Sie sind auf Seite 1von 6

Lamya Raisya Hanindiyya INTP D24150083

Bos taurus breed Hereford chromosome 23, Bos_taurus_UMD_3.1.1, whole genome shotgun sequence

NCBI Reference Sequence: AC_000180.1

GenBank Graphics

>AC_000180.1:c35113750-35105135 Bos taurus breed Hereford chromosome 23,


Bos_taurus_UMD_3.1.1, whole genome shotgun sequence

AGCCATAGGACGAGAGCTTCCTGGTGAAGTGTGTTTCTTGAAATCATCACCACCATGGACAGCAAAGGTT

CGTCGCAGAAAGGTATGTACAGCAGCTTGTGGAGTTGTTGGGTTTTATCCATGTTCCAATGGGGGCATTA

ATTTGAAATTTGAGGAAATATTCTCTTAGGTTTCAGGATTACAGAGTTTAGAAGAACTAGCTAATCCTGC

TCTAGAAATCAATTGTATAGGGGCACAATAGGACAGTGGTTCTTGAATGGAGGACTGTCTTCCAGAGACA

TTTGGTTAATGTCTGGAGATGGTTTTGGTTGTCTTAATATGGGGCAGGGGTGCAACTGGTGCCCAGGGGG

TAGAGAACAGAGATATTGCTAAGCATACTACAATGCACAAGTTAGCCCCCAGAACAAGTACTTATCCAGC

TCAGGGTGCCAATCATGTCAAAGTTGAGAAAACTTAGACTGGAATAAGACCAAAAATGTCTCTGAGTCCA

ATTCATCACAACTCCAGAAGGTAGAAACAAACATTTTCTAGTTACCAAGATTCTTATGTGGTGTGGCTAA

GATGAGTCAGTCTGATGAAACTTTTAACTCTGAAGCTATAATACAGACAGTGACAGCAGAGTAGTCTCCT

ACAATACTTTGTTGACTGGGTTTAATCCAAATGATATCTTAGAAGAAAACACAGGCTAGTAACAATAATC

GCCTTTACTTGCTTGGTTGACATTCGCTAGAAAAAGAAATTGCAGATAACTAATGAGAACTTACTGTATA

GCAAGGACAAATCTACTCAGTGCTCTCTGGTGACCTAACTGGGAAGGAAATCCAAAAAAGAGGGTATATA

TGTATACATACAGCTAATTCACTTTGCTATACAGCAGAAACTAGCATAATATTCTAAAGCAAGTATATTC

CGATAAAAATTAATTTAACAAAAGAAATTATAAGGCAAAGACAATTACAAAATTTATCTTATGAAACAAC

AAAAACATTTCTTTTTTATCTCATCTTAGGCTGTGGAAAAAAGTCCTTCAGATGATAAAGGTTCAGATAA

ATGTAGTCAGAGTTAAAGAATATCTATCCAGTTATGAATTTCCTAGAACCAATATTCCAATTTCTCTATC

TGTAAAGTACTTTATATTTATACTTGTAGATAAAACAGTTAATCAGCTGTGTTACATGACTGTAAAGTAC

CTAAAATAATCTCTTTGGAAATATGCCTTTGAAAAATTAAAAGACTGTTATATGAATTATCTCACAATAT

TGATATTTTTATTTTGCAACTAAAAGGTTGTTCATTCTATACTACATTCTATACTAAATAGTCTTTTAGA

TATTTTCAGGTGTTGAAGGTTAGGTATTTTTTCACCCTAAATCTTTAGCCCTTGCCTCGTTTTGTCTTGG
ACACTTTCCAATTACATTTATTCAAGATTCCAGACGAAAGGAGTTTTTTGGTAAACACATTTCTACATTC

TTTATTTTATTTGGAGCAATTTGAACTTAAACATGATTTAAATCATTGCCTTTTTCCTTTTGAAAGTGTA

AGTTATTGATATGTTAGTGGTTCATATCAGTCCATCTGCTGAGATAGTAAATCGGTGACTACATTGTCTC

TGCTAATTGTAAAGGACTTTAAAAATGAATGTTTTATAGACAGAGCAGAATGAGTGGATAAAATCGTCTT

TCTAGGGTCACTGCTGTCATGCAAAGACAAAATATTTTTCTCTACTAGTAACGGCAATGATCGCCCCAAG

CACGGGTCATCACAGCTACTGATGGGGTCCCTGTTACACACATGCAACCCAAGAGCCCAACTGCCTGTGT

GTTGTGACATGAGGAAGTGAAAAGATGACAGTGTGGTCCCCAGTCATCTCCATCTGCTAATCATGGGACT

TGGGGGAAAATCACTTGCCCTAAGTCACTGTTTATTAATAAAATCTGATGATAATAATGGAGATCACTGG

AGAGAGCCCTGATGCTGCGAAAGATTGAAGGCAATACAAGAAGTGGGCGGGAGAGGATGAGATGGTTAAA

TAGCATCACTGACTTAACAGACATAAATTTGAGCAAACTCCAGGATATAATGAATGAAGGGGAGCCTAGA

ATGCTGCAGTCTATGGGGTGACAAAGAGACTGAACTTAGTTATGCACAACAATAATACAGTGAAGGCCAA

GGCTATCTCAGAGGATTATCATGAAACACAAATTTTACACATTTTTAAAAGCTTTTAGCAAAGTATCAAG

GAAATGGATGGGGTTAGCAGATCCAAGATGCAGTATCCTTTTTCTCTTAGAATTCTCTTTGTGTTCAATA

ATAGGGTTCAGGAAGTCATGTGTTTCTTCTTACCCACCATGATGGTAAACCACACAAATCAACTGTGCTG

TTCTTGCCATTTCAGTGTCTAAAATGCAAGCATGAGTCAGTAACAGTGAAAAAATGACAAACTCCTACAA

GCTGCTGAGAATCTGCAGAGAATCCCAAGACATTAGACTATCGTAGGAGAATGACCTAAACACGCTGACT

CACATTAATTTAAATTCCAAGTGTTTGCAGAACACAGGAGCACTTCTGGGAGCAATACAAAAATGCATGG

GGTAACCTACTTCTGCAACTATATATCTGTGCAAATATCATCATCCATCTAAATTTACACAGTGGAAGGT

GTTGCTTCTTCCCCACCCCAGCTGCTACAGCACCAAATCCTGCTCAGGGCAACGGGGAGAGATGAGGCCT

CCCTGGACAGGATGGCTTTTGCTAACCTTGGGCTAATACATCATCTTAGAGCGGCTCATGTTTTTATTTA

AGCAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCCACC

CCCGTCTGTCCCAATGGGCCTGGCAACTGCCAGGTATCCCTTCGAGACCTGTTTGACCGGGCAGTCATGG

TGTCCCACTACATCCATGACCTCTCCTCGGAAATGTTCAACGAATTTGTAAGTACTGTATTTCTTGCTTA

TTTCCAGAAGAAACCTTTGCGTAAGTGACTGGGCTATACTATCCTTTAAACAAGAAGGCTGCATCAGCCA

AACTTCAAAGAACACACTTTCTAGGTCAAATAAGACATTAGCTCATAAGATGTGGTAACTGAAGAAAAGA
TGTTTCATGAAATCTCCAGGATTCTTAAGCAGTGACATACCTGTTTCAATTTGCTTTTATTTGTTAAATT

TCCAAAATAAATTTAAAGCACCTGTATTTGTCAGCTTGGACTCTCATAGCAGAATACCATAGACTCAGTG

GATTAAACAACAGAACTTTATTTCCTTGCACTTCTGGGGGCTGGAGGTCCCCGATCAGAGTGCCAGCAAG

GTCAGTTTCTGGTAAGGGCTCTGTCTACCCAGGTTGGCTTCTCCCTGTGTCCATGCAGGGTTGGGGGCAG

GGAAGAGAAACAGAGGAAAGGCACAGAGACAAAAGAGAAAACTCTCCAGTGTTTCTCTTCATAAAGACTC

TAACATTTTGGATCAGTGTTCCACCCTACGAGCTCATTTAACTTTAATTAATCCTCATAATCTTCTGGGC

TTCCCTTGTGGCTCAGCTGGTAAAGAATCCACCTGCAATGTGGGAGATCTGGGTTCAATCCCTGGGTTGG

GAAGATCCCCTGGATAAGGGAAAGGCTACCCACTCCAGTATTCTGGCCTGGAGAATTCCATGAGTGGGAC

ACAAATGAGTGATTTTCACTTTTATTGTCAATCTTCATAAGGGCTTCCTAGGTGGTGCTCGTGGGGAAGA

ACCCTCCTGCCAATGCAGGAGACATAAAAAATGCAGGTGCAATCCCTGGGTCAGGAAGATGCCCTGGAGG

AGGGCATGACAACCCATTCCAGTATTCTTGCCTGGAGAATCTCCATGGACAGAGGAGCCTAGAGGGCTAT

AGTCCACAGGGTTGCAAATAGCGGTGCACAACTGAAGCGACGTAGCTTGCACACAGTCTTCATAAAGACC

CTTCTCCAAACACAGTACTTCGGAGATTTTTGCTTCAACACATGAATTTGGGGGAGAAGGAAATGGCAAC

CCACTCCAGTGTTCTTGCCTGGAGAATCCCAGGGACTGGGGAGCCTGGTGGGCTGCCGTCTATGGGGTCG

CACAGAGTCGGACACGACTGAAGTGACTTAGCAGCAGCAGCAGCATTCAGTTCATAGCAGTACCTGACAA

AAAGCACTCTTAGGTGGGGCTGGGAAAAAGAAGCATCTTGATTTTCTGGTCCTTCAGTGTCCCTCTGGGC

ATTCTTCACCCAGCACACAGTAAATAGCCAATAAATGGGAACTGCACTTCAGTGAACTGGGTGGATGGAA

CACATTAGACAGAGCTGAATTCCTGTAATGAAAACAAATAATGATAGTTTTTTAAATGCTACAAATTACT

GTTCTAAGATGTGCAATATATGGGTTTATAACTACAATAGAATGCTTGGTTTATAATTGGAAACAAAATT

ATTCTCTTTCTGATGAAATTACTTTTAAAGTTGTATACTCTTTTATGTCAATCAAGGAGCCCATAGTAGA

GCAGAAAACTGATAAAAAATGGTGCTCAAAGTTTCTATTAAATTCATATAGTTCTTTTTATTCACTAGTT

TTCCTTTCATCTTCCATTTTTGACTGTCATCTTTTTTCCAGATCTTCGAAGTAATCTCTTTAAATGCTCA

CAACTTTTGCTAAAGATAAGGTTTTCTTTATCAACATGTTAGCTAGTTATTTCGACTCTCCTTCTCAGTC

CATTGCTTACTATTTTCAAAAATTTTATGCCATGTTTTTCTGACTTACCACTTTCTCATCATCAACAATG

CTGTATTCTGCATCTGTGAAGCATACTAAGCTATAGGTTTGTGGATTCAGATTAGTCAAAGAAAAGTTAT
AATTATATATCTTCTTTTAAGGGAGTACATTGGTTCCAACCCAAAGTAAACAAGAGATTAAATGTCTACA

TAGGTATCATACATATGCACTATATTTGGTTCAAATACTAAAAATAGATGATACTTAATAAAGCAGTTAA

TATTTCATATTTGGGTTATTTTTAGTGTTTGCTATCCAAATAGTAACTATGGGAAGGATGAAATGAAACA

AGGGAAAAAAAAAGAAGGAAAGAGGTTGGAATTTAGATGACAAGCAACTGTTTTCAGAGATAATAGAAAG

TAAAAGTAGGAAAAAGAATTACTTTCAATTTTTATGTGACCCTCATTAAAAAAAATTATTCATCTATCAA

ACGTGTTAATATTCTGCTAAAGGTTCATTTATTGAATGCCCAAACAACCCTAACGAATTGAATTTGCTTG

ATTGCTTCCAGGATAAACGGTATGCCCAGGGCAAAGGGTTCATTACCATGGCCCTCAACAGCTGCCATAC

CTCCTCCCTTCCTACCCCTGAAGATAAAGAACAAGCCCAACAGACCCACGTGAGTCTTTTATCCGGGTTT

TCACCAGAACAAGTGAGACAGTGCACTGGTGTCACCAGGCTTCAGGTTATTAGAGGTCATGGTAACTGGA

CATGCAGAGAAAGGTGGAGAAACATTATGCATTATGCAGTTGCATTATGCAGTTGATGAAATATGAGTAA

AATCAAGGGATGACTATAAAGATCTGTAGCAGCAAAATAAATAACAGATCTATGAATTGTCCATGTGGAC

AACATAAGTTCAACCAATGCATTAGATCCAAGGTTGCAGCCATTATACTGTATGAAAACATGAAATAAAT

GGAATGTCCATGTTTAAAATATAGATTTAAAAAATTCATGGATATGTAAGAAACACAACCCCAGTTTTGA

GTATTCCCTGTACTAGTGACTCCTACATGGGAGTCACTTCTACACTGCACTACTTAAGCCACCAATTCTG

CCTTTCAAGGCTCACCTGAGTCTTCTACTTCTCTGACACCTACCTCATTCTTGACTGACTCCTCTAACAC

CTCTTATTTTTAATTATAAATCTCCCTCCAAAATGGGTCCTAAAAAATATTATGTTTTGCTTCTCATGGT

TGTGATGATTGCCTTTGTTCTGATGACCACATGTCTACCGATAAGCCTCAATCATGTATCCCAGATCCAA

ATTTTTATCATTATAATCGCTCCTTCCTCATTCCCTGAACTAGGCACAGCGCTAACATTATTTAAAATAT

TTCCACATGCACCTCCCCTTAAGTACAATCTGTTCTCTTGCTTCAGCTTTGTTAGTGATACCAGGATTTT

TTTCATCTGCTAATCTTCTTAATAAGGAGGATGATAAAATGAAGGAAGAAGGTCAAGAAGAAAAAGGAGG

ACTTTTAAAATAAGTTTAAAATAAATTTAAAATTTATTGAGAGCTATTACCTTGCCATACAATTTACAAA

GTACTTTGTTTTCATTACTATGTTTAATCCTCATGAAAATTCCTGTAGCACAATGACCGTTATTACACTT

CCTGTAATATGGAAACCAAGACTCAGAAAAATTGTGGAATTTGTACCAGTCACATAGGTAGTAAGCAGTG

ATTCTGGGTTTCTTCCAATCAGAGCTCTCACTCTTCCTCTTTAAGCTACAACGCCCCCAGGAAAACCATG

CTGCCACTCACCCTAGAGTCTGAATTTCATTTCAGCTCCCTTACTCTCACATCCCATCATGTTTCTATTG
CAATGTCTGTTTGATTCTTCTCTGCTGTTCATTTCCTGTACCATTAAAGTAGTTCATGGCCATCAAGAAA

TCAAGAATTTTAATCAGAGATGCTCAGCCCCTGGGAGCATGTCCAGTCCTGATAGTAGTGAACTAGGGGG

CAAAACCCTCCATGGGGAATCCCACTAATGCTCTTAATAAAGACAACACTGTGCCATTTTCTGCCCAGAC

ACATGTCAACAAAATAGACTGCTCTGATATCAGCTTGGGGGCTGATGTTGGGATGGACTGAGGAAAGTGT

GGTTAGGAATGTCATATCTTCTTTACTGCCTCTTTGTTCTAATATCATAAAAGGAACTACCACTCAAAAA

CTAAAAATACATGAATGAATACATCGATTCATTAATATGAATGAATCACTGGGTGAAAATGAGTTGGGCA

CTGGTGGAGTCCTTCTTTCCTGGGTCAGGTACTCCAGGCACATACTGAGTTCCAACAAAATACTTAGATT

TCTCTCCCCAGACAAGCAAAGCATTCAAATATAAAAGAACTCACTCAGTGGATGGCAGAATTTCAGAGGG

AAAAAGAAAATTCTTTATGTTATAAATTAGAACTCATCAGAAACATTGGTTACTAAAATAAGCCAGATTT

TTAAGTATTTCAGCAAAGTATAAACCGATAGCTTACATTTTATAATTTTGCAACCTTCAAAAAATTTTCA

ATACATATAGGAAAAACCAGGAGTTTTTTAGGTCAATCACTCTGAGCAAAAATCACATGTTACCAAATCC

ACTGAATTATGCTTATTTTAATGAGATTGTTTCTTGTGGTTGTTCAGCATGAAGTCCTTATGAGCTTGAT

TCTTGGGTTGCTGCGCTCCTGGAATGACCCTCTCTATCACCTAGTCACCGAGGTGCGGGGTATGAAAGGA

GCCCCAGATGCTATCCTATCGAGGGCCATAGAGATTGAGGAAGAAAACAAACGACTTCTGGAAGGCATGG

AGATGATATTTGGCCAGGTGAGCAGCTTCATGAAAGCTTCCTTGCTATTTTCATGAATGAGAGAGGTGAT

TTCTGTAATGAGGAATGAGTTTTGAACTATCTCACTGTACAAGAACACAATTCAGGCCTTCTTTTTCTAG

ACCGGTGTTACATAAAGCAAGAACCTGTTCATTCATAGTGATAGATTCTATTGTAAGTGAATTAGAATTC

CACAGCAATTTTTCACAGGTATAGTCTTTCTTGAATTGTACAGTTACACCAAAATCTTGCCTCTTCCTGG

GTACAGATGGCTGAAATATTTTCAAGGATAAGAGAATTAGAGAATACAATTTGCAAGATAAATGTTTTCT

TCAAAATATCCCAAGATATCCTCTACTGAAATTCAGCTTGTATTCTTTCTCTATTCTCCTCAAACCACAG

GATGAGAATGAGAAGAAAGAAAAGAGAAGATCAAAACCAAATACTTGAGTTCTGCTTTAGTTTTTATTAA

TAAATTACTAACATATATCTGATACACTGGCTCCAAAATCCAAGTGTAGAGACTTTCATGTATCTTCCCT

AATTTTTAATTTGATAAATAGAAAGAACAAAGATGAGCTAATACTACTAAAACTCATAATAACTCATTAT

CTTTTGGATGTTTAGGTTATTCCTGGAGCCAAAGAGACTGAGCCCTACCCTGTGTGGTCAGGACTCCCGT

CCCTGCAAACTAAGGATGAAGATGCACGTTATTCTGCTTTTTATAACCTGCTCCACTGCCTGCGCAGGGA
TTCAAGCAAGATTGACACTTACCTTAAGCTCCTGAATTGCAGAATCATCTACAACAACAACTGCTAAGCC

CACATTCATCCTATCCATTTCTGAGATGGTTCTTAATGATCCATTCCCTGGCAAACTTCTCTGAGCTTTA

TAGCTTTGTAATGCATGCTTGGCTCTAATGGGTTTCATCTTAAATAAAAACAGACTCTGTAGCGATGTCA

AAATCT