International Journal of Food Microbiology 142 (2010) 190197

Contents lists available at ScienceDirect

International Journal of Food Microbiology

j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o

-Polyglutamic acid (-PGA) produced by Bacillus amyloliquefaciens C06 promoting

its colonization on fruit surface
Jun Liu a,b, Dan He a, Xiu-zhen Li b, Shengfeng Gao a, Huijun Wu a, Wenzhe Liu b,
Xuewen Gao a,, Ting Zhou b,
a
Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University, Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects,
Ministry of Agriculture, Nanjing 210095, People's Republic of China
b
Guelph Food Research Centre, Agriculture and Agri-Food Canada, 93 Stone Road West, Guelph, Ontario, Canada N1G 5C9

a r t i c l e i n f o a b s t r a c t

Article history: Bacillus amyloliquefaciens C06, an effective biological agent in controlling brown rot of stone fruit caused by
Received 17 April 2010 Monilinia fructicola, was also found to produce extra-cellular mucilage and form mucoid colonies on semi-
Received in revised form 17 June 2010 solid surfaces. This study aimed to characterize the extra-cellular mucilage produced by B. amyloliquefaciens
Accepted 26 June 2010
C06 using transposon mutagenesis and biochemical and physical analyses. The mucilage production in
B. amyloliquefaciens C06 was demonstrated to be associated with ywsC gene expression and characterized to
Keywords:
be of high molecular weight, consisted of only glutamic acid and linked with non-peptide bonds, thus
Bacillus amyloliquefaciens C06
-Polyglutamic acid (PGA)
identied as -polyglutamic acid (-PGA). Compared with wild type B. amyloliquefaciens C06, its mutants
Surface colonization decient in producing -PGA, e.g. M106 and C06ywsC showed less efciency in biolm formation, surface
Biolm adhesion and swarming ability. It was also demonstrated that -PGA was not essential for C06 to form colony
Surface adhesion on semi-solid surfaces, but was able to improve its colony structure. In vivo evaluation showed that
Swarming motility disruption of -PGA production in C06ywsC impaired its efciency of colonizing apple surfaces.
2010 Elsevier B.V. All rights reserved.

1. Introduction Bacillus amyloliquefaciens C06, isolated from a mesophilic cheese

Colonizing plant surface effectively and maintaining a mass of cells
sufciently have been demonstrated to be prerequisites for plant
growth promotion rhizobacteria (PGPR) to initiate benecial interac-
tions with host plants (Chin-A-Woeng et al., 2000). Several unique
properties of wild type Bacillus strains have been evolved to ac-
commodate themselves to the environments. (1) Bacillus strains have
the ability to attach to solidliquid interfaces, which was found to be
associated with the surface characteristics of Bacillus strains (Dwyer
et al., 2004; Husmark and Ronner, 1990; Peng et al., 2001) and was
considered to be the key factor of successfully colonizing the fruit and
plant root surfaces. (2) Wild type Bacillus strains are able to transfer
themselves from one niche to another by swarming and swimming
motilities, to gain more surviving opportunities (Kearns and Losick,
2003). (3) Wild type Bacillus strains could form sessile, multi-cellular
communities named biolms or pellicles to ght against the adverse
environments and the highly organized structures were bonded
together by the extra-cellular matrix including polysaccharides, pro-
teins, and nucleic acids.
Corresponding authors. Gao is to be contacted at Tel./fax: + 86 25 84395268. Zhou,
Tel.: + 1 519 780 8036; fax: + 1 519 829 2600.
E-mail addresses: gaoxw@njau.edu.cn (X. Gao), ting.zhou@agr.gc.ca (T. Zhou).
starter, showed potential application in biological preservation of
post-harvest fruit (Zhou et al., 2008). When applied with either
bacterial cells or cell-free ltrate, strain C06 effectively controlled
brown rot in peach caused by Monilinia fructicola. In the present work,
the strain C06 was also found to be able to produce extra-cellular
mucilage and form mucoid colony on semi-solid surfaces. The mucoid
property involved in increasing activity in biolm formation on
mycorrhizal and nonmycorrhizal carrot roots (Bianciotto et al., 2001),
and the abilities of Bacillus strains e.g. surface adhesion, swarming
motilities are inuenced by their extra-cellular compound composi-
tion as well. Thus, we assumed that the mucilage produced by C06,
modifying the composition of its extra-cellular substances, may
consequently improve the efciency of C06 colonizing fruit surface.
In this study, to characterize the mucilage produced by C06, a
transposon mutagenesis library of B. amyloliquefaciens C06 was
constructed and ywsC was found to be responsible for the mucilage
synthesis. Biochemical and physical analyses demonstrated that the
mucilage production in B. amyloliquefaciens C06 was associated with
ywsC gene expression and the mucilage was of high molecular weight,
consisted of only glutamic acid and linked with non-peptide linkages,
thus conrmed to be -polyglutamic acid (-PGA). Disruption of
-PGA production in B. amyloliquefaciens C06 impaired its abilities to
form biolms, adhere to airliquid surface and transfer by swarming
motility. In vivo evaluation using apples showed disruption of -PGA
production in M106 impaired its efciency of colonizing apple surface.

0168-1605/$ see front matter 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.ijfoodmicro.2010.06.023
 J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190197 191

2. Materials and methods Table 2

Oligo DNA primers used in this study.

2.1. Bacterial strains, plasmids, and media Name Sequencea (5-3)a

oIPCR1 GCTTGTAAATTCTATCATAATTG
The Bacillus and E. coli strains used in this study are described in oIPCR2 AGGGAATCATTTGAAGGTTGG
Table 1. E. coli DH5 was used as the host for all plasmids. The various oIPCR3 GCATTTAATACTAGCGACGCC
plasmids and strains constructed or used in this study are also ywsC-pMar-1 GGGGTACCGCAAGGGAAGCGTTATCAGGAA(Kpn I)
ywsC-pMar-2R AACTGCAGAAAGGCGGGCTACAAAACAGTCGG (Pst I)
described in Table 1. LuriaBertani medium (LB) (Bertani, 1951) was
ywsC-3 S GTCAACCGTAACGAGGCTGA
used for the growth of E. coli and Bacillus strains. The pathogenic fungi epsA-pMar-1 GGGGTACCAAACCGATTCAGAGATCATAACCAT(Kpn I)
were maintained on potato dextrose agar (PDA) (Hitchins et al., 1998) epsA-pMar-2R AACTGCAGAATACACAACCCCTAAAACAGGCAAGT(Pst I)
plates. Pellicle and biolm formation ability was assessed on MSgg epsA-3 S TTCATAGACCGTGTCTGCTGA
medium (Mascher et al., 2007). When required, antibiotics were tasA-pMar-1 GGGGTACCCTGATGGCTTTGAATTTTACTGACT(Kpn I)
tasA-pMar-2R AACTGCAGAATCGCATTGCCTTGGAACTTGTTTTG(Pst I)
added to the growth medium to the nal concentrations: ampicillin at
tasA-3 S GAGAATTGAAGAGAAATCGC
100 g/ml, kanamycin at 5 g/ml and erythromycin at 10 g/ml. sinI-pMar-1 GGGGTACCATTTACGGTATGACTTCTGGCTG(Kpn I)
sinI-pMar-2R AACTGCAGAATCACAATTAGATAAGGAATGGGT(Pst I)
sinI-3 S ATGAAAAATGCAAAAAATGGA
2.2. Transformation, DNA manipulation and transposon mutagenesis of EM-pMar GGTCTATTTCAATGGCAGTTACGA
B. amyloliquefaciens C06 BOX-A1R CTACGGCAAGGCGACGCTGACTGA
a
Restriction sites in primers are underlined.
The isolation and manipulation of recombinant DNA were
performed using standard techniques. E. coli and B. amyloliquefaciens
were transformed as described by Sambrook et al. (Sambrook and
erythromycin and incubated at 50 C overnight. Selected colonies were
Russell, 2001) and Spizizen (Spizizen, 1958), respectively. Transposon
subjected to PCR test by using the ywsC-pMar-3 S and EM-pMar to
mutagenesis library was constructed using pMarA and pMarC, and
conrm the insertion of pMar-ywsC into C06 chromosomal. In the same
southern blot was used to analyze the insertion copies of pMarA
way, C06epsA, C06tasA and C06sinI were constructed.
plasmids into the selected transposon mutants of C06 as described
previously (Le Breton et al., 2006). All enzymes used in this study
were purchased from TaKaRa Bio Inc. (Dalian, China). The specic
2.4. Characterization of the extra-cellular mucilage produced by
primers used for the PCR are listed in Table 2.
B. amyloliquefaciens C06

2.3. Generation of B. amyloliquefaciens C06 mutants 2.4.1. Molecular weight determination

Take the procedure of constructing C06ywsC as an example. To
construct plasmid pMar-ywsC used for disrupting ywsC operon in
B. amyloliquefaciens C06, a 390 bp DNA fragment of ywsC gene was
amplied by using ywsC-pMar primers incorporated kpn I and pst I
endonuclease target sequences respectively. The amplied fragment
was cloned into pMarC in place of TnYLB-1. pMar-ywsC was trans-
formed into C06 and plated on LB agar with erythromycin (10 g/ml).
Individual colonies were picked and grown overnight in LB medium at
37 C, and then portions of each culture were plated on LB plus 10 g/ml
B. amyloliquefaciens C06, M106 and C06ywsC were inoculated
into 35 ml medium E (Leonard et al., 1958) in 250 ml ask and
aerobically incubated at 37 C in a rotary shaker at 200 rpm for 48 h.
The cell-free ltrates of B. amyloliquefaciens C06, M106 and C06ywsC
were collected with 0.22 m membrane ltration.
The molecular mass of the mucilage were analyzed as described
previously (Xu et al., 2005) by gel permeation chromatography (GPC)
system, a Shodex 101 refractive-index with Shodex SB-806 M HQ
HPSEC column. Two hundred millimolar Na2SO4 with pH adjusted
to 4.0 with acetic acid was used as mobile phase at a ow rate of

Table 1
Bacterial strains and plasmids used in this study.

Strain or plasmid Relevant genotype or characteristicsa Source or reference

Escherichia coli
DH5 F 80dlacZ M12 minirecA Laboratory stock

B. amyloliquefaciens
C06 Wild type Zhou et al. (2008)
C06-MA C06 transformed with pMarA; Ermr, Kmr This study
C06-MC C06 transformed with pMarC; Ermr, Kmr This study
M106 Mutant of C06, ywsC::TnYLB-1; Kmr This study
C06ywsC ywsC:: pMar-ywsC; Ermr This study
C06epsA epsA:: pMar-epsA; Ermr This study
C06tasA tasA:: pMar-tasA; Ermr This study
C06sinI sinI:: pMar-sinI; Ermr This study

Plasmids
pMarA Shuttle vector carrying TnYLB-1 transposon and mariner-Himar1 transpose; pUC replicon, Le Breton et al. (2006)
thermosensitive replicon for gram-positive hosts; Kmr, Apr, Ermr
pMarC Shuttle vector carrying TnYLB-1 transposon; pUC replicon, thermosensitive replicon for Le Breton et al. (2006)
gram-positive hosts; Kmr, Apr, Ermr
pMar-ywsC pMarC derivative carrying ywsC in place of TnYLB-1; Apr, Ermr This study
pMar-epsA pMarC derivative carrying epsA in place of TnYLB-1; Apr, Ermr This study
pMar-tasA pMarC derivative carrying tasA in place of TnYLB-1; Apr, Ermr This study
pMar-sinI pMarC derivative carrying sinI in place of TnYLB-1; Apr, Ermr This study
a
Resistance marker: Apr, ampicillin resistance; Kmr, kanamycin resistance; Ermr, erythromycin.
192 J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190197
1 ml/min. The column temperature was held at 35 C. Dextrans
(polysaccharides) standards (Shodex, Inc., U.S.A.) were used to construct
a calibration curve, from which molecular weights of mucilage were
calculated with no further correction.
2.4.2. UV scanning and amino acid analysis with paper chromatography
Mucilage was separated by dialysis with molecular size of 300 KDa
and the high molecular weight separation was collected and subjected
to vacuum drying. To determine the absorption peak of the puried
mucilage, 0.1 g/ml puried mucilage solution was then subjected to
UV scanning with a Nanodrop ND-1000 UVvis spectrophotometer
(NanoDrop Technologies, Wilmington, DE, USA). To determine the
amino acid composition of the mucilage, the puried mucilage was
hydrolyzed with 6N HCl at 110 C for 24 h in a sealed and evacuated
tube and the amino acid compositions were determined by paper
chromatography method as described previously (Waley, 1955).
2.5. In vitro evaluations of the effects of -PGA on biolm formation,
glass surface adhesion and swarming motility
Three properties of Bacillus strains, surface adhesion, biolm formation
and swarming motility, were known to be involved in plant surface
colonization and inuenced by the bacterial extra-cellular compound
compositions. These three properties of both B. amyloliquefaciens C06 and
its mutants decient in -PGA producing were tested.
2.5.1. Pellicle and colony formation assay
For pellicle formation assay, bacteria strains were inoculated into a
tube containing 2 ml LB liquid medium. The tubes were shaken at low
speed (160 rpm) at 37 C for 16 h, at which point 5 l of each culture was
used to inoculate 20 ml of MSgg in a beaker. These beakers were
incubated without shaking at 37 C, and after 3 and 5 days of incubation,
their pellicles were analyzed by visual inspection respectively.
2.5.2. Glass surface adhesion assay
The Bacillus vegetative cells for adhesion test were prepared as
described previously (Ronner et al., 1990). Here, the glass surface was
prepared for the interaction with Bacillus cells, for the smooth and
negatively charged prosperities of its surface similar to the stone
Fig. 1. Colony morphology of B. amyloliquefaciens C06 and its mutants. Strains were grown in LB medium to mid-log phase with selection; 10 l was spotted on MSgg plates (dried for
30 min in a laminar airow) and incubated at 37 C overnight without selection and then photographed. A, B. amyloliquefaciens C06; B, M106; C, C06ywsC; D, C06epsA;
E, C06tasA; F, C06sinI.
fruit surface. Before each experiment, glasses were subjected to the
following cleaning and disinfection protocol: 1, 15 min cleaning in 2%
alkaline detergent RBS35 at 50 C; 2, 5 min rinse with reverse osmosis
water; 3, 20 min autoclaving at 121 C; and 4, glass chips dried at 50 C
overnight. For the adhesion study, 5 ml Bacillus cell suspension with nal
concentration of 108 cfu/ml was added into 50 ml tubes containing 30 ml
of PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 2 mM
KH2PO4). The sterile glass chips were vertically placed inside these bottles.
Adhesion was allowed to occur for 0.5, 1 and 1.5 h at 37 C with shaking at
150 rpm. The chips were then removed with sterile forceps. To remove
weakly adherent cells, chips were rinsed 3 times in 20 ml PBS for 1 min.
After washing, each chip was transferred to a test tube containing 10 ml
PBS; the attached bacterial cells were scraped from both sides of the chip
surface with a 22 cm sterile Mira clot. The test tube along with the cut
swab tip was stirred in a vortex mixer for 2 min to release the cells into the
PBS and cells in PBS were then enumerated (Peng et al., 2001). Each
experiment was performed at least twice and either two or three chips
were used in each experiment.
2.5.3. Swarming motility assay
The swarming expansion assay was performed according to pub-
lished procedures (Kearns and Losick, 2003). Cells were grown to
mid-log phase at 37 C in LB broth and resuspended to the appropriate
OD in PBS buffer. 0.3% and 0.7% minimal medium (MSgg) (Branda
et al., 2001) agar was dried for 30 min in a laminar ow hood,
centrally inoculated with 2 107 cells in 10 l (standard conditions),
dried for another 10 min and incubated at 37 C. The morphology of
swarming expansion was photographed at 6 h and 18 h respectively.
Each experiment was performed at least twice and either two or three
chips were used in each experiment.
2.6. In vivo assays of bacterial colonization on apple surface
The apples were soaked in 10% household bleach (5% sodium
hypochlorite) and 0.01% Tween 20 for 4 min and rinsed in reverse
osmosis water for 4 min. Once the surface was dry, the disinfected
apples were respectively immersed into culture suspensions of
B. amyloliquefaciens C06-MA and C06ywsC with the nal concentration
of 1 107 cfu/ml and then placed on a plastic packing tray contained
 J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190197 193

in a plastic box. The treated apples were incubated at 22 C. After

incubating for 1, 3 and 5 days, 1 cm2 apple skin was cut around equator
of the apple and grinded with a motor. The grinded apple skin was
suspended in 1 ml distilled water and vibrated for 1 min. The
suspension (200 l) was diluted to 10 4, 10 5 and 10 6 and 100 l
diluted suspension was spread on LB agar plates with 10 g/ml
erythromycin respectively. After incubation at 37 C overnight, the
single colonies on the ager plates were counted. To conrm that the
counted colonies were formed by C06 and its derivatives, 10 colonies
from both treatment and control groups were randomly picked and
subjected to BOX-PCR analysis using BOX-A1R primer (data not shown).
Each experiment was repeated 3 times.

2.7. Statistical analysis

The data were statistically analyzed using analysis of variance,

followed by Fisher's least-signicant-difference test (P = 0.05) using
SPSS software (SPSS Inc., Chicago, IL, USA).

3. Results

3.1. Transposon mutagenesis screening

Using kanamycin, 1000 TnYLB-1 transposon inserted mutants

were selected after B. amyloliquefaciens C06 was transformed with
transposon-carrying pMarA. Four of the mutants, designated M105,
M106, M107 and M108 were found unable to form sticky colonies on
LB plate and unable to secret mucoid substances in liquid medium
under any conditions. Here, only M106 was presented in Fig. 1, for the
colonies formed by the rest three mutants have the same morphol-
ogies as M106. Insertion copy analysis by Southern blot demonstrated
that only M106 and M107 had single insertions (data not shown), so
M106 and M107 were chosen for further investigation. To identify the
insertion site of M106, inverse PCR was performed and a 758 bp DNA
fragment was obtained. Sequence analysis revealed that this fragment
had 98% homology with ywsC in B. amyloliquefaciens FZB42, a gene
responsible for -polyglutamic acid synthesis in many Bacillus strains
(Urushibata et al., 2002).

3.2. Characterization of the extra-cellular mucilage by chemical and

physical analysis

The cell-free ltrates of B. amyloliquefaciens C06 and its mutants

decient in producing the extra-cellular mucilage were analyzed with
gel permeation chromatography. The chromatographic proles of C06
showed a unique peak with the retention time from 11 to 18 min,
which was not found in the proles of M106 or C06ywsC (Fig. 2),
thus the molecular weight of the extra-cellular mucilage from C06
was inferred to be 3003000 KDa based on the calculation according
to the retention time. The paper chromatography analysis revealed
that the non-hydrolyzed mucilage solution didn't show any band by
ninhydrin coloring, while only band of the hydrolyzed mucilage
showed the same color and same drift mobility as band of the
L-glutamic, indicating that the 6N HCl hydrolyzate of the puried extra-
cellular mucilage was composed solely of glutamic acid (Fig. 3).
Together with the result from UV scanning that the mucilage had
an absorption peak at 227 nm (data not shown), the mucilage
produced by B. amyloliquefaciens C06 was conrmed to be -poly
glutamic acid (-PGA) (Birrer et al., 1994).
3.3. In vitro assessment of PGA's effects on surface colonization abilities
of B. amyloliquefaciens C06
For biolm formation, both C06 and M106 were able to form typical
oating biolms (pellicles) after incubation at 37 C in MSgg medium
for 3 days (Fig. 4A and B). However, the pellicle formed by C06 turned
Fig. 2. Gel permeation chromatography analysis of the mucilage from B. amylolique-
faciens C06. A. Chromatographic proles of cell-free ltrates of B. amyloliquefaciens
C06 and the mutants decient in producing mucilage. 20 l culture ltrates of
B. amyloliquefaciens C06 and the mutants were analyzed gel permeation chromatog-
raphy (GPC) system. Fifty millimolar NaCl aqueous solutionacetonitrile (4:1, v/v) was
used as mobile phase at a ow rate of 0.7 ml/min.
to be more exible and showed more resistance against shaking. On
the fth day of incubation, the structure of pellicle formed by M106
started to be dissolved and was easy to be broken up (Fig. 4D) while
the one formed by C06 turned to be more stable and robust (Fig. 4C).
Exopolysaccharides (EPS), TasA and -PGA are three major extra-
cellular compounds known to be involved in biolm formation in
Bacillus strains. To determine their roles and correlations in colony
formation on semi-solid surface, three mutants C06epsA, C06tasA
and C06sinI, decient respectively in producing EPS, TasA and both,
were constructed and their colony structures on semi-solid surfaces
were evaluated together with B. amyloliquefaciens C06 and C06ywsC
(Fig. 1AF). The colonies formed by B. amyloliquefaciens C06 appeared
to be the most structured and the colonies formed by C06epsA,
C06tasA and C06ywsC were less structured than C06, while
C06sinI was unable to form structured colonies on semi-solid surface.
194 J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190197

M106 more than 18 h to accomplish the coverage; and the colony

formed by C06 extended in a non-branched way while M106
extended in a tendril way (Fig. 5).
For surface adhesion, wild type B. amyloliquefaciens C06 also
performed stronger adhesive activities than its mutant M106, and
with the extension of adhesion period, the retrieved adhering cell
numbers of both C06 and M106 increased steadily. The average
numbers of adhering cells per cm2 for B. amyloliquefaciens C06 at 0.5, 1
and 1.5 h was 621, 2561 and 3107, respectively, and the average
numbers for M106 were only 177, 729 and 1251, respectively (Fig. 6).

3.4. In vivo fruit surface colonization evaluation

Quantitative evaluation of bacterial adhesion to apple surface was

Fig. 3. Paper chromatography analysis of the hydrolyzed mucilage. Lane 1, hydrolyzed
mucilage solution; Lane 2, mucilage solution from B. amyloliquefaciens C06; Lane 3,
L-glutamic acid solution.
The swarming motilities of C06 and M106 on MSgg medium with
0.3% and 0.7% agar were investigated. The expansion rate of M106 on
0.3% agar plate turned to be faster than on 0.7% agar plate, for after
18 h incubation, M306 covered nearly the whole surface of 0.3% agar
plate while only 80% of surface of 0.7% agar plate. However, the
expansion rate of wild type C06 showed no signicant difference on
0.3% and 0.7% agar plates. C06 and M106 showed signicant
differences in both expansion rate and swarming patterns: the colony
formed by C06 covered the whole surface of plate in 12 h while it took
investigated (Fig. 7). Average number of adherent cells after 1 day,
3 days and 5 days colonization on apple surface and standard
deviations was shown in Fig. 7. B. amyloliquefaciens C06-MA was
wild type C06 transformed with pMarA, which kept the ability of
producing -PGA and was able to grow on LB agar plates with 10 g/
ml erythromycin. As shown in Fig. 7, the difference between retrieved
cell numbers of C06-MA and C06ywsC was signicant. On the
rst day, the gap between numbers of bacterial cells from C06-MA
(3 105 /cm2) and C06ywsC (8 104 /cm2) was nearly 4 times
(P = 0.001). When the incubation time extended to 3 days, the aver-
age numbers of adherent cells of both C06-MA and C06ywsC de-
creased 2.62.8 times, to 1.1 105 and 2.8 104 /cm2 (P = 0.001),
respectively. With prolonged incubation, the average adherent cells
numbers increased to 2.3 105 /cm2 for C06-MA and to 7.2 104 /cm2
for C06ywsC (P = 0.002) on the fth day, respectively.
4. Discussion
B. amyloliquefaciens C06, isolated from cheese starter, showed
signicant control effect on peach brown rot caused by M. fructicola.
The bacterial strain C06 was found to form highly structured colonies

Fig. 4. Pellicle morphology of B. amyloliquefaciens C06 and M106. 20 ml of liquid MSgg medium was inoculate with 50 l of mid-log phase culture and incubated at 37 C for 5 days.
The morphology of biolm was photographed against black ground. A1 and A2 were glasses inoculated with M106; B1 and B2 were glasses inoculated with B. amyloliquefaciens C06.
A1 and B1 were photographed after incubating for 3 days and A2 and B2 were photographed after incubating for 5 days.
 J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190197 195

Fig. 5. Swarming motility test of B. amyloliquefaciens C06 and M106. C06 and M106 were centrally inoculated on MSgg medium with 0.3% and 0.7% agar. The plates were
photographed against black ground at 6 and 18 h. A1 and B1 were 0.3% agar pates inoculated with M106; C1 and D1 were 0.7% agar plates inoculated with M106. A2 and B2 were 0.3%
agar pates inoculated with B. amyloliquefaciens C06; C2 and D2 were 0.7% agar plates inoculated with B. amyloliquefaciens C06. A1, A2, C1 and C2 were photographed after incubation
for 6 h, and B1, B2, D1 and D2 were photographed after incubation for 18 h.

on MSgg agar medium that were strikingly mucoid in their center
(Fig. 1). In the present work, transposon mutagenesis library of C06
was constructed and ywsC gene was identied to be involved in
synthesizing the extra-cellular mucilage. YwsC has been demonstrat-
ed to be involved in released -PGA production in many other Bacillus
spp. strains (Candela and Fouet, 2006; Urushibata et al., 2002). Gel
permeation chromatography analysis showed that the molecular
weight of the mucilage of C06 was from 300 to 3000 KDa (Fig. 2), and
the extra-cellular mucilage produced by B. amyloliquefaciens C06 was
puried according to its molecular weight. UV scanning indicated that
the puried mucilage did not contain signicant amounts of protein or
nucleic acid, as evidenced by the lack of absorbance at 280 and
254 nm. When the sample was processed according to previous paper
chromatography method for determining glutamic acid (Waley,
1955), a single band was observed at the position corresponding to
that of glutamic acid (Fig. 3). Taking the fact that -PGA is a poly-
anionic polymer that may consist of only D, only L or both glutamate
enantiomers polymerized through amide linkage between -amino
and -carboxylic acid groups (Birrer et al., 1994; Shih and Van, 2001),
the mucilage was conrmed to be -PGA.
The process of a planktonic Bacillus cell attaching to fruit surface
and forming stable biolm was considered to be the precondition of
exerting its biological functions. The colonization process of biological
control Bacillus strains applied to fruit surface usually consists of three
steps (Lemon et al., 2008): 1, Bacillus motile cells attach to the fruit
surfaces by cellsurface interactions; 2, Bacillus cells transformed
from motile cells to non-motile cells and started to form micro-
colonies; and 3, Bacillus cells expand in the form of colonies majorly
depending on swarming motility. Here, we demonstrated that -PGA
could improve the abilities of Bacillus cells to attach smooth surface,
form biolm and colony and to swarm on semi-solid surface in vitro
and enhance the apple surface colonization efciency in vivo.
In vitro, motile cells of wild type B. amyloliquefaciens C06 showed
stronger ability to attach to glass surface than C06ywsC (Fig. 6).
In vivo, C06-MA also performed more effectively than C06ywsC in
apple surface attachment (Fig. 7), particularly on the rst day of
evaluation when most attached Bacillus cells were in form of motile
cells (Branda et al., 2001). To rule out the possible inuence of growth
rate on the abilities of Bacillus strains adhering to the solid surfaces,
two steps were carried out: 1, the growth rate curves of both wild type
C06 and its mutant were measured and no signicant differences
were found between wild type and mutant strains; 2, before the
Bacillus strains were treated, their growth stages were unied by
measuring their OD values. It proved that increasing mucous activity
of Bacillus surface could enhance surface adhesion of motile Bacillus
cell. -PGA is a large, extra-cellular, anionic polymer and covered with
a large quantity of cations, while in nature most of the surfaces
including stone fruit surface, and glass surface are negatively charged.
In this case, salt ions like Mg2+ or Ca2+ could act as an intermediary
between two negatively charged surfaces (Mayer et al., 1999)
and thus the salt-bridges may form between the negatively charged
-PGA and the abiotic surface and again between -PGA and the cell
surface, which consequently contributes to cellsurface interaction.
Polysaccharides and TasA protein were characterized as two major
extra-cellular matrixes contributing to the mechanical stability of the
biolm (Branda et al., 2005). -PGA was also found to be important
during the biolm process. The domestic B. subtilis 168 was converted
from a non-biolm producer to a biolm producer by transferring the
genetic determinants controlling -PGA formation from a wild strain

Fig. 6. Glass surface adhesion evaluation. Average numbers of adherent cells of Fig. 7. Fruit surface colonization evaluation. Average numbers and standard deviations
B. amyloliquefaciens C06 and M106 after adhesion test are reported. The bar represents of adherent cells of B. amyloliquefaciens C06-MA and C06ywsC on per cm2 of apple
standard deviation of the mean. Different letters indicate signicant differences surface after incubated for 1 day, 3 days and 5 days are reported. Different letters
between treatments according to LSD at P = 0.05. indicate signicant differences between treatments according to LSD at P = 0.05.
196 J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190197
(Stanley and Lazazzera, 2005). However, deletion of ywsC, a gene
encoding -PGA synthesis, in the wild B. subtilis RO-FF-1 did not lead
to a marked decrease in surface-associated biolm formation (Stanley
and Lazazzera, 2005). To investigate the roles and correlations of three
extra-cellular compounds in biolm production, three mutants
C06epsA, C06tasA and C06sinI were constructed and evaluated
for their colony structures on semi-solid surfaces together with the
wild type B. amyloliquefaciens C06 and C06ywsC. The colonies
formed by B. amyloliquefaciens C06 was highly delicate in structure
while the colonies formed by the mutants were much less structured,
especially the colony formed by C06sinI, the mutant unable to
produce EPS and TasA (Kearns et al., 2005), showed no structure at all
(Fig. 1), inferring that -PGA could promote to form structured colony
but was not essential in the process of colony formation.
Swarming is a type of social motility, characterized by the rapid
and coordinated migration of highly differentiated swarm cells on
semi-solid surfaces (Fraser and Hughes, 1999; Harshey, 1994; Sharma
and Anand, 2002). Swarming migration is preceded by a profound
modication of cell morphology, where short planktonic cells dif-
ferentiate into elongated and multi-agellated swarm cells (Harshey,
2003). The swarming of Bacillus strains has been reported to be
inuenced by several elements, such as the presence of agella
(Ohgiwari et al., 1992; Senesi et al., 2004), the production of the
lipopeptide surfactin and mycosubtilin (Julkowska et al., 2005;
Kinsinger et al., 2003; Leclere et al., 2006), extra-cellular proteolytic
activity (Connelly et al., 2004; Gupta and Rao, 2009) and extra-cellular
potassium ion (Kinsinger et al., 2003). It was also identied that both
swarming motility and -PGA synthesis were under the regulation of
SwrAA (Osera et al., 2009). However, the role of -PGA in swarming
motility was not investigated yet. In this study, -PGA was found to
promote the swarming motility of B. amyloliquefaciens C06, not only
enhancing the spreading rate, but also converting its swarming
pattern from a successive dendritic way to nondendritic warming
pattern (Fig. 5). In this case, -PGA might improve the swarming
motility of B. amyloliquefaciens C06 in three ways: 1, the released extra-
cellular -PGA presumably changed the physical characteristics of the
surface terrain by absorbing water; 2, the mucous properties of -PGA
helped Bacillus cells aggregated into a highly coordinated manner; and
3, -PGA may also help the Bacillus cells absorb nutrients critical for
swarming motility from the environments e.g. potassium ion.
The improved abilities of biolm formation and swarming mo-
tilities may also explain why C06-MA showed stronger ability of apple
surface colonization than C06ywsC on the third and fth day. When
nutrients availability from fruit surface turned to be harder than from
the medium, the attached bacterial cells on fruit surface started to
form biolms (Branda et al., 2001; Stanley and Lazazzera, 2005) and
extended their colonies mainly relying on swarming motility
(Harshey, 2003). However, retrieved cell numbers of both C06-MA
and C06ywsC decreased 23 times on the third day compared to the
rst day, probably as a result of natural selection of the adverse
environment, and after the selection, the remaining cells started to
expand by forming colonies and swarming motility, resulting in the
increased adherent cell numbers on the fth day.
-PGA could enhance the colonization abilities of Bacillus cells
from biolm formation, surface adhesion and swarming motilities,
implying that converting a non -PGA producing Bacillus strain into a
-PGA producer can be a potential way to improve the biological
control effectiveness of Bacillus strains with enhanced surface
colonization abilities.
Acknowledgements
This research is funded by Agriculture and Agri-food Canada
and also supported by grants from the National Natural Science
Fund of China (30570041), the National 863 Program of China
(2006AA10Z172), the Program of International Science and Technol-
ogy Cooperation (2009DFA32740), the Special Nonprot Scientic
Research Program, PR China (3-23), and the National Transgenic
Major Program (2009ZX08009-055B). J. Liu received a graduate
scholarship from the China Scholarship Council.
References
Bertani, G., 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic
Escherichia coli. Journal of Bacteriology 62, 293300.
Bianciotto, V., Andreotti, S., Balestrini, R., Bonfante, P., Perotto, S., 2001. Mucoid mutants
of the biocontrol strain Pseudomonas uorescens CHA0 show increased ability in
biolm formation on mycorrhizal and nonmycorrhizal carrot roots. Molecular
PlantMicrobe Interactions 14, 255260.
Birrer, G.A., Cromwick, A.M., Gross, R.A., 1994. -Poly (glutamic acid) formation by
Bacillus licheniformis 9945a: physiological and biochemical studies. International
Journal of Biological Macromolecules 16, 265275.
Branda, S.S., Gonzalez-Pastor, J.E., Ben-Yehuda, S., Losick, R., Kolter, R., 2001. Fruiting
body formation by Bacillus subtilis. Proceedings of the National Academy of
Sciences of the United States of America 98, 1162111626.
Branda, S.S., Vik, S., Friedman, L., Kolter, R., 2005. Biolms: the matrix revisited. Trends
in Microbiology 13, 2026.
Candela, T., Fouet, A., 2006. Poly-gamma-glutamate in bacteria. Molecular Microbiology
60, 10911098.
Chin-A-Woeng, T., Bloemberg, G., Mulders, I., Dekkers, L., Lugtenberg, B., 2000. Root
colonization by phenazine-1-carboxamide-producing bacterium Pseudomonas
chlororaphis PCL1391 is essential for biocontrol of tomato foot and root rot.
Molecular PlantMicrobe Interactions 13, 13401345.
Connelly, M.B., Young, G.M., Sloma, A., 2004. Extracellular proteolytic activity plays a
central role in swarming motility in Bacillus subtilis. Journal of Bacteriology 186,
41594167.
Dwyer, K.G., Lamonica, J.M., Schumacher, J.A., Williams, L.E., Bishara, J., Lewandowski,
A., Redkar, R., Patra, G., DelVecchio, V.G., 2004. Identication of Bacillus anthracis
specic chromosomal sequences by suppressive subtractive hybridization. BMC
Genomics 5, 15.
Fraser, G.M., Hughes, C., 1999. Swarming motility. Current Opinion in Microbiology 2,
630635.
Gupta, M., Rao, K.K., 2009. Epr plays a key role in DegU-mediated swarming motility of
Bacillus subtilis. FEMS Microbiology Letters 295, 187194.
Harshey, R.M., 1994. Bees aren't the only ones: swarming in gram-negative bacteria.
Molecular Microbiology 13, 389394.
Harshey, R.M., 2003. Bacterial motility on a surface: many ways to a common goal.
Annual Review of Microbiology 57, 249273.
Hitchins, A., Feng, P., Watkins, W., Rippey, S., Amaguana, L., 1998. Bacteriological
Analytical Manual8th Edition. Food and Drug Administration, Washington, DC.
Husmark, U., Ronner, U., 1990. Forces involved in adhesion of Bacillus cereus spores to
solid surfaces under different environmental conditions. Journal of Applied
Microbiology 69, 557562.
Julkowska, D., Obuchowski, M., Holland, I.B., Seror, S.J., 2005. Comparative analysis of
the development of swarming communities of Bacillus subtilis 168 and a natural
wild type: critical effects of surfactin and the composition of the medium. Journal of
Bacteriology 187, 6576.
Kearns, D.B., Losick, R., 2003. Swarming motility in undomesticated Bacillus subtilis.
Molecular Microbiology 49, 581590.
Kearns, D.B., Chu, F., Branda, S.S., Kolter, R., Losick, R., 2005. A master regulator for
biolm formation by Bacillus subtilis. Molecular Microbiology 55, 739749.
Kinsinger, R.F., Shirk, M.C., Fall, R., 2003. Rapid surface motility in Bacillus subtilis is
dependent on extracellular surfactin and potassium ion. Journal of Bacteriology
185, 56275631.
Le Breton, Y., Mohapatra, N.P., Haldenwang, W.G., 2006. In vivo random mutagenesis of
Bacillus subtilis by use of TnYLB-1, a mariner-based transposon. Applied and
Environmental Microbiology 72, 327333.
Leclere, V., Marti, R., Bechet, M., Fickers, P., Jacques, P., 2006. The lipopeptides
mycosubtilin and surfactin enhance spreading of Bacillus subtilis strains by their
surface-active properties. Archives of Microbiology 186, 475483.
Lemon, K.P., Earl, A.M., Vlamakis, H.C., Aguilar, C., Kolter, R., 2008. Biolm development
with an emphasis on Bacillus subtilis. Current Topics in Microbiology and
Immunology 322, 116.
Leonard, C.G., Housewright, R.D., Thorne, C.B., 1958. Effects of some metallic ions on
glutamyl polypeptide synthesis by Bacillus subtilis. Journal of Bacteriology 76,
499503.
Mascher, T., Hachmann, A.B., Helmann, J.D., 2007. Regulatory overlap and functional
redundancy among Bacillus subtilis extracytoplasmic function (ECF) -factors.
Journal of Bacteriology 189, 69196927.
Mayer, C., Moritz, R., Kirschner, C., Borchard, W., Maibaum, R., Wingender, J., Flemming,
H.C., 1999. The role of intermolecular interactions: studies on model systems for
bacterial biolms. International Journal of Biological Macromolecules 26, 316.
Ohgiwari, M., Matsushita, M., Matsuyama, T., 1992. Morphological changes in growth
phenomena of bacterial colony patterns. Journal of the Physics Society Japan 61,
816822.
Osera, C., Amati, G., Calvio, C., Galizzi, A., 2009. SwrAA activates poly--glutamate
synthesis in addition to swarming in Bacillus subtilis. Microbiology 155, 22822287.
Peng, J.S., Tsai, W.C., Chou, C.C., 2001. Surface characteristics of Bacillus cereus and its
adhesion to stainless steel. International Journal of Food Microbiology 65, 105111.
 J. Liu et al. / International Journal of Food Microbiology 142 (2010) 190197
Ronner, U., Husmark, U., Henriksson, A., 1990. Adhesion of Bacillus spores in relation to
hydrophobicity. Journal of Applied Microbiology 69, 550556.
Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.
Senesi, S., Ghelardi, E., Celandroni, F., Salvetti, S., Parisio, E., Galizzi, A., 2004. Surface-
associated agellum formation and swarming differentiation in Bacillus subtilis are
controlled by the ifm locus. Journal of Bacteriology 186, 11581164.
Sharma, M., Anand, S., 2002. Swarming: a coordinated bacterial activity. Current
Science 83, 707715.
Shih, I.L., Van, Y.T., 2001. The production of poly-(-glutamic acid) from microorgan-
isms and its various applications. Bioresource Technology 79, 207225.
Spizizen, J., 1958. Transformation of biochemically decient strains of Bacillus subtilis by
deoxyribonucleate. Proceedings of the National Academy of Sciences of the United
States of America 44, 10721078.
197
Stanley, N.R., Lazazzera, B.A., 2005. Dening the genetic differences between wild and
domestic strains of Bacillus subtilis that affect poly-gamma-DL-glutamic acid
production and biolm formation. Molecular Microbiology 57, 11431158.
Urushibata, Y., Tokuyama, S., Tahara, Y., 2002. Characterization of the Bacillus subtilis
ywsC gene, involved in -polyglutamic acid production. Journal of Bacteriology 184,
337343.
Waley, S., 1955. The structure of bacterial polyglutamic acid. Journal of the Chemical
Society 1955, 517522.
Xu, H., Jiang, M., Li, H., Lu, D., Ouyang, P., 2005. Efcient production of poly (-glutamic
acid) by newly isolated Bacillus subtilis NX-2. Process Biochemistry 40, 519523.
Zhou, T., Schneider, K.E., Li, X.Z., 2008. Development of biocontrol agents from food
microbial isolates for controlling post-harvest peach brown rot caused by Monilinia
fructicola. International Journal of Food Microbiology 126, 180185.