes it inactive.
D The inhibitor allows caspase 1 to oscillate between catalytically active and inactive forms.
97
7
7 A cell (2n = 2) has some stages of nuclear divisions drawn which are randomly labelled I to VI.

The graph below represents one type of nuclear division.


Amount of
DNA

A C

Stages

Which stage corresponds to the different part of the graph correctly?

A Part A of graph stage III


B Part B of graph stage VI
C Part C of graph stage V
D Part D of graph stage IV

8 What is the basis for the difference in the synthesis of the leading and lagging strands of DNA
molecules?

1 The anti-parallel arrangement of the DNA strands.


2 The RNA primers are required to initiate DNA elongation.
3 DNA polymerase joins new nucleotides to the 3 end of the growing strand.
4 Helicase and single-stranded binding proteins work at the 5end of the DNA strand.

A 2 and 4
B 1 and 3
C 1 and 4
D 2 and 3
98
8
9 Three experiments were carried out to investigate the mode of DNA replication in bacteria.

Experiment 1: Bacteria were grown for many generations with only the light isotope of nitrogen,
14
N, and then allowed to replicate once with the light isotope, 15N.
Experiment 2: Bacteria were grown for many generations with only the heavy isotope of nitrogen,
15
N, and then allowed to replicate once with the light isotope, 14N.
Experiment 3: Bacteria were grown for many generations with only the heavy isotope of nitrogen,
15
N, and then allowed to replicate twice with the light isotope, 14N.

The figure shows possible DNA molecules U to Z and indicates the varying proportion of nitrogen
isotopes present in each DNA molecule.

Which of the following products shows the semi-conservative mode of DNA replication?

Experiment 1 Experiment 2 Experiment 3


A W W W and Y
B U W W and Y
C W W X and Z
D U W V and Z

10 An antibiotic, edeine, was isolated. It inhibits protein synthesis but has no effect on either DNA
synthesis or RNA synthesis. When added to a translation mixture containing fully intact organelles,
edeine stops haemoglobin translation after 10 seconds.
Analysis of the edeine-inhibited mixture by centrifugation showed that no polyribosomes remained by
the time protein synthesis had stopped. Instead, all the mRNA accumulated, together with small
ribosomal subunit and initiator tRNA.

What step in protein synthesis does edeine inhibit?

A It blocks translocation of the ribosome along the mRNA.


B It interferes with chain termination and release of peptide.
C It prevents formation of the translation initiation complex.
D It inhibits binding of amino-acyl-tRNAs to the A site of the ribosome.
99
9
11 The diagram below shows the process of translation.

Which of the following are correct?

1 The ribosome is translocating from right to left.


2 The diagram shows degeneracy of the genetic code.
3 The polypeptide does not dissociate immediately from the tRNA after histidine was
added.
4 The number of hydrogen bonds formed between the respective codons and
anticodons of the two tRNAs shown are equal.

A 1 and 4
B 1 and 2
C 2 and 3
D 2 and 4
100
10
12 The diagram below shows an electron micrograph of viruses entering into a T helper cell.

Which of following statements are true?

1 Most of the components found on the plasma membrane of X can be found on the envelope of
Y.
2 X and Y have the same type of nucleic acid.
3 Y enters by endocytosis.
4 Transduction occurs after Y successfully integrates its nucleic acid inside X.

A 1 only
B 1 and 3 only
C 2 and 4 only
D 3 and 4 only

13 Patients infected with the human immunodeficiency virus (HIV) tend to develop a cancer called
Kaposi Sarcoma. Which is the correct order of steps to explain how HIV causes this cancer?

1 Entry of Kaposi sarcoma herpes virus.


2 Double-stranded provirus integrated into host cell DNA.
3 Budding of HIV kills T helper cell.
4 Development of Acquired Immunodeficiency Disease Syndrome (AIDS).

A 1423
B 2314
C 1234
D 1243
101
11
14 The photomicrographs below show two different processes occurring in two different species of
bacteria.

Process 1 Process 2
Which of the following statements is/are true of both processes?
1 For both processes, only bacteria with genes that code for cytoplasmic bridge are involved.
2 Process 1 requires direct contact between 2 different bacteria whereas process 2 can occur
with 1 bacterium.
3 Process 1 will result in an increase in the number of identical bacteria whereas process 2 will
result in an increase in the number of different bacteria.
4 Both processes involve DNA replication.

A 1 and 3 only
B 2 and 4 only
C 1, 2 and 4 only
D All of the above

15 If glucose and lactose are both absent from the growth medium, and the lac structural genes are
expressed efficiently, what would you suspect about the condition of the E.coli cell?

1 The cell has a mutation in the operator of the lac operon.


2 The cell has a mutation in the lacI gene.
3 The cell has a mutation in the promoter of the lac structural gene.
4 The cell has a mutation in the Catabolite Activator Protein (CAP) binding site.

A 1 and 2 only
B 2 and 3 only
C 3 and 4 only
D 1, 2 and 4 only
102
12
16 The figure below shows the relative distributions of four types of mRNA molecules along the head-to-
tail axis in the cytoplasm of a Drosophila fertilized egg.

bicoid protein binds to the 3 untranslated region of caudal mRNA to interfere with the
interaction between 3 poly-A tail and 5 cap
bicoid protein is also a specific transcription factor that binds to the enhancer of the
hunchback gene
nanos protein inhibits translation of hunchback mRNA

Using the information given above, determine which one of the following graphs shows the relative
protein distribution along the head-to-tail axis of this fertilized egg.

B
103
13

17 In a laboratory, the 5 7-methylguanosine cap and the length of the polyA tail of an mRNA
transcript are altered in order to examine their effects on the number of functional proteins
translated.
mRNA Alteration
1 5 cap removed with 1000-adenine tail
2 5 cap removed with 500-adenine tail
3 5cap present with 500-adenine tail
4 5cap present with 300-adenine tail

Using the information given in the table above, predict the relative amount of protein
produced in the descending order (greatest least).

A 1,3,2,4
B 1,2,3,4
C 3,1,4,2
D 3,4,1,2
104
14
18 The diagram below illustrates the development of colorectal cancers.

Which of these statements can be inferred from this multistep model of carcinogenesis?

I Cells whose APC and -catenin genes are inactivated have lost density dependent inhibition.
II APC and -catenin genes are tumour suppressor genes.
III High levels of Ras protein are produced only when both copies of Ras gene are mutated.
IV Two copies of normal p53 alleles must be present to inhibit cell division.
V Gain-of-function mutation in COX-2 gene is a pre-requisite for the formation of carcinoma.

A I, II and III
B II, III and IV
C I, II and V
D II, III and V
105
15
19 Questions 19 and 20 refer to the following pedigree chart.

Blue eyes

Green eyes

Yellow eyes

Which of the following statements is true?

A Blue eyes are dominant.


B Individual 1 is homozygous.
C Individual 4 is homozygous.
D Yellow eyes are recessive to blue eyes.

20 Which of the following statements has a 50% chance of being true?

I One of the parents of individual 2 had the same phenotype as individual 2.


II If individual 10 married someone with green eyes, the first child would have green eyes.
III If individual 6 married a woman with green eyes, half of the offspring would have blue eyes.

A II only
B I and III only
C II and III only
D All of the above

21 In Shorthorn cattle, the allele for hornless is dominant to the allele for the presence of horns. Coat
colour can be red (genotype CRCR), roan (genotype CRCW) or white (genotype CWCW). A roan bull,
106
16
heterozygous for the hornless trait, is crossed with a cow of the same genotype.

What is the probability that a calf from this cross would have the same genotype as its parents?

A 1/4
B 3/8
C 1/2
D 3/4

22 A yellow flower, green-stemmed plant with the genotype YYrr was crossed with a white flower, red-
stemmed plant with the genotype yyRR. The F1 plants were allowed to self fertilise, A 2 test was
carried out on the results obtained for the F2 generation. Part of the table of values for 2 is shown.

The value of 2 in this investigation was 10.6.

What is the probability of this value of 2 and do the results fit the expected ratio?

results fit
probability
expected ratio
A between 0.01 and 0.05 No
B between 0.01 and 0.05 Yes
C between 0.05 and 0.1 Yes
D between 0.1 and 0.5 No
107
17

23 Fig. 23A and Fig. 23B show the results of two separate experiments on carbon dioxide fixation in
photosynthesis using a unicellular green alga and the radioactive isotope 14C to label carbon
dioxide. The algae were actively photosynthesizing before the start of both experiments.

Light Dark
R
Relative
quantity of
each
radioactive
labelled
substance
(Fig. 23A)
S

addition of time / s
14
CO2 14
CO2
Concentration
reduced
1% 14CO2 0.003% 14CO2

Relative
quantity of T
each
radioactive
labelled
substance
U
(Fig. 23B)

time / s

With reference to Fig. 23A and 23B, identify the graphs R, S, T, and U.

R S T U

A RuBP GP/PGA GP/PGA RuBP


B GP/PGA RuBP GP/PGA RuBP
C GP/PGA RuBP RuBP GP/PGA
D RuBP GP/PGA RuBP GP/PGA
108
18
24 Which of the following statements is true regarding cyclic and non-cyclic photophosphorylation?
A Cyclic photophosphorylation only requires light at 680nm to function optimally while non-
cyclic photophosphorylation requires light at both 680nm and 700nm to function optimally.
B Cyclic photophosphorylation is dependent on products generated through non-cyclic
photophosphorylation.
C The electrochemical gradient generated to drive ATP production by the non-cyclic is
different from that of the cyclic photophosphorylation.
D Only cyclic photophosphorylation can function in the absence of photosystem II.

25 When cyanide is bound to cytochrome oxidase, the cell can no longer produce ATP aerobically.
Which statement below best explains this?

A It prevents reduced NADP from being oxidised to NADP, hence preventing electron flow
down the electron transport chain.
B It prevents oxygen from accepting electrons and protons to form water, hence preventing
electron flow down the electron transport chain.
C It prevents photolysis from occurring to produce oxygen.
D It prevents pyruvate from being synthesised in glycolysis, hence stopping the Krebs cycle.

26 Which of the following shows correctly the differences in the products of glycolysis and Krebs cycle
per glucose molecule?

Glycolysis Krebs cycle

A 4ATP, 1 reduced NAD 4 reduced NAD, 1 reduced FAD, 1 ATP

B 4ATP, 2 reduced NAD 8 reduced NAD, 2reduced FAD, 2 ATP

C 2 net ATP, 1 reduced NAD 3 reduced NAD, 1 reduced FAD, 1 ATP

D 2 net ATP, 2 reduced NAD 6 reduced NAD, 2 reduced FAD, 2 ATP

27 Certain drugs act at synapses and affect the action of neurotransmitter substances. The table
shows the effects of four different drugs.

Drug Effect
1 Inhibits the enzyme cholinesterase
2 Prevents the release of acetylcholine
3 Opening of Ca2+ gates on the pre-synaptic membrane.
4 Binds to the post-synaptic membrane receptors.

Which of the two drugs would most likely to encourage the response from a skeletal response to an
electrical impulse arriving at the neuro-muscular junction?
A 1 and 3
B 1 and 4
C 2 and 3
D 2 and 4
109
19
28 What is the role of active transport in the transmission of nerve impulses by neurones?
A Propagates an action potential by pumping sodium ions across the membrane out of the
neurone.
B Propagates an action potential by pumping sodium ions across the membrane into the
neurone.
C Initiates the action potential needed for the transmission of an impulse by pumping calcium
ions out of the endoplasmic reticulum.
D Establishes the resting potential needed for the transmission of an impulse by pumping
sodium and potassium ions across the membrane.

29 Three proteins isolated from a human cell were investigated for their involvement in cell signalling
pathways.

Protein A Protein B Protein C


ATPase activity + - -
GTPase activity - - +
Kinase activity - + -
Trans-membrane Domain + + +

Key: (+) = present, (-) = absent

Which of the following correctly shows the identity of these three proteins?

Protein A Protein B Protein C


A Na+ - K+ Pumps Insulin receptor Glucagon Receptor
B Glucagon Receptor Insulin receptor Na+ - K+ Pump
C Na+ - K+ Pump Glucagon Receptor Insulin receptor
D Insulin receptor Glucagon Receptor Na+ - K+ Pump
110
20
30 The figure shows the relationship between glucose concentration in the blood and the
concentrations in the blood of the two hormones, Q and R.

Which hormones (Q and R) promote the processes shown?

conversion of glycogen to respiration of glucose in uptake of glucose by


glucose in liver cells liver cells muscle cells
A Q R Q
B Q R R
C R Q Q
D R Q R
111
21
31 Three pairs of enzymes and non-enzymatic proteins with similar primary structures are shown.

Enzyme Non-Enzymatic Protein

Which of the following correctly explains the type of structures for each pair?

A Analogous structures as they perform similar functions.


B Analogous structures as their tertiary structures are similar.
C Homologous structures as they perform different functions.
D Homologous structures as they are all polypeptides folded into a 3D configuration.
112
22
32 The volcanic islands that were formed millions of years ago, range from Kauai (the oldest) to
Hawaii (the youngest). Cytb gene from honey creepers and Yp1 gene from Drosophila were
analysed for divergence.

Which of the following statement is wrong?

A Geographical isolation prevented colonization of newly formed islands.


B There is a positive linear correlation between genetic distance and island age.
C Cytb gene and Yp1 gene are chosen because they are essential genes.
D Genetic drift is a factor that contributes to the increase in the mean genetic distance.

33 Which of the following describes the concept of gene flow correctly?

Plays a role in speciation Explains why population is Affects the strength of


the smallest unit to evolve selection pressure
A No No Yes
B No No No
C Yes Yes Yes
D Yes Yes No
113
23
34 The calls of six different species of frogs belonging to the Hyla genus are recorded and shown.

Which of the following can be inferred from the chart?

1 Frogs with more similar call patterns are more closely related.
2 A frog species can be identified by looking at the duration, intensity, and frequency of the
call.
3 The call of each species of frog acts as a selection pressure.
4 These calls are a form of isolation mechanism.

A 1 and 2 only
B 1, 2 and 4 only
C 1 and 3 only
D All of the above

35 Which primers should be paired to amplify, by PCR, the DNA flanked by the two indicated
sequences?
5 GGAATTCGT -- // -- AATGCTACC 3

A 5 ACGAATTCC 3 & 5 AATCGTACC 3


B 5 AATGCTACC 3 & 5 GGAATTCGT 3
C 5 GGTAGCATT 3 & 5 GGAATTCGT 3
D 5 ACGAATTCC 3 & 5 GGTAGCAAT 3
114
24
36 In people with a gene mutation where a base insertion has occurred, the protein formed has a very
different primary structure. To identify the presence of this mutant allele, DNA nucleotide sequences
were compared using gel electrophoresis. Read from the top to the bottom for the DNA sequence.
Heres an example:

Here is the DNA


sequence -
ATGCT

The electrophoresis result from the DNA of a normal allele of the gene is shown below.

Which diagram represents the DNA sequence for the mutant allele of this gene?
115
25
37 Genetic profiling can be used to determine the paternity of a child. DNA from the mother and the child
is cut into fragments, separated by electrophoresis and made visual using a stain. The diagram
shows the genetic profiles of a mother and child, and four possible fathers.

Who is the father?

38 Which of the following statements are TRUE about all stem cells?

1 Stem cells can be induced to differentiate by environmental signals.


2 Stem cells are easily isolated and propagated.
3 Stem cells are able to develop into whole organisms if implanted into the
womb.
4 Stem cells make more stem cells under appropriate conditions.

A 1 and 4
B 2 and 3
C 1, 3 and 4
D 1, 2, 3 and 4

39 Somaclonal variation may arise during in vitro culturing of plant tissues because

A crossing over occurs between homologous chromosomes during meiosis in the cultured
plant cells, leading to genetic recombination.

B some cells are committed to differentiation into specialized plant tissues, therefore may
silence the expression of certain genes.

C of increased rate of mutation due to high growth rate of cells which is induced by the large
amount of growth regulators used.

D pollinating insects inserts DNA sequences containing genes from other plant cells into the
cultured cells genome, leading to genetic variation.
116
26
40 Corn is a major crop grown in Europe. In the past, it was either ruined by attack from the corn borer
larvae or intensively sprayed with pesticides each year. The biotech company Novartis gained
approval to insert a Bt gene into corn. This gene codes for a protein that kills the larvae feeding on
the corn. The genetically engineered Bt corn initially thrived without the addition of any pesticides, but
later suffered damage from pests again.
Which of the following are possible reasons why the Bt corn is again under attack from pests?

I A strain of resistant larvae has emerged as a chance mutation. The frequency of the gene
conferring resistance as well as the number of larvae with resistance has increased. The Bt
gene is now ineffective.
II Corn is being attacked by other pests which are not killed by the Bt gene protein.
III The Bt allele has undergone insertional mutagenesis. This mutagenesis has had a selective
advantage in seed fertility.

A I and II only
B I and III only
C II and III only
D All of the above
117
1

H2 ANDERSON JUNIOR COLLEGE


HIGHER 2

CANDIDATE
NAME

PDG
PDG INDEX NUMBER

BIOLOGY 9648/01
Paper 1 Multiple Choice 4 September 2013

1 hour 15 mins

Additional Materials: Multiple Choice Answer Paper 40 marks

READ THESE INSTRUCTIONS FIRST


Write in soft pencil.
Do not use staples, paper clips, highlighters, glue or correction fluid.
Write your name, PDG and identification number on the Answer Sheet.

There are forty questions on this paper. Answer all questions. For each question there are four
possible answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer
Sheet.

Each correct answer will score one mark. A mark will not be deducted for a wrong answer.
Any rough working should be done in this booklet.

Calculators may be used.

This document consists of 26 printed pages


118
2

1 Which row is correct for each of the components found on the cell surface membrane?

ion pump glycoprotein phospholipid cholesterol


A restrains the
a carrier protein has sugar chain contains 2 fatty acid
phospholipids
involves in active attached to the chains and a
movements at high
transport protein phosphate head only
temperatures
B contributes to the
pumps ions against is a receptor site for contains 4
fluidity of the
concentration gradient the signal ligand interconnecting rings
membrane
C cannot move freely may be saturated or
use ATP with the unsaturated fatty acid Is a steroid
phospholipids chains
D unsaturated
has a hydrophilic hydrocarbon tails have is a lipid that does
for cell-to-cell
channel to allow ions kinks that allow the not contain fatty
recognition
to diffuse through molecules to pack acids
closely together
119
3

2 The electron micrograph shows two adjacent plant mesophyll cells with structures W to Z labeled.

Which of the following structure to function relationships is/ are correct?


Structure Function
I W Manufactures carbohydrates
II X Manufactures rRNA
III Y Regulates the movement of substances
IV Z Separates the cell from the external environment

A II only
B III only
C I and IV only
D II, III and IV only
120
4

3 Which molecule is found in glycogen?

4 The diagram represents molecules involved in protein synthesis.

Molecules 1,2 and 3 are formed as a result of


A dehydrogenation
B condensation
C enzymatic hydrolysis
D oxidation
121
5
5 An enzyme is completely denatured at 50 C. A fixed concentration of this enzyme is added to a fixed
concentration of its substrate. The time taken for completion of the reaction is measured at different
temperatures.

Which graph shows the results?


122
6
6 In an effort to identify allosteric inhibitors of caspases, close to 8,000 compounds were screened for
their ability to bind to a possible allosteric binding site in caspase 1 and inhibit the enzymes activity.
Each compound was designed to form a disulfide bond with a cysteine near the site in order to
stabilize the low-affinity interaction that is expected of an allosteric inhibitor.

Fig. 6.1.

X-ray diffraction analysis was used to determine the structure of caspase 1 when bound to one of the
inhibitors and to compare it with the active and inactive structures. The enzymes shape when one
such inhibitor was bound resembled the inactive caspase 1 more than the active form as shown in
Fig. 6.1.

Which of the following explains how the allosteric inhibitory site on caspase 1 controls enzymatic
activity?

A The inhibitor locks the enzyme in its inactive form.


B The inhibitor binds reversibly at a site other than the active site.
C The inhibitor binds to the active form and makes it inactive.
D The inhibitor allows caspase 1 to oscillate between catalytically active and inactive forms.
123
7
7 A cell (2n = 2) has some stages of nuclear divisions drawn which are randomly labelled I to VI.

The graph below represents one type of nuclear division.


Amount of
DNA

A C

Stages

Which stage corresponds to the different part of the graph correctly?

A Part A of graph stage III


B Part B of graph stage VI
C Part C of graph stage V
D Part D of graph stage IV

8 What is the basis for the difference in the synthesis of the leading and lagging strands of DNA
molecules?

1 The anti-parallel arrangement of the DNA strands.


2 The RNA primers are required to initiate DNA elongation.
3 DNA polymerase joins new nucleotides to the 3 end of the growing strand.
4 Helicase and single-stranded binding proteins work at the 5end of the DNA strand.

A 2 and 4
B 1 and 3
C 1 and 4
D 2 and 3
124
8
9 Three experiments were carried out to investigate the mode of DNA replication in bacteria.

Experiment 1: Bacteria were grown for many generations with only the light isotope of nitrogen,
14
N, and then allowed to replicate once with the heavy isotope, 15N.
Experiment 2: Bacteria were grown for many generations with only the heavy isotope of nitrogen,
15
N, and then allowed to replicate once with the light isotope, 14N.
Experiment 3: Bacteria were grown for many generations with only the heavy isotope of nitrogen,
15
N, and then allowed to replicate twice with the light isotope, 14N.

The figure shows possible DNA molecules U to Z and indicates the varying proportion of nitrogen
isotopes present in each DNA molecule.

Which of the following products shows the semi-conservative mode of DNA replication?

Experiment 1 Experiment 2 Experiment 3


A W W W and Y
B U W W and Y
C W W X and Z
D U W V and Z

10 An antibiotic, edeine, was isolated. It inhibits protein synthesis but has no effect on either DNA
synthesis or RNA synthesis. When added to a translation mixture containing fully intact organelles,
edeine stops haemoglobin translation after 10 seconds.
Analysis of the edeine-inhibited mixture by centrifugation showed that no polyribosomes remained by
the time protein synthesis had stopped. Instead, all the mRNA accumulated, together with small
ribosomal subunit and initiator tRNA.

What step in protein synthesis does edeine inhibit?

A It blocks translocation of the ribosome along the mRNA.


B It interferes with chain termination and release of peptide.
C It prevents formation of the translation initiation complex.
D It inhibits binding of amino-acyl-tRNAs to the A site of the ribosome.
125
9

11 The diagram below shows the process of translation.

Which of the following are correct?

1 The ribosome is translocating from right to left.


2 The diagram shows degeneracy of the genetic code.
3 The polypeptide does not dissociate immediately from the tRNA after histidine was
added.
4 The number of hydrogen bonds formed between the respective codons and
anticodons of the two tRNAs shown are equal.

A 1 and 4
B 1 and 2
C 2 and 3
D 2 and 4
126
10

12 The diagram below shows an electron micrograph of viruses entering into a T helper cell.

Which of following statements are true?

1 Most of the components found on the plasma membrane of X can be found on the envelope of
Y.
2 X and Y have the same type of nucleic acid.
3 Y enters by endocytosis.
4 Transduction occurs after Y successfully integrates its nucleic acid inside X.

A 1 only
B 1 and 3 only
C 2 and 4 only
D 3 and 4 only

13 Patients infected with the human immunodeficiency virus (HIV) tend to develop a cancer called
Kaposi Sarcoma. Which is the correct order of steps to explain how HIV causes this cancer?

1 Entry of Kaposi sarcoma herpes virus.


2 Double-stranded provirus integrated into host cell DNA.
3 Budding of HIV kills T helper cell.
4 Development of Acquired Immunodeficiency Disease Syndrome (AIDS).

A 1423
B 2314
C 1234
D 1243
127
11

14 The photomicrographs below show two different processes occurring in two different species of
bacteria.

Process 1 Process 2
Which of the following statements is/are true of both processes?
1 For both processes, only bacteria with genes that code for cytoplasmic bridge are involved.
2 Process 1 requires direct contact between 2 different bacteria whereas process 2 can occur
with 1 bacterium.
3 Process 1 will result in an increase in the number of identical bacteria whereas process 2 will
result in an increase in the number of different bacteria.
4 Both processes involve DNA replication.

A 1 and 3 only
B 2 and 4 only
C 1, 2 and 4 only
D All of the above

15 If glucose and lactose are both absent from the growth medium, and the lac structural genes are
expressed efficiently, what would you suspect about the condition of the E.coli cell?

1 The cell has a mutation in the operator of the lac operon.


2 The cell has a mutation in the lacI gene.
3 The cell has a mutation in the promoter of the lac structural gene.
4 The cell has a mutation in the Catabolite Activator Protein (CAP) binding site.

A 1 and 2 only
B 2 and 3 only
C 3 and 4 only
D 1, 2 and 4
128
12

16 The figure below shows the relative distributions of four types of mRNA molecules along the head-to-
tail axis in the cytoplasm of a Drosophila fertilized egg.

bicoid protein binds to the 3 untranslated region of caudal mRNA to interfere with the
interaction between 3 poly-A tail and 5 cap
bicoid protein is also a specific transcription factor that binds to the enhancer of the
hunchback gene
nanos protein inhibits translation of hunchback mRNA

Using the information given above, determine which one of the following graphs shows the relative
protein distribution along the head-to-tail axis of this fertilized egg.

B
129
13

17 In a laboratory, the 5 7-methylguanosine cap and the length of the polyA tail of an mRNA
transcript are altered in order to examine their effects on the number of functional proteins
translated.
mRNA Alteration
1 5 cap removed with 1000-adenine tail
2 5 cap removed with 500-adenine tail
3 5cap present with 500-adenine tail
4 5cap present with 300-adenine tail

Using the information given in the table above, predict the relative amount of protein
produced in the descending order (greatest least).

A 1,3,2,4
B 1,2,3,4
C 3,1,4,2
D 3,4,1,2
130
14
18 The diagram below illustrates the development of colorectal cancers.

Which of these statements can be inferred from this multistep model of carcinogenesis?

I Cells whose APC and -catenin genes are inactivated have lost density dependent inhibition.
II APC and -catenin genes are tumour suppressor genes.
III High levels of Ras protein are produced only when both copies of Ras gene are mutated.
IV Two copies of normal p53 alleles must be present to inhibit cell division.
V Gain-of-function mutation in COX-2 gene is a pre-requisite for the formation of carcinoma.

A I, II and III
B II, III and IV
C I, II and V
D II, III and V
131
15
19 Questions 19 and 20 refer to the following pedigree chart.

Blue eyes

Green eyes

Yellow eyes

Which of the following statements is true?

A Blue eyes are dominant.


B Individual 1 is homozygous.
C Individual 4 is homozygous.
D Yellow eyes are recessive to blue eyes.

20 Which of the following statements has a 50% chance of being true?

I One of the parents of individual 2 had the same phenotype as individual 2.

II If individual 10 married someone with green eyes, the first child would have green eyes.

III If individual 6 married a woman with green eyes, half of the offspring would have blue eyes.

A II only
B I and III only
C II and III only
D All of the above
132
16
21 In Shorthorn cattle, the allele for hornless is dominant to the allele for the presence of horns. Coat
colour can be red (genotype CRCR), roan (genotype CRCW) or white (genotype CWCW). A roan bull,
heterozygous for the hornless trait, is crossed with a cow of the same genotype.

What is the probability that a calf from this cross would have the same genotype as its parents?

A 1/4
B 3/8
C 1/2
D 3/4

22 A yellow flower, green-stemmed plant with the genotype YYrr was crossed with a white flower,
red-stemmed plant with the genotype yyRR. The F1 plants were allowed to self fertilise, A 2
test was carried out on the results obtained for the F2 generation. Part of the table of values for
2 is shown.

The value of 2 in this investigation was 10.6.


What is the probability of this value of 2 and do the results fit the expected ratio?

results fit
probability
expected ratio
A between 0.01 and 0.05 No
B between 0.01 and 0.05 Yes
C between 0.05 and 0.1 Yes
D between 0.1 and 0.5 No
133
17

23 Fig. 23A and Fig. 23B show the results of two separate experiments on carbon dioxide fixation in
photosynthesis using a unicellular green alga and the radioactive isotope 14C to label carbon
dioxide. The algae were actively photosynthesizing before the start of both experiments.

Light Dark
R
Relative
quantity of
each
radioactive
labelled
substance
(Fig. 23A)
S

addition of time / s
14
CO2 14
CO2
Concentration
reduced
1% 14CO2 0.003% 14CO2

Relative
quantity of T
each
radioactive
labelled
substance
U
(Fig. 23B)

time / s

With reference to Fig. 23A and 23B.identify the graphs R, S, T, and U.

R S T U

A RuBP GP/PGA GP/PGA RuBP


B GP/PGA RuBP GP/PGA RuBP
C GP/PGA RuBP RuBP GP/PGA
D RuBP GP/PGA RuBP GP/PGA
134
18
24 Which of the following statements is true regarding cyclic and non-cyclic photophosphorylation?
A Cyclic photophosphorylation only requires light at 680nm to function optimally while non-
cyclic photophosphorylation requires light at both 680nm and 700nm to function optimally.
B Cyclic photophosphorylation is dependent on products generated through non-cyclic
photophosphorylation.
C The electrochemical gradient generated to drive ATP production by the non-cyclic is
different from that of the cyclic photophosphorylation.
D Only cyclic photophosphorylation can function in the absence of photosystem II.

25 When cyanide is bound to cytochrome oxidase, the cell can no longer produce ATP aerobically.
Which statement below best explains this?

A It prevents reduced NADP from being oxidised to NADP, hence preventing electron flow
down the electron transport chain.
B It prevents oxygen from accepting electrons and protons to form water, hence preventing
electron flow down the electron transport chain.
C It prevents photolysis from occurring to produce oxygen.
D It prevents pyruvate from being synthesised in glycolysis, hence stopping the Krebs cycle.

26 Which of the following shows correctly the differences in the products of glycolysis and Krebs cycle
per glucose molecule?

Glycolysis Krebs cycle

A 4ATP, 1 reduced NAD 4 reduced NAD, 1 reduced FAD, 1 ATP

B 4ATP, 2 reduced NAD 8 reduced NAD, 2reduced FAD, 2 ATP

C 2 net ATP, 1 reduced NAD 3 reduced NAD, 1 reduced FAD, 1 ATP

D 2 net ATP, 2 reduced NAD 6 reduced NAD, 2 reduced FAD, 2 ATP

27 Certain drugs act at synapses and affect the action of neurotransmitter substances. The table
shows the effects of four different drugs.

Drug Effect
1 Inhibits the enzyme cholinesterase
2 Prevents the release of acetylcholine
3 Opening of Ca2+ gates on the pre-synaptic membrane.
4 Binds to the post-synaptic membrane receptors.

Which of the two drugs would most likely to encourage the response from a skeletal response to an
electrical impulse arriving at the neuro-muscular junction?
A 1 and 3
B 1 and 4
C 2 and 3
D 2 and 4
135
19
28 What is the role of active transport in the transmission of nerve impulses by neurones?
A Propagates an action potential by pumping sodium ions across the membrane out of the
neurone.
B Propagates an action potential by pumping sodium ions across the membrane into the
neurone.
C Initiates the action potential needed for the transmission of an impulse by pumping calcium
ions out of the endoplasmic reticulum.
D Establishes the resting potential needed for the transmission of an impulse by pumping
sodium and potassium ions across the membrane.

29 Three proteins isolated from a human cell were investigated for their involvement in cell signalling
pathways.

Protein A Protein B Protein C


ATPase activity + - -
GTPase activity - - +
Kinase activity - + -
Trans-membrane Domain + + +

Key: (+) = present, (-) = absent

Which of the following correctly shows the identity of these three proteins?

Protein A Protein B Protein C


A Na+ - K+ Pumps Insulin receptor Glucagon Receptor
B Glucagon Receptor Insulin receptor Na+ - K+ Pump
C Na+ - K+ Pump Glucagon Receptor Insulin receptor
D Insulin receptor Glucagon Receptor Na+ - K+ Pump
136
20
30 The figure shows the relationship between glucose concentration in the blood and the
concentrations in the blood of the two hormones, Q and R.

Which hormones (Q and R) promote the processes shown?

conversion of glycogen to respiration of glucose in uptake of glucose by


glucose in liver cells liver cells muscle cells
A Q R Q
B Q R R
C R Q Q
D R Q R
137
21
31 Three pairs of enzymes and non-enzymatic proteins with similar primary structures are shown.

Enzyme Non-Enzymatic Protein

Which of the following correctly explains the type of structures for each pair?

A Analogous structures as they perform similar functions.


B Analogous structures as their tertiary structures are similar.
C Homologous structures as they perform different functions.
D Homologous structures as they are all polypeptides folded into a 3D configuration.
138
22
32 The volcanic islands that were formed millions of years ago, range from Kauai (the oldest) to
Hawaii (the youngest). Cytb gene from honey creepers and Yp1 gene from Drosophila were
analysed for divergence.

Which of the following statement is wrong?

A Geographical isolation prevented colonization of newly formed islands.


B There is a positive linear correlation between genetic distance and island age.
C Cytb gene and Yp1 gene are chosen because they are essential genes.
D Genetic drift is a factor that contributes to the increase in the mean genetic distance.

33 Which of the following describes the concept of gene flow correctly?

Plays a role in speciation Explains why population is Affects the strength of


the smallest unit to evolve selection pressure
A No No Yes
B No No No
C Yes Yes Yes
D Yes Yes No
139
23
34 The calls of six different species of frogs belonging to the Hyla genus are recorded and shown.

Which of the following can be inferred from the chart?

1 Frogs with more similar call patterns are more closely related.
2 A frog species can be identified by looking at the duration, intensity, and frequency of the
call.
3 The call of each species of frog acts as a selection pressure.
4 These calls are a form of isolation mechanism.

A 1 and 2 only
B 1, 2 and 4 only
C 1 and 3 only
D All of the above

35 Which primers should be paired to amplify, by PCR, the DNA flanked by the two indicated
sequences?
5 GGAATTCGT -- // -- AATGCTACC 3

A 5 ACGAATTCC 3 & 5 AATCGTACC 3


B 5 AATGCTACC 3 & 5 GGAATTCGT 3
C 5 GGTAGCATT 3 & 5 GGAATTCGT 3
D 5 ACGAATTCC 3 & 5 GGTAGCAAT 3
140
24
36 In people with a gene mutation where a base insertion has occurred, the protein formed has a very
different primary structure. To identify the presence of this mutant allele, DNA nucleotide sequences
were compared using gel electrophoresis. Read from the top to the bottom for the DNA sequence.
Heres an example:

Here is the DNA


sequence -
ATGCT

The electrophoresis result from the DNA of a normal allele of the gene is shown below.

Which diagram represents the DNA sequence for the mutant allele of this gene?
141
25
37 Genetic profiling can be used to determine the paternity of a child.

DNA from the mother and the child is cut into fragments, separated by electrophoresis and made
visual using a stain.

The diagram shows the genetic profiles of a mother and child, and four possible fathers.

Who is the father? B

38 Which of the following statements are TRUE about all stem cells?

1 Stem cells can be induced to differentiate by environmental signals.


2 Stem cells are easily isolated and propagated.
3 Stem cells are able to develop into whole organisms if implanted into the
womb.
4 Stem cells make more stem cells under appropriate conditions.

A 1 and 4
B 2 and 3
C 1, 3 and 4
D 1, 2, 3 and 4

39 Somaclonal variation may arise during in vitro culturing of plant tissues because

A crossing over occurs between homologous chromosomes during meiosis in the cultured
plant cells, leading to genetic recombination.

B some cells are committed to differentiation into specialized plant tissues, therefore may
silence the expression of certain genes.

C of increased rate of mutation due to high growth rate of cells which is induced by the large
amount of growth regulators used.

D pollinating insects inserts DNA sequences containing genes from other plant cells into the
cultured cells genome, leading to genetic variation.
142
26

40 Corn is a major crop grown in Europe. In the past, it was either ruined by attack from the corn borer
larvae or intensively sprayed with pesticides each year. The biotech company Novartis gained
approval to insert a Bt gene into corn. This gene codes for a protein that kills the larvae feeding on
the corn. The genetically engineered Bt corn initially thrived without the addition of any pesticides, but
later suffered damage from pests again.
Which of the following are possible reasons why the Bt corn is again under attack from pests?

I A strain of resistant larvae has emerged as a chance mutation. The frequency of the gene
conferring resistance as well as the number of larvae with resistance has increased. The Bt
gene is now ineffective.
II Corn is being attacked by other pests which are not killed by the Bt gene protein.
III The Bt allele has undergone insertional mutagenesis. This mutagenesis has had a selective
advantage in seed fertility.

A I and II only
B I and III only
C II and III only
D All of the above
143
27
Paper 1 Answer scheme

Qns Ans Remarks Qns Ans Remarks


1 B 21 A
2 A 22 A
3 B 23 D
4 B 24 D
5 C 25 B
6 A 26 D
7 C 27 C
8 B 28 D
9 A 29 A
10 C 30 B
11 C 31 C
12 A 32 A
13 B 33 D
14 B 34 B
15 A 35 C
16 D 36 B
17 D 37 B
18 C 38 A
19 C 39 C
20 A 40 D
144

H2 ANDERSON JUNIOR COLLEGE


HIGHER 2

CANDIDATE
NAME

PDG
PDG INDEX NUMBER

BIOLOGY
9648/02
Paper 2 Core Paper 17 September 2013

2 hours

Additional Materials: Answer Paper

READ THESE INSTRUCTIONS FIRST


Write your name and PD group on all the work you hand in.
Write in dark blue or black pen. For Examiners Use
You may use a soft pencil for any diagrams, graph or rough working.
Do not use paper clips, highlighters, glue or correction fluid. Section A 80

1
Section A
Answer all questions. 2

Section B 3
Answer any one question.
4
All working for numerical answers must be shown. 5
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or 6
part question.
7
Calculators may be used
Section B 20

8/9

Total 100

This document consists of 19 printed pages.


145

Section A
Answer all the questions in this section.

1(a) In a DNA structure, what do 5 and 3 represent. [2]

(b) The nitrogenous bases of the double helix are paired in specific combinations:

adenine (A) with thymine (T)


guanine (G) with cytosine (C)

It was mainly by trial and error that Watson and Crick arrived at this key feature of DNA. At first,
Watson imagined that the bases paired like with likefor example, A with A. But this model was
inconsistent with the uniform width of the double helix.

Explain why the earlier DNA model would have inconsistent width. [3]

(c) DNA replicates semi-conservatively by the two strands separating and forming templates for the
synthesis of two new strands.

In addition to the template provided by the DNA, describe the role of two other types of factors that
are required for DNA replication. [2]

.
146

3
(d) Just as a DNA strand provides a template for making a new complementary strand during DNA
replication, it also can serve as a template for transcription.

Fig. 1.1 is a diagrammatic representation of the process of transcription.

Fig. 1.1

Identify molecule E, F and H. [1]

(i) Describe how the structure of molecule E is adapted to its role in transcription. [3]

.
147

(ii) Describe one way by which the structure of molecule(s) F, which is / are adapted for [1]
transcription, differs from that of amino acids, which are adapted for translation.

[Total : 12]
148

2 Influenza A viruses are divided into subtypes based on two proteins on the surface of the
virus: haemagglutinin (HA) and neuraminidase (NA). The influenza A (H7N9) virus designation of
H7N9 identifies it as having HA of the H7 subtype and NA of the N9 subtype.

(a) Describe the roles of haemagglutinin (HA) and neuraminidase (NA) in the reproductive cycle of the
influenza (H7N9) virus. [2]

(b) (i) The influenza genome comprises genes for RNA polymerase. How is the virus RNA
polymerase different from the host RNA polymerase? [1]

(ii) Explain the role of the viral RNA polymerase in the reproductive cycle. [3]

(c) H7N9 is an avian influenza virus but it is also able to infect mammals.

Suggest changes that may have occurred to give H7N9 greater ability to infect mammals. [2]

.
149

6
(d) While the influenza genome comprises 8 distinct linear segments of negative sense ssRNA,
bacterial genome consists of chromosome and plasmid. Operons are needed for the regulation of
gene expression.

Suggest why operons give bacteria a selective advantage. [3]

[Total : 11]
150

3 In normal person, the fragile X mental retardation protein (FMRP), regulates the synthesis of neurone
proteins by stopping ribosomal translocation on target mRNAs. Fig 3.1 shows how patients with fragile
X syndrome (FXS) have non-functional FMRP, resulting in accelerated synaptic protein synthesis that
leads to abnormal synaptic function and intellectual disability.

NonfunctionalFMRP(FXS)

Fig. 3.1

(a) Describe how polysomes are formed. [2]

..

..

..

(b) (i) State the level of control by FMRP on synaptic protein expression. [1]


151

(ii) Describe one other control mechanism of a similar level as (b)(i). [2]

(iii) Explain how FMRP stops the ribosome from translocation. [2]

(c) Initial gene therapy trial uses a short stretch of anti-sense RNA. Explain how this will help to
reduce the symptom of FXS. [2]

..

..

..

..

(d) Synaptic proteins that are folded wrongly are usually degraded.

Suggest the advantages of degrading proteins that are wrongly folded. [2]

..

..

..

[Total : 11]
152

4 Severe combined immunodeficiency (SCID) results from defects in signaling downstream of


cytokine receptors that contain the common cytokine-receptor -chain (c). c is a component of
the receptors (R) for many interleukin such as interleukin-2 (IL-2) and IL-7.

Fig. 4.1 shows the events in the JAK-STAT cell signaling pathway when cytokine binds and this in
turn leads to an activated receptor. Fig. 4.2 shows two causes that could lead to a non-functional
receptor.

Fig. 4.1 Fig. 4.2

(a) Explain why transmembrane proteins such as the cytokine receptor are especially suited for a role
in cell signalling. [2]

(b) With reference to Fig. 4.1, suggest when happens after cytokine binds to the receptor. [2]

.
153

10

(c) With reference to Fig. 4.2, explain how a change in the sequence of the DNA nucleotide may
affect the signaling downstream of cytokine receptors. [5]

(d) Proteins synthesized by ribosomes attached to the endoplasmic reticulum may be embedded in
the cell surface membrane. Outline the route taken by such a protein. [3]

[Total: 12]
154

11

5 Chickens have a structure called a comb on their heads. The drawings show two types of comb.

Fig. 5.1

The shape of the comb is controlled by two alleles of one gene. The allele for pea comb, A, is
dominant to the allele for single comb, a. The colour of chicken eggs is controlled by two alleles of
a different gene. The allele for blue eggs, B, is dominant to the allele for white eggs, b.

The genes for comb shape and egg colour are situated on the same chromosome.

A farmer crossed a chicken that had pea comb and produced blue eggs with a chicken that had a
single comb and produced white eggs. The chicken that had a pea comb and produced blue eggs
are the offspring of the cross between pure bred pea comb, blue eggs and pure bred single comb,
white eggs.

(a) Construct a genetic diagram to illustrate the above cross. [3]


155

12

(b) The farmer could identify which of the female offspring from this cross would eventually produce
blue eggs. Explain how. [2]

(c) However, in certain crosses, the farmer was not able to identify the female offspring which will
produce blue eggs. Explain why. [2]

.
156

13

(e) In chickens the males are the homogametic sex while the females are the heterogametic sex.

A gene on the X chromosome controls the rate of feather production. The allele for slow feather
production, F, is dominant to the allele for rapid feather production, f.

A farmer made a cross between two chickens with known genotypes. He chose these chickens so
that he could tell the sex of the offspring soon after they hatched by looking at their feathers.

Which of the crosses shown in the table did he make? Explain your answer.

Fig. 5.3 [2]

(f) Female chickens are more likely than male chickens to show recessive sex-linked characteristics.
Explain why. [2]

[Total: 11]
157

14

6 Table 6.1 shows the approximate percentage of protein in different membranes.

Table 6.1

Organelle Membrane Protein as a percentage of dry weight


Chloroplast Outer membrane 54
Chloroplast Inner membrane 70
Mitochondrion Outer membrane 55
Mitochondrion Inner membrane 80

(a) Describe one way in which the distribution of protein in the inner and outer membranes of these
two organelles is similar.

Suggest a reason for this similarity. [2]

..

..

..

..

..

(b) (i) Atrazine is a widely used herbicide (weedkiller). It binds to a chloroplast protein involved in
electron transfer between photosystems.

Explain how atrazine works as an effective herbicide. [4]


158

15

(ii) Maize plants are insensitive to atrazine.

The cytoplasm of maize plant cells contains a tripeptide which binds to atrazine. The product
is then transported to the vacuole.

Suggest why maize plants are insensitive to atrazine. [2]

(c) At the end of photosynthesis, glyceraldehyde 3-phosphate (3-carbon sugar) is produced by the [3]
Calvin cycle, which is subsequently converted into starch for storage.

Discuss the suitability of starch as a storage compound in plants.

..

..

..

..

..

..

[Total : 11]
159

16

7 The marine threespine sticklebacks, Gasterosteus aculeatus is a freshwater fish living in the
lakes of British Columbia, Canada as shown in Fig. 7.1.

Fig. 7.1

In order to investigate the process of speciation in these populations, three small lakes were
studied. Each lake contained two varieties of stickleback: a large, bottom-dwelling variety that
fed on invertebrates near the shore and a small, plankton-eating variety that lived in the open
water. The probability of breeding between pairs of individuals was measured under laboratory
conditions in the following breeding combinations:

I different varieties from the same lake


II different varieties from different lakes
III same variety from different lakes
IV same variety from the same lake

The data are summarized in Fig. 7.1 below.

Fig. 7.1
160

17

(a) (i) Identify the highest and lowest probabilities of breeding for individuals of the same variety
from different lakes. [1]

..

...

(ii) With reference to Fig. 7.1, describe the differences in probability of breeding between
individuals from the same lake. [2]

..

..

..

..

(b) Scientists concluded that speciation is taking place in these populations. Explain the type of
speciation as shown in Fig. 7.1. [4]

..

..

..

..

..

..

(c) With reference to Fig. 7.1, explain why all the individuals are still considered the same species. [2]

..

..

..
161

18

(d) The freshwater lakes also contain many different types of parasites that infect the marine
threespine sticklebacks. Suggest why these parasites help to speed up speciation of the marine
threespine sticklebacks. [3]

..

..

..

..

[Total : 12]
162

19

Section B
Answer one question.
Write your answers on the separate answer paper provided.
Your answer should be illustrated by large, clearly labeled diagrams, where appropriate.
Your answers must be in continuous prose, where appropriate.
Your answers must be set out in section (a), (b) etc., as indicated in the question.

8 (a) Explain how the positive and negative control of the lac operon affect bacteria growth. [10]

(b) Describe how regulation of blood glucose level in humans involves cAMP. [5]

(c) Explain the significance of the steps in glycolysis. [5]

9 (a) Describe the differences between cellulose synthase and cellulose. [5]

(b) With reference to photosynthesis and cellular respiration, explain the importance of
compartmentalization within a plant cell. [10]

(c) Explain the role of meiosis in natural selection. [5]


163

H2 ANDERSON JUNIOR COLLEGE


HIGHER 2

CANDIDATE ANSWERS
NAME

PDG
PDG INDEX NUMBER

BIOLOGY
9648/02
Paper 2 Core Paper 17 September 2013

2 hours

Additional Materials: Answer Paper

READ THESE INSTRUCTIONS FIRST


Write your name and PD group on all the work you hand in.
Write in dark blue or black pen. For Examiners Use
You may use a soft pencil for any diagrams, graph or rough working.
Do not use paper clips, highlighters, glue or correction fluid. Section A 80

1
Section A
Answer all questions. 2

Section B 3
Answer any one question.
4
All working for numerical answers must be shown. 5
At the end of the examination, fasten all your work securely together.
The number of marks is given in brackets [ ] at the end of each question or 6
part question.
7
Calculators may be used
Section B 20

8/9
Total 100

This document consists of 19 printed pages.


164
2

Section A
Answer all the questions in this section.

1(a) Explain why replication only occurs in a 5 to 3 direction. [2]


Shape of active site of DNA polymerase;
Needs 3OH end to initiate;
Primers only add at 3;

In a DNA structure, what do 5 and 3 represent. [2]


5 represents end (of strand of nucleotide) with free carbon 5 (on deoxyribose) having
phosphate group
3 represents end (of strand of nucleotide) with free carbon 3 (on deoxyribose) having
hydroxyl group
Antiparallel
(b) The nitrogenous bases of the double helix are paired in specific combinations: [3]
adenine (A) with thymine (T)
guanine (G) with cytosine (C)

It was mainly by trial and error that Watson and Crick arrived at this key feature of DNA. At first,
Watson imagined that the bases paired like with likefor example, A with A. But this model was
inconsistent with the uniform width of the double helix.

Explain why the earlier DNA model would have inconsistent width.
purines (A and G) are twice as wide as pyrimidines (C and T)
purines (A and G) are nitrogenous bases with two organic rings
pyrimidines (C and T) are single ring nitrogenous bases.
A purine-purine pair is too wide and a pyrimidine-pyrimidine pair too narrow to account for a
uniform (2-nm) diameter of the double helix.
Always pairing a purine with a pyrimidine results in a uniform width.
[Any 3]

(c) DNA replicates semi-conservatively by the two strands separating and forming templates for the
synthesis of two new strands.
[2]
In addition to the template provided by the DNA, describe the role of two other types of factors that
are required for DNA replication.
Presence of enzymes to catalyse the processes: (Any one enzyme)
1. Helicase
Unzipping of DNA double helix so that DNA molecule can be separated in order to create
replicating bubble/fork.
2. Topoisomerase
breaking, swiveling and rejoining DNA strands to relieve DNA strains during unwinding
3. DNA Polymerase
Addition of free deoxyribonucleotides for elongation of the new DNA strand.
4. DNA ligase
form phosphodiester bonds between adjacent deoxyribonucleotides to join the Okazaki
fragments.
5. Primase (Reject RNA primase N2010 comments)
to synthesise the RNA primers to provide free 3OH for DNA Polymerase to elongate the
new DNA strand
165
3
Free deoxyribonucleotides / deoxyribonucleoside triphosphate
6. to provide building blocks for the synthesis of new DNA strand
7. to provide free 5 Phosphate group for formation of phosphodiester bond with existing DNA
strand.

RNA primers
provide free 3OH for DNA Polymerase to elongate the new DNA strand

Single stranded binding proteins


to prevent the DNA from reannealing so that DNA Polymerase can bind / allow complementary
base-pairing

ATP
When a nucleoside triphosphate links to the sugar phosphate molecule backbone of a growing
DNA strand, it losses two of its phosphates as a pyrophosphate molecules. Hydrolysis of the bond
between the phosphate groups provides energy for the reaction.

NOTE: Enzymes are consider as ONE group of factors thus only a maximum of 1 mark will be
awarded if students mention more than 1 type of enzymes with explanation.

(d) Just as a DNA strand provides a template for making a new complementary strand during DNA
replication, it also can serve as a template for transcription.

Fig. 1.1 is a diagrammatic representation of the process of transcription.

Fig. 1.1

Identify molecule E, F and H. [1]


166
4
E RNA polymerase
F RNA nucleotides/ Ribonucleoside triphosphate/nucleoside triphosphate
H mRNA

1m for all 3 correct answers;

(i) Describe how the structure of molecule E is adapted to its role in transcription. [3]

1. molecule E has a specific active site which is complementary to substrate such as DNA
template, ribonucleotides;
2. R groups of (contact) amino acid residues forms weak (ionic) bonds with substrate;
3. R groups of (catalytic) amino acid residues; that catalyses phosphoester bond formation
between growing RNA strand and incoming free nucleotide;
4. funnel allows entry of nucleoside triphosphates;
5. rudder separates the RNADNA hybrid;

(ii) Describe one way by which the structure of molecule(s) F, which is / are adapted for [1]
transcription, differs from that of amino acids, which are adapted for translation.

1. a molecule of F (NTP) is made of a ribose sugar, phosphate group and nitrogenous base (also
accept ribulose triphosphate nucleoside (ribose sugar, 3 phosphates, nitrogeneous base); but
an amino acid is made of a central carbon attached to H group, R group, amine group,
carboxyl group;

2. identity of molecule F is determined by identity of nitrogenous base; but identity of amino acid
is determined by identity of Rgroup;

3. Molecule F has 4 different types (A, U, G, C) while amino acid has 20 different types (distinct R
group).
[Any 1 pt]

[Total : 12]
167
5

2 Influenza A viruses are divided into subtypes based on two proteins on the surface of the
virus: haemagglutinin (HA) and neuraminidase (NA). The influenza A (H7N9) virus designation of
H7N9 identifies it as having HA of the H7 subtype and NA of the N9 subtype.

(a) Describe the roles of haemagglutinin (HA) and neuraminidase (NA) in the reproductive cycle of the
influenza (H7N9) virus. [2]
Haemagglutinin facilitates attachment of virus to host cell membrane by binding to specific
sialic acid receptors on epithelial cells.

Neuraminidase facilitates the release of newly formed virus from the infected host cell by
cleaving the sialic acid receptors.

(b) (i) The influenza genome comprises genes for RNA polymerase. How is the virus RNA
polymerase different from the host RNA polymerase? [1]
host RNA polymerase is a DNA-dependent RNA polymerase, while the virus RNA
polymerase is a RNA-dependent RNA polymerase

(ii) Explain the role of the viral RNA polymerase in the reproductive cycle.
[3]
The viral RNA polymerase synthesizes (accept transcribes) complementary ssRNA (+)
using ssRNA (-) as a template.
These complementary ssRNA(+) strands serve as:
mRNAs for eventual translation into viral proteins in the cytoplasm using the host cell
ribosomes; and
templates for making new copies of the ssRNA (-) genome in the nucleus.

(c) H7N9 is an avian influenza virus but it is also able to infect mammals.

Suggest changes that may have occurred to give H7N9 greater ability to infect mammals.
[2]
Caused by mutations to haemagglutinin gene during the replication of viral RNA
Antigenic drift occurs when accumulation of mutations result in a gradual change to
haemagglutinin (HA)
change shape / conformation/ configuration of the haemagglutinin glycoprotein in H7N9
Shape of haemagglutinin have better fit / more complementary to shape of specific receptors
on human host cells

Haemagglutinin of H7N9 was previously only able to bind to sialic acid on epithelial cells of birds.
However, H7N9 has now acquired the ability to bind to sialic acid on epithelial cells of mammals.
Given that both avian and human influenza strains can infect pigs at the same time, suggest how
H7N9 acquired the ability to infect mammals.

Single cell infected with different types of viruses at the same time;
During viral assembly there could be random assembly of RNA segments from different influenza
viruses;
Leading to novel gene combinations/genetic shift;
168
6

(d) While the influenza genome comprises 8 distinct linear segments of negative sense ssRNA,
bacterial genome consists of chromosome and plasmid. Operons are needed for the regulation of
gene expression.

Suggest why operons give bacteria a selective advantage. [3]


Genes of the same metabolic pathways grouped together for control of gene repression/gene
switching
So that bacterium only produces enzymes when required.
Preventing waste of energy/ resources.
bacteria able to use a variety of sugars/ substrates as they contain different operons.
bacteria can respond to environmental change quickly

R description of selective advantage eg. increase in frequency, pass on alleles to next generation.

[Total : 11]
169
7

3 In normal person, the fragile X mental retardation protein (FMRP), regulates the synthesis of neurone
proteins by stopping ribosomal translocation on target mRNAs. Fig 3.1 shows how patients with fragile
X syndrome (FXS) have non-functional FMRP, resulting in accelerated synaptic protein synthesis that
leads to abnormal synaptic function and intellectual disability.

Non-functional FMRP (FXS)

Fig. 3.1

(a) Describe how polysomes are formed.

Ribosome attaches to AUG start codon;


Another ribosome then attaches to AUG as the preceding ribosome translocates from 5 to 3
direction of mRNA;

Comments:
The question asked how are polysomes formed and not what are polysomes or why
do polysomes form. Hence, answers related to beads on the string structure,
polysomes are multiple ribosomes on an mRNA, and they undergo translation
simultaneously to speed up translation are not accepted. [2]

(b) (i) State the level of control by FMRP on synaptic protein expression.
Translational control;

Comments:
This was generally well answered by the majority. Those who got it wrong either identified
the wrong stage of control or answered positive and negative control. [1]
170
8
(ii) Describe one other control mechanism of a similar level as (b)(i).

Presence of translation initiation factors;


Facilitates the initiation of translation;

OR
Binding of translational repressors/ regulatory proteins to 5UTR/ covers AUG;
Prevents the initiation of translation/ assembly of ribosome;

OR
Polyadenylation/ Addition of poly(A) tail;
A longer polyA tail increases the half life of mRNA so more translation;
[2]
(iii) Explain how FMRP stops the ribosome from translocation.

FMRP has a specific binding site complementary in shape to a specific mRNA base
sequence/ codon;
Physically blocks / steric hindrance to ribosome;
Accept: FMRP has amino acid R groups that attach to mRNA by weak hydrogen/ ionic
bonds;

(c) Initial gene therapy trial uses a short stretch of anti-sense RNA. Explain how this will help to
reduce the symptom of FXS.
[2]
Anti-sense RNA binds by complementary base pairing;
Ref to binding to same stretch of mRNA bases that FMRP binds (to cause the same effect of
stopping ribosomal translocation);
(d) Synaptic proteins that are folded wrongly are usually degraded.

Suggest the advantages of degrading proteins that are wrongly folded.


Can recycle amino acids for other protein synthesis;
Regulate cellular processes by removing enzymes and regulatory proteins that are no
longer needed;
Prevent accumulation of unwanted protein in the cytoplasm;
(Any 2)

Comments:
Some candidates suggested preventing the wrongly folded protein from causing a phenotypic
effect. This is not accepted because usually wrongly folded protein is non-functional and would
not cause any phenotypic effect. [2]
[Total : 11]
171
9

4 Severe combined immunodeficiency (SCID) results from defects in signaling downstream of


cytokine receptors that contain the common cytokine-receptor -chain (c). c is a component of
the receptors (R) for many interleukin such as interleukin-2 (IL-2) and IL-7.

Fig. 4.1 shows the events in the JAK-STAT cell signaling pathway when cytokine binds and this in
turn leads to an activated receptor. Fig. 4.2 shows two causes that could lead to a non-functional
receptor.

Fig. 4.1 Fig. 4.2

(a) Explain why transmembrane proteins such as the cytokine receptor are especially suited for a role [2]
in cell signalling.
Spans the entire membrane;
with one part interacting with extracellular ligand/ signal molecule;
and another interacting with intracellular proteins;
ligand binds via complementary shape;
Leading to conformational change of the transmembrane protein/ dimerisation of receptor;
Cause activation of intracellular enzymes / intracellular proteins inside the cell;
Allows cellular responses without the external signal having to move into the cell/ able to
transduce external signal into internal signal;
(1/2 mark each)

(b) With reference to Fig. 4.1, suggest when happens after cytokine binds to the receptor. [2]
Dimerization of and chains;
Activates JAKs;
(Activated JAK) phosphorylates the intracellular tails of the receptors;
Which activate/ phosphorylate STATs
(1/2 mark each)

(c) With reference to Fig. 4.2, explain how a change in the sequence of the DNA nucleotide may
affect the signaling downstream of cytokine receptors. [5]
Compulsory points:
Leads to change in mRNA codon leading to a change in amino acid sequence;
2 examples (2m):
change in amino acid R-group properties, lead to polypeptide chain folded wrongly, resulting in
172
10
a defective JAK
change in amino acid R-group properties, lead to polypeptide chain cannot embed in the
membrane, resulting in a absent c or absent IL-7R chain
ref to stop codon in mRNA resulting in shorter polypeptide or no polypeptide chain made,
resulting in absent c or absent IL-7R chain and;
relevant consequences (2m):
absent chain in receptor, cytokine cannot bind;
defective JAK, cannot be activated, subsequent events cannot occur;

(d) Proteins synthesized by ribosomes attached to the endoplasmic reticulum may be embedded in
the cell surface membrane. Outline the route taken by such a protein. [3]
Protein is inserted into the membrane of the rough endoplasmic reticulum;
Vesicles with protein embedded in membrane bud off from membrane of RER;
move to and fuse with cis face;
of Golgi apparatus;
modified and sorted;
Vesicles bud off from the trans face of Golgi apparatus;
fuse with the plasma/cell membrane and receptor is presented to the exterior of the cell;
movement across cell is aided by microtubules of cytoskeleton;
(1/2 mark each)

[Total: 12]
173
11

5 Chickens have a structure called a comb on their heads. The drawings show two types of comb.

Fig. 5.1

The shape of the comb is controlled by two alleles of one gene. The allele for pea comb, A, is
dominant to the allele for single comb, a. The colour of chicken eggs is controlled by two alleles of
a different gene. The allele for blue eggs, B, is dominant to the allele for white eggs, b.

The genes for comb shape and egg colour are situated on the same chromosome.

A farmer crossed a chicken that had pea comb and produced blue eggs with a chicken that had a
single comb and produced white eggs. The chicken that had a pea comb and produced blue eggs
are the offspring of the cross between pure bred pea comb, blue eggs and pure bred single comb,
white eggs.

(a) Construct a genetic diagram to illustrate the above cross. [3]


Gametes 1M;
Punnett Square 1M;
F2 phenotype and corresponding genotype ratios 1M;

Parental phenotype Pea comb, blue eggs X Single comb, white eggs
A B a b
Parental genotype
a b a b

A B A b
a b
Gametes
a B a b

A B A b a B a b

A B A b a B a b
a b
a b a b a b a b

F2 genotype A B A b a B a b
ratio
174
12
a b a b a b a b
1 single 1 single
F2 phenotype 1 Pea comb 1 Pea comb,
comb, Blue comb, white
ratio blue eggs white eggs
eggs eggs

(b) The farmer could identify which of the female offspring from this cross would eventually produce
blue eggs. Explain how. [2]
Pea comb offspring will produce blue eggs;
Alleles A and B are inherited together / are on the same chromosome;

(c) However, in certain crosses, the farmer was not able to identify the female offspring which will
produce blue eggs. Explain why. [2]
Crossing over will separate alleles;
If crossing over occurred some gametes will contain alleles A and b;

In chickens the males are the homogametic sex while the females are the heterogametic sex.

(e) A gene on the X chromosome controls the rate of feather production. The allele for slow feather
production, F, is dominant to the allele for rapid feather production, f.

A farmer made a cross between two chickens with known genotypes. He chose these chickens so
that he could tell the sex of the offspring soon after they hatched by looking at their feathers.

Which of the crosses shown in the table did he make? Explain your answer.

Fig. 5.3 [2]


Cross C / Xf Xf and XFY;
(Only) cross where all males are one phenotype and all females are a different phenotype;
Cross showing all males offsprings are slow feather production, all females offsprings fast
feather production;

(f) Female chickens are more likely than male chickens to show recessive sex-linked characteristics.
Explain why. [2]
Two alleles for each gene present in male / chromosomes are homologous in male;
OR female has one allele for each gene (for the non-homologous section of chromosome);
Recessive alleles always expressed in female;
Males need two recessive alleles for allele to be expressed / in males recessive alleles can
be masked by dominant allele

[Total: 11]
175
13

6 Table 6.1 shows the approximate percentage of protein in different membranes.

Table 6.1

Organelle Membrane Protein as a percentage of dry weight


Chloroplast Outer membrane 54
Chloroplast Inner membrane 70
Mitochondrion Outer membrane 55
Mitochondrion Inner membrane 80

(a) Describe one way in which the distribution of protein in the inner and outer membranes of these
two organelles is similar.

Suggest a reason for this similarity. [2]


Similarity:
Both the chloroplast and mitochondrion have more protein on their inner membrane as
compared to outer membrane;

Reason:
Inner membrane of mitochondrion and chloroplast has various enzymes and proteins such as
ATP synthase, proton pumps, electron transport proteins/ electron carriers in ETC required
to carry out chemiosmosis in respiration or photosynthesis;

Note: Chloroplast has a double outer membrane and the inner membrane refers to the thylakoid
membrane.

(b) (i) Atrazine is a widely used herbicide (weedkiller). It binds to a chloroplast protein involved in
electron transfer between photosystems.

Explain how atrazine works as an effective herbicide. [4]


Atrazine binds to an electron carrier or name a possible electron carrier;
shape of electron carrier change;
ETC stop/ photophosphorylation stop;
no ATP or reduced NADP will be produced and therefore the Calvin Cycle will cease to
function;
no G3P so no source of energy/sugar/food produced

(ii) Maize plants are insensitive to atrazine.

The cytoplasm of maize plant cells contains a tripeptide which binds to atrazine. The product
is then transported to the vacuole.

Suggest why maize plants are insensitive to atrazine. [2]


Atrazine will not enter the chloroplast.
when in the vacuole the tonoplast will act as an effective barrier preventing the atrazine
affecting the metabolism of the cell
Binding to tripeptide changes configuration of atrazine such that it is not able to enter the
chloroplast.

(c) At the end of photosynthesis, glyceraldehyde 3-phosphate (3-carbon sugar) is produced by the [3]
Calvin cycle, which is subsequently converted into starch for storage.
176
14

Discuss the suitability of starch as a storage compound in plants.


Large molecule prevented from diffusing out
Large molecule made up of a long chain of -glucoses linked by many glycosidic bonds able
to store large amount of energy
In a compact space because it can be coiled into a helix.
Helical formation was made possible with the OH groups pointing into the helix - insoluble
Insoluble thus does not affect the osmotic potential of the cell
No cross linked/glycosidic bonds on the exterior of the helices easily hydrolyzed

[Total : 11]
177
15

6 Fig 6.1 shows T.W. Engelmanns experiment to measure the action spectrum of the filamentous
green alga. He placed the filamentous green alga into a test-tube along with a suspension of
oxygen-seeking bacteria. He allowed the bacteria to use up the available oxygen and then
illuminated the alga with light that had been passed through a prism to form a spectrum. After a
short time he observed the results shown in Fig. 6.1.
(Fig on pg 333)

(a) (i) Sketch the action spectrum for this alga. [1]
2 peaks at correct range: one between 400 to 500 range the other between 600 to 700

(ii) Explain his observation shown in Fig. 6.1. [2]


More light energy absorbed at the two range;
By the light harvesting complexes;
Increase rate of photolysis of water;
To fill the electron hole of chlorophyll a at reaction centre PS II or PS700;
Produce more oxygen at the two region (to attract oxygen-seeking bacteria)

(b) (i) At the end of photosynthesis, glyceraldehyde 3-phosphate (3-carbon sugar) is produced by
the Calvin cycle. Outline how this glyceraldehyde 3-phosphate is made in the Calvin cycle
and converted into starch. [5]
(Carbon fixation phase) Carbon dioxide (1C) is accepted by RuBP (5C compound), [
catalyzed by ribulose bisphosphate carboxylase (Rubisco); 5
6C compound then cleaves to form 2 molecules of 3C glycerate-3-phosphate (GP); ]
(reduction phase) in the presence of ATP and NADPH, GP forms 3C triose phsophate
(G3P);
For every 6 G3P formed, 1 G3P exits the cycle
G3P can form glucose via condensation
Many -glucose monomers are linked to form long chain via glycosidic bonds
Long chain then coils to form compact helix

(ii) Discuss the suitability of starch as a storage compound in plants. [3]


Large molecule prevented from diffusing out
Large molecule made up of a long chain of -glucoses linked by many glycosidic bonds
able to store large amount of energy
In a compact space because it can be coiled into a helix.
Helical formation was made possible with the OH groups pointing into the helix -
insoluble
Insoluble thus does not affect the osmotic potential of the cell
No cross linked/glycosidic bonds on the exterior of the helices easily hydrolyzed

[Total : 11]
178
16

7 The marine threespine sticklebacks, Gasterosteus aculeatus is a freshwater fish living in the
lakes of British Columbia, Canada as shown in Fig. 7.1.

Fig. 7.1

In order to investigate the process of speciation in these populations, three small lakes were
studied. Each lake contained two varieties of stickleback: a large, bottom-dwelling variety that
fed on invertebrates near the shore and a small, plankton-eating variety that lived in the open
water. The probability of breeding between pairs of individuals was measured under laboratory
conditions in the following breeding combinations:

I different varieties from the same lake


II different varieties from different lakes
III same variety from different lakes
IV same variety from the same lake

The data are summarized in Fig. 7.1 below.

Fig. 7.1

(a) (i) Identify the highest and lowest probabilities of breeding for individuals of the same variety
from different lakes.

Highest probability: 0.58 (Allow answers from 0.570.59) [1]


179
17
Lowest probability: 0.25 (Allow answers from 0.240.26)
Both required for the mark.

(ii) With reference to Fig. 7.1, describe the differences in probability of breeding between
individuals from the same lake.
[2]
IV combination (of the same variety): Individuals have higher breeding probability if they
are the same variety and
quote values 0.58;
OR
Accept: Individuals of different varieties have a lower probability of breeding and
quote values;
The probability of breeding between individuals of the same variety shows a larger
range of values / narrower range if of different variety;
[Any 2]

(b) Scientists concluded that speciation is taking place in these populations. Explain the type of
speciation as shown in Fig. 7.1.

Sympatric speciation
is taking place because different varieties from the same lake have a low probability of
breeding
OR
No evidence of allopatric speciation
as same varieties from different lakes do not show strong reproductive isolation/ Comparing
exp III and IV, they show similar range of breeding probability.

Different feeding habits or habitat (shore versus open water) contribute to low breeding
probability/ reproductive isolation;
Reducing interbreeding and gene flow between the varieties in each lake;
[4]

(c) With reference to Fig. 7.1, explain why all the individuals are still considered the same species.

Probability of breeding is not zero/ Not completely reproductively isolated;


(According to Biological species concept), they can still interbreed to produce fertile, viable
offspring; [2]

(d) The freshwater lakes also contain many different types of parasites that infect the marine
threespine sticklebacks. Suggest why these parasites help to speed up speciation of the marine
threespine sticklebacks.

Parasites are host specific/ infect either bottom-dwelling variety or plankton-eating variety;
Parasites constitute a selection pressure;
Cite an example of a characteristic that confer a selective advantage, e.g. resistance against
parasitic infection
Those selected for survive, reproduce and pass on their alleles coding for the beneficial
characteristic to their offsprings. [3]

[Total : 12]
180
18

Section B
Answer one question.
Write your answers on the separate answer paper provided.
Your answer should be illustrated by large, clearly labeled diagrams, where appropriate.
Your answers must be in continuous prose, where appropriate.
Your answers must be set out in section (a), (b) etc., as indicated in the question.

8 (a) Explain how the positive and negative control of the lac operon affect bacteria growth. [10]
[Compulsory 1 point]
Metabolism is biased toward the utilization of glucose - glucose is the simplest form of
sugar /enzymes required for the breakdown of glucose via glycolysis are continuously
present.

[Max 3m]
When [glucose] high and [lactose] is absent, glucose is preferred over lactose/used as
a main respiratory substrate/ main energy source.
Repressor binds to operator;
[cAMP] decreases, CAP is not activated/cAMP does not bind to CAP and CAP unable
to bind to CAP binding site;
RNA polymerase does not bind to promoter/ lac operon is switched off;
bacteria growth increases exponentially because energy from glucose breakdown is
utilized for bacterial growth.

[Compulsory 2 points]
When glucose is fully utilized, bacterial growth will remain constant
[lactose] also remains constant initially as time is needed for lac operon to turn on
genes to produce -galactosidase to hydrolyse lactose;

[Max 3m]
Absence of [glucose] and high [lactose];
Allolactose acts an inducer, binds to repressor to inactivate it;
high levels of cAMP binds and activates CAP and
increases affinity of RNA polymerase to bind to promoter and to turn on expression of
lac genes;
high [lactose] - Bacteria growth increases exponentially due to production of -
galactosidase that hydrolyses lactose to form glucose (main respiratory substrate) and
galactose;
as [lactose] concentration decreases; less allolactose binds to the repressor; and as a
result, the activated repressor can bind to the operator;
this blocks binding of RNA Polymerase to the promoter and inhibits transcription of lac
operon;
bacteria growth plateaus/drops as lactose is used up

Description for bacteria growth [Compulsory 3m]


bacteria growth increases exponentially because energy from glucose breakdown is
utilized for bacterial growth.
When glucose is fully utilized, bacterial growth will remain constant
high [lactose] - Bacteria growth increases exponentially due to production of -
galactosidase that hydrolyses lactose to form glucose (main respiratory substrate) and
galactose;
bacteria growth plateaus/drops as lactose is used up
181
19
(b) Describe how regulation of blood glucose level in humans involves cAMP. [5]
-cells detects low blood glucose level,
secrete glucagon into bloodstream;
glucagon binds to GPCR at the cell surface membrane, activates GPCR;
Activated GPCR binds to G-protein;
Cause GDP to be displaced by GTP, activates G-protein;
Activated G-protein activated adenylyl cyclase;
Converts ATP to cAMP;
Which acts as 2nd messenger
Activates phosphorylation cascade
Activate glycogen phosphorylase
Break down glycogen to glucose (to increase blood glucose level)
(1/2 m each)

(c) Explain the significance of the steps in glycolysis. [5]


Glycolysis is a common step in both anaerobic and aerobic respiration;
Phosphorylation of glucose (by 2 ATP) is to activate it;
Phosphorylation of glucose (by 2 ATP) / glucose-6-phosphate results in glucose being
trapped in the cytosol/ unable to leave the cell through the same glucose carrier
protein/ committed to the end of glycolysis;
PFK which catalyse the phosphorylation of fructose phosphate also control rate of
glycolysis/ high rate of ATP act as allosteric inhibitor to PFK;
ATP synthesis by substrate level phosphorylation;
Forms two glyceraldehyde-3-phosphate/ triose phosphate from one glucose;
Forms two reduced NAD (NADH) (by dehydrogenation);
Which later give 6 ATP by oxidative phosphorylation;
Pyruvate can enter into link reaction/ mitochondria or be converted to lactate (in
mammals) or ethanol and carbon dioxide (in yeast);
Pyruvate is small enough to enter mitochondrion for aerobic respiration;

9 (a) Describe the differences between cellulose synthase and cellulose. [5]

Any five below:

Feature Cellulose synthase Cellulose


Nature Globular protein Polysaccharide
Monomer Amino acid glucose
Bond between Peptide bond (1,4) glycosidic bond
monomer
Shape Spherical Linear (chains)
Bonds Ionic bond, hydrogen bond, Hydrogen bonds
contributing to hydrophobic interaction and disulfide
structure bonds
Groups between R groups between OH groups
contributing to
bond formation
Location/ On cell surface membrane/ enzyme As part of plant cell wall
Function surrounding plant cell/
gives cell a regular shape
182
20
(b) With reference to photosynthesis and cellular respiration, explain the importance of
compartmentalization within a plant cell. [10]
The inner membrane of the chloroplast encloses the stroma where enzymes for Calvin
cycle are
Thylakoid membrane houses light harvesting complexes / photosystems for
harnessing light energy to excite electrons in the reaction centre down the ETC
with NADP reductase as final electron carrier which is reduced to NADPH for Calvin
cycle
Flow of electrons down ETC allows pumping of H+ from the stroma to the thylakoid
space, setting up a proton gradient
Diffusion of the H+ from the thylakoid space to the stroma via ATP synthase / stalked
particles in thylakoid membrane allows phosphorylation of ADP to form ATP required
in Calvin cycle
The inner mitochondrial membrane encloses the matrix where enzymes of the Krebs
cycle are localised
Enzymes localised in the cytoplasm allow glycolysis to occur
The inner mitochondrial membrane is the site of oxidative phosphorylation
and is highly folded forming cristae to increase surface area for more ETCs / stalked
particles
Flow of electrons down ETC allows pumping of H+ from the matrix to the
intermembrane space, setting up a proton gradient since the inner mitochondrial
membrane is impermeable to H+
Diffusion of the H+ from the inner mitochondrial space to the matrix via ATP synthase /
stalked particles in the inner mitochondrial membrane allows phosphorylation of ADP
to form ATP

(c) Explain the role of meiosis in natural selection. [5]

(Any 3)
Crossing over at prophase I (exchanges alleles);
Independent assortment of homologous chromosomes at metaphase I;
Introduces genetic variation in a population;
Random fusion of gametes after meiosis (further increases genetic variation in
individuals);
(Compulsory 2 marks)
Selection pressure results in some organisms having selective advantage;
Those selected for survive and reproduce and pass on their alleles to their offspring,
increasing frequency of alleles over time;
183

H2 ANDERSON JUNIOR COLLEGE


HIGHER 2

CANDIDATE
NAME

PDG PDG I
INDEX NUMBER

BIOLOGY 9648/03
Applications Paper and Planning Question 20 September 2013
Paper 3

2 hours
Additional Materials: Answer Paper

READ THESE INSTRUCTIONS FIRST


Write your name and PD group on all the work you hand in.
Write in dark blue or black pen.
You may use a soft pencil for any diagrams, graph or rough working.
Do not use paper clips, highlighters, glue or correction fluid.

Answer all questions.

All working for numerical answers must be shown.


At the end of the examination, fasten all your work securely For Examiners Use
together.
The number of marks is given in brackets [ ] at the end of each 1
question or part question.
2
Calculators may be used
3
4
5
Total 72

This document consists of 14 printed pages.


184
2
Answer all the questions.

1 In a maternity ward at a local hospital, a mix-up involving three couples and three babies caused
a lot of confusion. Based on phenotypic characteristics, the nurses were unable to correctly
identify the parents of the babies. In order to solve the case, a scientist was called in to carry out a
DNA test to identify the parents of the babies. The test was based on the principle that different
individuals have a different number of repeating units at a particular locus in a chromosome.

(a) State the name of the test that was carried out. [1]

......

Chromosome 13 was isolated from the DNA samples that were obtained from the three couples
and three babies and used for further analysis. The sequence below shows a segment of
chromosome 13, which was used in the analysis where (TTAGGAT) is the repeating unit and n
is the number of repeats.

The gel diagram in Fig. 1.1 shows the results of the DNA test obtained from each individual, Dad
and Mom #1, #2 and #3, and baby A, B, and C.

Fig. 1.1

(b) (i) Explain the purpose of the DNA ladder in Fig. 1.1. [1]

.....

......

(ii) DNA is colourless.


State how the DNA bands in the gel can be made visible. [1]

.....

.....
185
3
(c) With reference to Fig. 1.1, explain why

(i) some bands in a lane are higher than others; [2]

.....

.....

.....

(ii) the lane for Dad#3 has only one band; [2]

.....

.....

.....

(iii) some lanes have two bands. [2]

.....

.....

.....

(d) (i) With reference to Fig. 1.1, state and explain which couple is the parents of Baby A. [2]

.....

.....

.....

(ii) Explain why results of paternity testing are not absolutely certain. [2]

.....

.....

.....

[Total: 13]
186
4

22 One approach of gene therapy to treat cystic fibrosis uses viruses to deliver normal alleles of the
CFTR gene into epithelial cells of the airways.

A team of researchers in the USA developed a new strain of non-pathogenic adeno-associated


virus (AAV), AAV2.5T. Genes for the CFTR protein and the enzyme luciferase were inserted into
the DNA of the viruses. Luciferase catalyses the production of a green fluorescent protein when
luciferin is added.

The normal AAV strain and the AAV2.5T strain were added to cultures of epithelial cells from the
airways. After adding luciferin, the number of cells that had taken up the viral genes was
estimated using the intensity of the green fluorescence which developed. The results are shown
in Fig. 2.1.

Intensity of
green
fluorescence
/ arbitrary
units

AAV

Time / days
Fig. 2.1

(a) Explain why the researchers inserted a gene for luciferase into the viral DNA. [1]

.....

.....

.....

(b) With reference to Fig. 2.1, compare the ability of the two viral strains, AAV and AAV2.5T, to
infect epithelial cells of the airways. [2]

.....

.....

.....


187
5

(c) Suggest why a decrease in intensity of green fluorescence was detected in cells infected
with AAV2.5T during the last 10 days. [2]

.....

.....

.....

(d) Describe how delivering normal alleles of the CFTR gene into epithelial cells in the airways
could relieve the symptoms of cystic fibrosis. [4]

.....

.....

.....

.....

.....

.....

(e) Researchers have started to use cDNA of the CFTR gene for more effective therapeutic
results. Explain why cDNA of the normal CFTR gene is used instead of the normal CFTR
gene. [2]

.....

.....

.....
188
6

(f) AAV does not cause human disease, but because we are routinely exposed to this virus,
30 to 60 percent of people develop antibodies that neutralize AAV if it enters the
circulation.

To extend the potential benefits of gene therapy to a broader population, researchers have
produced a bioengineered decoy, which are empty AAV capsids disabled of their ability to
enter target cells.

Suggest how using both the decoy and vector at the same time would improve the success
rate of the gene therapy. [3]

.....

.....

.....

.....

.....

[Total: 14]
189
7

3 Plants have developed defense mechanisms against pathogens such as bacteria, fungi, and
viruses. Chemicals released by these pathogens can trigger a defense response in infected plant
cells. For example, the production of hydrogen peroxide (H2O2) which reacts with pathogen
membranes and cellular chemicals, eventually kills both the cell and the pathogen.

The OSRac1 gene was isolated and introduced into a number of rice plant (Oryza spp.) lines to
study its role in disease resistance of plants to Blast fungus. Experiments were carried out to see
if the OSRac1 gene was part of the signalling pathway for hydrogen peroxide production.

A control and four other genetically modified rice plant lines were exposed to chemicals known to
initiate a defense response and the production of hydrogen peroxide. The results are shown in
Fig. 3.1 below.

Fig. 3.1

(a) With reference to Fig. 3.1, compare the changes in H2O2 production in the control and [4]
genetically modified plants after the chemical was applied and conclude if OSRac1 gene is
involved in disease resistance.

.....

.....

.....

.....

.....

.....


190
8
(b) Suggest two possible concerns about the use of transgenic plants with the disease
resistance gene. [2]

.....

.....

.....

(c) Edible vaccine against cholera using rice was developed by a team of Japanese scientists
by cloning a gene from cholera bacteria, Vibrio cholerae into the genome of the Kitaake rice
plant. The gene expressed a subunit of the disease-causing cholera toxin B. The steps are
shown in Fig. 3.2.

Coded by

Fig. 3.2

(i) Describe how the antigen gene inserted into rice DNA genome would result in successful
vaccination once the rice is eaten. [2]

.....

.....

.....
191
9

(ii) Explain why it is necessary to form a callus in order to grow genetically modified rice. [3]

.....

.....

.....

(d) Edible vaccines have been made using other plants like tomato and banana. Suggest the
advantages of using rice over other plants. [2]

.....

.....

.....

[Total: 13]
192
10

4 Planning question

DNA is the genetic material in all living organisms. DNA from an external source can be taken up
by bacteria by a process known as transformation.

Plan an experiment to investigate the effect of varying plasmid concentration on the efficiency of
E. coli transformation.

You may, or otherwise, also use the following equipment and materials:
Solution of plasmid containing ampicillin resistance gene of concentration 100
Unit/ml
Suspension of competent E. coli cells
Distilled water
LB broth (nutrient solution)
Petri dishes containing LB agar medium and ampicillin (LB/amp plates)
Sterilised microfuge tubes
Micropipettes
Bleach solution
alcohol

Your plan should have a clear and helpful structure to include:


an explanation of theory to support your practical procedure
a description of the method used including scientific reasoning behind the method
an explanation of the dependent and independent variables involved
relevant, clearly labelled diagrams
how you will record your results and ensure they are as accurate and reliable as possible
proposed layout of results tables and graphs with clear headings and labels
correct use of scientific and technical terms
[Total:12]
193
11

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.
194
12

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.
195
13

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....

.....
196
14
Free-response question

Write your answers to this question on the separate answer paper provided.

Your answer:

should be illustrated by large, clearly labelled diagrams, where appropriate;


must be in continuous prose, where appropriate;
must be set out in sections (a), (b) etc., as indicated in the question.

5 (a) Rubisco is an important enzyme in the Calvin cycle. [6]

Outline how it might be possible to produce genetically modified plants with increased
rubisco concentrations, or rubisco with enhanced efficiency.

(b) Explain the basis of genetic engineering and how genetic engineering can improve the yield [8]
of one named crop plant and one named animal in solving the demand for food in the
world.

(c) Discuss how the human genome project can help parents customise their babies and the [6]
possible implications of doing so.

[Total: 20]
197

H2 ANDERSON JUNIOR COLLEGE


HIGHER 2

CANDIDATE
NAME

PDG PDG I
INDEX NUMBER

BIOLOGY 9648/03
Applications Paper and Planning Question 20 September 2013
Paper 3

2 hours
Additional Materials: Answer Paper

READ THESE INSTRUCTIONS FIRST


Write your name and PD group on all the work you hand in.
Write in dark blue or black pen.
You may use a soft pencil for any diagrams, graph or rough working.
Do not use paper clips, highlighters, glue or correction fluid.

Answer all questions.

All working for numerical answers must be shown.


At the end of the examination, fasten all your work securely For Examiners Use
together.
The number of marks is given in brackets [ ] at the end of each 1
question or part question.
2
Calculators may be used
3
4
5
Total 72

This document consists of 15 printed pages and 1 blank page.


198
2
Answer all the questions.

1 In a maternity ward at a local hospital, a mix-up involving three couples and three babies caused
a lot of confusion. Based on phenotypic characteristics, the nurses were unable to correctly
identify the parents of the babies. In order to solve the case, a scientist was called in to carry out a
DNA test to identify the parents of the babies. The test was based on the principle that different
individuals have a different number of repeating units at a particular locus in a chromosome.

(a) State the name of the test that was carried out. [1]
Paternity Test/ DNA Fingerprinting/Genetic Fingerprinting

Chromosome 13 was isolated from the DNA samples that were obtained from the three couples
and three babies and used for further analysis. The sequence below shows a segment of
chromosome 13, which was used in the analysis where (TTAGGAT) is the repeating unit and n
is the number of repeats.

The gel diagram in Fig. 1.1 shows the results of the DNA test obtained from each individual, Dad
and Mom #1, #2 and #3, and baby A, B, and C.

Fig. 1.1

(b) (i) Explain the purpose of the DNA ladder in Fig. 1.1. [1]
Each band serves as a comparison / reference for the size / no. of repeats present / found in
the individuals tested.

(ii) DNA is colourless.


State how the DNA bands in the gel can be made visible. [1]
Ethidium bromide under UV light
staining with methylene blue
autoradiography with a labeled probe

(c) With reference to Fig. 1.1, explain why


(i) some bands in a lane are higher than others; [2]
Higher bands are longer as the DNA fragments havea larger number of repeated units
199
3
The longer a DNA fragment, the harder it is for that fragment to travel through the pores
in the gel, and so it migrates slower than the smaller fragments with fewer repeats.

(ii) the lane for Dad#3 has only one band; [2]
They are homozygous at this locus.
they have the same number of repeats on both homologous chromosome13
For example: Dad #3 has 25 repeats on both versions of his chromosome 13.

(iii) some lanes have two bands. [2]


They are heterozygous at this locus.
they have a different number of repeats on each homologue of chromosome 13.

(d) (i) With reference to Fig. 1.1, state and explain which couple is the parents of Baby A. [2]
couple #3
Baby A has a band in n=25 and Dad #3 is the only parent with n=25 @ chromosome.

(ii) Explain why results of paternity testing are not absolutely certain. [2]
Only a limited number of loci were considered.
It is possible that a male may be a match at all the loci considered, but not be a match at
another loci that was not considered in the test.

[Total: 13]
200
4

22 One approach of gene therapy to treat cystic fibrosis uses viruses to deliver normal alleles of the
CFTR gene into epithelial cells of the airways.

A team of researchers in the USA developed a new strain of non-pathogenic adeno-associated


virus (AAV), AAV2.5T. Genes for the CFTR protein and the enzyme luciferase were inserted into
the DNA of the viruses. Luciferase catalyses the production of a green fluorescent protein when
luciferin is added.

The normal AAV strain and the AAV2.5T strain were added to cultures of epithelial cells from the
airways. After adding luciferin, the number of cells that had taken up the viral genes was
estimated using the intensity of the green fluorescence which developed. The results are shown
in Fig. 2.1.

Intensity of
green
fluorescence
/ arbitrary
units

AAV

Time / days
Fig. 2.1

(a) Explain why the researchers inserted a gene for luciferase into the viral DNA. [1]
infected cells are able to produce luciferase;
able to identify infected cells/cells that have taken up viral DNA (which will
fluoresce when luciferin is added)/ ref to gene for luciferase functions as a
reporter gene;

(b) With reference to Fig. 2.1, compare the ability of the two viral strains, AAV and AAV2.5T, to
infect epithelial cells of the airways. [2]
1. Both AAV and AAV2.5T can infect epithelial cells;
[Both pt 2 & 3 - 1m]
2. AAV2.5T infects more cells than AAV / infects cells more readily;
3. Quote relevant values (both intensity and day indicated) from graph;
[Both pt 4 & 5 - 1m]
4. Intensity of green fluorescence increases more in AAV2.5T compared to AAV
from 0-20 days;
5. from 0 to 15 au in AAV2.5T compared to only 2 au in AAV; A! any values correctly
comparing rate of increase anytime during the first 20 days period
[Both pt 6& 7 - 1m]
6. From the 20th to 30th day, ability of AAV2.5T to infect cells fall but AAVs ability
remains constant;
7. Intensity of green fluorescence decreases to 12.5 au in AAV2.5T compared to
remaining at 2 au in AAV; @ m
201
5

(c) Suggest why a decrease in intensity of green fluorescence was detected in cells infected
with AAV2.5T during the last 10 days. [2]
Green fluorescent protein was broken down;
Luciferin was used up;
(Infected) cells die (as virus regain virulence);
R! cells constantly being shed/killed by immune system as gene therapy was done in
cultures of epithelial cells.
(d) Describe how delivering normal alleles of the CFTR gene into epithelial cells in the airways
could relieve the symptoms of cystic fibrosis. [4]
1m, max 3
normal allele of CFTR gene is transcribed and translated / expressed to produce
functional CFTR protein;
CFTR protein embedded in cell membrane allows chloride ions to leave cell /
serves as functional chloride channel;
water also leaves cell down the water potential gradient;
normal / less viscous mucus formed ;
(essential point)
no blockage of airways / less chance of bacterial lung infections/any other
related possible symptoms;

(e) Researchers have started to use cDNA of the CFTR gene for more effective therapeutic
results. Explain why cDNA of the normal CFTR gene is used instead of the normal CFTR
gene. [2]
cDNA does not contain non-coding regions such as introns;
cDNA can be transcribed and translated directly without the need for post-
transcriptional modifications such as splicing;
Hence the CFTR proteins can be synthesized efficiently;

(f) AAV does not cause human disease, but because we are routinely exposed to this virus,
30 to 60 percent of people develop antibodies that neutralize AAV if it enters the
circulation.

To extend the potential benefits of gene therapy to a broader population, researchers have
produced a bioengineered decoy, which are empty AAV capsids disabled of their ability to
enter target cells.

Suggest how using both the decoy and vector at the same time would improve the success
rate of the gene therapy. [3]
Higher ratio of decoy to vector;
Decoy cannot enter target cells, thus they stay in circulation for longer period of
time;
Ref to antibodies bound to the capsid decoys;
Allowing the DNA-carrying vectors to evade the antibodies and enter the targeted
cells in the liver;

[Total: 14]
202
6

3 Plants have developed defense mechanisms against pathogens such as bacteria, fungi,
and viruses. Chemicals released by these pathogens can trigger a defense response in
infected plant cells. For example, the production of hydrogen peroxide (H2O2) which reacts
with pathogen membranes and cellular chemicals, eventually kills both the cell and the
pathogen.

The OSRac1 gene was isolated and introduced into a number of rice plant (Oryza spp.)
lines to study its role in disease resistance of plants to Blast fungus. Experiments were
carried out to see if the OSRac1 gene was part of the signalling pathway for hydrogen
peroxide production.

A control and four other genetically modified rice plant lines were exposed to chemicals
known to initiate a defense response and the production of hydrogen peroxide. The results
are shown in Fig. 3.1 below.

Fig. 3.1
(a) With reference to Fig. 3.1, compare the changes in H2O2 production in the control and [4]
genetically modified plants after the chemical was applied and conclude if OSRac1 gene is
involved in disease resistance.

Production of H2O2 increased less in C (control) plants than A1/A5 plants supported
with relevant data;
Production of H2O2 in D41/D42 plants increased less than in C (control) plants
supported with relevant data;
Production of H2O2 increased the most in A1/least in D41 plants supported with
relevant data;
[Compulsory conclusion point]
Transgenic plants with functioning gene showed more H2O2 production so
hypothesis; OR
Transgenic plants with gene suppressed showed less H2O2 production so
hypothesis;
203
7
(b) Suggest two possible concerns about the use of transgenic plants with the disease
resistance gene.

Disease resistance could spread to species related to rice, e.g. weeds;


Reluctance of consumers to eat genetically modified food products;
Outcompete natural species and change gene pool; [2]
May increase allergenic effects in human/cattle;
Any two above

(c) Edible vaccine against cholera using rice was developed by a team of Japanese scientists
by cloning a gene from cholera bacteria, Vibrio cholerae into the genome of the Kitaake rice
plant. The gene expressed a subunit of the disease-causing cholera toxin B. The steps are
shown in Fig. 3.2.

Coded by

Fig. 3.2

(i) Describe how the antigen gene inserted into rice DNA genome would result in successful [2]
vaccination once the rice is eaten.
[Essential compulsory point] Antigen protein would be expressed in rice cells;
Any 1 below:
Antigen would trigger immune system to produce the antibody;
Antibody have a specific configuration that is complementary to the glycoprotein
(antigen);
Antibody will be synthesized to mount an immune response against a subsequent
vaccination against cholera bacteria;
204
8
Extend Q N06/P2/Q8c - Outline the roles of glycoproteins in the cell surface membrane.
[8]

Aid cell recognition


Act as cell surface receptors (rarely seen)
Cell Attachment
Carbohydrates also form the glycocalyx coat, the layer outside of the plasma
membrane.
Functions of the glycocalyx:
Protection: Cushions the plasma membrane and protects it from chemical injury
Immunity to infection: Enables the immune system to recognize and selectively attack
foreign organisms
Transplant compatibility: Forms the basis for compatibility of blood transfusions,
tissue grafts, and organ transplants
Cell adhesion: Binds cells together so that tissues do not fall apart
Fertilization: Enables sperm to recognize and bind to eggs
Embryonic development: Guides embryonic cells to their destinations in the body

(ii) Explain why it is necessary to form a callus in order to grow genetically modified rice.

Callus divide by mitosis to ensure all the genetically identical daughter cells would
have the gene;
Callus can be genetically modified by A. tumefaciens;
Callus can be sub-cultured to increase the number of callus;
Callus can be manipulated by auxin and cytokinin to induce root and shoot
formation to form a plantlet; [3]
(Any three)

(d) Edible vaccines have been made using other plants like tomato and banana. Suggest the [2]
advantages of using rice over other plants.
Rice can be stored for a long time;
Rice forms a staple diet among many Asians
Rice is versatile enough to be eaten with other dishes;
[Total: 13]
205
9

4 Planning question

DNA is the genetic material in all living organisms. DNA from an external source can be taken up
by bacteria by a process known as transformation.

Plan an experiment to investigate the effect of varying plasmid concentration on the efficiency of
E. coli transformation.

You may, or otherwise, also use the following equipment and materials:
Solution of plasmid containing ampicillin resistance gene of concentration 100
Unit/ml
Suspension of competent E. coli cells
Distilled water
LB broth (nutrient solution)
Petri dishes containing LB agar medium and ampicillin (LB/amp plates)
Sterilised microfuge tubes
Micropipettes
Bleach solution
alcohol

Your plan should have a clear and helpful structure to include:


an explanation of theory to support your practical procedure
a description of the method used including scientific reasoning behind the method
an explanation of the dependent and independent variables involved
relevant, clearly labelled diagrams
how you will record your results and ensure they are as accurate and reliable as possible
proposed layout of results tables and graphs with clear headings and labels
correct use of scientific and technical terms
[Total:12]

Mark Scheme
1. Theoretical consideration / rationale of plan to justify the practical procedure [1]
2. Correct use of technical and scientific terms any 2 of the following [1]
Relate theory to prac
Examples:
DNA is the genetic material in all living organisms. Transformation is the process by
which DNA from an external source is taken up by bacteria.
The plasmid contains an ampicillin-resistance gene that confers resistance to the
antibiotic.
Bacteria that have taken up this plasmid are able to grow on LB/amp medium.
Amp resistance gene serves as genetic marker to identify transformed cell
When made competent by heat-shock, pores appear transiently in the membrane of
bacteria. External DNA/plasmids may then enter the cell via these pores
Consequently, as plasmid concentration increases, the efficiency of E.coli transformation
will also increase proportionally.

3. An explanation of the dependent and independent variables involved [1]


Independent variable: Concentration of plasmid (unit/ml)
Dependent variable: Efficiency of E. coli transformation is represented by Number of
colonies on LB/Amp plates

[A description of method used including the scientific reasoning behind the method]
4. Description of how the plasmid solution is prepared [1]
206
10
i. Using plasmid solution of concentration 100 Unit/ml, make dilutions to obtain 5 different
concentrations.
Concentration of Volume of plasmid solution of Volume of water
plasmid (unit/ml)* conc 100 Units/ml (ml)* (ml)*
100 1.0 0.0
80 0.8 0.2
60 0.6 0.4
40 0.4 0.6
20 0.2 0.8
0 0 1.0
* or any other reasonable range / volume
OR
serial dilutions:
Concentration of plasmid Volume of stock (ml) Volume of water (ml)
(unit/ml)
Undiluted 1.0 0.0
1 to 10 or 10-1 0.1 of non dilute 0.9
-2 -1
1 to 100 or 10 0.1 of 10 0.9
1 to 1000 or 10-3 0.1 of 10-2 0.9
1 to 10000 or 10-4 0.1 of 10-3 0.9

5. Controlling factors that affect experiment (eg. Duration, temp, volumes,etc) [1]

6. Description of expt [1]


ii. Mix a fixed volume of the E. coli culture with a fixed volume (eg 10l) of the each
plasmid solution
iii. Heat-shock the bacteria-plasmid mixture
iv. Plate each sample on LB/amp plate.
v. Seal the plates with tape and incubate for 24 hours in a 370C (range 28-37) incubator
oven.
vi. After an overnight incubation, count the number of colonies in each plate.

[How you will record your results and ensure they are as accurate and reliable as
possible]

7. Control [1]
vii. For the control tube, replace plasmid solution with same volume of 10l of distilled
water/buffer solution.

Rationale:
To show that the presence of bacterial colonies on agar plates containing
ampicillin is due to transformed bacteria which have taken up plasmid with amp
resistance gene OR
in the absence of plasmid which carries the ampicillin resistant genes, there are no
ampicillin resistant bacterial cells.

8. Accuracy and reliability [1]


For each plasmid concentration, perform two replicates / repeat steps __to __ twice
Calculate average
Check for at least 5 different concentrations of plasmid solutions

[Propose layout of results table and graph with clear headings and labels]

9. Table with appropriate headings [1]


Concentration of plasmid Number of colonies in each plate
solution (unit/ml) Reading 1 Reading 2 Reading 3 Average
207
11

10. Graph [1]


Clear label of axes with units and consistent headings of table
propose expected trend
Graph of average number of colonies against
plasmid concentration

Average number
of colonies
colonies

-1
Concentration of plasmid /Unit ml

11. Risk Assessment [1] any 2


E coli is a bacteria and can cause disease.
Safety Precautions:
Avoid contact - wear gloves and safety goggles.
If in contact, wash off with water and antibacterial soap immediately.
If skin is broken, obtain medical attention.
Dispose of used microfuge tubes / pipette tips / inoculation loops in bleach solution
Sterilize bench with alcohol after expt

12. Suitable diagram illustrating plates with bacteria / process of heat shock [1]
208
12

Free-response question

Write your answers to this question on the separate answer paper provided.

Your answer:

should be illustrated by large, clearly labelled diagrams, where appropriate;


must be in continuous prose, where appropriate;
must be set out in sections (a), (b) etc., as indicated in the question.

5 (a) Rubisco is an important enzyme in the Calvin cycle. [6]

Outline how it might be possible to produce genetically modified plants with increased
rubisco concentrations, or rubisco with enhanced efficiency.

Obtain an explant (from e.g. shoot tip);


Culture in a medium with (macro) and (micro) nutrients, sucrose as an energy
source, and intermediate ratio of auxin to cytokinin.
Reference to aseptic conditions, e.g. surface sterilization.
Callus forms and divides by mitosis to form a mass of undifferentiated cells.
Isolate DNA containing rubisco that has a high efficiency from another plant
species.
Use same restriction enzyme to cut DNA containing gene for rubisco and (Ti)
plasmid;
Allow complementary sticky ends anneal, and DNA ligase to seal the nick by
forming phosphodiester bond;
Recombinant DNA transformed into Agrobacterium tumefaciens bacteria cell by
calcium chloride heat shock method;
Infect callus with transformed Agrobacterium tumefaciens bacteria which will
integrate gene for rubisco into plant chromosome;
Subculture to increase number of callus with desired gene;
Increase cytokinin to auxin ration for shoot formation.
Increase auxin to cytokinin ratio for root formation.
Acclimatize plantlets in greenhouse;
Transfer to sterile soil outside;
Select for plants that have increased rubisco activity by measuring rate of
photosynthesis;
Repeat whole process of plant tissue culture;
(Half mark each)

(b) Explain the basis of genetic engineering and how genetic engineering can improve the yield [8]
of one named crop plant and one named animal in solving the demand for food in the
world.

Basis (2 marks) Any two:


The genetic code is universal / will code for same amino acids in all organisms;
Central Dogma of molecular biology applies,
when gene from another species can still be expressed in the new host;
By transcription and translation for protein synthesis;
Nucleic acid is the basis of all life-foms;

3 marks for plant example and elaboration:


A named crop: Bt corn
209
13
The problem: The European corn borer is a pest that feeds on corn, hence reducing the
amount of corn being sold. Nature of the infestation makes it difficult to deal with despite
using chemical insecticides and biological control methods.
Source of the gene: Bacillus thuringiensis (Bt) is a soil bacterium that encodes a cry
protein (Bt toxin).
Gene product in the crop: Bt toxin
The solution: Transgenic corn plants containing the Bt gene will produce the protoxin
which when ingested by the insect, is cleaved in the insect gut and the active Bt toxin
causes gut cells to lyse, leading to the death of the insect.

OR

A named crop: Flavr Savr tomatoes


The problem: Polygalacturonase (PG) degrades pectin in the tomato cell wall, causing
tomatoes to soften, and hence a short shelf life.
Source of the gene: Antisense gene
Gene product in the crop: Antisense mRNA
The solution: Antisense mRNA binds by complementary base-pairing to mRNA,
preventing translation and hence reducing PG. This increases the shelf-life of tomato.

OR
Reject
A named crop: Golden rice
The problem: Childhood blindness in developing countries due to vitamin A deficiency in
the diet, which comprised of rice primarily. Outer coat of the dehusked grains (aleurone
layer) does not contain beta-carotene.
Source of the gene: Two beta-carotene biosynthesis genes/ phytoene synthase (psy)
gene and phytoene desaturase (crt 1) gene from the daffodil plant and soil bacterium,
Erwinia uredovora.
Gene product in the crop: beta-carotene produced 23 times more.
The solution: Prevent vitamin A deficiency as beta-carotene is a precursor of Vitamin A.

AND

3 marks for animal example and elaboration:


A named crop: GM salmon
The problem: Atlantic salmon can only grow in summer because their growth hormone
gene is switched off in winter.
Source of the gene: Antifreeze protein (AFP) promoter from ocean pout to drive
expression of Chinook salmon growth hormone gene.
Gene product in the crop: Cold conditions stimulate transcription of growth hormone
gene.
The solution: GM salmons are larger and reach sexual maturity sooner than wild salmon.
They inhibit increased feed use efficiency so they convert more food into tissues more
rapidly.

(c) Discuss how the human genome project can help parents customise their babies and the [6]
possible implications of doing so.
Info from HGP [1] must have both to gain 2 marks.
One can use the information from Human Genome Project to identify a wide
range /genome-wide range (or state number of genes);
of disease causing alleles, alleles that give desirable traits such as height,
intelligence, strength endurance etc;
(Important to state that it is a genome-wide range, since prior to HGP, other genetic
traits would have been known).
How info use to create Designer Babies [1] either one is a necessary point.
Based on info from HGP, Designer babies could 1) be selected for using Pre-
210
14
implantation Genetic Diagnosis (PGD)/(OWTTE) that are disease-free or have
desirable traits;
Or based on the HGP, designer babies could 2) go through genetic modification
for enhancements in desirable traits/removal of undesirable traits discovered
through info from HGP;
Possible Benefits (at least 2 points to gain full marks)
Babies that are born would not have to suffer from genetic defects as those that
have disease-causing alleles are not implanted or have their genes modified to
correct the disease;
Designer siblings of children who have genetic diseases may be created to
provide matching and healthy stem cells for therapy;
Determine the sex of the child as this might prevent babies who have diseases
like haemophilia and Duchenne Muscular Dystrophy, Fragile X syndrome, only
show themselves in male babies;
Ethical concerns (at least 2 points to gain full marks)
For the selection of embryos to implant in PGD, those that are not selected are
discarded or unused which will raise ethical concerns since these embryos have
been fertilized.
Designer siblings may be feel that their existence was for a cure rather than
parents wanting a child/feel inferior to the child who is sick
Choosing the sex of babies can raise ethical concerns especially in societies
where boys are valued more highly than girls, tipping the sex-ratio.

Designer babies with genetical enhancements (cf gene therapy) to add genes for
HIV resistance or longevity or a high IQ?
May lead to a social divide between between those who can afford designer
babies/designer genome and those that cannot.
[Total: 20]
211
NAME: ___________________________________________ CLASS: _________ INDEX: __________

CATHOLIC JUNIOR COLLEGE


JC2 PRELIMINARY EXAMINATIONS
Higher 2

BIOLOGY 9648/01
Paper 1 Multiple Choice WEDNESDAY 4 SEPT 2013
1 hour 15 minutes
Additional Materials: Multiple Choice Answer Sheet

READ THESE INSTRUCTIONS FIRST

Write in soft pencil.


Do not use staples, paper clips, highlighters, glue or correction fluid.
Write and/or shade your name, NRIC / FIN number and HT group on the Answer Sheet in the
spaces provided unless this has been done for you.

There are forty questions on this paper. Answer all questions. For each question, there are
four possible answers, A, B, C and D.

Choose the one you consider correct and record your choice in 2B pencil on the separate
Answer Sheet.

Read the instructions on the Answer Sheet very carefully.

Each correct answer will score one mark. A mark will not be deducted for a wrong answer.

Any rough working should be done in this booklet.


Calculators may be used.

This document consists of 22 printed pages.


[Turn over
212
1 Which of the following are the most likely consequences for a cell lacking Structure X?

I The cell dies because it is unable to make glycoproteins to detect stimuli from its
environment.
II The cell dies from a lack of enzymes to digest food taken in by endocytosis.
III The cell dies from the accumulation of worn out organelles within itself.
IV The cell is unable to reproduce itself.
V The cell is unable to export its enzymes or peptide hormones.

A II and III

B II and V

C III, IV and V

D I, II, III and V

2
213
2 The diagram below shows a biological molecule found in the living cells.

The following are some statements concerning the molecule shown above.

1 It is soluble in water.
2 Double bonds between the carbon and oxygen atoms increase membrane fluidity.
3 It can act as a buffer against extreme pH change.
4 It can undergo condensation to form a polymer.

Which of the above statements are true about this molecule?

A 1 and 3

B 1 and 4

C 2 and 3

D 2 and 4

3 An experiment was carried out to investigate the digestion of starch using amylase at two different
temperatures. A sample was removed from each mixture at 15 second intervals and place onto a
spotting tile well containing two drops of iodine in KI solution. The results are shown in the diagram.

Which shows the correct temperatures and times for the complete digestion of starch?

temperature / C time / s
A 30 3.15
10 0.45
B 30 45
10 195
C 10 45
30 195
D 10 3.15
30 0.45

3
214
4 The graph shows changes in the amount of DNA in a cell during one cell cycle. The letters U Z
marks out the different phases in the cell cycle.

Many drugs that are used to treat cancer work at different time periods during the cell cycle.

(i) Cisplatin binds to DNA and stops free DNA nucleotides from joining together.

(ii) Drug B stops spindle fibres from shortening.

With reference to the cell cycle above, determine where these 2 drugs work.

Cisplatin Drug B

A W X

B W Y

C U X

D U Z

4
215
5 The diagram shows how genetically identical frogs can be developed from unfertilised frog eggs.
The diploid number for frogs is 26.

Which combination of numbers correctly identifies the number of chromosomes in each type of cell?

V W X
A 13 13 26
B 13 26 13
C 13 26 26
D 26 26 13

6 The table below shows a list of characteristics displayed by mutant strains of E.coli during DNA
replication and the possible reasons.

No Characteristics of mutant E.coli Enzymes or functions affected by mutation


1 Okazaki fragments accumulate and DNA ligase activity is missing
DNA synthesis is never completed
2 Supercoils are found to remain at the DNA helicase is hyperactive
flanks of the replication bubbles
3 Synthesis is very slow. DNA polymerase keeps dissociating from the
DNA and has to re-associate
4 No initiation of replication occurs. A-T rich region at origin of replication deleted

Which of the reasons correctly explain the characteristics displayed by the mutant E. coli strains?

A 2 and 3
B 1 and 3
C 1, 3, and 4
D All the above

5
216
7 Part of the amino acid sequence of protein X in normal and disease patients are shown below.

Protein X in normal patient Protein X in disease patient

Lys-His-Pro-Asp-Thr Lys-His-Pro-Gly-Thr

mRNA codons for the amino acids shown in the sequence are as follows:

His: CAU, CAC Asp: GAU, GAC Lys: AAA, AAG

Thr: ACU, ACC, ACA, ACG Gly: GGU, GGC, GGA, GGG Pro: CCU, CCC, CCA, CCG

Which transfer RNA is involved in forming the modified part of protein X?

A B C D

8 Listed below are some antibacterial drugs that can affect the synthesis of bacterial proteins.

Anti-microbial drug Rifampicin Streptomycin Tetracycline

Binds to RNA mRNA misread Prevents binding of


Mode of action
polymerase during translation tRNA to ribosome

Which row shows the correct effects of these drugs on bacterial protein synthesis?

Rifampicin Streptomycin Tetracycline


A Defective protein mRNA does not bind to Polymerization of amino acids
synthesised ribosome does not occur

B mRNA not Defective protein Polymerization of amino acids


synthesised synthesised does not occur

C mRNA not mRNA does not bind to Transcription prevented


synthesised ribosome

D Transcription Defective protein mRNA does not bind to


prevented synthesised ribosome

6
217
9 The diagram represents a length of DNA which includes an operon. E, F, G and H have different
functions.

What correctly identifies E, F, G and H?

E F G H

A operator structural gene(s) regulatory gene promoter

B promoter regulatory gene structural gene(s) operator

C regulatory gene promoter operator structural gene(s)


D structural gene(s) operator promoter regulatory gene

10 The following statements describe bacterial conjugation.

I The F plasmid is made of single-stranded DNA.


II When an F+ donor gives an F plasmid to an F- recipient, both become F-
III When an F+ donor gives an F plasmid to an F- recipient, both become F+
IV When an F+ donor gives an F plasmid to an F- recipient, the donor becomes F-
V When F+ cells are mixed with F- cells, eventually all the cells will become F+.

Which of the statements are true?

A I, II and IV

B II and IV

C III, IV and V

D III and V

7
218
11 Which of the following correctly identifies the reproductive cycles X and Y and structures A and B?

X Y A B
A lytic lysogenic virus DNA provirus
B lysogenic lytic virus DNA prophage
C lytic lysogenic bacterial DNA prophage
D lysogenic lytic bacterial DNA provirus

12 Which feature occurs in the life cycle of the influenza virus?

A Host cell DNA is destroyed by lytic enzymes.

B Viral genome is integrated into the host genome.

C Viral DNA acts as a template for DNA synthesis.

D Viruses enter the host cell by receptor-mediated endocytosis.

8
219
13 The diagram below shows the reproductive cycle of the herpes virus which causes cold sores on the
mouth. With reference to the diagram below, which of the following statements best describes the
herpes virus?

A It is not a retrovirus as it does not contain RNA as its genetic material.


B Its mode of replication is similar to that of HIV.
C Its replication cycle includes a lysogenic phase
D Death of the host cell is necessary for the release of the viral progeny.

14 Which of the following is NOT a feature of eukaryotic gene expression?

A Polycistronic mRNAs are very rare.


B Many genes are interrupted by noncoding DNA sequences.
C RNA synthesis and protein synthesis are coupled.
D mRNA is often extensively modified before translation.

9
220
15 Human telomeres consist of repeating TTAGGG sequences which extend from the ends of the
chromosomal DNA.

When cells undergo mitotic division, some of these repeating sequences are lost. This results in a
shortening of the telomeric DNA.

The diagram shows a eukaryotic chromosome.

What is a consequence of the loss of repeating DNA sequences from the telomeres?

A The cell will begin the synthesis of different proteins.


B The cell will begin to differentiate as a result of the altered DNA.
C The number of mitotic divisions the cell can make will be limited.
D The production of mRNA will be reduced.

16 The acetylation of histones promotes loose chromatin structure. Recent evidence has shown that
chemical modification of histones play a direct role in regulation of gene expression.

Which of the following best explains how acetylation regulates gene expression?

A Helicase action is enhanced by acetylation.


B Acetylation of histones neutralizes their negative charges and encourages binding to DNA
polymerase.
C RNA polymerase works better by binding with acetyl groups.
D When nucleosomes are highly acetylated, chromatin becomes less compact and DNA is
more accessible for transcription.

17 The translation mixture contains a polynucleotide that directs the synthesis of Met-Gly-Gly-Phe-Leu-
Ala. In the presence of Azithromycin, this polymer directs the synthesis of Met-Gly only.

From the information given, which of the following deductions could you make about Azithromycin?

Control Stage Conclusion


A Translational It prevents formation of the initiation complex, which contains the
initiator tRNA and both ribosomal subunits.

B Post translational It inhibits binding of aminoacyl- tRNAs to the A site in the ribosome.

C Translational It blocks translocation of peptidyl transferase-rRNA from the A site to


the P site of the ribosome.

D Post translational It interferes with chain termination and release of the peptide.

10
221
18 Which of the following genetic changes might lead to lower risk of cancer?

1 amplification of a tumour suppressor gene


2 deletion of the promoter upstream of a proto-oncogene
3 loss of function mutation of a proto-oncogene
4 translocation of a tumour suppressor gene to downstream of a strong promoter

A 1 and 3 only
B 2 and 3 only
C 1, 2 and 4 only
D 1, 2, 3 and 4

19 What do chromosomal aberrations and gene mutations have in common and how are they different?

Similarity Difference
A Both may involve addition of Gene mutations always produce dominant
nucleotides. alleles but not chromosomal aberrations.
B Both may not result in disorders. Gene mutations do not involve inversions but
inversions of segments of chromosomes do
occur.
C Both affect nucleotide sequence in Gene mutations occur within a chromosome
DNA molecule. but chromosomal aberrations may occur
across chromosomes.
D Both may not result in a difference in Chromosomal aberrations are more harmful
protein expression. than gene mutations.

20 In poultry, males have two X chromosomes and females have one X chromosome and one Y
chromosome. The gene for feather-barring is sex-linked. The allele for barred feathers is dominant
to the allele for non-barred feathers. A non-barred male is crossed with a barred female.

What ratio of offspring would be expected?

A 1 barred male : 1 barred female


B 1 non-barred male : 1 non-barred female
C 1 barred male : 1 non-barred female
D 1 non-barred male : 1 barred female

11
222
21 Purple buds of the morning glory flower, Ipomoea, open into blue flowers. As the flower opens, the
pH on the vacuoles of the flower epidermal cells increases and this results in a change of colour
from purple to blue.

A mutant purple-flowered morning glory plant carries recessive alleles of a gene B/b, coding for a
membrane-bound ion pump, and is unable to increase the pH of the vacuole. Both normal blue
flowers and mutant purple flowers have the same anthocyanin pigment, coded by the dominant
allele of the gene A/a. Plants with aa cannot produce anthocyanin and they have white flowers.

The genes A/a and B/b are not linked.

A blue-flowered morning glory plant was crossed with a purple-flowered plant. Their offspring
consisted of plants which are blue-flowered, purple-flowered as well as white-flowered.

What were the genotypes of the blue-flowered and purple-flowered plants?

Blue-flowered plant Purple-flowered plant

A AABB AaBb
B AaBb Aabb
C aaBB AaBB
D aaBb aaBb

22 The table below shows the blood group phenotypes resulting from crosses between different
genotypes.

Genotype of 1st Genotype of 2nd parent


A A
parent I I IAIO
IAIO A A and O
IBIO A and AB A, B, B and AB
Two parents have a son who has blood group O and phenylketonuria. One parent has blood group
O and the other has blood group A. Neither parent has phenylketonuria.

What is the probability that the second child of these parents will be a girl with blood group A who
does not have phenylketonuria?

A 1 in 16
B 1 in 8
C 3 in 16
D 3 in 8

12
223
23 When a pure-breeding maize plant with yellow seeds and full endosperm is crossed with another
pure-breeding plant having white seeds and shrunken endosperm, the F1 maize plants are found
with yellow seeds and full endosperm. When the F1 plants are selfed, four classes of descendants
are obtained as shown in the table below:

Colour of seed Shape of endosperm Number of seeds observed in F2


generation (O)
Yellow Full 128
Yellow Shrunken 27
White Full 20
White Shrunken 17

The formula for the chi-squared (2) test is given as follows:

where = sum of
O = observed value
E = expected value

Degrees of Probability
freedom 0.10 0.05 0.01 0.001
1 2.71 3.84 6.64 10.83
2 4.69 5.99 9.21 13.82
3 6.25 7.82 11.35 16.27
4 7.78 9.49 13.28 18.47

Which of the following conclusions made about the inheritance of colour of seed and shape of
endosperm is correct?

A Since p < 0.05, the difference between the observed and expected results is not significant.
Thus the inheritance of colour of seed and shape of endosperm is following Mendels law of
independent assortment.
B Since p > 0.05, the difference between the observed and expected results is not significant.
Thus the inheritance of colour of seed and shape of endosperm is not following Mendels law
of independent assortment.
C Since p < 0.01, the difference between the observed and expected results is not significant.
Thus the inheritance of colour of seed and shape of endosperm is following Mendels law of
independent assortment.
D Since p < 0.01, the difference between the observed and expected results is significant.
Thus the inheritance of colour of seed and shape of endosperm is not following Mendels law
of independent assortment.

13
224
24 Solute Q moves across the plasma membrane via protein channels. Solute R moves across the
plasma membrane by simple diffusion. The rate of movement of each solute into a cell is recorded
and graphed.

The results are shown in the following graph.

It would be reasonable to conclude that

A solute Q is lipid soluble.


B solute Q saturates the protein channels.
C the gradient of the graph for solute R will increase as the temperature decreases.
D as solute R is metabolised within a cell, its rate of movement across the membrane
decreases.

25 The diagram shows a section through a chloroplast.

Where would the products of photophosphorylation be used?

14
225
26 The following graphs shows two separate experiments on carbon dioxide fixation in photosynthesis
using a unicellular green alga and radioactive isotope 14C to label the carbon dioxide. The algae
were actively photosynthesizing before the start of both experiments.

Which of the following correctly identify the graphs E, F, G and H?

E F G H
A RuBP GP GP RuBP
B GP RuBP GP RuBP
C GP RuBP RuBP GP
D RuBP GP RuBP GP

15
226
27 Rotene and oligomycin are two metabolic poisons which affect cellular respiration. The effects of
rotene and oligomycin on aerobic respiration are summarised in the table.

Ability to use glucose Ability to use oxygen ATP yield


Rotene Yes No Decreases
Oligomycin Yes Yes Decreases

Which of the following correctly identifies the specific functions of these two metabolic poisons?

Rotene Oligomycin
A Electron transport inhibitor Inhibits ATP synthase
B Inhibits ATP synthase Electron transport inhibitor
C Dissipate proton gradient Inhibits ATP synthase
D Inhibits ATP synthase Dissipate proton gradient

28 The flow chart shows a series of reactions occurring in an animal cell.

Which of the following statements correctly describes the flow chart?

A Reaction X, which occurs in the cytosol, is an anabolic reaction.

B Reaction Y involves the process of substrate-level phosphorylation, whereby pyruvate is first


converted to a compound called acetyl coenzyme A.

C Reaction Y occurs in the cytoplasm whereas reaction Z occurs in the mitochondria.

D Reaction Z is a catabolic pathway which occurs twice for every glucose molecule to be
completely oxidised.

16
227
29 Which sequence of events correctly describes evolution?

1 Differential reproduction of the spiders occurs.


2 A new selection pressure occurs.
3 Allele frequencies within the spider population change.
4 Poorly adapted spiders have decreased survivorship.

A 2 4 1 3
B 2 4 3 1
C 4 1 3 2
D 4 3 1 2

30 The graph below shows data on a population of a species of moth which shows considerable
variation in colour intensity

Which conclusion can be made from this graph?

A Colour variation is environmentally induced.


B Colour variation is genetically determined.
C Extreme forms are favoured by natural selection.
D The species shows discontinuous variation with respect to colour.

17
228
31 Darwins view of the process of evolution to form new species (speciation) has been reinforced by
more recent discoveries in genetics and cell biology. This is termed the neo-Darwinian view of
evolution.

In this view, which sequence of events is considered most likely to lead to speciation?

competition and
adaptation of behavioural sympatric
A predation leading
population   isolation  speciation
to natural selection

competition and
adaptation of behavioural allopatric
B predation leading
population   isolation  speciation
to natural selection

competition and
adaptation of
predation leading geographical sympatric
C isolated
to natural  isolation   speciation
populations
selection

competition and
adaptation of
predation leading geographical allopatric
D isolated
to natural  isolation   speciation
populations
selection

32 The table shows amino acid sequences from a segment of a viral protein that is found in a number
of different viruses. These viruses were isolated from patients suffering from either the common cold
caused by rhinovirus or flu caused by influenza. Each letter represents a single amino acid.

Virus Amino acid sequence

Rhinovirus 1 P E F P Y N A T T E P T K A V P F Q
Rhinovirus 2 P E F S Y S A V D D P I G E E P F K
Rhinovirus 3 P E F S Y S A G D D P A G E E P F N

Influenza A P E Y H T P V M E P L D P F T M D K
Influenza B P E Y H T P K M E P L D A F A M D N
Influenza C P E Y H T P V M E P L D V F D M D K

Which of the following statements is consistent with the data given?

A The rhinoviruses are more closely related to each other than the influenza viruses are to
each other.

B Influenza virus A is more closely related to influenza virus B than influenza virus B is to
influenza virus C.

C The influenza viruses are less closely related to each other than they are to the rhinoviruses.

D Rhinovirus 2 is more closely related to rhinovirus 3 than it is to rhinovirus 1.


18
229
33 The pBR322 vector is used to clone a eukaryotic gene, which has been digested by the restriction
endonuclease BamHI.

pBR322
Vector
(4361 bp)

Following transformation, bacterial cells were grown in four different media, as shown below:

1 Nutrient broth containing ampicillin

2 Nutrient broth containing tetracycline

3 Nutrient broth containing ampicillin and tetracycline

4 Nutrient broth without ampicillin and tetracycline

Which of the following media would bacterial cells containing the recombinant plasmids grow in?

A 4
B 1 and 2
C 2 and 3
D 1 and 4

19
230
34 Digestion of a 4 kb DNA molecule with EcoRI yields two fragments of 1 kb and 3 kb each. Digestion
of the same molecule with HindIII yields fragments of 1.5 kb and 2.5 kb. Finally, digestion with
EcoRI and HindIII in combination yields fragments of 0.5 kb, 1 kb and 2.5 kb. How would a
restriction map indicating the positions of the EcoRI and HindIII cleavage sites look like?

35 The dashed lines in the template sequence represent a long sequence of bases to be amplified.

Template
5 ATTCGGACTTG - - - - - - - - - - - - - - - - - - - - GTCCAGCTAGAGG 3
3 TAAGCCTGAAC - - - - - - - - - - - - - - - - - - - - CAGGTCGATCTCC 5

Which of the following sets of primers can be used in the PCR for the amplification of the following
DNA sequence?

A 5 GTCCAGC 3 & 5 CCTGAAC 3


B 5 ATTCGGA 3 & 5 CCTCTAG 3
C 5 GGACTTG 3 & 5 GCTGGAC 3
D 5 AUUCGGA 3 & 5 GAUCUCC 3

20
231
36 Which of the following statements about the human genome project (HGP) is false?

A HGP aims to identify all the genes in human and to determine the DNA sequences of these
genes.
B HGP aims to allow genetic testing to take place for earlier detection of genetic diseases
C HGP allows defective genes to be replaced through gene therapy
D HGP allows comparative studies to be made between humans and other organisms to
identify similar genes associated with diseases.

37 What is the role of stem cells with regard to the function of adult tissues and organs?

A Stem cells are undifferentiated cells that divide asymmetrically, giving rise to one daughter
cell that remains a stem cell and one daughter that will differentiate to replace damaged and
worn out cells in the adult tissue or organ.
B Stem cells are embryonic cells that persist in the adult, and can give rise to all of the cell
types in the body.
C Stem cells are differentiated cells that have yet to express the genes and produce proteins
characteristic of their differentiated state, and do so when needed for repair of tissues and
organs.
D Stem cells are fully differentiated cells that reside under the surface of epithelial tissue, in
position to take over the function of the tissue when the overlying cells become damaged or
worn out.

38 Which of the following regarding embryonic stem cells and hematopoietic stem cells is true?

A As embryonic stem cells develop, they turned into hematopoietic stem cells as they lose their
ability to differentiate into all types of cells.
B Embryonic stem cells have more genes than hematopoietic stem cells and thus are able to
form more types of cells.
C Under normal conditions, embryonic stem cells express more of their genes compared to the
hematopoietic stem cells.
D Both stem cells are derived from the zygotic stem cells with the hematopoietic stem cells
having a lowered telomerase activity compared to the embryonic stem cells.

39 Some scientists are concerned about the release of genetically modified microorganisms into their
natural habitat.

What is the most likely reason for this concern?

A The microorganisms may reproduce quickly.


B The microorganisms may not survive.
C The mutation rate of the microorganisms would increase.
D The transfer of changed genes to other organisms.

21
232

40 An attempt was made to produce Golden rice. To determine whether or not DNA from the daffodils
and the bacterium had been successfully incorporated in the DNA of the rice, scientists used PCR
and gel electrophoresis to produce DNA profiles.

The following DNA profiles belong to the original strain of rice, three strains I to III of genetically
modified Golden rice, and the species of daffodil and bacterium used to incorporate beta-carotene
genes in the rice.

Which one of the strain(s) of Golden rice has successfully incorporated DNA from both the daffodil
and the bacterium?

A Strain I only

B Strain II only

C Strain I and III only

D Strain II and III only

END OF PAPER

22
233
2013 CJC H2 Biology Prelim Paper 1 Answers

1 D 21 B
2 B 22 C
3 B 23 D
4 A 24 B
5 C 25 A
6 C 26 C
7 D 27 A
8 B 28 D
9 C 29 A
10 D 30 C
11 C 31 D
12 D 32 D
13 A 33 D
14 C 34 A
15 C 35 B
16 D 36 B
17 C 37 A
18 D 38 D
19 C 39 D
20 C 40 B

23
234
1

Name: Index Class:


Number:

DUNMAN HIGH SCHOOL


Preliminary Examination
Year 6

H2 BIOLOGY
9648/01
Paper 1 Multiple Choice Questions 23 September 2013
1 hour 15 mins
Additional Materials: OTAS sheet

INSTRUCTIONS TO CANDIDATES:
DO NOT TURN THIS PAGE OVER UNTIL YOU ARE TOLD TO DO SO.
READ THESE NOTES CAREFULLY.

Section A MCQ [40 marks]

There are forty questions in this paper. Answer all questions. For each question there are four
possible answers A, B, C and D.
Choose the one you consider correct and record your choice in soft pencil on the separate Answer
Sheet.

Each correct answer will score one mark. A mark will not be deducted for a wrong answer. Any
rough working should be done in this booklet.

This document consists of 20 printed pages and 0 blank page.

[Turn over
DHS 2013
235
2

Answer all questions in this section.

1 A piece of mammalian tissue was homogenised and subjected to differential centrifugation to


yield four subcellular fractions. The activity within each fraction, of four different types of
enzyme, A, B, C and D, was investigated.

Which bar chart shows the results of investigating hydrolytic enzyme activity?

2 Membranes in cells include the following components.


1 cholesterol
2 glycoproteins
3 phospholipids
4 proteins
Which component is the most important for these functions of membranes?

3 In amylopectin, the bonds found between glucose units are __________ .

A (14) glycosidic bonds only


B (14) glycosidic bonds and (16) glycosidic bonds only
C (14) glycosidic bonds only
D (14) glycosidic bonds and (16) glycosidic bonds only
236
3

4 The figure shows a series of reactions in a metabolic pathway.


D
D E
A B C
A B C

J K
J K L

Enzyme C catalyses the splitting of C into D and J. Assuming that product E is an allosteric
inhibitor of C, which of the following would likely happen if E were not consumed in a
subsequent reaction?

A The rate of production of D would increase.


B The rate of production of E would remain the same.
C The rate of production of L would remain the same.
D The rate of production of all products D, E, J, K would decrease.

5 The figure shows the life cycle of the water flea, Daphnia. The cells of individual R contain
10 chromosomes.
R

P
T

Which of the following are correct?

Individual Ploidy Number of Reason for choice


level chromosomes
I P 2n 20 The cells of P can undergo both mitosis
and meiosis.
II Q 2n 20 P produces eggs Q by mitosis which
develop into females.
III S n 10 The gametic cells of P have undergone
normal meiosis.
IV T 2n 20 Random fertilisation of haploid gametes
from R and S occurred to form zygote T.

A I and II only
B I and III only
C II and IV only
D All of the above
237
4

6 Bacteria grown in 15N for many generations were transferred to 14N for further replication.
DNA from the bacteria was extracted and separated by density gradient centrifugation.

Their results are summarised in the following diagram.

What are the percentages of DNA containing 15N and 14N in tube 4?

7 What is the basis for the difference in the synthesis of the leading and lagging strands of
DNA molecules?

I The anti-parallel arrangement of the DNA strands.


II The RNA primers are required to initiate DNA elongation.
III DNA polymerase joins new nucleotides to the 3 end of the growing strand.
IV Helicase and single-stranded binding proteins work at the 5end of the DNA strand.

A I and III

B II and IV

C I and IV

D II and III
238
5

8 The diagram below shows part of a molecule of mRNA bound to a ribosome.

Which of the following is FALSE about molecule X?

I. It is formed by RNA polymerase in the nucleus.


II. It is able to form hydrogen bonds with mRNA.
III. An amino acid was attached to it by the enzyme amino-acyl tRNA transferase.
IV. It is held in the amino-acyl tRNA binding site of the ribosome.

A III only
B IV only
C I and II
D III and IV

9 Which of the following shows the possible effects of a single nucleotide substitution in each
of the following locations in a gene on the production of the protein it codes for?

Promoter Transcription Start codon Stop codon Middle of an


terminator intron
A No protein Protein product Protein product Protein product Too much
product is is shorter than is longer than is normal protein product
produced normal normal is produced
B Too much Protein product No protein Protein product Protein product
protein product is normal product is is longer than is normal
is produced produced normal
C Protein product Protein product Protein product Too much Protein product
is normal is longer than is shorter than protein product is longer than
normal normal is produce normal
D Protein product Too much Protein product Protein product No protein
is longer than protein product is normal is shorter than product is
normal is produced normal produced
239
6

10 Two new viruses E and Z, which infect eukaryotic cells, have been identified.

In one experiment, the nucleic acid from each virus is isolated and analyzed over a range of
temperatures. The light absorbance of nucleic acids changes when denaturation or
annealing occurs. The behaviour of the nucleic acid from each virus is shown in the graph.

Light Virus E
absorbance
(arbitrary units)
Virus Z

Temperature (C)

In a second experiment, it is found that treatment with reverse transcriptase inhibitors or with
inhibitors of DNA synthesis blocks the ability of virus Z to infect cells. In contrast, reverse
transcriptase inhibitors have no effect on the ability of virus E to infect cells but DNA
synthesis inhibitors block infection by virus E.

Which of the following conclusions can be drawn from both the experiments?

A The genome of virus E is single-stranded RNA and that of virus Z is double-stranded


DNA.
B The genome of virus E is double-stranded DNA and that of virus Z is single-stranded
RNA.
C The genome of virus E is double-stranded RNA and that of virus Z is single-stranded
DNA.
D The genome of virus E is double-stranded DNA and that of virus Z is double-stranded
RNA.
240
7

11 Which of the following correctly identifies the reproductive cycles X and Y and structures A
and B?

X Y A B
A lytic lysogenic virus DNA provirus

B lysogenic lytic virus DNA prophage

C lytic lysogenic bacterial DNA prophage

D lysogenic lytic bacterial DNA provirus

12 Bacterial strain A has been infected with viruses. Upon lysis, the virions produced are
introduced to Bacterial strain B. After a short period of time, a new strain of bacteria is
detected that is very similar to strain A but has a few characteristics of Strain B. Which is the
process that leads to the production of the new strain?

A Conjugation
B Transduction
C Transformation
D Transposition
241
8

13 A student has two cultures of cells. Cell culture A consists of a culture of normal cells
whereas cell culture B consists of a culture of cells dividing uncontrollably (isolated from a
tumour). He wanted to determine if the uncontrolled growth (in culture B) was the result of
an oncogene or a mutated tumour suppressor gene. He decided to fuse the cells from the
two cultures (i.e. culture A with culture B) to form a hybrid cell line. As he was not certain of
the expected results, he wrote down all the possible combinations in terms of the expected
results and the gene that is involved as shown below.

Expected results of hybrid cells Gene involved

1 Grows normally Oncogene

2 Grows uncontrollably Oncogene

3 Grows normally Mutated tumour suppressor gene

4 Grows uncontrollably Mutated tumour suppressor gene

Of the four possibilities, only two of them are set correctly. Based on your understanding of
the genetic changes that has occurred in oncogenes and the mutated tumour suppressor
genes, choose one of the options below which shows the two correct possibilities.

A 1 and 3

B 1 and 4

C 2 and 3

D 2 and 4

14 Four different genes are regulated in different ways.

Gene 1 undergoes tissue-specific patterns of alternative splicing.


Gene 2 is part of a group of structural genes controlled by the same regulatory
sequences.
Gene 3 under some circumstances undergo methylation.
Gene 4 codes for a repressor protein which acts at an operator site close by.

Which row of the table correctly identifies which genes are prokaryotic and which are
eukaryotic?

prokaryotic eukaryotic
A 1 and 2 3 and 4
B 1 and 3 2 and 4
C 2 and 3 1 and 4
D 2 and 4 1 and 3
242
9

15 Which of the following contains repetitive DNA sequences?

I. Telomere
II. Centromere
III. Intron
IV. Control element

A I and II
B II and III
C III and IV
D I, II and III

16 A cross between a round-leafed, tall plant and round-leafed dwarf plant produced the
following offspring:
Key
121 round-leafed, tall plant R round leaf
124 round-leafed, dwarf plant r oval leaf
42 oval-leafed, tall plant T tall
37 oval-leafed, dwarf plant t dwarf

What were the genotypes of the parents?

A RrTt x Rrtt
B RrTt x RRtt
C RrTT x Rrtt
D RrTT x RRtt
243
10

17 The inheritance of a disease in a family is presented in a pedigree tree below.

What type of inheritance could this disease show?

I Autosomal dominant

II Autosomal recessive

III Sex-linked dominant

IV Sex-linked recessive

A I only
B II only
C I and III
D II and IV

18 Agoutic mice have banded hairs, giving a grey colour. Black mice have unbanded hairs.
White mice have no pigment. A cross between a homozygous black mouse and a white
mouse produced offspring with agouti hair. Another cross between the black mouse and
another white mouse produced some offspring with agoutic hair and some with black hair.

What explains these observations on the phenotype of hair of mice?

A There is a single gene with two codominant allele, black and white.
B There is a single gene with three alleles in a dominance series, black grey white.
C There are two epistatic genes, one controlling pigment production and one controlling
banding.
D There are two linked genes, one controlling pigment production and one controlling
banding.

244
11

19 1. Light joins carbon dioxide to an acceptor compound which is then reduced by


hydrogen obtained from water.
2. Carbon dioxide combines with an acceptor compound and this is reduced by
hydrogen split from water by light
3. Light splits carbon dioxide and the resulting carbon then combines with oxygen and
hydrogen obtained from water.
4. Light splits water and the resulting hydroxyl group combines with a compound which
has incorporated carbon dioxide

Which of the following statement is/are CORRECT outline of the main events in
photosynthesis?

A 1 only
B 2 only
C 1 and 2
D 3 and 4

20 Dinitrophenol is a metabolic poison that can lodge within the thylakoid membranes of
chloroplasts. It then provides an alternative route for H+ ions to diffuse across the thylakoid
membranes. In what way will the Calvin cycle be affected in chloroplasts poisoned by
dinitrophenol?

A No change in rate as Calvin cycle occurs in the stroma and not at thylakoid membranes.
B The rate of Calvin cycle will increase as pH in the stroma will decrease towards the
optimum for enzymes involved in the cycle.
C The rate of Calvin cycle will decrease with the accumulation of glycerate-3-phosphate.
D The rate of Calvin cycle will decrease with the accumulation of glyceraldehyde-3-
phosphate.

245
12

21 Isotopes of oxygen can be used to distinguish between oxygen absorbed by plants and
oxygen evolved.

A mixture of oxygen isotopes 16O2 and 18O2 was supplied to a suspension of the
unicellular alga Chlorella which had previously been exposed to 16O2 only. During the
following hour, changes in concentration of these gases in the suspension were measured
in light and dark conditions.

The graph shows the results.

16
O2

18
oxygen O2
concentration/
arbitrary units

dark light dark light

time
16
What caused the concentration of O2 to rise in light?

A H218O was being photolysed more rapidly than H216O.


16
B O2 was being absorbed at different rates in light and dark.
16
C O2 was being produced in photosynthesis but was not being absorbed in
respiration.
16
D O2 was being produced in photosynthesis faster than it was being absorbed in
respiration.

22 Both glucose and appropriate enzymes are necessary for the process of glycolysis to
begin.

Which additional compound must also be present?

A Acetylcoenzyme A
B ATP
C Pyruvate
D Reduced NAD
246
13

23 In which of the following setups would carbon dioxide be produced?

I II III
A Mitochondria + glucose Cell lysate + pyruvate Chloroplast + RuBP
carboxylase
B Mitochondria + starch + Cell lysate + RuBP Cell lysate + pyruvate
amylase carboxylase
C Cell lysate + glucose Cell lysate + pyruvate Mitochondria + pyruvate
D Cell lysate + pyruvate Chloroplast + RuBP Lysosome + starch
carboxylase

24 Cyanide is a poison that prevents the production of ATP.

What will happen if a resting axon is treated with such a poison?

A The charge outside the axon membrane does not change.


B The charge inside the axon membrane becomes more negative.
C The charge outside the axon membrane becomes less positive.
D The charge inside the axon membrane becomes less positive.

25 The diagram represents a transverse section through a neurone as seen under an electron
microscope. Which of the following most appropriately describes the function of X?

A Insulate the neurone to maintain homeostatic conditions.


B Provide mechanical protection to the axon.
C Prevents ion exchange between the axon and extracellular fluid.
D Speeds up nervous transmission by allowing impulse to travel along it.
247
14

26 A particular type of autoimmune disease causes antibodies to destroy acetylcholine


receptors of neurons. What effect will this have on the functioning of the nervous system?

A Presynaptic neurons will be unable to release neurotransmitters into the synaptic


clefts.
B Neurons will be unable to propagate action potentials along their axons.
C Depolarized neurons will be unable to reestablish an ionic gradient across their
membranes.
D Postsynaptic neurons will be unable to detect signals from presynaptic neurons.

27 These statements describe an action potential. Which one of the following is FALSE?

A Its speed can be increased by myelination of the neurone.


B Its depolarization phase is an example of a positive feedback.
C It is regarded as an all-or-nothing response.
D It is initiated by the opening of voltage-gated sodium and potassium channels.

28 The diagram represents a G-protein coupled receptor on the cell surface membrane. A
peptide hormone ligand is bound to the receptor and initiates the production of a second
messenger.

What is the second messenger?

A a peptide hormone
B ATP
C cyclic AMP
D kinase
248
15

29 Which of the following is a correct statement regarding the hormonal control of blood glucose
level?

Hormone Receptor which hormone Effect


binds to
A Insulin Tyrosine kinase receptor Increase glycogenesis
B Insulin G protein-linked receptor Increase gluconeogenesis
C Glucagon Tyrosine kinase receptor Increase gluconeogenesis
D Glucagon G protein-linked receptor Increase glycogenesis

30 The diagram below shows an example of cell signaling. Identify the stages P, Q and R.

P Q R
A amplification ligand-receptor interaction phosphorylation
B ligand-receptor interaction dephosphorylation amplification
C transduction phosphorylation amplification
D ligand-receptor interaction amplification dephosphorylation

249
16

31 Molecular homology of haemoglobin is used to determine evolutionary relatedness in a range


of mammals. Either nucleic acids or proteins can be sequenced. The sequence of nucleic
acids and proteins are compared.

Which sequence will vary LEAST in related mammals?

A Amino acid
B DNA
C Edited mRNA transcript
D Primary mRNA transcript

32 When organochlorine insecticides such as DDT were in widespread use, mosquitoes in


malarial regions developed resistance more rapidly than houseflies in Britain.

What could account for the difference in the rates of the development of resistance?

A More insecticides were used in Britain.


B More insecticides were used in malarial regions.
C Mosquitoes have fewer random mutations when exposed to insecticides.
D Mosquitoes have more random mutations when exposed to insecticides.

33 Fish in the Artic and Antarctica have antifreeze proteins. But these two population of fish
diverged long before the antifreeze genes evolved. It was found that the genes that code for
the antifreeze proteins in fish, at the Artic and Antarctica, are quite different. This is evidence
that separate and independent episodes of molecular evolution occurred, and obtained the
same functional result.

Which of the following processes is responsible for the antifreeze property in the two
populations of the fish?

A Reproductive isolation
B Divergent evolution
C Convergent evolution
D Geographical isolation
250
17

34 Which of the following is TRUE of a genomic library?

A It is a catalogue of the different RFLPs of organisms within a population.


B It is a collection of DNA fragments that make up the entire genome of a particular
organism.
C It is a collection of DNA fragments created by reverse transcriptase which are then
inserted into vectors.
D It is a catalogue of all genes of an organisms genome which have been sequenced
thus far.

35 The diagram below shows the changes in temperature in a thermocycler over time during
polymerase chain reaction.

X X

Z Z

Y Y

Which of the following statements is TRUE?

A Elongation of new daughter strand occurs during Y.


B Taq polymerase functions optimally at X.
C DNA primers are anneal to the DNA template during Z.
D Double stranded DNA template denatures into single strands during X.
251
18

36 The diagram below shows the position of four restriction sites J, K, L and M for four different
restriction enzymes in a single plasmid. The distances between these sites are measured in
kilobases of DNA.

The plasmid was cut using only two restriction enzymes. The resulting fragments were
separated by gel electrophoresis. The positions of the fragments are shown in the chart
below.

Which restriction sites were cut?

A J and K
B L and M
C J and M
D L and K
252
19

37 A synthetic plasmid having an origin of replication (ori), a restriction site (R), two genetic
markers, -galactosidase gene (-gal) and tetracycline-resistance gene (tetr), was used as a
vector to transfer the human growth hormone gene into bacteria. The -gal gene codes for an
enzyme -galactosidase, which breaks down a colourless compound called X-gal to a blue
compound.

At which position should the restriction site (R) be located on the plasmid in order to identify
the desired transformed bacteria on an agar medium containing both X-gal and tetracycline?

38 How is the polymerase chain reaction (PCR) similar to the replication of DNA?

I DNA is heated to break hydrogen bonds


II DNA unzips
III free nucleotides are used
IV DNA polymerase are required

A I only
B II and IV only
C I, II and III only
D II, III and IV only
253
20

39 The autoradiograms obtained below (after electrophoresis and Southern Blotting) show
human DNA digested with a specific restriction enzyme and probed with labeled rRNA.

On the left, the probe used was 28S rRNA. On the right, the probe used was 18S rRNA.

If the arrows in the following map show the location of the restriction sites of this restriction
enzyme, which map best explains the results shown above?

40 Which of the following explains why insulin expressed in a prokaryotic host cell is not
functional?

I. Prokaryotic cells cannot replicate human DNA.


II. Prokaryotic cells cannot splice mRNA.
III. Prokaryotic cells do not possess sER.
IV. Prokaryotic protein expression machinery stops at translation.

A I only
B II only
C II and III
D I, II, III and IV

END OF PAPER
254
21

2013 Y6 Preliminary Exam H2


MCQ Answer Scheme

1 C 21 D
2 B 22 B
3 B 23 C
4 D 24 A
5 D 25 C
6 C 26 D
7 A 27 D
8 D 28 C
9 B 29 A
10 B 30 B
11 C 31 A
12 B 32 B
13 C 33 C
14 D 34 B
15 A 35 D
16 A 36 B
17 B 37 A
18 C 38 D
19 B 39 B
20 C 40 B

255
1

Name: Index Number: Class:

DUNMAN HIGH SCHOOL


Preliminary Examination
Year 6

H2 BIOLOGY 9648/02
Paper 2 Structured and Free-Response Questions 16 September 2013
2 hours
Additional Materials: Writing paper

INSTRUCTIONS TO CANDIDATES:
DO NOT TURN THIS PAGE OVER UNTIL YOU ARE TOLD TO DO SO.
READ THESE NOTES CAREFULLY.

Section B Structured Questions For Examiners Use


Answer all questions.
Section A [40]
Write your answers on space provided in the
Section B [80]
Question Paper.
1 / 10
Section C Free-Response Questions
2 / 5
Answer one question. Your answer to Section C
3 / 5
must be in continuous prose, where appropriate.
Write your answers on the writing paper provided. 4 / 10
Answer (a) and (b) on separate pieces of paper.
5 / 10

Submit your answers to Sections B and Section 6 / 9


C (a) and (b) separately.
7 / 13

8 / 9
INFORMATION FOR CANDIDATES
9 / 9
Essential working must be shown.
Section C [20]
The intended marks for questions or parts of
questions are given in brackets [ ]. 1/2

Total [140]

This document consists of 23 printed pages and 1 blank page.


[Turn over
DHS 2013
256
2

Section B: Structtured Ques stions (80 marks)


m For
Answer
A all q
questions in this section
n. Examiners
E
use

Questio
on 1

Fig 1.1 below show ws a pancreatic acinarr cell, an ex


xocrine cell involved inn the synthe
esis and
secretio
on of pancrreatic diges
stive enzym
mes. It show densing vaccuoles in the Golgi
ws the cond
region a
and mature secretory vesicles
v at tthe cell ape
ex.

Fig 1.1
257
3

(a) Naame the org ganelles lab


belled A, B and C and
d explain their role in ppancreatic enzyme
e
syynthesis. [6]]

(b) Onne major pa


ancreatic pro
otease synth
hesized by th
he pancreatic acinar cellls is trypsin
n, which
is synthesize
ed and pa ackaged intto secretoryy vesicles as the innactive proenzyme
ypsinogen.
try
Fig 1.2 showss the structu
ure of trypsin
n.

Fig 1.2
2
258
4

(ii) Describ
be region X. [2]

Trypsinogen is con nverted to tryypsin by the


e removal off a hexapepptide from its
s amino
terminuus after it is released in
nto the diges F 1.3 shoows the structure of
stive tract. Fig
trypsin and trypsino ogen.

Activ
ve site

Fig 1.3

(ii) With re
eference to Fig 1.3, exxplain how the removal of a hexxapeptide frrom the
amino terminus
t of trypsinoge n can resultt in the activ
vation of thee enzyme. [2]

Total: [10]

259
5

on 2
Questio For
Examiners
E
use
Fig. 2.1 shows a fe A F) of m eiosis in the
ew stages (A e lily, Lilium
m longiflorum
m.

A B C

D E F
Fig. 2.1

(a) W
With referencce to Fig. 2.1,
2
(ii) arrange
e these stag
ges in the ccorrect sequence. [1]

(ii) describ
be the main events thatt will occur to
t complete
e meiosis affter stage A.
A [2]
260
6

(b) Explain how meiosis results in genetically non-identical gametes. [2]

Total: [5]
261
7

Questio
on 3 For
Examiners
use
A studyy of a bacte
erias chrommosome sh howed that it possesse es a lac opperon to allow the
bacteriu
um to metabbolise lactos
se. The stru
ucture of the n is shown in Fig 3.1 below:
e lac operon b

Fig 3.1

The graaph in Fig 3.2 below shows


s the growth of bacteria
b in the presencce of gluco
ose and
lactose.

Fig 3.2

(a) W 2, state the main respiratory substrate of the bacteria in Part I.


With referencce to Fig 3.2
[1]
262
8

(b) Explain the changes in graph C in Part II and Part III. [4]

Total: [5]
263
9

Question 4 For
Examiners
use
(a) Alpha tropomyosin (-TM) is a protein found in muscles as well as several other
tissues in different isoforms.

Fig 4.1 shows the organisation of the -TM gene with exons shown as boxes.

Fig 4.1

Fig 4.2 shows the -TM mRNA transcripts found in various tissues.

Fig 4.2

(i) Explain how the -TM gene can produce different -TM isoforms in different
cell types. [3]
264
10

(ii) Explain the advantage of the process mentioned in (i). [1]

(b) Telomeres are found at the ends of eukaryotic chromosomes. They contain a series of
tandem repeat sequences and end with a single-stranded section called the 3
overhang. This 3 overhang results from the limitation of DNA polymerase to replicate
all the way to the end of the chromosome. This is known as the end-replication
problem.

Fig 4.3 shows the structure of a telomere.

Fig 4.3

(i) Explain the end-replication problem. [3]

(ii) Explain the role of the T loop structure shown in Fig 4.3. [1]
265
11

An enzyme called telomerase catalyses the lengthening of telomeres. Telomerase is


typically present only in germ cells and some rapidly dividing somatic cells. It has also
been found to be present in high concentrations in cancerous cells.

(iii) Explain how high telomerase activity promotes cancer. [2]

Total: [10]
266
12

Question 5 For
Examiners
use
In Drosophila flies, the wing shape and eye colour are controlled by two different genes
found on separate chromosomes. The gene controlling wing shape is found on chromosome
2 and has 2 alleles. Curly wings were found to be dominant over normal wings. Fig 5.1 and
Fig 5.2 shows the normal wing and curly wing phenotype respectively.

Fig 5.1: Normal Wing Fig 5.2: Curly Wing

The gene controlling eye colour is found on the X chromosome and has two alleles. It was
observed that red eye trait is dominant over white eye trait.

(a) Explain what is meant by the term dominant? [1]

(b) Construct a genetic diagram showing the phenotypes of the offspring and the
expected ratio of phenotypes when a white eyed female is crossed with a red eyed
male, both are heterozygous for curly wings. [4]
267
13

(c) A geneticist conducted an experim


ment on the e cross mentioned earrlier. 240 offspring
we
ere obtaine
ed from the experiment
e . The pheno he offspring were as follows:
otypes of th

83
3 red-eyed females
f witth curly wing
gs
41
1 red-eyed females
f witth normal wwings
78
8 white-eyed males witth curly wing
gs
38
8 white-eyed males witth normal wwings

A Chi-square
e test was performed o n the resultts on the cro
oss.

Fig 5.3
3

((i) ulate the Chi-square va


Calcu ng your workings in thee space belo
alue, showin ow. [2]

((ii) Use your


y calculated Chi-squ uare value anda the tablle of probabbilities proviided in
Fig 5..3 to find the
e probabilityy that the difference is due to cha nce. [1]

(iiii) State what conclusions mayy be drawn from


f the Ch
hi-square teest. [2]

Tottal: [10]
268
14

Question 6 For
Examiners
use
C3 plants undergo photorespiration, a process by which RuBP has oxygen added to it by
the enzyme RuBisCO, instead of carbon dioxide during normal photosynthesis.
Photorespiration can occur when carbon dioxide levels are low and when temperatures are
high, but unlike respiration, photorespiration produces no ATP.

Fig. 6.1 shows the rate of photosynthesis (measured by rate of CO2 fixation, graph drawn in
solid line) and the rate of photorespiration (measured by rate of O2 fixation, graph drawn in
dotted line) in wheat over a typical summer day.

Fig. 6.1

(a) With reference to Fig. 6.1, explain how stomata size affects the overall rate of
photosynthesis in wheat. [3]

(b) State the type of inhibitor that oxygen is to the enzyme RuBisCO. [1]
269
15

(c) Some plants have mechanisms to reduce photorespiration, such as the C4 plants.
These plants undergo additional steps of capturing carbon dioxide using another
enzyme (PEP carboxylase) to form oxaloacetate, before undergoing the Calvin cycle.
PEP carboxylase has been found to have a lower Km than RuBisCO for carbon
dioxide. Examples of C4 plants include sugar cane and maize.

Describe the type of environment that C4 plants are usually found in and explain how
PEP carboxylase enables C4 plants to be better adapted to their environments. [3]

(d) Explain why Calvin cycle is still necessary in C4 plants. [2]

Total: [9]
270
16

on 7
Questio For
Examiners
E
use
Fig. 7.1
1 shows thee observed changes inn permeability of the ax
xonal plasmma membra
ane of a
neuronee to sodium
m ions and to
o potassium
m ions durin
ng a single action
a potenntial.

Fig. 7.1

(a) De
escribe and
d explain the f sodium ions betweeen 0.5 ms and
e shape of the curve for a 0.7
mss. [4]
271
17

(b) During an action potential, the membrane potential rises to +40 mV and then falls. Use
information from Fig. 7.1 to explain the fall in membrane potential. [3]

(c) Tetraethylammonium (TEA) is a drug that blocks voltage-gated potassium channels.

(i) Predict and explain the effect of TEA on the axonal plasma membrane of the
neurone. [2]

(ii) Predict and explain the effect of TEA if it could be applied selectively to a
presynaptic neurone that releases an excitatory neurotransmitter. [2]

(d) After exercise, some ATP is used to re-establish the resting potential in axons. Explain
how the resting potential is re-established. [2]

Total: [13]
272
18

Question 8 For
Examiners
use
(a) Fig. 8.1 shows the sequence of events in the inositol phosphate signaling pathway.

Fig. 8.1

With reference to Fig. 8.1,

(i) describe the main sequence of events that leads to the activation of protein
kinase C. [4]

(ii) explain why the signal molecule cannot act directly on the DNA in the nucleus.
[1]
273
19

(iii) suggestt and explain how an IP


P3-triggered
d response is terminateed. [2]

(b) Etthylene glyccol tetra-ace


etic acid (EG
GTA) is a chelating agent that is ccapable of bonding
b
2+
se
ecurely to io
ons such as s Ca . The pharmacolo ogical effec
cts of EGTAA have been n widely
stu
udied.

In one study, smooth muscle


m cellss were transferred to a medium ccontaining varying
co
oncentration n of EGTA. Fig. 8.2 sshows the effects
e of EGTA on th e released rate of
Caa2+ in an ino
ositol phosp
phate signallling pathwa
ay.

Fig. 8.2
2

Coomment if the data in Fig. 8.2 su pports the hypothesis that high cconcentratio on of up
to 14.3mM off EGTA can effectively inhibit the binding
b of IP
P3 to its recceptor. [2]

To
otal: [9]

274
20

on 9
Questio For
Examiners
E
use
(a) IIn Lake Tan
nganyika in Africa, therre are six sp
pecies of fis
sh of the geenus Tropheeus and
a much larg ger numberr of distincttly coloured
d subspecie es of each oof the six species.
s
TTropheus species
s are small fish that are co onfined to issolated rockky habitats around
tthe shores of
o Lake Tannganyika.

TThe six spe ecies evolve ed during th


he primary radiation phase whenn the lake was
w first
ffilled, aboutt 1.25 millio
on years aago. They arose
a from river dwelliing ancesto
ors and
a available niches in th
tthen filled all he lake.

SSecondary radiations into the m any subspe ecies occurrred during the last 2002 000
yyears. Sommetime durin ng this peri od, the water level in the lake feell, resulting
g in the
fformation of three sepaarate lake b basins. The
ese basins persisted
p foor many tho ousands
oof years beffore the watter level rosse again.

F
Fig. 9.1 shows an outtline map o of the lake and the loc
cation of thhe three tem
mporary
b
basins caussed by lowe
ering of lake
e levels.

Fig. 9.1

EExplain howw natural selection


s co
ould have caused
c the
e evolution of the six closely
rrelated speccies in the primary
p radiiation. [4]
275
21

(b) Recent research has compared DNA sequence of cytochrome b gene of the six
different species of Tropheus. Fig. 9.2 shows part of the cytochrome b DNA
sequence.

T. brichardi CTTTTAACTATGATAACAGCTTTTGTGGGCTACG
T. kasabae CTTTTAACTATGATAATAGCTTTTGTGGGCTACG
T. annectens CTTTTAACTATGATAACAGCTTTTGTGGGCTACG
T. moorii CTTTTAACTATGATAACAGCTTTTGTGGGTTACG
T. polli CTTTTAACTATAATAACAGCTTTTGTGGGCTACG
T. duboisi CTTTTAACCATGATAACGGCTTTTGTAGGCTATG
Fig. 9.2

A family tree based on differences between the DNA sequences is shown in Fig. 9.3.

Fig. 9.3

With reference to Fig. 9.2, explain why different species of Tropheus can have similar
DNA sequence in their cytochrome b gene. [2]
276
22

(c) With reference to Fig. 9.2 and Fig 9.3, describe how the time of divergence of the
species could be estimated. [3]

Total: [9]
277
23

Section C: Free-Response Questions (20 marks)

Answer only one question.


Write your answers on the writing paper provided.
Your answers should be illustrated by large, clearly labelled diagrams, where appropriate.
Your answers must be in continuous prose, where appropriate.
Your answers must be set out in sections (a), (b) etc., as indicated in the question.
A NIL RETURN is required.

Question 1

(a) Compare transcription and translation in eukaryotes. [10]

(b) (i) Describe how molecular methods can be used to classify organisms. [6]
(ii) Suggest how bacteria evolve. [4]

OR

Question 2

(a) Outline the differences between prokaryotic and eukaryotic control of gene expression. [10]

(b) (i) Describe Krebs Cycle. [5]


(ii) Compare oxidative phosphorylation and photophosphorylation. [5]

Total: [20]

Please answer (a) and (b) on separate sheets of writing paper.

You will need to hand in (a) and (b) separately.

END OF PAPER
278
24

BLANK PAGE


279
25

DUNMAN HIGH SCHOOL


PRELIMINARY EXAMINATION 2012
YEAR SIX
H2 BIOLOGY (9648)

Answer Scheme

Structured Answers

Question 1
(a)
A Rough Endoplasmic Reticulum;
Ribosomes on RER responsible for synthesis of proteins (enzymes) to be secreted;
OR
Packaging of proteins (enzymes) for transport to Golgi Apparatus in transport vesicles;

B Mitochondrion;
Aerobic cellular respiration for the synthesis of ATP necessary for protein synthesis;

C Nucleus;
Contains the genes that code for the various pancreatic enzymes which are transcribed into
mRNA for protein synthesis;

(b)(i)
Alpha helix,
held by H bonds located between CO and NH groups (of the main polypeptide chain);
Between n and n+4 residues in the chain;

(ii)
Cleavage of hexapeptide from amino terminus shortens primary structure which changes the
secondary structure such that pleated sheets can form;
this creates a pocket / groove for the substrate to fit into on the surface of the tertiary
structure that functions as the active site of the enzyme;

Question 2
(a) (i) D, F, C, B, A, E ;

(ii)
The chromosomes uncoil / decondense and become very indistinct to form chromatin;
Spindle fibres disassemble / disintegrate / dissassociate;
Nuclear envelopes reform around each nucleus;
2 max

(b)
Crossing over between non-sister chromatids / homologous chromosomes during prophase
I;
Independent assortment and random segregation of homologous pairs of chromosomes
during metaphase I and anaphase I respectively;
Independent assortment and random segregation of non-identical sister chromatids due to
crossing over during metaphase II and anaphase II respectively;
2 max
280
26

Question 3
(a) glucose as the level of glucose is decreasing;

(b)
In Part II, there is no increase in the cell count of the bacteria as glucose has been used up
and time is needed for the expression/activation of the lac operon to produce -
galactosidase before lactose can be used/metabolized;
The presence of lactose means that the small amount of -galactosidase present in the
bacterial cells will catalyse conversion of some lactose molecules to allolactose;
Allolactose binds to the lac repressor, causing a change in conformation, inactivating it such
that it no longer binds to the lac operator. Allowing RNA polymerase access to the promoter;
The absence of glucose means that cAMP levels in the cells are high;
cAMP binds to CAP, causing a change in conformation of CAP such that it binds to the CAP
binding site, increasing RNA polymerases affinity for the promoter, increasing the rate of
transcription of -galactosidase;
many copies of -galactosidase, allowing bacteria to efficiently use lactose as a respiratory
substrate to support growth, thus the increase in the bacterial cell count seen in part III. This
continues until lactose is used up and cell count levels off;
4 max

Question 4
(a)(i)
alternative RNA splicing of the pre-mRNA;
different spliceosomes are present in different cell types which recognize different base
sequences are introns and exons;
from 1 gene 1 pre-mRNA different mRNAs produced different proteins;

(ii)
1 gene can code for different versions of a protein, this increases the coding capacity of the
genome without needing to increase the amount of DNA within the cell;

(b)(i)
DNA polymerase can only add nucleotides to the 3 hydroxyl end of a pre-existing daughter
strand / cannot add nucleotides to the bare template;
In lagging strand synthesis, once that primer is removed, it cannot be replaced with DNA as
there is no 3 end onto which DNA polymerase can add deoxyribonucleotides;
Therefore the 5 ends of daughter DNA strands of the lagging strand cannot be completed /
repeated rounds of replication thus produce shorter and shorter DNA molecules at the 5
end;

(ii)
to prevent exonucleases from degrading the ends of the linear DNA molecules;
to prevent fusions of the ends of chromosome with other DNA molecules;
1 max

(iii)
Telomere length plays a role in regulating replicative cell senescence as the length of the
telomeres limits the number of times each cell can divide / ref to apoptosis;
Telomerase allows the generation of telomeres lost at each cell division. This allows cancer
cells to divide continuously and indefinitely;
281
27

Question 5
(a)
In a heterozygous individual, the phenotype of the dominant allele is always expressed and
masks the effect of the recessive allele;

(b)
Let A represent the dominant allele for curly wings
a represent the recessive allele for normal wings
XR represent the dominant allele for red eyes
Xr represent the recessive allele for white eyes

Parental White-eyed female Red-eyed male


X [1]
phenotype: with curly wings with curly wings
Parental XrXrAa XRYAa
X
genotype:
Gametes: r
XA r
Xa XRA XRa YA Ya
X

Punnets square:

XRA XRa YA Ya

[1]
XrA XRXrAA XRXrAa XrYAA XrYAa

Xra XRXrAa XRXraa XrYAa XrYaa

Offspring XRXrAA XRXraa XrYAA XrYaa


genotype: 2 XRXrAa 2 XrYAa
Offspring Red eyed Red eyed White eyed White eyed
phenotype: [1]
female with female with male with male with
curly wing normal wing curly wing normal wing

Offspring 3: 1: 3: 1 [1]
phenotypic ratio:

(c)(i)
Classes Observed Expected Expected (O E)2 (0 E)2
number (O) ratio number (E) E
Red eyed female 83 3 90 49 0.544
with curly wing
Red eyed female 41 1 30 121 4.033
with normal wing
White eyed male 78 3 90 144 1.6
with curly wing
White eyed male 38 1 30 64 2.133
with normal wing
Total 240 8 240 0 0
8.31
(Calculations / Workings [1] Correct Answer to 2d.p. [1])
282
28

(ii)
0.02 <p < 0.05;

(iii)
Critical 2 value (7.82) < calculated 2 value (8.31), therefore there is a significant difference
between observed and expected values;

cross does not follow Mendalian ratios and other factors may be at work;

Question 6
(a)
As average stomata size increases from 0 to 10 units, rate of photosynthesis increases
drastically by 550% / from 20 to 130 a.u.;

An increase in stomata size enables more atmospheric CO2 to enter, which is fixed by
RuBisCO;

Therefore, overall rate of photosynthesis increases as more CO2 is fixed as compared to


amount of O2 fixed;

(b)
Competitive;

(c)
Dry and hot;
Stomata closes and thus result in lower CO2 concentration entering leaves;
Since PEP carboylase has a higher affinity for carbon dioxide than RuBisCO/ PEP
carboylase not inhibited by oxygen;
Thus C4 plants are able to fix the carbon dioxide more efficiently;

(d)
Calvin cycle is the light-independent stage of photosynthesis;
Only through Calvin cycle can carbon dioxide be fixed to form glucose/ carbohydrate;
283
29

Question 7
(a)
permeability to sodium ions increases drastically from 0 to 28 a.u;
initial rise in permeability to sodium ions occurs when a stimulus opens some voltage-gated
sodium channels;
Influx of sodium ions through those channels depolarises the membrane, making the inside
of the neurone positive with respect to the outside / threshold;
As the influx of sodium ions continues, the membrane becomes further depolarised in a
positive-feedback loop, opening more voltage-gated sodium channels;
This allows even more sodium ions to diffuse into the neurone, explaining the sharp rise in
permeability to sodium ions;
4 max

(b)
The fall in membrane potential indicates repolarisation of the membrane as efflux of
potassium ions occurs without further influx of sodium ions;

Permeability to sodium ions decreases from 28 to 0 a.u. as most voltage-gated sodium


channels are inactivated / Closure of voltage gated sodium channels by the time the
membrane potential reaches +40 mV;

Permeability to potassium ions increases up to 12 arbitrary units as most voltage-gated


potassium channels are open by the time the membrane potential reaches +40 mV;

(c)(i)
Depolarised membrane would not be able to repolarise / return to the resting potential;
This is because efflux of potassium ions cannot occur when voltage-gated potassium
channels are blocked by TEA;
OR
Takes a long time for resting potential to return back to resting potential;
hence the next action potential will take a longer time to be generated / no action potential
can be generated;

(ii)
The presynaptic neurone would continue to release excitatory neurotransmitters until the
neurotransmitters in the presynaptic neurone are depleted;

This is because calcium ions would continue to enter the presynaptic neurone via the
voltage-gated calcium channels and trigger the release of excitatory neurotransmitters so
long as the presynaptic membrane remains depolarized;

OR

TEA prevents next action potential from being generated since neurone is perpetually in its
depolarised state / repolarisation cannot occur when efflux of potassium ions across the
voltage gated channels cannot take place.

hence the neurone is not able to release neurotransmitter across the synapse upon
stimulation. / action potential cannot be generated / decrease the occurrence of action
potential;

(d)
Sodium-potassium ion pump by active transport with the hydrolysis of ATP;
2 potassium ions in and 3 sodium ions out of the neurone;
284
30

Question 8

(a) (i)
Signal molecule binds to GPCR via ligand-receptor interaction which in turn activates G-
protein. G-protein is activated when it is attached to GTP nucleotide;

Upon activation, activated G-protein dissociates from the receptor, diffuses along the
membrane and then binds to and activates phospholipase C-;

PI 4,5 bisphosphate is cleaved into diacylglycerol and IP3 / Activation of phospholipase C-


catalyzes the formation of IP3;

IP3 serves as the second messenger and binds to ligand-gated Ca2+ channels in the ER
membrane, causing them to open;

Ca2+ ions flow down concentration gradient from ER lumen to cytosol and binds to protein
kinase C, thus activating the enzyme;
4 max

(ii)
Signal molecule is water soluble / lipid-insoluble, thus it cannot pass through the
hydrophobic lipid bilayer/ fatty acid tails of the plasma membrane;

(iii)
Dephosphorylation of IP3 by phosphatase which removes phosphate groups from proteins;
IP3 will no longer be able to bind to ligand-gated Ca2+ channels, hence leading to the inability
of Ca2+ ions to diffuse into the cytosol;
Presence of calcium ions that enter the cytosol is rapidly pumped out, mainly to the exterior
of the cell disruption to the ionic gradient of Ca2+ / answers pertaining to the disruption in
the Ca2+ concentration;
Breakdown of signal molecule such that it is unable to bind to GPCR, forming ligand-
receptor interaction. Hence, there will be no activation of G-protein and phospholipase C;
2 max

(b)
Data in Fig. 8.2 do not support the hypothesis that high concentration of EGTA can inhibit
the binding of IP3 to its receptor;
When total EGTA concentration was increased from 4.5 mM to 10.0 mM to 14.3 mM, the
calcium release rate remained relatively constant at approximately 0.020 sec-1;
285
31

Question 9
(a) (i)
variations in the Tropheus fish population due to mutation resulting in different alleles;
at least 6 different niches in the lake with different selection pressure;
fish with at selective advantage survive and reproduce viable offspring;
passing on advantageous genes/alleles to the next generation;
accumulation of many genetic changes over a long period of time to evolve into 6 species;
reproductive/ behavioural/ sympatric/ allopatric/ geographical isolation/ accept hundreds of
km apart thus no gene flow between different populations;
4 max

(b)
evolved from a common ancestor;
cytochrome b gene code for important protein involved in respiration thus any mutation will
result in non-functional protein which will be fatal to the organism;
this gene would have gone through the least mutation not counting silent mutation;
3 max

(c)
compare and note the number of differences in the DNA sequences between species;
determine the age of fossil record of each species by dating;
calculate the rate of mutation using calibrated molecular clock;
no. of mutation/ no. of difference in DNA sequence is used to calculate the length of time
since divergence;
3 max
286
32

Essay answers

1(a)
Similarities:
1. Function: Both processes are required for gene expression / protein synthesis;
2. Process: Both involve synthesis of polymers from monomers by condensation
reaction with the removal of 1 water molecule;
3. Process: both involve synthesis of polymer based on a reference molecule /
template;
4. Process: initiation of both processes requires the aid of factors in formation of
initiation complex;
5. Both require post-processing of products post-transcriptional modification for
pre-mRNA to become mature mRNA and post-translational modification of
polypeptide chain before formation of mature protein;

Differences:

Features Transcription Translation


6. Location Nucleus Free ribosomes in cytoplasm and
ribosomes bonds to the RER
7. Template DNA template strand of gene Mature mRNA
8. Direction of Template is read in 3 to 5 mRNA is read in 5 to 3 direction
reading of direction
template
9. Method of Template is read in individual Template is read in codons, with
reading of nucleotides, with incoming free incoming amino-acyl tRNA
template ribonucleotide added by anticodon recognizing the codon
complementary base pairing on mRNA by complementary base
pairing
10. Type of Free ribonucleotides Amino acids
monomer

11. Monomer no Yes


requires Requires activation / attachment to
activation tRNA
12. Bond Phosphodiester bonds between Peptide bonds between amino
between ribonucleotides acids
basic units

13. Enzyme RNA polymerase II Peptidyl transferase in large


(catalyst for ribosomal subunit
bond
formation)
14. Products mRNA, rRNA and tRNA Polypeptide chain
287
33

1 (b) (i)
1. Molecular methods used in classification of organisms involve using molecular homology
such as similarities in DNA or amino acid sequences;

2. molecular methods are objective and quantifiable ways to classify organisms base on
their phylogenetic relationships;

3. By comparing the DNA or amino acid sequence of different organisms , we can


determinate the amount of similarity in the sequences of each birds;

4. the higher the percentage of similarities in DNA or amino acid sequence, the more
closely related the organisms are; Accept: vice versa

5. If the species have evolved from the same common ancestors, their DNA or amino acid
sequence should show a high degree of homology with each others and also with that of
the original species;

6. based on the idea of molecular clock, different species can be arranged in chronological
order of time of evolution, thus creating a phylogeny and extrapolation in phylogenetic
studies;

7. Molecular methods can pick up in silent mutation thus the mutation will be reflected in
the DNA sequence;

8. New species are evolved when changes in DNA sequence are accumulated over time;
6 max

(b) (ii)

Variation in bacteria population due to random gene mutation;


To form new genes;
Lack proof reading mechanism during DNA replication;
Novel genes can also be introduced into bacteria via transformation, transduction and
conjugation;
New alleles can be incorporated into the bacteria genome via homologous recombination;
4 max
288
34

2(a)

Genetic code

Prokaryotes Eukaryotes

1. Gene Does not occur Occurs to increase the number of


amplification copies of the gene of interest, which
hence increases the overall rate of
transcription and the amount of gene
product.

Transcriptional control

Prokaryotes Eukaryotes

2. Access to Does not occur DNA methylation and histone


genes by acetylation / deacetylation can occur,
modification resulting in conversion between
of chromatin
euchromatin (transcribed) and
structure
heterochromatin (not transcribed).

3. Control Few More


elements Close to promoter / genes Can be located proximally upstream,
under their control or distally upstream / downstream of
the gene
E.g. operators located E.g. enhancer, silencer, proximal
near or within the promoter control elements, distal control
elements
4. General RNA polymerase core General transcription factors required
transcription enzyme can recognize and for RNA polymerase to bind to
factors bind to the promoter with the promoter and assembly of
aid of the sigma factor
transcription initiation complex

5. Specific Repressors bind to operator binding of activators to enhancers to


transcription preventing transcription up-regulate transcription
factors Activators bind to activator repressors binding to silencers /
binding sites to increase rate competing with for activator binding
of transcription sites to down -regulate transcription
6. RNA All RNAs synthesized by the Three different classes of RNA each
polymerase same RNA polymerase; synthesized by a different RNA
polymerase

7. Coordinated Genes or same metabolic No operons, each gene has own


transcription pathway organized into promoter resulting in monocistronic
of genes operons controlled by single mRNA,
promoter, resulting in Coordination of gene expression
transcription of single occurs by a combination of control
polycistronic mRNA element and specific TFs
289
35

Post-transcriptional

Prokaryotes Eukaryotes

8. Post- Does not occur Addition of 5 7-methylguanosine cap,


transcriptional 3 poly-A tail, splicing / alternative
modification splicing, editing of mature mRNA

Translational

Prokaryotes Eukaryotes

9. Simultaneous Translation is often begins No direct coupling of transcription and


transcription & before transcription is translation. (mRNA must pass across
translation complete as processes are nuclear envelope before translation in
not separated by nuclear the cytoplasm. RNA transcript is not
envelope free to associate with ribosomes prior
to the completion of transcription).

10. Half-life of Lower stability of transcript Higher stability of transcript,


mRNA / degradation within degradation after minutes / days
seconds or minutes
/ mRNAs shorter half life to controlled by length of poly-A tail
rapidly respond to (longer tail, slower degradation)
environmental changes
11. Binding of Production of anti-sense Production of small RNAs (miRNAs
complementary RNA from non-coding and siRNAs) which are cut into
sequence to DNA strand can bind to smaller pieces by Dicer and picked
RNA complementary mRNA up by RISC which will degrade any
and inhibit translation mature mRNA that has sequences
complementary to the small RNA.
12. Ribosome mRNAs have multiple start mRNAs have only one start codons
binding sites codons direct synthesis of only one kind of
direct the synthesis of polypeptide
several different
polypeptides

Post-translational

Prokaryotes Eukaryotes

13. Post- no/minimal post- Post-translational modifications


translational translational modifications usually required to get functional
modification occur protein

e.g. proteolysis, chemical


modification, ubiquitination for
degradation,
290
36

2 (b)(i)
1. Acetyl CoA and oxaloacetate undergo a condensation reaction. Acetyl CoA adds its two-
carbon acetyl group to oxaloacetate to form citrate. Enzyme = citrate synthetase;

2. Citrate is isomerised to isocitrate. Enzyme = aconitase;

3. Isocitrate undergoes oxidative decarboxylation to form -ketoglutarate. Carbon dioxide


is lost in this process. NAD+ is the hydrogen acceptor and NADH is formed. Enzyme =
isocitrate dehydrogenase

4. -ketoglutarate undergoes oxidative decarboxylation to form succinyl CoA. Carbon


dioxide is lost in this process. NAD+ is the hydrogen acceptor and NADH is formed.
Enzyme = -ketoglutarate dehydrogenase

5. Succinyl CoA is converted to succinate. ATP is formed by substrate level


phosphorylation. Enzyme = succinyl CoA synthetase

6. Succinate undergoes dehydrogenation to form fumarate. FAD is the hydrogen acceptor


and FADH2 is formed. Enzyme = succinate dehydrogenase

7. Fumarate undergoes hydration to form malate. Enzyme = fumarase

8. Malate undergoes dehydrogenation to form oxaloacetate. NAD+ is the hydrogen


acceptor and NADH is formed. Enzyme = malate dehydrogenase

2(b) (ii)
Similarities
Both processes synthesizes ATP by chemiosmosis, where energy released by the transport
of electrons down electron transport chain is used to pump H+ against a concentration
gradient. And as the H+ diffuses back down a concentration gradient, the energy released is
used to phosphorylate ADP to ATP;
Both processes involves the transport of electron down ETC.
2 max

Differences
Features Oxidative phosphorylation Photophosphorylation
Definition ;
Synthesis of ATP occurs as Synthesis of ATP occurs as
electrons are transferred from electrons are transferred from
NADH or FADH2 to oxygen by an water and chlorophyll
electron transport chain. The molecules to NADP by an
energy coupling occurs through a electron transport chain. The
proton gradient. energy coupling occurs
through a proton gradient.

Location On the inner membrane of on the thylakoid membrane ;


mitochondrion.

Reactions Involves a series of redox reactions hydrolysis of water molecule ;


via a series of electron carriers in on top of redox reaction in the
the electron transport chain. electron carriers.
Synthesis of by both cyclic and noncyclic ;
by Oxidative phosphorylation
ATP Photophosphorylation
3 max
291
1

Name: Index Number: Class:

DUNMAN HIGH SCHOOL


Preliminary Examination
Year 6

H2 BIOLOGY 9648/03
Paper 3 Applications Paper and SPA Planning Task 23 September 2013
2 hours
Additional Materials: Writing paper

INSTRUCTIONS TO CANDIDATES:
DO NOT TURN THIS PAGE OVER UNTIL YOU ARE TOLD TO DO SO.
READ THESE NOTES CAREFULLY.

Section A:
Consists of 4 Structured Questions
Answer all questions.
Write your answers in the space provided on the
question paper.

Section B:
Consists of 1 SPA Planning Task
Write your answers on the separate writing papers
provided. At the end of the examination, fasten all
your work securely together.
For Examiners Use
Section C: Section A [40]
Consists of 1 Free-Response Question.
Write your answers on the separate writing papers 1 / 12
provided. At the end of the examination, fasten all
your work securely together. 2 / 8

Sections A, B and C are to be submitted 3 / 13


separately. 4 / 7

INFORMATION FOR CANDIDATES Section B [12]

Essential working must be shown. Section C [20]

The intended marks for questions or parts of Total [72]


questions are given in brackets [ ].

This document consists of 13 printed pages and 1 blank page.


[Turn over
DHS 2012
292
2

Section A: Structured Questions (40 marks) For


Answer all questions in this section. Examiners
use

Question 1

Fig 1.1 shows two plasmids pAMP and pKAN. Ampr and Kanr confer resistance to the
antibiotics ampicillin and kanamycin respectively.

Bam HI Bam HI

Kanr
Nco I
784 bp
pAMP pKAN 1875 bp
3755 bp
4539 bp 4207 bp
2332 bp
Hind III

ori
Ampr
Hind III
Sca I
ori

Fig 1.1

In an experiment to make a cloning vector, solution containing the plasmids pAMP and
pKAN were treated with a solution containing restriction enzymes BamHI and HindIII. DNA
ligase was then added and the mixture was incubated at 37oC.

This experiment produced the plasmid pAK which can be used as a cloning vector. The
restriction map of pAK is shown in Fig 1.2 and the specific recognition sequence of its
restriction sites are shown in Table 1.3.
Bam HI
Restriction Recognition Sequence
Enzyme
Kanr Bam HI 5'-G^G A T C C-3'
3'-C C T A G^G-5'
Nco I
Hind III 5'-A^A G C T T-3'
3'-T T C G A^A -5'
1875 bp
pAK
Sca I 5'-A G T^A C T-3'
5630 bp 3'-T C A^T G A-5'
3755 bp
Nco I 5'-C^C A T G G-3'
3'-G G T A C^C-5'
Ampr
Hind III
^ indicates where the restriction enzyme cuts
Sca I ori
Fig 1.2 Table 1.3
293
3

(a) Restriction sites are palindromic. Explain the meaning of the term palindromic. [1]

(b) With reference to Fig 1.2 and Table 1.3, explain why Nco I is a more suitable choice of
restriction enzyme for use in genetic engineering with the pAK plasmid than Sca I. [2]

To clone a human gene with a molecular size of 600 bp in bacterial cells, the following
proceedure was carried out as shown in Fig 1.4.

Isolate mRNA

Procedure X: Synthesis of double stranded cDNA

Addition of linkers Cloning vector pAK

Cut with restriction enzyme Nco I

Ligation of cDNA and pAK

Transformation of recombinant
plasmids into E.coli

Culture E.coli on agar plates

Fig 1.4
294
4

(c) With reference to Fig 1.4, briefly describe procedure X. [3]

(d) Draw three possible gene products formed in the ligation mixture. [3]










295
5

(e) Explain how the plasmid pAK can aid in the successful selection of recombinant
colonies with the gene of interest. [3]

Total: [12]
296
6

on 2
Questio Foor
Exxaminers
usse
A lengthh of DNA frrom one of a pair of ho
omologous chromosom mes is show
wn in Fig 2.1. The
target sites of EcoR
RI are show
wn by arrowws and the le NA betweenn the target sites is
ength of DN
given in kilobases (kb).
(

Fig 2.1

A mutattion alters one


o base off the codingg sequencee at the site
e marked w with an asterrisk (*).
DNA froom two individuals, onne who is n
normal and the other whow is heteerozygous for this
mutation
n is cut with
h EcoRI and
d the DNA ffragments separated
s byy gel electroophoresis.

(a) On
n Fig. 2.2 below,
b
(i)) Draw all
a the fraggments of this length h of DNA produced from the pair of
homolo ogous chrom
mosomes in n each of the individualls tested annd label the size of
the frag
gments prod
duced. [2]

(ii) Circle the


t fragmen nts which w
will combine
e with the ra
adioactive pprobe and appear
as blacck bands on an autorad
diography. [1]

Fig 2.2
297
7

(b) Describe how DNA fragments may be separated by electrophoresis. [4]

(c) State the role of the DNA ladder seen in Fig 2.2. [1]

Total: [8]
298
8

Question 3 For
Examiners
use
(a) Cystic fibrosis (CF) is a genetic disease which affects many parts of the body. This
disease is caused by mutations of a gene coding for a transmembrane protein
(CFTR) which acts as an ion pore.

A study on ion transport was carried out on pancreatic cells by comparing ion
transport in cells expressing the normal allele for CFTR with that in cells expressing
mutant alleles. The pancreas secretes pancreatic juice which is alkaline to neutralize
the acidic gastric acid from the stomach.

The abilities of the cells to transport HCO3 and Cl were measured and expressed as
a HCO3 : Cl transport ratio. The results are shown in Table 3.1.

CF allele expressed by cells HCO3 : Cl transport ratio of cells

Normal alleles 1.0 : 1.0

Mutant alleles associated with CF with


All < 0.1 : 1.0
inadequate functioning of the pancreas

Table 3.1

(i) With reference to Table 3.1, explain the cause of inadequate functioning of the
pancreas in CF. [2]

(ii) Suggest one possible consequence of inadequate functioning of the pancreas


as a result of CF. [1]

(b) Gene therapy involves transferring normal CFTR genes into lung epithelial cells with
defective genes. Describe how a liposome can be used to insert the normal CFTR
gene into a CF patient. [2]
299
9

(c) The mucus produced in the lungs of someone with cystic fibrosis contains a lot of
DNA from dead cells. DNase, an enzyme which cuts DNA into short pieces has
recently been approved for the treatment of cystic fibrosis. In an investigation, different
concentrations of DNase were added to mucus collected from people with cystic
fibrosis. Fig. 3.1 shows the results.

Fig. 3.1

Using the information given in Fig. 3.1, explain why inhaling DNase helps a cystic
fibrosis patient to breathe more easily. [3]

(d) Describe how the isolated CFTR gene can be obtained from the genome using the
polymerase chain reaction. [3]

(e) About twenty percent of the DNA molecules produced by the PCR are copied
inaccurately. Explain why it is not safe to use the PCR to clone the normal CFTR gene
for use in treating cystic fibrosis. [2]

Total: [13]

300
10

Question 4 For
Examiners
use
EH1 is a hybrid derived from a cross between Eucalyptus grandis (2n = 22) and Eucalyptus
urophylla (2n = 22). Embryo culture is used to develop EH1 embryos into plantlets. At three
different stages of the embryonic development as shown in Fig. 4.1, the nutrients and plant
growth hormones concentrations in the medium are changed to allow development into
plantlets.

Fig. 4.1

(a) (i) Explain why the EH1 plantlets grown from different hybrid embryos are not
genetically identical. [2]

(ii) With reference to Fig. 4.1, explain why the concentrations of the plant growth
hormones have to be applied and changed to ensure development of plantlets.
[3]
301
11

The average growth of wood was recorded for EH1 grown in different parts of the
United States. Non-GM EH1 was grown in plot A, while GM EH1 was grown in plots B,
C, and D. The results are shown in Fig. 4.2.

Fig. 4.2

(b) Explain how the data shows that lignin gene expression level is difficult to control in
GM crops despite being placed under the control of an antifreeze promoter. [2]

Total: [7]
302
12

Section B: SPA Planning Task (12 marks)


Write your answers on the writing paper provided.
A NIL RETURN is required.

Question 5

Digestion of lipids usually occurs in the small intestines by the action of pancreatic lipase.
Unfortunately, dietary fats do not dissolve in water, and bile salts secreted by the liver are
required to emulsify fats. This provides a larger surface area for lipase to act on.

Phenolphthalein is an acid-base indicator which is colourless in acidic solutions and pink in


basic solutions such as sodium carbonate solution. A 1:1 ratio of sodium carbonate solution
to full cream milk will provide a slightly alkaline pH which is optimum for lipase action.

Using this information and your own knowledge, design an experiment to investigate the
effect of bile salt concentration on the rate of digestion of lipids.

Your planning must be based on the assumption that you have been provided with the
following equipment and materials.

Phenolphthalein
5% lipase solution
5% Bile salts solution
Sodium carbonate solution
Distilled water
Full cream milk
Stopwatch
A variety of different sized beakers, measuring cylinders and syringes for measuring
volumes
Access to standard laboratory equipment

Your plan should have a clear and helpful structure to include:

An explanation of theory to support your practical procedure


A description of the method used, including the scientific reasoning behind the method
An explanation of dependent and independent variables involved
How you will record your results and ensure they are accurate and reliable as possible
Proposed layout of results tables and graphs with clear headings and labels
The correct use of technical and scientific terms

Total: [12]

303
13

Section C: Free-Response Questions (20 marks)


Write your answers on the writing paper provided.
Your answers should be illustrated by large, clearly labelled diagrams, where appropriate.
Your answers must be in continuous prose, where appropriate.
Your answers must be set out in sections (a), (b) etc., as indicated in the question.
A NIL RETURN is required.

Question 6

(a) Describe the treatment of SCID using gene therapy. [10]

(b) Discuss the social and ethical considerations for gene therapy. [10]

Total: [20]

END OF PAPER
304
14

BLANK PAGE
305
15

DUNMMAN HIGH SCHOOL


S
PRELIMINA
P ARY EXAMINATION 2013
YEAR SIX
X
H2 BIOLOGY (9648)
PAPER 3
Answer Scheme

Structu
ured Answe ers
1(a)
nucleotide sequences that are e the same on both strands of the DNA moleccule when read r in
the sam
me direction (5 to 3) / read
r the sa me in the 5
5 to 3 direction on eacch strand of DNA.

(b)
Nco I prroduces sta
aggered / stticky ends w
whereas Sca I produce
es blunt endds;
This faccilitates the
e annealing of the gene
e of interes
st to plasmid
d when thee plasmid an
nd gene
are cut with Nco I byb complemmentary basse pairing;
Using S
Sca I would require the e additional procedure of
o adding lin
nker DNA too generate sticky
o facilitate annealing of gene of intterest.
ends to

(c)
Oligo-dT primers anneal
a to 3 poly-A tail o
of mRNA
Reversee transcripttase extends primers u
using mRNA
A as templatte to syntheesize single
strande
ed cDNA, prroduct is RNNA-DNA du plex.
Partial d
digestion off mRNA using alkaline solution / RNase
R H
ref to syynthesis of 2nd comple
ementary sttrand to form
m double stranded cDN
NA using DNA
polymerase
3 max.

(d)

1 mark each

(e)
AmpR g gene codess for ampic cillin resista
ance thus allows
a for first
f selectioon for succ
cessfully
transforrmed coloniies which ha
ave taken in n the plasm
mid;
Coloniees with rean
nnealed pla ct Kanr gene
asmids will have intac e which coodes for kan
namycin
nce and will survive on kanamycin
resistan n plate;
Coloniees with reco ombinant pla asmids will gene of inte erest inserted into Kannr gene wich
h results
in inserrtional inactiivation, and
d will not surrvive on kan
namycin plaate;
306
16

2(a)

Figure2.2

(i)
Normal individual 3 correct bands, labeeled and of the correct thickness;
Heterozzygous indivvidual 4 correct
c band
ds, labeled and
a of the correct
c thickkness;

(ii)
circling of 10kb and
d 5kb bands for norma
al individual & circling of
o 20kb, 10kkb and 5 kb bands
for heteerozygous in
ndividual;

(b)

A loadinng dye is addded to the DNA samp ples to help DNA to sink into the w wells / allowss the
processs of electropphoresis to be tracked;;
DNA lad dder and saamples are loaded intoo wells;
Gel is ssubmerged in a buffer solution
s tha
at will condu
uct electricity
y;
electric current is applied
a thou
ugh electroddes at oppoosite ends of the gel;
negatively-charged d DNA fragmments migra ate to the positively charged electtrode / anod de;
Gel elecctrophoresis separates s DNA fragm ments by sizze / molecu ular weightss, with the smallest
fragmen nts moving the fastest and furthesst;
4 max.

(c)

As a refference / sttandard, prooviding know


wn DNA fra
agments of specific
s lenggths to estim
mate
the size
e of DNA mo olecules in samples
307
17

3 (a) (i)
Transport ratio is all < 0.1 : 1.0;
Inability to transport HCO3 out of pancreatic cell;
increase in acidity / decrease in pH outside the cells in the intestine;
2 max

(ii)
Poor digestion of proteins/ lipid/starch in the intestines thus poor absorption of nutrients;
Decreases secretion of insulin/glucagon thus affect blood glucose level;
ref. damage to wall of intestine/ pain in the intestine;
1 max

(b)
Normal CFTR gene is inserted into liposomes which are inhaled/sprayed into nose and
mouth;
Liposomes fuse with the cell membrane and release normal CFTR gene into (cytoplasm of
lung epithelial ) cells;

(c)
A higher conc. of DNase will result in a greater number of shorter DNA pieces;
With shorter DNA pieces in the lungs, viscosity of the mucus is reduced;
more air can pass through the airways/airways are no longer blocked/mucus more easily
removed from airways;

(d)
Heat dsDNA to 95C for 1-2min to break the hydrogen bonds (between complementary
bases) / separate DNA strands;
Lower temperature to 55 C for 1-2min to allow annealing of forward and reverse primers to
ssDNA / to regions flanking the CFTR gene;
Increase temperature to 70C for 1-2min to allow Taq polymerase catalyses formation of
new DNA strand (using the template);

(e)
percentage risk is too high for human application/ ref to a wrong/mutant gene introduced into
CF patient;
incorrect mRNA formed changes sequence of amino acids in protein;
produce a toxic/harmful/non-functional/ mutated protein;
chloride ions not transported / thick mucus results;
2 max

4 (a) (i)
Crossing over and independent assortment and random segregation of chromosomes during
meioisis;
Formed gametes which showed variation / allelic recombination;

(ii)
Need to apply auxin and cytokinin to stimulate mitosis of undifferentiated embryonic cells;
Need to change to low auxin to cytokinin ratio to stimulate formation of shoot meristem;
Need to change to high auxin to cytokine ratio to stimulate formation of root meristem;

(b)
B, C and D experienced average winter temperature of 3 C, -1 C and 2 C respectively,
yet average growth are 5, 8 and 15 kg/ tree respectively;
There is no correlation between temperature and average growth;
308
18

Planning Answer

1. theory and expected trend


2. theory to support method to measure rate
3. independent variable
4.dependent variable
5. AVP temperature with method to control
6. dilution
7. appropriate volumes suggested
8. Measuring time taken for indicator to decolourise
9. 3 replicates, 2 repeats
10. method to calculate rate 1/t
11. appropriate table
12. appropriate graph
13. correct use of technical and scientific terms

Essay Answers

6 (a) Describe the treatment of SCID using gene therapy.

1. remove T-lymphocytes from patient with SCID and insert healthy genes in them using a
retrovirus, then transplanting them back into the patient;
2. gene therapy can be used to treat both ADA-SCID and sex-link-SCID;
3. An ex vivo gene therapy approach was used;
4. where lymphocytes obtained from the blood of the patient/bone marrow stem cell;
5. was stimulated to proliferate in culture;
6. A functional adenosine deaminase (ADA) cDNA/ IL2-RG cDNA in a retroviral vector was
then introduced into these cells;
7. The retrovirus had been inactivated to become non-pathogenic;
8. The transgenic lymphocytes were allowed to proliferate further;
9. retroviruses naturally integrate their genome into the genome of host cells;
10. thus the retrovirus was integrating the normal ADA gene / IL2-RG gene into the
chromosomes of the patients cells during this culturing;
11. After a short period of culturing, these ADA-containing lymphocytes were re-introduced
into the patient;
309
19

6 (b) Discuss the social and ethical considerations for gene therapy.

Arguments in favour of gene therapy:


1. Potential for treating ill patients or preventing onset of severe illness
2. corrects the genetic defect present in the individual alone
3. like any other new medical technology.
4. To prevent research on gene therapy is to infringe upon intellectual freedom of
researchers.
5. With current rate of progress in gene therapy techniques risks become more identifiable
and outcomes can be predicted rather precisely.
6. offers true cure, not just a relief of symptoms or a palliative treatment.
7. The expense of somatic-cell therapy for multiple generations is avoided.
8. Medicine should respond to the reproductive health needs of prospective parents at risk
for transmitting serious genetic diseases.
9. The scientific community has a right to free inquiry within the bounds of acceptable
human research.
10. Once successful techniques are developed, gene therapy could help parents and
researchers avoid the moral dilemma of disposing defective embryos in the laboratory

Arguments against gene therapy:


11. It is difficult to distinguish between "good" and "bad" uses of gene modification
techniques.
12. It is important to consider between genetic disease and genetic attribute. Consideration
should be given beyond the therapeutic if there is only a genetic tendency towards a
particular disease.
13. There is potential for harmful abuse of the technology.
14. There are many unresolved questions raised by gene therapy:
15. There is difficulty in following patients in long-term clinical research, including
surveillance of future generations to monitor the long-term effects of gene therapy.
16. Many gene therapy candidates are children who are too young to understand
ramifications of gene therapy
17. There are potential conflicts of interest of individuals who wish to protect their privacy
and confidentiality versus interests of insurance companies or society in not bearing the
financial burdens of caring for children with serious genetic defects.
18. There are issues of justice and allocation: can we afford the expense of gene therapy?
Who should receive gene therapy? If only those who can afford it, where is the principle
of justice? The procedures now being tested are expensive and require expertise and
equipment found only in major medical centers. A related question is, Should gene
therapy be reserved for treating serious diseases? Who should pay for their use?
Should we skew the distribution of desirable biological traits?
19. Long-term effects of germ-line therapy are not known.
20. It opens the door to attempts at altering human traits not associated with disease (i.e.,
eugenics), which in turn leads to issues of increased social inequality and a lowered
tolerance for genetic diversity.
21. Violates rights of future generations to inherit a genetic endowment which has not been
intentionally modified.
22. Too expensive.
23. Essentially mates generations of unconsenting research subjects (i.e., germ-line therapy
involves research on early embryos and affects their offspring).
310

Civics Group Index Number Name (use BLOCK LETTERS)


H2

ST. ANDREWS JUNIOR COLLEGE


2013 JC2 Preliminary Examinations

H2 BIOLOGY 9648/1

Paper 1: Multiple Choice


Friday 20 September 2013 1 hour 15 minutes

Additional Materials: Multiple Choice Answer Sheet


Soft clean eraser (not supplied)
Soft pencil (type B or HB is recommended)

READ THESE INSTRUCTIONS FIRST

Do not open this booklet until you are told to do so.

Write your name, civics group and index number on the multiple choice answer sheet in
the spaces provided.

There are 40 questions in this paper. Answer all questions. For each question, there are
four possible answers, A, B, C and D.

Choose the one you consider correct and record your choice in soft pencil on the separate
multiple choice answer sheet.

INFORMATION TO CANDIDATES

Each correct answer will score one mark. A mark will not be deducted for wrong answer.
Any rough working should be done in this booklet.

At the end of the examination, submit the multiple choice answer sheet only.

This document consists of 15 printed pages.


[Turn over
311
2

1 Th
he nuclei off both plan
nt and anim
mal cells co
ontain one or more deense bodie es known
as nucleoli. Which
W one of the follo
owing corrrectly describes the fuunction of nucleoli?

A The forrmation of new DNA molecules s.


B The orgganization of the spin
ndle during
g nuclear division.
d
C Synthe
esis of chro
omatin fibrees.
D The forrmation of ribosomess.

2 Whhat could be
b a possib
ble explana
ation for th
he ability off lysosomees to withsttand self-
dig
gestion?

A lysosommes contain inactive hydrolytic enzymes


B lysosomme membrane has numerous modified proteins w with carbo
ohydrate
side-ch
hains
C lysosommes do notn contain n lipases which are e the enzyymes cappable of
digestin
ng the lipid
d membran ne
D hydrola
ases in the t lysos omes aree inhibited
d by thee acidic internal
environ
nment of th he lysosommes

3 Th
he diagram
m below sho ows the ulttrastructure aryotic cell . Which orrganelle
e of a euka
do
oes not con
ntain nucleic acid?

4 ome organ
So nisms cha ange the compositiion of the
eir membbranes to maintain
me
embrane fluidity when tempera ture chang
ges.

Whhich chang
ges occur in the com
mposition of
o the mem
mbranes folllowing a change
c to
low
w temperatture?

A Increasse phosphoolipids, deccrease choolesterol.


B Increasse saturate
ed fatty acid
ds, increas
se cholesteerol.
C Increasse saturate
ed fatty acid
ds, decreaase cholestterol.
D Increasse unsatura
ated fatty a
acids, incre
ease chole esterol.

SAJC / H22 Biology 9648/1 JC2 Prelims 2013


312
3

5 What does a haemoglobin molecule contain?

A four iron (Fe2+) ions attached to each haem group


B four oxygen molecules attached to each haem group
C four polypeptide chains each with one attached haem group
D four polypeptide chains each with four attached haem groups

6 Liver tissue produces an enzyme called catalase which breaks down


hydrogen peroxide into water and oxygen.

2H2O2 2H2O + O2

The rate of this reaction can be determined by measuring the volume of


oxygen produced in a given length of time. Students added small cubes of
fresh liver tissue to a range of hydrogen peroxide solutions and measured the
volumes of oxygen produced. Their data were used to produce the graph
showing how changing the concentration of hydrogen peroxide affected the
rate of oxygen production.

Which statements are correct?

1 At P, the rate of reaction is limited by the concentration of enzyme.


2 At Q, all of the enzyme active sites are occupied by substrate molecules.
3 At Q, the rate of reaction is limited by the concentration of the substrate.
4 At S, all of the enzyme active sites are occupied by substrate molecules.

A 1 and 4
B 2 and 3
C 2 and 4
D 1, 3 and 4

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


313
4

7 Thhe graph sh
hows the effect
e of two
o different compound
ds on the rrate of reac
ction of
the
e enzyme at
a differentt substrate
e concentraations.

hich statem
Wh ment is true
e?

A Compound which results


r in ccurve R is a competitiive inhibitoor which als
so
increases the Km of the enzym me.
B Compound which results
r in ccurve R is a non-competitive inhhibitor whicch did
not affecct the Km off the enzym me.
C Compound which results
r in ccurve S is a competitive inhibitoor which alsso
decrease es the Km of
o the enzyyme.
D Compound which results
r in ccurve S is a non-competitive inhhibitor whicch
increases the Km of the enzym me.

8 Ahhypothetical diploid cell


c has fouur chromos somes and
d total amoount of DNA
A in the
cell is denote
ed by X before
b DNA
A replicatio
on.

hich of the following is correct?


Wh ?

Cell Cycle Phase Num


mber of Am
mount of DNA
chromoso
omes per cell per celll
A Interphase 8 2X
B Telophase of mitosis 8 X
C Metapphase of meiosis
m I 4 X
D Anaph hase of me
eiosis II 4 X

9 Whhen identiical twins marry id entical tw


wins, the children
c oof both co
ouple are
ge
enetically

A identiccal unless crossing oover takes place


B identiccal becausse of the efffect of sem
mi-conserv vative DNA
A replicatio
on prior
to nucclear divisio
on
C differe
ent becaus se non-disjuunction of chromatids occurs
D differe
ent becaus se of rando
om segrega ation during parental meiosis

SAJC / H22 Biology 9648/1 JC2 Prelims 2013


314
5

10 To function as the heritable genetic code, DNA molecules must have all of the
following structural features except

A the ability to form complementary base-pairs with RNA molecules.


B exist as a very stable, double helical form when being replicated
C a sequence of nucleotides that can be decoded into a sequence of amino
acids in a protein
D ability to undergo semi-conservative replication

11 A particular eukaryotic protein is 300 amino acids long. Which of the following
could be the minimum number of nucleotides in the DNA molecule containing the
gene that codes for the amino acids in this protein?

A 100
B 300
C 900
D 1800

12 Which process in bacteria always allows chromosomal and non-chromosomal


DNA to be transferred?

A Binary fission.
B Conjugation.
C Transduction.
D Transformation.

13 Which of the following statements about binary fission is not true?

1 The mode of replication is semi-conservative


2 Chromosomes are separated to opposite ends of the cell.
3 DNA replicates using the rolling circle mechanism.
4 DNA replication at the ori is bi-directional.

A 3 only
B 1 and 2
C 2 and 4
D 3 and 4

14 Which of the following statements concerning lac operon is true?

1 Transcription of lac operon takes place all the time.


2 There is one single mRNA transcribed from the lac operon.
3 There is one start and one stop codon in the mRNA of lac operon.
4 The repressor molecule binds to the operator to turn off lac operon.

A 4 only
B 1 and 3
C 2 and 4
D 2, 3 and 4

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


315
6

15 How do viruses cause diseases in animals?

1 They inhibit normal synthesis of host cell DNA, RNA, or protein.


2 They degrade the host cells chromosomes.
3 They disrupt the oncogenes of the host cell causing uncontrolled cell division.
4 Their viral proteins and glycoproteins on the surface membrane of host cells
cause them to be recognized and destroyed by the bodys immune defences.

A 1 and 3
B 2 and 3
C 1, 2 and 4
D 1, 2, 3 and 4

16 The pedigree shows the inheritance of a condition known as galactosemia.

1 2 3 4

5 6 7 8 9 10 11

12 13 14 15 16

What is the probability that the first child of individuals 15 and 16 will be a
normal boy?

A 0.125
B 0.25
C 0.50
D 0.75

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


316
7

17 Agouti mice have banded hairs, giving a grey colour. Black mice have unbanded
hairs. White mice have no pigment. A cross between a homozygous black mouse
and a white mouse produced offspring with agouti hair. Another cross between the
black mouse and another white mouse produced some offspring with agouti hair
and some with black hair.

What explains these observations on the phenotype of hair of mice?

A There is a single gene with two codominant alleles, black and white.
B There is a single gene with three alleles in a dominance series, black
grey white.
C There are two epistatic genes, one controlling pigment production and one
controlling banding.
D There are two linked genes, one controlling pigment production and one
controlling banding.

18 With reference to prokaryotic and eukaryotic genomes, which of the following


statement is not true?

A They both have extrachromosomal DNA.


B They both have non-coding regions.
C They both have regulatory sequences.
D They are both associated with histones.

19 Four different genes are regulated in different ways.

Gene 1 undergoes tissue-specific patterns of alternative splicing


Gene 2 is part of a group of structural genes controlled by the same regulatory
sequences
Gene 3 is in some circumstances subject to methylation
Gene 4 codes for a repressor protein which acts at an operator site close by

Which role of the table correctly identifies which genes are prokaryotic and which
are eukaryotic?

prokaryotic eukaryotic
A 1 and 2 3 and 4
B 1 and 3 2 and 4
C 2 and 3 1 and 4
D 2 and 4 1 and 3

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


317
8

20 Which of the following statements about the eukaryotic control elements are
correct?

1 Attachment of the RNA polymerase II at the TATA box is achieved with


the help of a series of specific transcription factors
2 Upstream regulatory elements (UREs) increase the basal level of
transcription
3 A given gene may have multiple enhancers, each active at a different time
or in a different cell type or location in the organism
4 Repressors bind to silencer regions of DNA far upstream of promoters to
repress transcription

A 1 and 4
B 2 and 3
C 2, 3 and 4
D 1, 2, 3 and 4

21 Cells taken from a human bone cancer multiplied readily in culture. Analysis
showed that the cells were homozygous for the deletion of an allele on
chromosome 13 coding for a protein, RB.

Addition of RB to these cells reduced their rate of division.

Which individual is not able to produce a tumour suppressor?

A Both chromosomes 13 carry alleles for RB.


B Both chromosomes 13 have the alleles for RB deleted.
C One chromosome 13 carries an allele for RB, but the other chromosome 13
carries the deletion.
D One chromosome 13 carries an allele for RB, but the other chromosome 13
carries a different mutation.

22 Which of the following processes could still occur in a chloroplast in the presence
of an inhibitor that prevents H+ from passing through ATP synthase complexes?

1 Sugar synthesis
2 Photolysis of water
3 Transfer of electrons down the electron transport chain
4 Oxidation of NADPH

A 1 and 2
B 1and 4
C 2 and 3
D 3 and 4

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


318
9

23 Some photosynthetic organisms containing chloroplasts that lack PS II


(photosystem II) are able to survive. The best way to detect the lack of PS II in
these organisms would be to

A test for carbon fixation in the dark.


B test for liberation of oxygen in the light.
C determine the production of starch.
D determine if they have thylakoids in the chloroplasts.

24 A mitochondria suspension obtained from liver cells is prepared for investigations


of the products of respiration. Acetyl-CoA is added to the suspension.

Which of the following correctly matched the products of glycolysis and Krebs
cycle for every oxidation of one glucose molecule in this mitochondria suspension?

Product Glycolysis Krebs cycle


ATP 2 2
A Reduced NAD 2 6
Reduced FAD 0 2
CO2 0 4

Product Glycolysis Krebs cycle


ATP 0 2
B Reduced NAD 0 6
Reduced FAD 0 2
CO2 0 4

Product Glycolysis Krebs cycle


ATP 2 4
C Reduced NAD 2 4
Reduced FAD 0 2
CO2 0 2

Product Glycolysis Krebs cycle


ATP 0 4
D Reduced NAD 0 6
Reduced FAD 0 2
CO2 0 4

25 What would be the effect of inhibition of lactate dehydrogenase in a mammalian


cell under anaerobic conditions?

A A decrease in glycolysis, due to the lack of NAD.


B A decrease in cell pH, due to the accumulation of lactic acid.
C An increase in ATP production, due to increased amounts of reduced NAD.
D An increase in the activity of Krebs cycle, due to increased amounts of
pyruvate.

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


319
10

26 Tetrdotoxin, a puffer fish toxin, blocks voltage-gated sodium channels. Black


widow spiders venom causes the voltage-gated calcium channels to be constantly
open. Crotoxin binds irreversibly to acetylcholine receptors. What will happen to
the nerve transmission if each toxin is applied?

Tetrodotoxin Black widow spiders Crotoxin


venom
A block action potentials reduce transmission of increase transmission
along axon impulse across of impulse across
synapse synapse
B increase transmission reduce transmission of block action potentials
of impulse across impulse across along axon
synapse synapse
C block action potentials increase transmission reduce transmission of
along axon of impulse across impulse across
synapse synapse
D reduce transmission of block action potentials increase transmission
impulse across along axon of impulse across
synapse synapse

27 Which one of the following statements about the transmission across a typical
chemical synapse is true?

A Neurotransmitter molecules are stored in vesicles in the dendrites.


B Vesicles containing neurotransmitter molecules diffuse to the post-
synaptic membrane.
C The binding of neurotransmitter molecules to receptors transmits an
impulse across a synapse.
D Action potentials trigger chemical changes that make the
neurotransmitter vesicles fuse with the post-synaptic membrane.

28 The diagram shows a hormone which affects metabolism in humans.

How does this hormone act on its target cell?

A It activates an enzyme cascade that amplifies the hormone signal.


B It alters specific receptor sites on the cell surface membrane.
C It enters the cell and binds to nuclear receptors.
D It inhibits the synthesis of cholesterol molecules.

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


320
11

29 Some receptors for hormones like growth factors activate a protein kinase
cascade, with the participation of multiple enzymes catalysing multiple steps to
effect a change in gene expression. Which of the following statement about a
protein kinase cascade are true?

A Multiple steps in a process allow for the amplification of the signal.


B Multiple steps in an activation process means that abnormal stimulation of
a cellular response such as growth will not occur even with mutations in
more than one gene.
C Multiple steps in an activation process ensure that the chemical signal will
be sent at the corresponding magnitude as the original hormone signal.
D Having multiple steps in the process allows for an all-or-nothing
response.

30 Which of the following statements were not part of Darwins theory of evolution by
natural selection?

1 Characteristics acquired during an organisms lifetime are passed to its


offspring
2 Individuals in a sexually reproducing population are different.
3 Organisms produce more offspring than the environment can support.
4 Only those individuals best adapted to the environment survive and
reproduce.
5 Regions that encode portions of the polypeptide that are vital for structure
and function are less likely to incur mutations.

A 1 and 2
B 1 and 5
C 2 and 3
D 3 and 5

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


321
12

31 A comparison was made between human, rabbit, mouse and chimpanzee of the

DNA coding sequence of the globin gene


DNA sequence in the introns of the globin gene
amino acid sequence of the globin polypeptide

The data is shown in the table below.

Sequence similarity (%)


Organisms being compared Coding DNA Intron Amino acid
sequence
Human globin / chimpanzee globin 100 98.4 100
Human globin / rabbit globin 89.3 67 92.4
Human globin / mouse globin 82.1 61 80.1

It is possible to conclude from this data that

A a human is more closely related to a mouse than to a rabbit.


B the variation between chimpanzees and humans occurs in a region of the
globin gene which would code for amino acids.
C the variation in the intron sequence between human and mouse would
account for some of the differences in the amino acid sequence.
D the comparison between rabbit and human indicates that the differences
in their DNA did not always make a difference to the amino acid
produced.

32 A researcher is interested to study the gene expression of a particular ATPase


gene in the liver of mice during development using an appropriate DNA library.
Which of the following steps are relevant in the creation of this library?

1 Restriction digestion of genomic DNA


2 Reverse transcription of mRNA
3 Ligation of single-stranded linkers to the ends of DNA
4 Restriction digestion of plasmid

A 1 and 4
B 2 and 4
C 1, 3, and 4
D 2, 3, and 4

33 Which of the following is the most powerful way of increasing the specificity of a
DNA profile analysis?

A Repeat the analysis multiple times.


B Increase the number of markers used.
C Analyze each marker by PCR rather than RFLP analysis.
D Select markers present on the sex chromosomes rather than on the
autosomes.

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


322
13

34 The data below shows the results of electrophoresis of PCR fragments amplified
using primers for the site that has been shown to be altered in Huntington's
disease.

The inherited mutation in the Huntington's disease gene abnormally repeats the
nucleotide sequence CAG from 36 up to more than 120 times of that. The male
parent, shown as individual 2, had the onset of Huntington's disease when he was
40 years old.

Six of his children (individuals 3, 5, 7, 8, 10, 11) suffer from Huntington's disease,
and the age at which the symptoms first began is shown by the number below the
band from the PCR fragment.

What is the likely outcome for the normal individuals 4, 6, and 9?

A Individuals 4 and 9 do not have the trait, and will not get Huntington's
disease, but individual 6 is likely to start the disease when he reaches his
father's age of 40.
B Individuals 4, 6, and 9 have not inherited the defect causing Huntington's
disease.
C Individuals 4, 6, and 9 will still develop Huntington's disease at some point
in their lives, since the disease is inherited as a dominant trait.
D Two of the three will develop the disease, since it is inherited as a
dominant trait, but the data does not allow you to predict which two.

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


323
14

35 Which of the following shows a correct comparison of the various processes?

Gene amplification Polymerase chain DNA replication


reaction
A Occurs in the nucleus Occurs in the Occurs in the nucleus
cytoplasm
B Requires nucleic acids Requires nucleic acid Does not require
nucleic acids
C Involves hydrogen Involves hydrogen Involves hydrogen
bonding bonding bonding
D Does not replicate the Replicates the entire Replicates the entire
entire template strand template strand template strand

36 Which of the following statements are true about adult stem cells?

1 They can undergo self-renewal


2 They can be totipotent, pluripotent or multipotent.
3 They can differentiate into almost any cell type.
4 They can give rise to specialised cells.

A 1 and 2
B 1 and 4
C 2 and 3
D 3 and 4

37 A patient underwent gene therapy using an adenoviral mediated delivery system.


The gene therapy failed and you were asked to find out the cause of the failure.
Which of the following could not be the explanation behind the failure in the gene
therapy?

A Failure of the expressed protein to be folded into the correct


conformation.
B The CFTR protein was not expressed in adequate amount.
C Integration of the target gene in the enhancer region.
D Rejection of the vector by the host immune system.

38 What is not expected to be an outcome of the human genome project?

A Identification of all genes present in human beings


B Identification of all alleles present in human beings
C Map and sequence the genetic makeup of every human being
D Map and sequence all the genetic material present in the chromosomes of
human beings

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


324
15

39 Which uses of the information from the human genome project are generally
considered to be unethical?

1 an insurance company only giving cheap rates to people with genetic


predisposition to fewer diseases
2 genetic archaeologists identifying the earliest forms of genes to show
evolutionary relationships
3 cytologists developing tests for only some defective genes
4 doctors only giving specific drugs to block the actions of faulty genes to carriers
of those genes
5 genetic counsellors giving specific lifestyle information only to people
genetically predisposed to risks
6 parents choosing embryos for implantation only after antenatal tests for
acceptable genes

A 1 and 3
B 1 and 6
C 2 and 5
D 3 and 4

40 Which of the following is not a scientific concern relating to creating genetically


modified crops?

A Commercially important plants become resistant to drought.


B Herbicide resistance may spread to weedy species.
C Non-target insects may be affected.
D Genetically modified plants may lead to unknown risks to human health.

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


325

Civics Group Index Number Name (use BLOCK LETTERS)


H2

ST. ANDREWS JUNIOR COLLEGE


2013 JC2 Preliminary Examinations

H2 BIOLOGY 9648/1

Paper 1: Multiple Choice (Mark Scheme) v3


Friday 20 September 2013 1 hour 15 minutes

Additional Materials: Multiple Choice Answer Sheet


Soft clean eraser (not supplied)
Soft pencil (type B or HB is recommended)

READ THESE INSTRUCTIONS FIRST

Do not open this booklet until you are told to do so.

Write your name, civics group and index number on the multiple choice answer sheet in
the spaces provided.

There are 40 questions in this paper. Answer all questions. For each question, there are
four possible answers, A, B, C and D.

Choose the one you consider correct and record your choice in soft pencil on the separate
multiple choice answer sheet.

INFORMATION TO CANDIDATES

Each correct answer will score one mark. A mark will not be deducted for wrong answer.
Any rough working should be done in this booklet.

At the end of the examination, submit the multiple choice answer sheet only.

This document consists of 15 printed pages.


[Turn over
326
2

1 Th
he nuclei off both plan
nt and anim
mal cells co
ontain one or more deense bodie es known
as nucleoli. Which
W one of the follo
owing corrrectly describes the fuunction of nucleoli?

A The forrmation of new DNA molecules s.


B The orgganization of the spin
ndle during
g nuclear division.
d
C Synthe
esis of chro
omatin fibrees.
D The forrmation of ribosomess.

2 Whhat could be
b a possib
ble explana
ation for th
he ability off lysosomees to withsttand self-
dig
gestion?

A lysosommes contain inactive hydrolytic enzymes


B lysosomme membrane has numerous modified proteins w with carbo
ohydrate
side-ch
hains
C lysosommes do notn contain n lipases which are e the enzyymes cappable of
digestin
ng the lipid
d membran ne
D hydrola
ases in the t lysos omes aree inhibited
d by thee acidic internal
environ
nment of th he lysosommes

3 Th
he diagram
m below sho ows the ulttrastructure aryotic cell . Which orrganelle
e of a euka
do
oes not con
ntain nucleic acid?

4 ome organ
So nisms cha ange the compositiion of the
eir membbranes to maintain
me
embrane fluidity when tempera ture chang
ges.

Whhich chang
ges occur in the com
mposition of
o the mem
mbranes folllowing a change
c to
low
w temperatture?

A Increasse phosphoolipids, deccrease choolesterol.


B Increasse saturate
ed fatty acid
ds, increas
se cholesteerol.
C Increasse saturate
ed fatty acid
ds, decreaase cholestterol.
D Increasse unsatura
ated fatty a
acids, incre
ease chole esterol.

SAJC / H22 Biology 9648/1 JC2 Prelims 2013


327
3

5 What does a haemoglobin molecule contain?

A four iron (Fe2+) ions attached to each haem group


B four oxygen molecules attached to each haem group
C four polypeptide chains each with one attached haem group
D four polypeptide chains each with four attached haem groups

6 Liver tissue produces an enzyme called catalase which breaks down


hydrogen peroxide into water and oxygen.

2H2O2 2H2O + O2

The rate of this reaction can be determined by measuring the volume of


oxygen produced in a given length of time. Students added small cubes of
fresh liver tissue to a range of hydrogen peroxide solutions and measured the
volumes of oxygen produced. Their data were used to produce the graph
showing how changing the concentration of hydrogen peroxide affected the
rate of oxygen production.

Which statements are correct?

1 At P, the rate of reaction is limited by the concentration of enzyme.


2 At Q, all of the enzyme active sites are occupied by substrate molecules.
3 At Q, the rate of reaction is limited by the concentration of the substrate.
4 At S, all of the enzyme active sites are occupied by substrate molecules.

A 1 and 4
B 2 and 3
C 2 and 4
D 1, 3 and 4

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


328
4

7 Thhe graph sh
hows the effect
e of two
o different compound
ds on the rrate of reac
ction of
the
e enzyme at
a differentt substrate
e concentraations.

hich statem
Wh ment is true
e?

A Compound which results


r in ccurve R is a competitiive inhibitoor which als
so
increases the Km of the enzym me.
B Compound which results
r in ccurve R is a non-competitive inhhibitor whicch did
not affecct the Km off the enzym me.
C Compound which results
r in ccurve S is a competitive inhibitoor which alsso
decrease es the Km of
o the enzyyme.
D Compound which results
r in ccurve S is a non-competitive inhhibitor whicch
increases the Km of the enzym me.

8 Ahhypothetical diploid cell


c has fouur chromos somes and
d total amoount of DNA
A in the
cell is denote
ed by X before
b DNA
A replicatio
on.

hich of the following is correct?


Wh ?

Cell Cycle Phase Num


mber of Am
mount of DNA
chromoso
omes per cell per celll
A Interphase 8 2X
B Telophase of mitosis 8 X
C Metapphase of Meiosis
M I 4 X
D Anaph hase of Me
eiosis II 4 X

9 Whhen identiical twins marry id entical tw


wins, the children
c oof both co
ouple are
ge
enetically

A identiccal unless crossing oover takes place


B identiccal becausse of the efffect of sem
mi-conserv vative DNA
A replicatio
on prior
to nucclear divisio
on
C differe
ent becaus se non-disjuunction of chromatids occurs
D differe
ent becaus se of rando
om segrega ation during parental meiosis

SAJC / H22 Biology 9648/1 JC2 Prelims 2013


329
5

10 To function as the heritable genetic code, DNA molecules must have all of the
following structural features except

A the ability to form complementary base-pairs with RNA molecules.


B exist as a very stable, double helical form when being replicated
C a sequence of nucleotides that can be decoded into a sequence of amino
acids in a protein
D ability to undergo semi-conservative replication

11 A particular eukaryotic protein is 300 amino acids long. Which of the following
could be the minimum number of nucleotides in the DNA molecule containing the
gene that codes for the amino acids in this protein?

A 100
B 300
C 900
D 1800

12 Which process in bacteria always allows chromosomal and non-chromosomal


DNA to be transferred?

A Binary fission.
B Conjugation.
C Transduction.
D Transformation.

13 Which of the following statements about binary fission is not true?

1 The mode of replication is semi-conservative


2 Chromosomes are separated to opposite ends of the cell.
3 DNA replicates using the rolling circle mechanism.
4 DNA replication at the ori is bi-directional.

A 3 only
B 1 and 2
C 2 and 4
D 3 and 4

14 Which of the following statements concerning lac operon is true?

1 Transcription of lac operon takes place all the time.


2 There is one single mRNA transcribed from the lac operon.
3 There is one start and one stop codon in the mRNA of lac operon.
4 The repressor molecule binds to the operator to turn off lac operon.

A 4 only
B 1 and 3
C 2 and 4
D 2, 3 and 4

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


330
6

15 How do viruses cause diseases in animals?

1 They inhibit normal synthesis of host cell DNA, RNA, or protein.


2 They degrade the host cells chromosomes.
3 They disrupt the oncogenes of the host cell causing uncontrolled cell division.
4 Their viral proteins and glycoproteins on the surface membrane of host cells
cause them to be recognized and destroyed by the bodys immune defences.

A 1 and 3
B 2 and 3
C 1, 2 and 4
D 1, 2, 3 and 4

16 The pedigree shows the inheritance of a condition known as galactosemia.

1 2 3 4

5 6 7 8 9 10 11

12 13 14 15 16

What is the probability that the first child of individuals 15 and 16 will be a
normal boy?

A 0.125
B 0.25
C 0.50
D 0.75

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


331
7

17 Agouti mice have banded hairs, giving a grey colour. Black mice have unbanded
hairs. White mice have no pigment. A cross between a homozygous black mouse
and a white mouse produced offspring with agouti hair. Another cross between the
black mouse and another white mouse produced some offspring with agouti hair
and some with black hair.

What explains these observations on the phenotype of hair of mice?

A There is a single gene with two codominant alleles, black and white.
B There is a single gene with three alleles in a dominance series, black
grey white.
C There are two epistatic genes, one controlling pigment production and one
controlling banding.
D There are two linked genes, one controlling pigment production and one
controlling banding.

18 With reference to prokaryotic and eukaryotic genomes, which of the following


statement is not true?

A They both have extrachromosomal DNA.


B They both have non-coding regions.
C They both have regulatory sequences.
D They are both associated with histones.

19 Four different genes are regulated in different ways.

Gene 1 undergoes tissue-specific patterns of alternative splicing


Gene 2 is part of a group of structural genes controlled by the same regulatory
sequences
Gene 3 is in some circumstances subject to methylation
Gene 4 codes for a repressor protein which acts at an operator site close by

Which role of the table correctly identifies which genes are prokaryotic and which
are eukaryotic?

prokaryotic eukaryotic
A 1 and 2 3 and 4
B 1 and 3 2 and 4
C 2 and 3 1 and 4
D 2 and 4 1 and 3
20 Which of the following statements about the eukaryotic control elements are
correct?

1 Attachment of the RNA polymerase II at the TATA box is achieved with


the help of a series of specific transcription factors
2 Upstream regulatory elements (UREs) increase the basal level of
transcription
3 A given gene may have multiple enhancers, each active at a different time
or in a different cell type or location in the organism
4 Repressors bind to silencer regions of DNA far upstream of promoters to

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


332
8

repress transcription

A 1 and 4
B 2 and 3
C 2, 3 and 4
D 1, 2, 3 and 4

21 Cells taken from a human bone cancer multiplied readily in culture. Analysis
showed that the cells were homozygous for the deletion of an allele on
chromosome 13 coding for a protein, RB.

Addition of RB to these cells reduced their rate of division.

Which individual is not able to produce a tumour suppressor?

A Both chromosomes 13 carry alleles for RB.


B Both chromosomes 13 have the alleles for RB deleted.
C One chromosome 13 carries an allele for RB, but the other chromosome 13
carries the deletion.
D One chromosome 13 carries an allele for RB, but the other chromosome 13
carries a different mutation.

22 Which of the following processes could still occur in a chloroplast in the presence
of an inhibitor that prevents H+ from passing through ATP synthase complexes?

1 Sugar synthesis
2 Photolysis of water
3 Transfer of electrons down the electron transport chain
4 Oxidation of NADPH

A 1 and 2
B 1and 4
C 2 and 3
D 3 and 4

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


333
9

23 Some photosynthetic organisms containing chloroplasts that lack PS II


(photosystem II) are able to survive. The best way to detect the lack of PS II in
these organisms would be to

A test for carbon fixation in the dark.


B test for liberation of oxygen in the light.
C determine the production of starch.
D determine if they have thylakoids in the chloroplasts.

24 A mitochondria suspension obtained from liver cells is prepared for investigations


of the products of respiration. Acetyl-CoA is added to the suspension.

Which of the following correctly matched the products of glycolysis and Krebs
cycle for every oxidation of one glucose molecule in this mitochondria suspension?

Product Glycolysis Krebs cycle


ATP 2 2
A Reduced NAD 2 6
Reduced FAD 0 2
CO2 0 4

Product Glycolysis Krebs cycle


ATP 0 2
B Reduced NAD 0 6
Reduced FAD 0 2
CO2 0 4

Product Glycolysis Krebs cycle


ATP 2 4
C Reduced NAD 2 4
Reduced FAD 0 2
CO2 0 2

Product Glycolysis Krebs cycle


ATP 0 4
D Reduced NAD 0 6
Reduced FAD 0 2
CO2 0 4

25 What would be the effect of inhibition of lactate dehydrogenase in a mammalian


cell under anaerobic conditions?

A A decrease in glycolysis, due to the lack of NAD+.


B A decrease in cell pH, due to the accumulation of lactic acid.
C An increase in ATP production, due to increased amounts of reduced NAD.
D An increase in the activity of Krebs cycle, due to increased amounts of
pyruvate.

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


334
10

26 Tetrdotoxin, a puffer fish toxin, blocks voltage-gated sodium channels. Black


widow spiders venom causes the voltage-gated calcium channels to be constantly
open. Crotoxin binds irreversibly to acetylcholine receptors. What will happen to
the nerve transmission if each toxin is applied?

Tetrodotoxin Black widow spiders Crotoxin


venom
A block action potentials reduce transmission of increase transmission
along axon impulse across of impulse across
synapse synapse
B increase transmission reduce transmission of block action potentials
of impulse across impulse across along axon
synapse synapse
C block action potentials increase transmissionreduce transmission of
along axon of impulse across impulse across
synapse synapse
D reduce transmission of block action potentials
increase transmission
impulse across along axon of impulse across
synapse synapse
27 Which one of the following statements about the transmission across a typical
chemical synapse is true?

A Neurotransmitter molecules are stored in vesicles in the dendrites.


B Vesicles containing neurotransmitter molecules diffuse to the post-
synaptic membrane.
C The binding of neurotransmitter molecules to receptors transmits an
impulse across a synapse.
D Action potentials trigger chemical changes that make the
neurotransmitter vesicles fuse with the post-synaptic membrane.

28 The diagram shows a hormone which affects metabolism in humans.

How does this hormone act on its target cell?

A It activates an enzyme cascade that amplifies the hormone signal.


B It alters specific receptor sites on the cell surface membrane.
C It enters the cell and binds to nuclear receptors.
D It inhibits the synthesis of cholesterol molecules.

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


335
11

29 Some receptors for hormones like growth factors activate a protein kinase
cascade, with the participation of multiple enzymes catalysing multiple steps to
effect a change in gene expression. Which of the following statement about a
protein kinase cascade are true?

A Multiple steps in a process allow for the amplification of the signal.


B Multiple steps in an activation process means that abnormal stimulation of
a cellular response such as growth will not occur even with mutations in
more than one gene.
C Multiple steps in an activation process ensure that the chemical signal will
be sent at the corresponding magnitude as the original hormone signal.
D Having multiple steps in the process allows for an all-or-nothing
response.

30 Which of the following statements were not part of Darwins theory of evolution by
natural selection?

1 Characteristics acquired during an organisms lifetime are passed to its


offspring
2 Individuals in a sexually reproducing population are different.
3 Organisms produce more offspring than the environment can support.
4 Only those individuals best adapted to the environment survive and
reproduce.
5 Regions that encode portions of the polypeptide that are vital for structure
and function are less likely to incur mutations.

A 1 and 2
B 1 and 5
C 2 and 3
D 3 and 5

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


336
12

31 A comparison was made between human, rabbit, mouse and chimpanzee of the

DNA coding sequence of the globin gene


DNA sequence in the introns of the globin gene
amino acid sequence of the globin polypeptide

The data is shown in the table below.

Sequence similarity (%)


Organisms being compared Coding DNA Intron Amino acid
sequence
Human globin / chimpanzee globin 100 98.4 100
Human globin / rabbit globin 89.3 67 92.4
Human globin / mouse globin 82.1 61 80.1

It is possible to conclude from this data that

A a human is more closely related to a mouse than to a rabbit.


B the variation between chimpanzees and humans occurs in a region of the
globin gene which would code for amino acids.
C the variation in the intron sequence between human and mouse would
account for some of the differences in the amino acid sequence.
D the comparison between rabbit and human indicates that the differences
in their DNA did not always make a difference to the amino acid
produced.

32 A researcher is interested to study the gene expression of a particular ATPase


gene in the liver of mice during development using an appropriate DNA library.
Which of the following steps are relevant in the creation of this library?

1 Restriction digestion of genomic DNA


2 Reverse transcription of mRNA
3 Ligation of single-stranded linkers to the ends of DNA
4 Restriction digestion of plasmid

A 1 and 4
B 2 and 4
C 1, 3, and 4
D 2, 3, and 4

33 Which of the following is the most powerful way of increasing the specificity of a
DNA profile analysis?

A Repeat the analysis multiple times.


B Increase the number of markers used.
C Analyze each marker by PCR rather than RFLP analysis.
D Select markers present on the sex chromosomes rather than on the
autosomes.

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


337
13

34 The data below shows the results of electrophoresis of PCR fragments amplified
using primers for the site that has been shown to be altered in Huntington's
disease.

The inherited mutation in the Huntington's disease gene abnormally repeats the
nucleotide sequence CAG from 36 up to more than 120 times of that. The male
parent, shown as individual 2, had the onset of Huntington's disease when he was
40 years old.

Six of his children (individuals 3, 5, 7, 8, 10, 11) suffer from Huntington's disease,
and the age at which the symptoms first began is shown by the number below the
band from the PCR fragment.

What is the likely outcome for the normal individuals 4, 6, and 9?

A Individuals 4 and 9 do not have the trait, and will not get Huntington's
disease, but individual 6 is likely to start the disease when he reaches his
father's age of 40.
B Individuals 4, 6, and 9 have not inherited the defect causing Huntington's
disease.
C Individuals 4, 6, and 9 will still develop Huntington's disease at some point
in their lives, since the disease is inherited as a dominant trait.
D Two of the three will develop the disease, since it is inherited as a
dominant trait, but the data does not allow you to predict which two.

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


338
14

35 Which of the following shows a correct comparison of the various processes?

Gene amplification Polymerase chain DNA replication


reaction
A Occurs in the nucleus Occurs in the Occurs in the nucleus
cytoplasm
B Requires nucleic acids Requires nucleic acid Does not require
nucleic acids
C Involves hydrogen Involves hydrogen Involves hydrogen
bonding bonding bonding
D Does not replicate the Replicates the entire Replicates the entire
entire template strand template strand template strand

36 Which of the following statements are true about adult stem cells?

1 They can undergo self-renewal


2 They can be totipotent, pluripotent or multipotent.
3 They can differentiate into almost any cell type.
4 They can give rise to specialised cells.

A 1 and 2
B 1 and 4
C 2 and 3
D 3 and 4

37 A patient underwent gene therapy using an adenoviral mediated delivery system.


The gene therapy failed and you were asked to find out the cause of the failure.
Which of the following could not be the explanation behind the failure in the gene
therapy?

A Failure of the expressed protein to be folded into the correct


conformation.
B The CFTR protein was not expressed in adequate amount.
C Integration of the target gene in the enhancer region.
D Rejection of the vector by the host immune system.

38 What is not expected to be an outcome of the human genome project?

A Identification of all genes present in human beings


B Identification of all alleles present in human beings
C Map and sequence the genetic makeup of every human being
D Map and sequence all the genetic material present in the chromosomes of
human beings

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


339
15

39 Which uses f the information from the human genome project are generally
considered to be unethical?

1 an insurance company only giving cheap rates to people with genetic


predisposition to fewer diseases
2 genetic archaeologists identifying the earliest forms of genes to show
evolutionary relationships
3 cytologists developing tests for only some defective genes
4 doctors only giving specific drugs to block the actions of faulty genes to carriers
of those genes
5 genetic counsellors giving specific lifestyle information only to people
genetically predisposed to risks
6 parents choosing embryos for implantation only after antenatal tests for
acceptable genes

A 1 and 3
B 1 and 6
C 2 and 5
D 3 and 4

40 Which of the following is not a scientific concern relating to creating genetically


modified crops?

A Commercially important plants become resistant to drought.


B Herbicide resistance may spread to weedy species.
C Non-target insects may be affected.
D Genetically modified plants may lead to unknown risks to human health.

SAJC / H2 Biology 9648/1 JC2 Prelims 2013


340

Civics Index Name (use BLOCK LETTERS)


Group Number H2
ST. ANDREWS JUNIOR COLLEGE
2013 JC2 Preliminary Examinations

H2 BIOLOGY 9648/2

Paper 2: Core
Thursday 29 August 2013 2 hours

Additional Materials: Answer Paper


Cover Sheet for Section B

READ THESE INSTRUCTIONS FIRST

Write your name, civics group and index number on all the work you
hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagram, graph or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.

Section A (Structured Questions)


Answer all seven questions.
Write your answers in the spaces provided on the question paper.

Section B (Essay Question) For Examiners Use


Answer one essay question.
Section A
Write your answers on the separate answer paper provided.
All working for numerical answers must be shown. 1
/11

2
/13
INFORMATION TO CANDIDATES 3
/11

At the end of the examination, 4


/12
1. Attach Section B answers to the cover sheet provided.
5
/12

6
/11
The number of marks is given in brackets [ ] at the end of each
question or part question. 7
/10

Total
/80

This document consists of 19 printed pages.


[Turn over
341
2
Section A

Answ
wer all ques
stions.

1. Fig. 1.1 show ws the intracellular annd extracellular eventts in the forrmation of a
collageen fibril. Co
ollagen fibrils are shoown assemmbling in thee extracell ular spacee
containned within a large info olding in th
he plasma membrane e. Collagenn fibrils cann form
ordered d arrays in the extraccellular spaace by further assemmbling into llarge collagen
fibre.

Fig 1.1

(a) P representss two organ


nelles foun
nd in the eu
ukaryotic cell.
c Identiffy these tw
wo
organe
elles.



...

....[1]

Procollagen peptidase remo oves the te


erminal peptides of th
he procollaagen to form
collage
en in Step 7 of Fig. 1..1.

(b) Exxplain the interaction between p


procollagen and proc
collagen peeptidase.



...

........



...

........



...

........



...

....[2]

SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
342
3
(c) Suggest why assembly of collagen fibril is done outside the cell.
...........
.......[1]

(d) Vitamin C is necessary in aiding the conversion of proline and lysine to


hydroxyproline and hydroxylysine. A deficiency in Vitamin C could lead to scurvy, a
disease displaying symptoms such as loss of teeth and easy bruising.

Collagen is an important matrix for the deposition of hard mineral crystals in the
formation of bones. Certain forms of osteogenesis imperfecta, or brittle-bone
disease, are caused by a single change of amino acid in the middle of the chain, from
glycine to arginine.

With reference to the structure of collagen, account for the following:

(i) Bleeding gum and easy bruising in scurvy


...........
...........
...........
...........
...........
...........
...........
.......[4]

(ii) weak and fragile bones in osteogenesis imperfecta


...........
...........
...........
...........
...........
.......[3]

[Q1 Total: 11]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


343
4
2.
(a) During semi-conservative DNA replication, both parental strands act as
templates for synthesis of complementary daughter strands. One of the daughter
strands, called the leading strand, is synthesized continuously. The other daughter
strand, called the lagging strand, is synthesized discontinuously in the form of short
fragments. The replicated DNA molecule consist of one new and one original strand
of DNA.

(i) State 3 structural differences in the formation of the leading and lagging strands.
...........
...........
...........
......[1]

(ii) Explain why the two new strands of DNA are synthesized in opposite directions.
...........
......[1]

(b) State three differences between the structures of DNA and RNA. [3]

DNA RNA

(c) In eukaryotic cells, the end-replication problem explains why normal somatic
cells are limited in the number of mitotic divisions before they die out.

(i) Outline the end-replication problem in eukaryotic chromosomes.


...........
...........
...........
...........
...........
..........[3]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


344
5
(ii) What are telomeres?
...........
..........[1]

(iii) State the role of telomeres in relation to the end-replication problem.


...........
......[]

(iv) Suggest why bacteria do not have telomeres.


...........
.......[1]

In bacteria cells, binary fission differs significantly from the process of mitosis seen in
eukaryotic cells.

(d) Explain the significance of binary fission in bacteria


...........
...........
...........
.......[2]

[Q2 Total: 13]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


345
6
3.
(a) Fig. 3.1 shows two different viruses.

Virus A Virus B
Fig. 3.1

(i) Relate the structure of virus A to its mechanism of release from the host.
...........
...........
...........
...[2]

(ii) Contrast the reproductive cycles of the Virus A and Virus B. [3]

Virus A Virus B

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


346
7
(b) One of the most common treatment methods for patients infected with virus B is
the use of reverse transcriptase inhibitors. These inhibitors bind to an inhibitor-
binding site (other than the active site) on the reverse transcriptase.

However, virus B often develop resistance against these inhibitors due to a single
base substitution in the DNA sequence resulting in a change of an amino acid in a
subunit of reverse transcriptase. The mutant protein is full-length and retains reverse
transcriptase activity, but does not allow the binding of the inhibitors.

(ii) Explain why the mutated protein remains full-length and retains reverse
transcriptase activity, but does not allow the binding of the inhibitors.
...........
...........
...........
...........
..[2]

(c) In recent years, vaccines have been developed for virus B. Vaccines can either
be live but weakened forms of the virus, or its structural parts that are recognised by
the immune system. This provides immunity to the disease.

However, vaccine development for virus B has become more challenging due to the
viruss ability to undergo a high rate of antigenic drift.

(i) Suggest a reason for this high rate of antigenic drift and how it affects vaccine
development.
...........
...........
...........
...........
..[2]

(ii) A student tries to produce a vaccine by heating a human virus to 100C for five
minutes to inactivate its infectivity. Suggest why effective vaccines cannot be
produced using the virus that has been heated to 100C.
...........
...[1]

[Q3 Total: 11]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


347
8
4. Familial Dysautonomia (FD), is an autosomal disorder which affects the
development of sensory neurons in the autonomic and sensory nervous system,
resulting in various symptoms including the insensitivity to pain.

Mutation in another gene, transmembrane channel 1 gene (TMC1), results in a form


of DFNB7 hearing loss which is also inherited in an autosomal manner.

A world-wide, long term genetic study on the possible associations between FD and
hearing loss is implemented in 2003. Table 4.1 above shows the genotypes and
phenotypes of some subjects in this study.

Subject
Gene name Genotype Phenotype
number
FD Heterozygous No FD
1031
TMC1 Heterozygous Normal hearing
FD Homozygous recessive FD
1050
TMC1 Homozygous dominant Normal hearing
FD Homozygous dominant No FD
1088
TMC1 Homozygous recessive Hearing loss
FD Homozygous recessive FD
1092
TMC1 Homozygous recessive Hearing loss

Table 4.1

(a) Define the following terms:

(i) genotype
...........
...[1]

(ii) phenotype
...........
...[1]

(b) Subject 1031 and another subject listed in Table 4.1 are married and they have
their first child in 2005. This cross between them theoretically resembles a test
cross.

(i) Deduce the subject number of subject 1031s wife from Table 4.1.
......[]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


348
9
Subject 1031 has a hearing impaired father with FD; his mother has normal hearing
and does not suffer from FD (she is homozygous dominant for both gene locus).

A total of 200 couples with the same genotypes as subjects 1031 and his wife were
monitored in this study. Information on their children (total number of 186) was
collated 10 years after the implementation of this study and presented in Table 4.2.

Phenotype Number of children


No FD, Normal hearing 59
FD, Normal hearing 35
No FD, Hearing loss 26
FD, Hearing loss 66

Table 4.2

(ii) Using the information give in Table 4.2, calculate the 2 and state the
conclusions derived from this test.
2 =
Conclusion .............
...........
...........
...[2]

(O E) 2
=
2
v=c1
E
where = sum of O = observed value
v = degrees of freedom E = expected value
c = number of classes

A chi-squared table.
degrees of probability, p
freedom 0.10 0.05 0.02 0.01 0.001
1 2.71 3.84 5.41 6.64 10.83
2 4.61 5.99 7.82 9.21 13.82
3 6.25 7.82 9.84 11.35 16.27
4 7.78 9.49 11.67 13.28 18.47

(iii) Explain the discrepancy from the expected results.


...........
...........
...........
...........
...........
...[3]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


349
10
(iv) Using the symbols provided, draw a genetic diagram of the cross between
Subject 1031 and his wife. [2]

Symbols:
F dominant allele for no FD
f recessive allele for FD
T dominant allele for Normal hearing
t recessive allele for hearing loss

During gamete formation in Subject 1031s wife from a diploid germ cell, an error
occurred once. As a result, her children will have 50% chance of having 3 copies of
chromosome 9; and 50% of having only 1 copy of chromosome 9 in his/her cells.

(v) Explain how this could have happened.


...........
...........
...........
...[2]

[Q4 Total: 12]


SAJC / H2 Biology 9648/2 JC2 Prelims 2013
350
11
5.
(a) Fig
g. 5.1 showws the norm mal seque nce of cell signaling events whhen insulin
reaches its targett cell and binds
b to an
n insulin rec
ceptor.

Fig. 5.1

(i) Sta
ate the sou
urce of the insulin mo
olecule in Fig
F 5.1.



...

....[1]

(ii) With reference to the structure


s off the plasm
ma membra ane, descriibe how the
structural features of recepttor tyrosine
e kinase en nables it to
o be embeddded as a
transmembrane protein.
p



...

........



...

........



...

........



...

........



...

........



...

....[3]

(iii) W
With referen
nce to Fig. 5.1, descrribe the eve
ents occurrring in stagges A to D.
D



...

........



...

........



...

........



...

........



...

........



...

........



...

........



...

....[3]

SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
351
12
(iv) Based on your knowledge, describe the events that lead to an increase in the
number of glucose transporters in the cell surface membrane.
...........
...........
.......[1]

(v) A tissue may, over time, lose its responsiveness to insulin, even though insulin
concentration remains unchanged. Suggest possible reasons for this decrease in
responsiveness.
...........
.......[1]

An aqueous solution contains small membranous vesicles which may be derived


either from a thylakoid or a mitochondrial membrane. In these vesicles, the
orientation of the ATP synthase enzymes is preserved as it is in the cell.

Fig. 5.2 shows the various experimental systems that are prepared in an attempt to
synthesize ATP.

Fig. 5.2

(b) Which experimental system (A to D) shown in Fig. 5.2 would result in the
successful synthesis of ATP by thylakoid-derived vesicles? Explain your answer.
...........
...........
...........
...........
...........
......[3]

[Q5 Total: 12]


SAJC / H2 Biology 9648/2 JC2 Prelims 2013
352
13
6.
(a) During an action potential, the permeability of the cell-surface membrane of an
axon changes. Fig 6.1 shows changes in permeability of the membrane to sodium
ions (Na+) and to potassium ions (K+) during a single action potential.

Fig. 6.1

(i) Explain the shape of the curve for sodium ions between 0.5 ms and 0.7 ms.
...........
...........
...........
...[2]

(ii) During an action potential, the membrane potential rises to +40mV and then falls.
Using information from the graph, explain the fall in membrane potential.
...........
...........
...........
...[2]

(iii) After exercise, some ATP is used to re-establish the resting potential in axons.
Explain how the resting potential is re-established.
...........
...[1]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


353
14
(b) Th
he black mamba is a poisonouss snake wh
hich produc
ces a toxinn.

(i) The
e length off the sectio
on of DNA that codes
s for the co
omplete toxxin is longe
er than
the mR
RNA used for
f translattion. Explaain.



...
...[]

(ii) Thhe black mambas tox xin kills pre


ey by inhib
biting the en
nzyme aceetylcholinesterase
at neurromuscularr junctions that contro ols musclees involvedd in breathi ng. Explain how
this inh
hibition affe
ects breath
hing.


...

........



...

........



...

........



....[2]

(c) Do opamine iss a neurotraansmitter rreleased by dopamin nergic neurrons for the
e
transmission of nerve signa als importa nt for moto
or control. Dopaminee binds to and
a
activate
es its recep
ptors locatted on the post-synapptic membrane.

Fig 6.2 shows a crystallogra


c aphy of the
e dopamine
e receptor.

Fig 6.2

(i) Witth referencce of Fig. 6.2,


6 identifyy the type of
o receptorr which thee dopamine
e
recepto
or belongs to.



...
...[]

SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
354
15
Excesssive neurottransmissio
on of dopaamine is asssociated with
w schizoophrenia, a clinical
mental disorder. To
T relieve this disord
der, antipsy ugs are devveloped to bind to
ychotic dru
and ina
activate the
e post-syna
aptic dopa mine receptors.

Fig 6.3 shows the


e cell signa
alling pathw
way when dopamine binds to itts receptorrs.

Fig 6.3

(ii) With reference to Fig 6.3,


6 briefly describe how
h binding
g of the druugs to the
recepto
or affects downstream
d m signallin g pathway
y.



... ........



...

........



...

........



...

........



...

........



...

........



...[3]

otal: 11]
[Q6 To

SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
355
16
7. Fishes in the genus Anisotremus comprise of ten described species which occur
predominantly on coral reefs and subtropical rocky reefs in the Neotropics.

(a) Bernardi et.al. did a molecular phylogenetic study on such fishes in that area.
Results are shown in Fig. 7.1.

Fig. 7.1

(i) Explain how molecular methods can be used to elucidate the evolutionary
relationships of the different species of Anisotremus fishes.
...........
...........
...........
...........
..............[2]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


356
17
(ii) Explain why it may be more reliable to construct a phylogenetic tree of the ten
species of Anisotremus using molecular data instead of morphological comparisons.
...........
...[1]

(iii) With reference to Fig. 7.1 and molecular homology, comment on the
evolutionary relationship between A. taeniatus and A. virginicus.
...........
..............[1]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


357
18
(b) A. taeniatus is found in
n the Pacifiic Ocean, whereas
w A.
A virginicuss is found in the
Caribbe
ean Sea. These
T two species wwere derived due to th
he formatioon of the Is
sthmus
of Pana
ama aboutt 3.5 million
n years ag o. Before that
t event, the waters
rs of the Pa
acific
Ocean and Caribbean Sea mixed free ely.

(i) Expplain how the


t formation of the IIsthmus off Panama results
r in thhe emerge
ence of
A. taen
niatus and A.
A virginicu
us.



...

........



...

........



...

........



...

........



...

........



...

........



...

........



...

........



..
.[4]

(c) Exxplain why it is impos


ssible for evvolution to
o occur at the individuual level.



... ........



...

........



...

........



..
.[2]

[Q7 To
otal: 10]

SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
358
19
Section B

Answer one question.

Your answers should be illustrated by large, clearly labelled diagrams, where


appropriate.

Your answers must be in continuous prose, where appropriate.

Your answers must be set out in sections (a), (b) etc., as indicated in the question.

8 (a) Distinguish between the concepts of repressible and inducible systems


of gene regulation. [4]
(b) Outline the differences between prokaryotic control of gene expression
with the eukaryotic model. [10]
(c) Describe how gene amplification can occur and the significance of gene
amplification in development [6]

[Total: 20]

OR

9 (a) Describe the molecular structure of starch (amylose) and cellulose and
relate these structures to their functions in living organisms. [7]
(b) Explain, with two named examples, how the environment may affect the
phenotype. [6]
(c) Explain how biogeography and the fossil record support the
evolutionary deductions based on homologies. [7]

[Total: 20]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


359

Civics Index Name (use BLOCK LETTERS)


Group Number H2
ST. ANDREWS JUNIOR COLLEGE
2013 JC2 Preliminary Examinations

H2 BIOLOGY 9648/2

Paper 2: Core (Mark Scheme)


Thursday 29 August 2013 2 hours

Additional Materials: Answer Paper


Cover Sheet for Section B

READ THESE INSTRUCTIONS FIRST

Write your name, civics group and index number on all the work you
hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagram, graph or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.

Section A (Structured Questions)


Answer all seven questions.
Write your answers in the spaces provided on the question paper.

Section B (Essay Question) For Examiners Use


Answer one essay question.
Section A
Write your answers on the separate answer paper provided.
All working for numerical answers must be shown. 1
/11

2
/13
INFORMATION TO CANDIDATES 3
/11

At the end of the examination, 4


/12
1. Attach Section B answers to the cover sheet provided.
5
/12

6
/11
The number of marks is given in brackets [ ] at the end of each
question or part question. 7
/10

Total
/80

This document consists of 30 printed pages.


[Turn over
360
2
Section A

Answ
wer all ques
stions.

1. Fig. 1.1 show ws the intracellular annd extracellular eventts in the forrmation of a
collageen fibril. Co
ollagen fibrils are shoown assemmbling in thee extracell ular spacee
containned within a large info olding in th
he plasma membrane e. Collagenn fibrils cann form
ordered d arrays in the extraccellular spaace by further assemmbling into llarge collagen
fibre.

Fig 1.1

(a) P representss two organ


nelles foun
nd in the eu
ukaryotic cell.
c Identiffy these tw
wo
organe
elles.

...

....[1]
1 roug
gh endopla
asmic retic
culum
2 Golgi body

Examineers comme ents:


More spe
ecific label must
m be given
n: ACCEPT b
bound riboso
omes

Procollagen peptidase remo oves the te he procollaagen to form


erminal peptides of th
collage
en in Step 7 of Fig. 1..1.

(b) Exxplain the interaction between p


procollagen and proc
collagen peeptidase.
... ....[2]
1 3D conforma ation/struc cture of proocollagen molecule is s complem mentary to
2 shaape of activve site of procollagen n peptidasee
3 formm enzyme--substrate complex
4 ref. lock-and-kkey hypoth hesis / induuced-fit hyp
pothesis
5 contact amino o acid in ac
ctive site fo
or brief bon
nding with substrate
/ via
a hydrogen n bonds an nd/or ionic bonds
6 cataalytic amino acids are e brought iinto correcct orientatio
ons in the aactive site
/ reff. inducing stress in bonds
b of suubstrate
/ reff. increasin
ng substratte reactivityy
SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
361
3
(c) Suggest why assembly of collagen fibril is done outside the cell.
.......[1]
1 collagen fibrils are too large (to be assembled inside the cell)
2 cannot be secreted out of cell
/ ref. affect internal cell environment

(d) Vitamin C is necessary in aiding the conversion of proline and lysine to


hydroxyproline and hydroxylysine. A deficiency in Vitamin C could lead to scurvy, a
disease displaying symptoms such as loss of teeth and easy bruising.

Collagen is an important matrix for the deposition of hard mineral crystals in the
formation of bones. Certain forms of osteogenesis imperfecta, or brittle-bone
disease, are caused by a single change of amino acid in the middle of the chain, from
glycine to arginine.

With reference to the structure of collagen, account for the following:

(i) Bleeding gum and easy bruising in scurvy


.......[4]
1 collagen is an important component in epidermis of gums and skin

2 lack of OH groups on proline


3 to form hydrogen bonds
4 to further stabilize tropocollagen structure

5 lack of hydroxylysine residues for formation of covalent bonds


6 between tropocollagen molecules forming collagen fibril
7 basic units of tropocollagen slide against each other

8 unable to form stable bundles of collagen fibres


9 leading to low tensile strength of collagen

Examiners comments:
Candidates should answer the question more directly, instead of phrasing the answers in a indirect,
reversed manner.
Order of packing: Tropocollagen (triple-helix) collagen fibrils collagen fibre
The terms microfibrils and macrofibrils are used to describe cellulose, NOT collagen!

(ii) weak and fragile bones in osteogenesis imperfecta


.......[3]
1 (R group of) arginine is too large
2 to fit into the crowded centre of the triple helix (REJECT: -helix)
3 unable to form hydrogen bonds between the NH groups of arginine residues on
each strand and CO groups on the other two strands.
4 unable to form stable tropocollagen
5 results in low tensile strength
6 lack stable matrix for deposition of minerals in bone (REJECT: no matrix)

Tutor: reject general statements about change in 3D structure due to amino acid change

[Q1 Total: 11]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


362
4
2.
(a) During semi-conservative DNA replication, both parental strands act as
templates for synthesis of complementary daughter strands. One of the daughter
strands, called the leading strand, is synthesized continuously. The other daughter
strand, called the lagging strand, is synthesized discontinuously in the form of short
fragments. The replicated DNA molecule consist of one new and one original strand
of DNA.

(i) State 3 structural differences in the formation of the leading and lagging strands.
......[1]
1 Presence of DNA ligase in lagging strand to ligate Okazaki fragments;
2 Presence of Okazaki fragments in lagging strand;
3 Presence of more than 1 primer/primase in lagging strand;
(REJECT: no primer needed in leading strand. This is incorrect!)
4 Strands are synthesized in opposite directions;

(ii) Explain why the two new strands of DNA are synthesized in opposite directions.
......[1]
1 DNA polymerase can only add nucleotides to the free 3 OH end of elongating
DNA strand
2 Template strands are antiparallel

(b) State three differences between the structures of DNA and RNA. [3]

DNA RNA
1 Exists as a double-stranded helix Single-stranded
2 Pentose sugar is deoxyribose Pentose sugar is ribose
3 Bases are A, T, C and G Bases are A, U, C and G
4 Ratio of A to T and G to C is always 1. Ratio varies.

(c) In eukaryotic cells, the end-replication problem explains why normal somatic
cells are limited in the number of mitotic divisions before they die out.

(i) Outline the end-replication problem in eukaryotic chromosomes.


.........[3]
1 DNA polymerase can only add nucleotides to the free 3 OH end
2 of a pre-existing/elongating polynucleotide (not DNA, since primer is RNA)
3 primer (bound to the very end of the template strand) removed
4 but cannot be replaced with DNA
5 because no 3-OH available (to which a DNA nucleotide can be added)
6 the 5 end of the DNA becomes shorter relative to that of the previous generation

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


363
5
(ii) What are telomeres?
..........[1]
1 ends of the linear DNA molecules
2 of eukaryotic chromosomes
3 ref. short repeated sequences

(iii) State the role of telomeres in relation to the end-replication problem.


......[]
1 prevents genes from being lost as DNA shortens with each round of replication.

Examiners comments:
Candidates must answer the questions specifically for the role of telomeres in relation to the end-
replication problem. REJECT other roles of telomeres (i.e. protects the end of the chromosome from
degradation by nucleases; prevents end-joining of chromosome ends which may lead to chromosomal
mutations; prevents unintentional cell death).

Telomeres does not prevent DNA from shortening! It acts as a disposable buffer to protect the genes
from erosion as DNA shortens with each round of replication.

Telomeres Telomerase!

(iv) Suggest why bacteria do not have telomeres.


......[1]
1 bacteria have circular DNA
2 no degradation of chromosome ends at each replication of DNA
/ no end-replication problem

In bacteria cells, binary fission differs significantly from the process of mitosis seen in
eukaryotic cells.

(d) Explain the significance of binary fission in bacteria


......[2]
1 Ref. asexual reproduction for unicellular organism
2 Ensuring that offspring are genetically identical to the parent
3 Desirable alleles/traits are passed down

4 Rapid increase in cell numbers (under favourable conditions)


5 Important for survival of species

[Q2 Total: 13]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


364
6
3.
(a) Fig. 3.1 shows two different viruses.

Virus A Virus B
Fig. 3.1

(i) Relate the structure of virus A to its mechanism of release from the host.
...[2]
1 Haemagglutinin binds to sialic acid (receptor) on host cells
2 Neuraminidase removes/cleaves sialic acid on viral envelope
3 to prevent agglutination/clumping of virus
4 to allow release of virus from host cell
/ to prevent virus from attaching to host cell during release

(ii) Contrast the reproductive cycles of the Virus A and Virus B. [3]

Virus A Virus B
Enters host cell via endocytosis Enters host cell via membrane fusion
with plasma membrane of host cell

RNA genome is not reverse transcribed RNA genome is first reversed


/ negative-sense RNA is converted to transcribed by reverse transcriptase
positive-sense RNA into DNA

No integration of viral genome into DNA Double-stranded DNA is integrated as


of host cell provirus into DNA of host cell

No proteolysis; Proteolysis of viral polyprotein to form


mature viral proteins;

No latency phase Latency phase

Examiners comments:
REJECT structural differences e.g. reverse transcriptase vs no reverse transcriptase, enveloped virus
vs not enveloped virus;
REJECT metabolic machineries
Budding (which happens for both influenza virus and HIV) Exocytosis !!

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


365
7
(b) One of the most common treatment methods for patients infected with virus B is
the use of reverse transcriptase inhibitors. These inhibitors bind to an inhibitor-
binding site (other than the active site) on the reverse transcriptase.

However, virus B often develop resistance against these inhibitors due to a single
base substitution in the DNA sequence resulting in a change of an amino acid in a
subunit of reverse transcriptase. The mutant protein is full-length and retains reverse
transcriptase activity, but does not allow the binding of the inhibitors.

(ii) Explain why the mutated protein remains full-length and retains reverse
transcriptase activity, but does not allow the binding of the inhibitors.
..[2]
Remain full-length
1 No frame-shift mutation
2 number of amino acids coded for remains the same

Does not allow binding of inhibitors


3 Tertiary structure/3D conformation of protein is altered
4 Inhibitor-binding site is no longer complementary to the 3D conformation of the
inhibitor (no interaction between the inhibitor and reverse transcriptase)

Retains reverse transcriptase activity


5 But active site is not altered

(c) In recent years, vaccines have been developed for virus B. Vaccines can either
be live but weakened forms of the virus, or its structural parts that are recognised by
the immune system. This provides immunity to the disease.

However, vaccine development for virus B has become more challenging due to the
viruss ability to undergo a high rate of antigenic drift.

(i) Suggest a reason for this high rate of antigenic drift and how it affects vaccine
development.
..[2]
1 Reverse transcriptase lacks proof-reading ability
2 Unable to remove mismatched deoxyribonucleotides and insert the correct one
(during DNA polymerisation)
3 Mutation in genes coding for protein/glycoprotein (gp120)
4 Produces altered (gp120) protein/glycoprotein
5 Antibodies induced by earlier strains of HIV / previously synthesised antibodies
can no longer bind to protein/glycoprotein
6 Hence, new vaccines must be developed

Examiners comments
Vaccines Antibodies Antibiotics!
Vaccines = A vaccine typically contains an agent that resembles a disease-causing
microorganism, and is often made from weakened or killed forms of the microbe, its toxins or
one of its surface proteins. The agent stimulates the body's immune system to recognize the
agent as foreign, destroy it, and "remember" it, so that the immune system can more easily
recognize and destroy any of these microorganisms that it later encounters.
Antibodies = Immunoglobulin proteins produced by the immune cells in response to foreign
antigen (eg. virus or vaccines). Antibodies will bind to the antigen.
Antibiotics = chemicals that are used to kill bacteria. They have no effect on viruses.

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


366
8
(ii) A student tries to produce a vaccine by heating a human virus to 100C for five
minutes to inactivate its infectivity. Suggest why effective vaccines cannot be
produced using the virus that has been heated to 100C.
...[1]
1 heating denatures the viral glycoprotein/antigens/capsid/envelope proteins;
2 unable to elicit specific antibodies from the immune system that recognizes the
protein receptors/capsid from the viruses

Examiners comments
Function of vaccines is to stimulate the production of new antibodies by the immune system. Some
candidates mistakenly thought that vaccines will be targeted by existing antibodies.

[Q3 Total: 11]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


367
9
4. Familial Dysautonomia (FD), is an autosomal disorder which affects the
development of sensory neurons in the autonomic and sensory nervous system,
resulting in various symptoms including the insensitivity to pain.

Mutation in another gene, transmembrane channel 1 gene (TMC1), results in a form


of DFNB7 hearing loss which is also inherited in an autosomal manner.

A world-wide, long term genetic study on the possible associations between FD and
hearing loss is implemented in 2003. Table 4.1 above shows the genotypes and
phenotypes of some subjects in this study.

Subject
Gene name Genotype Phenotype
number
FD Heterozygous No FD
1031
TMC1 Heterozygous Normal hearing
FD Homozygous recessive FD
1050
TMC1 Homozygous dominant Normal hearing
FD Homozygous dominant No FD
1088
TMC1 Homozygous recessive Hearing loss
FD Homozygous recessive FD
1092
TMC1 Homozygous recessive Hearing loss

Table 4.1

(a) Define the following terms:

(i) genotype
...[1]
1 the genetic makeup of an organism;
2 the paired alleles that produces a phenotype;
3 can be either homozygous or heterozygous;

(ii) phenotype
...[1]
1 physical and chemical characteristic of an organism;
2 depend on genotype of the organism and the environment;

(b) Subject 1031 and another subject listed in Table 4.1 are married and they have
their first child in 2005. This cross between them theoretically resembles a test
cross.

(i) Deduce the subject number of subject 1031s wife from Table 4.1.
......[]
Subject 1092;

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


368
10
Subject 1031 has a hearing impaired father with FD; his mother has normal hearing
and does not suffer from FD (she is homozygous dominant for both gene locus).

A total of 200 couples with the same genotypes as subjects 1031 and his wife were
monitored in this study. Information on their children (total number of 186) was
collated 10 years after the implementation of this study and presented in Table 4.2.

Phenotype Number of children


No FD, Normal hearing 59
FD, Normal hearing 35
No FD, Hearing loss 26
FD, Hearing loss 66

Table 4.2

(ii) Using the information give in Table 4.2, calculate the 2 and state the
conclusions derived from this test.
...[2]
1 23.42 (follow d.p. or sig.fig, whichever is applicable, of the 2-square table)
2 Since the calculated 2 value 23.42 > critical 2 value 7.82 at p = 0.05;
3 reject null hypothesis
4 The results of the 2 test suggest that there is a significant difference between the
observed and the expected values at the 5% level
5 Any difference is not due to chance
6 The predicted phenotype ratio of 1:1:1:1 is incorrect;

(O E) 2
=
2
v=c1
E
where = sum of O = observed value
v = degrees of freedom E = expected value
c = number of classes

A chi-squared table.
degrees of probability, p
freedom 0.10 0.05 0.02 0.01 0.001
1 2.71 3.84 5.41 6.64 10.83
2 4.61 5.99 7.82 9.21 13.82
3 6.25 7.82 9.84 11.35 16.27
4 7.78 9.49 11.67 13.28 18.47

(O E) 2
2 =
E
(59 46.5) 2 (35 46.5) 2 (26 46.5) 2 (66 46.5) 2
= + + +
46.5 46.5 46.5 46.5

Degrees of freedom =c1


=41=3

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


369
11
(iii) Explain the discrepancy from the expected results.
...[3]
1 There is a larger number of parental phenotypes and smaller number of
recombinant phenotypes;
2 There is no independent assortment of genes;

3 There is partial linkage of FD and TMC1 genes;


4 the FD and TMC1 genes are located on the same chromosome;

5 Recombinants are formed when;


6 crossing over occasionally breaks the linkage between genes on the same
chromosome;
7 (Other scenario)If it is a normal dihybrid cross, the F2 generation results would
show 4 types of phenotypes with a phenotypic ratio of 1:1:1:1
8 (Other scenario)If it is tight gene linkage, the F2 generation results would show 2
types of phenotypes with a phenotypic ratio of 1:1

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


370
12
(iv) Using the symbols provided, draw a genetic diagram of the cross between
Subject 1031 and his wife. [2]

Symbols:
F dominant allele for no FD
f recessive allele for FD
T dominant allele for Normal hearing
t recessive allele for hearing loss

Parental phenotypes: No FD, Normal x FD, Hearing loss


hearing
FT ft
Parental genotypes: ft ft

Parental gametes: FT ft Ft fT ft

Parental gametes recombinant gametes

Punnett square
showing F1 genotypes:

FT ft Ft fT

ft FT ft Ft fT
ft ft ft ft

Legend:

: No FD, normal hearing


: FD, hearing loss
: No FD, hearing loss
: FD, normal hearing

F1 No FD, normal hearing ; FD, hearing loss; No FD, hearing loss ; FD, Normal hearing
phenotypes:
Parental Recombinant

1 Parental genotypes ;
2 Parental gametes;
3 F1 genotypes;
4 F1 genotypes correspond to phenotypes / legend for Punnett square;
5 Correct presentation of genetic diagram (circled gametes, Indication of
recombinants and non-recombinant gametes, Indication of recombinants and
non-recombinant phenotypes);

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


371
13
During gamete formation in Subject 1031s wife from a diploid germ cell, an error
occurred once. As a result, her children will have 50% chance of having 3 copies of
chromosome 9; and 50% of having only 1 copy of chromosome 9 in his/her cells.

(v) Explain how this could have happened.


...[2]
1 Non-disjunction
2 homologous chromosomes fail to separate (in anaphase I);
3 so two copies of chromosome 9 will be found in 2 out of 4 oocytes / eggs/
gametes;
4 remaining 2 oocytes/eggs/gametes will have no chromosome 9;
5 upon fertilisation by fusion with the male gamete; (there is 50% chance of having
3 copies of chromosome 9 and 50% chance of having none in the offspring)

Examiners comments:
Reject non-disjunction at anaphase II/separation of sister chromatids as an error that occurred once at
meiosis II will result in 50% chance of normal (2 copies of chromosome 9); 25% chance of getting 3
copies of chromosome 9; 25% chance of getting only 1 copy of chromosome 9 after fusion with sperm

[Q4 Total: 12]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


372
14
5.
(a) Fig
g. 5.1 showws the norm mal seque nce of cell signaling events whhen insulin
reaches its targett cell and binds
b to an
n insulin rec
ceptor.

Fig. 5.1

(i) Sta
ate the sou
urce of the insulin mo
olecule in Fig
F 5.1.

...

....[1]
1 -ceells of the islets of La
angerhans
2 of th
he pancrea as

(ii) With reference to the structure


s off the plasm
ma membra ane, descriibe how the
structural features of recepttor tyrosine
e kinase en nables it to
o be embeddded as a
transmembrane protein.
p
... ....[3]
1 hyddrophobic c region of protein connsist of am
mino acid with
w non-poolar R grou ups)
eracts with hydropho
2 inte obic core o of membra ane
3 consisting of fatty
f acid tail of phospholipid bilayer
b
4 hydrophilic reg
gion of pro
otein consisst of amino
o acids with polar/hyddrophilic R
grouups
5 inte
eracts with hydrophillic region oof membra ane
6 consisting of phosphate
p e heads off phospholipid bilayer

SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
373
15
(iii) With reference to Fig. 5.1, describe the events occurring in stages A to D.
.......[3]
1 insulin receptor exists as a dimer prior to the binding of insulin
2 insulin bind to insulin receptor
3 ref. complementary in shape to the ligand binding site of the insulin receptor
4 results in the activation of the tyrosine kinase domains in the cytoplasmic tail.
5 each receptor phosphorylates the tyrosine residues (at the cytoplasmic tails) of
the other receptor, hence activating it
6 auto-crossphosphorylation
7 receptor phosphorylates and activates IRS-1
8 which in turn phosphorylates and activates PI 3-kinase

Examiners comment
The question asks for a description of stages A, B C. Candidates must use the information given in the
diagram i.e. specifically referring to IRS-1, PI 3-kinase and phosphorylation rather than just proteins,
tyrosine kinases, relay proteins, activation.

(iv) Based on your knowledge, describe the events that lead to an increase in the
number of glucose transporters in the cell surface membrane.
.......[1]
1 movement of vesicles containing glucose transporters (GLUT4 transporters)
towards the cell surface membrane.
2 fusion of vesicle membrane with cell surface membrane results in incorporation
of glucose transporters on the cell membrane.

(v) A tissue may, over time, lose its responsiveness to insulin, even though insulin
concentration remains unchanged. Suggest possible reasons for this decrease in
responsiveness.
.......[1]
1 Mutation in the gene coding for insulin receptor / change in the shape of insulin
receptor as cell/tissue ages
2 Mutation in the gene coding for insulin receptor / change in the shape of Glut4
transporters as cell/tissue ages

3 Fewer insulin receptors are synthesised / ref. lower transcription rate of gene that
codes for insulin receptor
4 Fewer Glut4 transporters are synthesised/incorporated / ref. lower transcription
rate of gene that codes for Glut4 transporters

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


374
16
(b) An aqueous solution contains small membranous vesicles which may be derived
either from a thylakoid or a mitochondrial membrane. In these vesicles, the
orientation of the ATP synthase enzymes is preserved as it is in the cell.

Fig. 5.2 shows the various experimental systems that are prepared in an attempt to
synthesize ATP.

Fig. 5.2

Which experimental system (A to D) shown in Fig. 5.2 would result in the successful
synthesis of ATP by thylakoid-derived vesicles? Explain your answer.
......[3]
1 Experimental system A
2 pH within the membrane is lower (pH 4 as compared to pH 8 outside the
membrane)
3 Concentration of H+ ions is higher within the membrane (than outside the
membrane)
4 ref. proton gradient
5 tendency for the H+ ions to diffuse out of the vesicle
6 via ATP synthase;
7 ATP is formed using ADP and Pi found outside the membrane

Examiners comments
pH 4 represents a higher concentration of H+. Some candidates made careless mistakes when relating
pH and H+ concentrations.
Some candidates merely describe the chloroplast without reference to the diagram. This will earn
them minimum marks.
Only ATP synthase can be seen in the diagram; no ETC or stalked particles are drawn.

[Q5 Total: 12]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


375
17
6.
(a) During an action potential, the permeability of the cell-surface membrane of an
axon changes. Fig 6.1 shows changes in permeability of the membrane to sodium
ions (Na+) and to potassium ions (K+) during a single action potential.

Fig. 6.1

(i) Explain the shape of the curve for sodium ions between 0.5 ms and 0.7 ms.
...[2]
1 Between 0.5 ms and 0.7 ms, permeability to Na+ ions increases from 0 a.u. to 28
a.u. (acceptable range 23 29 a.u.)
2 Some voltage-gated Na+ ion channels open
3 Na+ ions diffuse into the neurone
4 Changes membrane potential/makes inside of axon less
negative/positive/depolarisation/ reaches threshold
5 All voltage-gated Na+ ion channels open
6 More Na+ ions diffuse into the neurone

Examiners comments
The type of ion channels (eg. ungated, voltage-gated, ligand-gated) must be clearly stated.
In this question about action potential occurring in the axon, the ligand-gated ion channels are NOT
applicable.

(ii) During an action potential, the membrane potential rises to +40mV and then falls.
Using information from the graph, explain the fall in membrane potential.
...[2]
1 Repolarisation occurs;

2 Voltage-gated Na+ ion channels (in the membrane) are closed;


3 decreasing/stopping diffusion of Na+ ions into neurone;
4 ref. 0.7 ms to 1.5 ms, permeability to Na+ ions decreases from 28 a.u. to 0 a.u.
(acceptable range: 27-29 a.u.)

5 voltage-gated K+ ion channels (in the membrane) open;


6 increasing diffusion of K+ ions out of neurone;
7 ref. 0.5 ms to 1.2 ms, permeability to K+ ions increases from 0 a.u. to 12 a.u.
(acceptable range: 11-13 a.u.)

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


376
18
(iii) After exercise, some ATP is used to re-establish the resting potential in axons.
Explain how the resting potential is re-established.
...[1]
1 Na+- K+ pump on membrane
2 Pumps 3Na+ out and 2K+ in neurone (by active transport)
3 restores the unequal distribution/concentration gradient of Na+ ions and K+ ions
(in the intracellular and extracellular fluids at resting potential)

(b) The black mamba is a poisonous snake which produces a toxin.

(i) The length of the section of DNA that codes for the complete toxin is longer than
the mRNA used for translation. Explain.
......[]
1 DNA contains introns/non- coding bases
/ mRNA only contains exons/coding bases

(ii) The black mambas toxin kills prey by inhibiting the enzyme acetylcholinesterase
at neuromuscular junctions that controls muscles involved in breathing. Explain how
this inhibition affects breathing.
...[2]
1 Acetylcholine not broken down
/ stays bound to receptor
2 Na+ ions continue to enter
/ continued depolarisation
/ Na+ channels continuously open
3 action potentials generated/impulses fired continuously;
4 Muscles involved in breathing remain contracted/cannot relax;

Examiners comments:
Muscles contract alone is not sufficient; muscles remain contracted.
Inability to breath is not due to lack of action potential generation. Students should read the question
carefully to note that acetylcholinesterase is inhibited.

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


377
19
(c) Do opamine iss a neurotraansmitter rreleased by dopamin nergic neurrons for the
e
transmission of nerve signa als importa nt for moto
or control. Dopaminee binds to and
a
activate
es its recep
ptors locatted on the post-synapptic membrane.

Fig 6.2 shows a crystallogra


c aphy of the
e dopamine
e receptor.

Fig 6.2

(i) Witth referencce of Fig. 6.2,


6 identifyy the type of
o receptorr which thee dopamine
e
recepto
or belongs to.
...[]
...
G-prote
ein coupled
d receptor

SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
378
20
Excesssive neurottransmissio
on of dopaamine is asssociated with
w schizoophrenia, a clinical
mental disorder. To
T relieve this disord
der, antipsy ugs are devveloped to bind to
ychotic dru
and ina
activate the
e post-syna
aptic dopa mine receptors.

Fig 6.3 shows the


e cell signa
alling pathw
way when dopamine binds to itts receptorrs.

Fig 6.3

(ii) With reference to Fig 6.3,


6 briefly describe how h binding
g of the druugs to the
recepto
or affects downstream
d m signallin g pathway y.
...[3]
1 Prevents confformation change
c in rreceptor (h
hence no activation
a oof receptor)
2 Gp protein unable to bindd to receptoor
3 GDP not displlaced by GTP G
4 Gp mains inactive / -sub unit of G protein
protein rem p doe
es not dissoociate
5 and d bind to / activate
a ad
denylyl cyc lase
6 No conversion n of ATP to
o cAMP.
7 No activation of protein kinase C
8 No opening off Na+ ion channels
c

otal: 11]
[Q6 To

SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
379
21
7. Fishes in the genus Anisotremus comprise of ten described species which occur
predominantly on coral reefs and subtropical rocky reefs in the Neotropics.

(a) Bernardi et.al. did a molecular phylogenetic study on such fishes in that area.
Results are shown in Fig. 7.1.

Fig. 7.1

(i) Explain how molecular methods can be used to elucidate the evolutionary
relationships of the different species of Anisotremus fishes.
..............[2]
1 Neutral mutations do not confer any selective advantage or disadvantage;
2 Neutral mutations are accumulated at a relatively constant rate for any particular
gene and use as a molecular clock;
3 compare DNA sequence of a particular common gene (between different species
of fish);
/ comparison/alignment of homologous genetic sequences

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


380
22
4 E.g. rRNA genes, cytochrome c genes, hypervariable regions of mtDNA
5 number of mutation in genetic sequence is used to calculate the length of time
since divergence
/ % sequence homology indicates degree of evolutionary closeness

(ii) Explain why it may be more reliable to construct a phylogenetic tree of the ten
species of Anisotremus using molecular data instead of morphological comparisons.
...[1]
1 Quantifiable ;
protein, nucleic acid sequence data are precise and accurate and easy to
quantify / convertible to numerical form for mathematical and statistical analysis;

OR

2 Objective;
based strictly on heritable material
/ can be easily described in an unambiguous manner
/ some morphological characteristics may be analogous / ref. convergent
evolution;

(iii) With reference to Fig. 7.1 and molecular homology, comment on the
evolutionary relationship between A. taeniatus and A. virginicus.
..............[1]
1 A. taeniatus and A. virginicus are closely related;
2 share a (recent) common ancestor;
3 high percentage homology in DNA sequence alignment;

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


381
23
(b) A. taeniatus is found in
n the Pacifiic Ocean, whereas
w A.
A virginicuss is found in the
Caribbe
ean Sea. These
T two species wwere derived due to th
he formatioon of the Is
sthmus
of Pana
ama aboutt 3.5 million
n years ag o. Before that
t event, the waters
rs of the Pa
acific
Ocean and Caribbean Sea mixed free ely.

(i) Expplain how the


t formation of the IIsthmus off Panama results
r in thhe emerge
ence of
A. taen
niatus and A.
A virginicu
us.
.. .[4]
1 geo ographical isolation
/Istthmus of Panama
P is a physical barrier
/ re
ef. allopatric speciatio
on;
2 disruption to gene flow in the ance estral popu
ulation
/ noo interbree
eding betwe een the org
ganisms inn the Pacific Ocean aand Caribb
bean
Sea a;
3 proocesses of natural se election and
d genetic drift
d occur;

4 gen netic variattions exist within eacch sub-pop pulation;


5 diffferent selection press sures in Pa acific Ocea an and Carribbean Seea;
6 list 1 eg. food
d availabilitty/ salinity /temperatu ure/ different predatoors;
7 individuals wiith a selecttive advan tage in the e particularr environm ent survive ed till
repproductive age and pass on the o offspring;
eir alleles to
8 cha ange in alle
ele frequen ncy of gene e pool;
9 acccumulation n of genetic c difference es over timme;
10 diffferent popuulations ulttimately ca annot interb breed to prroduce via ble, fertile
offsspring;

(c) Exxplain why it is impos


ssible for evvolution to
o occur at the individuual level.
.. .[2]
1 Evo
olution = ch
hanges in allele
a frequ
uencies in a gene pool of a poppulation over time;

2 The ere must bee variation (in a popuulation) beffore selection can takke place;
3 Individuals aree selected for or aga inst by nattural selecttion;
4 Individuals can only pas ss alleles too the next generationn;
5 It is the popula
ations thatt actually e
evolve

[Q7 To
otal: 10]

SAJC / H2 B
Biology 9648/2 JC2 Prelims 2013
382
24
Section B

Answer one question.

Your answers should be illustrated by large, clearly labelled diagrams, where


appropriate.

Your answers must be in continuous prose, where appropriate.

Your answers must be set out in sections (a), (b) etc., as indicated in the question.

8 (a) Distinguish between the concepts of repressible and inducible systems


of gene regulation. [4]
(b) Outline the differences between prokaryotic control of gene expression
with the eukaryotic model. [10]
(c) Describe how gene amplification can occur and the significance of gene
amplification in development [6]

[Total: 20]

OR

9 (a) Describe the molecular structure of starch (amylose) and cellulose and
relate these structures to their functions in living organisms. [7]
(b) Explain, with two named examples, how the environment may affect the
phenotype. [6]
(c) Explain how biogeography and the fossil record support the
evolutionary deductions based on homologies. [7]

[Total: 20]

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


383
25
8(a) Distinguish between the concepts of repressible and inducible systems
of gene regulation. [4]

Repressible system Inducible system


1 Repressible enzymes are produced Inducible enzymes are produced

2 Involved in anabolic (biosynthesis) Involved in catabolic (hydrolysis)


pathways pathways

3 Repressors are synthesized in Repressors are synthesized in active


inactive form form

4 Transcription of structural genes is Transcription of structural genes is


normally switched on normally switched off

5 Pathway end-product (tryptophan) Substrate molecule serves as inducer


serves as co-repressor that signals (allolactose) that signals the induction of
repression of the trp operon the lac operon

6 Operon is repressed to prevent over Operon is induced to stimulate


production of pathway product production of enzymes necessary for
breakdown substrate

8(b) Outline the differences between prokaryotic control of gene expression


with the eukaryotic model. [10]

For every comparison:


mark for correct comparison
mark for correct information

Chromosomal Level (max 2)


Prokaryotes Eukaryotes
1. Prokaryotic DNA not organised into Eukaryotic DNA is complexed with
chromatin / not associated with histones and other proteins to form
histones chromatin / associated with histones

2. DNA demethylation/methylation and DNA and histone modification can occur,


histone acetylation/deacetylation resulting in conversion between
cannot occur euchromatin and heterochromatin

3. DNA sequences, eg. promoters Structure of chromatin euchromatin,


and operators, serve as the on/off ready to be transcribed, or
switch heterochromatin and not available is
the major on/off switch for gene
regulation

/ Ease of transcription DNA made


accessible to RNA polymerase and other
regulatory proteins

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


384
26
Transcriptional Level (max 2)
Prokaryotes Eukaryotes
4. One RNA polymerase consisting of Three different RNA polymerases, each
five subunits containing 10 or more subunits;
/ All RNAs synthesized by the same / Three different classes of RNA each
RNA polymerase; synthesized by a different RNA
polymerase (i.e. mRNA, tRNA, rRNA)
5. Simple regulatory sequence: Complex regulatory sequence:
Transcriptional regulatory protein / More extensive interaction between
Regulator protein binds to DNA- upstream DNA sequences and protein
binding sites upstream of the cluster factors involved to stimulate and initiate
of structural genes to regulate transcription. In addition to promoters,
initiation of transcription. enhancers and silencers control rate of
transcription.

6. Related genes are transcribed No operon


together as operons / each gene has own promoter
/ only 1 promoter / monocistronic mRNA
/ polycistronic mRNA

Post-transcriptional Level (max 2)


Prokaryotes Eukaryotes
7. Translation is often coupled to No direct coupling of transcription and
transcription translation
/ Transcription and translation take / mRNA must pass across nuclear
place in the same cellular envelope before translation in the
compartment simultaneously. cytoplasm. RNA transcript is not free to
associate with ribosomes prior to the
completion of transcription.

8. Primary transcripts are the actual Primary transcripts undergo processing to


mRNAs produce mature mRNAs methylated
/ no post-transcriptional modification guanosine cap at the 5 end, poly-A tail
at the 3 end, splicing

9. Lower stability of transcript Higher stability of transcript


/ degradation within seconds or / prevent transcript degradation
minutes / mRNAs longer half-life remaining much
/ mRNAs shorter half life to rapidly longer to orchestrate protein synthesis
respond to environmental changes prior to their degradation by nucleases in
the cell

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


385
27
Translational level (max 2)
Prokaryotes Eukaryotes
10. Control at this level is unlikely; due Control at translational level:
to simultaneous transcription and phosphorylation of ribosomal translation
translation initiation factors
/ negative translational control through
regulatory proteins
/ cytoplasmic elongation of poly (A) tails
/ mRNA degradation
/ RNA interference and microRNA

11. mRNAs have multiple ribosome mRNAs have only one start site
binding sites / direct synthesis of only one kind of
/ direct the synthesis of several polypeptide
different polypeptides

Post-translational Level (max 2)


Prokaryotes Eukaryotes
12. no/minimal post-translational Post-translational modifications
modifications occur determine the functional abilities of the
protein
13. Proteolysis: Processing eukaryotic
polypeptides to yield functional protein
molecules e.g. cleavage of pro-insulin to
form the active insulin hormone
14. Chemical modification of proteins to yield
functional protein molecules
15. Phosphorylation of proteins to increase
or decrease its function
16. Transportation of proteins to target
destinations in the cell where it functions
is mediated by signal sequences at N-
terminus of some proteins. Once
transported to destination, signal
sequence is enzymatically removed from
the proteins
17. Ubiquitination marks protein for
degradation, ref to ubiquitin &
proteasome

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


386
28
8(c) Describe how gene amplification can occur and the significance of gene
amplification in development . [6]

1 gene amplification is the the (selective) replication of certain genes


2 increases the number of templates for transcriptions
/ results in increased gene expression
/ allows more copies of mRNA to be made
3 increase amount of gene product / polypeptide in a short period of time
4 to carry out specialised functions in the cell

How gene amplification can occur

Faulty cytokinesis
5 faulty cytokinesis / non-disjunction
6 result in one or more extra sets of chromosomes ending up in a single cell
/ ref. polyploidy
/ ref. duplication of chromosomes sets

Errors in crossing over


7 errors in crossing over / unequal crossing over
8 of non-sister chromatids during prophase I of meiosis
9 even when their homologous gene sequences are not correctly aligned

Slippage during DNA replication


10 slippage occur during DNA replication
11 such that the template shifts with respect to the new complementary strand
12 one region of the template strand is copied twice

Significance in development
13 In developing ovum/egg cell, additional copies of the rRNA genes
14 for making enormous number of ribosomes
15 for active protein synthesis (once the egg is fertilized)

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


387
29
9(a) Describe the molecular structure of starch (amylose) and cellulose and
relate these structures to their functions in living organisms. [7]

Starch

Structure
1 amylose is unbranched;
2 polymer of -glucose molecules linked by (1, 4) glycosidic bonds

3 hydrophilic hydroxyl groups of glucose residues project into interior of helices;


4 no cross-linking between amylose or glycogen chains
/ no cross-linking to form big bundles

Property and Function


5 insoluble;
6 can be stored in large quantities without having any great effect on the water
potential of cells
7 and can be prevented from diffusing out of cells

8 individual chains can fold into compact shape;


9 can be stored in large quantities (within a cell);

10 easily hydrolysed to monosaccharides when required;

Cellulose

Structure
11 unbranched;
12 polymer of -glucose molecules linked by (1, 4) glycosidic bonds;

13 alternative units are oriented 180 to each other


/ every other glucose monomer is upside down with respect to the others
14 hydroxyl groups project outwards from each cellulose chain;
15 form H-bonds with neighboring chains
/ cross-linking of chains to form macrofibrils;

Property and Function


16 great tensile strength
17 prevents plant cells from bursting when placed in solutions of higher water
potential
/ used as cell wall material for structural support in plants;

18 large intermolecular spaces between macrofibrils


19 allows passage of water and solute molecules;

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


388
30
9(b) Explain, with two named examples, how the environment may affect the
phenotype. [6]

Example 1 [max 3]
1 Himalayan rabbit homozygous for the ch allele;
2 tyrosinase gene codes for heat-sensitive enzyme/tyrosinase that makes
melanin;

3 low temp /below 33C tyrosinase active / melanin produced;


4 eg. in parts of the body that are cool enough / the extremities / feet, nose, ears
and tail black;

5 high temp /above 33C tyrosinase inactive / no melanin produced ;


6 eg. in body regions that are massive enough to conserve a fair amount of heat
white;

7 if a small section of fur is shaved from a Himalayan rabbit, fur will grow back
either white or black depending on temp. of environment / Eg. experiment
involving ice-pack on shaved rabbit ;
8 just-born rabbits are all white as they had developed at temp. of mothers womb;
9 to produce rabbits with black extremities, the young are kept in the cold;

Example 2 [max 3]
1 In Drosophila homozygous for allele coding for vestigial wing;
2 allele for vestigial wing is recessive to that for long wing;
3 expression of vestigial wing is affected by the temperature at which the insect
develops;
4 The allele for vestigial wing is expressed only at low temperatures;
5 develop vestigial wings at 21C;
6 intermediate wings at 26C;
7 long wings at 31C;

Example 3 [max 3]
1 honeybee drones, queen and workers;
2 drones are males arise from unfertilised eggs;
3 queen and workers are females arise from fertilised eggs;

4 queen and workers have same amount of genetic material but phenotypically
different;
5 depends on diet of larva;

6 in the first 3 days of hatching, all female larvae feed on royal jelly;
7 after 3 days, those fed with diet consisting of honey/nectar and pollen would
develop into workers;
8 workers are sterile, smaller in size and have larger mouthparts and modified legs
as compared to the queen;
9 those fed with royal jelly develops into queens as high protein content of royal
jelly stimulates formation and maturation of female reproductive system;

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


389
31
Example 4 [max 3]
1 people with functional pancreas/with no type I diabetes have functional genes for
insulin uptake;
2 insulin is secreted when blood glucose level increases;
3 overeating of sugary foods for a long period of time causes repeated stimulation
of the pancreas;
4 which responds by secreting high levels of insulin;
5 repeated exposure of target cells to large amounts of insulin desensitizes the cells
responsiveness to insulin;
6 result in the target cells failing to take in glucose;
7 resulting in type II diabetes;

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


390
32
9(c) Explain how biogeography and the fossil record support the evolutionary
deductions based on homologies. [7]

Biogeography [max 3]
1 the study of the geographic distribution of species;
2 species that are closely related are found closer together;
3 and not found in similar environments far away due to geographical
barriers/convergent evolution;
4 e.g. Marsupials are not found anywhere else in the world except in Australia;

5 organisms found close together are evolved from a common ancestor;


6 e.g. Island Biogeography of the Galapagos: Most species of plants and animals
living on islands are closely related to neighbouring mainland species;

7 differences suggest evolution from mainland ancestral /descent with modification;


8 different species of finches on Galapagos Islands closely resemble one another;
9 they exhibit homology in terms of shape and size of beak;
10 due to natural selection: Favoured populations with beaks that enabled the birds
to acquire their particular food source at each island;

Fossil Records [max 4]


11 Fossils are the preserved remains of organisms.
12 allow scientists to study/compare morphological traits / homologous structures
with existing species;
13 coupled with dating of fossils based on radioactive isotopes to determine age of
fossil;
14 show that organisms evolved in a chronological manner / historical sequence
(fish amphibians reptiles birds and mammals);
15 show new species appearing and others disappearing;
16 reveal ancestral characteristics that have been lost over time;

17 discovery of transitional fossils linking older organisms to modern species


supports the idea of descent with modification.

18 provide evidence that accumulated changes over long period of time led to
diverse forms of life present today/diversity of life arose from evolution;

19 DNA/protein could be extracted from fossils and sequences compared;


20 higher molecular homology indicates closer relation;
21 can be used to prove that continental drift (land pieces which have drifted apart)
leads to divergent evolution;

SAJC / H2 Biology 9648/2 JC2 Prelims 2013


391

Civics Index Name (use BLOCK LETTERS)


Group Number H2
ST ANDREWS JUNIOR COLLEGE
2013 JC2 Preliminary Examinations

H2 BIOLOGY 9648/3

Paper 3: Applications and Planning Question

Wednesday 18 September 2013 2 hours

Additional Materials: Answer Paper


Cover Sheet for Section B

READ THESE INSTRUCTIONS FIRST

Write your civics group, index number and name on all the work you
hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagram, graph or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.

Answer all questions.

At the end of the examination,


1. Attach Question 5 to the cover sheet provided.
For Examiners Use
The number of marks is given in brackets [ ] at the end of each
Paper 3
question or part question.
1
/14
2
/14
3
/12
5
/20
Total
/60

4
(Planning) /12
This document consists of 15 printed pages.
[Turn over

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


392
2
Answer all questions.

1. A student researcher attempted to clone the Human Growth Hormone (HGH)


gene. Two separate samples of HGH DNA were obtained from DNA libraries and
subjected to agarose gel electrophoresis. Results were shown in Fig.1.1.

Sample 1 Sample 2

- well

+
Fig. 1.1

(a)(i) Describe how the DNA fragments were separated into visible bands.
.......
.......
.......
......[2]

Subsequent cloning procedures involving Escherichia coli host cells yield functional
HGH protein when Sample 2 was used, but not for Sample 1.

(ii) Based on the difference in the bands observed in Fig. 1.1, account for the failure
to produce functional HGH protein for Sample 1.
.......
.......
.......
......[2]

(iii) State the type of DNA library where Sample 2 was obtained from.
......[]

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


393
3
The student researcher has designed the following plasmid (Fig. 1.2) for use in her
preliminary trials of a cloning experiment.

Restriction site for BamHI

Kanamycin resistant
(kanr) gene

Tetracycline
resistant (tetr) gene

Fig. 1.2

(b) With reference to the properties of bacterial plasmids, provide 2 reasons why this
plasmid in Fig 1.2 will not work well as a cloning vector.
.......
.......
.......
..........[2]

(c) The student researcher has since made improvements to the plasmid in Fig. 1.2
such that it is now a functional cloning vector.

Steps were then taken to create a recombinant plasmid using BamHI and the
improved plasmid.

Restriction enzyme Specific recognition site


5'-G^G A T C C-3'
BamHI
3'-C C T A G^G-5'

^ indicates where the restriction enzyme cuts

(i) Describe the natural function of BamHI restriction enzyme.


.......
...[1]

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


394
4
(ii) Explain the main problem with using Sample 2 and BamHI in the formation of a
recombinant plasmid and suggest how this problem can be solved.
.......
.......
.......[1]

(iii) Describe the subsequent steps in the formation of recombinant plasmid.


.......
.......
.......
.......[2]

(iv) With reference to Fig. 1.2, explain how you would identify transformed bacterial
cells that have taken up the recombinant plasmid with the HGH gene using antibiotic
selection.
.......
.......
.......
.......
.......
.......
.......[3]

[Q1 Total: 14]

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


395
5
2. Severe combined immunodeficiency (SCID) is a genetic disorder characterized
by lack of functional lymphocytes, resulting in defects in both T and B cells responses
of the immune system. Patients are susceptible to opportunistic infections while
children usually die if not treated.

Fig. 2.1 shows the inheritance of SCID in a family in which both parents are carriers.
Only one of the sons suffer from SCID.

Fig. 2.1

(a) State the form of SCID that is being inherited in the family and the mode of
inheritance.
.......
...[1]

(b) Two RFLP morphs have been found tightly linked to the adenosine deaminase
(ADA) gene which can be used for genetic screening. A radioactive probe has been
designed to reveal the two RFLP morphs.

Both RFLP morphs and radioactive probe are shown in Fig. 2.1 with the arrows
representing the PvuII restriction sites. The asterisk (*) indicates the position of a
mutation at the restriction site that results in the loss of the restriction site. Morph 2
was found to be linked to the mutant ADA gene.

Fig. 2.2

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


396
6
(i) With reference to Fig 2.1 and Fig. 2.2, draw the resulting autoradiogram you
would expect to see in the space below. [3]

DNA
ladder Father Daughter 1 Son 2

200 bp

100 bp

20 bp
5 bp

(ii) Explain the role of the DNA ladder.


.......
...[1]

(c) Apart from disease detection, other applications of RFLP include genetic
fingerprinting and in genomic mapping.

(i) Explain why genes especially protein-encoding genes are seldom used as
markers for genetic fingerprinting.
.......
.......
.......
......[2]

(ii) Explain the use of genetic markers in genomic mapping in terms of linkage
mapping.
.......
.......
.......
.......
.......
.......
......[3]

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


397
7
(d) Another method to detect ADA-SCID is through the use of PCR. Fig 2.3 shows
the number of DNA molecules made using PCR, starting with one molecule.

Fig 2.3

(i) Explain three advantages of PCR.


.......
.......
.......
.......
.......
.......
.......[3]

(ii) Suggest two reasons for the leveling off of the graph from cycles 17 to 20.
.......
...[1]

[Q2 Total: 14]

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


398
8
3.
(a) Many varieties of rice, Oryza sativa, die quickly when totally submerged by flood
water during the monsoon season. Typically, submergence-intolerant plants respond
to submerged conditions by elongating rapidly.

In 2006, a gene, Sub1A, on rice chromosome 9 was found to be involved in tolerance


of prolonged submergence.

An allele, Sub1A-1, was found only in submergence-tolerant rice. Varieties that are
submergence-intolerant either have a second allele, Sub1A-2, or lack the gene
altogether.

(i) Sub1A-1 codes for a protein that controls the transcription of the gene for alcohol
dehydrogenase. This gene is activated when the plant is in anaerobic conditions.

Explain the importance to submerged rice plants of producing alcohol dehydrogenase.


.......
.......
.......
..........[2]

A variety of submergence-intolerant rice, which lacked the gene Sub1A, was


genetically engineered to express Sub1A-1.

The mean heights of three types of rice plants were compared before and after 10
days of submergence in water. The types of rice plants were:

I : submergence-intolerant plants
I+ : submergence-intolerant plants genetically engineered to express Sub1A-1
T : submergence-tolerant plants

The results are shown in Fig. 3.1.

Fig. 3.1

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


399
9
(ii) With reference to Figure 3.1, compare the effect of submergence on the
elongation of the three types of rice plants.
.......
.......
.......
.......
.......
.......[2]

The allele Sub1A-1 could be introduced into high-yielding variety of submergence-


intolerant rice either by genetic engineering or by selective breeding.

(iii) Suggest two advantages of using genetic engineering, rather than selective
breeding, to introduce the allele.
.......
..........[1]

(b) Round-Up ReadyTM soybeans are genetically modified to be resistant towards


Round-UpTM herbicide, a glyphosate-based herbicide that normally inhibits an
important enzyme in the aromatic amino acid synthesis pathway in plants. This allows
farmers to freely apply Round-UpTM to destroy weeds without affecting the Round-Up
ReadyTM soybeans.

Round-Up ReadyTM soybeans may be produced by first transfecting soybean callus


cells with the resistance gene from Agrobacterium.

(i) To obtain a callus culture, suitable explants must first be chosen. Suggest a
suitable explant and explain your choice.
.......
.......[1]

(ii) Explain three advantages of growing soyabean plants from tissue culture rather
than from seeds.
.......
.......
.......
.......
.......
.......
.......[3]

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


400
10
(iii) Soyabean plants can reproduce sexually by means of seeds. Soyabean plants
grown from seeds are very variable in their yield. Explain why.
.......
.......
.......
.......[2]

Genetically modifying soybean plants to be resistant towards Round-UpTM herbicide


might threaten the environment and human safety.

(iv) State one possible adverse effect on:

The environment
.......
.........[]

Human safety
.......
.........[]

[Q3 Total: 12]

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


401
11
4. Planning question

The goshawk is an endangered species protected by the Convention of International


Trade in Endangered Species of Wild Fauna and Flora (CITES).

The Royal Society for the Protection of Birds (RSPB) has found a man in possession
of four young goshawks and an adult female. He claimed to have bred the young
birds using his adult female and a male bird borrowed from another keeper of these
birds of prey. The RSPB suspects that the young goshawks were poached from the
wild and not bred in captivity as claimed by the man.

Plan an investigation using DNA fingerprinting to verify if the young goshawks were
bred in captivity or poached from the wild.

[Total: 12]

You planning must be based on the assumption that you have been provided with the
following equipment and materials

tissue samples (feather tips) from the four young gohawks, the adult female
and the adult male under investigation
pestle and mortar
DNA extraction buffer solution
ice-cold ethanol
glass rods
microcentrifuge tubes
centrifuge
restriction enzyme
PCR reagents and equipment
agarose gel electrophoresis reagents and equipment
suitable source of electrical current
radioactive probe
nitrocellulose membrane
autoradiography equipment

Your plan should have a clear and helpful structure to include

an explanation of the theory to support your practical procedure

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


402
12
a description of the method used, including the scientific reasoning behind the
method
the type of data generated by the experiment
how the results will be analysed including how the origin of the organism can
be determined.
relevant risks and precautions taken

.......
.......
.......
.......
.......
.......
.......
.......
.......
.......

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


403
13

.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
SAJC / H2 Biology 9648/3 JC2 Prelim 2013
404
14

.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
.......
SAJC / H2 Biology 9648/3 JC2 Prelim 2013
405
15
Free-response question

Write your answer to this question on the separate answer paper provided.

Your answer:

should be illustrated by large, clearly labeled diagrams, where appropriate;


must be in continuous prose, where appropriate;
must be set out in sections (a), (b) etc., as indicated in the question.

5 (a) Compare the properties, features and functions of zygotic and


embryonic stem cells. [5]

(b) Using one named example of an adult stem cell, describe its normal
role and how it could be used in gene therapy against SCID using a
retrovirus. [8]

(c) Discuss the social and ethical considerations for the use of gene
therapy. [7]

[Total: 20]

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


406

Civics Index Name (use BLOCK LETTERS)


Group Number H2
ST ANDREWS JUNIOR COLLEGE
2013 JC2 Preliminary Examinations

H2 BIOLOGY 9648/3

Paper 3: Applications and Planning Question


(Mark Scheme)
Wednesday 18 September 2013 2 hours

Additional Materials: Answer Paper


Cover Sheet for Section B

READ THESE INSTRUCTIONS FIRST

Write your civics group, index number and name on all the work you
hand in.
Write in dark blue or black pen on both sides of the paper.
You may use a soft pencil for any diagram, graph or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid.

Answer all questions.

At the end of the examination,


1. Attach Question 5 to the cover sheet provided.
For Examiners Use
The number of marks is given in brackets [ ] at the end of each
Paper 3
question or part question.
1
/14
2
/14
3
/12
5
/20
Total
/60

4
(Planning) /12
This document consists of 15 printed pages.
[Turn over

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


407
2
Answer all questions.

1. A student researcher attempted to clone the Human Growth Hormone (HGH)


gene. Two separate samples of HGH DNA were obtained from DNA libraries and
subjected to agarose gel electrophoresis. Results were shown in Fig.1.1.

Sample 1 Sample 2

- well

+
Fig. 1.1
(a)(i) Describe how the DNA fragments were separated into visible bands.
......[2]
1 negatively-charged DNA fragments migrate to the positively-charged electrode;
2 through an agarose gel/matrix;
3 DNA fragments separated by size / molecular weights
/ shorter fragments move faster than longer ones;
4 invisible DNA bands revealed under UV light by staining the gel with a dye such
as ethidium bromide;

Examiners comments:
Many candidates failed to read the question properly and missed out the EtBr staining followed by
visualization under UV light in order to obtain visible bands

Subsequent cloning procedures involving Escherichia coli host cells yield functional
HGH protein when Sample 2 was used, but not for Sample 1.

(ii) Based on the difference in the bands observed in Fig. 1.1, account for the failure
to produce functional HGH protein for Sample 1.
......[2]
1 sample 1 has a higher molecular weight/larger size compared to sample 2;
2 due to presence of introns in sample 1;
3 bacterial host cells do not have RNA splicing machinery;
4 ref. HGH gene not expressed correctly;

(iii) State the type of DNA library where Sample 2 was obtained from.
......[]
1 cDNA library;

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


408
3
The student researcher has designed the following plasmid (Fig. 1.2) for use in her
preliminary trials of a cloning experiment.

Restriction site for BamHI

Kanamycin resistant
(kanr) gene

Tetracycline
resistant (tetr) gene

Fig. 1.2

(b) With reference to the properties of bacterial plasmids, provide 2 reasons why this
plasmid in Fig 1.2 will not work well as a cloning vector.
..........[2]
1 no origin of DNA replication ;
2 no independent replication of the plasmid (and target gene)
/ cannot result in multiple copies of the plasmid (and target gene) within one
bacterium;

3 no prokaryotic promoter;
4 which allows recognition by host cells RNA polymerase (which is also prokaryotic)
/ no transcription/ expression of genes;

(c) The student researcher has since made improvements to the plasmid in Fig. 1.2
such that it is now a functional cloning vector.

Steps were then taken to create a recombinant plasmid using BamHI and the
improved plasmid.

Restriction enzyme Specific recognition site


5'-G^G A T C C-3'
BamHI
3'-C C T A G^G-5'

^ indicates where the restriction enzyme cuts

(i) Describe the natural function of BamHI restriction enzyme.


...[1]
1 protect bacteria from attack by viruses/bacteriophages ;
2 cleave any foreign DNA that enters bacterial cell
/ by cutting up intruding DNA from other organism

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


409
4
(ii) Explain the main problem with using Sample 2 and BamHI in the formation of a
recombinant plasmid and suggest how this problem can be solved.
.......[1]
1 cDNA has blunt ends;
2 ref. incompatibility with sticky ends of plasmid after BamHI cuts;
3 ligate linker DNA;
4 to both ends of cDNA fragment;

(iii) Describe the subsequent steps in the formation of recombinant plasmid.


.......[2]
1 Use the same restriction enzyme to digest HGH cDNA and plasmid to generate
complementary sticky ends
2 The plasmid and the HGH cDNA are mixed together
3 the sticky ends will anneal by complementary base pairing
4 DNA ligase added to seal the nicks by catalyzing the formation of phosphodiester
bonds (between adjacent nucleotides on the sugar phosphate backbone)

(iv) With reference to Fig. 1.2, explain how you would identify transformed bacterial
cells that have taken up the recombinant plasmid with the HGH gene using antibiotic
selection.
.......[3]
1 grow bacteria on LB/tet plate ;
2 transformed cells can survive;
3 as they contain plasmid with intact with tetracycline resistance gene;

4 transfer a small amount of each colony to an identified spot on LB/kan plate


/ replica plate on LB/kan plate;
5 bacterial colonies that cannot survive on LB/kan plates have the recombinant
plasmid;
6 insertion of human gene disrupts sequence of kanamycin resistance gene;

Examiners comments
REJECT recombinant plasmid cannot survive. The correct phrasing should be bacterial colonies
containing the recombinant plasmid cannot survive.

[Q1 Total: 14]

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


410
5
2. Severe combined immunodeficiency (SCID) is a genetic disorder characterized
by lack of functional lymphocytes, resulting in defects in both T and B cells responses
of the immune system. Patients are susceptible to opportunistic infections while
children usually die if not treated.

Fig. 2.1 shows the inheritance of SCID in a family in which both parents are carriers.
Only one of the sons suffer from SCID.

Fig. 2.1

(a) State the form of SCID that is being inherited in the family and the mode of
inheritance.
...[1]
1 ADA-SCID
2 autosomal recessive

(b) Two RFLP morphs have been found tightly linked to the adenosine deaminase
(ADA) gene which can be used for genetic screening. A radioactive probe has been
designed to reveal the two RFLP morphs.

Both RFLP morphs and radioactive probe are shown in Fig. 2.1 with the arrows
representing the PvuII restriction sites. The asterisk (*) indicates the position of a
mutation at the restriction site that results in the loss of the restriction site. Morph 2
was found to be linked to the mutant ADA gene.

Fig. 2.2

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


411
6
(i) With reference to Fig 2.1 and Fig. 2.2, draw the resulting autoradiogram you
would expect to see in the space below. [3]

DNA
ladder Father Daughter 1 Son 2

200 bp

100 bp

20 bp
5 bp

For each individual,


1 Correct bands
2 Correct thickness

(ii) Explain the role of the DNA ladder.


...[1]
1 as a reference/standard
/ providing known DNA fragments of specific lengths
2 to estimate the size of unknown DNA molecules

(c) Apart from disease detection, other applications of RFLP include genetic
fingerprinting and in genomic mapping.

(i) Explain why genes especially protein-encoding genes are seldom used as
markers for genetic fingerprinting.
......[2]
1 sequence of protein-encoding genes are conserved
2 due to its important biological function;
3 mutation rate lower than non-coding region
4 not able to differentiate between individuals;

(ii) Explain the use of genetic markers in genomic mapping in terms of linkage
mapping.
......[3]
1 Genetic markers are scattered throughout each of the chromosomes
2 used to determine the order/position of genes
3 Frequency with which two genetic markers are inherited together
4 is a measure of the closeness of the two loci on a chromosome

5 Recombination frequency / frequency of crossing over between 2 genetic markers


6 indicates the distance between two loci on a chromosome in map units /
centiMorgan;

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


412
7
(d) Another method to detect ADA-SCID is through the use of PCR. Fig 2.3 shows
the number of DNA molecules made using PCR, starting with one molecule.

Fig 2.3

(i) Explain three advantages of PCR.


.......[3]
1 Millions of copies of target DNA can be obtained in a relatively short amount of
time
2 Target DNA is doubled after every round of PCR / exponential increase / 2n

3 Easy to set up a PCR reaction and the use of a thermocycler / PCR machine
4 availability of computer software for primer design / commercial synthesis of
primers

5 Sensitivity of PCR
6 capable of amplifying sequences from minute amounts of target DNA

7 Specificity in amplifying only target sequences


8 as primers hydrogen-bond only to complementary sequences

9 A broad range of nucleic acid sources are suitable templates for PCR
amplification / Robustness
10 permit amplification of specific sequences from material in which the DNA is badly
degraded or embedded in a medium

11 Cell-free method of DNA replication


12 requires no cleanup of unwanted cellular debris or vector DNA

(ii) Suggest two reasons for the leveling off of the graph from cycles 17 to 20.
...[1]
1 Nucleotides are used up (hence is unable to make complementary chains)
2 Primers are used up
3 the template DNA strands anneal with each other instead of with the primer
4 Taq DNA polymerase gradually becomes denatured ref. no elongation

[Q2 Total: 14]


SAJC / H2 Biology 9648/3 JC2 Prelim 2013
413
8
3.
(a) Many varieties of rice, Oryza sativa, die quickly when totally submerged by flood
water during the monsoon season. Typically, submergence-intolerant plants respond
to submerged conditions by elongating rapidly.

In 2006, a gene, Sub1A, on rice chromosome 9 was found to be involved in tolerance


of prolonged submergence.

An allele, Sub1A-1, was found only in submergence-tolerant rice. Varieties that are
submergence-intolerant either have a second allele, Sub1A-2, or lack the gene
altogether.

(i) Sub1A-1 codes for a protein that controls the transcription of the gene for alcohol
dehydrogenase. This gene is activated when the plant is in anaerobic conditions.

Explain the importance to submerged rice plants of producing alcohol dehydrogenase.


..........[2]
1 Lack of oxygen in submerged conditions
2 leads to anaerobic respiration
3 Alcohol dehydrogenase catalyse conversion of ethanal to ethanol
/ regeneration of NAD+
/ hydrogen atoms from NADH donated to ethanol to form NAD+
4 allows for generation of ATP (by glycolysis)

Examiners comments
In plants (i.e. alcoholic fermentation), alcohol dehydrogenase enzyme catalyses the reduction of
ethanol/acetaldehyde to produce ethanol, with NAD+ being regenerated in the process. In animals,
alcohol dehydrogenase is used in the liver in an opposite reaction to breakdown ethanol..

A variety of submergence-intolerant rice, which lacked the gene Sub1A, was


genetically engineered to express Sub1A-1.

The mean heights of three types of rice plants were compared before and after 10
days of submergence in water. The types of rice plants were:

I : submergence-intolerant plants
I+ : submergence-intolerant plants genetically engineered to express Sub1A-1
T : submergence-tolerant plants

The results are shown in Fig. 3.1.

Fig. 3.1

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


414
9
(ii) With reference to Figure 3.1, compare the effect of submergence on the
elongation of the three types of rice plants.
.......[2]
1 All three plants elongate during submergence ;
2 ref. comparison of elongation of I, I+ and T plants
/ eg. Expression of Sub1-A1 in I+ and T resulted in reduced elongation ;

3 I 28 cm elongation / 2.4 times elongation


4 I+ 5 cm elongation / 1.5 times elongation
5 T 2 cm elongation / 1.08 times elongation

The allele Sub1A-1 could be introduced into high-yielding variety of submergence-


intolerant rice either by genetic engineering or by selective breeding.

(iii) Suggest two advantages of using genetic engineering, rather than selective
breeding, to introduce the allele.
..........[1]
1 More specific in transfer of allele conferring high yield
2 Does not dilute desirable traits of high yield variety
3 Genes from different species can be combined (to produce a transgenic
organism)
4 Shorter time required to see results compared to traditional selective breeding
which may take several generations

(b) Round-Up ReadyTM soybeans are genetically modified to be resistant towards


Round-UpTM herbicide, a glyphosate-based herbicide that normally inhibits an
important enzyme in the aromatic amino acid synthesis pathway in plants. This allows
farmers to freely apply Round-UpTM to destroy weeds without affecting the Round-Up
ReadyTM soybeans.

Round-Up ReadyTM soybeans may be produced by first transfecting soybean callus


cells with the resistance gene from Agrobacterium.

(i) To obtain a callus culture, suitable explants must first be chosen. Suggest a
suitable explant and explain your choice.
.......[1]
1 eg. apical or axillary buds / shoot tips / root tips
2 contain meristematic tissues which are (actively dividing, undifferentiated and)
disease-free

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


415
10
(ii) Explain three advantages of growing soyabean plants from tissue culture rather
than from seeds.
.......[3]
1 genetically identical
2 possess the desirable features of the stock plants

3 allows the rapid multiplication of plants


4 giving rise to bulk production of genetically identical plants

5 new plants are disease-free;


6 leading to higher yield / better quality

7 genetic modifications possible (with help of protoplast cultures)


8 desirable traits can be introduced

9 Take up little space when compared with plants growing in fields


10 can be grown intensively

11 Plantlets are light and small in size


12 can be air-freighted and transported easily/cheaply/in large quantities, increasing
international trade

13 Independent of climate changes so plants can be produced continuously/at any


time of year
14 flexibility in meeting consumer demand

15 possible to standardise the conditions for growth and obtain many batches of
identical plants
16 ensures product uniformity

(iii) Soyabean plants can reproduce sexually by means of seeds. Soyabean plants
grown from seeds are very variable in their yield. Explain why.
.......[2]
1 there is genetic variation due to

During gamete formation, there is


2 Crossing over
3 between non-sister chromatids of homologous chromosomes during prophase I
4 Independent assortment of homologous chromosomes

5 Seeds formed through random fusion of gametes

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


416
11
Genetically modifying soybean plants to be resistant towards Round-UpTM herbicide
might threaten the environment and human safety.

(iv) State one possible adverse effect on:

The environment
.........[]
1 Seeds from GM crops might be carried to other places and establish themselves
as weeds
2 Cross-pollination between the GM crops and their wild relatives may spread the
resistance to weeds
/ Emergence of vigorous weeds with herbicide-resistant genes

Examiners comments
Some candidates were confused between herbicide-resistant plants and pesticide-resistant plants.

Human safety
.........[]
1 Introduction of foreign gene(s) may result in production of secondary metabolites
which may be toxic to animals themselves and/or livestock/humans that consume
them.
2 New proteins in GM plants may be potentially allergenic to humans that consume
them.
3 Vectors used in introducing the herbicide resistant gene can contain genes for
antibiotic resistance which may pass from the plant to the E. coli in the gut when
the soybean is eaten, making the bacteria resistant to antibiotics

[Q3 Total: 12]

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


417
12
4. Planning question

The goshawk is an endangered species protected by the Convention of International


Trade in Endangered Species of Wild Fauna and Flora (CITES).

The Royal Society for the Protection of Birds (RSPB) has found a man in possession
of four young goshawks and an adult female. He claimed to have bred the young
birds using his adult female and a male bird borrowed from another keeper of these
birds of prey. The RSPB suspects that the young goshawks were poached from the
wild and not bred in captivity as claimed by the man.

Plan an investigation using DNA fingerprinting to verify if the young goshawks were
bred in captivity or poached from the wild.

[Total: 12]

You planning must be based on the assumption that you have been provided with the
following equipment and materials

tissue samples (feather tips) from the four young gohawks, the adult female
and the adult male under investigation
pestle and mortar
DNA extraction buffer solution
ice-cold ethanol
glass rods
microcentrifuge tubes
centrifuge
restriction enzyme
PCR reagents and equipment
agarose gel electrophoresis reagents and equipment
suitable source of electrical current
radioactive probe
nitrocellulose membrane
autoradiography equipment

Your plan should have a clear and helpful structure to include

an explanation of the theory to support your practical procedure

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


418
13
a description of the method used, including the scientific reasoning behind the
method
the type of data generated by the experiment
how the results will be analysed including how the origin of the organism can
be determined.
relevant risks and precautions taken

Theoretical consideration or rationale of the plan to justify the practical


procedure (1 mark)
1 RFLP refers to differences in the restriction sites on homologous chromosomes
that leads to different restriction fragment patterns.
2 DNA fingerprints makes use of polymorphisms that consist of repeated short
tandem repeats (STRs).

Method of DNA extraction including homogenization and use of buffers (2


marks)
1 Homogenise the feather tips of a goshawk by grinding using the pestle and
mortar in the presence of DNA extraction buffer solution.
2 Centrifuge homogenised mixture to separate DNA from the rest of the cell debris.
Use a micropipette to transfer the supernatant which contains the DNA into
another clean microcentrifuge tube
3 Add ice-cold ethanol to precipitate the DNA out of solution. Using the glass rod
to spool up the precipitated DNA and transfer it to a fresh microcentrifuge tube.
4 Resuspend the DNA with restriction enzyme buffer.
5 Repeat steps the preparation of DNA from the other goshawk tissue samples
and. ensure that the same mass of tissue is used to ensure an equivalent amount
of DNA can be produced for analysis.

Selection of restriction enzyme and reason for the selection (1 mark)


1 Add 5 l of EcoRI to sample. Incubate enzyme with DNA samples for 2 hours at
37C.
2 EcoRI will cleave the DNA segments at different sites, generating different sized
fragments for different individual goshawks.

Amplification of DNA fragment using PCR including detail of PCR (2 marks)


1 The DNA is added in a PCR tube with Taq polymerase, free deoxyribonucleotides
and primers designed to flank the DNA sequence to be amplified.
2 The mixture is heated to 95C to break the hydrogen bonds so that the double-
stranded DNA separates into single strands.
3 The mixture is then cooled to 55C to enable the annealing of DNA primers to
complementary sequences flanking the target sequence to be amplified
4 The mixture is heated to 72C for Taq polymerase to catalyse the synthesis of a
complementary strand of DNA for each of the single strands of the target DNA.
5 PCR is needed to generate sufficient DNA for genetic fingerprinting or analysis
/ Repeat cycles for 30 times. The amount of DNA produced will double each
time, resulting in amplification of target DNA sequence.

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


419
14
Separation of fragments by agarose gel electrophoresis and the principles
behind the separation (2 marks)
1 Prepare agarose gel cast and set up electrophoresis chamber.
2 Add 5 l loading dye to DNA samples. Spin the samples down using centrifuge.
3 Load 10 ul of DNA ladder into the first slot. Load 10 ul of individual DNA samples
into the subsequent slots.
4 Conduct gel electrophoresis at 100V till tracking dye move to length of gel.
5 DNA is negatively-charged and will migrate to the positive electrode. Smaller
fragments move through the gel faster than larger fragments.

Transfer of DNA onto nitrocellulose membrane (3 marks)


1 The gel is treated with sodium hydroxide to cause the double-stranded DNA to
denature, separating it into single strands. Denaturation is necessary so that the
DNA will stick to the membrane and be hybridized by the single stranded DNA
probe.
2 A sheet of nitrocellulose membrane is placed on top of the gel. Pressure is
applied evenly to the gel by placing a stack of paper towels and a weight on top of
the membrane and gel. This causes the DNA to move from the gel onto the
nitrocellulose membrane by capillary action, where it sticks.
3 The membrane is then baked to permanently crosslink the DNA to the membrane.

Hybridisation with radioactive labeled DNA probe


4 The membrane is treated with a single-stranded radioactive hybridization probe
which is complementary to the target STR sequence.

Autoradiography method and method of band visualization


5 After hybridization, excess probe is washed from the membrane
6 The pattern of hybridization is visualized on X-ray film by autoradiography.

Significance of matching bands and proposed method of result feedback to


RSPB (1 mark)
1 If the young goshawks are bred in captivity, all bands in the offspring can be
assigned as coming from either the mother or the father.
2 If the young goshawks are poached from the wild, there will be unassigned bands.
3 Autoradiograph diagram

DNA Male Female Young Young Young Young


ladder goshawk goshawk goshawk 1 goshawk 1 goshawk 3 goshawk 4

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


420
15
Risks and safety measures (1 mark)
1 Radioactive probe is carcinogenic. Use isolated area for radioactive probe
hybridisation, work behind a radioactive shield and use latex gloves when
handling samples.
2 To prevent electrical shock, ensure hands are dry before using the electrical
appliance such as the electrical power supply of agarose gel electrophoresis.
Clean all spillage before running the gel to ensure all surfaces near the
electrophoresis gel chamber are dry.

Control (1 mark)
1 Extract DNA from random gohawks and conduct the same DNA fingerprinting
experiment. Unrelated gohawks should have unassigned bands compared to the
male and female parents.
2 Otherwise, new probes for other regions of the genome should be designed to
differentiate between individuals.

Reliability ( mark)
1 ref. At least 3 replicates and at least 3 repeats

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


421
16
1 Free-response question

Write your answer to this question on the separate answer paper provided.

Your answer:

should be illustrated by large, clearly labeled diagrams, where appropriate;


must be in continuous prose, where appropriate;
must be set out in sections (a), (b) etc., as indicated in the question.

5 (a) Compare the properties, features and functions of zygotic and


embryonic stem cells. [5]

(b) Using one named example of an adult stem cell, describe its normal
role and how it could be used in gene therapy against SCID using a
retrovirus. [8]

(c) Discuss the social and ethical considerations for the use of gene
therapy. [7]

[Total: 20]

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


422
17
(a) Compare the properties, features and functions of zygotic and embryonic
stem cells. [5]

Similarities (max 1)
1 Self-renewal ability / divide continuously by mitosis to produce new stem cells
2 Unspecialized / do not have cell-specific structures to carry out specific functions
3 Undifferentiated

Differences
Zygotic stem cells Embryonic stem cells
Isolated from morula / zygote; Isolated from inner cell mass of
blastocyst;

Totipotent, pluripotent and multipotent; Pluripotent, not totipotent but are


multipotent;

able to differentiate into any cell type to able to differentiate into almost any cell
form any organ or type of cells, type to form any organ or type of cells,
including extra-embryonic membranes; except those of the extra-embryonic
membranes;

ability to differentiate into any cell type to give rise to various organs in organism /
form whole organisms; multiple specialized cell types that make
up the heart, lung, skin and other tissues
in the developing foetus

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


423
18
(b) Using one named example of an adult stem cell, describe its normal role
and how it could be used in gene therapy against SCID using a retrovirus. [8]

1 Named example: blood stem cells;


2 Differentiate into cells of the same lineage;
3 E.g. red blood cells, white blood cells and platelets;
4 Replace cells worn out from normal wear and tear;

5 (blood stem cells) isolated from bone marrow (of patient);


6 No cell rejection;
7 Cultured in vitro first to increase numbers;

8 Attenuate retroviral vector by removing viral genes that cause harm (eg. lysis);
9 mRNA of target gene inserted in vector;
10 ref. ADA gene / IL2RG gene;

11 Recombinant vector allowed to infect cultured blood stem cells;


12 Viral genome is reverse transcribed;
13 and resulting cDNA is then integrated into host cell DNA;
14 can be stably propagated by chromosomal replication following cell division

15 Selection of transformed blood stem cells on selection plates;


16 Transformed blood stem cells grown in culture to increase number of cells
[e.c.f from pt 7]
17 Transgenic blood stem cells grown reimplanted/injected into patient;

18 ref. normal functional protein product, thereby restoring the correct function of the
target cells and altering the phenotype
19 functional T and B lymphocytes in the patient;
20 to fight off infections / development of functional immune system;

(c) Discuss the social and ethical considerations for the use of gene therapy.[7]

Benefit of gene therapy


1 Potential for tremendous patient benefit
2 Germline therapy can eradicate disease from subsequent generation and
prevent transmission of serious genetic diseases from parent to offspring

Interfere with evolution


3 elimination of unwanted alleles from the gene pool will decrease genetic
variation
4 genes that are damaging under some conditions may be advantageous under
other conditions
/ germ-line gene therapy would forever change the genetic makeup of an
individuals descendants / the human gene pool would be permanently affected
/ detrimental to the survival of our species in future

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


424
19
Safety
5 question of safety and efficiency of treatment and therefore unknown long term
consequences to the well-being of the recipients.
6 raises questions over who should participate in a human trial the terminally ill
with no treatment options or anyone who understands the potential risk but is a
willing patient

Cost
7 gene therapy is currently very expensive, require expertise and equipment found
only in major medical centres, concerns about gene therapy become a luxury
available only to the rich and powerful.
8 possible genetic enhancements creating an advantage for those who can
afford the treatment

Eugenics social policies


9 type of circumstances that determines whether genomes should be altered
/ what is normal or a disability or disorder, and who decides
/ potential for non-therapeutic enhancement possibilities / eugenic social
policies
10 concerns about the widespread use of gene therapy making society less
accepting of people who have mild disorders / genetic diseases or less able
/ lead to new definitions of normal (e.g. intellect / height / strength etc.)

Privacy
11 concerns about the protection of privacy and confidentiality of medical
information of patients involved in clinical trials
12 which may have implications on (medical) insurance coverage / employability

Interfering with life


13 opposition to gene therapy based on religious grounds, believing that altering
genetic material is against Gods will
14 the unborn child who would be affected by germline gene therapy cannot
choose whether to have the treatment

SAJC / H2 Biology 9648/3 JC2 Prelim 2013


425
HWA CH HONG INST TITUTION
JC2 Preliminary Examinatio
ons
Higher 2

CANDIDA
ATE
CT
C GROUP
P 12S7___
__
NAME

CENTRE INDEX
R
NUMBER NUMBER
N

BIOLOG
GY 9648/01
Paper 1 M
Multiple Cho
oice 27 Septe
ember 2013
3
Additional Materials: Optical Marrk Sheet 1 hour 15
1 minutes
s

CTIONS TO CANDIDAT
INSTRUC TES

1. Writee your nam me, CT grou up, Centre number an


nd index number in t he spaces provided att
the ttop of this cover
c page.
2. Fill iin your parrticulars on the Optica heet. Write your NRIC
al Mark Sh C number and shade
e
acco ordingly.
3. Therre are forty
y questions in this pap ons. For ea ch question
per. Answerr all questio n, there are
e
four possible an
nswers, A, B,
B C and D..
Chooose the onee you consider correctt and record
d your choic
ce in soft p
pencil on th
he separate
e
Opticcal Mark Sh
heet.
4. he end of the paper, yo
At th ou are to sub
bmit only th
he Optical Mark
M Sheet .

ATION FOR
INFORMA R CANDIDA
ATES

Each corre
ect answer will