P. John, E. a. Reynolds, A. G. Prescott, A.-d. Bauchot (Auth.), A. K. Kanellis, C. Chang, H. Klee, A. B. Bleecker, J. C. Pech, D. Grierson (Eds.)-Biology and Biotechnology of the Plant Hormone Ethylen

BIOLOGY AND BIOTECHNOLOGY OF
THE PLANT HORMONE ETHYLENE II

Biology and Biotechnology of
the Plant Hormone Ethylene II
Edited by
A.K. Kanellis
Department of Pharmaceutical Sciences,
Aristotle Vniversity of Thessaloniki,
Thessaloniki, Greece
C. Chang
Department of Cel! Biology and Molecular Genetics,
Vniversity of Maryland,
Col!ege Park, MD, U.S.A.
H. Klee
Department of Horticultural Sciences,
Vniversity of Florida,
Gainesville, FL, V.S.A.
A.B. Bleecker
Department of Botany,
Vniversity of Wisconsin-Madison,
Madison, WI, V.S.A.
J.C. Pech
ENSAT
Auzevil/e Tolosan, Castane! Tolosan cedex, France
D. Grierson
BBSRC Research Group in Plant Gene Regulation,
Departmen! of Physiology and Environmental Science,
Vniversity of Nottingham, Sutton Bonington Campus.
Loughborough, Vnited Kingdom
SPRINGER-SCIENCE+BUSINESS MEDIA, B.V.

Library of Congress Cataloging-in-Publication Data
Proceedings of the EU-TMR-Euroconference Symposium on
Biology and Biotechnology of the Plant Hormone Ethylene II,
Thira (Santorini), Greece
5-8 September, 1999
ISBN 978-94-010-5910-7 ISBN 978-94-011-4453-7 (eBook)

DOI 10.1007/978-94-011-4453-7
Printed an acid-free paper
AH Rights Reserved
1999 Springer Science+Business Media Dordrecht
Originally published by Kluwer Academic Publishers in 1999
Softcover reprint of the hardcover Ist edition 1999
No part of the material protected by this copyright notice may be reproduced or
utilized in any form or by any means, electronic or mechanical,
including photocopying, recording or by any information storage and
retrieval system, without written permission from the copyright owner.
TABLE OF CONTENTS
~~~ ~
Kanellis. A.K.. C. Chang. H Klee. A.B. Bleecker. J.c. Pech and D. Grierson
1. Biochemical and Molecular Mechanisms of Ethylene Synthesis
ACC oxidase in the biosynthesis of ethylene

John, P., E.A. Reynolds, A.G. Prescottand and A.D. Bauchot
Analysis of ACC oxidase activity by site-directed mutagenesis of

conserved amino acid residues 7
D. Kadyrzhanova, TJ. McCully, T. Warner, K. Vlachonasios, Z. Wang
and D.R. Dilley
Evaluation of novel inhibitors of ACC oxidase possessing

cyclopropyl moiety 13
Dourtoglou, V., E. Koussissi and K. Petritis
Characterization of the promoter of mungbean auxin-inducible

ACC synthase gene, Vr-ACS6 21
Yoon, I. S., D.H. Park, H. Mori, B.G. Kang and H. Imaseki
Searching for the role of ethylene in non-climacteric fruits:

Cloning and characterization of ripening-induced ethylene biosynthetic
genes from non-climactericpPineapple (Ananas Comosus) fruits 29
Cazzonelli, C.J., A.S. Cavallaro and J.R. Botella
Organization and structure of l-aminocyclopropane-l-carboxylate

oxidase gene family from peach 31
Bonghi, C., B. Ruperti, A. Rasori, P. Tonutti and A. Ramina
Metabolism of l-aminocyclopropane-l-carboxylic acid by

Penicillium citrinum 33
Honma, M., YJ. Jia, Y Kakuta and H. Matsui
Structural modifications of ACC oxidase during catalytic inactivation 35

Ramassamy, S., S. Bidonde, L. Stella, J.C. PechandA. Latche
2. Perception and Signal Transduction Pathways
Characterization of Arabidopsis ethylene-overproducing mutants 37

Woeste, K.E. and J. J. Kieber
vi
Control of ethylene responses at the receptor level 45

Sisler, E.C. and M. Serek
The Ethylene Signal Transduction Pathway 51

Bleecker, A. B., A. E. Hall, F. I. Rodriguez, J. J. Esch and B. Binder
The role of two-component systems in ethylene perception 59

Gamble, R.L., M.L. Coonfield, M.D. Randlett, and G.E. Schaller
Protein-protein interactions in ethylene signal transduction in Arabidopsis 65

Chang, e., P.B. Larsen, C-K. Wen, W. Ding, J.A. Shockey and Z. Pan
Ethylene signaling: more players in the game 71

Van Der Straeten, D., J. Smalle, A. Bertran, A. De Paepe, I. De Pauw,
F. Vandenbussche, M. Haegman, W. Van Caeneghem, and M. Van Montagu
The effect of ethylene and cytokinin on GTP binding and

MAP kinase activity in Arabidopsis thaliana 77
Smith, A.R., I.E. Moshkov, G.V. Novikova and M.A. Hall
Ethylene and methyl jasmonate interaction and binding models

for elicited biosynthetic steps of paclitaxel in suspension
cultures of Taxus canadensis 85
Phisalaphong, M. and J.e. Linden
Barren mutants in maize - a case study in plant signaling 95

Peterson, P. A.
Ethylene signal transduction pathway in cell death during

aerenchyma formation in maize root cells: role of phospholipases 103
He, C.J., P.W. Morgan, B.G. Cobb, W.R. Jordan and M.e. Drew
3. Growth and Development and Fruit Ripening
Ethylene-dependent and ethylene-independent pathways in a

climacteric fruit, the melon 105
Pech, J.e., M. Guis, R. Botondi, R. Ayub, M. Bouzayen, J.M. Lelievre,
F. EI Yahyaoui and A. Latche
Isolation and characterization of novel tomato ethylene-responsive

cDNA clones involved in signal transduction, transcription and
mRNA translation I 11
Zegzouti, H., B. Jones, B. Toumier, J. Leclercq, A. Bemadac and
M. Bouzayen
vii
Analysis of gene expression and mutants influencing ethylene

responses and fruit development in tomato 119
Giovannoni, J., E. Fox, P. Kannan, S. Lee, V. Padmanabhan and 1. Vrebalov
Ethylene as the initiator of the inter-tissue signalling and gene

expression cascades in ripening and abscission of oil palm fruit 129
Henderson, J. and D. 1. Osborne
Ethylene perception and response in Citrus fruit 137

Cubells-Martinez, X., J.M. Alonso, M.T. Sanchez-Ballesta and A. Granell
Phytochrome B and ethylene rhythms in sorghum: biosynthetic

mechanism and developmental effects 145
Finlayson, S.A., C-J. He, I-J. Lee, M.C. Drew, J.E. Mullet and P.W. Morgan
Involvement of ethylene biosynthesis and action in regulation

of the gravitropic response of cut flowers 151
Philosoph-Hadas, S., H. Friedman, R. Berkovitz-Simantov,
I. Rosenberger, E.J. Woltering, A.H. Halevy and S. Meir
Ethylene and flower development in tobacco plants 157

De Martinis, D., I. Haenen, M. Pezzotti, E. Benvenuto and C. Mariani
ACC oxidase expression and leaf ontogeny in white Glover 165

McManus, M.T., D.A. Hunter, S.D. Yoo and D. Gong
Interaction of ethylene with jasmonates in regulation of some

physiological processes in plants 173
Saniewski, M., J. Ueda and K. Miyamoto
Isolation of developmentally-regulated genes in immature tomato

fruit: towards an understanding of pre-ripening development 181
Jones, B., H. Zegzouti, P. Frasse and M. Bouzayen
Interaction between ethylene and abscisic acid in the regulation of

Citrus fruit maturation 183
Alferez, F. and L. Zacarias
Interactions between abscisic acid and ethylene in ethylene-forming

capacity of preclimacteric apple fruits 185
Lara, L and M. Vendrell
Soil compaction: Is there an ABA-ethylene relationship regulating

leaf expansion in tomato? 187
Hussain, A., J.A Roberts, C.R. Black and LB. Taylor
viii
Use of I-methylcyclopropene to modulate banana ripening 189

Joyce, D.C., AJ. Macnish, P.J. Hofman, D.H. Simons and M.S. Reid
Endo-J3-mannanase activity during lettuce seed germination at

high temperature in response to ethylene 191
Nascimento, W.M., D.J. Cantliffe and D.J. Huber
Ethylene and gibberelin in secondary dormancy releasing

of Amaranthus caudatus seeds 193
K~pczyIiski, J. and M. Bihun
4. Ethylene and Senescence of Plant Organs
Regulation and function of pollination-induced ethylene in

carnation and petunia flowers 195
Jones, M.L., W.R. Woodson and J.T. Lindstrom
The role of short-chain saturated fatty acids in inducing sensitivity

to ethylene 203
Halevy, A. H. and C. S. Whitehead
Apoptotic cell death in plants: The role of ethylene 209

Woltering, E. J., A. J. de Jong and E. T. Yakimova
Cloning of tomato DADI and study of its expression during

programmed cell death and fruit ripening 217
Hoeberichts, F.A., L.H.W. Van der Plas, and EJ. Woltering
RNAase activities is post-translationallly controlled during the

dark-induced senescence program 221
Gallie, D.R. and S.-C. Chang
Ethylene regulation of abscission competence 227

Lashbrook, C.C. and H.J. Klee
Role of ethylene sensitivity in mediating the chilling-induced leaf

abscission of Ixora plants 235
Michaeli, R., S. Philosoph-Hadas, J. Riov and S. Meir
Expression of abscission-related endo-p-l,4-glucanase 243

Casadoro, G., L. Trainotti and C.A. Tomasin
Differential display and isolation of cDNAs corresponding

to mRNAs whose abundance is influenced by ethylene during
peach fruitlet abscission 249
ix
Ramina, A., C. Bonghi, J.J. Giovannoni, B. Ruperti and P. Tonutti
The effect of auxins and ethylene on leaf abscission of Ficus benjamina 255
AI-Khalifah, N.S. and P.G. Alderson
Effect of ethylene on the oxidative decarboxylation pathway

of indole-3-acetic acid 261
Goren, R., L. Winer and J. Riov
An Arabidopsis ETRI homologue is constituvely expressed in

peach fruit abscission zone and mesocarp 267
Tonutti, P., C. Bonghi, B. Ruperti, A. Scapin and A. Ramina
Characterization of caEG2, a pepper endo-8-1,4-glucanase gene

involved in the abscission of leaves and flowers 269
Trainotti, L., C.A. Tomasin and G. Casadoro
Cellulase gene expression in ethylene treated geranium flowers 271

Rilioti, Z., S. Lind-Iversen, C. Richards and K.M. Brown
Use of I-methylcyclopropene to prevent floral organ abscission

from ethylene-sensitive Proteaceae 273
Macnish, AJ., D.C. Joyce, J.D. Faragher and M.S. Reid
Effects of selenium uptake by tomato plants on senescence,

fruit ripening and ethylene evolution 275
Pezzarossa, B., F. Malorgio and P. Tonutti
5. Stress Ethylene: Biochemical and Molecular Approaches
Ethylene enhances the antifungal diene content in idioblasts

from avocado mesocarp 277
Prusky, D., A. Leikin-Frenkel and L. Madi
Stimulated ethylene production in tobacco (Nicotiana tabacum L.,

CV. KY 57) leaves infected systemically with cucumber mosaic virus
yellow strain 285
Chaudhry, Z., S. Fujimoto, S. Satoh, T. Yoshioka, S. Rase and Y. Ehara
ACC deaminase is central to the functioning of plant

growth promoting Rhizobacteria 293
Glick, B. R., J. Li, S. Shah, D. M. Penrose and B. A. Moffatt
The role of ethylene in the formation of cell damage during ozone 299
Stress: Does ozone induced cell death require concomitant ADS
x
and ethylene production?

Kettunen, R., K. Overmyer and J. Kangasjarvi
Flooding-induced sensitisation to ethylene in Rumex palustris

and the possible involvement of a putative ethylene receptor 307
Vriezen, W.H., C. Mariani and L.A.C.J. Voesenek
Interactions between oxygen concentration and climacteric

onset of ethylene evolution 313
Solomos, T.
Manipulation of the expression of heme activated protein hap5c

gene in transgenic plants 321
Gherraby, W., A. Makris, I. Pateraki, M. Sanmartin, P. Chatzopoulos
and A. K. Kanellis
Ethylene and polyamines synthesis in cherimoya fruit under

high CO 2 levels: Adaptative mechanism to chilling damage 327
Mufioz, M.T., M.I. Escribano and C. Merodio
Effects of copper and zinc on the ethylene production of

Arabidopsis thaliana 333
Mertens, J., J. Vangronsveld, D. Van Der Straeten and M. Van Poucke
Ethylene dependent aerenchyma formation is correlated

with diverse gene expression patterns 339
Finkelstein, D. B, S. A. Finlayson, M. C. Drew, W. R. Jordan,
R. A. Wing and P. W. Morgan
Ethylene biosynthesis in Rumex palustris upon flooding 343

Vriezen, W.H., L.A.C.J. Voesenek and C. Mariani
Apoplastic ACC in ozone- and elicitor- treated plants 345

MOder, W., J. Kangasjarvi, E.F. Elstner, C. Langebartels
and H. Sandermann Jr.
ACC synthase isozymes of tomato (LE-ACSIB & LE-ACS6)

that are inducible only by touch 347
Tatsuki, M. and H. Mori
6. Biotechnological Control of Ethylene
Ethylene perception in tomato: lots of genes, lots of functions 351

Klee, H., D. Tieman and C. Lashbrook
xi
Horticultural performance of ethylene insensitive petunias 357

Clark, D.G., H.J. Klee, J.E. Barrett, and T.A. Nell
Role of ethylene in aroma formation in cantaloupe charentais melon 365

Bauchot, A.D., D.S. Mottram, A.T. Dodson and P. John
Genetic engineering of cantaloupe to reduce ethylene biosynthesis

and control ripening 371
Clendennen, S., K. J. A. Kellogg, K. A. Wolff, W. Matsumura,
S. Peters, J. E. Vanwinkle, B. Copes, M. Pieper, and M.G. Kramer
Physiological analysis of flower and leaf abscission in

antisense-ACC oxidase tomato plants 381
Zacarias, L., C. Whitelaw, D. Grierson, and J.A. Roberts
Ethylene in higher plants: biosynthetic interactions with polyamines

and high-temperature-mediated differential induction of NR versus
TAEI ethylene receptor 387
Mehta, R. A., D. Zhou, M. Tucker, A. Handa, T. Solomos
and A. K. Mattoo
Understanding the role of ethylene in fruit softening using antisense

ACC oxidase melons 395
Guis, M., A. Latche, M. Bouzayen and J.C. Pech
Rose, J.K.C., K.A. Hadfield and A.B. Bennett
Ethylene biosynthesis in transgenic auxin-overproducing tomato plants 397

Castellano, J.M., J. Chamarro and B. Vioque
Unpredictable phenotype change connected with Agrobacterium

tumefaciens mediated transformation of non-ripening tomato mutant 399
Bartoszewski, G., O. Fedorowicz, S. Malepszy, A. Smigocki, and
K. Niemirowicz-Szczytt
7. Applied Aspects
On chloroplast involvement and ethylene/nitric oxide (NO)

stoichiometry in fruit maturation 401
Leshem, Y.Y., R.B.H. Wills and V.V. Ku
Ethylene delays onset of woolly breakdown in cold-stored peaches 405

Sonego, L., A. Lers, A. Khalchitski, Y. Zutkhi, H. Zhou, S. Lurie
and R. Ben-Arie
Ethylene removal by peat-soil and bacteria: aspects for application

xii
in horticulture 411
EIsgaard, L.
Ethylene development in different clones of" Annurca" apple and

its influence on the biosynthesis of aroma esters and alcohols 419
Lo Scalzo, R. and A Testoni
Does inhibition of ACO activity in Japanese-type plums account for

the suppression of ethylene production in attached fruit by the tree
factor and the suppressed climacteric? 427
The role oj ethylene in the tree Jactor and suppressed climacteric in
Japanese-type plums
McGlasson, W.B., N. Abdi and P. Holford
Softening in apples and pears: a comparative study of the role

of ethylene and several cell wall degrading enzymes 431
Moya, M.A., C. Moggia, J. Eyzaguirre and P. John
Differential effects of low temperature inhibition on kiwifruit

ripening and ethylene production 433
Antunes, M.D.C., I. Pateraki, P. Ververidis, AK. Kanellis and E. Sfakiotakis
Differences in colour development and earliness among pepino clones

sprayed with ethephon 437
Leiva-Brondo, M., J. Prohens and F. Nuez
S-methyl-cysteine sulfoxide increases during postharvest storage

of broccoli 439
Accumulation ofalkyl-cysteine derivatives in Crucifers
Masuda, R., K. Kaneko and M. Saito
Action of 1,1-dimethyl-4-(phenylsulfonyl) semicarbazide

(DPSS), a new antisenescence preservative for cut carnation flowers 441
Satoh, S., M. Mikami, S. Kiryu, T. Yoshioka and N. Midoh
Differences in postharvest characteristics of miniature

potted roses (Rosa hybrida) 443
Muller, R., AS. Andersen, B.M. Stummann and M. Serek
Dry weight variations as influenced by thylene inside tissue

cultures vessels 445
Jona, R. and D.Travaglio
Index of authors 447
Index of Keywords 451

Prologue
Ethylene is a simple gaseous plant hormone (C 2 H4 , the simplest olefin) produced by

higher plants and also by bacteria and fungi. Because of its commercial importance and
its profound effects on food quality, plant growth and development, its biosynthesis,
action, and control of its action by chemical, physical and biotechnological means have
been intensively investigated. Thanks to new tools available in biochemistry and
molecular genetics, major parts of the ethylene biosynthesis, perception and signal
transduction pathways have been elucidated. This knowledge has been applied to
enhance the quality of a number of agronomically important crops.
The rapid advances in elucidating the mechanisms of ethylene perception and synthesis
by plants, the signal transduction pathway, and ethylene control in transgenic plants
have made the organization of a series of conferences dedicated to the plant hormone
ethylene imperative. It is noted here that studies on ethylene have led the way in
enhancing our understanding of the biosynthesis of a plant hormone at the biochemical
and molecular levels, and future studies should further help in the understanding of the
biochemical machinery responsible for the perception and signal transduction of this
plant hormone.
The Ethylene Symposia were established two decades ago as important international
scientific events. The purpose of the present Symposium was the critical assessment of
the existing knowledge and the exchange of new ideas on the mechanisms of ethylene
synthesis, perception and signal transduction, its role in pathogenesis and stress, its
involvement in plant growth and development and, lastly, the biotechnological control
of its formation and function. This book will be of major interest to all academic,
industrial and agricultural researchers as well as advanced undergraduate and graduate
students in plant biology, biotechnology, biochemistry, genetics, molecular biology and
food science.
This volume contains the main lectures and selected contributed papers that were
presented at the EU-TMR-Euroconference Symposium entitled "Biology and
Biotechnology of the Plant Hormone II" held in Thira (Santorini), Greece, September 5-
8, 1998. This international scientific event was organized by the Postharvest
Physiology and Biotechnology Group of the Institute of Viticulture, Vegetable Crops
and FloricuIture-N.AG.RE.F., Heraklion, Crete, Greece, the Institute of Molecular
Biology and Biotechnology-FO.R.T.H., Heraklion, Crete, Greece and the Laboratory of
Farmacognosy, Dept. of Pharmaceutical Sciences, Aristotle University of Thessaloniki,
Thessaloniki, Greece.
We would like to thank the European Commission of the European Union and
especially the TMR-Euroconference Programme, Cost Action 915, DGXII-INCO DC
Programme and DGXII-FAIR Programme. Special thanks go to the Ministry of
Education of Greece, Ministry of Culture of Greece, Hellenic Tourism Organization,
General Secretariat of Research & Technology of Greece and National Agricultural
Research Foundation of Greece for their financial support. Appreciation is also
xiii
xiv
extended to a number of private firms which contributed to the success of this important
event.
We are particularly indebted to the members of the scientific and local organizing
committees as well as to the staff of the P.M. NOMIKOS Conference site in Thira for
their efforts for the success of this Symposium. Lastly, we acknowledge the help of
Mrs. A. Giannakopoulou for handling secretarial aspects.
A.K. Kanellis, Thessaloniki (Greece)

C. Chang, College Park (MD, USA)
H. Klee, Gainesville (FL, USA)
A. B. Bleecker, Madison (WI, USA)
J.C. Pech, Toulouse (France)
D. Grierson, Sutton Bonington (UK)
ACC OXIDASE IN THE BIOSYNTHESIS OF ETHYLENE
P. JOHN I, E.A. REYNOLDS 1, A.G. PRESCOTT2 AND A.-D.

BAUCHOT 1
Department of. Agricultural Botany, School of Plant Sciences, The
University of Reading, Reading, RG6 6AS, UK. Department of Applied
Genetics, John Innes Centre, Norwich Research Park, Cotney Lane,
Norwich, NR44UH, UK
1. Abstract
The paper concerns two aspects of the role of l-aminocyclopropane-l-carboxylate

oxidase (A CO) in the biosynthesis of ethylene. First, a mechanism is proposed to
account for the provision of ascorbate to the enzyme functioning in the plant cell.
Evidence indicates that the enzyme is located in the apoplasm, at least in ripening fruit.
It is suggested that ascorbate in the apoplast remains in a reduced state by the outward
flow of reducing potential across the plasma membrane. Second, ACO is proposed to
have evolved from an ancestral Fe (H)-dependent dioxygenase so as to enhance ethylene
production as a regulated signal of plant stress. Among extant non-flowering plants,
ACO activity has been found only in seedlings of representatives of the Coniferales and
Gnetales. These results suggest that ACO arose relatively late in the evolution of the
land plants; an evolutionary event reversed by suppressing expression in genetically
engineered fruits.
2. Introduction
I-aminocyclopropane-l-carboxylate oxidase (ACO) is the enzyme responsible for the

final stage in the biosynthesis of ethylene in higher plants (Fig. 1). From considerations
of protein sequence and function ACO belongs to the family of Fe(II)-dependent
dioxygenases [I, 2]. When compared with other members of this enzyme family [3],
ACO shows two unique features: it uses ascorbate instead of 2-oxoglutarate as a co-
substrate, and it has an absolute requirement for CO 2 as a cofactor. The present paper is
concerned with two aspects of the role of ACO in the biosynthesis of ethylene. First,
we shall consider how the requirement for ascorbate is met in vivo; then we shall
examine the origin of the ascorbate-requiring ACO in the evolution ofland plants.
1
2
o OH
O~OH OH
HO OH
Fe(II) CO2
+ +
H2C=CH2
NH3+ +
[><COO- HCN + CO 2 +
Figure 1. Reaction catalysed by ACC oxidase.
3. Interaction of ACO with Ascorbate in vivo
ACO appears able to function in both the cytosol of plant cells and in the cytosol of
transgenic yeast cells [4-8]. In ripening climacteric fruit, where the highest ACO
activity is observed, there is evidence that the enzyme is localised predominantly in the
apoplast [7, 9]. Ascorbate occurs in the apoplast but it is unlikely that the
concentrations of apoplastic ascorbate reach those of the symplast [\ 0, \\]. Moreover
the apoplast does not appear to posses enzyme systems for the regeneration of ascorbate
from dehydroascorbate [II]. It was previously suggested [3, \2] that Cyt-b in the
plasma membrane [\3] could conduct electrons from cytosolic ascorbate for the
regeneration ofapoplastic ascorbate from its oxidised form (Fig. 2.).
The outward flow of negative charge across the plasma membrane would depend
upon the external positive charge of the plasma membrane generated by the electrogenic
proton pumping of the plasma membrane ATPase. The proposal finds a parallel in
chromaffin granules of the adrenal medulla where the internal ascorbate pool is
maintained in a reduced state by Cyt-b mediated electron transport across the granule
membrane [14]. The proposal is consistent with the results of Malerba and colleagues
[15-19] who showed that ACO activity in vivo is stimulated by enhanced proton
extrusion at the plasma membrane. It is also consistent with the observation that
protonophoric uncouplers, such as 2,4-dinitrophenol (DNP), which discharge the
ATPase-generated potential across the plasma membrane, inhibit ACC conversion to
ethylene in plant tissues [20, 21]. Under the same treatment cytosolic activities such as
that of ACC synthase remain relatively unaffected. These last observations were made
before ACO had been characterised [22]. When the ascorbate requirement for ACO
was recognised, Ververidis [23] showed that the ACO activity measured in melon fruit
discs was protected against DNP-inhibition by the addition of ascorbate and Fe(II).
Thus, as predicted by the model (Fig. 2) the DNP-sensitivity may depend upon
ascorbate coming, in effect, from the tissue.
3
In some tissues ascorbate and monodehydroascorbate may be transported directly

across the plasma membrane [24]. Significantly this transport is sensitive to inhibition
by ionophores in a manner consistent with the transport being driven by an
electrochemical proton gradient [24]. A clear picture of the in vivo action of ACO can
come only when we know more about the localisation of ACO in different tissues, and
how ascorbate (and ACC) cross the plasma membrane.
)C
Cyt-b
Ethylene _ ( Ascorbate)C GSSG \ ( NADPH
DHA
ACC Ascorbate DHA GSH) NADP
Apoplast Cytoplasm
Figure 2. Proposed model of how ascorbate is supplied to an apoplastic ACC oxidase.
4. Evolutionary Origin of ACO
Ethylene is released on the breakdown of a very wide range of organic compounds [25],
thus it is likely that small amounts of ethylene would be released whenever plant tissues
break down or decay, consequently it would have been available to the earliest land
plants as an indication of stress (a Fig. 3). It was previously suggested [13] that ACC
accumulated in early land plants as a side reaction from S-adenosyl methionine, an
- intermediary metabolite common to many plant stress response pathways (b Fig. 3).
Conversion of ACC to ethylene in a regulated manner by ACO could have served as a
means of generating a signal that reported the plant response to the stress, rather than
being simply a consequence of the stress applied (c Fig. 3).
A prerequisite of this proposed evolutionary transition is the ability of all land plants
to detect and respond to ethylene. Esch et al. (this volume) have provided evidence for
the presence of slow-release-ethylene-binding activity in representatives of all major
groups of land plants. It was also found in the cyanobacterium, Synechocystis where it
may have arisen from an original function as a copper scavenging protein.
4
Methionine ~ STRESS Cell damage

I
===~>
SAM synthase 1~ a
S-Adenosyl methionine "-... f b

ACC synthase
~
ACC
~
ACC oxidase
Lignification Polyamines
~ Ethylene
Betaine
Figure 3. In the evolution of land plants it is proposed that ACC oxidase arose as a means of
generating ethylene from ACC which had accumulated in a side-reaction of metabolic pathways up-
regulated by stress.
An initial screening of land plants for their ability to convert ACC to ethylene [26,
27] led us to locate the origin of ACO with the origin of the spermatophytes [28]. In
this survey ACC was supplied to excised leaf material; we have repeated the screen
using an in vitro assay for ACO [22]. When extracts were prepared from leaf material,
an ACO activity was recovered only from angiosperms. The leaves of many
gymnosperm species are rich in tannins and other compounds that can inhibit enzyme
activity. Thus we checked in each case that ACO activity from an angiosperm source
was not inhibited by co-extraction with leaf material from the gymnosperms. However,
when we turned from leaves to seedlings as a source of enzyme, in vitro ACO activity
was detected in representatives of the Coniferales and the Gnetales. In contrast ACO
was absent, when assayed either in vivo or in vitro, from representatives of the
Cycadaceae and Gingkoaceae. The activity which was recovered from seedlings of
representatives of Coniferales and Gnetales showed all the characteristics of angiosperm
ACO: it required CO 2, Fe(JI) and ascorbate and it was inhibited by the addition of
oxaloacetate.
We are now extending this work to identifY (i) the distribution of putative ACO
sequences in lower plants, and (ii) the patterns of transcription of ACO among different
tissues in different phylogenetic groups.
5. Concluding Remarks
Transgenic plants in which ACO activity is suppressed through the expression of an

antisense gene have been produced, first with tomato [29] and subsequently in other
fruit and flower crops. In Cantaloupe melon hybrids we have been comparing the
development of aroma volatiles in wild-type fruit and in fruit containing an ACO
5
antisense gene (Bauchot et al. this volume). This work exemplifies how ACO-
generated ethylene regulates specific components of a complex biochemical system.
We have proposed here (Fig. 3) that ACO arose relatively late in the evolution of land
plants. If future findings support this proposal, then the genetically engineered
suppression of ACO activity in tomato and melon can be viewed as a reversal of a
relatively recent evolutionary event; a reversal that occurred without human intervention
in Potamogeton pectinatus, where ACO activity has been lost naturally [30].
6. Acknowledgements
Weare grateful for financial support from the Research Endowment Trust Fund of the
University of Reading (E.R.) and the EU FAIR Programme (A-D. B.).
7. References
1. Prescott, AG. (1993) A dilemma of dioxygenases (or where biochemistry and molecular biology fail
to meet), J. Expt. Bot. 44, 849-861.
2. Roach, P.L., Clifton, 1.1., Fulop, Y., Harlos, K., Barton, G.J., Hajdu, J., Andersson, I., Schofield, C.J.
and Baldwin, J.E. (1995) Crystal structure of isopenicillin N synthase is the first from a new
structural family of enzymes, Nature 375, 700-704.
3. Prescott, AG. and John, P. (1996) Dioxygenases molecular structure and role in plant metabolism,
Annu. Rev. Plant Phys. Planl Mol. Bioi. 47,245-271.
4. Bouzayen, M., Latche, A. and Pech, 1.e. (1990) Subcellular localization of the sites of conversion of
l-aminocyc1opropane-l-carboxylic acid into ethylene in plant cells, Planla 180, 175-180.
5. Peck, S.e., Reinhardt, D., Olson, D.C., Boller, T. and Kende, H. (1992) I.ocalization of the ethylene-
forming enzyme from tomatoes, l-aminocyc1opropane-l-carboxylate oxidase in transgenic yeast J.
Plant Physiol. 140, 681-686.
6. Ayub, R.A., Rombaldi, C., Petitprez, M., Latche, A, Peeh, J.e. and Lelievre, J.M. (1993)
Biochemical and immunocytological characterization of ACC oxidase in transgenic grape cells, in
J.e. Pech, A Latche and C. Balague (eds.), Cellular and Molecular Aspects of the Plant Hormone
Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 98-99.
7. Rombaldi, C. Lelievre, 1.M., Latche, A., Petitprez, M .. , Bouzayen, M .. and Pech, J.e. (1994)
Immunocytolocalization of I-aminocyclopropane-I-carboxylic acid oxidase in tomato and apple
fruit, Planta 192, 453-460.
8. Reinhardt, D., Kende, H. and Boller, T. (1994) Subcellular localization of l-aminocyc1opropane-l-
carboxylate oxidase in tomato cells, Planla 195, 142-146.
9. LaIche, A, Dupille, E., Rombaldi, C., Cleyet-Marc1, J.e., Lelievre, J.M. and Pech, J.e. (1993)
Purification, characterization and subcellular localization of ACC oxidase from fruits, in J.e. Pech,
A Latche and e. Balague (eds.), Cellular and Molecular Aspects of the Plant Hormone Ethylene,
Kluwer Academic Publishers, Dordrechl, pp. 39-45.
10. Foyer, e.H. (1993) Ascorbic acid., in R.G. Alscher and J.L. Hess (cds.), Antioxidants in Higher
PlanlS, CRC Press Boca Racon, ppJ I-58.
II. Smirnoff, N. (1996) The function and metabolism of ascorbic acid in plants, Ann. Bot, 78, 661-669.
12. John, P. (1997) Ethylene biosynthesis: the role of l-aminocyc1opropane-l-carboxylate (ACC)
oxidase, and its possible evolutionary origin, Physiol. Plant. 100, 583-592.
13. Horemans, N., Asard, 1-1., and Caubergs, R.J. (1994) The role of ascorbate free radical as an electron
acceptor to cytochrome b-mediated trans-plasma membrane electron transport in higher plants, Planl
Physiol. 104, 1455-58.
14. lalukar, Y., Kelley, P.M. and Njus, D. (1991) Reaction of ascorbic acid with cytochrome b561 -
concerted electron and proton transfer, J. BioI. Chern. 266,6878-6882.
15. Malerba, M.. Crosti, P, Armocida, D. and Bianchctti, R. (1995) Activation of ethylene production in
Aeer pseudoplalanus L.cultured cells by fusicoccin, J. Plant Physiol. 145: 93-100.
6
16. Malerba, M., Crosti, P. and Bianchetti, R. (1995) Trans-plasma membrane reduction offerricyanide
induces an activation of l-aminocyclopropane-l-carboxylic acid oxidase in Acer pseudoplatanus L
cultured cells, J. Plant Physiol. 145, 580-582.
17. Malerba, M., Crosti, P. and Bianchetti, R. (1995) Regulation of I-aminocyclopropane-I-carboxylic
acid oxidase by the plasmalemma proton pump in Acer pseudoplatanus L cultured cells, J. Plant
Physiol. 145,711-716.
18. Malerba, M., Crosti, P. and Bianchetti, R. (1995) Ferricyanide induced ethylene production is a
plasma membrane proton pump dependent I-aminocyclopropane-I-carboxylic acid (ACC) oxidase
activation, J. Plant Physiol. 147, 182-190.
19. Malerba, M. and Bianchetti, R. (1996) A mutant of Arabidopsis thaliana with decreased activity of
the plasma-membrane proton pump lacks the fusicoccin-dependent stimulation of ethylene synthesis,
J. Plant Physiol. 147,614-616.
20. Yu, Y., Adams, D.O. and Yang, S.F. (1980) Inhibition of ethylene production by 2,4-dintrophenol
and high temperature, Plant Physiol. 66, 286-290.
21. John, P., Porter, AJ.R. and Miller, AJ. (1985) Activity of the ethylene-forming enzyme measured in
vivo at different cell potentials, J. Plant Physiol. 121,397-406.
22. Ververidis, P., and John, P. (1991) Complete recovery in vitro of ethylene-forming enzyme activity,
Phytochemistry30, 725-727.
23. Ververidis, P. (1991) Characterisation and partial purification of the enzyme responsible for ethylene
synthesis from l-aminocyclopropane-l-carboxylic acid in plant tissues, PhD thesis, The University of
Reading.
24. Rautenkranz, AAF., Li, L., MOchler , MOrtinoia, E., and Oertli, lJ. (1994) Transport of ascorbic
and dehydroascorbic acids across protoplast and vacuole membranes isolated from barley (Hordeum
vulgare L. cv Gerbel) leaves, Plant Physiol. 106, 187-193.
25. Abeles, F.B. (1973) Ethylene in Plant Biology, Academic Press, New York.
26. Osborne, 0.1 (1989) The control role of ethylene in plant growth and development, in H. Clijsters et
al. (eds.), Biochemical and Physiological Aspects of Ethylene Production in Lower and Higher
Plants, Kluwer Academic Publishers, Dordrecht, pp. I-II.
27. Osborne, OJ., Walters, J., Milborrow, B.V., Norville, A and Stange, L.M.C. (1996) Evidence for a
non-ACC ethylene biosynthesis pathway in lower plants, Phytochemistry 42,51-60.
28. John, P., Iturriagagoitia-Bueno, T., Lay, V., Thomas, P.G., Hedderson, TAl, Prescott, AG.,
Gibson, E.l & Schofield, CJ. (1997) l-aminocyclopropane-I-carboxylate oxidase: molecular
structure and catalytic function, in AK. Kanellis et al. (eds.) Biology and Biotechnology of the Plant
Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 15-21.
29. Hamilton, AJ., Lycett, G.W. and Grierson, D. (1990) Antisense gene that inhibits synthesis of the
hormone ethylene in transgenic plants, Nature 346, 284-287.
30. Summers, lE., Voesenek, LACJ., Blom, C.W.P.M., Lewis, MJ. and Jackson, M.B. (1996)
Potamogeton pectinatus is constitutively incapable of synthesizing ethylene and lacks 1-
aminocyclopropane-l-carboxylic acid oxidase, Plant Physiol. 111,901-908.
ANALYSIS OF ACC OXIDASE ACTIVITY BY SITE-DIRECTED
MUTAGENESIS OF CONSERVED AMINO ACID RESIDUES
O. KAOYRZHANOV A, T.J. MCCULLY, T. WARNER, K.

VLACHONASIOS, Z. WANG AND O.R. DILLEY
Postharvest Physiology Laboratory, Horticulture Dept., Plant and Soil
Sciences, Michigan State University, East Lansing, Michigan, 48824 USA
l. Abstract
Site-directed mutagenesis of ACC oxidase (ACO) was used to determine the nature and
role of conserved amino acid residues in the mechanism by which CO 2 activates the
enzyme. Mutants of ACO were expressed in E. coli as His-Tag fusion proteins. A
consensus sequence search of 38 known or putative ACO revealed 8 completely
conserved lysine residues; K72 , K 144 , K 158 , KI72, K 199 , K230 K292 and KZ96 All of the
lysine mutant forms were typically activated by COz indicating that none of them is
essential for CO 2 activation by a carbamylation mechanism. H 177 , H234 and 0 179 are
essential ligands for Fe. The H 177, H234 and 0 179 ligands for Fe in ACO have equivalent
residues in isopenicillin N synthase (IPNS) as H 214 , 0 216 and H270. ACO, a non-heme
Fe 2 +/ascorbate requiring enzyme, belongs to the IPNS protein structure family. The C-
terminal sequence from K292 through E 301 is important for enzyme activity and CO 2
activation; Arg299 may be involved in the mechanism of CO 2 activation. We prepared
R244K and S246A mutants to determine if these Arg and Ser residues may serve as
ligands for the carboxyl group of ACe. The R244K and S246A mutants were 5.4% and
35% as active, respectively, as the native enzyme but were typically activated by CO 2 ;
the Km values for ACC for the R244K and S246A mutants were increased 2- to 3-fold
compared to the native enxyme. This supports a putative role of Arg244 and Ser246 as
ligands for the ACC carboxyl group.
2. Itroduction
The plant hormone ethylene is of great significance to agriculture; it affects plant

development at all stages from seed germination to plant organ senescence. Its' effects
include: abscission of leaves, flowers and fruits, floral initiation, sex expression, and
fruit ripening among many others. Understanding how ethylene production is regulated
is of great practical and fundamental importance. We are studying the structure and
function of ACC oxidase to determine how it catalyzes the final step in ethylene
biosynthesis. We are employing site-directed mutagenesis of the protein to determine
the nature and role of key conserved amino acid residues important for oxidizing \-
7
8
aminocyclopropane-l-carboxylic acid (ACC) to ethylene, and to determine the

mechanism by which CO 2 activates the enzyme to be lO-fold more active than it is at
limiting ambient CO 2 levels in the atmosphere [2, 6].
3. Site-directed Mutagenesis
We prepared mutants by site-directed mutagenesis employing an E. coli vector

expressing apple ripening-related ACC oxidase [10] as His-Tag fusion proteins.
Enzyme activity of the mutant enzymes was examined in cell lysates [4]. A native
enzyme was prepared in parallel for each mutation for which the sequence was
confirmed [4].
Table I. None of the completely conserved lysine residues among 38 known or putative ACC oxidascs arc
essential for CO 2 activation of ACC oxidase.
Amino acid7. Cell Lysate

mutated
Activit~) C02 activation'
% of native native mutant
KI58E 32.0 11.6 12.0
KI58R 23.0 4.4 5.7
KI58Q 4.7 8.8 10.2
K158L 1.4 12.5 37.8
K230R 25.1 12.0 10.2
K230Q 22.0 7.7 8.5
K230E 7.4 8.4 5.1
K144E 65.6 5.6 5.4
KinE 53.9 5.4 7.7
KI99E 10.0 6.5 5.4
K292E 7.3 7.2 7.7
K296E 135.0 7.8 7.8
K72G73-EnT73 w 39.9 11.5 14.9
'Single letter abbreviations for amino acids: Arg, R; Glu, E; Gin. Q; Gly, G; Leu, L; Lys, K; Thr, T
'A native enzyme was prepared in parallel as the control for each mutation produced in the E. coli vector.
Activity is % of native enzyme activity.
'C02 activation expressed as ratio of enzyme activity at CO, saturation vs. air level CO,.
wThe double mutant was required to express the full length protein.
4. Carbamylation of Conserved Lysine Residues is not the Mechanism of CO 2

Activation
A consensus sequence search of 38 known or putative ACC oxidases revealed 8

completely conserved lysine (K) residues; K72, K144, KISS, KI72, K 199 , K 230 K292 and K296
(see footnotes to the tables for the single letter abbreviations for the amino acids
employed). Whereas some mutants, notably K 158L, K 199E, K230E and K292E
mutants, were only slightly active all mutant forms were typically activated (5 to 10-
9
fold) by CO 2 (Table I). This indicates that none of them is essential for CO 2 activation
by a carbamylation mechanism when examined as single point mutations. This confirms
the results of Chamg et al. [I] who mutated seven of these lysine residues to arginine
and found that all the mutants were CO 2 activated.
Table 2. Hisl77, His 2J4 and ASp 179 are ligands for iron in ACC oxidase. Gln ' s, Gln m , and HisJ ' are not
essential for activity nor CO 2 activation. Asp substitutes for Glu"'for activity and CO, activation while the
E30lL mutant has very low activity but is activated by CO,. ArgW and Ser 46 are ACe carboxyl group
ligands.
Amino acid' Cell Lysate
mutated
Activitt CO 2 activation'
HI77F 0 9.7 0
HI77E 0.3 12.9 15.7
HI77D 0 5.6 0
HI77Q 0.93 8.1 7.1
HI77N 0 12.7 0
H234F 0 9.8 0
Dl79L 0 11.1 0
H39F 86.0 10.4 12.4
Q294F 25.6 6.8 6.7
QI88A 19.2 7.8 8.6
QI88N 4.9 5.7 14.0
Ql88K 3.9 7.1 16.9
E30lD 43.3 6.3 7.8
E301L 2.64 17.0 15.1
R244K 5.4 8.9 12.6
S246A 35.0 8.6 10.4
7.Single letter abbeviations for amino acids: Ala, A,: Asn, N; Asp, D; Arg, R; Gill, E; Gin, Q; His, H; Leu, L;
Lys, K; Phe, F; Ser, S.
YA native enzyme was prepared in parallel as the control for each mutation produced in the E. coli vector.
'C0 2 activation expressed as ratio of enzyme activity at e02 saturation vs. air level CO2
5. Fe Binding Site
ACC oxidase is a Fe 2+/ascorbate requiring enzyme. We previously demonstrated [4] that

Hl77, H234 and 0 179 are essential ligands for Fe confirming the results of John el al. [5]
and Shaw et al. [9]. H39 and glutamine Q294, although completely conserved, are not
essential for enzyme activity. Low residual activity of the HI77F mutant found to be
independent of CO 2 [4] when examined as the purified fusion protein suggested that
HI77 might be directly involved in the CO 2 activation mechanism. Further studies with
the H 177F fusion protein assayed in cell lysates have not confirmed this (Table 2).
However, the HI77E mutant fusion protein shows low residual activity that is only
weakly activated by CO 2 while the H 1770 mutant has no activity. The low residual
activity of the H 177E mutant shows Fe concentration-dependent CO 2 activation; as the
Fe concentration is increased from 2.5 to 80 11M, CO 2 activation increases from nil to
10
about 5-fold. The Hl77Q mutant has low residual activity, which is dependent on CO 2 ,
while the H177N mutant is not active. These data suggest that CO 2 activation may
involve direct participation of Hl77. The H l77 , H234 and D 179 ligands for Fe in ACC
oxidase have the same residues in common in isopenicillin N synthase (IPNS) as H214 ,
D216 and H270 according to crystal structure analysis of IPNS [7, 8]. ACC oxidase,
among several other non-heme Fe2+/ascorbate requiring enzymes, has been shown to
belong to the same protein structure family as IPNS.
Table 3. Lys292, Glu297 and Glu301 flanking the important Arg299 strongly affect ACC oxidase activity but
their residual activities are activated by CO2
Amino Acid Cell Lysate

MutatedZ
Activi!t CO, activation'
K292E 7.3 7.2 7.7
Q294F 25.6 6.8 5.5
K296E 135.0 7.8 7.8
E297L 2.2 5.2 10.8
R299K 99.2 7.0 8.1

R299L 0.43 9.5 23.0
R299H 0.21 16.6 4.0
R299E 0 7.6 0
E301D 43.3 6.3 7.8

E30lL 2.6 17.0 15.1
ZSingle letter abbreviations for amino acids: Arg, R; Asp, D; Gin, Q; Glu, E; His, H; Leu, L; Lys, K; Phe, F.
YA native enzyme was prepared in parallel as the control for each mutation produced in the E. coli vector.
'CO, activation expressed as ratio of enzyme activity at CO2 saturation vs. air level CO 2
6. C-terminal Region of ACC Oxidase Is Important for Enzyme Activity and CO 2

Activation
Some of the residues in the C-terminal region are critically important for enzyme
activity. This portion of the protein is predicted to be in close proximity to the catalytic
site [8]. Of the conserved residues, K292 , E297 , R299 and E301 are important while Q294
and K296 are not (Table 3). When R299 was mutated to lysine, the R299K mutant was
equivalent in activity and CO2 activation to that of the native protein while the R299E
mutant was not active. This suggests that a strong positive charge as provided by Arg
or Lys at position 299 is important for activity. Histidine also has a positive charge at
neutral pH 7 but the R299H mutant had low residual activity poorly activated by CO 2.
Since the R299K mutant is equivalent in activity and CO2 activation to that of the native
enzyme while the R299H mutant is not, this suggests the possibility that Arg299 may be
subject to carbamylation or otherwise affected by CO2 and thus explain CO 2 activation.
The guanido-N of Arg is not known to be carbamylated [1] so the effect of CO 2 may be
through another mechanism. Moreover, the R299L mutant had low residual activity
11
and this was well activated by CO 2, The E301 D mutant was about 50% as active as the
native enzyme and was typically activated by CO 2 whereas the E301L mutant had low
activity and was activated by CO 2 These data indicate that the C-terminal sequence
from K292 through E J01 is important for enzyme activity and CO 2 activation. The
sequence from L291 through E297 is predicted to be a-helical in nature followed by the
helix-breaking p298. This would place R299 at a bend or loop and perhaps explain the
requirement for the positive charge at this position for COz-dependent activation. We
are currently preparing mutants for p298 and FJOO (which are completely conserved
residues among the ACC oxidases) to determine their role(s).
7. ACC Binding Site
l-aminocyclopropane-I-carboxylic acid (ACC) is recognized as a D-amino acid by

ACC oxidase [1]. The binding site for the D-valinyl residue in the IPNS tri-peptide
substrate (L-adipoyl-L-cysteinyl-D-valine) includes residues providing Van der Waals
forces for interacting with the D-valine isopropyl group [8] and ACC oxidase is
predicted to have similarly placed residues. Arg244 and Ser246 in ACC oxidases are
conserved and the equivalent residues in IPNS (Arg279 and Ser28 I) are H-bonded to
the D-valinyl carboxyl group of the IPNS substrate [8]. ACC oxidase also catalyzes
oxidation of alpha-aminoisobutyrate, D-alpha-aminobutyrate and D-alanine and these
are all competitive inhibitors of ACC oxidase with respect to ACC because they are
alternative substrates. Cyclopropane-I-carboxylic acid is also a competitive inhibitor of
ACC oxidase. The inhibitory substrates all probably have a common binding site for
the carboxyl group. The oxidation of D-alpha-aminobutyrate and alanine yields the
corresponding aldehydes, CO 2 and ammonia [1]. Alpha-aminoisobutyrate oxidation
yields CO 2 , ammonia and acetone. ACC oxidase converts D-valine to iso-butanal [3].
Based on these observations we prepared R244K and S246A mutants to determine if
these Arg and Ser residues may serve as ligands for the carboxyl group of ACe. The
R244K and S246A mutants were 5.4% and 35% as active, respectively, as the native
enzyme but were typically activated by CO 2 (Table 2). The Km values for ACC for the
R244K and S246A mutants were increased by about 2- to 3-fold. The efficiency of the
R244K mutant for ACC as substrate (Vmax IKm) was only about 2% of that of the
native enzyme and that of the S246A mutant was 6%. This supports a putative role of
Arg244 and Ser246 as ligands for the ACC carboxyl group perhaps by H-bonding as
was shown for the D-valinyl carboxyl group of the IPNS substrate [3]. Moreover,
Arg244 is more important than Ser246 in H-bonding to the ACC carboxyl group. We
are currently preparing the R244K-S246A double mutant which should be largely
inactive. The Km for ascorbate for the R244K mutant was 1.9 times greater than that
of the native enzyme while the Km for the S246A mutant was 1.6 times less than that of
the native enzyme. The Km for CO 2 for the R244K mutant was 1.8 times greater than
that of the native enzyme whereas that for the S246A mutant was about 1.5 times
greater. The efficiencies of the R244K and S246A mutants for ascorbate as substrate
were 21 and 44%, respectively, while for CO 2 the efficiencies were 9 and 25%,
respectively. These data suggest that proper binding of ACC to R244 and S246 is
important for the enzyme to use ascorbate as a co-substrate in the reaction and for CO 2
12
activation. Since the Km for ascorbate was lowered for the S246A mutant and raised
for the R244K mutant by similar magnitudes, this suggests that ACC binding directly
affects ascorbate binding.
8. Other Mutants
We have also prepared mutants Q188A, Q188N, Ql88K that differ greatly in activity
but are all CO 2 activated (Table 2]. For the 3 conserved cysteine residues (C 2S , Cl33 and
C l65 ] only C28 is very important for activity but all the cysteine mutants C28A, C133A,
C133P (proline] and C165A are about equally active and typically activated about 10-
fold by CO 2 [4].
9. Acknowledgements
This work was funded by USDA-NRI Grant # 9602627 and the Michigan Agricultural
Experiment Station.
10. References
1. Charng, Y.Y., Lin, Y., Dong, J.G. and Yang, S.F. (1997) On I-aminocyclopropane-I-carboxylate
(ACC) oxidase, in AK. Kanellis et al. (eds.), Biology and Biotechnology of the Plant Hormone
2. Fernandez-Maculet, J.C., Dong, J.G. and Yang, S.F. (1993) Activation of l-aminocyclopropane-I-
carboxylate oxidase by carbon dioxide, Biochem. Biophys. Res. Comm. 193,1168-1173.
3. Gibson, E.l, Zhang, Z., Baldwin, lE. and Scholdield, CJ. (1998) Substrate analogues and
inhibition of ACC oxidase: conversion ofD-valine to iso-butanal, Phytochemistry 48,619-624.
4. Kadyrzhanova, Dina, McCully,IJ., Jarwarski, SA, Ververidis, P., Vlachonasios, K., Murakami,
K.G. and Dilley, D.R. (1997) Structure-function analysis of ACC oxidase by site-directed
mutagenesis, in A.K. Kanellis et al. (eds.), Biology and Biotechnology of the Plant Hormone
5. John, P., lturriagagoitia-Bueno, Lay, V., Thomas, P.G., Hedderson, I.AJ., Prescott, AG., Gibson,
EJ. and Schofield, CJ. (1997) I-aminocyclopropane-I-carboxylate oxidase: molecular structure
and catalytic function, in AK. Kanellis, et al. (eds.), Biology and Biotechnology of the Plant
6. Poneleit, L. and Dilley, D.R. (1993) Carbon dioxide activation of l-aminocycJopropane-l-
carboxylate (ACC) oxidase in ethylene biosynthesis, Postharvest BioI. and Technol. 3,191-1993.
7. Roach, P.L., Clifton, I.J., FUlOp, V., Harlos, K., Barton, G.F., Hajdu, J., Anderson, 1., Schofield,
CJ. and Baldwin, lE. (1995) Crystal structure of isopencillin N synthase is the first from a new
structural family of enzymes, Nature 375,700-704.
8. Roach, P.L., Clifton, I.J., Hensgens, C.M.H., Shibata, N., Schofield, C.J., Hajdu, J.and Baldwin,
J.E. (1997) Structure of isopenicillin N synthase complexed with substrate and the mechanism of
penicillin formation, Nature 387,827-830.
9. Shaw, J.F., Chou, Y.S., Chang, R.C. and Yang, S.F. (1996) Characterization of the ferrous ion
binding sites of apple I-aminocyclopropane-I-carboxylate oxidase by site-directed mutagenesis,
Biochem, Bio. Res. Commun. 225:697-700.
10. Wilson, LD., Zhu, Y., Burmeister, D.M. and Dilley D.R. (1993) Apple ripening-related cDNA
clone pAP4 confers ethylene-forming ability in transformed Saccharomyces cerevisiae, Plant
Physiol. 102,783-788.
EVALUATION OF NOVEL INHIBITORS OF ACC OXIDASE POSSESSING
CYCLOPROPYL MOIETY
V. DOURTOGLOU, E. KOUSSISSI, AND K. PETRITIS

Viory/ SA, Vitanioti St. 36, GR-145 64 Kifissia, Athens, Greece
1. Abstract
Ethylene production is inhibited by several new structural analogues of amino

cyclopropane carboxylic acid (ACC), without an amine function in the Cl position.
The Substituted Cyclopropane Carboxylic Acids (SCCA) require a minimal
cyclopropane ring but no amine function to exhibit inhibition. Ethylene inhibition was
essayed on tomato discs, and on partially purified ACC oxidase from apple fruits.
These new inhibitors possess a cyclopropane ring and a substituant (R2) in the C2
position. First results showed that the amount of ethylene inhibition is strongly
correlated to the chemical structure of (R2, R5) and to the presence or not of a
carboxylic function in the CI position of the cyclopropane ring. To evaluate the nature
of inhibition, kinetic studies were made using partially purified ACC oxidase from
apple fruits. From all the inhibitors tested the best results were obtained using trans -
phenyl cyclopropane carboxylic acid and cyclopropane I, I dicarboxylic acid.
2. Introduction
Ethylene is a plant hormone that profoundly influences many diverse aspects of plant
growth development and responses to environmental stresses. I-aminocyclopropane-I-
carboxylate (ACC) synthase and ACC oxidase (ACO) are the two key enzymes of the
biosynthetic pathway [1,2,3,4,9]. ACO has been extracted and purified from various
fruit species, [2, 3, 4, 5, 6]. I-Amino cyclopropane-I-carboxylate (ACC) oxidase
catalyses the final step in the biosynthesis of ethylene in plants. The above enzyme
belongs to a family of felTous iron (Fell) oxidases and requires carbon dioxide (C02) as
activator [7,8, 10].
The global reaction is described by the following equation:
ACC+0 2 +ascorbate -----. C2 H4 +HCN+C0 2 +H 20+dehydroxyascorbate

This enzyme has a structural similarity with the non-heme oxygenases [10] and like
the other enzymes of the same family requires dioxygen as co-substrate. Previous work
has been done in order to clarify the exact mechanism of catalysis, which is still
unknown.
13
14
It has been proved using site directed mutagenesis that H177 and Dl79 of ACC
oxidase participate in the catalysis mechanism and CO 2 activation does not necessariily
involve LYS participation for carbamate formation [12, 15, 16, 17]. It has also been
demonstrated that some oxo-acids act as inhibitors. [16]. In addition, ACC oxidase
catalyses oxidation of ACC in a stereospecific way as already shown [3, 7] with the
recombinant apple ACC oxidase [6, 17] and the avocado fruit enzyme.
The synthesis of novel inhibitors requires knowledge of the mechanism of the active
centre catalysis. New inhibitors should have specificity for ACC oxidase and should
not interfere with other enzymes ofthe plant.
3. Materials and Methods
3.1. PLANT MATERIAL
Cherry tomatoes were grown in the greenhouse of Vioryl S.A. under hydroponic
conditions using perlite as substrate and liquid fertiliser (Auxenol, Stabolin 1, Stabolin
2) which are commercial products of VIORYL S.A. Apples "Golden Delicious" were
purchased from the local market.
3.2. CHEMICALS
All chemicals were purchased from commercial sources. Potential inhibitors were
purchased from ACROS and FLUKA except: trans-2-phenylcyclopropane carboxylic
acid (PCCA), which was synthesised in VIORYL S.A.
3.3. IN VITRO EVALUATION OF THE INHIBITORS USING TOMATO FRUIT

DISCS
Cherry tomatoes were cut in two pieces, and put in Erlenmeyer flasks with an open top
screw cap, equipped with silicon rubber septum. Half of each tomato was covered with
3ml of inhibitor and half with 3ml of water. The experiment was done for three different
inhibitor concentrations: 0,25-0,5-0,7 mM. After 19h at 300C the produced ethylene in
each flask was calculated by gas chromatography (1 ml gas samples were withdrawn
from the headspace and the amount of ethylene produced was analyzed by GC).
3.4. EXTRACTION AND PARTIAL PURIFICATION OF THE ACC OXIDASE

(ACO) FROM APPLES
Unless otherwise stated all operations were carried out at 4C. 100g of apple (cut in 4-5
pieces) were turned into powder inside a thermomixer that contained liquid nitrogen,
and a spoon of sea sand. The powder was mixed with buffer A (0,1 M Tris-HCI
(pH=7.4), 10% (v/v) glycerol, 30mM sodium ascorbate, 5mM DDT, 1% PVP 40000).
The proportion of buffer to apple (v/w) was 2: 1.
The mixture was then centrifuged at 13000 rpm for 40 min, the supernatant was
30% saturated in ammonium sulphate, and centrifuged again under the same conditions.
15
The supernatant was then 90% saturated in ammonium sulphate, and centrifuged for the
third time under the same conditions. Protein was precipitated from the supernatant by
ammonium sulphate added at 90% saturation and collected by centrifugation as above.
Thereafter the pellet was thawed and resuspended in 5mL of buffer B (Tris-HCI 20mM
(pH=7.4), Glycerol 10% (v/v), sodium ascorbate 3mM, DDT ImM), saturated 1M in
ammonium sulphate. Then 2mL of the dissolved pellet were desalted by passage
through a column of Sephadex-G25, 33,5cm long (radius: 0,75cm) that had been
equilibrated with Buffer B. 30 fractions of3,5mL were collected.
3.5. ASSAY FOR ENZYMATIC ACTIVITY
Enzymatic activity was measured according to two slightly different methods. A) Inside
a 5 ml vial, equipped with a cap with silicon septum, was put the reaction mixture,
consisting of: IOmM NaHC0 3, 20llM FeS04, 0,25mM ACC, 100llL of enzymatic
extract, made up to ImL with buffer B. Enzyme extract was always added last, and the
vial was immediately closed with its cap. ACO activity was assayed by measuring the
ethylene produced by GC (Varian 3700), after incubation for Ih at 35C. In this case to
take samples from the vial headspace, a gas tight syringe of ImL was used. B) In some
cases 2 ml vials were used where the total volume of the reaction mixture remained
1mL so the headspace left was I mL. Also, in this case the final concentration of FeS04
in the reaction mixture was changed to 200IlM. Ethylene was measured using the
Varian 3800 Gas chromatograph, equipped with a capillary RT-Q-PLOT column
(RESTEC) (0,53mm i.d., 15m, 0,5Ilm) with a Helium flow rate of 8mLlmin at 50C.
Column temperature was stable at 50C (isotherm), and the detector was maintained at
150C. The GC was also equipped with an autosampler (Varian 8200) which would
take 10 0 ilL samples from the headspace of the vials and inject them. Using this facility
ethylene was measured after incubation for 10min at 30 D C.
In order to estimate the initial velocity of the reaction, in some experiments, we
measured the ethylene produced both after 10 and 20 min of incubation. The value of
Uo in each case was calculated using an Excel curve-fitting program and the data of
each experiment.
4. Results
The elution profile of ACO after desalting by Sephadex-G25 column is shown in Figure
1. The fractions used for the determination of the inhibitory effect were those of the
highest activity. In general maximal activity was found between fractions 6 and 10.
4.1. EVALUA TION OF THE INHIBITORS
The apparent value ofKm for ACO was determined and found to be 25-30IlM, In order
to evaluate the inhibitors further purification was not required; the inhibitory effect of
the new compounds was determined, using the same enzyme extract both for the
inhibitor and the blank assays.
16
l\
\ :
T~ i
~ ~
~
"-"\.
, /
~
o 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32
Fraction num ber
Figure 1. Elution profile of apple ACO from Sephadex G-25 column (33.5 cm long,
radius 0.75). The fractions used for the all the assays are 7, 8, 9.
As shown in Table 1, the highest inhibitory effect has been observed for the
compounds: CDA, CPA, CMK, and PCCA (see the legend to Table I for
abbreviations). Compounds like CCA exhibit activation effect like CO 2 Further
studies are required to determine if ACO I oxidizes the above inhibitors to others
compounds and what is the chemical structure of the reaction products.
2-MCM, CMC, MCC tested as potential inhibitors of ACC oxidation, using ACOI,
did not reveal any inhibition effect and this is probably due to the lack of a strong
nucleophilic group attached to the active site. As shown in Table I, the above three
compounds have as the Rl group a primary or secondary alcohol, or an ester.
Comparing the effect of a bulky chain at C2 carbon (R2 group) we found that by
increasing the size of the R2 group increased the rate of inhibition if the position C I is
occupied by a strong nucleophilic group like a carboxylic or amino group.
CMK possessing a methyl ketone in the C I position revealed an inhibition also,
possibly due to a ligation to iron in the active site.
4.2. EVALUATION OF THE INHIBITORS IN TOMATO DISC EXPERIMENTS
The inhibitory effect ofPCCA and CHRA (see the legend to Figure 3 for abbreviations)
has been evaluated in tomato disc experiments. Inhibition of ethylene production 24
hours was observed in tomato discs treated with 5mM and 10 mM of the inhibitors and
production of ethylene plotted against tomato discs treated only with water. In Figure 3
the inhibitory effect of the two compounds on tomato discs is more clearly shown over a
short time scale.
The results observed from the inhibition of ethylene production from tomato discs
are in agreement with these obtained from the inhibition of ACC oxidation using
partially purified apple ACOl. The cyclopropane -I,l-dicarboxylic acid has not been
tested in tomato disc experiments.
17
~3
H~5
R2 R1
TABLE 1. Evaluation of the inhibitory effect of cyclopropane compounds on ethylene production from ACC
using apple ACOI extract.
I n(%)
Inhibitor Chemical Structure ofRl, R2, R3, R4, R5 Ki Km KmI
[ImM]
Rl R2 R3 R4 R5
PCCA COOH C5H6 H H H 50[10] 8,6 16 18

MCA COOH CH3 H H H See Figure 2
CCA COOH H H H H Activator
0,1
CDA COOH H H H COOH 88 [1] 30 30
8
C C
CRHY COOH (CH3)2C=CH H 23 [5] No kinetic models
H3 H3
C C
CRHA CH20H (CH3)2C=CH H 11 [10] No kinetic models
H3 H3
2-MCM CH20H CH3 H H H No inhibition

CHOHC
CMC H H H H No inhibition
H3
CMK -COCH3 H H H H 35 [1] No kinetic models
COOCH
MCC H H H H No inhibition
3
CPA NH2 H H H H 51 [1] No kinetic models
PCCA: Trans-2-Phenylcyclopropane-l-carboxylic acid, MCA: 2-Methylcyclopropanecarboxylic acid CCA:

Cyclopropanecarboxylic acid, CDA: Cyclopropane-I, I-dicarboxylic acid CRHY: Trans-2-Chrysanthemic
acid, CHRA: Chrysanthemyl alcohol, 2-MCM: 2-Methyl-Cyclopropane-Methanol CMC: Cyclopropyl methyl
Carbinol, CMK: Cyclopropyl methyl Ketone, MCC: Methyl Cyclopropane carboxylate, CPA
Cyclopropylamine, In%, [I] = % of inhibition of ethylene production, using apple ACO 1 at [ACe] = 250!JM.
[I] indicates the concentration in mM of the inhibitor, KmI is the Km in the presence ofthe Inhibitor
5. Discussion
Ki values were obtained for PCCA and CDA, which exhibited a non-competitive
inhibition. The apparent Ki was found to be 8.6 mM for PCCA and 0.18 mM for CDA.
From the kinetic data it was not possible to predict the type of inhibition for all the
inhibitors due to non-linearity in Lineweaver -Burk plots. Taken into consideration that
previous authors reported [12] that iron is li~ated to HI77, Dl79 and H234, we propose
a schematic active site with ferrous iron (Fe I) in an octahedral configuration with three
18
bonds occupied by the side chains of the above amino acids, and two others with the
amino carboxylic group of ACC in a bidentate five atom ring. The last one should be
occupied from the hydroxyl group of ascorbic acid.
,~ 5 t------~==::_::=__---------____1
e
~ 4+----~------~~~------~
0>
~ 3+--~~----------------~
'E
~ 2r~;r~======;:=:~~::;;~:;~==~::~~
i1hf---.~:F===4.-L---"-----------i
~ o~=---~x--.--x~x~x:-------xj
0,2 0,4 o,e 0,8 1 1.2 1,4 11e
-1L--------------------~
mMofACC
-+-0 ___ 10mM -+-15mM -X-20mM
Figure 2. Effect of different concentrations of 2-methylcyclopropanecarboxylic acid

on Ethylene production using an ACOI apple extract.
I 2 3 4 5 6 7 8 9 10 II 12 13
Hours (h)
-+- Tomato disks + water

_ 10 mM trans-2-Phenylcyclopropane-I-carboxylic acid
- . - 10 mM Chrysanthemyl alcohol
Figure 3. Inhibition of ethylene production from tomato discs using 10 mM of

trans-2-phenylcyclopropane -I-carboxylic acid (PCCA) and Chrysanthemyl
alcohol (CHRA)
19
If ACC binds to the ferrous iron (Fell) with both the amino and carboxyl groups, the
obtained stable spatial conformation partially explains the sterospecificity of ACC
oxidation, clearly demonstrated in the case of (I R, 2S)-1-amino-2-ethy lcyclopropane-1-
carboxylic acid (AEC) by previous authors [6, 7]. The ethyl group attached to C2
position of AEC in the diasteroisomer (1 R, 2S) has not steric hindrance to an
intramolecular oxidation. This fact leads us to suggest that the oxidation occurs by a
iron (H)-linked peroxide in a unique spatial orientation. While this is not the aim of this
study it must be taken into consideration in order to propose a model of inhibition.
ASCORBATE
Figure 4. The schematic intermediate (B) resulting from the action of hydrogen peroxide
at the active site of ACOI.
PCCA ..
__
0C;N
0,
o/O-r~:::""
I N
I
-...
/:"--./
./,
N Fe
H '"'e.... ~ci
ASCORBATE o L-(_N I
N:::d ASCORBATE
Figure 5. Schematic reaction with the PCCA in the intermediate (8)

20
with ferrous iron (Fell). The bulky side chain attached to C2 of the inhibitor influences
the replacement of the inhibitor from the ACC, when the first is attached prior to ACC
to the ferrous iron (Fell) active site. The bulky side chain also leads to a less active
ACOI conformation by disturbing the internal geometry of the enzyme active site.
6. References
I. Yang, S.F. and Hoffman, N.E. (\984) Ethylene biosynthesis and its regulation in higher plants, IInnu.
Rev. Plant Physiol. 35, 155-189
2. Dong, J.G., Olson, D., Silverstone, A and Yang, S.F. (1992) Sequence of a eDNA coding for a 1-
aminocyclopropane-I-earboxylate oxidase homolog from apple fruit, Plant Physiol. 98,1530-1531
3. Fernandez-Maculet, le. and Yang, S.F. (1992) Extraction and partial characterization of the
ethylene-forming enzyme from apple fruit, Plant Physiol. 99, 751-754
4. Yerveridis, P. and John, P. (1991) Complete recovery in vitro of ethylene-forming enzyme activity,
Phytochemistry 30, 725-727
5. Dupille, E., Latche, A, Roques, e. and Pech, le. (1992) Stabilization in vitro et purification de
I'enzyme formant I 'ethylene chez la pommc, C.R. Acad. Sci. PariS, Serie 1II, t 315, 77-84
6. McGarvey, I. and Christoffersen, R.E. (1992) Characterization and kinetic parameters of cthylene-
forming enzyme from avocado fruit, 1. BioI. Chern. 267,5962-5967
7. Charng, Y.-Y., Dong, J.-G. and Yang, S.F. (1996) Structure-function studies on the 1-
aminocyclopropane-I-carboxylic acid (ACC) oxidase carbon dioxide binding site. in NATO
Advanced Research Workshop, Biology and Biotechnology of the Plant Hormone Ethylene, June 9-
13, Chania, Crete, Greece
8. Dilley, D.R., Wilson, I.D., Burmeister, D.M., Kuai, J. Poneleit L., Zhu, Y., Pekker, Y. Gran, e. and
Bower, A (1993) Purification and characterization of ACC oxidase and its expression during
ripening in apple fruit, in J. C. Pech et al. (eds.), Cellular and Molecular Aspects of the Plant
9. Dong, J.G., Femandez-Maculet, J.e. and Yang, S.F. (1992) Purification and characterization of 1-
aminocyc\opropane-I-carboxylate oxidase from ripe apple fruit, Proc. Natl. Acad. Sci. USA 89,
9789-9793.
10. Femandez-Maculet, J.e. and Yang, S.F. (1993) Activation of I-aminocyclopropane-I-carboxylate
oxidase by carbon dioxide, Biochem. Biophys. Res. Comm.193, 1168-1173.
11. Dupille, E., Rombaldi, e., Lelievre, J.M., Cleyet-Marel, le., Pech, le. and Laiche, A (1993)
Purification, properties and partial amino-acid sequence of l-aminoeyclopropane-I-carboxylic acid
oxidise from apple fruits, Planta 190:65-70.
12. Barlow, J., Zhang, Z., 10hn, P., Baldwin, lE. and Schofield, C.1. (1997) Inactivation of 1-
Aminocyclopropane-I-carboxylate oxidase involves oxidative modifications, Biochemistry, 36.
3563-3569.
13. Zhang Z. H., Barlow J.N., Baldwin J.E. and Schofield e. (1998) Metal-catalysed oxidation and
mutagenesis studies on the iron (II) binding site of I-aminocyclopropane-I-carboxylate oxidase,
Biochemistry, 36, 15999-16007.
14. Pirrung, M.e., Kaiser, L.M. and Chen, J. (1993) Purification and properties of the apple fruit
ethylene-forming enzyme, Biochemistry, 32, 7445-7450.
15. Kadyrzhanova, D.K, McCully, T.1., Jaworski,S.A, Yerderidis P, Ylachonasios K.E., Murakami, K.J.
and Dilley, D.R. (1997) Structure-function analysis of ACC oxidase by site-directed mutagenesis, in
A.K. Kanellis et at. (cds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer
Academic Publishers, Dordrecht, pp. 5-13.
16. John, P., Iturriagagoitia-bueno, T., Lay, Y., Thomas, P.G., Hedderson, T.A.J., Prescott, A.G., Gibson,
E.G. and Schofield, C.1. (1997) l-Aminocyclopropane-I-carboxylate oxidase: Molecular structure
and catalytic function, in A.K. Kanellis et at. (cds), Biology and Biotechnology of the Plant
17. Charng, Y., Lui, Y., Dong, J.G. and Yang, S.F. (\997) On I-aminocyclopropane-I-carboxylic acid
(ACC) Oxidase, in A.K. Kanellis et al. (eds.), Biology and Biotechnology of the Plant Hormone
Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 23-29
CHARACTERIZATION OF THE PROMOTER OF THE MUNG BEAN AUXIN-
INDUCIBLE ACC SYNTHASE GENE, Vr-ACS6
I.S. YOON 1, D.H. PARKI, H. MORI 2, B.G. KANG 1 AND H. lMASEKe

JDepartment of Biological Sciences, Yonsei University, Seoul, Korea,
2Graduate Division of Biochemical Regulation, Nagoya University,
Nagoya, Japan
1. Abstract
Auxin-induced ethylene production in mung bean hypocotyls is further modified by

other plant hormones. Cytokinin synergistically stimulates, and abscisic acid and
ethylene suppress auxin-induced ethylene production. We have isolated an ACC
synthase gene, Vr-ACS6, the expression of which is specific to auxin. Transgenic
tobacco plants were prepared with a fusion gene in which the GUS gene was placed
under the Vr-ACS6 promoter (1.5 kb), and seedlings obtained from T1 seeds were
treated with combinations of auxin and cytokinin, abscisic acid or ethylene, then GUS
activity was assayed. The expression of GUS activity was specific to auxin (lAA, 2,4-0
or NAA) and the degree of expression was dependent on concentrations of lAA, with a
detectable GUS activity as low as 0.1 11M lAA. lAA-induced GUS expression was
stimulated by simultaneous presence of cytokinin, and suppressed by ABA and
ethylene. These interactions were also confirmed by GUS staining of treated seedlings
of both green and etiolated transgenic plants. In etiolated seedlings, GUS stain was
observed in the elongation zone ofhypocotyls, whereas in green seedlings, the stain was
observed in shoot tips and cotyledons. These interactions were found to affect the rate
of ethylene production in mung bean hypocotyls. The results indicate that the 1.5 kb 5'-
untranscribed region of Vr-ACS6 gene contains all these elements necessary for the
hormone interactions.
2. Introduction
The rate of ethylene production in higher plant is changed by a number of internal as

well as external stimuli. Auxin is a notable internal stimulus that increases dramatically
the ethylene production rate in a concentration dependent manner. This increase results
from an increased endogenous activity of ACC synthase that is caused by activated
transcription of a specific isogene of ACe synthase [I, 2). Genes of Aee synthase are
comprised of a small gene family, and some of the isogenes are expressed in response to
a specific stimulus. Using winter squash, tomato, and mung bean Ace synthase
isogenes, we have functionally classified the isogenes into 3 groups; auxin-, wound- and
ripening-inducible isogenes [3].
21
22
Mung bean, which we have used for physiological as well as biochemical studies of
ethylene production, was reported to contain at least 5 isogenes (Vr-ACSI - 5) [4, 5],
and a sequence fragment of an ACC synthase isogene which was different from any of
the 5 genes was also isolated (Vr-ACS6) and its expression was induced by auxin [6].
Botella et al. [7] reported that the Vr-ACSI isogene was induced by auxin, and recently,
Kim et al. [8] also reported that Vr-ACSI was expressed in response to auxin. We have
cloned full length cDNAs of four isogenes from mung bean (Vr-ACSJ, 2, 3, and 6), and
found that Vr-ACS6 was an auxin-specific isogene but not Vr-ACSJ [2]. The expression
of Vr-ACS6 was under the control of auxin, cytokinin, abscisic acid and ethylene, as
was observed in ethylene production.
In order to analyze the interaction of plant hormones at the molecular level, we
introduced a Vr-ACS6 5'-untranscribed region/GUS chimeric gene into tobacco, and
examined if the region is sufficient for interaction of plant hormones. In this report, we
describe that a 1.5 kb untranscribed region of Vr-ACS6 contains all the elements
sufficient to confer the hormonal interaction affecting Vr-ACS6 gene expression.
3.1. ISOLA nON OF Vr-ACS6ISOGENE
Using Vr-ACS6 eDNA, we screened a genomic library of mung bean, and nine positive
clones were isolated after 3 rounds of screening. One of them which contained the
longest insertion (7.6kb) was selected and used for further analysis. The nucleotide
sequence of the gene contained a sequence identical to that of the cDNA, that were
separated into three exons. The transcription initiation site determined by primer
extension was the cytosine base 280 base-upstream of the translation initiation codon,
ATG. and the clone contained 1612 bases of 5'-untranscribed region.
3.2. TRANSGENIC TOBACCO CONTAINING THE Vr-ACS6 PROMOTER-GUS

CHIMERIC GENE
The 1.5 kb untranscribed region from -1531 to +158 was prepared by PCR and inserted
into the HindIII/XbaI site of pBIlOl, and tobacco SRI was transformed with the
chimeric gene via Agrobacterium tumefaciens. Transformed tobacco lines were
selected by kanamycin resistance, and Tl or T2 seedlings were used in this work.
3.3. GUS ACTIVITY ASSAY AND STAINING
For GUS activity assay, Tl or T2 seeds were germinated and grown in soil mix, and
leaf discs excised from second leaves of 4 to 6-leaf stage plants were incubated in 10
mM phosphate buffer, pH 6.8, that contained indole-3-acetic acid (IAA), and
benzylaminopurine (BA) or abscisic acid (ABA), for 6 hours. For ethylene treatment,
incubation was carried out in an air-tight chamber which contained IOLethylene/L. The
leaf discs were then extracted with a buffer and GUS activity was fluorometrically
determined with 4-methylumbelliferone glucuronide (MUG) as substrate.
23
For histochemical GUS staining, Tl or T2 seeds were germinated and grown on agar
that contained 114 strength of Hoagland solution and 100g./mLkanamycin in the dark or
continuous light at 26C for 6 days (in dark) or 10 days (in light). Seedlings were
incubated with plant hormones as described above for 5 hours in the dark, then
transferred to X-Glu in TrisHCI buffer followed by incubation at 37C for 6 hours.
4. Results
4.1. Vr-ACS6 IS THE AUXIN-INDUCIBLE ISOGENE, BUT Vr-ACSI IS NOT
Northern blot analysis was carried out with hypocotyl sections of etiolated mung bean
(Vigna radiata) seedlings. The results indicated that mRNAs for Vr-ACSI and 6 were
not detected in control hypocotyls, but incubation of hypocotyl sections with IAA
induced great accumulation of Vr-ACS6 mRNA, but not of Vr-ACSI mRNA. 2,4-
dichlorophenoxyacetic acid, I-naphthaleneacetic acid and indole-3-butyric acid
similarly induced expression of Vr-ACS6, but none of BA, ABA, methyljasmonate,
salicylic acid, and sucrose induced expression of Vr-ACS6. Thus, the response of Vr-
ACS6 is highly specific to auxin. The auxin-induced expression of Vr-ACS6 was
dependent on IAA concentration from 1f.lM to 500 f.lM, and was further increased by
simultaneous addition of BA or kinetin to IAA solution, but suppressed by ABA or
ethylene. The expression of Vr-ACS6 in etiolated hypocotyls by auxin was not inhibited
by cycloheximide. By contrast, expression of Vr-ACSI was induced by cyclohexmide
but not by auxin, and mRNA accumulation increased with increased concentration of
cycloheximide.
4.2. FUNCTION OF THE 1.5 KB 5'-UNTRANSCRIBED REGION IN A

HETEROLOGOUS SYSTEM
Since tobacco leaf discs behaved similarly to mung bean hypocotyls in terms of
ethylene production as affected by plant hormones, we used tobacco (Nicotiana
tabacum SRI) for transformation with the Vr-ACS6 promoter/GUS chimeric gene for
convenience.
In transgenic tobacco, both green leaf discs and etiolated seedlings produced no
GUS activity without treatment, but when the tissues were treated with varying
concentration of IAA, GUS activity appeared at 1M and further increased as IAA
concentration was elevated (Fig. 1).
The auxin-induced GUS activity was modified by the simultaneous presence of
other plant hormones. When kinetin was added to 100M lAA, GUS activity increased
several fold compared to IAA alone, and the effect of kinetin was concentration
dependent, whereas ABA and ethylene significantly suppressed the IAA-induced GUS
activity (Fig. 2).
24
Green Leaf Discs Etiolated Seedlings
8
6
4
2
M 8 765 4 654 3
-Log[IAA] -Log[IAA]
Figure I. Dose dependency of Vr-ACS6 promoter activity on IAA concentration in

transgenic tobacco. Tissues were treated with lAA as indicated, and GUS activity was
assayed.
Histochemical staining of GUS activity revealed that GUS was expressed primarily
in elongating hypocotyls in etiolated seedlings, and in apical buds and petiole to lamina
of cotyledons in green seedlings. Root tips did not produce GUS stain. The presence of
cytokinin expanded the area of staining as well as intensified the stain, and the opposite
effect was observed in the presence of ABA and of ethylene. Microscopic observation
of sections of the stained green cotyledons revealed that all of mesophyll cells and
vascular cells were stained.
Those results indicate that the promoter region of Vr-ACS6 functioned in tobacco
plant in the same manner as in mung bean plants.
Cytokinin Effect
~ 30
ABA Effect Ethylene Effect
U
til
25
(/) 20 .
:::l
C) 15
Q)
>
~
Q)
a::: ~
~ 10 100 uM 10 100 uM
cP Kinetin
+
ABA
+
1M 100uM 1M 500 uM
Figure 2. Effects of cytokinin (kinetin), ABA and ethylene on auxin-induced activity of the
Vr-ACS6 promoter in transgenic tobacco. Hypocotyl sections of etiolated mung bean
seedlings were treated with plant hormones as indicated, and GUS activity was assayed.
25
4.3. STRUCTURE OF THE PROMOTER REGION OF Vr-ACS6
The promoter region of Vr-ACS6 contained multiple nucleotide sequences highly

homologous to the functionally identified auxin-responsive elements (Fig. 3).
ABRECore
CACGTGGC CTATGTGGC
~lIdGH3D1
Figure 3. Structure of the 1.5 kb promoter region of Vr-ACS6. Ml to M3 boxes indicate

sequences conserved only in auxin-specific ACC synthase isogenes (Vr-ACS6, Cm-ACS2,
Cm-ACS3 and A t-ACS4).
The 41bp sequence between -187 to -147 consisted oftwo domains homologous to the
D4 and Dl domains of the soybean GH3 promoter. Soybean GH3 is an auxin-inducible
gene and its promoter contains three independently functional auxin-responsive
elements, Dl, D4 and El [9]. Another class of auxin-responsive element (ARE-I) is
present in the parB promoter [10], and the Vr-ACS6 promoter also contained a sequence
homologous to ARE-I. Tobacco protoplasts proliferate in response to auxin, and parB
is a gene specifically expressed concomitant with cell growth. ARE-I has been shown
to drive expression of a reporter gene in response to auxin in transgenic tobacco.
A G-box sequence, CACGTGGC, located at -110 to -104 of the Vr-ACS6 promoter
is identical to the functionally identified ABA responsive element of rice rab-16A [11]
and wheat Em [12]. However, application of ABA alone neither stimulated expression
of Vr-ACS6 in mung bean, nor induced GUS activity in the transgenic tobacco.
We noticed 3 or 4 short sequences conserved only in auxin-specific ACS isogenes,
and 3 of them, Ml to M3 were found in Vr-ACS6 promoter region.
5. Discussion
Auxin-induced ethylene production is a unique system in which interaction of plant

hormones can be studied at the molecular level. The gene affected by auxin has been
identified as a specific isogene of ACC synthase, and auxin inducibility of its
expression was shown to be enhanced by cytokinin and suppressed by ABA or ethylene
[2]. As the first step to delineate the molecular mechanism of hormonal interaction, we
26
have chosen Vr-ACS6 of mung bean, isolated its gene, and examined if its promoter
region confers interactive responsiveness to auxin, cytokinin, ABA and ethylene.
A 1.5 kb promoter region of Vr-ACS6 functions in heterologous tobacco plant as we
expected. GUS gene placed under control of the Vr-ACS6 promoter was efficiently
expressed in a dose-dependent manner when transgenic tobacco plants were treated with
auxin, and its expression was specific to auxin. Moreover, the auxin-induced
expression of the chimeric GUS gene is enhanced by cytokinin, but suppressed by ABA
or ethylene. These characteristics of the transgene in tobacco plant are identical to those
of the native Vr-ACS6 gene in mung bean. These results indicate that the transgenic
tobacco plants can be used to dissect domains in the promoter that are functional for
hormonal interaction.
The 1.5 kb promoter region of Vr-ACS6 contains multiple auxin-responsive
elements. Auxin-responsive elements have been functionally identified in the promoter
of several auxin-responsive genes, PS-IAA4/5 [13], GH3 [9] and SAUR [14]. These
genes were isolated from elongating tissues in response to auxin, and contained a
conserved TGTCTC motif, which had been shown as a core element that confers auxin-
responsiveness. Another class of auxin-responsive elements has been identified in
dividing cells in response to auxin, and are contained in parA, parR and areA genes of
tobacco. The promoter of Vr-ACS6 contains domains which are highly homologous to
parR and GH3 auxin-responsive elements (Fig. 5). GH3 contains two independent
auxin-responsive elements [D1 and D4). Vr-ACS6 contains two segments in tandem,
each of which are homologous to D4 and Dl, respectively. Although these elements in
Vr-ACS6 are yet to be functionally confirmed, high specificity of Vr-ACS6 expression to
auxin may result from interaction of these multiple auxin-responsive elements.
The response of Vr-ACS6 to ABA is suppression of auxin-inducibility, but,
interestingly, the gene contains a typical ABA-responsive element, CACGTGGC, that
confers induced expression of particular genes. Moreover, there are two more
sequences homologous to the ABA-responsive elements, albeit one is in reverse
direction. However, a known ethylene-responsive element of class I chitinase gene
[GCC box, TAAGAGCCGCC) is not present in Vr-ACS6.
These observations indicate that further detailed analysis of the promoter region will
reveal the structural bases of the molecular mechanism ofhoromonal interaction.
6. Acknowledgement
This work was supported in part by a Grant-in-Aid for Scientific Research on Priority
Area [No. 05276101 and 05276102) from the Ministry of Education, Science and
Culture, Japan.
7. References
I. Nakagawa, N., Mori, H, Yamazaki, K. and Imaseki, H. (1991) Cloning ofa complementary DNA
for auxin-Induced l-aminocyc1opropane-I-carboxylate synthase and differential expression of the
gene by auxin and wounding, Plant Cell Physiol. 32, 1153-1163.
27
2. Yoon, LS., Mori, H., Kim, JH., Kang, E.G. and Imaseki, H. (1997) VR-ACS6 is an auxin-
inducible I-aminocyclopropane-I-carboxylate synthase gene in mungbean (Vigna radiata), Plant
Cell Physio/' 38, 217-224.
3. Imaseki, H. Ethylene, in PJ.J. Hookyaas (ed.) The Biochemistry and Molecular Biology of Plant
Hormones, Elsevier Science, Amsterdam, (in press).
4. Botella, l.R., Schlagnhaufer, C.D., Arteca, R.N. and Phillips, AT. (1992) Identification and
characterization of three putative for I-aminocyclopropane-I-carboxylate synthase from etiolated
mung bean hypocotyl segments, Plant Mol. Bioi. 18,793-797.
5. Botella, JR., Schalgnhaufer, CD., Arteca, lM., Arteca, R.N. and Phillips, AT. (I 993}
Identification of two new members of I-aminocyclopropane-I-carboxylate synthase-encoding
multigene family in mung bean, Gene 123,249-253.
6. Kim, W.T., Silverstone, A, Yip, W.K., Dong, J.G. and Yang, S.F. (1992) Induction of 1-
aminocyclopropane-I-carboxylate synthase mRNA by auxin in mungbean hypocotyls and apple
cultures shoots, Plant Physio/' 98, 465-471.
7. Botella, J.R., Arteca, 1.M., Schlagnhaufer, CD., Arteca, R.N. and Phillips, AT (1995)
Identification and characterization of a full-length cDNA encoding for an auxin-induced 1-
aminocyclopropane-I-carboxylate synthase from etiolated mung bean hypocotyl segments and
expression of its mRNA in response to indole-3-acetic acid, Proc. Nail. Acad. Sci. USA 92, 1595-
1598.
8. Kim, J.H., Kim, W.T., Kang, E.G. and Yang, S.F. (1997) Induction of I-aminocyclopropane-I-
carboxylate oxidase mRNA by ethylene in mung bean hypocotyls: involvement of both protein
phosphorylation and dephosphorylatio in ethylene signaling, Plan I J. 11,399-405.
9. Liu, Z.E., Ulmasov. AD., Shi, T., Hagen, G. and Guilfoyle, T.1. (1994) Soybean GH3 promoter
contains multiple auxin-inducible elements, Planl Ce/l6, 645-657.
10. Takahashi, Y., Sasaki, T., Ishida, S. and Nagata, T. (1995) Identification of auxin-responsive
elements of parB and their expression in apices of shoot and root, Proc. Nail. Acad. Sci. USA 92,
6359-6363.
II. Mundy, J., Yamaguchi-Shinozaki, K. and Chua, N.H. (1990) Nuclear proteins bind conserved
elements in the abscisic acid-responsive promoter of a rice rab gene, Proc. Nail. Acad. Sci. USA
87,1406-1410.
12. Marcotte, W.R., Russell, S.H. and Quatrano, R.S. (1989) Abscisic acid-responsieve sequence from
the Em gene of wheat, Plant CellI, 969-978.
13. Ballas, N., Wong, L-M. and Theologis, A (1993) Identification of auxin-responsive element,
AuxRE, in the primary indoleacetic acid inducible gene, PS-IAA4/5, of pea (Pisum sativum), 1.
Mol. BioI. 233, 580-596.
14. Li, Y., Liu, \Z.E., Shi, X., Hagen, G. and Guilfoyle, T. (1994) An auxin-inducible element in
soybean SAUR promoter, Plant Physiol. 106,37-43.
SEARCHING FOR THE ROLE OF ETHYLENE IN NON-CLIMACTERIC
FRUITS
Cloning and Characterization of Ripening-induced Ethylene Biosynthetic Genes from

Non-climacteric Pineapple (Ananas Comosus) Fruits
C.1. CAZZONELLI, A.S. CAVALLARO AND J.R. BOTELLA

Plant Genetic Engineering Laboratory, Department of Botany, University
of Queensland, Brisbane 4072, Australia
1. Introduction
The essential role that ethylene plays during climacteric fruit ripening has made it the
focus of intense research. The cloning of an ACe synthase cDNA by Sato and
Theologis [3] and subsequent production of transgenic tomatoes with reduced levels of
ethylene and delayed ripening [2] opened the door to the use of molecular biology
approaches to control of ripening in other climacteric fruit crops. Nevertheless, non-
climacteric fruit ripening is still poorly understood and the role of ethylene remains
unclear. The molecular events involved in the ripening of non-climacteric fruits have
not been characterized in detail; the elucidation of these events could provide valuable
insights into the difference between climacteric and non-climacteric fruits.
We are interested in understanding the role of ethylene at the molecular level during
non-climacteric fruit ripening. We describe here the isolation and characterization of
two ripening-induced cDNAs encoding ethylene biosynthetic enzymes in non-
climacteric pineapple fruits.
2. Results and Discussion
To gain a better understanding of non-climacteric fruit ripening, pineapple was used as a

model system to clone and characterize two ripening-inducible cDNAs coding for two
enzymes of the ethylene biosynthetic pathway, I-aminocyclopropane-l-carboxylate
CACC) synthase Cacacc-I) and I-aminocyclopropane-I-carboxylate oxidase Cacaco-l)
respectively. Due to the extreme acidity and high polyphenolic content of pineapple
fruits, a method was optimized for the extraction of high quality RNA from fruit tissue.
Full details of the RNA isolation method can be found in Cazzonelli et al. [I].
Total RNA was isolated from ripe fruits, reverse transcribed and the cDNA used to
amplify an ACC synthase fragment Cacacc-I) by PCR CRT-PCR) using degenerate
oligonucleotides eEZ5, EZ6, EZ7 and EZ8) designed from several conserved regions of
the ACC synthase protein family [I]. acacc-l is a 1080 bp cDNA fragment encoding
360 amino acids including 10 of the 12 amino acid residues conserved in all
29
30
aminotransferases. Comparison of the deduced amino acid sequence with previously

reported ACC synthases shows between 52 and 67% similarity at the protein level.
Southern analysis suggests the presence of only one copy of acacc-I in the pineapple
genome. Although some acacc-I expression is detected in green fruits, there is a 16-
fold increase in the level of acacc-I in ripe fruit tissue. Some minor expression of
acacc-l was also found in wounded leaf tissue [1].
RT-PCR was also used to amplify an ACC oxidase cDNA fragment (acaco-l) from
ripe fruit total RNA using degenerate nucleotides (ACOI and AC03) [1]. acaco-J is a
partial length cDNA clone of 611 bp which codes for 203 amino acids representing
approximately 66% of the ACC oxidase open reading frame. Southern analysis suggests
the presence of one or two copies of the gene in the pineapple genome. Northern
analysis shows the expression of acaco-J to be highly induced in wounded leaf tissue
and to a lesser extent in ripening fruit tissue [1].
To our knowledge, this is the first time that either an ACC synthase or an ACC
oxidase gene has been shown to be induced during ripening of non-climacteric fruits. It
is difficult to explain the significance of the fact that pineapple fruits show a similar
trend of ripening enhanced expression of ACC synthase and oxidase to that observed in
climacteric fruits such as tomato. There are no reports of an ethylene surge during
ripening of pineapple; therefore the significance of the ripening-induced ACC synthase
and oxidase genes is questionable. The literature does not presently support a role for
ethylene in the control of non-climacteric fruit ripening and, although it is possible that
ethylene may have some other role(s), that remains to be elucidated. Nevertheless, the
fact that the genes encoding not only one but the two rate limiting enzymes of the
ethylene biosynthetic pathway are induced strongly suggests that ethylene is actively
produced during the ripening of pineapple fruits. It is also plausible that the existence
of post-transcriptional and/or post-translational regulation of either ACACC-l or
ACACO-l could limit the amount of active protein present in the tissue. The cloning of
ripening-induced ACC synthase and oxidase genes from a non-climacteric fruit
represents the first step towards understanding the putative role of ethylene in the
ripening process of this economically important group of fruits.
3. References
1. Cazzonelli, C.I., Cavallaro, AS. and Botella, 1.R. (1998) Cloning and characterisation of ripening-
induced ethylene biosynthetic genes from non-climacteric pineapple (Ananas comosus) fruits, Aust.
J. Plant Physiol. 25, 513-518.
2. Oeller, P. W., Min-Wong, 1., Taylor, 1. P., Pike, D. A and Theologis, A (1991) Reversible
inhibition of tomato fruit senescence by antisense RNA, Science 254, 437-439.
3. Sato, T. and Theologis, A (1989) Cloning the mRNA encoding I-aminocyclopropane-I-carboxylate
synthase, the key enzyme for ethylene biosynthesis in plants, Proc. Nat. Acad. Sci., USA 86,6621-
6625.
ORGANIZATION AND STRUCTURE OF l-AMINOCYCLOPROPANE-l-
CARBOXYLATE OXIDASE GENE FAMILY FROM PEACH
C. BONGHI, B. RUPERTI, A. RASORI, P. TONUTTI AND A.

RAMINA
Department of Environmental Agronomy and Crop Science, University of
Padova Agripolis, 35020 Legnaro, Padova, Italy
1. Introduction
ACC oxidase (ACO) catalyzes the last step of ethylene biosynthesis, converting 1-
aminocyclopropane-I-carboxylate to ethylene. Previous work described the isolation
and characterization of an ACO peach cDNA clone (pch313) [1]. Southern analysis
indicated that also in peach ACO is encoded by a multigene family in which at least
three members are present [4]. Herein the isolation and characterization of two (PP-
ACOI and PP-AC02) of these members is reported.
2. Results
2.1. ACO GENE STRUCTURE
The screening of the peach genomic library, carried out as described by Sambrook et a/.
[3], using pch313 cDNA resulted in isolation of 5 clones (A2, A5, Al 0, A12, AI9). After
subcloning and sequencing it has been demonstrated that the isolated clones represent
two different genes homologous to pch3 13. A5, AIO, A.l2 and AI9 contain the gene
indicated as PP-ACOI, while A2 contains the gene named PP-AC02.
Comparison of the nucleotide sequence of the cloned genomic regions with the
pch313 cDNA indicated that the latter is identical to PP-ACOI. PP-ACOl is organized
in 4 exons inters paced by 3 introns, while PP-AC02 is lacking the second intron. The
comparison of the deduced amino acid sequences of PP-ACOI and PP-AC02 reveals a
78% identity which is lower than that found within the multigene family of petunia
(above 90%) and tomato (between 88 and 94%) but quite similar to that found between
two members of the melon ACO gene family (CM-ACOI and CM-AC03).
2.2. EXPRESSION OF ACO GENES
Gene specific probes have been isolated in the 3' untranslated regions and used for
expression analyses performed as described by Tonutti et at. [4], in different peach
tissues. The maximum PP-ACOl transcript accumulation occurred in flower at
31
32
anthesis. No PP-AC02 transcript accumulation was observed in flower as well as in the

fruitlet abscission zones. In these regions the PP-ACOI mRNA accumulation were
observed at AZ3 level after propylene treatment. PP-AC02 transcripts were detected
only at S I (early stage of fruit development), while, at ripening, only the expression of
PP-ACOI was observed. Propylene treatment (48 h) performed on fruit at ripening
strongly stimulated PP-ACOI transcript accumulation. The same treatment performed at
SI enhanced the appearance of PP-ACOI transcript and depressed the expression of
PP-AC02. In leaves ACO activity increased during senescence, following propylene
treatment, and wounding. Under these conditions, a marked accumulation of PP-ACOI
was observed whereas no PP-AC02 transcripts were detected. In green and etiolated
epicotils, root and stem of seedlings grown in a greenhouse, a greater expression of PP-
AC02 was observed in comparison to PP-ACOI.
3. Conclusion
Two members (PP-ACOI and PP-AC02) of the ACO multigene family present in
peach have been isolated and characterized. PP-ACOI, similar to tomato and petunia
ACO genes and to a member (CM-ACOJ) of the melon ACO gene family, has three
introns and four exons. PP-AC02 has only two introns inserted in position
corresponding to the first and third intron of PP-ACOI. A similar situation has been
reported for CM-AC02 and CM-AC03 which, compared to CM-AC01, are lacking one
intron [2]. PP-ACOI appears to be constitutively expressed in almost all the peach
tissues, although biosynthesis increases during fruitlet abscission, fruit ripening and leaf
senescence. PP-ACOI is up regulated by propylene. PP-AC02 transcripts were found
only in vegetative tissues and in fruit during early development where propylene
depresses its transcription. The different effect of propylene on PP-ACOI and PP-
AC02 transcription might be imputed to Ethylene-Responsive Elements (ERE) which
are present in PP-ACOI but not in PP-AC02.
4. References
I. Callahan, AM., Morgens, P.H., Wright, P. and Nichols, K.E. Jr. (1992) Comparison of Pch313
(pTOMI3 homolog) RNA accumulation during fruit softening and wounding of two phcnotipically
different peach cultivars, Plant Physiol. 100,482-488.
2. Lasserre, E., Bouquin, T., Hernandez. J.A. Bull, J., Pech, J.c. and Balague, C. (1996) Structure and
expression of three genes encoding ACC oxidase homolgs from melon (ClIcumis melD L.), Mol. Gen.
Genet. 251,81-90.
3. Sambrook, J., Fritsch, E.F. and Maniatis, 1'. (1989) Molecular Cloning: a Laboratory Manual, Cold
Spring Harbor Laboratory, New York.
4. Tonutti, P., Bonghi, c., Ruperti, 8., Tornielli, G.B and Ramina, A (1997) Ethylene evolution and 1-
aminocyclopropane- I -carboxylate oxidase gene expression during early development and ripening of
peach fruit, J. Amer. Soc. Hart. Sci. 122,642-647.
METABOLISM OF l-AMINOCYCLOPROPANE-I-CARBOXYLIC ACID BY
PENICILLIUM CITRlNUM
M. HONMA, Y. J. JIA, Y. KAKUTA, AND H. MATSUI

Faculty ofAgriculture, Hokkaido University, Sapporo 0608589, Japan
The cyclopropane amino acid, l-aminocyclopropane-I-carboxylic acid (ACC) was

found in fruit juices [I] and to be a precursor of ethylene in higher plants [2].
Microorganisms are known to liberate ethylene, which is derived from 2-oxoglutarate or
2-oxo-4-methylthiobutyrate [3]. ACC has never been found in microorganisms,
although 2-alkyl derivatives of ACC have been isolated from bacterial metabolites [4,
5]. A fungus Penicillium citrinum synthesized ACC and liberated a little amount of
ethylene. As shown by the figure, ACC was released into the medium in the
logarithmic phase of growth. The extracellular concentration of ACC reached the
maximal level faster than did intracellular ACC and subsequently disappeared from the
medium. The intracellular ACC reached the maximal level after the maximal mycelia
growth and decreased gradually. The addition of 0.05% L-methionine in the medium
raised the accumulation of intracellular and extracellular ACe.
400 r------------, r------------, 3.0
B ~
300 ~
';:j
2.0 ~
.<:
~
U 200 <!::
U '-
o
-<: 1.0 ~
100 ~o
o
0.0
iIW'-=:;::'.L..-"-O<:j..o..L..-J.o-.L..-.Lo-~
50 100 150 200 250 0 50 100 150 200 250
Time (h) Time (h)
Figure J. Formation of ACC by Penicillium cilrinum P cilrinum was cultured at 28C
under shaking in the absence (A) or in the presence (8) of 0.05% L-mcthionine in 100mi of
a medium containing 0.5% glucose. 0.4% polypepton, 0.1 % yeast extract, 0.125%
MgS04-7H20, 0.002% FeS04-7H20, and 1.36% KH2P04.
: t:.. growth,. intracellular ACC, :0 extracellular ACe.
The results indicate the existence of enzymes related to synthesis and degradation of
ACe. As ethylene liberation by P. citrinum was not affected by the addition of ACC in
the medium, ACC oxidase was not thought to be involved in the ACC metabolism by P.
citrinum, whereas ACC deaminase was induced by the incubation with 1% 2-
aminoisobutyrate instead. ACC synthase was purified from P. citrinum grown in a
medium containing 0.05% L-methionine. ACC deaminase was purified from the
mycelia incubated for 72 h in a medium containing 1% 2-aminoisobutyrate. Using
protein sequence data, cDNAs encoding these two enzymes were isolated and
sequenced. The purified ACC synthase was a dimer of a single subunit, Mr 48,000, and
33
34
had lower catalytic constant &at (0.56 S-l) and higher Km (1.74 mM) relative to those of
plant enzymes (apple: Km=12 IlM, &at=9 S-l; winter squash: Km=21 IlM, &at=21 S-l) [6,
7]. The ACC synthase was inert to S-adenosyl-L-homocysteine, S-methyl-L-
methionine, L-methionine sulfoxide, and L-methionine. Several papers [8, 9] show that
ACC synthase was closely related to a group of aspartate aminotransferase from the
sequence profiles. The aspartate aminotransferase is a homodimer, in which the active
site is shared between the subunits. Apple and winter squash ACC synthases expressed
in E. coli were shown to be dirners. The result on quaternary structure of P. citrinum
ACC synthase is consistent with these previous findings. About 24 to 30% of its amino
acid residues were identical to those in the sequences of the plant enzymes. Most of the
residues conserved in the plant ACC synthase and aspartate aminotransferase were also
conserved in the P. citrinum ACC synthase. ACC deaminase purified from P. citrinum
had a higher Km for ACC (4.8 mM) and higher specificity that was indicated by relative
activities of3.6% of ACC activity to dl-coronamic acid and 0.7% to D-serine, compared
with enzymes from other origins (Pseudomonas: 1.6 mM, 23 and 3.3% ; Hansenula
saturnus : 2.6 rnM, 15.4 and 2.9%) [10, 11]. The P. citrinum ACC deaminase did not
show an N-terrninal residue in protein sequencing, and the cDNA coded 360 amino acid
residues. This sequence was 51% similar of to that of Pseudomonas enzyme (338
residues) and 45% to the enzyme from Hansenula saturnus (341 residues) [11, 12].
References
1. Burroughs, L. E (1957) I-Aminocyclopropane-I-carboxylic acid: a new amino-acid in perry pears
and cider apples, Nature 179,360-361.
2. Adams, D. O. and Yang, S. E (1979) Ethylene biosynthesis: identification of I-aminocyclopropane-
I-carboxylic acid as an intermediate in the conversion of methionine to ethylene, Proc. Natl. Acad.
Sci. USA, 76, 170-174.
3. Lieberman, M. (1979) Biosynthesis and action of ethylene, Ann. Rev. Plant Physiol., 30, 533-591.
4. Ichihara, A., Shiraishi, K., Sato, H., Sakamura, S., Nishiyama, K., Sakai, R., Furusaki, A. and
Matsumoto, T. (1977) Structure of coronatine, J. Amer. Chem. Soc. 99,636-637.
5. Mitchell, R. E., Pirrung, C. M. and McGeeham, G. M. (1987) Absolute configuration of
norcoronatine, Phytochemistry 26, 2695-2697.
6. White, M. E, Vasquez, 1., Yang, S. E and Kirsch, 1. E (1994) Expression of apple 1-
aminocyclopropane-I-carboxylate synthase in Escherichia coli: kinetic characterization of wild-type
and active-site mutant forms, Proc. Nat!. Acad. Sci. USA. 91, 12428-12432.
7. Satoh, S., Mori, M. and Imaseki, H. (1993) Monomeric and dimeric forms and the mechanism-based
inactivation of I-aminocyclopropane-I-carboxylate synthase, Plant Cell Physiol. 34, 753-760,
8. Mehta, P. K. and Christen, P. (1994) Homology of I-aminocyclopropane-I-carboxylate synthase, 8-
amino-7-oxononanoate synthase, 2-amino-6-caprolactam racemase, 2,2'-dialkylglycine
decarboxylase, glutamate-I-semialdehyde 2,I-aminomutase and isopenicillin-N-epimerase with
aminotransferase, Biochern. Biophys. Res. Commun. 198,138-143.
9. Rottmann, W. H., Peter, G. E, Oeller, P. w., Keller, 1.A., Shen, N. E, Nagy, B. P., Taylo,r L. P.,
Campbell, A. D. and Theologis, A. (1991) I-aminocyclopropane-I-carboxylate synthase in tomato is
encoded by a multigene family whose transcription is induced during fruit and floral senescence, J.
Mol. BioI. 222,937-961.
10. Honma, M., Shimomura, T., Shiraishi, K, Ichihara, A. and Sakamura, S. (1979) Enzymatic
deamination of d-coronamic acid: stereoselectivity of I-aminocyclopropane-l-carboxylate
deaminase,Agric. Bioi. Chern. 43,1677-1679.
II. Minami, R., Uchiyama, K., Murakami, T., Kawai, 1., Mikami, K., Yamada, T., Yokoi, D., Ito, H.,
Matsui, H. and Honma, M., (1998) Properties, sequence, and synthesis in Escherichia coli of 1-
aminocyclopropane-I-carboxylate deaminase from Hansenula saturnus, J. Biochem. 123, 1112-1118.
12. Sheehy, R. E., Honma, M., Yamada, M., Sasaki, T., Martineau, B. and Hiatt W. R. (1991) Isolation,
sequence, and expression in Escherichia coli of the Pseudomonas sp. strain ACP gene encoding 1-
aminocyclopropane-I-carboxylate deaminase, J. Bacteriol. 173, 5260-5265.
STRUCTURAL MODIFICATIONS OF ACC OXIDASE DURING CATALYTIC
INACTIVATION
S. RAMASSAMY', S. BIDONDE', L. STELLA2, J.e. PECH' AND A.

LATCHE'
1 ENSAT, Avenue de l'Agrobiop6le BP 107, Auzeville, 31326 Castanet
Tolosan Cedex, France. 2 UMR CNRS 6517, Avenue Normandie-Niemen

BP 562, 13397 Marseille Cedex 20, France
1. Introduction
During the catalytic reaction, ACC oxidase (ACO) self inactivates and displays a very
short half-life [I]. Functional alterations occurring through metal-catalysed oxidations
are considered to be responsible for this inactivation [2). Hypothesising that chemical
modifications could yield changes on the protein surface charge, we have used
isoelectric focusing to study the inactivation process. This work has been performed
with the apple fruit native protein and with recombinant ACO produced in S. cerevisiae.
A more precise investigation has been undertaken using a pure recombinant ACO
overproduced in E. coli. Peptides generated from Lys C endoprotease digestion of the
active and inactive protein have been separated by HPLC and their molecular mass
determined by MALDI-TOF analysis.
2. Results
After 3 and 6 h of incubation in the presence of alI co-factors and substrates, the apple
and yeast proteins showed modifications of the IEF profile, whereas the SDS-PAGE
profile remained unchanged (Fig. I A, B). The appearance of more acidic forms of the
protein was correlated with an important decrease of ACO activity. However, the
native ACO of climacteric apple already showed three forms before any incubation in
the presence of exogenous substrates, indicating that the enzyme had already been
modified in situ. The comparison of HPLC elution profiles obtained from endoprotease
digestion of active and inactive recombinant ACO showed important modifications in
the retention time of few of the 37 peaks. We were able to show that, during the
inactivation process, the peptide of peak 23 was generating two new peptides with lower
retention times but with an amino acid sequence exactly equivalent to the original
peptide. They differed only by an increase in molecular mass of 15 and 30,
respectively. The modified peptide 23 is located between amino acids 173 and 191.
Interestingly it comprised histidine 177 reported to be a metalIocenter ligand.
35
36
A
ACO activity
(nl.mg1 prot .hi )
301J
25
20
15
10
5
B
2501:]
200
ACO activity 150

(nl.g1MF.h-1) ~o
o 0.25 3 6
0.25 3 B
S06-PAGE 38 kDa SOSPAGE t~~:+I- 36 kDa

_1.8
.u
IEF -'- ts.4.6 IEF - 11.8
--11.8
'.7
+ +
0.25 3 0.25
Tlmelh) Time I")
Figure 1. Time course of structural and functional changes taking place in ACO
protein during catalytic reaction. Immunoblot analysis were performed after SDS-
PAGE and denaturing-IEF of protein extracts from yeast (A) and apple (B)
incubated 05, 3 and 6 hours in the presence of I mM ACC, 100 /lM FeS04, 3 mM
ascorbate and 10 mM NaHC03 . Ethylene production was measured for 15 min.
before the end of each incubation period.
3. Conclusion
We demonstrate that the catalytic inactivation of ACO is associated with a decrease in

the pI of the protein, which is related to an increase of the molecular mass of some
amino acids, possibly by oxidation. This subtil change in some amino acids, as well as
the severe fragmentation of ACO recently reported [2] corresponds to alterations
occuring during metal-catalysed oxidation. They may arise from the combination of
ascorbate and transition metal ions that generate active oxygen species capable of
interacting with the protein and causing covalent and functional alterations.
4. Acknowledgements
This work was supported by the Department TPV of INRA (Bursary to S. R.) and by
NATO (Grant N 930996).
5. References
L Smith, ll, Zhang, ZR, Schofield, CJ., John, P. and Baldwin, JE (1994) Inactivation of 1-
aminocyclopropane-I-carboxylate (ACC) oxidase, J. Exp. Bot. 45, 1521-527.
2. Barlow, J.N., Zhang, Z., John, P., Baldwin, lEo and Schofield, CJ. (1997) Inactivation of 1-
aminocyclopropane-I-carboxylate (ACC) oxidase involves oxidative modifications, Biochemistry
36,3563-3569.
3. Lay, v.J., Prescott, AG., Thomas, P.G. and John, P. (1996) Heterologous expression and site-
directed mutagenesis of I-aminocyclopropane-I-carboxylate oxidase from kiwi fruit, Eur. J
Biochem. 242, 228-234.
CHARACTERIZATION OF ARABIDOPSIS ETHYLENE-OVERPRODUCING
MUTANTS
K. E. WOESTE AND 1. 1. KlEBER

Department of Biological Sciences, Laboratory for Molecular Biology,
University of Illinois at Chicago, Chicago, IL 60607
1. Abstract
We have taken a molecular genetic approach to identify elements involved in ethylene

signal transduction and in the regulation of ethylene biosynthesis. Ctr mutations result
in the constitutive activation of ethylene responses by disrupting ethylene signaling
components. Two loci have been identified: CTR I, which encodes a protein that is
similar to the Raf family of protein kinases, and clr2, mutants in which display a
rosette-lethal phenotype. We have characterized CTR I protein purified from a
baculovirus expression system and have found that its enzymatic properties are similar
to those of Raf, including its ability to phosphorylate the MEK protein kinase. The clr2
mutation disrupts both ethylene signaling and a second, non-ethylene related pathway
that is involved in cell expansion. The characterization of this mutation and progress in
the cloning of CTR2, as well as the further analysis of the CTRI protein will be
presented. A number of mutants affecting the regulation of ethylene biosynthesis have
also been identified. One class disrupts the induction of ethylene by cytokinin. The
cloning of one such On (cytokinin-insensitive) mutant revealed that the ACS5 isoform
of ACC synthase is responsible for the induction of ethylene by low doses of cytokinin,
and that this regulation is primarily post-transcriptional. A second class of mutants
result in an elevation of the basal level of ethylene biosynthesis in etiolated seedlings.
The gene corresponding to the el02 (ethylene overproducer) mutation has been cloned.
This mutation disrupts the carboxy-terminal II amino acids of ACS5, suggesting that
the carboxy-terminus of this protein negatively regulates its function.
2. Introduction
Ethylene biosynthesis is modulated by a diverse group of factors, including wounding,

water stress, mechanostimulation, and application of other plant hormones, including
auxin, cytokinin and ethylene itself and also increases dramatically during a number of
developmental events such as germination, leaf and flower senescence and abscission,
fruit ripening [I, 13,26]. A major mechanism in the regulation of ethylene biosynthesis
is to increase the steady-state level of mRNA encoding ACC synthase [for example, see:
2, 3, 16, 17, 18, 19], the first committed and generally rate-limiting step in ethylene
37
38
biosynthesis. However, there is accumulating evidence to suggest that ACC synthase is

also post-translationally regulated [IS, 16, 22, 25].
ACC synthase is encoded by a small gene family comprised of at least three to six
members in the species that have been closely examined. Distinct subsets of ACS genes
are expressed in response to various developmental, environmental and hormonal
factors. In Arabidopsis, six ACS genes have been identified (ACSl-6), two of which are
non-functional [9, 23; Woeste, Vogel and Kieber, submitted]. Inhibition of protein
synthesis by cycloheximide treatment induces expression of all four functional genes,
suggesting that they are under the control of a short-lived repressor [9]. Wounding,
auxin, LiCI and anaerobiosis differentially induce these genes [9, II, 23]. The ACS3
gene is most likely a pseudogene and ACS] encodes a non-functional ACC synthase
[10].
One approach to understanding complex circuitry regulating the numerous
regulatory inputs into ethylene biosynthesis has been to isolate mutants altered in the
level of ethylene production. The triple response, which is observed in etiolated
seedlings treated with ethylene, has been utilized to identifY Arabidopsis mutants
affected in the regulation of ethylene biosynthesis, as well as mutants disrupted in
ethylene signaling [7]. The former class fall into two categories: mutants that fail to
induce ethylene in response to a particular inducer [Ytokinin-insensitive mutants, Cin;
24, 25], and mutants that overproduce ethylene [~hylene-Qverproducers, Eto; 5, 8].
These mutations identifY elements important in regulating ethylene biosynthesis in
etiolated Arabidopsis seedlings. This analysis has demonstrated that cytokinin elevates
ethylene biosynthesis in Arabidopsis by a post-translational modulation of ACS5 [25].
Furthermore, cloning of the gene corresponding to the et02 mutation has revealed that
the carboxy-terminus of ACS5 is a negative regulator of ACS5 function [25]. Two
additional Eto mutants, etol and et03, have been identified and characterized [5, 8 and
K. Woeste, C. Ye and J. Kieber, submitted Here we describe a further analysis of these
two mutants.
3. Isolation of Eto Mutants
We screened independent lots of ethyl methanesulfonate (EMS), diepoxybutane (DEB)

and X-ray mutagenized seeds for mutants that displayed the triple response in the dark
in the absence of exogenous ethylene (Fig. I). Seeds derived from more than 60,000 M,
plants were screened in this manner, yielding four hundred putative mutants, of which
eighteen survived, produced seeds and re-tested for this phenotype. These mutants fell
into two classes: those that were revertible by inhibitors of ethylene biosynthesis and
binding (Eta mutants) and those that were not [5, 8]. The latter class are affected in
ethylene signaling, and are not considered here. The Eta (~hylene Qverproducing)
mutants fell into three genetic loci. Nine new alleles of the recessive eta] locus and one
allele each of the dominant et02 and et03 loci were identified. The reversion by
inhibitors of ethylene action suggests that the seedling phenotype of the Eto mutants is
due to overproduction of ethylene, a prediction that is confirmed by measurements of
ethylene biosynthesis [5, 8; Table 1]. The novel eta]-3 allele produces about the same
amount of ethylene as the previously-identified eta]-] allele (Table I). These Eta
39
mutations result in seedlings with elevated levels of ACC synthase activity, although the
level of ACS mRNA is unaffected (K. Woeste, C. Ye and J. Kieber, submitted). This
data, along with an evaluation of the interaction between various inducers of ethylene
biosynthesis that act through distinct ACS isoforms, suggests that these Eta mutants are
most likely affected in the post-transcriptional regulation of ACC synthase.
wt etol eto3
Figure 1. Phenotypes of three-day-old etiolated wild-type and Eta mutant Arabidapsis seedlings. Seedlings
were grown for three days on MS agar in the dark at 23C. Representative seedlings were picked and
photographed.
4. Spatial Analysis of EthyleneBiosynthesis in Etiolated Seedlings
We examined the spatial pattern of ethylene biosynthesis in etiolated wild-type and

etal-3 seedlings by measuring ethylene production from isolated roots, hypocotyls and
combined apical hooks and cotyledons. There is only a very minor effect (~ two-fold)
of wounding on ethylene biosynthesis in etiolated Arabidapsis seedlings (Woeste,
Vogel and Kieber, submitted), and so wound-induced ethylene was not a major factor in
this analysis. Furthermore, sections were cut under a green safe light to eliminate the
effect of light on ethylene biosynthesis. In general, all tissues from etiolated wild-type
seedlings make approximately the same, very low level of ethylene (Table 2). The
amount of ethylene produced in this experiment by wild-type seedlings was just above
the level of detection, which may obscure differences between organs. However, in
etal mutant seedlings, it is clear that the majority of ethylene is produced by the apical
hook/cotyledons, with the root and shoot producing much lower levels. This is similar
40
to etiolated pea and mung bean seedlings, in which the majority of ethylene is made by
the apical hook [4, 20, 21]. Interestingly, etal roots and hypocotyls produced only
slightly more ethylene than their wild-type counterparts, even though elongation is
severely reduced in these organs in etiolated etal seedlings (Fig. I). However, even a
small two-fold) increase in ethylene biosynthesis in etiolated Arabidapsis seedlings is
sufficient to reduce hypocotyl and root elongation [25], and thus the small increase
observed in etal seedlings in roots and hypocotyls may be enough to inhibit elongation.
TABLE I. Ethylene biosynthesis in wild-type and Elo mutant seedlings
Genotype Mutagen Ethylene Production (pLoseedling-'oh-')"
wild-type 0.6 0.5

elol-I EMS 10.4 0.5
elol-3 X-ray 9.3 1.6
ela3 DEB 18.53.2
'The ethylene that accumulated from etiolated seedlings 48-72 hours after
gennination was measured as described (25). Values are the mean SD based on at
least three replicates.
5. Gene Dosage Analysis of the eto3 Mutation
There are several possible mechanisms for the genetic dominance of the eta3 mutation
[14]: the mutation could hypomorphic (Ioss-of-function) if one gene copy is not
sufficient to produce a wild-type phenotype; the mutation could be hypermorphic, that
is, it results in increased gene function; the mutation could be neomorphic, that is the
protein is altered in such a way that it acquires a novel function; or the mutation could
be antimorphic, that is acting against the function of the wild-type gene product (e. g. a
dominant negative). Neither neomorphic nor hypermorphic mutations are sensitive to
gene dosage: increasing the ratio of wild-type to mutant genes has no effect on the
phenotype. Conversely, antimorphic mutations are sensitive to gene dosage, and so if
the ratio of wild-type to mutant genes is increased, a lessening of the phenotype is
observed. Additionally, if eta3 is hypermorphic, a +/+/eta3 plant should have a wild-
type phenotype.
To distinguish these possibilities, we constructed a series of lines that contained
different doses of the mutant allele of eta3 relative to the wild-type allele. To this end,
we crossed a homozygous eta3 line to a wild-type diploid (Columbia) and tetraploid
line (CS3151) and then measured ethylene production from the F I progeny, as well as
from the parental lines (Table 3). This analysis is complicated by the fact that triploid
Arabidapsis cells are larger than their diploid counterparts, and thus the cellular
concentration of any particular gene product may not be increased in the triploid plants.
Thus, to determine the effect of this and other variables resulting from triploidy that are
not due to gene dosage effects, we also analyzed the eta2 mutation in this way. eta2 is a
hypermorphic mutation that is the result of a single base pair insertion in the 3' end of
the ACS5 coding region. This insertion results in a perturbation of the carboxy-terminal
41
eleven amino acids of ACS5, resulting in an increase in function of the ACS5 isoform,
and thus an elevation of ethylene biosynthesis [25]. The phenotype of eta2 should be
insensitive to gene dosage, and thus any difference in ethylene production between
+/+/eta2 and +/eta2 seedlings can be attributed to the effects oftriploidy.
TABLE 2. Spatial analysis of ethylene biosynthesis in etiolated seedlings
Ethylene Production (pLoindividuar 1024-h'l)a
Genotype seedlings roots shoots hooks/cots
wild-type 27 9 23 9 21 9 24 12
etal-3 31726 389 28 6 198 80
aSeedlings were grown for three days on MS agar as described [25]. The
seedlings were cut at the root hypocotyl junction and just below the apical
hook (hooks/cots) under a green safe light. Whole seedlings or sections
(ten each) were placed on MS agar in GC vials and the accumulated
ethylene measured 24 hours later as described [25]. Values are the mean
SD based on two replicates. cots = cotyledons.
eta2 etiolated seedlings made 28% less ethylene when heterozygous in a triploid as
compared to a diploid genetic background (Table 3). This reduction represents the
effect of triploidy on an Eto mutation that should be insensitive to gene dosage and if
the reduction in eta3 is greater than this, it indicates that the mutation is sensitive to
gene dosage. Ethylene biosynthesis was reduced by 64% in eta3 seedlings in the
triploid relative to the diploid heterozygote, which is significantly more than the
reduction observed in eta2 seedlings, suggestiing that eta3 is sensitive to gene dosage.
Furthermore, the +/+/eta3 seedlings still displayed an ethylene overproducing
phenotype, indicating that eta3 is not the result of haploinsufficiency. Thus, eta3 is
most likely the result of an antimorphic mutation, which implies that the wild-type
ET03 gene product could be part of a multisubunit complex, and that the mutant protein
acts to disrupt this complex).
TABLE 3. Gene dosage analysis of dominant Eta mutants
Ethylene Production (pLo 'lo3_days'l)a Decrease in triploid

Genotype -/- +/- ++/- het vs. diploid het.
eta2 876 281 418 77 303 64 28%

eta3 731 52 338 64 120 28 64%
a The ethylene that accumulated from etiolated seedlings 72-96 hours after germination
was measured as described [25]. Values are the mean SD based on at least eight
replicates
42
6. Acknowledgments
This work was supported by USDA Grants 95-37304 and 97-01425 and NASAINSF
grant #IBN-9416017. The authors thank the Arabidopsis Stock Center at The Ohio State
University for the CS3151 line.
7. References
1. Abeles, F.B., Morgan, P.w. and Saltveit, M.E., Jr. (1992) Ethylene in Plant Biology, Academic
Press, Inc., San Diego, CA
2. Botella, 1.R., Arteca, R.N. and Frangos, J.A (1995) A mechanical strain-induced 1-
aminocyclopropane-l-carboxylate synthase gene, Proc. Natl. Acad Sci. USA 92, 1595-1598.
3. Botella, J.R., Schlagnhaufer, C.D., Arteca, J.M., Arteca, R.N. and Phillips, AT. (1993)
Identification of two new members of the l-aminocyclopropane-l-carboxylate synthase-encoding
multigene family in mung bean, Gene 123,249-253.
4. Goeschl, J.D., Pratt, H.K. and Bonner, BA (1967) An effect oflight on the production of ethylene
and the growth of the plumular portion of etiolated pea seedlings, Plant Physiol. 42,1077-1080.
5. Guzman, P. and Ecker, J.R. (1990) Exploiting the triple response of Arabidopsis to identify
ethylene-related mutants, Plant Cell 2, 513-523.
6. Kathiresan, A, Reid, D.M. and Chinnappa, c.c. (1996) Light and temperature entrained circadian
regulation of activity and mRNA accumulation of I-aminocyclopropane-I-carboxylic acid oxidase
in Stellaria longipes, Planta 199, 329-335.
7. Kieber, J.J. (1997) The ethylene response pathway in Arabidopsis, Annu. Rev. Plant Physiol. Plant
Mol. BioI. 48,277-296.
8. Kieber, J.J., Rothenburg, M., Roman, G., Feldmann, KA and Ecker, J.R. (1993) CTRI, a negative
regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of
protein kinases, Celln, 427-441.
9. Liang, x., Abel, S., Keller, JA, Shen, N.F. and Theologis, A (1992) The I-aminocyclopropane-l-
carboxylate synthase gene family of Arabidopsis thaliana, Proc. Natl. Acad Sci. USA 89, 11046-
11050.
10. Liang, X., Oono, Y., Shen, N.F., Kohler, c., Li, K., Scolnik, PA and Theologis, A (1995)
Characterization of two members (ACSI and ACS3) of the I-aminocyclopropane-l-carboxylate
synthase gene family of Arabidopsis thaliana, Gene 167, 17-24.
II. Liang, x., Shen, N.F. and Theologis, A (1996) Li+-regulated I-aminocyclopropane-l-carboxylate
synthase gene expression in Arabidopsis thaliana, Plant J. 10, 1027-1036.
12. Machackova, r., Chauvaux, N., Dewitte, W. and Van Onckelen, H. (1997) Diurnal fluctuations in
ethylene formation in Chenopodium rubrum, Plant Physiol. 113,981-985.
13. Mattoo, AK. and Suttle, J.C. (1991) The Plant Hormone Ethylene, CRC Press, Boca Raton, FL.
14. Muller, J.F. (1932) Further studies on the nature and causes of gene mutations, in D. F. Jones (ed.),
Proceedings of the Sixth International Congress of Genetics, Brooklyn Botanic Gardens, Menasha,
pp. 213-255.
15. Nakajima, N., Nakagawa, N. and Imaseki, H. (1990) Molecular size of wound-induced 1-
aminocyclopropane-I-carboxylate synthase from Cucurbita maxima Ouch. and change of
translatable mRNA of the enzyme after wounding, Plant Cell Physiol. 29, 989-998.
16. Oetiker, lH., Olsen, D.C., Shiu, O.Y. and Yang, S.F. (1997) Differential induction of seven 1-
aminocyclopropane-I-carboxylate synthase genes by elicitor in suspension cultures of tomato
(Lycopersicon esculentum), Plant Mol. BioI. 34, 275-286.
17. Olson, D.C., Oetiker, J.H. and Yang, S.F. (1995) Analysis of LE-ACS3, a I-aminocyclopropane-I-
carboxylic acid synthase gene expressed during flooding in the roots of tomato plants, J. Bio/.
Chern. 270, 14056-14061.
18. Olson, D.C., White, J.A, Edelman, L., Harkins, R.N. and Kende, H. (1991) Differential expression
of two genes for I-aminocyclopropane-I-carboxylate synthase in tomato fruits, Proc. Natl. Acad
Sci. USA 88, 5340-5344.
43
19. Rottmann, W.H., Peter, G.F., Oeller, P.W., Keller, 1.A., Shen, N.F., Nagy, B.P., Taylor, L.P.,
Campbell, A.D. and Theologis, A. (1991) I-aminocyclopropane-I-carboxylate synthase in tomato
is encoded by a multigene family whose transcription is induced during fruit and floral sencscence,
1. Mol. BioI. 222, 937-961.
20. Samimy, C. (1978) Effect of light on ethylene production any hypocotyl growth of soybean
seedlings, Plant Physiol. 61. 771-774.
21. Schierle, 1., Rohwer, F. and Bopp, M. (1989) Distribution of ethylene synthesis along the etiolated
pea shoot and its regulation by ethylene, 1. Plant Physiol. 134,331-337.
22. Spanu, P., Grosskopf: D.G., Felix, G. and Boller, T. (1994) The apparent turnover of 1-
aminocyclopropane-I-carboxylate synthase in tomato cells is regulated by protein phosphorylation
nrl.pt:t)~nf)J~nmhtia{} f'ht:lf.Phlyill" .1 !!6u;'J2,~35 J.
23. Van Der Straeten, D., Van Wiemeersch, L., Goodman, H.M. and Van Montagu, M. (1990) Cloning
and sequence of two different cDNAs encoding I-aminocyclopropane-I-carboxylate synthase in
tomato, Proc. Natl. Acad. Sci. USA 1987,4859-4863.
24. Vogel, I.P., Schuerman, P., Woeste, K.W., Brandstalter, I. and Kieber, 1.1. (1998) Isolation and
characterization of Arabidopsis mutants defective in induction of ethylene biosynthesis by
cytokinin, Genetics 149, 417-427.
25. Vogel, I.P., Woeste, K. W., Theologis, A. and Kieber, 1.1. (1998) Recessive and dominant
mutations in the ethylene biosynthetic gene ACS5 of Arabidopsis confer cytokinin insensitivity and
ethylene overproduction, respectively, Proc. Natl. Acad. Sci. USA 95, 4766-4771.
26. Yang, S.F. and Hoffman, N.E. (1984) Ethylene biosynthesis and its regulation in higher plants,
Annu. Rev. Plant Physiol. 35,155-189.
CONTROL OF ETHYLENE RESPONSES AT THE RECEPTOR LEVEL
E.C. SISLER l AND M. SEREK2

I Department of Biochemistry, North Carolina State University, Raleigh,
NC 27695, USA, 2Department ofAgricultural Sciences, Horticulture, The

Royal Veterinary and Agricultural University, Thorvaldsensvej 57, 1871
Frederiksberg C, Denmark
1. Abstract
A range of compounds bind to the putative ethylene receptor. Some are agonists and
mimic the effects of ethylene; some are antagonists and block ethylene action. In the
past few years some particularly effective blocking agents for the ethylene receptor have
been discovered. They block the receptor for up to 12 days at 25 C when provided in a
single exposure and for much longer periods if exposure is repeated at 8-10 days
intervals. A 24-hour exposure to 0.5 nl.l l l-methylcycIopropene (I-MCP) protects
banana fruit and carnation flowers from the effects of ethylene, but about 40 nl.l- l is
required to prevent ethylene-induced inhibition of pea seedling growth and abscission
in mung beans. The reason for this large concentration difference is unknown. Other
cyclopropene compounds block banana ripening for shorter periods of time (3, 5, 7 or
12 days) but require higher treatment concentrations than l-MCP.
2. Introduction
The growth regulating properties of ethylene have been recognized for nearly a century.
Now considered a true plant hormone, ethylene is thought to act by binding to a metal in
a receptor [I]. A number of other compounds such as carbon monoxide, acetylene, and
isocyanides mimic ethylene in inducing a response. Many other olefins are also active,
but none are as effective as ethylene.
In 1973 Sisler and Pian [6] reported that some olefins block ethylene responses. In
recent years some very effective blocking agents for the ethylene receptor have been
discovered by Sisler and co workers [12,13,14]. These compounds hold the promise of
providing new tools for controlling ripening, senescence and other ethylene responses.
Since the ethylene receptor is ubiquitous in plants, these compounds should control all
plant ethylene responses. Some aspects of receptor blocking agents have recently been
reviewed [14, IS]; this paper does not attempt to review the many papers reporting
effects of these compounds, but rather to report the most significant findings and uses
of these interesting materials.
45
46
3. 2,5-Norbornadiene and Related Compounds
2,5-Norbornadiene (2,5-NBD) was the first of the olefins that were reported to block
the ethylene receptor. To be effective, it requires continuous exposure and relatively
high concentration (50 fll.l- I or higher). It has a very unpleasant odor, but it has proved
useful as an experimental tool in many scientific studies of the role of ethylene in plant
growth and development. A number of other cyclic olefins were also found to be
effective when plants were exposed to them continuously [7]. Most required higher
concentrations than 2,5-NBD, but transcyclooctene was effective at 0.8 fll.rl, a
considerably lower concentration than the concentration required for 2,5-NBD [7].
None of these appear to have much commercial value in counteracting ethylene.
4. Diazocyclopentadiene
While searching for a photoaffinity label for the ethylene receptor, we synthesized
diazocycIopentadiene (DACP), a compound that decomposed in the presence of light
into products that were shown to block the ethylene receptor for many days following a
single exposure [8, 9]. DACP is a weak inhibitor of ethylene responses, but upon
irradiation with visible light gives rise to one or several much more active components.
The product appears to be a gas at room temperature; however, it is very unstable and
has not been identified. The product of DACP photolysis has been shown to block
ripening and senescence in several crops like banana (Musa sapienlum), tomato
(Lycopersicon esculentum), kiwi (Aclinidia chinensis), persimmon (Diospyros
virginiana), carnation (Dianthus caryophyllus), miniature rose (Rosa hybrida) and to
prevent ethylene inhibition of pea (Pisum sativum) growth [4, 8, 9, II]. It also has been
shown, using the 14 C-ethylene binding assay, to block the receptor in mung bean (Vigna
radiata) sprouts and tobacco (Nicotiana tabacum) leaves. Table I gives some Kd
values for leaves and petals in roses.
TABLE 1. Binding constants (Kd values) of rose petals and leaves obtained from
Scatchard plots. The values indicated for DACP in the light represent the photolysis
product of DACP after 3 hours in the light. The Kd value is the concentration of
compound that will occupy 112 of the binding sites in the absence of competing
ethylene.
Cultivar Treatment Value (~III)

Petal Leaf
Cara mia Ethylene 0.16 0.14

Cara mia I"C_ Ethylene+ DACP (light) 0.34 0.39
Cara mia 14C_ Ethylene + DACP (dark) 141.00 146.00
Victory Parade Ethylene 0.12 0.11

Victory Parade I"C_ Ethylene+ DACP (light) 0.80 0.89
Victory Parade I"C_ Ethylene + DACP (dark) 208.00 200.00
47
5. Cyclopropenes
Cyclopropenes compete with ethylene for the receptor if applied at the same time as
ethylene, i.e. before binding occurs, but after binding the cyclopropenes prevent
ethylene binding and protect against ethylene even at very high concentrations. Some
cyclopropenes are very active; treated tissues are resistant to ethylene for 10-12 days at
22C after a single 24 hour exposure to concentrations as low as 0.5 nUl [2, 5, 12, 13],
then they become sensitive to ethylene again and undergo apparently normal ripening or
senescence.
5.1. I-METHYLCYCLOPROPENE
I-Methylcyclopropene is the most effective of a group of active cyclopropene

compounds, based on active concentration and stability considerations. This will
probably be the ethylene inhibitor of choice for the immediate future and holds
considerable commercial potential. This compound is presently being registered for
commercial use by Biotechnologies for Horticulture Inc., (751 Thunderbolt Dr.,
Walterboro, SC 29488, USA). It can be synthesized easily by those familiar with air-
sensitive reagents [3]. At its active concentration (0.5 nl.1- 1 on carnation), it has no
detectable odor and has not been reported to have toxic properties. The longer the
exposure time, the lower the required concentration [12]. Table 2 shows a considerable
difference in the amount of I-MCP required for protection in different plants. I-MCP
completely protects carnation and banana when they are given a 24-h exposure at 0.5
n1.1- 1 . However, treatment with 40 n1.1- 1 of I-MCP is required for maximum retardation
of pea seedling growth. It is unclear why a much higher concentration is needed to
counteract ethylene in pea tissues, but even this higher level represents a far lower
amount of active substance than of the ethylene required to elicit the normal response.
The length of the protection period has not been determined accurately in carnation but
appears to be 12-15 days. Bananas are protected for 12 days at 22C, but become
sensitive again in 5 days at 35C.
TABLE 2. Concentration of I-MCP necessary for maximum inhibition of the ethylene

response
Species Response Exposure time (h) Concentration (nl. r')

Musa sapienturn ripening 24 0.7
Lycopersicon ripening 24 7.0
esculenturn
Dianthus caryophyllus senescence 24 0.5
Pisurn sativurn growth 24 40.0
Vigna radiata abscission 24 40.0
5.2. OTHER CYCLOPROPENES

48
Cyclopropene (CP), I-MCP and 3,3-dimethyIcycIopropene (3,3-DMCP) are all active,

but CP and I-MCP are about 1000 times more active than 3,3-DMCP (Table 3). All of
these compounds are gases at room temperature and have no obvious odor at the
concentrations needed to protect plants. Most of the studies to date have been done with
I-MCP, since it is more stable than CP and more active than 3,3-DMCP.
TABLE 3. Concentration required for maximum inhibition, and time of ethylene

insensitivity in Musa sapien/urn fruits
Compound Concentration Insens iti v ity

nl.l' Days
I-MCP (I-methyleyelopropene) 0.7 12

CP (eyclopropene) 0.7 12
3,3-MCP (3,3-dimethylcyclopropene 500 7
It has so far not been possible to determine the length of the protection period in all
cases. Some flowers may deteriorate for other reasons before they again become
ethylene sensitive, thus preventing an accurate determination. Fungi may infect some
plant parts before they become sensitive to ethylene after treatment with inhibitors.
Banana and tomato fruit treated remain insensitive for 12 days after treatment with CP
or I-MCP at 24C, then ripen normally. When treated with 3,3-DMCP fruit remained
insensitive for 7 days [13].
Bananas treated at 8-10 day intervals failed to ripen in 40 days, but decay was noted
on each end of the banana. To keep fruit for extended periods of time with I-MCP
treatment, it will also be necessary to control decay organisms.
TABLE 4. Inhibitory concentrations for different compounds that

prevent ethylene action in plants.
Compound Plant Concentration

nl ("'
2,5-NBD Banana 55.000

DACP (dark) Carnation 700.000
DACP (light) Carnation 140
I-MCP Banana 0.7
I-MCP Carnation 0.5
I-MCP Pea (growth) 40
3,3-DMCP Banana 500
3,3-DMCP Campanula 400
Table 4 shows the effect of compounds concentration in preventing ethylene action in

plants. It is required a relatively high concentration of2,5-NBD to block the receptor in
bananas (55.000 nU- 1). Like ethylene binding, 2,5-NBD binding is an equilibrium
49
reaction, and if the 2,5-NBD is vented away, the plant materials become sensitive to
ethylene in a short time. Carnations exposed to DACP in the dark require 700.000 nl.l- 1
for protection against 10 !ll.r 1 ethylene, but after the DACP is pre-irradiated with
fluorescent light, 140 nl.l- 1 of DACP is sufficient. Probably the unidentified photo lysed
product of DACP binds more rapidly than DACP and remains bound for many days;
most of the unconverted DACP comes off the receptor within 60 minutes [10].
To prevent ethylene induced ripening of bananas requires 2 nl.l- 1 I-MCP for 6 h
exposure or 0.7 nI.r 1 for a 24 h exposure. It is not known if it is an equilibrium reaction
or not, but since the inhibition lasts for 12 days, in a practical sense it probably can be
considered as a non-equilibrium reaction. It is possible thet at least part of the regained
sensitivity to ethylene is due to the systhesis of new receptors. Although these values
are for bananas, they can be considered approximate for most fruits and flowers.
6. Conclusions
The new gaseous receptor-level inhibitors provide an important new way to control
ethylene responses for extended periods. Much remains to be learned about them, but
they appear to be capable of controlling all ethylene responses in plants Why do these
compounds work? It will be necessary to know how the ethylene receptor works before
this can be definitively answered. They obviously prevent ethylene from binding to the
receptor, but why are they not themselves active, when many structurally diverse
compounds are active?
It has been proposed [14, 15] that the high strain present in these compounds causes
them to bind much more tightly and longer than ethylene and ethylene agonists. It was
suggested [14, 15] that for a compound to be active it must leave the binding site after
an initial activation event, and ethylene antagonists do not leave rapidly enough to
induce a response. This remains to be tested experimentally.
7. Future work
To date 13 cyclopropene compounds have been shown to be antagonists of ethylene

although most of these have not yet been published. Some bind to the receptor for 3, 5,
7, and 12 days. This may provide a series of compounds that can be used to block the
receptor for finite periods of time. This should be useful in scientific studies and
possibly in commercial applications. Many more receptor blocking compounds are
possible and other differences no doubt will be noted. Since these compounds bind
specifically and irreversibly to the ethylene receptor, it should be possible to study the
location and action of the ethylene receptor using tritium-labelled cyclopropenes. Such
studies could be useful in determining how the receptor works and whether there is
more than one type of receptor. These compounds may even help in identifying the
metal that has been postulated as an essential cofactor in the ethylene binding site.
50
8. Acknowledgements
This work was supported by the U.S. Department of Agriculture (Bard Grant US
-2786-96-R) and the Danish Ministry of Agriculture (NON93-KVL-15).
9. References
I. Burg, S.P. and Burg, E.A. (1967) Molecular requirement for the biological, activity of ethylene.
Plant Physiol. 42, 144-152. .
2. Dupille, E. and Sisler, E.C (1995) Effect of ethylene receptor antagonist on plant material, in A.
Ait-Oubahou and M. EI- Otmani (eds.), Postharvest Physiology, Pathology and Technologies for
Horticultural Commodities, Institute Agronomique et Veterinaire Hassan ll, Agidar, Morocco.
ISBN 9981-9842-2-1, pp. 294-301.
3. Magid, R. M., Clarke, T,e. and Duncan, C. D. (1970) An efficient and convenient synthesis of 1-
methylcyclopropene, J. Org. Chem. 36, 1320-1321.
4. Serek, M., Sisler, E.C. and Reid, M.S. (1994) A volatile ethylene inhibitor improves the post-
harvest life of potted roses, J. Amer. Soc. Hart. Sci. 119,572-577.
5. Serek, M., Sisler, E.e. and Reid, M.S. (1995) Effects of I-MCP on the vase life and ethylene
response on cut flowers, Plant Growth Regul. 16,93-97.
6. Sisler, E. C. and Pian, A. (1973) Effect of ethylene and cyclic ole tins on tobacco leaves, Tab. Sci.
17,698-672.
7. Sisler, E.C. (1991) Ethylene-binding components in plants, in A. K. Mattoo and J. e. Suttle (eds.),
The Plant Hormone Ethylene, CRC Press, Boca Raton, pp. 81-99.
8. Sisler, E. e. and Blankenship, S. M. (1993a) Diazocyclopentadiene (DACP) a light sensitive
reagent for the ethylene receptor in plants, Plant Growth Reg. 12, 125-132.
9. Sisler, E. e. and Blankenship, S.M. (I993b) Effect of diazocyclopentadiene on tomato ripening.
Plant Growth Reg. 12, 155-160.
10. Sisler, E. C; Blankenship, S.M., Fearn, J.e. and Haynes, R. (1993) Effect of diazo-cyclo-
pentadiene (DACP) on cut carnations, in J.C. Pech, A. Latche and e. Balague (eds.), Cel/ular and
Molecular Aspects of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrectht, pp.
182-187.
II. Sisler, E.e. and Lallu, N. (1994) Effect of Diazocyclopentadiene (DACP) on tomato fruits
harvested at different ripening stages, Postharvest Bioi. and Tech. 4, 245-245.
12. Sisler, E.e., Dupille, E. and Serek, M. (1996a) Effect of I-methylcyclopropene and methylene-
cyclopropane on ethylene binding and ethylene action on cut carnations, Plant Growth Reg. 18, 79-
86.
13. Sisler, E.C., Serek, M. and Dupille, E. (1996b) Comparison of cyclopropenc, 1-
methylcyclopropene, and 3,3-dimethylcyclopropenc as ethylene antagonists in plants, Plant
Growth Reg. 18, 169-174.
14. Sisler, E.C. and Serek, M. (\997) Inhibitors of ethylene responces in plants at the receptor level:
Recent developments, Physiol Plant. 100, 577-582.
15. Sisler, E.C. and Serek, M. (1998) Compounds controlling the ethylene receptor. Bot. Bull. Acad.
Sinica 40, (in press).
THE ETHYLENE SIGNAL TRANSDUCTION PATHWAY
A. B. BLEECKER, A. E. HALL, F. I. RODRIGUEZ, J. J. ESCH AND B.

BINDER
Department of Botany, University of Wisconsin-Madison, Madison, WI
53706
1. Introduction
The molecular details of early steps in ethylene signal transduction are becoming firmly
established. Many key components have been identified through the study of mutations
that affect a broad range of ethylene responses in the plant. Members of the ETR gene
family can cause dominant ethylene insensitivity when mutated [1]. Loss of function
mutations in EIN2 and EIN3 also result in ethylene insensitivity in the plant; while loss
of function mutations in the CTRI gene leads to constitutive activation of ethylene
response pathways [2]. Genetic epistasis analysis indicated that the CTRI protein acts
between the ETR receptors and EIN2 and EIN3 in the signal transduction chain. The
genes responsible for these all of these mutant phenotypes have been cloned by a variety
of techniques and the derived amino acid sequences have provided important clues as to
the biochemical functions of the gene products [3]. The ETR family shows homology
to the two-component histidine-kinase receptors common in bacteria. CTR 1 shows
homology to eukaryotic serine/threonine protein kinases that initiate MAP kinase
cascades in eukaryotes. EIN2 is related to a family of metal transporters found in
eukaryotes while EIN3 represents a family of transcription factors found only in plants.
These components of ethylene signaling and their evolutionary relationships are
depicted in Figure I.
While function may be inferred by these interesting sequence homologies, the actual
biochemical functions of these genes are being investigated by a combination of
molecular and biochemical approaches. Manipulation of these gene sequences in vitro
and reintroduction of the modified genes into plants and other organisms has provided
methods for the testing of specific hypotheses regarding protein function. Expression of
ETRI in yeast led to the discovery that the N-terminal hydrophobic domain of the
protein binds ethylene with high affinity, providing unequivocal evidence that the ETR 1
protein acts directly as the receptor [4]. Both yeast two-hybrid and in vitro biochemical
experiments indicate that the transmitter domain of ETR 1 can interact with the
regulatory domain ofCTRI [5], providing a direct connection between these genetically
related components. Little is known about the signaling role of the EIN2 protein,
whereas the EIN3 protein induces constitutive ethylene responses when overexpressed
in Arabidopsis, even in an EIN2 null background [6]. The EIN3 protein binds as a
homodimer to a specific target sequence in the promoter of the ERFI gene, a gene in the
51
52
plant-specific EREBP family of transcription factors [7] that is rapidly induced by

ethylene. Overexpression of ERFI in Arabidopsis leads to constitutive activation of
some ethylene responses, providing a functional link to the ethylene signaling pathway.
ETR1
ETR2
EIN4 - - - . CTR1 EIN2 - - - . EIN3 - - - . ERF1
ERS1
ERS2
RAFllke MAPklnase Nramp EIUEREBP

Cascade? Metal Transcrition
Transporter Factors
Two-Component
Regulators
Eukaryotes
Figure I. Genetically identified components of ethylene signal transduction and their evolutionary origin.
See text for explanation.
This exciting research provides a framework for understanding the mechanism by

which the ethylene signal is processed in plants. It is the goal of researchers in this field
to gain a better understanding of how the identified components interact and whether
there are additional components that the direct genetic approach has failed to identify.
53
TM GAF Kinase Response

Domains Domain Domain Regulator
]
ETR1
ERS1
ETR2
EIN4
P+LI .... F
ERS2
Figure 2. The ETR family of ethylene receptors from Arabidopsis. The amino acid substitutions that confer
dominant insensitivity to ethylene are indicated for each family member. The canonical histidine kinase
subdomains are indicated where present. See text for additional explanation.
2. The ETR Family of Ethylene Receptors
There are currently 5 members of the ETR family that have been identified in
Arabidopsis (Fig. 2). All members share significant sequence homology from the N-
terminal ethylene-sensor domain through the histidine kinase domain. The receptor
sequence is composed of recognizable domains. The ethylene binding domain is
contained within the first 128 amino acids of ETR1 [8] and is composed of three
hydrophobic subdomains that have been modeled as membrane spanning helicies with
the topology for the disulfied-linked homodimer shown in Figure 1. Adjacent to the
sensor domain is a domain that contains a GAF motif. This sequence motif has been
associated with cyclic nucleotide binding sites in some proteins and with the
54
chromophore binding domain ofphytochromes [9]. The function of this domain in the
ethylene receptors is unknown. The C-terminal half of the receptors shows varying
degrees of sequence homology to the catalytic domains of bacterial histidine kinases.
The residues thought to be essential for histidine kinase activity are conserved in ETRI
and ERSI, but are not completely conserved in ETR2, EIN4 or ERS2 [10]. The latter
three members of the family are also distinguished by the presence of an additional
hydrophobic region at the N-terminus. This sequence has the characteristics of a
membrane-targeting signal sequence. Based on these distinguishing features and on
overall sequence similarity, the members of the receptor family can be divided into two
subfamilies: the ETRI-like subfamily and the ETR2-like subfamily. One member of the
each subfamily lacks the C-terminal receiver domain that is present in ETRI
All members of the ETR family are functionally linked to ethylene signaling by
virtue of the fact that specific missense mutations in the ethylene binding domain of any
one member of the family leads to dominant ethylene insensitivity that affects responses
throughout the plant [1]. Most of these mutations are known to disrupt ethylene binding
activity in the yeast expressed ETRI protein. Expression studies in Arabidopsis and
tomato indicate that, while all family members are expressed at some level in most
tissues, the relative mRNA levels of specific family members varies from tissue to
tissue [10, 11].
3. Transduction of the Ethylene Signal
In the conception of models for ethylene signal transduction, several observations must
be taken into account, including the genetic dominance of mutations in receptor genes,
and the fact that loss of function mutations in either CTRI [2] or in a combination of
three or more receptor family members [12], leads to constitutive activation of ethylene
response pathways. These findings are consistent with a model in which the receptors
act in concert with CTRI to repress ethylene response pathways when ethylene is not
present. In other words, ethylene acts as a negative regulator, or inverse agonist, of
receptor signaling--binding of ethylene would tum the receptors off. The interactions
between components in this model are depicted diagrammatically in the upper portion
of Figure 1.
The inverse agonist model for ethylene signaling can account for the dominance of
receptor mutants by a gain-of-function mechanism. If specific mutations disrupt
ethylene binding to the sensor domain of a receptor, the mutant form of the receptor
could continue to signal CTRI and keep response pathways repressed even in the
presence of saturating concentrations of ethylene where all wild-type forms of the
receptor have been turned off. Complete loss of function mutations in anyone receptor
family member do not result in an ethylene response phenotype, indicating that there is
some functional redundancy between family members. Apparently, any less than three
functional members of the family are insufficient to maintain CTRI in a fully active
state, leading to a constitutive response phenotype in triple-null receptor mutants.
It is not yet known how CTRI represses response pathways. By sequence, CTRI is
related to RAF kinase which initiates a MAP kinase cascade in mammals. Genes
representing the protein-kinase components of MAP kinase cascades are found as gene
55
families in plants [13]. It is presently not known whether any of these are directly
involved in ethylene signaling. The genetic evidence indicates that CTRI operates by
negatively regulating the Nramp-type metal transporter coded by EIN2 [14]. EIN2 is
somehow involved in the activation of the EIN3-like family of transcription factors.
The biochemical connection between the membrane-located EIN2 and the nuclear-
localized EIN3 is not yet known, nor is the mechanism by which EIN3 and related
proteins differentially regulate target genes in response to EIN2 signaling.
Overexpression of EIN3 and the target EREBP, ERFI, both lead to some constitutive
ethylene response phenotypes, indicating that differential gene expression acts early in
inducing aspects of ethylene response [7].
4. The Mechanism of Ethylene Binding
The binding site for ethylene is contained within the first 128 amino acids of the ETRI
protein. This domain is the most conserved between different members of the family.
Preliminary results indicate that the range of isoforms of the receptor is capable of
binding ethylene. The most divergent homologous domain is found in the slrl2l2 gene
from the cyanobacterium Synechocystis, which shows only 25% amino acid identity
with the ETRI sensor domain. Nevertheless, the slrI2l2 protein is capable of binding
ethylene with high affinity [8]. The function of slrl212 is unknown and is something of
a mystery because Synechocystis makes only trace amount of ethylene and no response
to the gas has been identified to date. Whatever its function, the homology between the
cyanobaterial domain and the plant receptor domain provide clues as to which amino
acid residues within the domain are essential for ethylene binding. When the
hydrophobic sub domains are modeled as membrane-spanning a-helicies, conserved
residues fall along a single face of the helix for helicies 2 and 3 [8]. These conserved
areas are likely to represent the ethylene binding site and are targets for site-directed
mutagenesis.
Insights into the mechanism of ethylene binding have been provided by the ability to
express the binding domain in yeast in an active form [4]. Yeast cells show no intrinsic
saturable ethylene-binding activity, nor do they synthesize significant amounts of
ethylene. Expression of ETRI protein in yeast results in IOO-fold higher binding
activity than that observed in plant tissues on a fresh weight basis. Equivalent levels of
binding activity in yeast were obtained by expressing a fusion protein consisting of the
ETRI sensor domain fused to a bacterial glutathione-S-transferase [GST] gene. This
construct was used to test the long-standing hypothesis that a transition-metal cofactor
mediates the binding of ethylene with its receptor [15]. Ethylene binding in membranes
extracted from yeast expressing either full-length ETRI or the GST fusion protein was
enhanced lO-fold by the addition of copper sulfate. Of other transition metals tested,
only silver ions had a similar effect. In addition, stoichiometric amounts of copper
copurified with the GST fusion protein [8].
Mutational analysis has revealed specific amino acid residues in the ethylene
binding domain that disrupt ethylene binding in the yeast-expressed ETRI protein. Of
particular significance are residues Cys65 and His69. Conversion of these residues to
Ser and Ala respectively led to complete loss of ethylene binding. Cys65 and His69
56
align within the conserved face of the second hydrophobic subdomain when it is
modeled as an a-helix, and are particularly good candidates as ligands for the copper
cofactor. In support, copper did not copurify with a mutant form of the GST fusion
protein in which Cys65 was converted to Tyr [8].
Based on these results, a model for ethylene perception has been proposed in which
the ethylene-binding domain consists of a Cu[I] coordinated in an electron rich
hydrophobic pocket formed by membrane-spanning helicies of the ETRI protein.
Interaction of ethylene with the copper ion would result in a change in coordination
chemistry, which, in tum would lead to a conformational change in the receptor.
5. Two Challenges for the Future
The establishment of several components of the ethylene signal transduction pathway is

a major accomplishment. However, the specific mechanisms through which these
components interact to produce the ethylene response behaviors observed in the intact
plant have yet to be determined.
The genetic evidence indicates that the ETR family of receptors acts through a linear
pathway that includes CTRI and EIN2. If this is the case, then combinations of
receptor isoforms can contribute quantitatively but not qualitatively to ethylene-
response pathways downstream. Do multiple receptor-isoform interactions increase the
dynamic range of the system? Ethylene binding kinetics in both plants and yeast
expressing single isoforms of the receptor indicate a KD for ethylene binding of less
than 0.1 mVI [4], yet ethylene responses in planta show a much wider dynamic range of
ethylene concentrations than predicted by simple Michaelis/Menten kinetics [16]. Do
interactions between different isoforms, or subtle differences in binding affinities in
different isoforms contribute to this dynamic range? Detailed physiological analysis of
plants that are null for different combinations of receptor isoforms may provide the
answer. Reintroduction of modified forms of the missing receptors into these receptor-
null backgrounds should provide a means to test specific hypotheses regarding the
mechanisms by which receptor isoforms interact.
Analysis of ethylene binding in the yeast-expressed ETRI protein has also
demonstrated that the dissociation of ethylene from the receptor occurs at a very slow
rate [half-life for release of bound ethylene is II hours]. This slow rate of dissociation
must be reconciled with the fairly rapid recovery from ethylene responses in vivo once
ethylene has been removed. For example, seedling growth recovers to pretreatment
levels within 40 minutes of removal of exogenous ethylene. Using a time lapse camera
system to measure short term changes in growth rates of etiolated Arabidopsis
seedlings, we have verified this fast recovery rate. We are currently testing the
hypothesis that recovery rates depend on synthesis of new unoccupied receptor
molecules which would activate CTRI once ethylene had been withdrawn and thus
repress the response pathways. This model is consistent with the observation that some
receptor isoforms are induced by ethylene [17].
57
6. Acknowledgments
Research by the author is supported by the Department of Energy [ER20029.00] and the
National Science Foundation [MCB-9603679].
7. References
1. Bleecker, A B. et al. (1998) The ethylene receptor family from Arabidopsis: structure and
function, Phil. Trans R. Soc Land. B 353,1405-1412
2. Kieber, J . .1. et al. (1993) 1993 CTRI, a negative regulator of the ethylene response pathway in
Arabidopsis, encodes a member of the Raffamily of protein kinases, Cell 72, 427-441.
3. Johnson, P. B. and Ecker, J. R. (1998) The ethylene gas signal transduction pathway, Ann. Rev.
Genet. 32: 227-254
4. Schaller, G.E. and Bleecker, AB. (1995) Ethylene-binding sites generated in yeast expressing the
Arabidopsis ETRI gene, Science 270, 1809-1811.
5. Clark K.1. et al. (1998) Association of the Arabidposis CTRI Raf-like kinase with the ETRI and
ERS ethylene receptors, Prac. Natl. Acad. Sci. USA 95, 5401
6. Chao, Q. et al. (1997) Activation of the ethylene gas response pathway in Arabidopsis by the
nuclear protein ETHYLENE INSENSITIVE3 and related proteins, Cell 89, 1133-1144.
7. Solano, R., et al. (1998) Nuclear events in ethylene signaling: a transduction cascade mediated by
ETHYLENE INSENSITIVE3 and ETHYLENE RESPONSE FACTORl, Genes Dev. 12, 3703-
3714.
8. Rodriguez et al. (1999) A copper cofactor for the ETRI receptor from Arabidopsis, Science 283,
996-998
9. Aravind, 1. and Ponting, C.P. (1998) The GAF domain: an evolutionary link between diverse
phototransducing proteins, Trends Biochem. Sci. 22,458-459.
10. Hua et al. (1998) EIN4 and ERS2 are members of the putative ethylene receptor gene family, Plant
Cell 10, 1321-1332
11. Tieman, D. and Klee (1999) Differential expression of two novel members of the tomato ethylene
receptor family Plant Physiol. 120 (in press)
12. Hua, J. and Meyerowitz, E. M. (1998) Ethylene responses are negatively regulated by a receptor
gene family in Arabidopsis thaliana, Cell 94, 261-271
13. Treisman, R. (1996) Regulation of transcription by MAP kinase cascades, Cur. Opin. Cell BioI. 8,
205-215
14. Flemming, M. D. and Andrews, N. C. (1998) Mammalian iron transport: an unexpected link
between metal homeostasis and host defense, J. Lab. Clin. Med. 132,464- 468
15. Burg, S.P. and Burg, E.A.(1967) Molecular requirements for the biological activity of ethylene,
Plant Physiol. 42,144-152
16. Chen, G.Q. and Bleecker, AB. (1995) Analysis of ethylene signal transduction kinetics associated
with seedling-growth responses and chitinase induction in wild-type and mutant Arabidopsis, Plant
Physiol. 108, 597-607
17. Wilkinson, J.Q., Lanahan, M.B., Yen, H.-C., Giovannoni, lJ. and Klee, H.J. (1995) An ethylene-
inducible component of signal transduction encoded by Never-ripe, Science 270, 1807-1809
THE ROLE OF TWO-COMPONENT SYSTEMS IN ETHYLENE PERCEPTION
R.L. GAMBLE, M.L. COONFIELD, M.D. RANDLETT, AND G.E.

SCHALLER
Department of Biochemistry, University of New Hampshire Durham, NH
USA 03824
1. Abstract
Ethylene receptors from Arabidopsis contain domains with similarity to the two-
component signal transduction systems originally identified in bacteria. The ETRI
ethylene receptor, for example, has both histidine kinase and response regulator
domains. We are interested in how the two-component system has been adapted for
signal transduction in eukaryotes and, more specifically, ethylene signal transduction in
plants. In order to biochemically characterize the histidine kinase domain of ETR 1, this
portion of the protein was transgenically expressed in yeast. Auto-phosphorylation was
observed upon incubation with radio labeled ATP. Based on the acid/base stability of
the phospho-amino acid and site-directed mutagenesis, ETR 1 was demonstrated to
contain histidine kinase activity. In addition to its enzymatic function, the histidine
kinase domain ofETRI bound CTRI, a Raf-like protein kinase that acts in the ethylene
signal transduction pathway. This interaction occurred in ETR 1 mutants that lacked
residues required for histidine kinase activity. These data suggest that the histidine
kinase domain of ETRI performs both an enzymatic and a physical role in ethylene
signal transduction.
2. Introduction
The means by which plants recognize and transduce the ethylene signal has only begun
to be established. Several components of the ethylene response pathway have been
identified by a mutational approach with Arabidopsis [I]. The ETRI gene was
identified as the result of dominant mutations that rendered the plant insensitive to
ethylene [2, 3]. In contrast, the CTRI gene was identified as the result of mutations in
which the plant displayed a constitutive ethylene phenotype [4]. The overall
significance of these two genes in ethylene signal transduction became apparent after
their cloning and sequencing. The ETRI gene product is related to members of the two-
component signal transduction systems from bacteria, and contains all the conserved
residues required for histidine kinase activity [3]. Biochemical analysis revealed that
the ETRI protein was capable of directly binding ethylene [5], which established ETRI
as an ethylene receptor. Since the initial identification ofETRl, additional genes related
59
60
to ETRI have been identified in Arabidopsis [6-8], indicating that a family of receptors
may participate in ethylene perception. The CTRI gene product is related to the Raf-
type serine/threonine protein kinases from mammals, indicating that ethylene signal
transduction feeds into a MAP kinase cascade, with CTRI representing a MAPKKK
[4]. ETRI and CTRI have recently been shown to directly interact with each other [9].
The bacterial two-component systems, to which the ethylene receptors of
Arabidopsis are related, confer the ability to sense and respond to variety of
environmental stimuli [10-12]. These sensory systems contain two conserved domains,
termed the histidine kinase and response regulator, and for this reason are referred to as
two-component systems. Histidine kinase and response regulator domains can be
incorporated into proteins in a variety of ways. A common strategy is to link the
histidine kinase domain to a membrane-localized receptor. These bacterial receptors
function as dimers and, in response to an environmental stimulus, one monomer trans-
phosphorylates another on a conserved histidine residue [II]. The phosphate is then
transferred to an aspartic acid residue of a response regulator, the second component in
the two-component system, which mediates downstream signaling. Some of the
histidine kinases also contain a phosphatase activity that facilitates turnover of the
phosphoaspartic acid of the response regulator [II, 12].
The ETRI ethylene receptor contains an ethylene-binding site in its amino-terminal
half, and has regions with homology to histidine kinases and response regulators in its
carboxy-terminal half. We report here that ETRI has histidine kinase activity, thereby
providing evidence that ETRI may function in a manner analogous to the bacterial
receptors, with ethylene regulating activity of the histidine kinase domain. We also
report that the histidine kinase activity of ETRI is not required for interaction with
CTRI, indicating that the histidine kinase domain ofETRI performs a physical role in
addition to its enzymatic role.
3. Histidine Kinase Activity of the ETRI Ethylene Receptor
The ETRI ethylene receptor has a modular structure (Fig. lA), containing an ethylene-
binding domain [5] and discrete regions with homology to histidine kinases and
response regulators [3]. In order to facilitate analysis of histidine kinase activity, we
expressed soluble portions ofETRl, all lacking the amino-terminal domain responsible
for membrane localization and ethylene binding. We hypothesized that these soluble
portions ofETRI might still retain enzymatic activity. These were expressed in yeast as
fusions with glutathione S-transferase (GST). The fusions were soluble, as predicted
from sequence, and could be readily purified from yeast by binding to glutathione-
agarose beads [13].
Assays for histidine kinase activity were then performed directly on the GST-ETRI
fusion proteins while bound to the glutathione-agarose beads (Figure IB). Purified
GST-ETRI fusions were incubated with radiolabeled ATP, subjected to SDS-PAGE
and then blotted to nylon membrane. Incorporated radiolabel was visualized by
autoradiography. GST-fusions to wild-type ETRI were found to autophosphorylate by
this assay. The stability of the incorporated phosphate was then tested by treatment
with acid or base as a means of assessing the type of phosphate linkage. The phospho-
61
amino acid was resistant to treatment with 3 M NaOH, but was sensitive to treatment
with I M Hel, consistent with identity of the phosphoamino acid being phospho-
histidine [13].
A
Hydrophobic Histidine kinase RR
III IH G1
r0
GST IH G1
r0
B H D
-
353659
WTQ N G1
1-
d
In vitro
phosphorylation
I
1----1 Anti-ETR1
Immunoblot
Figure 1. Autophosphorylation of the ETRI ethylene receptor. (A) Features of

ETRI and the GST-ETRI fusion. Positions of the conserved histidine (H)
residue, GI box, and aspartic acid (D) residue are shown. (B) Kinase assays
perfonned with GST-ETRI fusion proteins. Assays were perfonned with
wildtype (WT) protein as well as proteins containing site-directed mutations of
the conserved histidine residue, aspartic acid residue, and G 1 box. The presence
of protein was confinned by immunoblot. This figure is adapted from Gamble et
al. [13], copyright 1998 National Academy of Sciences, U.S.A.
To further analyze the requirements for autophosphorylation, site-directed mutations

were made in ETRI (Fig. IB). These mutations were of two types--either within the
catalytic domain of ETRI, or of potential sites for autophosphorylation. The G I box of
histidine kinases is present in the region involved in ATP binding. Mutation of the G 1
box of ETRI abolished autophosphorylation, demonstrating the necessity of this region
for enzymatic activity. Mutation of the conserved histidine (His353) predicted to be the
site of autophosphorylation also eliminated the incorporation of phosphate. In contrast,
mutation of the aspartic acid residue (Asp659) within the response regulator domain of
ETRI did not eliminate the base-resistant autophosphorylation. These results are
consistent with the mechanism of two-component systems in which the initial site of
phosphorylation is a conserved histidine residue within the histidine kinase domain [II].
Truncations were used to delineate the region of ETRI required for enzymatic
activity [13]. We found that the portion ofETRI from amino acids 333 to 609 retained
histidine kinase activity. This region contains the predicted histidine kinase domain, but
62
lacks the response regulator domain and the region upstream of the histidine kinase
domain. In addition, histidine kinase activity was found to be dependent upon the
presence of divalent cations [13], showing maximal activity with Mn2+, low levels of
activity with Mg2+, and no detectable activity with Ca2+.
4. Interaction of ETRI with CTRI
Based on the genetic analysis of mutations in ETRl and eTRl, ETRI acts upstream of
CTRI in the pathway for ethylene signal transduction [4]. Thus a member of a two-
component system acts upstream of a member of a MAP kinase pathway. Such a
system has similarities to the osmosensing pathway of yeast [14]. In yeast, changes in
osmolarity are sensed by a membrane associated histidine kinase (SLNl), and the signal
is passed through a phospho-relay among members of a two-component system to a
response regulator (SSKl); the response regulator then modulates activity of SSK2, a
MAPKKK acting in the HOG 1 MAP kinase cascade.
The ETRI and ERSI ethylene receptors both interact with CTRI [9]; this interaction
supports the concept of a protein complex being involved in ethylene signal
transduction. We have investigated the interaction between ETR 1 and CTR 1, focusing
on the role that histidine kinase activity could play in this interaction.
A portion of CTRI (representing amino acids 1 to 698 of the 821 amino acid-long
protein) was co-expressed in yeast along with GST or GST-ETRI fusions. GST
proteins were then affinity purified by binding to glutathione-agarose beads, and the
purified proteins examined by Western blot analysis using antibodies directed against
GST and CTRl. We observed that CTRI co-purified with the GST-ETRI fusion
protein. However, no CTRI co-purified with control yeast expressing GST, indicating a
specific interaction between CTR1 and ETRl. These results confirm the previous
report that the amino-terminal portion of CTR1 can interact with the histidine kinase
domain ofETRI [9].
We then examined whether CTR1 could interact with GST-ETR1 fusions in which
the ETRI histidine kinase domain contained mutations that affect histidine kinase
actIVIty. Two mutant versions of ETRI that eliminate autophosphorylation were
examined, one in which the G 1 box was mutated, the second in which the putative site
of autophosphory1ation was mutated. Both these mutations eliminate
autophosphorylation of ETR1 [13]. CTR1 was found to co-purify with both mutant
versions of ETR1, indicating that histidine kinase activity of ETR 1 is not required for
the interaction. It is not known at this point whether autophosphorylation of ETR 1
might disrupt the interaction with CTRI.
5. Implications for Ethylene Signaling
The histidine kinase activity of ETRI indicates that the protein could function in a
manner analogous to two-component systems characterized in bacteria [11]. In this
model, ethylene would regulate the level of histidine kinase activity within the ETR1
ethylene receptor; after autophosphorylation, the phosphate group could be passed on to
63
downstream elements in the two-component system thereby regulating their activity. In

such case, one would predict the involvement of additional components in the pathway
for ethylene signal transduction, specifically a separate response regulator protein and
perhaps a histidine-containing phosphotransfer protein. Plants contain both response
regulators [15, 16] and phosphotransfer proteins [17], but a functional role in ethylene
signaling has not yet been demonstrated.
The bacterial model for signaling by two-component systems may require
modification in the case of ethylene signaling. Ethylene perception in Arabidopsis
involves a family of five known proteins: ETR1, ERS1, ETR2, ERS2, and EIN4 [3,6-
8]. ERS 1, like ETR1, contains a histidine kinase domain in which all the residues
required for activity are conserved [6]. However, the other putative ethylene receptors
contain diverged histidine kinase domains that lack residues considered essential for
histidine kinase activity. One can postulate several possible functions for these
diverged histidine kinase domains. First, rather than having kinase activity, they might
have phosphatase activity. The precedent for this proposal is that many bacterial
histidine kinases also have a phosphatase activity directed at the phosphorylated
response regulator [11]. The requirements for the phosphatase activity are not as
stringent as the kinase activity and may be met in the sequences of ETR2, ERS2, and
EIN4. Second, rather than histidine kinase activity, the diverged members of the family
might have serine/threonine kinase activity. The precedent for this proposal is that
several proteins with homology to histidine kinases have been demonstrated to be
serine/threonine kinases [18, 19]. Evidence exists that plant phytochromes, which
represent diverged histidine kinases, may function as serine/threonine kinases [20].
Third, it may be that the diverged members lack any enzymatic activity, and that the
residual histidine kinase domain functions strictly as an interaction domain.
Evidence has begun to accumulate that ethylene signaling may involve formation of
a complex involving both ethylene receptors and other signaling components. Notably,
the CTRI protein has been demonstrated to associate with ETRI and ERS 1 [9]. Thus,
the ethylene receptors perform both enzymatic and physical roles in signal transduction.
Due to this interaction between proteins, it is possible that changes in activity or
conformation of ETRI could serve to regulate CTRI. Such regulation could be direct
or could involve additional proteins such as other members of the two-component
signaling system. In yeast, osmosensing involves a two-component system that feeds
into a MAP kinase pathway [14], a situation very similar to what is found in the plant
ethylene-signaling pathway. How similar these two eukaryotic pathways are will have
to await further dissection of the plant ethylene signaling pathway and elucidation of the
precise role that two-component systems play in delivering the ethylene signal to CTR 1.
6. Acknowledgements
We thank Joe Kieber and Caren Chang for assistance with the experiments involving
CTRI. We thank Tony Bleecker for sharing his insights on the mechanism of ethylene
perception. The National Science Foundation (MCB-9603679) and the New Hampshire
Agricultural Research Station (Hatch 386) supported this work.
64
7. References
1. Ecker, 1.R. (1995) The ethylene signal transduction pathway in plants, Science 268, 667-674.
2. Bleecker, AB., Estelle, M.A., Somerville, e. and Kende, H. (1988) Insensitivity to ethylene
conferred by a dominant mutation in Arabidopsis thaliana, Science 241, 1086-1089.
3. Chang, C., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (1993) Arabidopsis ethylene
response gene ETRl: Similarity of product to two-component regulators, Science 262, 539-544.
4. Kieber, J.J., Rothenberg, M., Roman, G., Feldman, KA and Ecker, 1.R. (1993) CTRI, a negative
protein kinases, Cell 72, 427-441.
5. Schaller, G.E. and Bleecker, AB. (1995) Ethylene-binding sites generated in yeast expressing the
Arabidopsis ETR! gene, Science 270, 1809-1811.
6. Hua, 1., Chang, e., Sun, Q. and Meyerowitz, E.M. (1995) Ethylene sensitivity conferred by
Arabidopsis ERS gene, Science 269, 1712-1714.
7. Sakai, H., Hua, 1., Chen, Q.G., Chang, e., Medrano, LJ., Bleecker, AB. and Meyerowitz, E.M.
(1998) ETR2 is an ETR! -like gene involved in ethylene signaling in Arabidopsis, Proc. Natl. Acad.
Sci. USA 95, 5812-5817.
8. Hua, J., Sakai, H., Nourizadeh, S., Chen, Q.G., Bleecker, AB., Ecker, 1.R. and Meyerowitz, E.M.
(1998) EIN4 and ERS2 are members of the putative ethylene receptor family in Arabidopsis, Plant
Cell, 10, 1321-1332.
9. Clark, K.L., Larsen, P.B., Wang, X. and Chang, e. (1998) Association of the Arabidopsis CTRI
Raf-like kinase with the ETRI and ERSI ethylene receptors, Proc. Nat!. Acad. Sci. USA 95,5401-
5406.
10. Stock, J.B., Ninfa, AJ.,and Stock, AM. (1989) Protein phosphorylation and regulation of adaptive
responses in bacteria, Microbiol. Reviews 53, 450-490.
11. Parkinson, lS. (1993) Signal transduction schemes of bacteria, Cell 73, 857-871.
12. Swanson, R.Y., Alex, L.A and Simon, M.l. (1994) Histidine and aspartate phosphorylation: two-
component systems and the limits of homology, Trends Biochern. 19,485-490.
13. Gamble, R.L., Coonfield, M.L. and Schaller, G.E. (1998) Histidine kinase activity of the ETRI
ethylene receptor from Arabidopsis, Proc. Natl. Acad. Sci. USA 95, 7825-7829.
14. Posas, F., Wurgler-Murphy, S.M., Maeda, T., Witten, EA, Thai, T.e. and Saito, H. (1996) Yeast
HOG I MAP kinase cascade is regulated by a multistep phosphorelay mechanism in the SLN 1-
YPOI-SSKI "two component" osmosensor, Cell 86, 865-875.
15. Brandstatter, I. and Kieber, J.J. (1998) Two genes with similarity to bacterial response regulators
are rapidly and specifically induced by cytokinin in Arabidopsis, Plant Cell 10, 1009-1019.
16. Imamura, A, Hanaki, N., Umeda, H., Nakamura, A, Suzuki, T., Ueguchi, C. and Mizuno, T.
(1998) Response regulators implicated in his-to-asp phosphotransfer signaling in Arabidopsis,
Proc. Natl. Acad. Sci. USA 95,2691-2696.
17. Miyata, S.-i., Urao, T., Yamaguchi-Shinozaki, K. and Shinozaki, K. (1998) Characterization of
genes for two-component phosphorelay mediators with a single HPt domain in Arabidopsis
thaliana, FEBS Lett. 437,11-14.
18. Popov, K.M., Kedishvili, N.Y., Zhao, Y., Shimomura, Y., Crabb, D.W. and Harris, RA (1993)
Primary structure of pyruvate dehydrogenase kinase establishes a new family of eukaryotic protein
kinases, J. Bioi. Chern. 268, 26602-26606.
19. Popov, K.M., Zhao, Y., Shimomura, Y., Kuntz, MJ. and Harris, R.A (1992) Branched-chain
alpha-ketoacid dehydrogenase kinase: Molecular cloning, expression, and sequence similarity with
histidine protein kinases,J. Bioi. Chern. 267, 13127-13130.
20. Yeh, K.-C. and Lagarias, 1.C. (1998) Eukaryotic phytochromes:Light-regulated serine/threonine
protein kinases with histidine kinase ancestry, Proc. Natl. Acad. Sci. USA 95,13976-13981.
PROTEIN-PROTEIN INTERACTIONS IN ETHYLENE SIGNAL
TRANSDUCTION IN ARABIDOPSIS
C. CHANG, P.B. LARSEN, K.L. CLARK, c.-K. WEN, W. DING, l.A.

SHOCKEY and Z. PAN
Department of Cell Biology and Molecular Genetics, University of
Maryland, College Park, MD 20742 USA
1. Abstract
We are using molecular genetic approaches in Arabidopsis thaliana in order to elucidate

the mechanisms of ethylene signal transduction. In particular, we are interested in
understanding how the ETRI ethylene receptor and its homologs signal to the
downstream protein kinase, CTRI. A starting point for addressing this question is to
examine protein-protein interactions involving the receptors and CTRI. To detect
protein interactions, we are utilizing the yeast two-hybrid assay as well as in vitro
protein association assays. Using these methods, we are analyzing the association
between the putative regulatory domain ofCTRl and the predicted cytoplasmic portions
of both ETR 1 and ERS I. In addition, we have been screening yeast two-hybrid
libraries in order to identify proteins that interact with the CTRI amino-terminal domain
and/or the ETRI, ETR2 and ERSI ethylene receptors.
2. Introduction
A number of protein components are known to function in the ethylene-response

pathway in Arabidopsis [reviewed in I]. Here, we focus on the early events of ethylene
signal transduction, which involve a family of ethylene receptors and a Raf-like protein
kinase called CTRI. CTRI is a negative regulator of the pathway, because CTRI loss-
of-function mutations give constitutive ethylene responses in the absence of ethylene
[2]. Epistasis analysis indicates that CTRI acts downstream of each of the known
ethylene receptors [3].
There are five ethylene receptor genes in Arabidopsis: ETRI, ERSl, ETR2, EIN4
and ERS2. All are considered to code for ethylene receptors based on their mutant
phenotypes and sequence similarities. The encoded products share a common amino-
terminal domain followed by a histidine protein kinase-like domain. In addition, ETR I,
ETR2 and EIN4 have a carboxyl-terminal receiver domain. The histidine protein kinase
and receiver domains are the two main elements of the "two-component" signaling
system, in which histidine autophosphorylation is followed by transfer of the phosphate
65
66
to an aspartate residue in the receiver domain [4]. Reversible ethylene binding [5] and
in vitro histidine autophosphorylation [6] have been demonstrated for ETR 1.
The ethylene receptors fall into two classes based on their structural similarities.
ETR1 and ERSl, which are in the first class, are more closely related to each other than
they are to the other three. Likewise, the three in the second class are more similar to
each other than they are to ETR1 and ERS 1. Notably, both ETRI and ERS 1 possess all
five sequence motifs that characterize the histidine protein kinases, whereas members of
the second class lack most or all of these motifs, raising doubts as to whether this class
of receptors possesses histidine kinase activity.
The ethylene receptors were initially identified by dominant mutations that confer
ethylene insensitivity [7-9]. When recessive loss-of-function or null mutations were
subsequently isolated in the receptor genes, the individual mutants were phenotypically
wild-type, indicating that the receptors have redundant functions [10]. (The ely} mutant
had a slightly shorter hypocotyl [10]). When three or more receptors were knocked out,
however, constitutive ethylene responses were observed [10]. This result indicates that
the receptors are normally negative regulators of the pathway. Because the negative
regulator CTRI acts downstream of all the receptors (based on genetic epistasis), the
receptors are deduced to be positive regulators of CTRI in the absence of ethylene
binding (Fig. 1). Thus, genetic analyses suggest that ethylene binding inhibits signaling
by the receptors, shutting off CTRI and resulting in ethylene responses. In the
dominant insensitive receptor mutants, CTR1 must somehow be kept active to repress
responses.
ETR1
ERS1
C2 H 4 -1 ETR2 -.....t.,~ CTR1 ----1 responses
EIN4
ERS2
Figure 1. Genetic model of early events in Arabidopsis ethylene signal

transduction. Ethylene binding negatively regulates the five receptors
(ETRl, ERSl, ETR2, EIN4 and ERS2), which are positive regulators of
the CTRI protein kinase. CTRl, in tum, acts as a negative regulator of
the pathway.
This family of ethylene receptors raises a number of questions, such as why are
there multiple receptors? Do they have both unique and overlapping functions?
Although genetic analysis of mutant phenotypes has indicated that the receptor genes
are partially redundant, it is unlikely that they are entirely redundant (as suggested by
their structural differences). We are interested in: 1) how each of the ethylene receptors
signals to CTR1, and 2) how these receptors might differ in their signaling functions in
terms of their protein-protein interactions. To address these questions at the
biochemical level, our starting point has been to examine protein-protein interactions
involving the receptors and CTRI. This has led to us to analyze direct interactions
between CTRl and two of the receptors, ETRI and ERSl. In conjunction with this, we
are screening two-hybrid libraries in search of proteins that might interact with the
predicted cytoplasmic domain of the receptors and/or the regulatory domain of CTR1.
67
3. Association of CTRl with the ETRl and ERSl Ethylene Receptors
We have employed the yeast two-hybrid protein interaction assay [11] to test whether
the ethylene receptors can interact directly with the CTRI protein kinase. As we had no
particular reason for expecting this to occur, we were somewhat surprised to detect an
association of the N-terminal (presumed regulatory) portion of CTRI with both the
ETRI and ERSI histidine kinase domain [12]. We observed these interactions using the
two-hybrid assay, as well as by in vitro protein association assays [12]. Additionally,
we found that the amino-terminal domain of CTRI can associate in vitro with the
receiver domain ofETRI [12]. There was no detectable interaction between the CTRI
kinase domain and either ETRI or ERSl [12; Clark and Chang, unpublished].
The interaction of the CTRl N-terminal domain with ETRl and ERSI is novel in
that there have been no other reports of direct interactions between a serine/threonine
protein kinase and a two-component signaling protein to date. A similar association has
not been seen for the corresponding components of the S. cerevisiae osmolarity-
response pathway [13]. This osmolarity-response pathway has parallels with the plant
ethylene-response pathway in that it is comprised of a two-component phosphorelay
system coupled to a MAPK cascade [14]. However, in this yeast pathway, the
osmolarity sensor (SLNI) does not detectably interact with the MAPKKK (SSK2) of the
pathway [13].
Our results suggest the possibility that the regulation of CTRI activity may involve
novel direct interactions with the ethylene receptors in plants. We are currently working
on obtaining evidence for the interaction in plant cells and determining the functional
relevance of the association. Some possible mechanisms are that CTRI, like Raf, might
be activated by recruitment to the membrane, or the receptors might facilitate dimerization
of CTRl. Or perhaps CTRl is directly phosphorylated by the receptors. In addition, other
components are likely to be involved. A very simplistic model for CTRl regulation is that
there are two alternative binding states for the regulatory domain of CTRI; perhaps it
either associates with the receptors or with its own kinase domain in an ethylene-
dependent fashion.
We next considered the possibility that the receptor histidine kinase domain might be
phosphorylated on His353 in the yeast cells, and that perhaps the CTRI association was
dependent upon this phosphorylation. We used in vitro site-directed mutagenesis to
replace the codon for His353, which was shown to be the site of autophosphorylation
[6], with a codon for Gin in ETRl. However, we found that this amino acid substitution
had essentially no effect on the two-hybrid interaction with CTRI (Table 1). This result
indicates that the two-hybrid association of CTRl and ETRI does not require the
His353 residue. In contrast, a pair of point mutations creating the substitutions Ser544
to Arg and Gly545 to Asp within a putative ATP binding site (the "G2" motif) of the
histidine kinase domain caused a dramatic reduction in the interaction (Table 1). We
verified that this loss of interaction was not due to reduced protein expression levels in
the yeast cells (data not shown). There are several interpretations of this result, but the
most interesting is that binding of ATP by G2 is involved in the interaction of ETRI
with CTRl; conceivably, ATP could serve as an allosteric effector at this site, rather
than as a hydrolyzed substrate [4].
68
Table I. Effect of amino acid substitutions on the two-hybrid interaction of CTRI with the ETRI
histidine kinase (HK) and receiver (R), as measured by p-galactosidase activity (Millar units) +/-
standard error.
DNA-binding domain fusion Activation domain fusion p-gal units
ETRI HK+R CTRI N-term 20.2 +/-2.8

ETRI HK+R (H353Q) CTRI N-term 20.9 +/-4.0
ETRI HK+R (S544R + G545D) CTRI N-term 0.52+/-0.05
ETRI HK+R (H353Q + S544R + G545D) CTRI N-term 0.48+/-0.07
Vector CTRI N-term 0.34+/-0.05
What about the second class of ethylene receptors, which consists of ETR2, EIN4
and ERS2? Epistasis analysis indicates that CTRI acts downstream of all five
receptors. We thus expected that CTRI would similarly interact with the second class
of receptors. To date, however, we have been unable to detect any interaction of CTR I
with different constructs of ETR2, EIN4 and ERS2. This result may reflect differences
in signaling mechanisms between the two classes of receptors. The ETR2, EIN4 and
ERS2 receptors lack most or all of the sequence motifs that are characteristic of
histidine protein kinases, including the 02 motif (which could be why CTR 1 is unable
to interact with them). Somehow, we must reconcile the apparent lack of interaction
with the genetic data, which suggests that this second class of receptors does signal
through CTR I. One clue may come from our recent observation that ETR2 can interact
with ETRI and ERSI (Wen and Chang, unpublished). In addition, preliminary data
suggests that ETR2 can form a protein complex in yeast involving both ETRI and
CTRI (Wen and Chang, unpublished). Perhaps the second class of receptors, which
might lack histidine kinase activity of their own, requires interactions with ETRI and/or
ERSI for ethylene signaling. Although this is a highly speculative model, such
communication between the receptors might explain how the dominant receptor
mutations can result in severe ethylene insensitivity. For example, a mutant receptor
that is locked into a state that signals the absence of ethylene might "switch" other
receptors within a complex to the non-ethylene state. We are currently investigating
whether ETR2 signals to CTR I via interaction with ETR I and ERS I.
4. Two-hybrid Library Screens
Despite the direct association of the receptors with CTRI, we cannot rule out the
possibility that other protein components are part of the ethylene receptor complex, and
playa role in ethylene signaling or its regulation. Therefore, we have been using the
two-hybrid assay to screen expression libraries for proteins that interact with the
ethylene receptors and/or the amino-terminal domain of CTR I. We used three different
receptor bait constructs (shown in Figure 2) to screen a two-hybrid library of etiolated
Arabidopsis seedling cDNAs (obtained from the Arabidopsis Biological Resource
Center, The Ohio State University). Altogether, we screened several million clones.
69
We eliminated clones that either activated the two-hybrid reporter genes on their own
(in the absence of the bait construct) or gave reporter gene activity in combination with
human lamin (an arbitrary control for non-specific interactions). We confirmed the
positives by purification of the plasmids and re-transformation of yeast. To date, we
have sequenced 43 different genes encoding products that interact with ETR 1, ETR2
and/or ERSI in the two-hybrid assay. Based on their sequences, about one third have
no significant similarity to sequences in the databases. Another third of the genes have
sequence homology that we think is unlikely to be significant. The remaining third
have sequence homologies that are of interest to us because they are either known
signaling proteins or implicate crosstalk to other signaling pathways. This latter group
of positives includes a GAl homolog (which is a gene involved in the gibberellic acid
signaling pathway), a SNFI homolog, a GRRI homolog, and phytochrome A. Some of
the products also interact with CTRI.
-
ethylene histidine
ETR1 bindin! kinase receiver
or ( >t t-C)
ETR2 ser/thr
regulatory kinase
CTR1
ethylene histidine

binding kinase
ERS ( ~
Figure 2. Protein constructs used as baits (fused to the lexA DNA-binding

domain) in two-hybrid library screens for interacting components. Portions
used are shown below the schematics of the full-length proteins.
We also screened the same two-hybrid library with an amino-terminal portion of

CTRI as a bait (Fig. 2). Of the 28 positive clones we have sequenced to date, 21 of
these encode members of the 14-3-3 protein family. These clones represent five of the
ten known 14-3-3 isoforms in Arabidopsis. None of the clones display interaction with
the kinase domain of CTRI nor with negative controls (data not shown). In mammals,
several 14-3-3 isoforms can interact physically with Raf, and seem to playa role in Raf
kinase activation [e.g., 15-17]. These findings suggest the possibility that 14-3-3
proteins have a role in the ethylene signal transduction pathway in Arabidopsis.
We are currently seeing if we can verify any of these protein interactions
functionally either in plants or in heterologous systems.
5. Acknowledgements
Our research is funded by NRI Competitive Grants Program/USDA grant 98-35304-

6795, Maryland Agricultural Experiment Station grant MICR-99-25, and a University
of Maryland Center for Biomolecular Structure and Organization research support
award. P.L is supported by NRI Competitive Grants Program/USDA postdoctoral grant
97-35304-4921.
70
6. References
1. Ecker, J.R. (1995) The ethylene signal transduction pathway in plants, Science 268, 667-674.
2. Kieber, J.1., Rothenberg, M., Roman, G., Feldmann, K.A., and Ecker, J.R (1993) CTR1, a negative
regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of
3. Roman, G., Lubarsky, B., Kieber, J.1., Rothenberg, M., and Ecker, J.R. (1995) Genetic analysis of
ethylene signal transduction in Arabidopsis thaliana: Five novel mutant loci integrated into a stress
response pathway, Genetics 139, 1393-1409.
4. Parkinson, J.S. and Kofoid, E.C. (1992) Communication modules in bacterial signaling proteins,
Annu. Rev. Genet. 26, 71-112.
5. Schaller, E.G. and Bleecker, AB. (1995) Ethylene binding sites generated in yeast expressing the
6. Gamble RL., Coonfield M.L., and Schaller G.E. (1998) Histidine kinase activity of the ETRI
ethylene receptor from Arabidopsis, Proc. Natl. Acad. Sci. USA 95,7825-7829.
7. Bleecker, AB., Estelle, M.A., Somerville, C., and Kende, H. (1988) Insensitivity to ethylene
8. Hua, J. Sakai, H., Nourizadeh, S., Chen, Q.G., Bleecker, A B., Ecker, J. R., and Meyerowitz, E.
M. (1998) EIN4 and ERS2 are members of the putative ethylene receptor gene family in
Arabidopsis, Plant Cell 10, 1321-1332.
9. Sakai, H., Hua, J., Chen, Q.G., Chang, C., Medrano, L.1., Bleecker, AB., and Meyerowitz, E.M.
(1998) ETR2 is an ETRI-like gene involved in ethylene signaling in Arabidopsis, Proc. Nat!. Acad.
Sci. USA 95, 5812-5817.
10. Hua, J. and Meyerowitz, E.M. (1998) Ethylene responses are negatively regulated by a receptor
gene family in Arabidopsis thaliana, Cell 94, 261-271.
II. Fields, S. and Stemglanz, R (1994) The two-hybrid system: an assay for protein-protein
interactions, Trends Genet. 10, 286-292.
12. Clark K.L., Larsen P.B., Wang x., and Chang C. (1998) Association of the Arabidopsis CTRI Raf-
like kinase with the ETRI and ERS ethylene receptors, Proc. Nat!. Acad. Sci. USA 95, 5401-5406.
13. Posas, F. and Saito, H. (1998) Activation of the yeast SSK2 MAP kinase kinase kinase by the
SSKI two-component response regulator, EMBO J. 17, 1385-1394.
14. Posas, F., Wurgler-Murphy, S.M., Maeda, T., Witten, E.A., Thai, T.C., and Saito, H. (1996) Yeast
HOGI MAP kinase cascade is regulated by a multi-step phosphorelay mechanism in the SLNI-
YPDI-SSKI "two-component" osmosensor, Cell 86, 865-875.
15. FantJ, W.J., Muslin, A J., Kikuchi, A, Martin, J.A, MacNicol, AM., Gross, R.W., and Williams,
L.T. (1994) Activation of Raf-l by 14-3-3 proteins, Nature 371, 612-614.
16. Freed, E., Symons, M., Macdonald, S.G., McCormick, F., and Ruggieri, R. (1994) Binding of 14-
3-3 proteins to the protein kinase Raf and effects on its activation, Science 265, 1713-1716.
17. Fu, H., Xia, K., Pallas, D.C., Cui, C. Conroy, K., Narsimhan, RP., Mamon, H., Collier, RJ., and
Roberts, T.M. (1994) Interaction of the protein kinase Raf-l with the 14-3-3 proteins, Science 266,
126-129.
ETHYLENE SIGNALING: MORE PLAYERS IN THE GAME
D. VAN DER STRAETEN, J. SMALLE, S. BERTRAND, A. DE

PAEPE, I. DE PAUW, F. VANDENBUSSCHE, M. HAEGMAN, W.
VAN CAENEGHEM, and M. VAN MONTAGU
Laboratorium voor Genetica, Departement Genetica, Vlaams
Interuniversitair Instituut voor Biotechnologie (VIB), Universiteit Gent,
K.L. Ledeganckstraat 35, B-9000 Gent, Belgium
1. Abstract
The Arabidopsis ethylene response pathway was established by characterization of

ethylene mutants that were isolated exploiting the triple response of dark-grown
seedlings. The various triple response screens were not yet exhaustive; however, a large
number of ethylene-related loci have been identified, and for several of these an allelic
series was isolated. To increase the chance of identifying new loci, screening for
mutants at developmental stages other than the etiolated seedling stage might be a
useful approach. We have isolated mutants from light-grown populations, by using the
ethylene response of nutrient-deficient seedlings at two stages in development.
Characterization of these mutants has resulted in the identification of new loci involved
in ethylene signaling.
2. Introduction
By using the triple response assay for isolating ethylene mutants and subsequent double-
mutant analysis, the ethylene signal was found to be perceived through several receptors
(ETRI, ETR2, ERSI, ERS2, and EIN4) and to be transduced via a linear pathway to the
nucleus, where the expression of a set of primary ethylene response genes is regulated
[1-5]. The receptor genes have significant homology with bacterial two-component
regulators.
Downstream, the signal is transduced via CTRI that encodes a Raf-Iike protein kinase
[6]. All the ctrl mutations that were found are predicted to disrupt the kinase activity [6].
Furthermore, the homology of CTRI to Raf-I suggested that a MAP kinase cascade is
located downstream [7].
Several facts suggest the existence of additional components in ethylene signaling.
For instance, certain mutants are affected at specific developmental stages [8]. In other
mutants, the effect of the mutation is related to the presence or absence of light [9].
Therefore, developmental regulation of both ethylene biosynthesis and sensing should
exist. In addition, signaling pathways are unlikely merely linear and parallel to one
another, but rather form a complex network that balances and fine tunes effects of
71
72
different endogenous and exogenous factors, which control downstream gene expression.
Thus, hormone signaling pathways are probably integrated with those participating in
phototransduction, control of the biological clock, nutrient sensing, and stress. Bearing
these facts in mind, one can design novel screens not only to isolate the missing links in
the currently known ethylene pathway, but perhaps also to define additional components.
3. Novel Screening Methods
In order to identify novel components in ethylene signaling, different screening methods

were designed [10-1 I]. These assays would be required to identify genes that mediate
ethylene effects at developmental stages other than the etiolated seedling stage. To
complement the work done on triple-response mutants, assays were set-up that allow the
screening of large populations of seedlings that are grown in the light, without the
requirement for supplementary greenhouse space. These methods were based on the size
reduction of nutrient-deficient seedlings, in combination with the stimulatory effect of
ethylene or its precursor l-aminocyclopropane-I-carboxylate (ACC) on hypocotyl
elongation and leaf emergence (Figs I and 2). Besides the reduction in seedling size, the
smaller and more slowly emerging leaves also allowed the analysis of hypocotyl length
during a longer time interval, significantly facilitating the analysis of large populations of
seedlings. In both cases, insensitive and hypersensitive mutants can be screened for in the
presence of the hormone, whereas constitutive mutants can be recognized in hormone-free
conditions.
4. New Players in the Game?
Both the hypocotyl elongation and leaf emergence response were used in screening
populations of mutant Arabidopsis seedlings, which resulted in a large collection of
candidate ethylene mutants. Some of the mutants were allelic to known ethylene mutants,
whereas others were identified as novel components of the ethylene response pathway
(Smalle et at., in preparation).
Three lines have been characterized genetically. One of these mutants was of special
interest, because its phenotype combines both an ethylene insensitive and a partially
constitutive response. In the light, the hypocotyl of this mar I (acronym for mimics ACC
response 1) mutant is slightly more elongated, and leaf blades are epinastic and reduced in
size. In addition, newly emerging marl rosette leaves showed an increased negative
gravitropic growth pattern. Dark-grown mar 1 seedlings have a partially constitutive triple
response that is characterized by a thicker hypocotyl and an exaggerated apical hook.
Light- as well as dark-grown marl seedlings were also less sensitive to ethylene or ACC,
indicating that the amplitude of possible ethylene responses in mar I is decreased both in a
negative and positive manner. The marl mutation is dominant, and epistasis analysis that
uses the light-grown phenotype allowed us to position MARl in the ethylene signal
transduction pathway.
The various screens also resulted in several ACC-insensitive mutants, one of which
displayed a novel mutant phenotype. The ain2 mutant is strongly insensitive to both ACC
73
Screening for Arabidopsis mutants

in the light (hypocotyllength)
Wild type
Constitutive
Figure 1. Hypocotyl elongation screen. For details on the procedure, see Smalle et al. [10].
and ethylene, with a dramatic delay in flowering time and leaf senescence. Normally,
these characteristics accompany ethylene insensitivity; however, in contrast to all
ethylene-insensitive mutants known to date, ain2 also showed a decreased shoot apical
dominance, confirming previous physiological data on the role of ethylene in this
developmental process [11]. Analysis of the progeny of an ain2 X ein2 cross indicated
that both mutants are allelic. Strong ethylene insensitivity normally results in a decreased
germination percentage, which can be further aggravated when germination is performed
in the dark. This is expected to cause an underrepresentation of strong insensitive mutants
in a etiolated popUlation of mutant seedlings, and may explain why mutants such as ain2
have not been isolated so far in the various triple-response screens [8, 9, 13-15].
Therefore, screening of a light-grown population of seedlings therefore is expected to
increase the chance of obtaining strongly insensitive mutants.
74
Figure 2. Leaf emergence response screen. For details on the procedure, see [II].
Besides marJ and ain2 that were isolated by monitoring hypocotyl elongation of light-
grown seedlings, another new ethylene-related locus was identified by screening for leaf
emergence mutants. The slo mutant showed a delay at several developmental stages,
including leaf emergence. Compared to the wild type, slo seedlings were less sensitive to
high concentrations of ACC or ethylene. In addition, the slo mutation enhanced the ACC
resistance of etrJ and ein2 mutants, indicating that SLO acts in an ACC response pathway
separate from the one defined by the ETRJ and EJN2 genes. Development of slo seedlings
displayed several characteristics that can be related directly to a loss of ethylene effects,
including a delay in seed germination and leaf senescence, and a reduction in root hair
formation and elongation. Characterization of slo in different ecotype backgrounds and in
combination with the ethylene mutants etrJ, ein2, and ctrJ also indicated a role for
ethylene in cotyledon formation.
5. Perspectives
A number of mutated Arabidopsis seedlings have been screened for ethylene mutants by
using two novel response assays. These screens led to the identification of at least two
new ethylene-related loci. The results indicate that many more ethylene-related genes
await identification and suggest that the mechanism with which higher plants sense and
respond to ethylene is complex and integrated into a larger network of signal transduction
pathways, including the response to light, to nutrients, and also to other hormones.
75
6. Acknowledgments
This work was supported by grants from the Fund for Scientific Research (G.028 1.98 and
Krediet aan Navorsers 93-96). D.V.D.s. is a Research Associate of the Fund for Scientific
Research (Flanders),
7. References
1. Chang, C., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (1993) Arabidopsis ethylene-response
gene ETRl: similarity of product to two-component regulators, Science 262, 539-544.
2. Chao, Q., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W. and Ecker, J.R. (1997) Activation of the
ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and
related proteins, Cell 89, 1133-1144.
3. Hua, J., Chang, C., Sun, Q. and Meyerowitz, E.M. (1995) Ethylene insensitivity conferred by
Arabidopsis ERS gene, Science 269,1712-1714.
4. Hua, J., Sakai, S., Nourizadeh, S., Chen, Q.G., Bleecker, AB., Ecker, J.R. and Meyerowitz, E.M. (1998)
EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis, Plant Cell
10, 1321-1332.
5. Sakai, H., Hua, 1., Chen, Q.G., Chang, C., Medrano, LJ., Bleecker, AB. and Meyerowitz, E.M. (1998)
ETR2 is an ETRI-Iike gene involved in ethylene signaling in Arabidopsis, Proc. Natl. Acad. Scie. USA
95, 5812-5817.
6. Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A. and Ecker, 1.R. (1993) CTRl, a negative
8. Roman, G., Lubarsky, B., Kieber, J.J., Rothenberg, M. and Ecker, J.R. (1995) Genetic analysis of
ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress
response pathway, Genetics 139,1393-1409.
9. Guzman, P. and Ecker, J.R. (1990) Exploiting the triple response of Arabidopsis to identifY
ethylene-related mutants, Plant Cell 2, 513-523.
10. Smalle, J., Haegman, M., Kurepa, J., Van Montagu, M. and Van Der Straeten, D. (1997) Ethylene can
stimulate Arabidopsis hypocotyl elongation in the light, Proc. Natl. Acad Scie. USA. 94,2756-2761.
II. Smalle,1. and Van Der Straeten, D. (1997) Ethylene and vegetative development, Physiol. Plant. 100,
593-605.
12. Abeles, F.B., Morgan, P.w. and Saltveit, M.E. (1992) Ethylene in Plant Biology, 2nd ed., Academic
Press, San Diego.
13. Bleecker, AB., Estelle, M.A., Somerville, C. and Kende, H. (1988) Insensitivity to ethylene conferred
by a dominant mutation in Arabidopsis thaliana, Science 241, 1086-1089.
14. Harpham, N.V.J., Berry, AW., Knee, E.M., Roveda-Hoyos, G., Raskin, I., Sanders, 1.0., Smith, AR.,
Wood, C.K. and Hall, M.A. (1991) The effect of ethylene on the growth and development of wild type
and mutant Arabidopsis thaliana (L.) Heynh, Ann. Bot. 68,55-62.
15. Van Der Straeten, D., Djudzman, A, Van Caeneghem, W., Smalle, 1. and Van Montagu, M. (1993)
Genetic and physiological analysis of a new locus in Arabidopsis that confers resistance to
I-aminocyclopropane-I-carboxylic acid and ethylene and specifically affects the ethylene signal
transduction pathway, Plant Physiol. 102,401-408.
THE EFFECT OF ETHYLENE AND CYTOKININ ON GTP BINDING AND
MAP KINASE ACTIVITY IN ARABIDOPSIS THALIANA
A.R. SMITH\ I.E. MOSHKOy2, G.Y. NOYIKOYA 2 AND M.A.HALLI

Ilnstitute of Biological Sciences, University of Wales, Aberystwyth, UK.
2Timiryazev Institute of Plant Physiology, Russian Academy of Sciences,
Moscow, Russia
1. Abstract
Current evidence suggests that ethylene signal transduction is mediated through protein
phosphorylation . While ethylene has been shown to promote protein phosphorylation,
incubation with cytokinin antagonises this effect in Triton X-I 00 solubilised membrane
fractions from rosette leaves of Arabidopsis. In etr, protein phosphorylation is lower
than wild type and is promoted by cytokinin. Protein phosphorylation in the mutant ctr
is not only much higher than in wild type but is different in pattern. Ethylene treatment
results in increased GTP binding to a monomeric G-protein in wild type membrane
extracts. Constitutive GTP binding in etr is lower than in wild type. MAP kinase
activity in cytosolic fractions is increased by ethylene and cytokinin antagonises this
effect. In etr, MAP kinase activity is lower than in wild type but in ctr activity was
enhanced. Hence, it is proposed that ethylene signal transduction, at least in part,
involves small GTP-binding proteins in the mediation of a MAP kinase cascade.
2. Introduction
Enormous strides have been made over the last decade in identifying ethylene receptors
and components of the ensuing transduction chain. Much of this progress has arisen
from the use of Arabidopsis mutants and there is now a wide range of these where the
mutated genes are well defined.
Less well defined however are the consequences of these mutations in vivo, both in
terms of physiology and of biochemistry. It is already clear that there exists a family of
ethylene receptors the relative functionality of which is unknown and that the
transduction chain(s) is complex. Moreover, it is becoming increasingly clear that
interactions occur between transduction chains for different hormones [8, 17] and that
this may also be the case in relation to the transduction processes for stress responses [6,
15, 2, 3, 12] and responses to pathogens [18, 10]. In such circumstances, the
consequences of inactivating individual components are unpredictable.
We describe here some investigations on aspects of the ethylene transduction chain
using the Arabidopsis mutants etr. ctr and eti5 [I, 7, 5].
77
78
150
"e 125
E
a
0 100
c
0
G 75
~
~
lI- 50
-i
25
~...
o - wild typo - oti5 E3 - etr
Figure 1. In vitro protein phosphorylation in 130kg membranes from Arabidopsis

leaves. Ethylene was applied at a concentration of I III 1"1 for I h and 10" M BAP
was added to the homogenisation buffer.
wild
type cfr
kDa: 94
67
43
30
20.1 -
14.4-
Ethylene: - +
Figure 2. In vitro protein phosphorylation in membranes of ethylene-treated and

untreated wild type and untreated ctr leaves.
79
3. Signal transduction
3.1. PROTEIN PHOSPHORYLATION
It has been demonstrated by our group and others that ethylene treatment of tobacco
[16] peas [13] and Arabidopsis [17] leads to increased protein phosphorylation.
Moreover, the CTRI gene shows strong homology with Raf I [7] (a MAPKK Kinase)
and possesses the appropriate biochemical activity [9]. Thus, protein phosphorylation
in 130kg membranes from Arabidopsis leaves was measured and the results are shown
in Figure 1. The effect of ethylene in promoting phosphorylation is clear; benzyladenine
(BAP) has little effect alone but strongly antagonises the ethylene effect.
As noted previously [17] consitutive protein phosphorylation is higher in eti 5 than
in wild type and is promoted by BAP. In etr on the other hand, protein phosphorylation
is below that found in wild type but is promoted by cytokinin. The pattern of
phosphorylation is similar in each case.
In etr by contrast, protein phosphorylation is not only much higher than in wild type
but the pattern is strikingly different (Fig. 2).
3.2. GTP BINDING
We have demonstrated that both in peas and in Arabidopsis [14,17] ethylene treatment
leads to increased GTP binding (using a)2p GTP affinity labelling) and that such
binding is associated with small monomeric G-proteins. In eti5 constitutive GTP
binding is higher than in wild type but in etr the constitutive level of GTP binding is
very low indeed (Fig. 3). In other work we have shown that the specific receptor-
directed inhibitor methylcyclopropene (MCP) antagonises the ethylene-induced
increases in GTP binding. Moreover, in peas we have found that the activation of GTP
binding by ethylene can be detected within 10 min [4].
kOa
43
30
20.1-
14.4-
123
Figure 3. GTP binding to Triton X-IOO solubilised l30kg membrane

fractions from wild type (I), eti5 (2) and etr (3) Arabidopsis leaves.
80
KDa
94
87
43
30 -
Figure 4. In-gel protein kinase assay using MBP as the substrate of

cytosolic fractions from ethylene-treated and untreated wild type
Arabidopsis leaves.
3.3. MAP KINASE ACTIVITY
As noted in section 2.1, ethylene significantly upregulates protein phosphorylation in

Arabidopsis and, as a result of this observation we have investigated the effect of
ethylene on protein kinase activity in wild type and measured constitutive activity in the
mutants. Figure 4 shows the result of an in-gel assay from ethylene-treated and
untreated leaves using myelin basic protein (MBP) as substrate. Clearly, most activity
is observable at ca. 47kDa and there is a substantial promotion by ethylene. A
comparison of constitutive protein kinase activities in wild type and the three mutants is
shown in Figure 5. In this case MBP phosphorylating activity was measured in samples
30
20.1
14.4
Figure 5. Constitutive in vitro MBP phosphorylation of ERKI

immunoprecipitated proteins from cytosolic extracts.
81
immunoprecipitated by antibodies raised to a conserved sequence from ERK 1

(extracellular signal related kinase, a MAP kinase). The activity in etr was lower than
in wild type, but higher in eti5 and ctr - in the latter case very much higher.
In further experiments cytosolic proteins from wild type leaves treated or not with
ethylene were probed with antibodies raised to either the phosphorylated (on tyrosine)
or non-phosphorylated forms of MAP kinase. The results are shown in Figure 6.
kDa 1 2 3 4 1 2 3 4
57
46.5-
37.5-
Figure 6. Western blot of cytosolic proteins from wild type Arabidopsis leaves. A
probed with antibodies to non-phosphorylated MAP kinase. B: probed with
antibodies to phosphorylated MAP kinase. Lanes I - non-phosphorylated MAP
kinase control protein, 2 - phosphorylated MAP kinase control protein, 3 - cytosolic
extract from untreated leaves and 4 - cytosolic extract from ethylene-treated leaves.
The specificity of the two kinds of antibody is clearly shown; both recognise
nonphosphorylated MAP kinase markers whereas the antibody to phosphorylated MAP
kinase recognises only phosphorylated MAP kinase. It is evident that the antibody to
phosphorylated MAP kinase recognises proteins at about 47 kDa and the signal is much
stronger in the ethylene treatment.
4. Discussion
The results described here tend to confirm previous suggestions that ethylene responses
in Arabidopsis may be mediated, at least in part, by small GTP-binding proteins and
protein phosphorylation cascades, within which latter MAP kinases playa role.
It is perhaps surprising that no ethylene sensitivity mutants have yet been
characterised having a lesion in small GTP-binding proteins. The reason for this may
lie either in functional redundancy or, since such G-proteins are key elements (in
animals at least [11]), lethality. However, the fact that in etr constitutive GTP binding
is very low provides compelling evidence that GTP binding is part of the ethylene
signal transduction chain since such a reduction would be expected in a system where
the receptor is disabled which is known to be the case for etr. Equally, the fact that
MCP antagonises the ethylene effect on GTP binding and that the latter is activated very
rapidly by the growth regulator provides strong support for a role for small monomeric
82
G-proteins. While we have not yet proved that the protein kinases involved are indeed
MAP kinases sensu strictu, several lines of evidence suggest that this is indeed so,
namely the facts that MBP is a superior substrate to histone and casein, that the activity
is precipitated by antibodies to a MAP kinase (ERK 1), and that western blots using
antibodies raised to phosphorylated MAP kinase demonstrate the upregulation, as do
phosphotyrosine antibodies. Both MAPKK kinases and MAPK kinases can
phosphorylate MBP but the latter are unlikely to be involved here because they
phosphorylate on serine and threonine and the former are much larger proteins than
those shown to be activated in this work.
The most unexpected result in the present work was the observation that in the clr
mutant both protein phosphorylation and protein kinase activity are higher than in the
wild type. It has hitherto been supposed that the lesion in the CTR protein led to
inactivation but our data suggest another possible explanation namely that the mutation
leads to constitutive activation leading to upregulation of MAP kinase as we have
shown. This would not be surprising since such a scenario is well established in
animals, indeed Raf proteins were first discovered through an acutely transforming
murine retroviral oncogene product (v-Rat) which was a constitutively activated form of
its normal cellular homologue cRafl. Clearly, if activation of CTR by ethylene is the
normal transduction response then increased activity in ctr might well lead to the
phenotype observed in the mutant. There are of course other explanations - for example
that inactivation of CTR indirectly affects other Raf genes and gene products (of which
there are at least two others in Arabidopsis).
Whatever the true explanation it is clear that the lesion in the ctr mutant does not
lead to a down regulation of protein phosphorylation and protein kinase activity as had
previously been suggested [7] but rather the reverse.
It seems likely that the reason for the various apparent contradictions may lie in the
probable complexity of the transduction chain. In all other eukaryotes so far studied
such chains show interactions, branches and feedback and there is no reason to suppose
that plants will be less complex. Indeed, we ourselves have shown here and elsewhere
[17] that treatment of cell-free preparations from Arabidopsis leaves with cytokinin very
rapidly antagonise the upregulation by ethylene of protein phosphorylation, small GTP-
binding proteins and protein kinase activity. Hence, if this scenario is indeed the case
for ethylene signal transduction it is likely that manipulation of a single component of
such chains will have far-reaching and complex consequences in vivo.
5. Acknowledgements
We acknowledge the support of the EU INCO-COPERNICUS programme.
6. References
I. Bleecker, AB., Estelle, M.A, Somerville, AS. and Kende, H. (1988) Insensitivity to ethylene
83
2. Bogre, L., Ligterink, W., Meskiene, I., Barker, P.J., Heberle-Bors, E., Haskisson, N.S. and Hirt, H.
(1997) Wounding induces the rapid and transient activation of a specific MAP kinase pathway,
Plant Cell 9,75-83.
3. Ellinger-Ziegelbauer, H., Brown, K., Kelly, K. and Seibenlist, U. (1997) Direct activation of the
stress-activated protein kinase (SAPK) and extracellular signal related protein kinase (ERK)
pathway by an inducible mitogen-activated protein kinase/ERK kinase kinase 3 (MEKK)
derivative, J. BioI. Chem. 272, 2668-2674.
4. Hall, M.A., Smith, A.R., Novikova, G. V. and Moshkov, I.E. (1998) Ethylene signal transduction in
relation to hormone sensitivity, Plant Biology. In press.
5. Harpham, N.V.J., Berry, AW., Knee, E.M., Roveda-Hoyos, G., Raskin, I., Sanders, 1.0. Smith,
AR., Wood, C.K. and Hall, M.A. (1991) The effect of ethylene on the growth and development of
wild type and mutant Arabidopsis thaliana (L.) Heynh, Ann. Bot. 68,55-61.
6. Jonak, V., Keigerl, S., Ligterink, W., Barker, P.J., Huskisson, N.S. and Hirt, H. (1996) Stress
signalling in plants: A mitogen-activated protein kinase pathway is activated by cold and drought,
Proc. Nat!. Acad. Sci. USA, 93, 11274-11279.
7. Kieber, J.J., Rothenberg, M., Roman, G., Fellman, K.A. and Ecker. J.R. (1993) CTRI, a negative
regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raj family of
8. Knctsch, M.L.W., Wang, M. and Snaar-Jagaiska, B.E. (1996) Abscisic acid induces mitogen-
activated protein kinase activity in barley aleurone protoplasts, Plant Cell 8, 1061-1067.
9. Li, H., Huang, Y. and Kieber, 1.1. (1998) Biochemical and molecular characterisation ofCTRI, a
protein kinase involved in ethylene signalling, 9th Int. Conf. on Arabidopsis Research, University
of Wisconsin - Madison, June 24-29, 1998, Abstract 409.
10. (http://genome-www.stanford.edu/Arabidopsis/madison981).
II. Ligterink" W., Kroj, T., Nieden, U., Hirt, H. and Scheel, D. (I997) Receptor-mediated activation
of a MAP kinase in pathogen defence of plants, Science 276, 2054-2057.
12. Lowy, D.R. and Willumsen, B.M. (1993) Function and regulation of Ras, Ann. Rev. Biochem. 62,
851-891.
13. Mizoguchi, T., Ishimura, K. and Shinozaki, K. (I997) Environmental response in plants: the role of
mitogen-activated protein kinases, Tibtech. 15, 15-19.
14. Novikova, G.V., Moshkov, I.E., Smith, AR. and Hall, M.A. (1993) Ethylene and phosphorylation
of pea epicotyl proteins, J.c. Pech, A Latche and C. Balague (eds.), Cellular and Molecular
Aspects oJthe Plant Hormone Ethylene, Kluwer Academic Publichers, Dordrecht, pp. 371-372.
15. Novikova, G.V., Moshkov, I.E., Smith, AR. and Hall, M.A. {I 997) The effect of ethylene on GTP-
binding in extracts from pea epicotyls, Planta 201, 1-8.
16. Popping, B., Gibbons, T. and Watson, M.D. (1996) The Pisum sativum MAP kinase homologue
(PsMAPK) rescues the Saccharomyces hogJ deletion mutant under conditions of high osmotic
stress, Plant Mol. BioI. 31, 355-363.
17. Raz, V. and Fluhr, R. (1993) Ethylene signal is transduced via protein phosphorylation events in
plants, Plant CellS, 523-530.
18. Smith, AR., Berry, AW., Harpham, N.V.J., Hemsley, R.J., Holland, M.G., Moshkov, I.E.,
Novikova, G.V. and Hall, M.A. (1997) Ethylene signal perception and transduciton, in AK.
Kanellis, C. Chang, H. Kende and D. Grierson (eds.), Biology and Biotechnology oj the Plant
19. Suzuki, K. and Shinshi, H. (1995) Transient activation and tyrosine phosphorylation of a protein
kinase in tobacco cells treated with a fungal elicitor, Plant Cell 7,639-647.
ETHYLENE AND METHYL JASMONATE INTERACTION AND BINDING
MODELS FOR ELICITED BIOSYNTHETIC STEPS OF PACLITAXEL IN
SUSPENSION CULTURES OF TAXUS CANADENSIS
M. PHISALAPHONG AND J.e. LINDEN

Department of Chemical and Bioresource Engineering, Colorado State
University, Fort Collins, CO 80523, USA
1. Abstract
Ethylene and methyl jasmonate (MJ) act as co-mediators of defined cellular responses
in many plant systems. We postulate that specific biosynthetic steps for taxane
production are regulated by allosteric regulation of ethylene binding, based on our
absorption and induction modeling of pacIitaxel formation in elicited suspension cell
cultures of Taxus canadensis. Binding sites for ethylene on cellular membranes from
many plant genera have been established for years, and recently the transmembrane
ethylene receptor protein, ETR 1, has been characterized as a two-component regulator.
In attempting to model this system, we view a two-step process: MJ absorption in the
membrane is directly related to MJ concentration, but its interaction with ETRI is
effective only at higher concentrations. Hence, at low MJ concentrations (0-20 11M),
the unmodulated ethylene binding blocks induction of enzymes that either synthesize 3-
phenylisoserine and/or add the sidechain to the baccatin III ring. Sigmoidal plots of
pacIitaxel and 7-xylosyl-IO-deacetyltaxol productivity versus MJ concentration
indicates allosteric modulation of ethylene binding by MJ. At medium to high MJ
concentrations (200-400 11M), the modulation site is saturated, and no greater
productivities are seen. These data logically fit an induction model described by
Mirjalili and Linden [22]. Dependence on ethylene concentration is observed
(27) 10>7>3 f..lLlL) in baccatin III accumulation, but 7-xylosyl-1O-deacetyltaxol and
taxol in the culture medium are maximized using continuous 7 f..lLlL headspace
(estimated 70 nM dissolved) ethylene, that is supplied independently to replicated shake
flasks using flow along with uniform 10 (v/v) % oxygen and 0.5 (v/v) % carbon dioxide
(balance nitrogen) from a gas mixing station.
2. Introduction
Higher plants are suppliers of indispensable raw materials and drugs in the food and
pharmaceutical industries. Among these is Taxol (generic name pacIitaxel), which
has been approved by the FDA for use in treatment of lung, ovarian and breast cancers;
clinical trials are underway for treatment of other cancers. While many academic and
85
86
industrial research groups around the world are pursuing plant cell culture route of
production, Phyton (Ithaca, NY) is leading the development of a plant cell culture
process for production of pac litaxel. With their German subsidiary, Phyton Gesellschaft
fur Biotechnik GmbH, a large scale (75 m3) process is being developed [6] under
license to Bristol-Meyer Squibb, which recently committed $25 million for commercial
production within the next five years. If successful, this process could be the
technological foundation for other plant cell culture processes.
Our past work has identified approaches that enhance paclitaxel productivity in cell
culture, which established complex interdependence of ethylene and methyl jasmonate
(MJ) in affecting paclitaxel biosynthesis [17]. Concentrations of pac litaxel increase in a
manner roughly proportional to MJ concentration (see below for discussion of allosteric
relationship). The level of enhancement is dependent on ethylene concentration;
optimally paclitaxel production after three weeks of growth was enhanced 30-fold over
unelicited conditions using headspace gas concentrations of 0.5% CO 2, 15% O2 and 7
ppm ethylene with 200 JlM MJ elicitation 8 days after culture transfer.
Through experiments described here, the understanding of the ethylene/MJ
interaction is refined. T canadensis cultures are exposed to various ethylene
concentrations from 0 to 20 ppm) in the heads pace continuously. MJ concentrations
from 0 to 400 JlM) are added in replicated fashion to each set of cultures, and after two
weeks the culture media are analyzed for taxane composition and concentration.
Reproducible results from independent experiments demonstrate baccatin III
concentrations are relatively unaffected compared to changes in paclitaxel levels, which
increase in a manner directly proportional to the ethylene concentration. Insight to
paclitaxel biosynthesis is solidified through model validation and possible
interpretations are made about ethylene binding to membrane receptors.
3. Co-mediation of Ethylene and Methyl Jasmonate
The role of ethylene is difficult to understand because effects vary with developmental
stage and because low concentrations can promote a process, whereas higher levels
have the opposite effect [9]. Continuous presence of 7 ppm headspace ethylene (an
estimated 70 nM dissolved concentration in the culture medium [17]) results in greater
levels of paclitaxel than at higher ethylene concentrations. Statistical modelling data of
Mirjalili and Linden [16] demonstrate the optimal concentration of ethylene for
paclitaxel production between 5 and 8 ppm headspace concentration. Using optimum
headspace concentrations for oxygen, carbon dioxide at 15 (v/v) percent and 0.5 (v/v)
percent, respectively, were also provided using a gas mixing apparatus described [16],
ethylene concentrations at or greater than 50 ppm were shown to have inhibitory effects
on paclitaxel production [17].
Similarly, MJ-induced rosmarinic acid biosynthesis in Lithospermum erythrorhizon
cell suspension cultures is optimal at 0.1 mM concentration of MJ; distinct inhibition
occurred at higher concentrations [6]. Plant pathogen-related (PR) defense genes are
synergistically induced by ethylene and methyl jasmonate. Recently ethylene was
found to be involved in wound-induced gene activation in tomato, in which it acts
together with MJ to regulate expression of the protease inhibitor pin2 gene [18]. A
87
correlation can be established between sensitivity to MJ and the accumulation of the

transcripts in systemic tissues upon wounding [18]. Polyphenylalanine lyase activity
and coumarin derivative synthesis are regulated by ethylene and methyljasmonate [14].
Xu et al. speculate the binding of ethylene to its receptors on the plasma membrane
sensitize hypothetical MJ receptors on the membrane [28].
Methyl jasmonate is one of several mediators derived from lipids in the cell
membrane that represent an important class of elicitors. Examples are described by
Farmer [7, 25], Porat and coworkers [19], Saniewski et al. [4,20,24] and others [12,
23]. We first showed that MJ could enhance paclitaxel production [17]. Other groups
continue to study MJ, [15,29]; the best reported case caused production of 112 mgIL of
paclitaxel. The control cultures, with no MJ, produced about 1 mglL [15].
25,----------------------------------,
-+-1().[Et1CET'rl-
BA::CAlNUI
20
M J added -ill- BA::CAlN II
15
~10
5
1 -f1r- 7-X'rlCS'Il..-1Q.
I:FPCET'r1... TAXa..
-+-TAXa..
o 5 10 15 20 25
Figure 1. Time course kinetics oftaxane formation by a suspension culture of Taxus cuspidata
Figure 1 represents typical time course kinetics of taxane formation by a suspension

culture of Trocus cuspidata in which MJ was added eight days after culture transfer.
Subsequent results presented in this paper are from cultures grown under conditions of
optimal headspace concentrations at 23C in darkness with rotary shaking at 125 rpm
and harvested after 21 days of growth (14 days after elicitation). Paclitaxel was
identified based on retention time identity with standards obtained from Hauser
Chemical Research, Inc. (Boulder, CO) and routinely analyzed as described elsewhere
[16].
4. Biosynthesis Inhibition by Methyl Jasmonate
As noted above, inhibition by MJ on paclitaxel production was observed especially at

MJ concentrations greater than 200 ~M. Inhibition effects of MJ could be expressed in
mathematical terms by the following equation.
88
Pobserved - Ppredicted
(
[MeJA] )Y
Ppredicted - [MeJA]max
where for Figures 2 and 3, P = paclitaxel concentration.

[MJ]max = 200 11M MJ, and
y = a power constant that averaged 2.6 0.3
from all ofthe measurements in this system.
The comparison of experimental data with the binding model and the combined
binding and inhibition model are shown in Figures 2 and 3; dashed lines represent the
binding model and the solid lines represent the binding model combined together with
inhibition effect. Data in Figures 2A, 2C and 2D fit the binding/inhibition model better
than the allosteric binding model over the range of MJ concentrations from 0-200 11M.
The results in Figure 2B demonstrate that no inhibition is observed at 200 11M MJ when
the ethylene concentration is 7.4 ppm.
These data are supported by an additional experiment when ethylene is held at 6
ppm and MJ concentrations are varied from 0-400 11M. Data in Figure 3 shows a close
fit with the simple binding model from 0-200 11M, as seen in Figure 2B. Inhibition is
then apparent at MJ concentrations greater than 200 11M. The seemingly anomalous,
but of repeated observation over many years with many Taxus cell lines, of optimal
paclitaxel productivity at 5-8 ppm ethylene is then perhaps explained by this co-
mediation analysis.
5. Allosteric Relationships
The allosteric relationship mentioned above is seen more clearly from the results of
another experiment. Twelve MJ concentrations (0-400 11M) were provided to all of the
cultures at one ethylene concentration (6 ppm), one oxygen concentration (15 (v/v)
percent) and one carbon dioxide concentration (0.5 (v/v) percent). Hill plots between
MJ and normalized concentrations of both paclitaxel demonstrate respective linear log-
log relationships for all data points but the lowest (0.5 11M) and the two greatest (300
and 400 11M) MJ concentrations where inhibition occurs (Fig. 4). The linear
relationships are defined by the Hill equation, which in general form is, inhibition by
MJ on paclitaxel production was observed especially at MJ concentrations greater than
200 11M. Inhibition effects of MJ could be expressed in mathematical terms by the
following equation.
89
_ _ 8 Ind Ing + Inh ib iUo n

C2H4 3.7 ppm
.... exp data (3.7 ppm)
- - Bin ding mode I
20 .................__..........._....._.....-.......__..-.-....-.-.-.. ~--------------I
-- -- - -- ~
:i15
a.
..
~10
!:. 5
-- - ---!
i
;
o 50 100 150 200 250
CZH4 =7.4 ppm
--
20
50 100
M J (u M )
--
1 50 200
-- 250
C2H4 = 10.6 ppm --Bindin g+lnhibiti on

... exp data (10.6 ppm)
---
- -B indlng mode I
20
.:. 15
...o 10
----
!:.
o ~~._~~--------~------~--------~------~
o 50 100 150 200 250
C2H4=27.6 ppn
---
~ ,.......................................................................................................................................................................................................................................... ,
~15 t-------------------~~~.,==--====~==--~-------l
.:.
--10 t-----------~~~---------------~~~~
1~ 5t--------A.,~----------------------------~
o~~ ..~--,---------_r-------r--------~--------~
o 150 200 250
MJ(uM)
Figure 2. Comparisons of experimental data with the binding and inhibition models at four ethylene
concentrations: 3.7 ppm (SA); 7.4 ppm (58); 10.6 ppm (5C); and 27.6 ppm (5D).
90
109(~)
l-Y
= n log[L] + log[K]
where for Figure 4, Y = [paclitaxel] / [paclitaxel]max

L = MJ concentration,
n = the number of ligands bound, and
K = the binding constant
The Hill plots (Fig. 4) illustrate induced paclitaxel production at one of the observed
conditions (6.0 ppm headspace concentration of ethylene for concentrations between 0
and 400 IlM MJ). All data sets from other experiments were similarly analyzed; the
number of bound MJ ligands calculated from the slope of the Hill plots in each
experiment was between 2 and 3. The number of bound ligands (n) and binding constant
(K) from all observed treatments are summarized in Table I. The value of n increases in
non-linear means with ethylene concentration (7.4 <10.4 < 3.7 <27.6); recall that at 7.4
ppm ethylene optimum production occurs. We view the bound ligand in this case could
represent MJ binding nonspecifically in plasma membrane, as discussed below.
Table 1. The number of bound ligands (n), binding constant (K) and inhibition factor (y) based on
analysis of paC\itaxel data from all observed treatments.
Experiment set I
Ethylene Bound ligand Binding const Inhibition
(ppm) (n) (K) factor (y)
3.7 2.45 2.09x 10-0 2.6
7.4 2.10 3.72x 10.5 2.6
10.6 2.45 5.37x 10-0 2.6
27.6 3.10 1.00x 10-0 2.6
Experiment set II
Ethylene Bound ligand Binding const Inhibition
(ppm) (n) (K) factor (y)
6.0 2.09 1.20x 10-0 2.6
Another possible significance of these constants may relate MJ to ethylene

interaction with receptors in ETRI. The effect of ethylene on the kinetic parameters of
the model is shown in Table I. At concentrations of ethylene lower or higher than the
optimal point (7.4 ppm in this study), a lower binding constant (K <10- 6) is observed
than at the optimal ethylene concentration (K> 10-6). The number of bound ligands (n)
was slightly higher and approached 3 at non-optimal ethylene concentrations. The
physical model of ETRI from the characterization work of Chang et al. [1], Chen and
Bleecker [2], Wilkinson et al. [26] and Woltering et al. [27] coincidentally places two
91
ethylene molecules per homodimer two-component receiver. The allosteric model was
developed assuming homodimeric receptors.
... 7-Xylosyl-l0-
Deacetyl Taxol
III Taxol
- -Binding Model
-Binding+lnhibit
o 100 200 300 400

MJ(uM)
Figure 3. Comparison of experimental data with binding and inhibition models at

optimum ethylene concentration and MJ concentrations greater than for Figure 2.
6. Discussion
Three possible rate limiting processes could be envisioned for the dual substrate
pathway for paclitaxel biosynthesis. Ethylene and MJ interaction could be affecting a
limitation due to enzyme activity, precursor availability or substrate delivery to specific
organelles [3]. Direct effects on anyone or more of these three possibilities seems
unlikely; indirect effects through signal transduction pathways is consistent with our
hypothesis based on binding modelling and allosteric effects. Our literature review has
uncovered nothing about MJ receptors or MJ binding constants. On the other hand,
binding sites for ethylene on cellular membranes from many plant genera have been
established for years with kinetic evidence for two polypeptides with different binding
affinities [11,13], and recently the transmembrane ethylene receptor protein, ETRI, has
been characterized [9]. In attempting to model this system, we view a two-step process:
MJ absorption in the membrane is directly related to MJ concentration, but its
interaction with the ethylene binding site, ETRI, is effective only at higher
concentrations. Hence, at low to high MJ concentrations, the ethylene effect is
dependent on the MJ concentration. Sigmoidal plots of pac1itaxel productivity versus
MJ concentration are found, as described above. This allosteric behavior indicates
modulation of ethylene binding by MJ. At medium to high MJ concentrations, the
modulation site is saturated, and no greater productivities are seen.
The initial steps of the signal pathway for ethylene are at least known to have
similarity to two-component regulators of eukaryotes [22]. Each component contains a
conserved domain and a variable domain. Most sensor proteins consist of a variable
amino-terminal domain (typically located in the periplasmic space flanked by two
transmembrane domains) and a conserved carboxyl-terminal histidine kinase domain
located in the cytoplasm. Signal perception on the N-terminal domain results in
autokinase activity by the transfer of the phosphate from the histidine to a certain
92
aspartate residue in the cognate cytoplasmic response regulator [9].
0,5 1,5 2 2,5

-0.54_-----------------__l
s:- -1,5
~ 4_------tL!'"-1l,=lL---cE~----__l
~
~ ~4----------~~------__l
.9
-2,5 -l---------~L-----------I
log(MJ)
Figure 4. Hill plot for calculating allosteric parameters relating

paclitaxel productivity to MJ concentration.
MJ may act as an "ethylene sensitivity factor" in modulation of ethylene binding to

ETR1, which initiates the intracellular signal cascade that results, ultimately, in the
accumulation of secondary compounds. The mode of action may involve non-specific
dissolution of MJ in the membranes, decrease in the order of regions of the
phospholipid bilayer, and direct alteration of ethylene binding to ETRI. This sort of
phenomena has been suggested as lipid activation of enzymes resulting from
interactions with annulus phospholipids that surround the membrane-embedded portion
of many proteins [5,8,10,21].
7. Conclusions
Ethylene and methyl jasmonate (MJ) act as co-mediators of cellular responses in many
plant systems. We postulate that specific biosynthetic steps for taxane production in
plant cell culture are regulated by allosteric regulation of ethylene binding, based on our
interaction and binding modeling of paclitaxel formation in elicited suspension cell
cultures of T canadensis. This allosteric behavior could, but not necessarily, indicate
modulation of ethylene binding by MJ.
8. Acknowledgements
The authors wish to thank the National Science Foundation Engineering Directorate
Project BES-9702582 for support and M.L. Shuler (Cornell University) and D.M.
Gibson (USDA/ARS at Ithaca, NY) for cell cultures and helpful discussions.
93
9. References
1. Chang, C., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (1993) Arabidopsis ethylene-response
gene ETRI: similarity of product to two-component regulators, Science 262, 539-544.
2. Chen, Q.G. and Bleecker, AB. (1995) Analysis of ethylene signal-transduction kinetics associated
with seedling-growth response and chitinase induction in wild-type and mutant Arabidopsis, Plant
Physiol. 108,597-607.
3. Ciddi, v., Srinivasan, V. and Shuler, M.L. (1995) Elicitation of Taxus sp. cell cultures for production
oftaxoi. Biotechnology Letters 17, 1343-1346.
4. Czapski, l, Horbowicz, M. and Saniewski, M. (1992) The effect of methyl jasmonate on free fatty
acids content in ripening tomato fruits, Bioi. Plant. 34, 71-76.
5. Dewitt, N.D., Hong, B., Sussman, M.R. and Harper, IF. (1996) Targeting of two Arabidopsis
H+-ATPase isoforms to the plasma membrane, Plant Physiol. 112,833-844.
6. DOrnenburg, H. and Knorr, D. (1995) Strategies for the improvement of secondary metabolite
production in plant cell cultures, Enzyme and Microbial Technol. 17,674-684.
7. Farmer, E.E. (1994) Fatty acid signalling in plants and their associated microorganisms, Plant Mol.
Bioi. 26, 1423-1437.
8. Fauth, M., Schweizer, P., Buchala, A, Markstaedter, c., Riederer, M., Kato, T. and Kauss, H. (1998)
Cutin monomers and surface wax constituents elicit H20 2 in conditioned cucumber hypocotyl
segments and enhance the activity of other H20 2 elititors, Plant Physiol. 117, 1373-1380.
9. Gamble, RL., Coonfield, M.L. and Schaller, G.E. (1998) Histidine kinase activity of the ETRI
ethylene receptor from Arabidopsis, Proc. Nat!. Acad Sci. U. S. A 95, 7825-7829.
10. Harper, IF., Binder, B.M. and Sussman, M.R. (1993) Calcium and lipid regulation of an Arabidopsis
protein kinase expressed in Escherichia coli, Biochemistry 32,3282-3290.
11. Harpham, N.VJ., Berry, AW., Holland, M.G., Moshkov, I.E., Smith, AR. and Hall, M.A. (1996)
Ethylene binding sites in higher plants, Plant Growth Regul. 18,71-77.
12. Holbrook, L., Tung, P., Ward, K., Reid, D.M., Abrams, S., Lamb, N., Quail, J.W. and Moloney,
M.M. (1997) Importance of the chiral centers of jasmonic acid in the responses of plants, Plant
Physiol. 114,419-428.
13. Holland, M.G., Berry, AW., Cowan, V.S.L., Harpham, N.V.J., Hemsley, RJ., Moshkov, I.E.,
Novikova, G.V., Smith, AR. and Hall, M.A. (1996) Ethylene perception and hormonal signal
transmission in higher plants, Fiziologiya Rastenii (Moscow) 43, 22-30.
14. Kauss, H., Krause, K. and Ieblick, W. (1992) Methyl jasmonate conditions parsley suspension cells
for increased elicitation of phenylpropanoid defense responses, Bioch. Biophys. Res. Com. 189,
304-308.
15. Ketchum, RE.B., Gibson, D.M., Croteau, R. and Shuler, M.L. (1998) The kinetics of taxoid
accumulation in cell suspension cultures of Taxus following elicitation with methyl jasmonate,
Biotech. Bioengin. [in press].
16. Mirjalili, N. and Linden, lC. (1995) Gas phase composition effects on suspension cultures of Taxus
cuspidata, Biotech. Bioengin. 48, 123-132.
17. Mirjalili, N. and Linden, lC. (1996) Methyl jasmonate induced production of taxol in suspension
cultures of Taxus cuspidata: Ethylene interaction and induction models, Biotechn. Progress 12,
110-118.
18. O'Donnell, PJ., Calvert, C., Atzom, R, Wastemack, C., Leyser, H.M.O. and Bowles, DJ. (1996)
Ethylene as a signal mediating the wound response of tomato plants, Science 274,1614-1917.
19. Porat, R, Halevy, AH., Spiegelstein H, Borochov, A Botha, L. and Whitehead, C.S. (1996) Short-
chain saturated fatty acids in the regulation of pollination-induced ethylene sensitivity of
Phalaenopsisjlowers, Physiol. Plant. 97,469-474.
20. Saniewski, M. and Wegrzynowicz L.E. (1994) - Is ethylene responsible for gum formation induced
by methyl jasmonate in tulip stem? J. Fruit Ornam. Plant Res. 2, 79-90.
21. Schaller, G.E., Harmon, AC. and Sussman, M.R (1992) Characterization of a calcium and
lipid-dependent protein kinase associated with the plasma membrane of oat, Biochemistry 31,
1721-1727.
22. Schaller, G.E. (1997) Ethylene and cytokinin signalling in plants: the role of two-component systems,
Essays Biochem. 32, 10 1-111.
94
23. Titarenko, E., Rojo, E., Leon, 1. and Sanchez-Serrano, 1.1. (1997) Jasmonic acid -dependent and
-independent signaling pathways control wound-induced gene activation in Arabidopsis thaliana,
Plant Physiol. 115,817-826.
24. Urbanek, H., Bergier, K., Saniewski, M. and Patykowski, 1. (1996) Effect of jasmonates and
exogenous polysaccharides on production of alkannin pigments in suspension cultures of Alkanna
tinctoria, Plant Cell Reports 15. 637-641.
25. Weber, H., Vick, B.A, and Farmer, E.E. (1997) Dinor-oxo-phytodienoic acid: a new hexadecanoid
signal in thejasmonate family. Proc. Natl. Acad. Sci. U.S.A 94.10473-10478.
26. Wilkinson, 1.Q., Lanahan, M.B., Yen, H.C., Giovannoni, J.J. and Klee, H.J. (1995) An
ethylene-inducible component of signal transduction encoded by never-ripe, Science 270. 1807-1809
27. Woltering, E.J., van der Bent, A, de Vrije, GJ. and van Amerongen, A (1997) Ethylene: Interorgan
siganling and modeling of binding site structure, in AK. Kanellis, C. Chang, H. Kende, and D.
Grierson, (eds.) Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic
Publishers, Dordrecht, pp. 163-173.
28. Xu, Y., Chang, P.L., Liu, D., Narasimhan, M.L., Raghothama, K.G., Hasegawa, P.M. and Bressan,
R.A (1994) Plant defense genes are synergistically induced by ethylene and methyl jasmonate, Plant
Cell 6. 1077-1085.
29. Yukimune, Y, Tabata, H., Higashi, Y. and Hara, Y. (1996) Methyl jasmonate-induccd
overproduction of paclitaxel and baccatin 111 in Taxus cell suspension cultures, Nat. Biotechn. 14,
1129-1132.
BARREN MUTANTS IN MAIZE-A CASE STUDY IN PLANT SIGNALING
P. A. PETERSON
Departments of Agronomy/Zoology-Genetics Iowa State University,
Ames, IA 5001I,USA
1. Abstract
Barren in this context indicates the complete lack of female organs, not just flowers, but
the absolute lack of even female (ear) initials in the maize plant. There are at least 5
non-allelic genes in maize that when mutated cause barrenness. This has been verified
by extensive allelic tests. The phenotype of each of these genes is generally similar in
the female part of the plant. There is a phenotypic change in the tassel, that is quite
obvious in the plants in the field, though admittedly, this has not been exhaustively
verified by sufficient out crossing. Most any maize geneticist or breeder that is familiar
with plants in the maize genetic or breeding nursery has observed the relationship of the
maturing male and female components in the plants. In almost every case (there are
occasional exceptions) the male flowering and pollen-shed occurs before the female
begins silking. The gap between the two events varies, from I day to almost the end of
the pollen-shedding period. It has been anecdotally assumed that hormones in the tassel
control the initiation of female activity. The tassel appears to repress the female
receptivity (silking) until the pollen shedding begins. This is only anecdotal and the
necessary experiments have not been made to clearly show this relationship. There are
mutants that vary this process but these have not been coupled with physiological
investigations. Though the ba4 mutant arose in a transposon plot, the necessary
molecular confirmation of this mutant has not confirmed a transposon insert. The
behavior of this mutant illustrates some interesting features. The mutant expression is
characterized by plants that are typically barren. The barren plants are unilaterally
susceptible to anthracnose. In a segregating row, only the barren plants show
anthracnose disease symptoms. The factor that is deficient and causes barrenness is
suggestive that the mutant effect makes the plant susceptible to anthracnose infection.
This mutant is predominantly recessive but not entirely. In crosses of these barren
(obviously, as male) on to assorted wild type plants (+/+ x ba4/ba4), there is a low
frequency of escapes, that is, plants are +/ba4 and barren. But not entirely, because
late, after the tassel has been fully spent, even dried, and probably 30 days, a small
deformed ear appears on the very last leaf, very low in the plant. Hypothesis on ba4:
That a hormone is suppressing ear formation and thus barrenness. When the plant is
nearing senescence, the hormone is depleted and the ear initial finally becomes evident.
95
96
2. Introduction
The inflorescence of the monoecious maize plant is unique among the Gramineae in the
sharp separation of the male and female structures. The male tassel at the terminus of
the plant most often sheds pollen before the visual appearance of the receptive silks of
the female ear at a lateral bud, normally at the 10 th leaf [I].
Earlier studies examined the ontogeny of the growing tissues beginning with the
embryo in the kernel through to the obvious protuberances of the growing point as the
kernel germinates. The differentiated developing soon-to-become tassel and the lateral
bulges that develop into the ears on the lateral buds become apparent very early in the
germinating kernel [2, 3, 46]. A certain number of cells are destined for tassel and ear
development [8]. As the plant develops, there is a phase transition [\3, 16] from the
vegetative lateral buds to the reproductive lateral buds. This change in phase has been
ascribed to genotypic control as evidenced in the differences among different genotypes
in the initiation of the reproductive [I].
The genetic control of tassel and ear initiation has been gleaned from anatomical
observations. Lejeune and Bernier [I2] found that maize plants terminate the initiation
of additional axillary meristems at the time of tassel initiation. This would indicate that
the top-most ear shoot is initiated on the same day as the initiation of tassel
development and this event signals the end of the undifferentiated growing point.
Because of this simultaneous development of tassel and ear-shoot, these authors
hypothesize that this mutual control suggests some kind of hormonal control.
Physiological studies have concentrated on the levels of Indole Acetic Acid (IAA)
levels as the governing feature controlling the growth and development of the ear.
Professor Irvin Anderson of Iowa State University (personal communication) indicates
that the tassel growing point produces significant amounts of IAA only after the V6 to
V9 stage of plant growth. However, because tassel sizes in current hybrids are quite
small, it is unlikely that the IAA level is a determining factor in the growth of the ear.
Thus, there must be a complex of signals that determine the timing and growth of the
tassel and ear.
The use of barren mutants might be a means of dissecting the signalling system in
sex-organ development in maize. Mature barren stalk plants, unlike normal plants that
have visible buds and a deep indentation above each bud that makes an indentation in
the internode, lack any ear tissue and any indentation in the stalk.
The discovery of ba3 [15] added to the col\ection of the three previously describe ba
mutants {ba J and ba20 [\1] and baf[8]}. The allelic tests of these mutants indicating
independent genes and their distinguishing tassel morphology are described in the Pan
and Peterson [\5] paper.
In this report, a new barren mutant (ba4) is described. This mutant arose in a
transposon containing plant (94 3805-2). A description of its characteristics and the
non-allelism to the previously described ba mutants is provided.
97
3. Results
3.1. INHERITANCE
The ba4 mutant was crossed to a wild type line and the FI was selfed. An example of a
segregation is illustrated in Table 1. The segregation is of a typical recessive. An
example of a barren plant is shown in Figure I.
Table 1. Segregation of ba plants from the self of an F I
derived from cross of wild type +/+ x balba.
+ ba T
1. 94g 128- 6 x 21 7 28
2. 92 yg 128-21 x 25 7 32
Total 46 14 60
Figure 1. Barren plant illustrating the lack of an

ear shoot.
3.2. EXCEPTIONAL SEGREGATION
Because barren plants lack ear shoots, there is an obligation to cross ba (balba) plants as
males. This is important in the observation of the ba plants in the segregating row of
plants derived from the cross +1+ x balba. Note that all progeny are +Iba but
surprisingly, ba plants appear in a low frequency. An example of such a segregating
progeny is illustrated in Table 2. These occurrences of these ba plants are termed ba-
escapes. (Note, the nature of the cross obviates any contamination origin for these
escapes.)
Table 2. Segretation of ba escapes from the cross of +/+ x balba (ba

male parent in this cross is a segregant from segregating plants in
progeny 2 in Table 1).
+ b Total
95 g 084/116-6 +/+ x balba 19 6 25
37 ~ 42
56 11 67
98
Because the escapes were exceptional, similar crosses were made on commercial
corn lines and assorted genetic lines with the other ba mutants and the progeny were
planted in nursery rows. These are illustrated in Table 3.
Table 3. Segregation of ba in crosses of commercial and genetic lines x ba plants.
Crosses + ba T
* 96 g A01l3 +/+ x bal/bal 5 100 0 100
** 96 g 11213 +/+ x ba2lbal 3 50 0 50
'" 96 g AOll12 +/+ x baJ/baJ 3 55 0 55
*'" 96 g 104/18 +/+ x baJ/baJ 4 107 0 107
* 96g A01125 +/+ x ba4/ba4 3 55 2 57
** 96 044212415-3 +/+ x ba4/ba4 2 41 2 43
*** 96 assorted genetic +/+ x ba41ba4 15 235 3 238
* 96 A01l9 +/+ x baflbaf 7 93 0 93
* AOI were commercial hybrids

** Genetic lines
*** Various genetic lines
Figure 2. Appearance of a very late ear of a

ba plant arising from the cross of +1+ x ba/ba.
Again, ba plants appear in a low frequency among a wide variety of outcrosses. It

appears that ba4 is unique in this exceptional appearance of mutant ba plants among the
segregating progeny of crosses of wild type lines by ba males. Neither ba2, ba3, nor
bafba4lba4) plants, leaf die-back was noticed. However, in this segregating row, only
99
the barren plants expressed this severe leaf-die-back. These infected leaves (Fig. 3)
were tested in the ISU plant pathology laboratory and, were identified as infected with
anthracnose. Such a segregating row is illustrated in Table 4 and Figure 4.
Table 4. Susceptibility of ba plants to

anthracnose. Segregating plants arising from
self (I) of +/ba (94 g/28-b) and from a
backcross of+/ba x ba/ba.
Progeny + ba T
1 10 5 15
2 13 5 18
Infected leaves are illustrated in Figures 3 and 4.
Figure 3. A close up of an infected leafofa ba4 plant. Figure 4. A segregating row of plants from the self of
+/ba4 illustrating that the infected plants are confined
to the ba phenotypes.
3.3. TILLERS ESCAPE THE ba EFFECT
Tillers of a maize plant are part of the same node structure of a plant, but tillers
originate from lateral buds below ground. Tillers of barren plants have tillers with
terminal ears. This indicates that the tillers are under a different set of signals and
escape the effects of the ba mutant effects.
100
4. Discussion
That there are four non-allelic loci that as mutant result in barren plant expression
indicates several pathways or genes controlling part of a general pathway that could
cause barrenness. Further, there is phenotypic evidence that some of the barren mutants
also affect tassel development. In the extreme bal is largely devoid of any anthesis.
Further, ba2 is accompanied by a bush-like, broom-type tassel.
ba4 is unique in several ways. First, there is the occurrence ofba-escapes. Some of
these ba-escapes, not all, include an abortive ear appearing in a very low leaf node,
often, among the brace roots (Fig. 2). This would possibly indicate that a repressing
signal (the ear development) is operative and that late in plant maturity the signal is
depleted allowing an ear shoot to materialize. Or possibly, there is a constitutive
expression of a gene that suppresses ear development but is suppressed by the ba
mutation similar to the ts2 gene effect in maize [9]. The absence of the ba suppressive
effect on the constitutively expressed gene would allow the expression of the female
suppressing gene which in time is depleted.
The feature of anthracnose susceptibility would indicate a lack of defense against
infection. The fIrst line of defense could be an ethylene response which may be related
to an ethylene receptor. Whether the possibility of the ethylene form of catalyzing
defense is missing in ba4 is worth entertaining.
The lack of ear initials would support the possibility that the ba effect occurs early
during the differentiation of the growing point. Whether the cell signaling occurring in
the growing point as indicated in Arabidopsis [7, 10, 14] is operative in these barren
mutants remains for further investigation.
5. References
1. Baba, T. and Yamazaki, K. (1996) Effects of phase transition on the development of lateral buds in
maize, Crop Sci. 36, 1574-1579.
2. Bonnett, O.T. (1940) Development of the staminate and pistillate inflorescences of sweet corn, 1.
Agric. Res. 60,25-37.
3. Bonnett, O.T. (1948) Ear and tassel development in maize, Annual Missouri Botany Garden 35, 269-
288.
4. Bonnett, O.T. (1953) Developmental morphology of the vegetative and floral shoots of maize,
University ofIllinois Agriculture Experiment Station Bulletin 568.
5. Bonnett, O.T. (1966) Inflorescences of maize, wheat, rye, barley, and oats: Their initiation and
development, University of Illinois Agriculture Experiment Station Bulletin 72 J.
6. Cheng, P.C., Greyson, R.I. and Walden, D.B. (1983) Organ initiation and the development of
unisexual flowers in the tassel and ear of Zea mays maize, structure, Am. 1. Bot. 70, 450-462.
7. Clark, S.E., Running, M.P. and Meyerowitz, E.M. (1995) CLAVATA3 is a specific regulator of shoot
and floral meristem development affecting the same processes as CLAVATAJ, Development 121,
2057-2067.
8. Coe, E.H., Jr. and Neuffer, M.G. (1977) Cells in the embryo and their destinies in tassel, ear and
vegetable parts (maize), Maize Genetics Cooperation Newsletter 51,62-63.
9. DeLong, A, Calderon-Urrea, A and Dellaporta, S.L (1993) Sex determination gene Tasselseed2 of
maize encodes a short-chain alcohol dehydrogenase required for stage-specific floral organ abortion,
Cell 74, 757-768.
10. Elliott, R.C., Betzner, AS., Huttner, E., Oakes, M.P., Tucket, W.Q.J., et al. (1996)
AINTEGUMENTA, an APETALA2-like gene of Arabidopsis with pleiotropic roles in ovule
development and floral organ growth, Plant Cell 8, 155-168.
101
II. Hofmeyr, 1.0.1. (1930) The inheritance and linkage relationships of barrenstalk-I and barrenstalk-2,
two mature plant characters of maize, Unpublished Ph.D. thesis, Department of Plant Breeding,
College of Agriculture, Cornell University, Ithaca, NY.
12. Lejeune, P. and Bernier, O. (1996) Effect of environment on the early steps of ear initiation in maize
(Zea mays L.), Plant, Cell Environ. 19,217-224.
13. McDaniel, C.N. and Poethig, R.S. (1989) From here to there in maize: A fate map of the shoot apical
meristem of the germinating com embryo, in R. Goldberg (ed.), Molecular Basis 0/ Plant
Development, Liss, New York, pp. 25-35.
14. Meyerowitz, E.M. (1998) Molecular and genetic mechanisms of shoot meristem activity: Plant
architectural engineering, 18th International Congress o/Genetics (Abstracts), 84.
IS. Pan, Y.B. and Peterson, PA (1992) ba3: A new barrenstalk mutant in Zea mays L, J. Genetics and
Breeding 46, 291-294.
16. Poethig, R.S. (1988) Heterochronic mutations affecting shoot development in maize, Genetics 119,
959-973.
ETHYLENE SIGNAL TRANSDUCTION PATHWAY IN CELL DEATH
DURING AERENCHYMA FORMATION IN MAIZE ROOT CELLS: ROLE OF
PHOSPHOLIPASES
C.J. HEl, P.W. MOROAW, B.O. COBB\ W.R. JORDAN 2 AND M.e.
DREWl
lDepartment of Horticultural Sciences and 2Department of Soil and Crop
Sciences, Texas A&M University, College Station TX 77843, USA
1. Introduction
Ethylene biosynthesis is accelerated in roots of maize when they become hypoxic

(partially O 2 deficient) following soil flooding. The increased concentration of ethylene
to which cells close to the root tip are exposed subsequently induces premature death
and degeneration of cells in the root cortex, leaving air-filled cavities (aerenchyma). The
interconnected cavities improve oxygenation of the root cells, and contribute to plant
tolerance of flooding.
The selective death, specifically of cells of the mid-cortex that is triggered by
ethylene suggests a mechanism of programmed cell death. Previous research, using
antagonists and agonists of particular steps in signal transduction [1], indicated that 0-
proteins, phospholipases, phosphoinositides, increased cytosolic Ca2.,. and protein
phosphorylation are likely components of an ethylene signal transduction pathway in
maize roots.
The aim of the present work was to directly determine changes in the activity of
phospholipase C (PLC) and phospholipase D (PLD) in relation to the initiation of cell
death in response to ethylene. The rationale was that a possible role for PLC or PLD in
signaling cell death would be indicated by an early change in activity of these enzymes
in response to ethylene, or hypoxia. Additionally, if IP 3 were acting as a signal
molecule in this system, we might expect to detect a change in its concentration as a
result of PLC.
2. Results
The plasma membrane fraction was prepared by the phase partitioning procedure of
Widell et al. [2]. The activity of marker enzymes for possible contaminants was
cytochrome C oxidase (for mitochondrial membranes) and glucose-6-phosphate
dehydrogenase (for cytosol). We found that the plasma membrane fraction had little or
no contamination, relative to the activities of these enzymes in the unfractionated
homogenates prepared by grinding whole tissues.
103
104
At 3 d of hypoxia, when roots were exposed to 2% O2 in the aerating gas stream, the
activity of PLC in the plasma membrane fraction increased strongly in the root tip,
whereas plasma membrane PLO activity in the same tissues changed little. For the total
cell homogenates, hypoxia caused a more general increase in PLC and PLO activity
along the whole root.
As a function of time, either exogenous ethylene (l/lL.L- 1 air) or hypoxia caused an
appreciable increase in the activity of PLC in the apical 10 mm zone. Activity doubled
within the first 30 min with ethylene, and continued to increase up to 24 h. The
response to hypoxia was slower, because of the additional time taken to accelerate the
production of ethylene. No comparable changes occurred in the PLC activity for the
whole cell homogenate, or for PLO in either the plasma membrane fraction or the total
cell homogenate. PLO activity actually decreased in response to hypoxia, in the whole
cell homogenate.
At longer times, PLO activity in total cell homogenates increased steeply after 48 h,
coinciding with the earliest stage in cell death and degradation detectable in the
microscope.
Antagonists of signal transduction were used previously to inhibit cell death in
response to hypoxia, down stream of the ethylene receptor [1]. Neomycin or EGTA,
either of which block cell death in hypoxic roots, inhibited any rise in activity ofPLC or
PLO in the plasma membrane fraction. For the whole cell homogenates, activities of
these two enzymes increased only at longer times in hypoxic roots, and were strongly
inhibited by the antagonists.
The products ofPLC activity are IP 3 and OAG. We assayed for IP3 concentration in
whole cell homogenates. IP3 concentration increased markedly with ethylene treatment,
and to a lesser extent with hypoxia.
3. Conclusious
PLC activity in the plasma membrane fraction is an early marker for ethylene-dependent
cell death in the root cortex. Increases in PLC activity take place in the apical zone, at
least several hours to a day before any signs of cell death and degradation are detectable
under the microscope.
The role of PLO appears to be predominantly in cell degradation, rather than in the
early stages of signaling cell death.
We conclude that greater PLC activity, and a concomitant rise in IP3 concentration,
could be messengers for the onset of cell death, induced by activation of the ethylene
signal transduction pathway in maize roots.
4. References
1. He, C.l., Morgan, P.W. and Drew, M.C. (1996) Transduction of an ethylene signal is required for
cell death and lysis in the root cortex of maize during aerenchyma formation induced by hypoxia,
2. Widell, S., Lundborg, T. and Larsson, C. (1982) Plasma membranes from oats prepared by
partition in an aqueous polymer two-phase system, Plant Physiol. 70, 1429-1435.
ETHYLENE-DEPENDENT AND ETHYLENE-INDEPENDENT PATHWAYS IN
A CLIMACTERIC FRUIT, THE MELON
J.e. PECH', M. ours', R. BOTONDI', R. AYUB2, M. BOUZAYEN',

J.M. LELIEVRE', F. EL YAHYAOUr 1 AND A. LATCHE'
JENSAT, VA INRA, Av. de l'Agrobiopole, BPI07, Auzeville, 31326
Castanet-Tolosan, Cedex, France, 2Vniv. Estad Ponta Grossa, Dept de
Fitotecnia, Pr Santos Andrade, SIN, 84010330 Ponta Grossa-PR, Brazil
1. Abstract
Transgenic antisense ACC oxidase melons in which ethylene has been inhibited by more
than 99% have been used for discriminating between ethylene-dependent and -
independent pathways. In this paper, we have compared wild type and transgenic
melons in terms of cell wall-degrading enzymes, ACC synthase activity and gene
expression and resistance to chilling injury. The activity of some cell wall-degrading
enzymes (pectin methyl esterase and exo-polygalacturonase) were identical in wild type
and transgenic fruit. These are not regulated by ethylene. On the contrary, the activity
of galactanase, a-arabinosidase, [3-galactosidase, and endo-polygalacturonase was
higher in wild type fruit, indicating a regulatory role for ethylene for at least a portion of
activity that could correspond to specific isoforms. The increase in ACC synthase
activity at the early stages of ripening occured exactly at the same time in wild type and
ethylene-inhibited fruits, indicating that the initiation of ripening associated ethylene
biosynthesis could occur as a developmentaly and ethylene-independent phenomenon.
An ACS gene (CMe-ACSl) showed strong stimulation during ripening of wild type
melons. It was also expressed in transgenic fruits but at a low level that could not
directly account for the high ACS activity encountered in these fruits. Ethylene
treatment of transgenic fruits stimulated the accumulation of CMe-ACSI transcripts but
caused a decrease of ACS activity. These data suggest a complex regulation process of
ACS by ethylene at both the transcriptional and post-transcriptional level.
2. Introduction
It is classically thought that ethylene is necessary for triggering the biochemical changes
that occur during the ripening of climacteric fruits. However, in recent years, with the
availability of ethylene-inhibited transgenic mutants and the characterization of
naturally-occuring ethylene-insensitive mutants, the concept has emerged that some of
the ripening pathways of climacteric fruits could be ethylene-independent, in other
words, of the non-climacteric type [5]. Some pathways and molecular events that are
105
106
ethylene-independent have been reported in transgenic antisense ACC synthase (ACS )

[10] and ACC oxidase (ACO) [6] tomatoes. In order to further investigate the role of
ethylene in individual aspects of fruit ripening we have decided to use the Cantaloupe
Charentais melon as a model. Compared to the tomato, this melon has some specific
ripening traits such as the accumulation of large amounts of sugars, production of
abundant aroma volatiles and a very rapid ripening rate associated with a sharp
climacteric peak. We have generated an antisense ACO line of this melon that exhibits
almost 100% inhibition of ethylene production [I]. This line therefore represents a very
good model for discriminating between ethylene-dependent and -independent pathways.
In the work reported here, we have focused our efforts on cell wall degrading enzymes
and ACC synthase.
3. Results
3.1. ROLE OF ETHYLENE ON THE ACTIVITY OF CELL WALL-DEGRADING

ENZYMES
The wild type Charentais Cantaloupe melon undergoes a complete collapse of flesh
texture within 3 to 4 days of the onset of ripening. The suppression of ethylene
production in antisense ACO fruit resulted in an almost total inhibition of softening on
the vine [3]. Exogenous ethylene above 2.5 ppm could fully reverse softening at a rate
that was identical to the normal softening rate of wild type fruits. By comparing the
activity of a number of cell wall-degrading enzymes in wild type and transgenic fruit,
two types of behavior have been observed:
(i) enzymes showing the same pattern of evolution in both type of fruits (pectin
methyl esterase and exo-polygalacturonase, Figs I A and I B). Their activity can be
considered as ethylene-independent;
(ii) enzymes showing higher activity in wild type than in transgenic fruit either at
the early (endo-polygalacturonase and galactanase, Fig. I C and D) or late stages of
ripening (a-arabinosidasse and 13-galactosidase, Fig. I E and F). The portion of activity
which is increased in wild type fruit can be considered as ethylene-dependent. It is
conceivable that the two different portions of activity correspond to different isoforms.
At least two isoforms of 13-galactosidases have been separated in muskmelons [7].
Isoform I was constituvely present in fruit at all stages of development, while isoform II
appeared when fruit ripening was initiated. In addition, it has been shown that 13-
galactosidases are encoded by gene familes in the apple [8] and in the tomato [2].
Recently Sozzi et at. [9] have found that the activity of one of the 13-galactosidase
isoforms of tomato (I)-gal II) was ethylene-dependent. Its activity decreased in
transgenic antisense ACC synthase tomatoes, while they increased sharply during the
ripening in wild type tomatoes. T he existence of several isoforms of a-arabinosidases
has not yet been documented, to our knowledge.
107
I-
~ 750 ti 3.0 , . . . - - - - - - - - - - - - .
LU
A ~
~~ 600 ~~
~.= 2.3
~E
~~ 450 en::::
u:!: ~ g 1.5
il
~I::
300 ~i
tiiE
~ KI 0.8
~ 150 z-
1=0
fd[
~ O'-----'---'-_...I-_..L...---lL......l
28 32 36 40 44 48
a.. 0.0 L-L_.L........L.---L_.L........L.---L-I
32 36 40 44 48 52 56
DAYS AFTER POLLINATION
8----------
DAYS AFTER POLLINATION
80,...---------~
32 36 40 44 48 52 56 32 36 40 44 48 52 56
DAYS AFTER POLLINATION DAYS AFTER POLLINATION
100~--------------~
~
:> 80 E
~~
LU- 60
~.~
~i
I~
40
20
32 36 40 44 48 52 56 32 36 40 44 48 52 56
DAYS AFTER POLLINATION DAYS AFTER POlliNATION
Figure 1 . Activity of cell wall-degrading enzymes in wild type melon (e)and, antisense ACO melon (0)
A: exo-polygalacturonase, B: endo-polygalacturooase, C: pectin methylesterase, D: galactaJlase,
E: a-arabinosidase, F: fJ-galactosidase.
108
3.2. RELATIONSHIP BETWEEN ETHYLENE AND ACC SYNTHASE
We have previously demonstrated [4] that the levels of ACC and ACC synthase activity
started to increase at the same time in antisense ACO and in wild type melons, indicating
that the induction of ACC synthesis was an ethylene-independent event. In addition, the
level of ACC and ACC synthase activity reached a peak around the maximum
climacteric and decreased rapidly thereafter in wild type fruits. In transgenic fruits,
ACC and ACS activity increased for several days to reach levels that were respectively
about 10 and 3 times higher than in the wild type, and then slowly declined. Ethylene
treatment of transgenic fruit resulted in a decrease in ACS activity. These results
suggest that ACS activity is negatively regulated by ethylene and that ethylene
suppression in transgenic fruits allowed the development of ACS activity to proceed at a
high rate. In order to investigate the regulation of ACS gene expression, we have
studied the expression of 2 ACS genes isolated in melons by Yamamoto et al. [11]
using RT-PCR with gene-specific primers.
Wild Type Antisense
DAP 49DAP
+C2H4
34 37 41 43 46 Od 1d 4d
CM-ACSl
CM-56.10
Internal C2H4 0.02 - 0.06 - 1.6 - 58 - 37 0.01 - 0.02 - 0.02

(ppm)
ACS activity 0.02 - 0.09 -2.38 -15.2 - 1.1 14.1 - 11.9 - 1.7
(nmol. h-I.g- I FW)
Figure 2. Pattern of accumulation ofCMe-ACSl mRNA, internal ethylene and ACC synthase activity in wild
type and antisense ACO melon fruits harvested at different stages of development (DAP, Days After
Pollination). The accumulation of CMe-ACSl mRNA was estimated by RT-PCR using the constitutively
expressed CMe-56.1O gene of unknown function as an internal control. Antisense fruits were treated on the
vine with a continous flow of 50 ppm ethylene for 1 or 4 days.
109
CMe-ACS2 mRNA could not be detected in the flesh of both antisense and wild type
fruits. It has been reported to be expressed in the placenta only [11]. On the contrary,
CMe-ACSI exhibited strong stimulation of expression during ripening of wild type fruit
(Fig. 2). It was also expressed in transgenic melons, but at such a low level that it could
not account for the very high ACS activity found in these fruits. In addition, CMe-ACSI
expression was strongly stimulated by ethylene treatment of antisense ACO fruits while
ACS activity was depressed (Fig. 2). Attempts to isolate other ACS cDNA sequences in
transgenic fruit by RT-PCR using consensus degenerate primers have failed. We
hypothesize that ethylene has opposite effects on the transcriptional (stimulation) and
post-transcriptional (inhibition) regulation of CMe-ACSI gene expression.
4. Conclusions
A summary of ethylene-dependent and independent events that have been described

here, in Guis et al. [3-4] or still unpublished is presented in Table 1. Obviously,
ethylene is not required for the development of all biochemical events occuring during
melon fruit ripening. By extension, it can be concluded that the ripening of climacteric
fruits comprises a portion of non-climacteric behavior. The observation that an upsurge
in ACS activity occured in the absence of ethylene indicates that developmental factors
are responsible for the development of the competence of the fruit to synthesize
ethylene. Understanding this important step will involve the elucidation of the
transcriptional and postranscriptional regulation of ACS gene expression. Overall these
data show that antisense ACO melons represent a valuable tool for understanding the
role of ethylene in the various ripening pathways and the development of competence of
the fruit to ripen.
TABLE 1: Ethylene-dependent and independent pathways in the melon. The sign* indicates that only part of
the activity (probably corresponding to some isoforrns) is ethylene-dependent.
Ethylene-dependent Ethylene-independent
General metabolism
Yellowing of the rind Coloration of the flesh
Softening Accumulation of sugars and organic acids
Aroma volatiles Loss of acidity (late ripening)
Climacteric respiration Accumulation of ACC
Detachment of peduncle
Chilling injury
Activities of enzymes
Galactanase* Pectin methyl esterase
a-arabinosidase* Exo-polygalacturonase
~-galactosidase *
Endo-polygalacturonase*
ACC synthase (negative feedback) ACC synthase (induction at onset of ripening)
ACC N-malonyltransferase*
110
5. Acknowledgements
We would like to acknowledge the support of the EU (FAIR CT-96-1138) and a

bilateral French-Italian Galileo programme (N97011) between the University of
Viterbo (IT) and ENSAT, Toulouse (FR).
6. References
I. Ayub, R., Guis, M., Ben Arnor, M., Gillot, L., Roustan, J.P., Latche, A, Bouzayen, M. and Pech,
lC. (1996) Expression of ACC oxidase antisense gene inhibits ripening of cantaloupe melon fruits,
Nature Biotech. 14,826-866.
2. Carey, AT., Holt, K., Picard, S., Wilde R., Tucker, G.A., Bird, e.R.. Schuch, W. and Seymour, G.B.
(1995) Tomato exo-( 1-4)- 13-D-galactanase. Isolation, changes during ripening in normal and mutant
tomato fruit and characterization of related cDNA clone, Plant Physiol. 108, 1099-1107
3. Guis, M., Botondi, R., Ben Arnor, M., Ayub, R., Bouzayen, M., Pech, J.e. and Latche, A (1997)
Ripening-associated biochemical traits of cantaloup charentais melons expressing an antisense ACC
oxidase transgene, J. Amer. Soc. Hort. Sci. 122,748-751.
4. Guis, M., Bouquin, T., Zegzouti, H., Ayub, R., Ben Arnor, M., Lasserre, E., Botondi, R., Raynal, J.,
Latche, A, Bouzayen, M., Balague, C. and Pech lC. (1997) Differential expression of ACC oxidase
genes in melon and physiological characterization of fruit expressing an antisene ACC oxidase gene,
in AK. Kanellis et al. (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer
5. Lelievre, J.M., Latche, A., Jones, 8., Bouzayen, M. and Pech, J.e. (1997) Ethylene and fuit ripening,
Physiol. Plant. 101,727-739.
6. Picton, S., Barton, S.L., Bouzayen, M., Hamilton ,AJ., Grierson, D. (1993) Altered fruit ripening
and leaf senescence in tomatoes expressing an antisense ethylene-forming enzyme transgcne, Plant
J. 3, 469-481.
7. Ranwala, AP., Suematsu, C. and Masuda, H. (1992) The role of 13-galactosidases in the
modification of cell wall components during muskmelon fruit ripening, Plant Physiol. 100, 1318-
1325.
8. Ross, O.S., Wegrzyn, T., MacRae, E.A. and Redgwell, R.l (1994) Apple 13-galactosidase. Activity
against cell wall polysaccharides and characterization of related cDNA clones, Plant Physiol. 106,
521-528.
9. Sozzi, G.O., Camperi, S.A, Cascone, O. and Fraschina, A.A. (1988) Galactosidases in tomato fruit
ontogeny: decreased galactosidase activities in antisense ACC synthase fruit during ripening and
reversal with exogenous ethylene, Aust. J. Plant Physiol. 25. 237-244.
10. Theologis, A, Oeller, P.W., Wong, L.M., Rottmann, W.H. and Gantz .D. (1993) Use of a tomato
mutant constructed with reverse genetics to study ripening, a complex developmental process, Dev.
Genet. 14, 282-295.
II. Yamamoto, M., Miki, T., Ishiki, Y., Fujinami, K., Yanagisawa, Y., Nakagawa, H., Ogura, N.,
Hirabayashi, T. and Sato, T. (1995) The synthesis of ethylene in melon fruit during the early stage of
ripening, Plant Cell Physiol. 36, 591-596.
ISOLATION AND CHARACTERIZATION OF NOVEL TOMATO ETHYLENE-
RESPONSIVE cDNA CLONES INVOLVED IN SIGNAL TRANSDUCTION,
TRANSCRIPTION AND mRNA TRANSLATION
H. ZEGZOUTl, B. JONES, P. FRASSE, B. TOURNIER, J. LECLERCQ,

A. BERNADAC AND M. BOUZAYEN
ENSAT-INRA Toulouse, Avenue de ['Agrobiopole, BP ] 07, 3]326
Castanet-Tolosan Cedex, France
1. Abstract
In order to gain more information on the molecular basis by which ethylene regulates the
ripening process, we used the differential display approach to isolate early ethylene-
responsive (ER) genes from late immature-green tomato fruit. Among the isolated ER
clones many correspond to regulatory genes involved either in signal transduction or in
transcriptional and post-transcriptional regulation. ER43 and ER50 share significant
homology with a GTP-binding protein and a Raf kinase from the CTR] type,
respectively. ER24 is homologous to the multibridging factor MBFI, a component of
the TAF complex (TATA box binding protein associated factor). Finally, ER49, a
putative mitochondrial translational elongation factor is potentially involved in the
ethylene postranscriptional regulation of gene expression.
2. Introduction
The phytohormone ethylene orchestrates a variety of physiological processes in plants

including senescence, fruit ripening, abscission [I]. This hormone also plays an
important role in physiological responses to environmental stresses such as water deficit
[2], mechnical wounding [3], and pthogen attack [4 The tremendous progress made in
the recent years in elucidating the mechanisms involved in the perception and
transduction of the ethylene signal [5, 6] are still not sufficient to explain the diversity of
plant responses to the hormone. The identification of early ethylene-regulated genes is
another strategy towards understanding the molecular basis of ethylene action and its
role in physiological processes. Within the last decade, a number of ethylene-regulated
genes have been isolated and characterized through differential screening techniques [7].
However, the limited number of clones isolated so far cannot account for the tremendous
biochemical and physiological modifications that occur in response to ethylene during
fruit ripening or flower senescence. In an attempt to identify novel genes involved in the
111
112
ethylene response, we screened for early ethylene-regulated genes in late immature

green tomato fruit using the mRNA differential display approach [8, 9].
A Ethylene
o 15' 5H
Up
regulated
Down
regulated
B Ethylene
+1MCP
o 1~ 5h 1~ 5h
ER30
Figure I. A. Sections of denaturing polyacrylamide gels exhibiting the 3 types of ethylene-

regulated mRNAs detected by differential display. Untreated fruit (0), ethylene-treated fruit
15 min (15 ') or 5 hours (5h). B. Northern blot analysis of the effectiveness of the ethylene
treatment using ER30 (tomato E4 homologue) as a probe.
3. Results
3.1. IDENTIFICATION OF ETHYLENE-REGULATED cDNAS BY

DIFFERENTIAL DISPLAY
Differential display was used to compare mRNAs isolated from late immature green
tomato fruit, unable to produce ripening-related ethylene either untreated or treated with
ethylene (50 IlI.r!). A typical differential display showed three classes of differentially
regulated clones: (i) ethylene up-regulated; (ii) ethylene down-regulated; and finally (iii)
transiently induced (Fig. lA).
Among the ethylene-regulated cDNA fragments isolated in this study, many
corresponded to clones already characterized as ethylene responsive. In order to
validate our experimental model, we used ER30 as a control gene. This clone
corresponds to the tomato E4 gene that has been shown to be up-regulated by ethylene
in tomato fruit [10]. Northern analysis (Fig. lB) showed that ER30 is strongly induced
113
upon 5 hours ethylene treatment. In addition, this induction is totally suppressed by the
use of I-methy1cyclopropene (I-MCP), a potent inhibitor of ethylene action [11]. These
results clearly demonstrate the effectiveness of the ethylene treatment and the
appropriateness of the plant material chosen for this study.
The differential display based screening performed in this study led to the isolation
of nineteen cDNA clones (Table 1), corresponding to novel s;thylene-responsive genes
(ER clones) that show differential regulation during the ripening process. Among the
isolated ER clones, several display homology to regulatory genes that may participate in
the ethylene response at the levels of signal transduction, transcription and translation.
TABLE 1. Tomato ethylene-regulated cDNA clones.
Clone Sequence homology
ER5 lea-like gene (L. esculentum)

ER6 Sequence F21M12.12 (A. thaliana)
ER21 Hsc70 gene (L. esculentum)
ER24 Transcriptional coactivator MBFl (B. mari)
ER28 Enolase (L. esculentum)
ER33 Putative protein (A. thaliana)
ER43 Small GTP-binding prot. (Pisum sativum)
ER49 Elongation factor Ts (s. platensis)
ER50 CTRI-like protein kinase (A. thaliana)
ER60 Catalase (N. plumbaginifalia)
ER66 FIN21.9 similar to extensin (A. thaliana)
ER68 RNA helicase DBP2 (s. cerevisiae)
ER69 Methionine synthase (c. rase us)
ER15,ER27 Unknown
ER31,ER34 Unknown
ER35,ER55 Unknown
3.2. ER24, A GENE ENCODING A PUTATIVE TRANSCRIPTION FACTOR
ER24, an early and transiently induced clone in ethylene-treated late immature-green

fruit (Fig. 2), is highly homologous to a transcriptional coactivator known as
multiprotein bridging factor 1 (MBFl) isolated from the silkworm Bombyx mori [12].
MBFl is a transcriptional cofactor that binds to the TATA box-binding protein (TBP)
and an enhancer-associated activator to form an active transcription complex. Based on
its sequence homology and its tight regulation by ethylene and during ripening of tomato
fruit (Fig. 2), ER24 may conceivably be one of the bridging proteins that link Ethylene
Responsive Element Binding Proteins (EREBPs) to the TATA box-binding protein
allowing transcription of ethylene-regulated genes to proceed.
3.3. ER49 ENCODED PROTEIN IS POTENTIALY INVOLVED IN POST-

TRANSCRIPTIONAL REGULATION OF GENE EXPRESSION
ER49, which bears a putative mitochondrial localisation sequence at its N-terminal,

encodes a mitochondrial protein that shows homology to both the prokaryotic translation
114
elongation factor EF-Ts [13] and the bovine mitochondrial EF-Tsml [14]. The ethylene
responsiveness of ER49 (Fig. 3) suggests that the hormone controls gene expression at
the post-transcriptional level. According to the bacterial model, the EF -Ts is required to
Ethylene Ripening
o 15' 5h MG Br Tu R
Ubi 3
ER24
Figure 2. RT-PCR analysis of ER24 mRNA expression in response to ethylene and during
ripening. Tomato ubiquitin mRNA (Ubi 3) was used as an internal control during the PCR
amplification.
recycle EF-Tu, another elongation factor, which in turn promotes the binding of
aminoacyl-tRNA to ribosomes allowing translation to proceed. It is well known that in
climacteric fruits such as the tomato there is a sharp increase in respiration at the onset
of ripening [1]. While the mitochondria is the major organelle involved in this increase
in respiration, the regulation of genes encoding mitochondrial proteins is still poorly
understood. Here, we show that ER49 mRNA accumulate in response to ethylene and
during ripening (Fig. 3) which raise the possibility that it plays a role in the increase of
mitochondrial metabolic activity during tomato fruit ripening.
Ethylene Ripening
o 15' 5h MG Br Tu R
Ubi 3
ER49
Figure 3. RT-PCR analysis ofER49 mRNA expression in response to ethylene and during
ripening. Tomato ubiquitin mRNA [Ubi 3) was used as an internal control during the PCR
amplification
lIS
3.4. ER GENES ENCODING COMPONENTS OF SIGNAL TRANSDUCTION

PATHWAYS
In tomato fruit, ethylene has been shown to regulate its own transduction pathway
through the induction of the Nr gene which encodes an ethylene receptor [IS]. We have
isolated ER50, which is identical to a serine/threonine kinase clone from tomato [16]
and shows strong homology to the Arabidopsis CTRI gene, the negative regulator of the
ethylene signal transduction pathway in Arabidopsis thaliana [17]. However, unlike
CTRl, the expression of ER50 gene was found to be strongly up regulated by ethylene
and during fruit ripening (Fig. 4).
Ethylene Ripening
o 15' 5h MG Br Tu R
Ubi 3
ER50
Figure 4. RT-PCR analysis ofER50 mRNA expression in response to ethylene and during
ripening. Tomato ubiquitin mRNA [Ubi 3) was used as an internal control during the PCR
amplification
Like CTR1, the ERSO predicted protein shows typical characteristics of the RAF
protein kinase family known to be involved in the transduction of regulatory signals
through MAP kinase cascades [18]. To investigate the putative role of ERSO in the
ethylene signal transduction pathway, transgenic tomato plants under and overexpressing
the gene have been generated and are currently being analysed.
The ER43 predicted protein is highly homologous to the rab/ypt-related small GTP-
binding protein family which has been shown to play a role in vesicular transport
between different compartments of eukaryotic cells [19]. ER43 is another ethylene
regulated gene (Fig. S) potentially involved in signal transduction. In animal systems,
the activation of MAP kinase cascades following the perception of external regulatory
signals occurs through the small GTP-binding protein RAS [20]. The putative
interaction between ERSO and ER43 , a RAF-like kinase and a RAS-like protein
respectively, will be investigated using the yeast two hybrid approach.
4. Conclusions
Our work allowed the isolation of a large number of cDNA fragments corresponding to
novel ethylene-regulated (ER) clones. The expression studies of the ER genes indicated
116
that ethylene-responsive genes can be up-regulated, down-regulated and transiently

induced. Also, the alteration of gene expression by ethylene can be rapid (minutes) or
delayed (hours). Sequence analysis revealed significant homologies with known genes
for a number of the clones, while for others, no homologous sequences were found in the
databases.
Ethylene Ripening
o 15' 5h MG Br Tu R
Ubi 3
ER43
Figure 5. RT-PCR analysis of ER43 mRNA expression in response to ethylene and during
ripening. Tomato ubiquitin mRNA (Ubi 3) was used as an internal control during the PCR
amplification
To gain more information about the putative function of the ER genes, spatio-
temporal expression of these genes is currently being completed. Finally, the
involvement of the encoded proteins in the ripening process as well as in other
developmental and physiological processes is being studied through the generation of
mutant transgenic lines showing altered expression of the ER genes.
5. References
1. Abeles, F.B., Morgan, P.W. and Salveit, M.E. (1992) Ethylene in Plant Biology, San Diego:
Academic Press, 2nd ed.
2. Apelbaum, A and Yang S.F. (1981) Biosynthesis of stress ethylene induced by water deficit,
3. Boller, T. and Kende, H. (1980). Regulation of wound ethylene synthesis in plants, Nature 286,
259-260.
4. Boller, T. (1991) Ethylene in pathogenesis and disease resistance, in AK. Mattoo and J.C. Suttle
(eds.), The Plant Hormone Ethylene, CRC Press, Boca Raton, pp. 293-314.
5. Bleecker, AB. and Schaller, G.E. (1996) The mechanism of ethylene perception,
Plant.Physiol.lll,653-660.
7. Deikman, J. (1997) Molecular mechanisms of ethylene regulation of gene transcription, Physiol.
Plant. 100, 561-566.
8. Liang, P. and Pardee, AB. (1992) Differential display of eukaryotic messenger RNA by means of
the polymerase chain reaction, Science 257, 967-971.
9. Zegzouti, H., MartY, C., Jones, B., Bouquin, T., Latche, A, Pech, J-c. and Bouzayen, M. (1997)
Improved screening of cDNAs generated by mRNA differential display enables the selection of
true positives and the isolation of weakly expressed messages, Plant Mol. BioI. Rep. 15,236-245.
117
10. Lincoln, lE., Cordes, S., Read, E. and Fischer, R1. (1987) Regulation of gene expression by
ethylene during Lycopersicon esculentum [tomato) fruit development, Proc. Natl. Acad. Sci. USA
84,2793-2797.
11. Sisler, E.C., Serek, M. and Dupille, E. (1995) Comparison of cyclopropene, 1-
methylcyclopropene, and 3,3-dimethylcyclopropene as ethylene antagonists in plants, Plant
Growth Reg. 17, 1-6
12. Takemaru, K.i., Li, F.Q., Ueda, H. and Hirose, S. (1997) Multiprotein bridging factor 1 [MBFl) is
an evolutionarily conserved transcriptional coactivator that connects a regulatory factor and TATA
element-binding protein, Proc. Natl. Acad. Sci. USA 94, 7251-7256.
13. Blank, l, Nock, S., Kreutzer, R and Sprinzl, M. (1996) Elongation factor Ts from Thermus
thermophilus overproduction in E. coli, quaternary structure and interaction with EF Tu, Eur. J
Biochem. 236,222-227.
14. Xin, H., Woriax, V., Burkhart, W. and Spremulli, 1.1. (1995) Cloning and expression of
mitochondrial translational elongation factor Ts from bovine and human liver, J Bioi. Chem. 270,
17243-17249.
15. Wilkinson, lQ., Lanahan, M.B., Yen, H-C., Giovannoni, J.J. and Klee, H.1. (1995) An ethylene
inducible component of signal transduction encoded by Never-ripe, Science 270, 1807-1809.
16. Wang, Y. and Li, N. (1997) A cDNA sequence isolated from the ripening tomato fruit encodes a
putative protein kinase, Plant Physiol. 114, 1135.
17. Kieber, J.1., Rothenberg, M., Roman, G., Feldman, K.A. and Ecker, lR. (1993) CTRI, a negative
protein kinases, Cell 72, 427-441
18. Avruch, l, Zhang, X.F. and Kyriakis, lM. (1994) Rafmeets Ras: completing the framework of a
signal transduction pathway, Trends Biochem. Sci. 19,279-283.
19. Zerial, M. and Stenmark, H. (1993) Rab GTPases in vesicular transport, Curro Opin. Cell.Biol. 5,
613-620.
20. Heidecker, G., Kolch, W., Morrison, O.K. and Rapp, U.R (1992) The role of Raf-l
phosphorylation in signal transduction, Adv. Cancer Res. 58, 53-73.
ANALYSIS OF GENE EXPRESSION AND MUTANTS INFLUENCING
ETHYLENE RESPONSES AND FRUIT DEVELOPMENT IN TOMATO
J. GIOVANNONI, E. FOX, P. KANNAN, S. LEE, V. PADMANABHAN

AND J. VREBALOV
Department of Horticultural Sciences Crop Biotechnology Center, Texas
A&M University, College Station, TX 77843-2133
1. Abstract
Efforts in numerous laboratories including our own have focused upon the isolation of
specific genes which regulate the ripening process and related fruit quality characters.
Together these efforts have resulted in the isolation of genes involved in numerous
aspects of the ripening phenotype including cell wall metabolism, ethylene biosynthesis
and perception, pigment biosynthesis, and susceptibility to post-harvest pathogens.
Specific efforts in our laboratory are focused in two general areas. The first is toward
isolation and characterization of genes which represent upstream global developmental
regulators of ripening such as the ripening-inhibitor (rin) and non-ripening (nor) genes.
We are currently characterizing genes which we believe represent both target loci. Our
second focus is on analysis of ethylene signal transduction components and analysis of
corresponding gene expression and function during the ripening process. We have
isolated a putative tomato homologue of the Arabidopsis CTRI gene and have shown
that it is ethylene regulated during tomato fruit development. This represents a second
component of ripening-related ethylene signal transduction, in addition to the Never-ripe
ethylene receptor, whose mRNA accumulation is itself under ethylene control. In
addition, we have shown through genetic mapping that a putative tomato constitutive
ethylene response mutant (pi; Epinastic) does not represent a mutation in the tomato
CTR 1 gene TCTRI. EpilEpi; NrlNr double-mutant analysis suggests that the Epi
mutation represents a step in ethylene responses limited to ethylene-mediated cell size
effects.
2. Introduction
The ripening of climacteric fruits such as tomato is influenced by hormonal,

developmental and environmental stimuli. Our group is especially interested in the
mechanisms and regulation of ethylene signal transduction and the identification of
developmental switches which regulate the ripening process via initiation of the ethylene
cascade. We have isolated a CTRI-like gene from tomato (TCTRJ) and have shown its
119
120
expression to be regulated during fruit maturation by both ethylene and developmental

stage. Function of the TCTRI gene is being addressed via targeted repression and over-
expression of the endogenous gene in transgenic plants. We are also characterizing the
putative constitutive ethylene response mutant of tomato, Epi (Epinastic), and through
double mutant analysis with the ethylene receptor mutant Nr have evidence that Epi
regulates a subset of ethylene responses related to regulation of cell expansion. As such,
the Epi mutant results in constitutive leaf epinasty, triple-response, and reduced leaf cell
size, but does not directly influence fruit ripening, leaf senescence, or pedicel abscission.
Efforts toward elucidation of developmental regulators of climacteric ripening continue
to focus on map-based cloning of the rin and nor loci. Toward this end we have
recently constructed a lOX tomato BAC library and have isolated BAC clones
containing both target genes. Candidate cDNAs corresponding to both genes have been
isolated and are currently being characterized.
2.1. TOMATO AS A MODEL SYSTEM FOR FRUIT RIPENING
Tomato has long served as a model system for plant genetics, development, pathology,
and physiology, resulting in the accumulation of substantial information regarding the
biology of this economically important organism. In recent years the most widely
studied aspects of tomato biology include the development and ripening of their fleshy
fruits. Although Arabidopsis has surpassed most plant systems as a model for basic
plant biology research, the area of fruit ripening continues to thrive using tomato as the
system of choice. This is due simply to the fact that the developmental program which
results in the dramatic expansion and ripening of carpels in tomato (and in many other
economically and nutritionally important species) does not occur in Arabidopsis.
Nevertheless, examination of tomato gene sequences homologous to those previously
described in Arabidopsis, and especially those related to ethylene signal transduction,
has resulted in significant advancement of our collective understanding of the molecular
mechanisms underlying fruit ripening control. Specific efforts in our research group are
focused toward analysis of tomato fruit ripening and ethylene signal transduction via the
use of cloned gene sequences and mutants. Our overall objective is genetic
characterization of hormonal and developmental regulatory systems which regulate
ethylene responses and the ripening process in tomato.
Considerable attention has been directed toward understanding the molecular basis
of fruit development, and in particular ripening, during recent years with the majority of
effort directed toward the tomato system [1]. The role of ethylene in regulating
climacteric ripening has been demonstrated at molecular level [2], and the in vivo
functions of fruit development and ripening-related genes including HMG-CoA
reductase, polygalacturonase (PG), pectin methyl-esterase, ACC synthase, ACC oxidase,
phytoene synthase, and the NR ethylene receptor have been tested via antisense gene
repression and/or mutant complementation in tomato. For example, the cell wall
pectinase, PG, was shown to be necessary for ripening-related pectin depolymerization
and pathogen susceptibility, yet to have little effect on fruit softening [3, 4, 5].
Inhibition of phytoene synthase resulted in reduced carotenoid biosynthesis and
reduction in fruit and flower pigmentation [6]. Reduced ethylene evolution resulting in
121
ripening inhibition occurred with ACC synthase and ACC oxidase antisense [7, 8] while
introduction of a dominant mutant allele of the NR ethylene receptor resulted in tomato
plants inhibited in virtually every measurable ethylene responses including fruit ripening
[9, 10].
Further analysis of transgenic and mutant tomato lines inhibited in ethylene
biosynthesis or perception demonstrates that climacteric ripening represents a
combination of ethylene regulation and developmental control. Indeed the gene
encoding the rate limiting activity in ethylene biosynthesis, ACC synthase, is itself
initially induced during ripening by a developmental signaling system that remains to be
defmed [11]. In addition, tomato geneticists have identified several mutants including
ripening-inhibitor (rin) and non-ripening (nor) which are apparently blocked at steps
prior to ethylene biosynthesis suggesting that these mutants represent required
components of the developmental regulatory system which precedes ethylene
biosynthesis [12]. In summary, years of research on tomato fruit development has
resulted in a large collection of allelic variants influencing the continuum of fruit
development including ripening [13]. Together the available and rapidly expanding
collection of natural, induced, and transgenic mutants represent an unparalleled resource
for continued analysis of fruit development and ethylene response. Critical steps
toward exploitation of these genetic resources for expanded understanding of ripening
regulation will include 1) extensive physiological and genetic characterization of
phenotypic effects resulting from alteration of specific ripening-related genes, 2)
identification of specific genes corresponding to known mutational effects, and 3)
examination of tomato genes homologous to those isolated from, and characterized in,
other plant systems and hypothesized to influence the fruit ripening process such as
Arabidopsis ethylene signal-transduction genes.
2.2. GENETIC CHARACTERIZATION OF ETHYLENE SIGNAL

TRANSDUCTION IN TOMATO
Analysis of tomato ethylene response has centered on analysis of mutant and transgenic
plants altered in ethylene biosynthesis or perception. Antisense repression of the E8
oxidase resulted in delayed fruit ripening and elevated ethylene biosynthesis, together
suggestive of a defect in ethylene perception and/or signaling [14]. While the in vivo
function of the E8 protein is unclear, a role in maintaining receptor oxidation and
activity has been suggested and is consistent with the antisense E8 phenotype [15]. The
fact that E8 is fruit and anther-specific would suggest that alternate genes or pathways
play similar roles in other tissues. Additional E8 family members have been suggested
based on RFLP mapping [16], however none have been cloned or characterized to date.
In Arabidopsis only one E8 homologue has been identified and this gene shows
expression in numerous tissues as contrasted to the fruit and anther-specific expression
of the characterized tomato E8 gene [17].
The NEVER-RIPE gene is the best characterized ethylene signaling component of
tomato to date. The Nr mutation blocks a continuum of ethylene responses including
inhibition of the seedling triple response and incomplete fruit ripening [18]. The Nr
gene was cloned, sequenced and shown to have high homology to the ETRI and ERS
122
genes of Arabidopsis with greater structural similarity to the later [9]. All three genes
have significant homology to members of the "two component" class of protein kinases
[19]. The reduction of ethylene binding capacity in Etrl mutants [20] and yeast
expressing a mutant ETRI cDNA [21], in combination with the fact that the ETRI gene
product is apparently involved in protein phosphorylation, suggests that ETRI (and
presumably Nr and ERS) is likely to encode an ethylene receptor which conveys signal
transduction via modification of protein phosphorylation. Recent introduction of the
dominant mutant Arabidopsis ETRI-I allele of ETRI into petunia and tomato both
demonstrates a conserved signaling system in these species and the potential for
practical exploitation of ethylene receptor sequences in a range of crop species [22].
The tomato Epinastic (Epz) mutant likely represents and additional component of
ethylene signal transduction [23]. The Epi mutation was originally characterized as a
semi-dominant, single locus mutation resulting in leaf epinasty, vertical growth, minimal
branching, and highly branched root structure. These effects are consistent with
ethylene over-production or constitutive ethylene signaling [24]. Although elevated
ethylene biosynthesis has been reported in some tissues of the Epi mutant, treatment
with inhibitors of ethylene biosynthesis or action had little effect on mutant phenotype,
suggesting that Epi represents a lesion in ethylene signaling [23]. As described below,
double mutant analysis suggests that the Epi locus influences a subset of ethylene
responses particularly those related to regulation of cell expansion. The Arabidopsis
ctr1 mutant is also characterized by constitutive ethylene signal transduction, and the
corresponding CTRI gene has been isolated and shown to have homology to the Raj
family of protein kinases [25]. We have isolated a tomato fruit ripening-induced gene
with similarity to Arabidopsis CTRI which we have designated TCTRI. Genetic
mapping studies indicate that TCTRI is non-allelic with Epi. Current efforts include
characterization of TCTRI function in transgenic tomato plants.
3. Results
3.1. CHARACTERIZATION OF EPI,NR andEPI;NR DOUBLE MUTANTS
In order to better understand the relationship of the Epi mutant to ethylene signaling
systems in tomato single and double mutants (with Nr) were analyzed for ethylene
response phenotypes. Tomato plants homozygous for the mutant Epi allele are
characterized by vertical growth, minimal lateral branching, and leaf epinasty [26]. In
addition, Epi seedlings demonstrate a constitutive triple-response phenotype as was
previously shown by Fujino [23]. While Epi tissues are known to overproduce ethylene,
treatment of seedlings with inhibitors of ethylene action or biosynthesis did not result in
reversion of the mutant phenotype [23], suggesting that Epi may represent a constitutive
ethylene signaling mutant. The Arabidopsis ctr 1 mutant is a constitutive ethylene
response mutant and the corresponding CTRI gene has Raj kinase homology [25]. Two
tomato CTRI-like genes have been isolated (TCTRI, P. Kannan and J. Giovannoni,
unpublished; TCTR2, R. Hackett and D. Grierson, unpublished) and were both shown
via RFLP mapping to be non-allelic with the Epi locus (data not shown).
123
Table I summarizes the ethylene-associated phenotypes of normal, Epi/Epi, NrlNr,

and EpilEpi; NrlNr lines. In summary, the Epi;Epi line showed a constitutive seedling
triple-response, leaf epinasty, reduced leaf cell size, delayed inflourescence
development, and inhibition of lateral shoot development. No notable effects were
observed on fruit ripening, pedicel abscission or petal senescence. The Nr;Nr mutant
showed inhibition of virtually all ethylene-associated responses observed including a
lack of the seedling triple-response, larger leaf cell size, inhibition of petal senescence,
fruit ripening and pedicel abscission as has been reported previously [16, 18]. Analysis
of Epi/Epi; NrINr double mutants revealed that seedlings and leaves show a constitutive
ethylene response while fruit displayed incomplete ripening characteristic of the Nr
mutation (E. Fox and J. Giovannoni, unpublished). In addition, double mutant fruit
showed reduced cell size and inhibited lateral shoot development similar to Epi/Epi and
inhibited pedicel abscission, and petal senescence similar to NriNr. These results
suggest that Epi represents a component of ethylene signal transduction that does not
operate in all stages of development, and in particular, has no role during fruit ripening.
In short, virtually all Epi effects are observed in the double mutant lines suggesting that
Epi is in fact epistatic to Nr. However, Epi influences only a subset of ethylene effects
in tomato so that non-effected aspects of tomato development (such as fruit ripening)
yield the Nr characteristic in double mutant lines. Our best interpretation of these results
is that Epi influences a subset of ethylene responses in tomato associated primarily will
cell expansion responses (Fig. 1).
TABLE 1. Ethylene responses of normal and mutant lines
Genotype TR E R PA PS CS
Normal +/- +/- +/+ +/+ +/+ intermediate

Epi/Epi +/+ +/+ +/+ +/+ +/+ small
NrlNr -/- -/- -/- -/- -/- large
EpilEpi; +/+ +/+ -/- -/- -/- small
NrlNr
xly - 10 ppm ethylene or 20 uM ACC / air

TR = triple-response; E = leaf epinasty; R = ripening
PA = pedicel abscission; PS = petal senescence; CS = cell size
3.2. MOLECULAR AND FUNCTIONAL CHARACTERIZATION OF A TOMATO

CTR1-LIKE GENE: TCTRl
Southern blot hybridization of the Arabidopsis CTRl full-length cDNA to tomato

genomic DNA (at high stringency) indicates the presence of 2 - 3 related sequences in
the tomato genome (data not shown). One strongly hybridizing band appeared
predominantly with each of the restriction enzymes tested, suggestive of one highly
homologous locus. A breaker stage tomato fruit cDNA library was screened using the
CTRl cDNA as probe, and resulted in the isolation of a partial cDNA which hybridizes
124
to the Arabidopsis CTRl cDNA at high stringency. 5' and 3' RACE-PCR were
employed to isolate near full-length overlapping sequences which have been fused to
form a single contiguous cDNA. The tomato cDNA has 70% DNA sequence identity,
and 62% amino acid identity, with CTRI. We have tentatively named this cDNA
TCTRI (P. Kannan and J. Giovannoni, unpublished).
Inhibited triple-response
Nr Increased leaf cell size
Ihibited epinasty
Inhibited fruit ripening
Delayed petal senescence
Delayed pedicel abscission Nrl
Epi
Constitutive triple-response in seedlings
Red uced leaf cell size
Leaf epinasty
Figure 1. Summary of Epilpi, Nr/Nr and pilpi;NrINr double mutant phenotypes. The Nr/Nr line
displayed inhibition of virtually every ethylene-related phenotype scored while the pilpi line showed
constitutive ethylene-related phenotypes for a subset of responses. Double mutants displayed all of the
phenotypes observed in the Epilpi parents and Nr/Nr phenotypes for all parameters not significantly
influenced by the pi mutation.
Preliminary gene expression analysis indicates that the TCTR 1 transcript is

approximately 3 kb in length, which is similar to that reported for CTRI [25]. Of
particular interest was the observation that TCTRl is induced during ripening, and by
exogenous ethylene in mature green fruit (data not shown). TCTRI is additionally
ethylene inducible in the rin and nor mutants, and expressed at lower levels in both
ripening and ethylene treated Nr fruit. This pattern of expression in fruit is similar to
that observed for the Nr ethylene receptor [9].
Genetic mapping studies of TCTRI and TCTR2 indicated that neither gene is allelic
with Epi. To asses the role of TCTRI in tomato ethylene responses we have created a
number of constitutive and fruit-specific DNA constructs for Agrobacterium-mediated
T-DNA transfer. These constructs are shown in Figure 2 and represent means for both
repression of the endogenous TCTRI mRNA and over/ectopic expression of the TCTRI
transcript in tomato. Transformation with all constructs has been initiated and primary
transform ants are available. Analysis of transgenic tomato plants altered in TCTR 1
125
expression will permit functional analysis of this gene and assessment of its role in
tomato ethylene signal transduction.
3' .... 5'
~Tll I CaMV 35s promote~ TCTRI ~

pBI121 ~
3' ... 5'
~Tll E8Promoter TCTRI ~

~
.
pBI121
5' 3'
2:Tll
E8 Promoter TCTRI ~
pBI121 ~
Figure 2. DNA constructs for altering TeTRI expression in transgenic tomato plants. Constitutive
(CaMV35s) and fruit-specific (ES) promoters have been used to generate both sense and antisense constructs
in the binary plant transfonnation vector pBI121. The NPTII gene is included for selection of transform ants
on kanamycin containing media.
3.3. MAP-BASED CLONING OF DEVELOPMENTAL REGULATORS OF

TOMATO FRUIT RIPENING
In an effort to gain insight into the genetic regulation of ethylene biosynthesis, response,
and additional components of fruit ripening control, which are influenced in part or
solely by factors outside the sphere of ethylene effects, we have continued efforts toward
map-based cloning of the rin and nor loci. rin and nor are non-allelic yet result in
similar phenotypes including inhibition of climacteric ethylene biosynthesis and fruit
ripening, and ripening of fruit from both mutants cannot be induced with exogenous
ethylene [27]. In addition, rin and nor have been mapped to chromosomes 5 and 10,
respectively, and both have been shown to reside in regions of tomato chromosomes
sufficiently saturated with DNA markers for chromosome walks [15]. Recent progress
has resulted in the development of BAC and YAC contigs which span both loci (J.
Vrebalov, V. Padmanabhan, D. Ruezinsky, R. White and J. Giovannoni, unpublished)
and use of said high molecular weight clones as hybridization probes to isolate candidate
RIN and NOR cDNAs. Mutant complementation with putative RIN and NOR cDNAs is
in progress.
126
4. Conclusion
Comprehensive understanding of the mechanisms underlying the fruit ripening process

in climacteric fruits such as tomato will require analuysis of both hormonal and
developmrnental pathways which regulate this process. Eventual understanding of the
function of genes such as EPI, TCTRI, RIN and NOR, which represent putative
components of both ethylene-signaling and developmental regulatory systems, will be
important steps toward comprehension of how evolution has selected and modified
control mechanism for both general whole plant ethylene response and specific
coordinated events such as fruit ripening.
5. References
1. Hobson, G. and Grierson, D. (1993) Tomato, in G.B. Seymour, J.E. Taylor, G.A Tucker (eds.)
Biochemistry of Fruit Ripening, Chapman and Hall, London pp 405-442.
2. Gray, J.E., Picton, S., Giovannoni, J.1. and Grierson, D. (1994) The use of transgenic and naturally
occurring mutants to understand and manipulate tomato fruit ripening. Plant, Cell Environ. 17,
557-571.
3. Smith, c., Watson, C., Ray, J., Bird, c., Morris, P, Schuch, W. and Grierson, D. (1988) Antisense
RNA inhibition of polygalacturonase gene expression in transgenic tomatoes, Nature 334, 724-
726.
4. Giovannoni, 1., DellaPenna, D., Bennett, A and Fischer, R. (1989) Expression of a chimeric
polygalacturonase gene in transgenic rin (ripening inhibitor) tomato fruit results in polyuronide
degradation but not fruit softening, Plant CellI, 53-63.
5. Kramer, M., Sanders, R., Sheehy, R., Melis, M., Kuehn, M. and Hiatt, w. (1990) Field evaluation
of tomatoes with reduced polygalacturonase by antisense RNA, in A Bennett, and S. O'Neill,
(eds.), Horticultural Biotechnology, Alan R. Liss, pp 347-355.
6. Fray, R. and Grierson, D. (1993) Identification and genetic analysis of normal and mutant phytoene
synthase genes of tomato by sequencing, complementation, and co-suppression, Plant Mol. BioI.
22,589-602.
7. Oeller, P.W., Wong, L.M., Taylor, L.P., Pike, D.A. and Theologis, A (1991) Reversible inhibition
of tomato fruit senescence by antisense l-aminocyclopropane-l-carboxylate synthase, Science 254,
427-439.
8. Hamilton, A, Lycett, G. and Grierson, D. (1990) Antisense gene that inhibits synthesis of the
9. Wilkinson, J., Lanahan, M., Yen, H., Giovannoni, J. and Klee, H. (1995) An ethylene-inducible
component of signal transduction encoded by Never-ripe, Science 270,1807-1809.
10. Yen, H., Shelton, A, Howard, L. Vrebalov, J. and Giovannoni, 1. (1997) The tomato high pigment
(hp) locus maps to chromosome 2 and influences plastome copy number and fruit quality. Theor.
AppliedGen. 95, 1069-1079.
II. Theologis, A, Oeller, P., Wong, L., Rothmann, W. and Gantz, D. (1993) Use of a tomato mutant
constructed with reverse genetics to study fruit ripening, a complex developmental process, Dev.
Gen. 14,282-259.
12. Giovannoni, J., Noensie, E., Ruezinsky, D., Lu, x., Tracy, S., Ganal, M., Martin, G., Pillen, K. and
Tanksley, S. (1995) Molecular genetic analysis of the ripening-inhibitor and non-ripening loci of
tomato: a first step in genetic map-based cloning of fruit ripening genes, Mol. Gen. Gen. 248, 195-
206.
13. Rick, C. (1980) Tomato linkage survey, Rep. Tomato Genet. Coop. 30,2-17.
14. Penarrubia, D., Aguilar, M., Margossian, L. and Fischer, R. (1992) An antisense gene stimulates
ethylene hormone production during tomato fruit ripening, Plant Cell 4, 681-687.
127
15. Theologis, A. (1992) One rotten apple spoils the whole bushel: the role of ethylene in fruit
ripening, Cell 70, 181-184.
16. Yen, H., Lee, S., Tanksley, S., Lanahan, M., Klee, H. and Giovannoni, J. (1995) The tomato
Never-ripe locus regulates ethylene-inducible gene expression and is linked to a homologue of the
Arabidopsis ETR1 gene, Plant Physiol. 107, 1343-1353.
17. Trentmann, S. and Kende, H. (1995) Analysis of Arabidopsis cDNA that shows homology to the
tomato E8 cDNA, Plant Mol. BioI. 29, 161-166,
18. Lanahan, M.B., Yen, H.C., Giovannoni, lJ. and Klee, H.J. (1994) The Never Ripe mutation blocks
ethylene perception in tomato, Plant Cell 6, 521-530.
19. Koshland, D. (1995) The two-component pathway comes to eukaryotes, Science 262,532.
20. Bleeker, A., Estelle, M., Somerville, C. and Kende, H. (1988) Insensitivity to ethylene conferred by
a dominant mutation in Arabidopsis thaliana, Science 241, 086-1089.
21. Schaller, G. and Bleeker, A. (1995) Ethylene-binding sites generated in yeast expressing the
Arabidopsis ETR1 gene, Science 270, 1809-1811.
22. Wilkinson, J., Lanahan, M., Clark, D., Bleeker, A., Chang, C., Meyerowitz, E. and Klee, H.
(1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in
heterologous plants, Nature Biotech. 15,444 - 447
23. Fujino, D., Burger, D. and Bradford, K. (1989) Ineffectiveness of ethylene biosynthetic and action
inhibitors in phenotypically reverting the Epinastic mutant of tomato (Lycopersicon esculentum
Mill.), J. Plant Growth Reg. 8, 53-61.
25. Kieber, J., Rothenberg, M., Roman, G., Feldman, K. and Ecker, J. (1993) CTRl, a negative
regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raffamily of
protein kinases, Cel/n, 427-441.
26. Ursin, V. (1987) Morphogenetic and physiological analyses of two developmental mutants of
tomato, Epinastic and diageotropica, Ph.D. Dissertation, University of Cali fomi a, Davis.
27. Tigchelaar, E.C., McGlasson, W.B. and Buescher, R.W. (1978) Genetic regulation of tomato fruit
ripening, HortScience 13, 508-513
ETHYLENE AS THE INITIATOR OF THE INTER-TISSUE SIGNALLING AND
GENE EXPRESSION CASCADES IN RIPENING AND ABSCISSION OF OIL
PALM FRUIT
J. HENDERSON AND D. J. OSBORNE

Oxford Research Unit, The Open University, Foxcombe Hall, Boars Hill,
Oxford, United Kingdom, OX1 5HR. UK
1. Abstract
The ripening and shedding of the oil palm fruit has unusual characteristics. The onset of
ripening is not initiated by a rise in ethylene production. The induction of a mesocarp
lipase, the start of carotene and lipid synthesis and the steady accumulation of 13-
carotene and triacylglycerol proceeds for some 20 days without a detectable formation
of ethylene. Then, at a critical stage of late ripeness, ethylene is produced by mesocarp
tissue and during the next 8-10 hours rises many-fold. Coincident with this ethylene
rise, the mesocarp synthesises a highly active 13-1,4-glucanhydrolase (Cellulase 1) of pI
6.0. These two events are followed closely by translucency of the central cells of the
fruit abscission zone and the expression there of a zone-specific cellulase (Cellulase 2)
and newly induced exo- and endo-polygalacturonases. On the palm, the fruit is shed
naked; the subtending tepals that remain on the bunch abscind some two days later with
different enzymes involved. In mutant non-abscinding palms, that do not shed their fruit
in the field, links in these inter-tissue co-ordinated events are disrupted. The rise in fruit
mesocarp ethylene does not signal fruit abscission, although it is coincident with the
induction of mesocarp cellulase 1. Also, the Cellulase 2 induced in the abscission zone
is unlike that of the wild type. The association of non-shedding with an abnormal
cellulase function is now the basis of transformation efforts to remodel the oil palm.
2. Introduction
There are two major economically important oil crops grown today. The soybean, a
dicotyledonous field plant grown for its seeds in temperate climates has already been
genetically manipulated for improved yield and lipid composition. The other, the oil
palm, is a monocotyledon plantation crop grown for its fruits in tropical and semi-
tropical countries, mainly SE Asia, Africa and South America.
The oil palm fruit yields two types of triacylglycerol; composed mainly of palmitic
and oleic acids from the mesocarp and lauric acid from the kernel [1]. Yields of these
valuable lipids have been increased some 25-30% since the 1960s through breeding
129
130
programmes, improved plantation management and the introduction of clonal material

generated via tissue culture propagation procedures from elite palms. Current
restrictions to a further improvement of crop yields lie in the mechanisms that control
fruit ripening and abscission and the problems these cause for harvesting.
2.1. THE PROBLEM
Several hundred fruit are produced in large, tight bunches (25-30kg). At maturity, the
fruit are bright orange with a purple region around and below the stigma, but this orange
colour is obscured in the densely-packed fruit. Only when a few fruit fall to the ground
is the whole bunch harvested. At that stage, the outer fruit are fully ripe and at
maximum triglyceride content but the inner fruit are less mature and still capable of
further synthesis. As soon as a fruit starts the abscission process, net lipid production in
the mesocarp ceases and instead, the triacylglycerol is hydrolysed with liberation of the
free fatty acids so spoiling oil quality. For this reason, harvested bunches are
transported on the same day to the plantation factory for steam killing and oil extraction.
The industry, therefore, seeks the means to synchronise the ripening of the fruit on the
bunch and to delay the time for shedding. With the goal of remodelling the oil palm to
achieve these objectives, we have explored the factors that regulate both the ripening
and the shedding of this valuable fruit to discover the most appropriate gene targets for
man ipulation.
3. Fruit Ripening
3.1. THE SIGNAL FOR RIPENING
By c.120 days after anthesis, the pale yellow fruit reaches full size. Shortly after, it
starts to synthesise and deposit triacylglycerol in specific oil-bearing cells in the
mesocarp, in association with a newly-expressed lipase activity [2] and a synthesis of
carotenes (Fig. I). There is no detectable rise in ethylene production and the signal for
the induction of these events remains unknown [3].
In the next c.20 days, the fruit ripens and turns bright orange except for the region of
high anthocyanin content around the stigma. At c.140-l45 days after anthesis, the fruit
starts to produce ethylene which rises to high levels over the next 8-10 hours. Again, the
signal initiating this rise is unknown, but it is coincident with a disruption of membrane
integrity in the large oil-bearing cells, as seen by transmission electron microscopy (Fig.
2A). No deterioration is observed in cells surrounding the vascular elements (Fig. 2B).
131
I 350 9
7
Q N I
I '0 P
I ~
~ x
~ 250
f 5
1)1: .!::!.
u..
C'I ii:
VI
C'I c
2. ~ 150 3
OJ
VI L..
OJ
C OJ OJ
OJ +- C
+- C QJ
o OJ
50 >-
8'- 0
I :!:
I.J..I
o ~.--- .,................................
, , ,
. o
50 90 130 170
Day s after anthesi s
Figure 1. Carotene accumulation, lipase activity [2] and

ethylene production [3] during fruit development and
ripening. Triacylglycerol deposition [8] also begins c.12S
daa and parallels lipase activity
Figure 2. TEMs of ripe mesocarp. A. Large oil-containing cell. B. Lignified cell with surrounding
parenchyma.
3.2. INDUCTION OF CELLULASE 1
With the initiation of ethylene production in the mesocarp, a specific mesocarp cellulase
is also newly expressed over the next 8-10 h and cellulase activity rises (Fig. 3). This
expression is ethylene-induced, being initiated by added ethylene or ACC and
suppressed by inhibitors of ACC synthase and/or ACC oxidase. No other
polysaccharide-cleaving enzymes are induced in the mesocarp at this stage.
132
90
.
1 FRUIT: x
7"0
T
~
-;;;
0
~ 70 .
0 Nol separa led
Separa Ii ng
. . ....
x
)( _,1(- ....
/'
"-
50 ~
'.c"
.
-s; /
x Separa led \ 3-0 "';s
/
. :::
--
. LL
Ethylene production I .. en
~
I 10
C
~
x
50 1 10
.
"0 I
.". .1 x o-e -0
>.
1 QJ
u
+- I ::J
-:;; 0-6 "0
:+= 30 0
'-

u
1r Q-4
0...
.
QJ
C
QJ
III 0'"I QJ
E >-
.3
10
. :-/,: 0-2 .c
--- - --
+-
(jj ___ 4 w
LJ 0
(>
0
120 125 130 135 140 145 150 155 160 165
Days after anthesis
Figure 3_ Mesocarp cellulase activity and ethylene production of
individual fruit during ripening and abscission_
4. Fruit Shedding and the Initiation of Abscission
Within a further 9-\ 0 hours of the rise of ethylene and Cellulase I in the mesocarp, the
cells of the fruit-pedicel abscission zone become translucent, round up and separate. In
this short period, major enzymic changes take place within these cells. Two exo-acting
and another (possibly two) endo-acting polygalacturonase activities are newly
expressed, together with a zone specific cellulase (Cellulase 2). In association, a ~
galactosidase and a ~-l ,3-glucanhydrolase are up-regulated approximately four-fold.
4.1. INDUCTION OF POL YGALACTURONASES
Fractionation of the polygalacturonases and their location on activity gels (Fig. 4)

indicates exo-activities resembling those of the peach abscission zone (and unlike the
tomato fruit) but endo-activity with similar pIs and immunorecognition to that of the
tomato fruit [4, 5]. Extraction of zone material at low pH (1.6) followed by column
fractionation indicates that almost all PG endo-activity corresponds to PG2 with little
conforming to a PG 1 complex [6].
133
VOID AND
I-
BUFFER WASH
40 pi 6.2--6.4 pi 9.3 pI 9.0
..e:
..'e
e: 30
0
:;::
-
I
,I
'"
':' x ~
,, ,,
- 2 :3:
u
d
L.. ,: 1 ,' I,
I
i
-0
E 20 500
c:
~
oS
300
~ 10
u
W
d
Z
100~
,
I
O~~~~~.----~---"~~~--~
o 5 15 25 35 45
Fraction Number
Figure 4. Fractionation of polygalacturonase isoenzyrnes by

cation exchange chromatography from the abscission zone tissue
of separated ripe fruit. The fractions containing PG activity from
each peak were combined, concentrated by ultrafiltration,
fractionated on IEF gels (PI 3.5-9.5) and silver stained for protein.
IEF activity gels confirmed the pI 6.2-6.4 isoforms, and acid
activity gels (pH 5.5) confirmed the pI 9.3 and 9.0
4.2. INDUCTION OF CELLULASE 2
During the change to translucency in abscission zone cells, and over the same period as
the new expression of the zone exo- and endo-polygalacturonases occurs, a new
cellulase activity is co-induced in the zone. This cellulase (Cellulase 2) differs from the
Cellulase 1 of the mesocarp. Whereas the mesocarp Cellulase 1 has a broad pH range of
activity extending from pH 3.0 to an optimum of pH 5.5-5.8 and a pI of approx. 6.0 (as
detected on IEF and acidic activity gels), the zone Cellulase 2 has a more restricted
range with low activity below pH 4.8 (Fig. 5) and no detectable activity at pI 6.0.
5. The Quest for Non-abscinding Mutants
As part of the overall programme to modity fruit ripening and abscission, mutant palms
with non-abscinding characteristics were sought amongst the Malaysian plantation
population. One such palm has been identified that does not shed its fruit although in all
134
other respects its growth and development appears normal. The progress of fruit
ripening is similar to that of other wild-type palms including the rapid (over 8-10 hours)
rise in ethylene production and the induction of a mesocarp-type Cellulase 1. Unlike
normal palms, however, fruit shedding does not follow upon the rise in ethylene and the
meso carp-specific cellulase expression. Instead, the fruit remains upon the palm until it
rots and no Cellulase 2 or polygalacturonase activities develop at the zone.
,..
60
1---""-, /
.~
..
.s:on T Mesocarp
..;
,j,/
'C
i>E , " \
....;:.. 40
",)1
> tr'
:;:::
u

20
Figure 5. pH-dependent cellulase activity in ripe mesocarp

and separated zone tissue. Enzyme extract + CMC substrate
incubated for 3h (n = 5, bar = s.d)
These fruit are not, however, incapable of abscission for if spikelets of fruit are
removed from the bunch the fruit present upon them will commence a slow abscission,
taking some 1-3 days to completion instead of the wild-type speed of 8-10 hours. The
abscission zone therefore clearly possesses functional target cells for separation.
Analyses of the enzyme activities induced during the post-harvest off-the-palm
abscission indicates induction of the normal polygalacturonase gene expressions as well
as the induction of a new cellulase activity. This zone cellulase activity does not,
however, resemble Cellulase 2 of the wild-type zone (Fig. 6). Instead its fractionation
and pH characteristics more closely resemble those of the mesocarp Cellulase 1 (Fig. 5).
Careful analyses of other enzymes with a potential for cell wall modification or
degradation have indicated no differences between the mutant and wild-type enzyme
cohort at abscission, other than that of the Cellulase 2. For this reason the differences in
the Cellulase 2 gene expressions in mutant and wild-type zones is one focus for the
remodelling of oil palm fruit abscission. The difference is not necessarily attributable to
a different gene expression, for it could as well be due to a post-transcriptional or post-
translational modification of the same gene product. Additionally, the cell wall
composition or sugar linkages in the abscission zone of the mutant could be different
from that of wild-type and 13C CP-MAS NMR analysis has indicated that there are such
differences although these may not be causal to non-shedding.
135
20
w
VI
o
"'----Normal Zone
.3
w
LJ
3-5 40 45 50 55 60 65 70 75
pH
Figure 6. pH-dependent cellulase activity in ripe wild-type and
mutant separated zone tissue. Enzyme extract + CMC substrate
incubated for 3h (n = 5, bar = s.d)
It appears that if the correct abscission signal is conveyed from the mutant mesocarp it is
not perceived or exploited in the zone as long as the fruit remain upon the palm. A
further possibility suggests that the Cellulase I of the mutant is abnormal and fails to
produce an additional oligosaccharide signal that is required (in addition to ethylene) for
the induction of the specific polygalacturonases and Cellulase 2 of a normal and rapidly
separating zone. Indeed, we already have evidence for the presence of an abscission-
accelerating oligosaccharide fragment in bean leaf abscission [7] and in normal
separating wild-type zones of the oil palm (unpublished data).
The critical stages for a proposed inter-tissue signalling control of ripening and
abscission and a perceived role for cellulases in the achievement of these events in the
oil palm is set out in Figure 7.
6. Acknowledgements
A BBSRC ROPA Award and Unilever pIc funding is acknowledged. We thank Ms H.

Davies for transmission electron micrographs and Mrs Vivian Reynolds for camera-
ready preparation of the manuscript. This work was carried out during the tenure (DJO)
of a Leverhulme Fellowship.
136
SIGNAL
?
NOT
ETHYlENE FRUIT RIPENING
lipase Induction -lipid Synthesis-
carotenj Synthesis
FULLY RIPE MESOCARP

Oil (ell Membrane Disintegration
I
Ethylene Production
Cetlula.se1 Induction ___ ...,
SIGNAL MUTANT 7
LESIONS .
ffilYLENE
+/-
ABSCISSION ZONE
'
!,
Cellulase 2 Induction _ -- J
oligo-
sacchilride I
Exo-& Endo- Polygalacturonase
ExpreSSion
Middle Lamella ~issolution

t
FRUIT ABSCISSION
Figure 7. Signalling cascade in the ripening and

abscission of wild-type oil palm fruit
7. References
1. Hartley, C.W.S. (1988) The Oil Palm, Third Edition, Longman Group, UK.
2. Henderson, J. and Osborne, DJ. (1991) Lipase activity in ripening and mature fruit of the oil palm.
Stability in vivo and in vitro, Phytochemistry 30, 1073-1078.
3. Henderson, l and Osborne, DJ. (1994) Inter-tissue signalling during the two-phase abscission in
oil palm fruit, J. Exp. Bot. 45, 943-951.
4. Bongbi, C., Rascio, N., Ramina, A. and Casadoro, G. (1992) Cellulase and polygalacturonase
involvement in the abscission ofleafand fruit explants of peach, Plant Mol. Bioi. 20, 839-848.
5. Ali, Z.M. and Brady, CJ. (1982) Purification and characterization of the polygalacturonases of
tomato fruits, Aust. J. Plant Physiol. 9, 155-169.
6. Pressey, R. (1988) Re-evaluation of the changes in polygalacturonase in tomatoes during ripening,
Planta 174, 39-43.
7. Thompson, D.S. and Osborne, D.l (1994) A role for the stele in inter-tissue signalling in the
initiation of abscission in bean leaves (Phaseolus vulgariS L.), Plant Physiol. 105,341-347.
8. Bafor, M.E. and Osagie, A.U. (1986) Changes in lipid class and fatty acid composition during
maturation of mesocarp of oil palm (Elaeis guineensis) variety Dura, J. Sci. Food Agric. 37, 825-
832.
ETHYLENE PERCEPTION AND RESPONSE IN CITRUS FRUIT
X. CUBELLS-MARTINEZ, J.M. ALONSO, M.T. SANCHEZ-

BALLESTA AND A. GRANELL
instituto de Biologia Molecular y Celular de Plantas, UP V-CSIC,
Universidad Politf!cnica de Valencia, Spain
1. Abstract
Most of our knowledge of the plant hormone ehylene in fruit comes from studies
conducted with climacteric fruit where ethylene has a key importance. Citrus fruit are
probably one of the most studied non-climacteric fruits and still the role of ethylene in
certain aspects of fruit development is a matter of debate. In this paper we substantiate
the hypothesis that in the flavedo of the fruit, many of the molecular changes associated
with maturation of the peel are mediated by ethylene. The nature of some of the genes
regulated by ethylene is presented. The posibility that ethylene responsive genes may be
regulated by modulation of ethylene sensitivity in the flavedo is discussed and the
strategy for more confidently answer this question by using a transgenic approach is
presented.
2. Introduction
Fruit ripening/maturation is a complex process which involves changes in a number of

characteristics such as colour, texture and flavour. Fruits have traditionally been
classified into climacteric and non-climacteric depending on the presence or absence of
a large transient increase in respiration and in the synthesis of the plant hormone
ethylene at the onset of ripening. The citrus fruit is a non-climacteric fruit and
maturation extends over a period of months during which the internal composition
changes gradually, making the fruit palatable. The peel also "matures", although in this
tissue the most conspicuous change refers to the colour of the flavedo (outer coloured
part of the rind). Environmental factors such as temperature, light and nutritional state
are important for the induction of co lor transition in citrus fruit peel [1 I]. In fact a first
evidence that the developmental programme of peel "ripening" can be separated from
that of the pulp is evidenced in tropical regions where the high constant temperatures
prevent the peel from developing the characteristic rind colour of citrus, while the pulp
matures normally.
Although the peel of Citrus fruit is able to produce significant amounts of ethylene
under certain conditions [I7, 23] sound fruit behave as a typical non-climacteric fruit,
137
138
exhibiting only low constant levels of ethylene production throughout maturation. Thus,
the role of endogenous ethylene has been a matter of debate [5, 21, 22] but the latest
results using ethylene antagonists indicate that low basal levels of bound ethylene may
indeed be required for degreening of the flavedo [12]. Treatment of full-size fruit with
ethylene induces a number of changes at the morphological [21], physiological and
biochemical levels similar to those observed during natural degreening of the fruit that
occurs during ripening and is therefore used as a commercial practice [14]. The pulp
however show no physiological response to ethylene, neither do gibberellins modify the
pulp ripening programme. Flavedo maturation is associated with changes at the
biochemical and gene expression level [4, 7]. But in contrast to the wealth of
information concerning climacteric fruit, we know very little of the molecular changes
during maturation of non-climacteric fruits.
3. Differential Gene Expression during Flavedo Maturation in the Citrus Fruit
The biochemical characterization of the enzymes responsible for the changes occurring
during Citrus flavedo maturation, mainly pigment changes, sugars and volatiles is
difficult because of the presence of secondary metabolites (phenolic compounds,
terpenes, flavonoids, etc) which interfere with the determination of enzyme activities. A
molecular approach based on 2D-gel protein analysis of the in vivo and in vitro
synthesized polypeptides [4] provided a broad qualitative approach to the molecular
changes occurring during flavedo maturation. In this study it was shown that maturation
of the flavedo was accompanied by the specific synthesis of mRNAs and proteins, and
that ethylene was able to induce in the flavedo the accumulation of a similar set of
polypeptides. Ethylene induced also the accumulation of an additional class of mRNAs
and polypeptides that were not detected during flavedo maturation, either because they
were not expressed during maturation or they expression was transient and escaped to
the analysis. Later studies are leading to the identification of specific mRNAs which are
helping to understand the changes occurring during maturation of the citrus flavedo [1,
2,3].
3.1. GENES AND PROTEINS RELATED TO THE TRANSFORMATION FROM

CHLOROPLAST TO CHROMOPLAST
During the maturation of the citrus fruit, the flavedo undergoes a transition from
photosynthetic to a non-photosynthetic stage, which is affected by environmental,
nutritional, hormonal and genetic factors [11]. This transformation is associated with
the differentiation of chloroplast to chromoplast and involves many changes, those
dealing with color, such as chlorophyll degradation and carotenoid biosynthesis being
the most evident.
The levels of chloroplast polypeptides decrease during flavedo maturation [11] and
this is also observed at the mRNA level as shown for RubisCO and chlorophyll alb
binding transcripts (see Figure 1). The activity of a plastid enzyme, chlorophyllase,
which seems to playa role in chlorophyll degradation, was shown to increase in Citrus
139
fruit peel in response to ethylene due to de novo synthesis of the protein [27].
Furthermore gibberellic acid, which has an antagonistic effect on the chloro to
chromoplast transformation, reverts the ethylene inducing effect [27].
The increased levels of a non photosynthetic Fd in maturing flavedo, which can be
also induced by ethylene may provide the Fd required for the dioxygenase step of
chlorophyll degradation [25] and also observed in senescing tissues [2,26].
Another important component of the color change occurring in the flavedo during
maturation is the increase in carotenoids. Carotenoid biosynthesis appears to require the
presence of the vitamin thiamin. It is interesting that thiamin and thi mRNA levels,
which probably encodes an enzyme involved in the biosynthesis of this vitamin,
accumulate in the flavedo during development and maturation and that the levels of thi
mRNA can be further increased by ethylene treatment but reverted by the inhibitor of
flavedo degreening gibberellin [18].
The possibility of a nutritional control of flavedo degreening has been proposed by
Huff [16]: high C/N ratios will favour the transformation of chloroplast to chromoplast.
Interestingly, the mRNA for a sucrose phosphate synthase accumulates in the flavedo
during maturation [unpublished results, and also in the pulp: 19]. It is known that the
total sugar content of the peel increase in parallel to the natural degreening of the peel of
fruits attached to the tree [11]. In this respect it is interesting that low temperatures have
been reported to bring about sugar accumulation and this would favour the
transformation of chloroplast into chromoplast [11].
UCE,PR Figure 1. Gene expression

during flavedo fruit maturation.
Rubisco VCE: ubiquitin conjugating
Cab enzyme; PR: pathogenesis
related protein; RubisCO: small
NP-Fd, Thi, subunit of Ribulosebisphosphate
SPS, VacPro, PR carboxylase/oxygenase, Cab:
Chlorophyl alb binding protein;
NP-Fd: non-photosyntehtic
PAL,Phyto ferredoxin; SPS: sucrose-
phosphate synthase; PAL:
phenylalanine ammonia lyase;
Phy: phytoalexin biosynthesis
gene; LTP: lipid transfer protein;
LTP, Glucanase GIucanase:B-I,3-glucanase,
CERS: citrus ethylene response
sensor.
Unknown
CERS
_lilliE. maturation_
140
3.2. GENES INVOLVED IN PROTECTION AGAINST PATHOGENS AND

ENVIRONMENTAL STRESSES
A number of mRNAs accumulating in the flavedo corresponds to proteins possibly

involved in protecting the tissue (and therefore the fruit) from pathogens. This is the
case for a ~-1,3-glucanase, aPR of unknown function, a non-specific LTP and a protein
related with a phytoalexin biosynthetic enzyme (unpublished results). It is interesting
that thiamin (thi gene reported to accumulate in flavedo maturation and in response to
ethylene) may also be important as an inducer of the accumulation ofPR proteins.
Another set of proteins seems to be there to protect the fruit against environmental
stress. This is the case for genes induced by low temperatures, a gene with homology
with a water-stress inducible protein and a CytP450 and PAL which are involved in the
biosynthesis or secondary metabolites, some of which may have a role in protecting the
fruit against pathogens or as sunscreens.
3.3. SENESCENCE RELATED GENES
A gene with homology with a vacuolar processing enzyme (VacPro) which also
accumulates in senescent tissues and the fact that most of the maturation associated
mRNAs can be found in ethylene-treated leaves and/or senescent leaves indicates that
overlapping gene expression programmes occur in the flavedo during degreening and in
leaf senescence. It is interesting that no increase in mRNAs homologous to cystein
proteinases of the papain type involved in general digestion of protein was observed in
the flavedo during colour change (unpublished). This result confirms previous
observations that during flavedo maturation no increase in general proteolytic activity or
protein decline was observed [10].
4. Effect of Ethylene and Ethylene Action Inhibitors on Fruit-maturation

Associated Gene Expression. Tissue Specificity
Different mRNAs accumulating in the flavedo during maturation can be induced,

although at specific rates and sensitivities, by exogenous treatment with ethylene (Fd,
VacPRo, many of the pathogen-related genes). Interestingly, this can be done at any
stage of fruit development, and most of these genes can also be induced by ethylene in
leaves (not in all cases for roots) and in flowers during natural opening and senescence.
Particularly striking is that ethylene not only upregulates genes whose mRNAs
accumulate during flavedo maturation but also have a down regulatory effect on the
levels of Cab and RubisCO whose levels decrease during maturation. Fd and Thi for
instance are induced by ethylene in a similar manner as occurs during normal
maturation. Application of ethylene action inhibitors lower the endogenous levels of
most of maturation associated genes (for instance Fd and VacPro), but not all of them (a
specific PR, other unknown mRNAs and CERS remain constant).
141
Exogenous treatment with ethylene induces on the other hand a number of mRNAs
that were not found to accumulate during flavedo maturation under normal conditions
[1,4].
5. Do Flavedo Cells Modulate their Level of Sensitivity to Ethylene during

Maturation? Future Directions
Citrus fruit tissues are able to produce ethylene [17] and to respond to ethylene [3, 27
and this paper]. Furthermore it was shown that Citrus tissues are able to bind ethylene as
determined by the ethylene displacement assay of Sisler [13]. The concentration of
ethylene required to occupy half of the binding sites present in citrus leaves was
estimated to be 0.15~LlL [13] that is in the range of ethylene conc. required to elicit a
molecular response as determined in ours and other people studies. Although similar
binding experiments were not conducted in fruit tissues, our studies of dose response
using ethylene inducible genes as probes indicates that the flavedo and leaves have
similar levels of ethylene sensitivity.
Using a combination of PCR and library screening we have isolated cDNAs and
genomic clones for a Citrus homologue (cERS) of the ethylene response sensor
[ERSINR; 15; 28] which we found to be developmentally regulated during flavedo
maturation. CERS expression can be further stimulated by exogenous treatment with
ethylene and by environmental stresses. Expression data supports that environmental
and developmental regulation of CERS modulate the expression of ethylene related
genes during normal flavedo maturation [Cube lis et al. in preparation].
The availability of flavedo specific genes (our results) would enable us to place a
mutated form of citrus ERS that confers dominant insensitivity to ethylene (assayed first
in yeast as in 24) under the control of a flavedo specific promoter and introduce this
construct into Citrus plants following an efficient method of transformation reported
recently [20]. Study of the plants modified to overexpress of the ethylene insensitive
ERS form in the flavedo would help to clarify the role on ethylene in natural flavedo
degreening and maturation. On the other hand over expression of ethylene biosynthetic
gene or wt ERS under the control of the specific promoter may yield plants where the
internal and external maturation coincide in time. Additional advantages of using a
mutCERS involves introducing the ethylene insensitive character by linking mutCERS
to and abscission specific promoter like those of cellulase genes [8] to delay or diminish
organ abscission.
6. Conclusions
The astounding diversity of tissues which can become fleshy (see review by Coombe,
[9] and differentiate into a fruit anticipates the existence of a wide variety of
developmental and ripening behaviors. In dealing with this, the division of fruits in
climacteric and non-climacteric, despite of being useful results too simplistic. This is
further reinforced when it is becoming clear that in addition to ethylene, other
142
developmental cues play an important role in climacteric fruit ripening and conversely
that ethylene may also regulate some aspects of ripening in non-climacteric citrus fruits
such as in citrus. Despite their low basal levels endogenous ethylene appears to be
responsible for part of the changes in gene expression occurring during flavedo
maturation by the environmental and developmental regulation of ethylene sensitivity
mediated by CERS.
Flavedo Maturation
. 1
Environmental cues ~ Developmental factors
~r m~~r1ti~
Ethylene independent Ethylene-mediated Ethylene independent
Changes Changes Changes
Figure 2. Schematic representation of different components of flavedo maturation

and the interplay of environmental and developmental factors in modulating
ethylene sensitivity.
7. Acknowledgement
This research was supported by the Spanish Ministry of Science and Education grant
ALI96-0506-C03-3.
8. References
1. Alonso, 1.M. and Granell, A. (1995) A putative vacuolar processing protease is regulated by ethylene
and also during fruit ripening in Citrus fruit, Plant Physiol. t09,541-547.
2. Alonso, 1.M., Charnarro, 1. and Granell, A. (1995) A non-photosynthetic ferredoxin gene is induced
by ethylene in Citrus organs, Plant Mol. BioI. 29, 1211-1221.
3. Alonso, I.M., Charnarro, 1. and Granell, A. (1995) Evidence for the involvement of ethylene in the
expression of specific RNAs during maturation of the orange, a non-climacteric fruit, Plant Mol.
BioI. 29, 385-390.
4. Alonso, 1.M., Garcia- Martinez, 1.1. and Charnarro, 1. (1992) Two dimensional gel electrophoresis
pattern of total, in vivo and in vitro translated polypeptides from orange flavedo during maturation
and following ethylene treatment, Physiol. Plant. 85, 147-156.
5. Apelbaum, A., Goldschmidt, E.E. and Ben-Yehoshua, S. (1976) The involvement of endogenous
ethylene in the induction of color changes in "Sharnouti" orange, Plant Physiol. 57, 836-838.
6. Buchanan-Wollaston, V. (1997) The molecular biology ofleafsenescence, J.Exp. Bot. 48, 181-199.
7. Bums, I.K., and Baldwin, E.A. (1994) Glycosidase activities in grapeffruit flavedo, albedo and juice
vesicles during maturation and senescence, Physiol. Plant. 90,37-44.
8. Burns, 1.K., Lewandowski, DJ., Nairn, 1. and Brown, G.E: (1998) Endo-l,4-B-glucanase gene
expression and cell wall hydrolase activities during abscission in Valencia orange, Physiol. Plant.
t02,217-225.
9. Coombe, B.G. (1976) The development of fleshy fruits, Ann. Rev. Plant Physiol. 27,207-228
143
10. Goldschmidt, E.E. (1986) Maturation, ripening, senescence, and their control: a comparison between
fruit and leaves, in S.P. Monselise (ed.), Handbook offruit set and development, CRC Press, Inc.,
pp. 483-491.
II. Goldschmidt, E.E. (1988) Regulatory aspects of chloro-chromoplast interconversion in senescing
Citrus fruit peel, Isr. J. Bot. 37, 123-130.
12. Goldschmidt, E.E., Huberman, M. and Goren, R. (1993) Probing the role of endogenous ethylene in
the degreening of citrus fruit with ethylene antagonists, Plant Growth Regut. 12,325-329.
13. Goren, R. and Sisler, E.C. (1986) Ethylene binding characteristics in Phaseolus, Citrus and
Ligustrum plants, Plant Growth Regul. 4,43-54.
14. Grierson, W., Cohen, E., and Kitagawa, H. (1986) Degreening, in W.F. Wardowski, S. Nagy and W.
Grierson (eds.), Fresh citrusfruils, Westport Connecticut: AVI Publishing CO. Inc., pp 253-274.
IS. Hua, 1., Chang, C., Sun, Q. and Meyerowitz, E. (1995) Ethylenc insensitivity conferred by
Arabidopsis ERS, Science 269, 1712-1714.
16. Huff, A (1983) Nutritional control of degreening and regreening in Citrus peel segments, Plant
Physiol. 73,243-249.
17. Hyodo, H. (1981) Ethylene production by citrus fruit tissues, Proc. Int. Soc. Citriculture 880-882.
18. Jacob-Wilk, D., Goldschmidt, E.E., Riov, J., Sadka, A. and Holland, D. (1997) Induction ofa Citrus
gene highly homologous to plant and yeast Ihi genes involved in thiamine biosynthesis during
natural and ethylene-induced fruit maturation, Plant Mol. Bioi. 35, 661-666.
19. Komatsu, A., Takanokura, Y., Omura, M., and Akihama, T. (1996) Cloning and molecular analysis
of cDNAs encoding three sucrose phosphate synthase isoforms from a citrus fruit (Citrus unshiu
Marc.), Mol. Gen. Gen. 252,346-351.
20. Pena, L., Cervera, M., Juarez, J., Ortega, c., Pina, J.A, Duran-Vila, N. and Navarro, L (1995) High
efficiency Agrobacterium-mediated transformation and regeneration of citrus, Plant Sci. 104, 183-
191.
21. Purvis, AC. (1981) Sequence and chloroplast degreening in calamondin fruit as influenced by
ethylene and AgN03, Plant Physiol. 66,624-627.
22. Purvis, AC. and Barmore, C.R. (1981) Involvement of ethylene in chlorophyll degradation in peel of
citrus fruits. Plant Physiol. 68, 854-856.
23. Riov, J. and Yang, S-F. (1982) Autoinhibition of ethylene production in citrus peel discs, Plant
Physiol. 69,687-690.
24. Schaller, G.E. and Bleecker, AB. (1995) Ethylene-binding sites in yeast expressing the Arabidopsis
ETRI gene, Science 270,1809-1811.
25. Schellengerg, M., Matile, P. and Thomas, H. (1993) Production of a presumptive chlorophyll
catabolite in vitro: requirement for reduced ferredoxin, Planta 191,417-420.
26. Smart, C.M., Hosken, S.E., Thomas, H., Greaves, JA, Blair, B.G. and Schuch, W. (1995) The
timing of maize leaf senescence and characterization of senescence-related cDNAs, Physiol. Plant.
93,673-82.
27. Trebitsh, T., Goldschmidt, E.E. and Riov, J (1993) Ethylene induces de novo synthesis of
chlorophyllase, a chlorophyll degrading enzyme, in Citrus fruit peel, Proc. Natl. Acad. Sci. USA 90,
9441-9445.
28. Wilkinson, JR., Lanahan, M.B., Hsiao-Ching, Y., Giovannoni, J.J. and Klee, H.J. (1995) An
ethylene-inducible component of signal transduction encoded by never-ripe, Science 270, 1807-
1809.
PHYTOCHROME B AND ETHYLENE RHYTHMS IN SORGHUM:
BIOSYNTHETIC MECHANISM AND DEVELOPMENTAL EFFECTS
S.A. FINLAYSON 1, C-J. HE 3 , I-J. LEEI, M.C. DREW3 , J.E. MULLET2

AND P.W. MORGAN 1
/Department of Soil and Crop Sciences, 2Department Biochemistry and
Biophysics, 3Department of Horticulture, Texas A&M University, College
Station, Texas 77843, USA
1. Abstract
The sorghum cultivar 58M exhibits reduced photoperiodic sensitivity resulting in early
flowering and shows shade avoidance behavior even under non-shaded conditions. This
cuItivar possesses a mutation in a PHYB gene, presumed to result in a non-functional
phytochrome B protein. Both mutant and wild-type plants produce ethylene in a
rhythmic cycle, with peaks near mid-day; however, peak ethylene production by the
mutant (phyB) is about 10 times greater than the wild-type's. Under bright light, the
ethylene rhythm is circadian, and correlates with rhythmic abundance of ACC oxidase
(ACCO) mRNA and ACCO enzyme activity. Under simulated shade, in which the wild-
type plant is a near phenocopy of the phyB mutant, the wild-type plant produces
ethylene rhythms similar to those observed in the mutant. ACCO mRNA abundance
shows a high amplitude rhythm in both cuItivars, but does not translate into enzyme
activity under these conditions. The high amplitude ethylene rhythms produced in both
cuItivars by simulated shading are diurnal but not circadian, and are caused by rhythmic
accumulation of ACC. Fumigation of seedlings with I ppm ethylene in a rhythm like
that produced by the plants themselves results in a reduction of shoot elongation in both
cultivars; however, the fresh and dry weights ofthe roots and shoots are reduced only in
the wild-type. While most of the differential ethylene is produced by the shoot, roots of
the phyB mutant produce two to three times as much ethylene as the wild-type. Hypoxic
treatment of roots induces ethylene production and aerenchyma only in the wild-type.
These results suggest that some aspects of seedling development may show reduced
sensitivity to ethylene as a result of the phyB mutation.
2. Introduction
Light rules the world of the plant. Because of the importance of light in the life of the
plant, plants have evolved sophisticated mechanisms to sense the duration and quality of
light they are exposed to, and to use this information to regulate their growth and
development in a manner complimentary to the signals they receive. One sensing
145
146
mechanism which plays a major role in higher plants utilizes the protein chromophore
complexes known as phytochromes. The phytochrome family is comprised of several
different members, some of which have not had clear functions ascribed. Two
phytochromes which seem to play major roles in the life of the plant, phytochrome A
and phytochrome B, have been studied in some detail. Phytochrome A has been
typically described as a light labile phytochrome and is thought to be responsible for the
far-red high-irradiance response [9]. Responses to the red/ far-red balance of light and
classical responses reversible by red/far-red light are principally attributed to
phytochrome B. In situations in which plants are shaded, phytochrome B may be
involved in sensing the reduced R:FR and low irradiance, resulting in a growth habit
designed to allow the plant to escape from the shaded environment. This phenomenon,
termed the shade avoidance response, includes the rapid and excessive elongation of the
shoot at the expense of root growth, reduced chlorophyll content, and other symptoms.
Crop stands exhibiting this response due to self-shading can be expected to produce
reduced yields due to unproductive allocation of resources [9].
Sorghum is a C4 grain of tropical origin, closely related to rice and maize. Sorghum
initiates floral development more rapidly when exposed to short photoperiods, and for
this reason is described as a qualitative short-day plant. Several genes involved in
decreasing the time required to flower (and therefore mature) under non-inductive
photoperiods (long days) have been characterized in sorghum [8]. Similarities to known
phytochrome mutants in other species suggested that one of these maturity alleles (Ma3)
encoded a phytochrome B gene [3]; subsequent experiments demonstrated the absence
ofa light stable phytochrome in a cultivar possessing the mutant allele [1], and mapping
and sequence analysis of the gene provided definitive evidence that Ma3 encodes PHYB,
with the mal allele encoding a mutant form (PhyB-J) which is prematurely truncated
and presumably non-functional [2]. Compared to the wild-type 100M, the near isogenic
cultivar 58M possessing the mutant phyB-l allele shows excessive shoot elongation, less
chlorophyll, reduced tillering and flowers very early even under non-inductive days [3].
The application of gibberellins can elicit dramatic shoot elongation, and promote
flowering- mimicking loss of phytochrome B function. Analyses of gibberellin levels in
the phyB-l mutant cultivar showed that while peak GA levels are about the same as in
the wild-type plant, the levels of the GAs in both cultivars followed a diurnal rhythm,
and the timing ofthe peak level was different between the two cultivars [5].
We have previously reported the phenomenon of circadian ethylene rhythms in
sorghum [4]. Both the wild-type and phyB-l mutant cultivars produce ethylene in a
circadian rhythm, with peaks occurring during the light period. However, the amplitude
of the ethylene rhythm is approximately ten times higher in the phyB-l mutant. While a
diurnal rhythm can be produced with either photo or thermoperiods alone, both signals
are required for circadian entrainment. Extreme shading can be simulated by growing
seedlings under a regimen of dim, far-red enriched light. Wild type seedlings grown in
this way exhibit a shade avoidance phenotype, very similar to that constitutively
expressed by the phyB-l mutant, which itself remains largely unaffected by this
treatment. Simulated shading also causes the wild-type seedlings to produce high
amplitude ethylene rhythms similar to those constitutively produced by the phyB-l
147
mutant. The correlation of high amplitude rhythms with the shade avoidance phenotype
suggests that endogenous ethylene rhythms may be involved in this response.
100M "Normal" Ught
20 8 20
Figure I. Density scans of diurnal northern blots of sorghum, harvested every 3 hours, probed with SAC02
3. Mechanism of Rhythmic Ethylene Production
The mechanistic basis for the rhythmic production of ethylene was investigated in
seedlings grown under both "normal" light and simulated shading environments, by
analyzing ACC oxidase mRNA abundance and enzyme activity and ACC levels. Under
"normal" light, abundance of the ACC oxidase mRNA SAC02 shows dramatic diurnal
oscillations in the phyB-1 mutant, but it is present only at very low levels in the wild-
type plant (Fig. I). ACC oxidase enzyme activity in the phyB-l mutant follows a pattern
consistent with SAC02 mRNA abundance, with peak activity near the middle of the
day, coincident with ethylene evolution. Again, ACC oxidase enzyme activity in the
wild-type plant is much lower than that observed in the phyB-1 mutant (data not shown).
The rhythms of both SAC02 mRNA abundance and ACC oxidase activity persist in
constant light demonstrating the circadian nature of these phenomena. ACC levels did
not correlate well with ethylene production in either cultivar, although ACC levels were
higher in the phyB-l mutant (data not shown).
Seedlings grown in simulated shade differed from those grown in "normal" light in
the mechanism of rhythmic ethylene production. SAC02 mRNA abundance from both
cultivars grown in simulated shade showed diurnal rhythms (Fig. I); however, ACC
oxidase enzyme activity did not correlate with these rhythms, nor with the ethylene
148
produced by the seedlings (data not shown). Analysis of ACC levels in both cultivars
indicates that under simulated shade, high amplitude ethylene rhythms are a
consequence of rhythmic abundance of ACC (data not shown). Interestingly, the
simulated shade environment was unable to elicit circadian entrainment of the ethylene
rhythm.
r
'-'
20
i 15
~ 10
1 5
o~"--'"'"''''''" .............'"''"-.....
SSM 100M SSM 100M
Figure 2. Inhibition of sorghum shoot Figure 3. Effect of 1 ppm ethylene on sorghum

elongation with 1 ppm ethylene shoot dry weitgh
4. Developmental Effects
Ethylene is known to play a promotive role in shoot elongation in deep water rice;
however, in most systems studied it has been shown to be inhibitory to both shoot and
root elongation. Does the high amplitude ethylene rhythm observed in the phyB-I
mutant, and in the wild-type plant under simulated shading, contribute to the shade
avoidance phenotype? Conversely, is the ethylene produced a consequence of the
phenotype? Perhaps shading, or the loss of PHYB function, renders the plant insensitive
to ethylene, releasing ethylene biosynthesis from a feedback inhibition loop. To test the
involvement of ethylene in the growth response of the seedlings, and to assay the plants'
sensitivity to ethylene, seedlings were fumigated with 1 ppm ethylene for 3 h per day in
a manner simulating the natural high amplitude ethylene rhythm. Shoot elongation was
inhibited by ethylene fumigation in both cultivars, with more dramatic inhibition
observed in the wild-type plants (Fig. 2). Furthermore, both the wild-type's shoot and
root dry weights were decreased with ethylene treatment, while the phyB-I mutant's
were unchanged, or slightly increased (Fig. 3).
The formation of aerenchyma, lysogenous air spaces in the root cortex, are known to
be induced by ethylene. As an additional measure of ethylene sensitivity, aerenchyma
development in roots subjected to hypoxia treatment (which induces root ethylene
production) was measured. While most of the additional ethylene produced by the
phyB-I mutant originates in the shoot, roots of this cultivar also generate approximately
two to three times as much ethylene as the wild-type. Roots of the phyB-I mutant were
found to possess a constitutive low level of aerenchyma development. Hypoxia
treatment was not able to induce further aerenchyma formation in the mutant, but it was
149
found to strongly promote aerenchYiila in roots of the wild-type plant (Fig. 4). Ethylene
exposure produced similar effects as hypoxia treatment (data not shown).
control
hypoxia
5
oa.-.......""""''''''''_.J...-__ ~ __
SSM 100M
Figure 4. Induction of aerenchyma in sorghum by hypoxia
5. Discussion
Two different mechanisms appear to be involved in the production of high amplitude

ethylene rhythms, one as a consequence of loss of PHYB function, and the other in
response to simulated shade. Both of these mechanisms generate a shade avoidance
response in the plant. Under "normal" light conditions, rhythmic ethylene production is
a consequence of cycling ACC oxidase enzyme activity, resulting from rhythmic
fluctuations in the abundance of ACC oxidase mRNA. Circadian ethylene rhythms in
Stellaria have also been demonstrated to arise from mRNA abundance driven ACC
oxidase enzyme activity [6]. Conversely, variations in ACC levels drive diurnal
ethylene rhythms in Chenopodium [7] and in sorghum under conditions simulating
shade.
We are accumulating evidence that some aspects of growth and development in the
phytochrome B deficient mutant show reduced sensitivity to ethylene. The inhibitory
effects of ethylene fumigation (Fig. 2) suggest that ethylene is not the cause of increased
shoot elongation in either the phyB-l mutant, or the wild-type plant grown in simulated
shade. The lack of an ethylene effect on dry matter accumulation in the phyB-l mutant,
and the inability of hypoxia to induce aerenchyma formation in the mutant's roots lends
support to the thesis that loss of PHYB function may reduce the plant's sensitivity to
some aspects of ethylene action.
6. Acknowledgments
Supported by USDA-NCRIGP grant #97-35304-4820 (PWM).

150
7. References
1. Childs, K.L., Cordonnier-Pratt, M-M., Pratt, L.H. and Morgan, P.W. (1992) Genetic regulation of
development in Sorghum bieolor. VII. mal flowering mutant lacks a phytochrome that
predominates in green tissue, Plant Physiol. 99, 765-770.
2. Childs, K.L., Miller, F.R., Cordonnier-Pratt, M-M., Pratt, L.H., Morgan, P.W. and Mullet, J.E.
(1997) The sorghum photoperiod sensitivity gene, MaJ, encodes a phytochrome 8, Plant Physiol.
113,611-619.
3. Childs, K.L., Pratt, L.H. and Morgan, P.W. (1991) Genetic regulation of development in Sorghum
bieolor. VI. The mal allele results in abnormal phytochrome physiology, Plant Physiol. 97,
714-719.
4. Finlayson, S.A, Lee, 1-1. and Morgan, P.W. (1998) Phytochrome 8 and the regulation of
circadian ethylene production in sorghum, Plant Physiol. 116, 17-25.
5. Foster, K.R. and Morgan, P.W. (1995) Genetic regulation of development in Sorghum bieolor. IX
The mal allele disrupts diurnal control of gibberellin biosynthesis, Plant Physiol. 108,337-343.
6. Kathiresan, A, Reid, D.M. and Chinnappa, c.c. (1996) Light and temperature entrained circadian
regulation of activity and mRNA accumulation of I-aminocyclopropane-I-carboxylic acid oxidase
in Stellaria longipes, Planta 199, 329-335.
7. Machackova, I., Chauvaux, N., Dewitte, W. and Van Onckelen, H. (1997) Diurnal fluctuations in
ethylene formation in Chenopodium rubrum, Plant Physiol. 113,981-985.
8. Quinby, J.R. (1967) The Maturity Genes of Sorghum, in AG. Norman, (ed.), Advances in
Agronomy, Vol 19, Academic Press, New York, pp. 267-305.
9. Smith, H. (1995) Physiological and ecological function within the phytochrome family, Ann. Rev.
Plant Physiol. Plant Mol. BioI. 46,289-315.
INVOLVEMENT OF ETHYLENE BIOSYNTHESIS AND ACTION IN
REGULA TION OF THE GRA VITRO PIC RESPONSE OF CUT FLOWERS
S. PHILOSOPH-HADAS 1, H. FRIEDMAN 1, R. BERKOYITZ-

SIMANTOy 1, I. ROSENBERGER 1, EJ. WOLTERING 2, A.H.
HALEyy3 AND S. MEIR 1
JDepartment of Postharvest Science of Fresh Produce, ARO, The Volcani
Center, Bet Dagan 50250, Israel; A TO-DLO, P.o.Box 17, 6700 AA
Wageningen, The Netherlands; and 3The Kennedy-Leigh Centre for
Horticulture Research. Faculty of Agriculture, The Hebrew University of
Jerusalem, Rehovot 76100, Israel
1. Abstract
Placing cut snapdragon (Antirrhinum majus L.) spikes horizontally induced elevated
ethylene production rates. The imposition of curvature was preceded (2 h after
gravistimulation) by an asymmetrical distribution of ethylene between lower and upper
longitudinally halved stem sections, in favor of the lower halves. A corresponding
gradient of free IAA could be detected only 30 min after gravistimulation. This lAA
gradient was rapidly reversed after 1-24 h of gravistimulation, showing higher IAA
levels in the upper stem halves. Additionally, one ACC synthase (ACS) gene, isolated
from the bending zone of horizontal spikes, was apparently not expressed in IAA-treated
stems. Thus, the gravity-induced ethylene asymmetry does not reflect an asymmetrical
distribution of free IAA, but rather possibly exhibits a stress response imposed by
change of stem orientation. Abolishing the ethylene gradient across the stem by
applying various ethylene inhibitors [CoCI 2, aminoethoxyvinyl-glycine (A YG), silver
thiosulfate (STS), 2,5-norbomadiene (NBD), or I-methylcyclopropene (I-MCP)], by
exposure to ethylene (1-10 ~I r\ or by using Ca2+ antagonists [LaCl 3, EGTA, 1,2-bis
(2-aminophenoxy)ethane-N ,N,N',N'-tetraacetic acid (BAPTA) or trans-l ,2-cyclohexane
dinitro-N,N,N',N'-tetraacetic acid (CDTA)], significantly inhibited curvature. This
indicates that the ethylene gradient is correlated with bending. The results therefore
suggest a role for ethylene in mediating the progress of the gravitropic response.
2. Introduction
One of the major postharvest problems of several cut flowers with actively growing
spikes is their bending in response to gravity, mainly during their horizontal transport
[5]. The prevailing model of Cholodny and Went [7, 12] tries to explain this negative
151
152
gravitropic response of shoots on the basis of excess IAA accumulation in the lower side
of the stem, thereby causing growth asymmetry that leads to its reorientation. Apart of
IAA and other plant hormones [6], ethylene was found to be involved in various
gravireacting systems. Thus, upon their reorientation from the vertical to the horizontal,
graviresponding plant organs showed increased ethylene production and formation of an
ethylene gradient [3, 4, 6, 8, 9, 13-15]. Based on the reported role of auxin-induced
ethylene production in growth promotion of vegetative tissues [1, 16], it could be
assumed that ethylene may mediate the gravitropic response induced by IAA [1, 9].
However, the role of ethylene in gravitropism is still controversial, since in only a few
cases ethylene inhibitors could block the gravitropic response [9, 13, 14].
The present study tries further to elucidate the role of ethylene in the gravitropic
response of snapdragon spikes, in relation to IAA, to formation of an ethylene gradient
across the stem and to increased ethylene production in response to shoot reorientation.
Experiments were performed with snapdragon (Antirrhinum majus L.) freshly cut
spikes. All treatments were performed as previously described [4, 9], in a standard
controlled environment room maintained at 20 c C with 60-70% relative humidity and 24-
h light (14 f.Ullol m-2s- 1). Spikes (60 cm long) were pulsed vertically with the various
solutions for 24 h, and then placed horizontally in 1-1 plastic cylinders, containing
organic chlorine, for an additional 24 h. Kinetics of stem bending was estimated by
monitoring with a protractor the curvature angle of 10 spikes at hourly intervals.
NBD was applied during 24 h of gravistimulation at a concentration of 4000 fll rl as
described previously [9, 15], to groups of 10 snapdragon spikes (60 cm long) placed
horizontally in 30-1 plastic barrels kept at 20 c C in darkness. I-MCP was applied before
gravistimulation at a concentration of Ifll rl by enclosing vertical snapdragon spikes (20
cm long) in 2-1 jars for 2 h in the light at 20 c C. Exogenous ethylene was applied during
10 h of gravistimulation at concentrations of 0.2, 1, 10 or 25 fll rl to snapdragon spikes
kept in 2-1 jars in light or darkness.
For measurements of ethylene production rates 5-cm stem segments were excised
from the bending zone of treated and untreated spikes at various time intervals following
gravistimulation, as described previously [4, 9]. Ethylene production of longitudinally
halved stem sections, enclosed in sealed 25-ml Erlenmeyer flasks for 1 h at 20 c C, was
monitored by a gas chromatograph.
Endogenous free IAA levels were determined in longitudinally halved 5-cm stem
sections (2 g) excised from the bending zone of snapdragon spikes at various time
intervals following gravistimulation. IAA was purified by HPLC and GC-MS [2]. Total
RNA was isolated from 5-cm stem sections excised from the bending zone of horizontal
spikes and vertical spikes treated with either water or IAA (10-3 mM). From each
sample, ACS genes were cloned by performing RT-PCR using degenerate primers to
ACS. PCR fragments with expected length of approximately 1200 bp were purified
from the gel and cloned. From each sample, 10-14 independent clones were sequenced.
153
4.1. EFFECT OF GRAVISTIMULATION ON ETHYLENE PRODUCTION
Placing cut snapdragon spikes horizontally induced elevated ethylene production rates
(Table 1). Consequently, as previously reported [3, 4, 6, 9,13-15], an ethylene gradient
between lower and upper longitudinally halved stem sections, in favor of the lower
halves, was formed within 2 h of gravistimulation and was maintained during 24 h,
(Table 1). During this period longitudinally halved stem sections excised from vertical
stems, did not show any gradient of ethylene formation (Table 1). The development of
the gradient was closely correlated with the angle of curvature (Table 1). These results
suggest that ethylene is involved in the gravitropic process of snapdragon spikes.
TABLE 1. Effect of stem orientation on ethylene production rates across the stem bending zone in
relation to the angle of curvature. Results represent means SE of 10 spikes. UH, upper halves; LH,
lower halves.
Time of Ethylene production rates (nl gFW- 1 h- 1) Angle of

gravistimulation or Vertical spikes Horizontal spikes curvature (0)
vertical position (h) Side A SideB UH LH
0 1.8 0.3 2.1 0.4 1.8 0.3 2.1 0.4 180 0.0
2 14.5 2.3 18.7 2.0 22.8 3.0 49.6 1.9 180 0.0
6 41.1 2.4 37.6 1.6 45.0 7.0 93.7 6.0 lSI 3.7
10 23.0 1.4 23.9 0.8 22.7 1.8 43.5 2.5 130 2.9
24 3.6 0.4 5.3 0.5 4.2 0.2 8.2 0.5 91 3.7
TABLE 2. Effect of gravistimulation on distribution of free lAA

across the bending zone of snapdragon stem. lAA was isolated from
2g tissue taken from 10 spikes. UH, upper halves; LH, lower halves.
Time of gravistimulation Free 1AA content (ng gFW- 1 h- 1)

(h) UH LH
o 2.21 1.50
0.5 4.30 12.30
1.0 3.39 1.58
1.5 2.00 0.50
2.0 3.70 1.57
24 7.80 1.10
4.2. RELATIONSHIP BETWEEN GRAVITY-INDUCED ETHYLENE AND IAA
Increased ethylene production rates may result from increased ACS activity, which is
known to be induced by IAA [16]. Thus, the gravity-induced ethylene asymmetry across
the stem may merely reflect the asymmetric distribution of IAA, which is postulated by
the Cholodny-Went theory [7, 12]. Our data show that a gradient of free IAA in favor of
the lower stem half could be detected only 30 min after gravistimulation (Table 2). This
154
IAA gradient was rapidly reversed after 1 h of gravistimulation, showing higher IAA
levels in the upper stem half, that were maintained up to 24 h (Table 2). This suggests
that the gravity-induced ethylene gradient across the spike (Table 1) does not necessarily
result from a corresponding gravity-induced gradient of IAA.
To further confIrm these unexpected results, we have cloned several ACS genes in
the stem bending zone following treatment with exogenous IAA or gravistimulation.
From each sample, 10-14 independent ACS clones were isolated. Based on their
sequences, these ACS clones were classifIed in 3 different groups, designated as ACS 1,
ACS2 and ACS3, which showed about 60% homology to each other. Table 3 shows that
ACS2 seems to be IAA-induced, while ACS3 seems to be associated with
gravistimulation and not induced by IAA. These results further support the suggestion
outlined above that the gravity-induced ethylene asymmetry does not reflect an
asymmetrical distribution offree IAA, but rather may possibly exhibit a stress response.
TABLE 3. Distribution of ACS clones in the bending zone of snapdragon

stems following IAA treatment or gravistimulation.
Treatments Number of ACS independent clones

ACS 1 ACS2 ACS3
VerticalIH20 5 5 0
Vertical I IAA 2 8 0
Horizontal I H20 8 2 4
4.3. IS ETHYLENE NECESSARY FOR THE BENDING RESPONSE?
In order to establish a direct involvement of ethylene in the gravitropic process, further

studies with ethylene inhibitors were performed. Unlike previous studies with Kniphofia
spikes [15], and similar to other stem systems [13, 14], all ethylene inhibitors tested
remarkably delayed curvature formation of snapdragon spikes following 8 h of
gravistimulation (Table 4). Moreover, as previously reported [9], several ethylene
inhibitors (CoCh, STS and NBD) also signifIcantly inhibited spike bending following
24 h of gravistimulation (Table 4). The lack of complete inhibition obtained by AVG or
I-MCP (Table 4) could probably be ascribed to insufficient concentrations. These
results indicate that ethylene is necessary for the gravitropic response of snapdragon
spikes, probably for mediating the promotion of the growth process involved [1,4].
TABLE 4. Inhibition of snapdragon spikes bending by ethylene

inhibitors during gravistimulation. Data (means of 10 spikes) are
presented as percentage of control untreated spikes. N.d., not
determined.
Ethylene inhibitor % Inhibition of the bending angle

8h 24h
AVG (I mM) 40 0
CoCI 2 (6.7 mM) 90 95
STS (1.5 mM) 67 73
NBD (40001-11 )"1) n.d. 88
I-MCP (1 flll"l) 47 o
155
4.4. ROLE OF ETHYLENE GRADIENT IN GRA VITROPISM
Although the existence of the gravity-induced ethylene gradient was reported in several
bending stems [3, 6, 13-15], its role in the process is still not understood. Therefore,
attempts were made in this study to examine the effect on stem curvature of abolishing
the ethylene gradient by various means. The ethylene synthesis inhibitor, CoCh
completely blocked stem curvature (Table 4), by abolishing the ethylene gradient
through inhibition of ethylene synthesis in both upper and lower stem halves. Based on
the assumption that the gradient of ethylene production across the stem (Table 1) reflects
presumably a similar gradient of ethylene action, the inhibition of curvature obtained by
the 3 ethylene action inhibitors assayed (STS, NBD and I-MCP) (Table 4), indicates
that this gradient is necessary for the bending process.
Conversely, neutralizing the gravity-induced differential endogenous ethylene
production by saturating the whole stem with excess concentrations of exogenous
ethylene (1 or 10 III rl) inhibited bending by 42 and 37%, respectively. The inhibitory
response was obtained only when exposure to ethylene was performed in the light. This
further implies a possible involvement of ethylene in the growth response following
gravistimulation [4], which may be differently manifested in light or darkness [11].
A further confirmation for the role of the gravity-induced ethylene gradient across
the stem was provided by the studies with calcium antagonists, which imply that
cytosolic Ca2+ plays an important role in the gravitropic response of snapdragon spikes
[4, 8, 9] and other gravibending systems [12]. The results of Table 5 clearly show that
all Ca2+ antagonists inhibited bending of snapdragon spikes, with LaCh and CDTA
being the most effective during 24 h of gravistimulation. These two Ca2+ antagonists are
of particular interest, since they blocked spike curvature by eliminating the ethylene
gradient in opposite manners. Thus, while LaCl 3 prevented ethylene gradient by
increasing ethylene production rates of both upper and lower stem halves [4], CDTA
prevented the gradient by reducing ethylene production rates of the lower stem half [9].
Taken together these results indicate that the development of this ethylene gradient
could be an important prerequisite for development of stem curvature, since abolishment
of an ethylene gradient by various inhibitors and in different manners eliminates
bending.
TABLE 5. Inhibition of the bending angle of snapdragon spikes

by various calcium antagonists during gravistimulation. Data
(means of 10 spikes) are presented as percentage of control
untreated spikes.
Ethylene inhibitor % Inhibition of the bending angle

8h 24 h
LaCI 3 (10 mM) 100 100
EGTA (20 mM) 56 10
CDTA(10mM) 100 100
BAPTA(5 mM) 100 52
It may, therefore, be concluded that the gravity-induced ethylene, which does not
seem to result from the gravity-induced IAA redistribution, has an independent role in
156
the bending process. This role might be associated with its possible effects on growth [I,
4] and/or changing sensitivity of the tissue to auxin [10].
5. Acknowledgments
Supported by grant No. 95/26 from DIARP, The Joint Dutch-Israeli Agricultural
Research Program, and by grant No. IS-2434-94 from BARD, The United States-Israel
Binational Agricultural Research and Development Fund. Contribution from the ARO,
The Volcani Center, Bet Dagan, Israel, No. 434-98.
6. References
1. Burg, S.P. and Burg, E.A (1967) Auxin stimulated ethylene formation: its relationship to auxin
inhibited growth, root geotropism and other plant processes, in F. Wightman and G. Setterfield
(eds.), Biochemistry and Physiology of Plant Growth Substances, Press, Ottawa, pp. 1275-1294.
2. Chen, K-H., Miller, AN., Patterson, G.W. and Cohen, J.D. (1988) A rapid and simple procedure
for purification of indole-3-acetic prior to GC-SIM-MS analysis, Plant Physiol. 86, 822-825.
3. Clifford, P.E, Reid, D.M. and Pharis, R.P. (1983) Endogenous ethylene does not initiate but may
modifY geobending - a role for ethylene in autotropism, Plant Cell Environ. 6, 433-436.
4. Friedman, H., Meir, S., Rosenberger, I., Halevy, AH., Kaufman, P.B. and Philosoph-Hadas, S.
(1998) Inhibition of the gravitropic response of snapdragon spikes by the calcium channel blocker
lanthanum chloride, Plant Physiol. 118(2), (in press).
5. Halevy, AH. and Mayak, S. (1981) Senescence and postharvest physiology of cut flowers - Part 2,
Hortic Rev. 3, 59-143.
6. Kaufman, P.B., Pharis, R.P., Reid, M.D. and Beall, F.D. (1985) Investigations into the possible
regulation of negative gravitropic curvature in intact Avena sativa plants and in isolated stem
segments by ethylene and GAl, Physiol Plant. 65,237-244.
7. Li, Y., Hagen, G. and Guilfoyle, TJ. (1991) Gene expression from an auxin-inducible promoter
supports the Cholodny-Went theory on tropisms, Plant Cell 3, 1167-1175.
8. Philosoph-Hadas, S., Meir, S., Rosenberger, I. and Halevy, AH. (\995) Control and regulation of
the gravitropic response of cut flowering stems during storage and horizontal transport, Acta
Hortie. 405, 343-350.
9. Philosoph-Hadas, S., Meir, S., Rosenberger, I. and Halevy, AH. (1996) Regulation of the
gravitropic response and ethylene biosynthesis in gravistimulated snapdragon spikes by calcium
chelators and ethylene inhibitors, Plant Physiol. 110,301-310.
10. Rorabaugh, P.A. and Salisbury, F.B. (1989) Gravitropism in higher plants shoots. VI. Changing
sensitivity to auxin in gravistimulated soybean hypocotyls, Plant Physiol. 91, 1329-1338.
11. Smalle, J., Haegman, M., Kurepa, J., Van Montagu, M. and Van der Straeten, D. (1997) Ethylene
can stimulate hypocotyl elongation in the light, Proc. Natl. Acad. Sci. USA 94, 2756-2781.
12. Trewavas, AJ. (ed.) (1992) Tropism forum: What remains of the Cholodny-Went theory? (A
multi-author discussion), Plant Cell Environ. 15, 757-794.
13. Wheeler, R.M. and Salisbury, F.B. (1981) Gravitropism in higher plant shoots. I. A role for
ethylene, Plant Physiol. 67,686-690.
14. Wheeler, R.M., White, R.G. and Salisbury, F.B. (1986) Gravitropism in higher plant shoots. IV.
Further studies on participation of ethylene, Plant Physiol. 82, 534-542.
15. Woltering, E.J. (1991) Regulation of ethylene biosynthesis in gravistimulated Kniphofia (hybrid)
flower stalks, J. Plant Physiol. 138,443-449.
EtHYLENE AND FLOWER DEVELOPMENT IN TOBACCO PLANTS
D. DE MARTINIS 12, I. HAENEN\ M. PEZZOTTe, E. BENVENUT02

AND C. MARlANII
ICatho/ie University of Nijmegen, Department of Botany, Plant Cell
Laboratory. Toernooiveld 1, 6525ED, Nijmegen, The Netherlands;
2ENEA Dipartimento lnnovazione, Divisione Bioteenologie ed
Agrieoltura. C.R. Casaecia, C.P.2400, Roma; 3Universita' di Perugia,
Faeolta di Agraria, lstituto di Miglioramento genetieo Vegetale, Borgo
XXgiugno 74,06122, Perugia,ltaly
1. Abstract
To study the role in plant reproduction of a pistil-specific gene encoding for the
ethylene-forming enzyme (ACC oxidase), we constructed transgenic tobacco plants in
which the expression of the ACC oxidase gene was inhibited. Transgenic flowers
showed female sterility due to an arrest in megasporogenesis. Pollen tubes were able to
reach the ovary but did not penetrate into the immature ovule. Flower treatment with an
ethylene source resulted in the recovery of ovule development as well as restored
guidance of the pollen tube tip into the ovule micropyle. These results demonstrate that
the plant hormone ethylene is necessary to trigger the very early stages of female
sporogenesis and ultimately to enable fertilisation.
2. Introduction
The role of the plant hormone ethylene in plant reproduction has been studied in a
number of flower types with regards to pollen tube/style interaction [24], pollination-
induced flower senescence [21] and fruit ripening [7, 16, 17]. So far, little is known
about the role of ethylene in early pistil development. In monocots, namely orchid, Zang
and O'Neill [26] have shown that pollination and auxin regulate ethylene production and
ovary development. In Petunia flowers, the expression of the gene family encoding for
the ACC oxidase, is temporally regulated during pistil development [21]. The authors
suggest that ethylene plays a role in reproductive physiology by regulating the
maturation of the secretory tissues of the pistil. In Arabidopsis, the gene encoding for a
member of the ethylene receptor family ETR2, recently cloned [9, 20], is preferentially
expressed in the inflorescences, floral meristems, developing petals and ovules thus
indicating a possible tissue-specific role of ethylene. However, the role of ethylene in
157
158
pistil development has not been elucidated yet. We are currently involved in the study
of the cellular and molecular mechanisms that rule flower development and fertilization
and we isolated a tobacco pistil-specific cDNA encoding for the ethylene-forming
enzyme ACC oxidase (ACO). To understand the role of ethylene during pistil
development, we used a transgenic gene silencing approach to down-regulate ACO gene
expression. Here we report the characterisation of the ACO gene, in the tobacco ovary
during development, and we describe the ovule morphology of transgenic plants in
which the ACO mRNA accumulation was greatly reduced. We show that ACO down-
regulation influences ovule development and the process of fertilisation. The phenotype
obtained is reversible if an ethylene source becomes available to the flower, thereby
demonstrating a direct involvement of the hormone in ovule development.
A Figure 1. Temporal and spatial characterisation

of ACO gene expression in the ovary during
tobacco flower development. We monitored
STAGE 1 2 3 4 5 6 7 8 9 10 11 12 ACO gene epression in the ovary during the 12
stages of tobacco flower development [6, II].
IOJ.lg of total ovary RNA from flowers at
different stages (\ to 12) of flower development
were loaded. A) The RNA gel blots were
hybridised with labelled full-length ACO cDNA.
The filters were stripped and rehybridised with
labelled tobacco ribosomal cDNA (rRNA). For
in situ hybridisation the ovaries from tobacco
flowers at different developmental stages were
used. Hybridisation was visualized as red/purple
color on the ovules. Photograph were taken
using brigth-field microscopy. B) In situ
hybridisation with the antisense ACO probe of a
developing ovule at flower stages I to 4. The
single integument is stil a primordia and does
not envelop the nucellus. C) in situ
hybridisation with the antisense ACO probe of a
sample at the same stage as in B). Size bar
IOOJ.lm. (cw) carpel wall, (fn) funiculus, (i)
integument, (nu) nucellus, (ov) ovules, (pI)
placenta.
3. ACO Gene Expression during Tobacco Ovary Development
The ACO gene is mainly expressed in the pistil - in the stigma, in the transmitting tract
of the style and in the ovary - and it is not detectable in the pollen nor in the anther
[Weterings K., Pezzotti M., Cornelissen M., Mariani C., unpublished]. Figure IA shows
ACO gene expression in the ovary during flower development. The expression is first
detectable in the ovaries of young flower buds at stage 4-5 [6, 11]. During flower
development, the ovules arise from the placenta as a finger-like structures composed of
the funiculus, that attaches the ovule to the placenta, the integument primordia and the
nucellus that harbors the megasporocyte [2]. The expression pattern of ACO is
detectable since the very early stages of flower/ovule development and gradually
159
increases until anthesis (stage 12) when the ovules are completely differentiated [23].
In situ hybridisation in wild-type tobacco shows that ACO transcript accumulation
within the ovary is preferential on the ovules (Figs 1B, C), on the funiculus, on the
integument primordia and on the nucellus.
AC03'end cDNA
S3 promoter............ .,/" NOS ter .
A) RB -------lC==~=:J--.-------
--+ +--
LB S30CA
B) RB __ ~~romotel ADH i , / ACO full length NOSter.

______LB 35ACO
-+-
Figure 2. Constructs used for plant trasformation. A) We constructed a chimaeric antisense gene consisting
of the 690-bp 3' end fragment of the ACO cDNA, cloned in reverse orientation under control of the pistil-
specific Petunia inflata promoter S3 [IS] into a plant expression vector, BINl9 [1]. Transgenic tobacco
plants were regenerated after Agrobacterium-mediated transformation essentially as described previously
[22]. B) We also generated transgenic plants expressing the ACO full-length cDNA in sense orientation,
under control of the 35SCaMV promoter, in order to inhibit the gene by 'co-suppression' (Fig. 2B). Both
promoters confer pistil expression of the gene encoding for ~-glucuronidase (GUS) in transgenic tobacco
plants (unpublished observation). Transgenic plants were selected on the basis of kanamycin resistance,
transferred into the greenhouse and analysed for flower phenotype.
4. ACO Gene Silencing in Transgenic Tobacco
As the product of the ACO gene is the last enzyme in ethylene biosynthesis, its
expression in plant cells suggests the production of ethylene. To understand a possible
role of ethylene in ovule development, we produced transgenic tobacco plants in which
A .....<::I .....<::I
~ ~ Figure 3. ACO gene expression and ACO activity
rL"J rL"J
U
'"
U
....
U '"<::I
U
in wild-type and transgenic tobacco at anthesis. A)
i '"
It")
I'f')
<::I
i ;J ~ '" i
It")
I'f')
M
rL"J
Northern blot analysis of the transformants. RNA
was isolated from dissected ovaries (OV) and
stigma/style (ST) portions of wild-type, 35 aco 14
ACO and S30caS pistils at anthesis. 10 ~g of total ovary
RNA and 5 ~g of total stigma and style RNA were
loaded. The RNA gel blots were hybridised with
rRNA labelled full-length ACO cDNA. The filters were
stripped and rehybridised with labelled tobacco
ribosomal cDNA (rRNA) to ensure an equable
Ovary Stigma/Style loading and transfer of RNA within the same
tissue.
160
ACO gene expression was silenced by two different approaches (described in Fig. 2).
We selected the transgenic plants at flowering stage on the basis of lack of seed setting
and flower morphology (small flowers, not shown). We produced heterozygous T1
generations by backcrossing wild-type flowers with transgenic pollen. The progenies
resulting from these crosses segregated for the same floral phenotype as observed in the
primary transformants. As the transgenic pollen was capable of fertilising and
transmitting the trans gene, our results indicate that the lack of seed set in transgenic
plants was not caused by male sterility but had to be related to a pistil defect. Northern
blot analysis of the transgenic plants revealed the level of ACO transcript accumulation
in the wild-type and transgenic tobacco (Fig. 3). In the ovary of the transformants
S30caS and 35aco14 the presence of the ACO rnRNA was no longer detectable.
Interestingly, we could not obtain ACO down-regulation in the stigma and style of the
plants harbouring the antisense construct, whereas we obtained a clear reduction using
the co-suppression approach.
Figure 4. Differential Interference Contrast images (DIC) of the most observed phenotypes from the
transgenic flowers at anthesis. A) A mononucleate megasporocyte partially surrounded by the integument.
B) A binucleate megasporocyte , presumably a dyad produced after the first meiotic division. In all the
samples, the nucellus (nu) still clearly surrounds the megasporocyte (m) is clearly visible. Size bar: 50 J.lm.
5. Megasporogenesis Is Arrested in Ovules of Sterile Plants
Cytological analysis revealed that the ovules of the female-sterile transgenic plants were
arrested in development. Figure 4 shows that at flower anthesis (stage 12), the ovules of
all the transgenic plant lines S30ca and 35aco always showed the main traits of early
ovule morphogenesis: presence of the nucellus (Fig. 4 A, B), callose accumulation
within the nucellus (not shown) and absence of the embryo sac. These results clearly
showed that ACO down-regulation in the tobacco ovary inhibited integument growth
and megasporogenesis, suggesting that ethylene controls ovule development.
161
6. Ethylene Restores Fertilty in the Transformed Plants
To demonstrate the direct involvement of ethylene in regulating ovule development we

provided an ethylene source to the transgenic flowers. Thus, we treated transgenic
flowers either with ethephon (2-chloroethylphosphonic acid), which hydrolytic
breakdown leads to evolution of ethylene [25]. Although it has been shown that some
ethephon effects are not due to ethylene release [14], in general ethephon closely mimics
the ethylene-related physiological changes and induces gene expression in different
plants, including Arabidopsis [14] and tobacco [18, 24]. To quantify whether the
different treatment mentioned above could affect ovule development and therefore
fertility, pollinated etephon-treated flowers were allowed to set seeds. Preliminary
results show that seed set increases significantly in transgenic flowers upon treatment
with an ethylene source. Cytological analysis revealed that ovules could reach maturity
and recover their functionality after ethephon treatment and be fertilized (Fig. 5).
These results demonstrate that the action of ethylene is necessary to tobacco plants in
order to produce mature and functional ovules [4].
A B
Figure 5. Ovule morphology and fertilisation in ethephon-treated transgenic flowers. A) A fully developed
ovule with a normal embryo sac from a transenic flower after ethephon treatment (DIe image). B) A detail
of a pollen tube targeting a micropyle (arrow) in ethephon -treated transgenic flowers indicates a recovered
functionality of the ovules (Scanning Electron Microscope image). Size bar lO0f.llll. (es) embryo sac, (fu)
funiculus, (1) integument, (mp) micropyle, (pt) pollen tube.
162
7. Discussion
We analysed the role ethylene in the reproductive processes of tobacco. Unlike in

orchid, in tobacco we can exclude the presence of a pollination induced signal to initiate
maturation of the ovule. At anthesis the ovules are at the end of the megagametogenesis.
The embryo sac is present and cellularization and early differentiation of the egg cell
and the synergids has occurred [23]. We isolated from a tobacco pistil cDNA library a
clone corresponding to the mRNA encoding for the ethylene-forming enzyme, (ACC
oxidase, accession number at EMBL data banle X98493) ACO. The pattern of
expression of the ACO gene we isolated is specifically linked to the reproductive tissues
of the pistil and suggests a specific role of this member of the ACO gene family in the
reproductive physiology of the tobacco flower. Using two distinct gene-silencing
approaches, we successfully down-regulated ACO gene expression within the ovary.
The two sets of transformants showed a similar female sterility. Cytological analysis
revealed that in the transgenic plants, ovules did not complete megasporogenesis and did
not produce an embryo sac. This is the first evidence of a direct role of ethylene in
ovule development. Moreover, the fact that the supply of an ethylene source was
sufficient in itself to recover fully developed and functional ovules clearly demonstrated
that ethylene alone induces ovule maturation at this stage [4]. Ethylene acts through
receptor encoded by a gene family in Arabidopsis and tomato [3, 8, 13]. One of these
gene family members, the gene encoding for the ethylene receptor ETR2, shows an
expression pattern enhanced in the developing carpels especially in the funiculi and in
the ovules since the early stages of megasporogenesis [9, 20]. These observations and
our findings suggest that ethylene controls ovule development. Moreover, it has been
shown that genes necessary for ovule and female gametophyte development, such as
AINTEGUMENTA (ANT) [5, 12] encode for putative transcription factors that present
homology with the ethylene-responsive element binding proteins (EREBPs) [18]. Thus,
ethylene may act through a phosphorylation-dephosphorylation cascade (summarized in
the scheme below) [3, 8, 10, 19], leading to activation of flower-specific, ethylene-
inducible transcription factors to regulate the expression of genes necessary for ovule
development. So far, we could not detect any expression of ANT within the tobacco
ovary using an ANT-specific Arabidopsis probe. However, we can not exclude the
presence of flower-specific EREBPs. The cloning of those factors and the
characterisation oftheir expression in the tissues of the ovules will elucidate the mode of
action of ethylene in regulating ovule development.
ACCoxidase percePtion!. gene ovule

ACC ~ C2H 4 ---. ...... I' ---. ---.
transduction response development
163
8. References
1. Bevan, MW, (1984) Binary Agrobacterium vectors for plant transformation, Nucleic Acids Res.
12,8711-8722.
2. Bouman, F. (1984) The Ovule, in B. M. Johri (ed.), Embryology of Angiosperms, Springer, pp.
123-157.
3. Chang, C., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (1993) Arabidopsis ethylene-
response gene ETR1: similarity of product to two component regulators, Science 262,539-544.
4. De Martinis D. and Mariani C., Silencing of the ethylene-forming enzyme gene expression results
in a reversible inhibition of ovule development in transgenic tobacco plants, (Submitted)
5. Elliott, R.C., Betzner, AS., Huttner, E., Oakes, M.P., Tucker, W.Q., Gerentes, D., Perez, P. and
Smyth, D.R. (1996) AINTEGUMENTA, an APETALA2-like gene of Arabidopsis with pleiotropic
roles in ovule development and floral organ growth, Plant Cell 8, 155-168.
6. Goldberg, R.B. (1988) Plants: novel developmental processes, Science 240, 1460-1467.
7. Hamilton, AJ., Lycett, G.W. and Grieson, D. (1990), Antisense gene that inhibits synthesis of the
8. Hua, J., Chang, C., Sun, Q. and Meyerowitz, E.M. (1995), Ethylene insensitivity conferred by
Arabidopsis ERS gene, Science 269, 1712-1714.
9. Hua, J., Sakai, H., Nourizadeh, S., Chen, Q.J., Bleecker, AB., Ecker, J.R. and Meyerowitz, E.M.
(1998) EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis,
Plant Cell 10, 1321-1332.
10. Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A. and Ecker, J.R. (1993) CTRI a negative
protein kinases, Cell,72, 427-441.
II. Koltunow, AM., Truenettner, J., Cox, KH., Wallroth, M. and Goldberg, R.B. (1990) Different
temporal and spatial expression pattern occur during anther development, Plant Cell 2, 1201-
1224.
12. Klucher, KM., Chow, H., Reiser, L. and Fischer, R.L., (1996) The AINTEGUMENTA gene of
Arabidopsis required for ovule and female gametophyte development is related to the floral
homeotic gene APETALA2, Plant Cell 8, 137-153.
13. Lashbrook, C.C., Tieman, D.M. and Klee, H.I. (1998) Differential reguation of the tomato ETR
gene family throughout plant development, Plant J. 15, 243-252.
14. Lawton, KA, Potter, S.L., Uknes, S. and Ryals, J. (1994) Acquired resistance signal transduction
in Arabidopsis is ethylene independent, Plant Cell 6, 581-588.
15. Lee, H.S., Huang, S. and Kao, T. (1994) S proteins control rejection of incompatible pollen in
Petunia inflata, Nature 367, 560-563.
16. Lincoln, J.E., Cordes, S., Read, E. and Fischer, R. (1987) Regulation of gene expression by
ethylene during Lycopersicum esculentum (tomato) fruit development, Proc. Natl. Acad Sci. USA
84, 2793-2797
17. Oeller, P.W., Lu, M.W., Taylor, L.P., Pike, D.A. and Theologis, A (1991) Reversible inhibition of
tomato fruit senescence by antisense RNA, Science 254, 437-439.
18. Ohme-Takagi, M. and Shinshi, H. (1995) Ethylene-inducible DNA binding proteins that interact
with an ethylene-responsive element, Plant Cell 7, 173-182.
19. Raz, V. and Fluhr, R. (1993) Ethylene signal is transduced via protein phosphorilation events in
plants, Plant CellS, 523-530.
20. Sakai, H., Hua, J., Chen, Q.J., Chang, C., Medrano, L.1., Bleecker, AB. and Meyerowitz, E.M.
(1998) ETR2 is an ETRI-like gene involved in ethylene signalling in Arabidopsis, Proc. Nat/.
Acad. Sci. USA 95, 5812-5817.
21. Tang, x., Gomes, AM.T.R., Bhatia, A and Woodson, W.R. (1994) Pistil-specific and ethylene-
regulated expression of 1-aminociclopropane-l-carboxylate oxidase genes in Petunia flowers,
Plant Cell 6, 1227-1239.
22. Tavazza, R., Ordas, R.I., Tavazza, M., Ancora, G. and Benvenuto, E. (1988) Genetic
transformation of Nicotiana clevelandii using a Ti plasmid derived vector, J. Plant Physiol. 133,
640-644.
23. Tian, H.Q. and Russel, S.D. (1997) Calcium distribution in fertilized and unfertilized ovules and
embryo sacs of Nicotiana tabacum L., Planta 202,93-105.
164
24. Wang, H., Wu, H.M. and Cheung, A.Y. (1996) Pollination induces mRNA poly(A) tail-shortening
and cell deterioration in flower transmitting tissue, Plant J. 9, 715-727.
25. Yang, S.F. Ethylene evolution from 2-chloroethylphosphonic acid, Plant Physiol. 44, 1203-1204
26. Zhang, X.S. and 0' Neill, S.D. (1993) Ovary and gametophyte development are coordinately
regulated by auxin and ethylene following pollination, Plant CeliS, 403-418.
ACC OXIDASE EXPRESSION AND LEAF ONTOGENY IN WHITE CLOVER
M.T. McMANUS, D.A. HUNTER, S.D.YOO AND D. GONG

Institute of Molecular BioSciences, Massey University, Private Bag
11222, Palmerston North, New Zealand
1. Abstract
During leaf ontogeny in white clover (Trifolium repens L.), significant production of
ethylene occurs at the apex and from newly initiated leaves, and then again from
senescent leaf tissue. A combination of RT-PCR and 3'- RACE, and Southern analysis
has been used to identifY three distinct ACC oxidase genes (designated TRA CO 1,
TRAC02 and TRAC03) from leaf tissue of white clover. TRACOI is expressed
specifically in the apex, TRAC02 is expressed in the apex, and in developing and mature
green leaves, with maximum expression in developing leaf tissue, and TRAC03 is
expressed in senescent leaf tissue. Using protein purification techniques, three isoforms
of ACC oxidase have been identified, one in mature green tissue (designated MG1) and
two in senescent tissue (designated SeI, Sell). Some biochemical properties of each
isoform are described.
2. Introduction
The ethylene biosynthetic pathway has now been characterised with two committed
enzymes in the pathway identified, l-aminocyclopropane-l-carboxylate (ACC) synthase
[EC 4.4.1.14] and ACC oxidase [EC 1.4.3] [8,21]. ACC synthase is proposed to be the
rate-determining step in the pathway, with many inducers of ethylene biosynthesis acting
through stimulation of this enzyme [8,19,21]. The enzyme is known to be coded for by
a multi-gene family in several plant species, with many of these genes cloned from a
wide variety of tissues, and in response to a variety of stimuli [5].
By contrast, the ability of most plant tissues to convert ACC to ethylene was
interpreted originally as evidence that regulation of ACC oxidase was not a major
control point of ethylene biosynthesis [21]. However, following the successful
demonstration of enzyme activity, in vitro, [20], ACC oxidase has now been purified to
homogeneity and characterised from apple fruits [5], and partially purified and
characterised from a range of tissues including apple, avocado and pear [5] and
mandarin fruit [4].
In concert with these biochemical studies, genes coding for the enzyme have now
been cloned from a wide variety of tissues in many plants [5], with the emerging view
165
166
that the expression of the ACC oxidase gene family, in common with ACC synthase, is
highly-regulated in plants. As such, it constitutes an extra tier of control of ethylene
biosynthesis. Differential expression of ACC oxidase genes has now been observed in
orchid flowers, mungbean epicotyls, Petunia floral tissues [5], broccoli floral tissue
[16], in tomato [1], melon leaf tissues [11,12], carnation floral tissues [18], sunflower
seedling tissue [14], geranium floral tissue [3], and in leaf tissue of Nicotiana glutinosa
[10]. Much of this research on the differential expression of ACC oxidase has been
conducted on fruit and floral tissue. Comparatively fewer studies have been undertaken
on the regulation of ACC oxidase gene expression during leaf development [1, 2, 7, 11],
although ethylene is an important regulator ofleaf ontogeny [15]. In this study, we have
examined the expression of ACC oxidase both at the transcriptional and translational
level during leaf ontogeny in white clover (Trifolium repens L.).
3. Leaf Development in White Clover
The rooting at a single node and the subsequent outgrowth of a stolon of white clover
over a dry matrix (to inhibit root formation) produces a full programme of leaf
development along the stolon from initiation at the apex through maturation, senescence
and then necrosis. This growth system also produces plants in which the number of
leaves attached to the stolon reaches a constant number as the production rate is
balanced by the senescence rate. Leaf development is defined using total chlorophyll (a
+ b) as an indicator of maturity. In the example shown (Fig. 1), chlorophyll levels
increased during leaf expansion (up to leaf 5), the levels reached a maximum from leaf 6
to 14 (the mature green stage), after which chlorophyll levels decline (onset and
senescent stage). These discrete stages of leaf development can also be identified using
a measure of quantum efficiency of PSII (FjFm). Here, changes in the ratio almost
precisely mirrored chlorophyll content, thus acting as confirmation of the identification
of three stages ofleaf development (developing; mature green; senescent).
4. Ethylene Production and ACC Oxidase Expression during Leaf Ontogeny
4.1. ETHYLENE PRODUCTION AND ACC OXIDASE ACTIVITY
Two stages of significant ethylene production, in vivo, are observed routinely during leaf
ontogeny in white clover. In the example shown (Fig. 2A), the first was observed at the
apex, which declined to reach a minimum value by leaf 3. Minimum evolution of
ethylene was observed from leaves 4 to 10 (the mature green leaf stage), after which a
second stage of significant ethylene evolution was observed. Here, the rate of ethylene
production gradually increased through to leaf 16 (coinciding with the senescent stage)
and only decreased again in necrotic tissue (data not shown).
167
0.6 2500
>.
u
s::::: 0.5
.!!! 2000
u >.
!E ::- 0.4
,c_
e~
-
G>
ttl LL
E 1500
u 0.3 .20)
-
-> ,c_
E
-
LL 1000 UO)
G> :::L
,c
u
0.2 S
0
.....
0
0 500 I-
,c 0.1
Il.
o o
o 2 4 6 8 10 12 14 16 18 20
Leaf number
Figure 1. Stages of leaf development along a single stolon of white clover defined by total chlorophyll levels
( ), and quantum efficiency ofPSII (Fv/Fm) ( . ).
ACO enzyme activity, in vitro, was detected in the apex, increased to reach a
maximum in leaves 4 to 9, after which the activity steadily declined (Fig. 2). The
pattern of ACO activity observed, therefore, is synchronous with chlorophyll levels
measured during leaf ontogeny, but contrasts with the trend of ethylene evolution which
is virtually undetectable in mature green tissue before increasing again at the onset of
leaf chlorosis.
4.2. ACC OXIDASE GENE EXPRESSION
RT-PCR was used to amplity cDNA sequences from RNA isolated from the apex,
mature green, onset of senescence and senescent leaf tissue using primers designed to
conserved domains within ACC oxidase genes sequenced from several other plant
species. Sequencing of clones from each tissue revealed three distinct sequences
designated TRACOl, TRAC02 and TRA C03 , and homology comparison of the three
ACC oxidase DNA sequences produced values ranging from 75 to 84% [6]. These
sequences accounted for the major portion of the coding region and so to produce gene-
specific probes, 3'-RACE was used to amplity the (normally more diverse) 3'
untranslated region [5]. The homology comparison of the 3 '-untranslated regions is
provided in Table 1, where homology values are now between 55 to 61%. These 3'-
untranslated regions were used in northern analysis to determine the constitutive
expression of each ACC oxidase gene (Fig. 2).
168
12 2.5
10 2 c
~
.>-
.. .e
0
;i.-
u . ::I.e
!lIO
(I) ...
1.5 03:
til Q. ~IL
!lICI 6 (I) CI
:9 E 1 5i::I
>(-
4 - C
0...1 >--
o
0-
c ....
.e
w
0.5
<C 2
Kb

0 0
-1.35
TR-AC01
TR-AC02 ~ - 1.35
TR-AC03 - 1.35
.t-.:
Apex 1 2 3 4 6 8 9 10 11 13 14 15 16
Leaf Number
Figure 2. A. Stages of leaf development along a single stolon of white clover defined by ethylene
evolution (.) and ACO activity, in vitro (e). B. Northern analysis of ACO gene expression during
leaf ontogeny in white clover [modified from 6].
Table 1. Nucleotide homology values (as percentages) between

the 3' -untranslated regions of three ACC oxidase sequences
generated by RT-PCR and 3' RACE [6].
TRACOl TRAC02 TRAC03
TRACOl 61 55
TRAC02 61 59
TRAC03 55 59
TRACOI is expressed almost exclusively in the apex, with a much lower intensity of
hybridization discernible in leaf 1, and no detectable hybridization in leaf 2 or any other
leaf along the stolon. TRAC02 is detectable in the apex, shows maximal expression in
leaves 1 to 2, before gradually decreasing in intensity such that no clearly discernible
169
expression can be observed by leaf 13. The expression of TRAC03 is clearly detectable
fIrst in leaf 9 then increases to reach maximum in leaves 13 to 16.
5. Characterisation of ACC Oxidase Isoforms
The expression of TRACOI followed most closely the activity, in vitro, of ACC oxidase
(Fig. 2). Therefore, in terms of ACC oxidase activity, there is no corresponding increase
in activity in chlorotic tissue to match the induction of TRAC03 determined by northern
analysis. To examine the concept of ACC oxidase isoforms more closely, particularly in
senescent tissue, purification of stage-specific isoforms has been initiated. Using
hydrophobic chromatography, followed by gel fIltration and ion-exchange column
chromatography, three distinct ACC isoforms have been identifIed in mature green and
senescent leaf tissue (Table 2). In addition to differences in the elution profIle after
column chromatography, the two senescent isoforms (designated SeI and Sell) had a
different molecular weight (determined by SDS-PAGE) when compared to the mature
green (MGI) isoform. No detailed isoform analysis has been undertaken in apical tissue.
6. Discussion
In this study, we have shown that three distinct ACC oxidase genes are expressed
differentially during leaf ontogeny in white clover. The maximal expression of two of
these genes coincides with the two peaks of ethylene evolution observed. The
expression of TRACOI is predominantly in the apex, while the expression of TRAC03
almost precisely matches the increase of ethylene evolution during leaf senescence.
Ethylene evolution from the apex has been reported in several plant species [15],
with some consensus that in dicotyledonous plants the role of the hormone is to limit cell
expansion in younger leaves [9, 13, 15]. However, expression of an apex-specifIc ACC
oxidase has not been reported previously. As yet we cannot say which ofthese tissues
that comprise the apex specifically express TRACOI, but tissue localisation of this
expression should provide significant clues as to the role of ethylene in developing
leaves.
Ethylene evolution from senescent leaves is now well documented, and senescent
leaves of many species can convert ACC to ethylene [15, 17]. In common with this
study, a similar pattern in which two genes of ACC oxidase are differentially expressed
in mature green and senescent leaf tissue has also been reported for tomato [1], melon
[12] and tobacco [10]. In white clover, the examination of ACO gene expression has
been extended with the measurement of corresponding ACC oxidase activity. Detectable
ACC oxidase activity coincides more closely with TRAC02 gene expression. Some
ACO activity is observed in the apex, but in leaves from nodes 13 to 16, where the
expression of TRAC03 is induced, there is no concomitant increase in detectable
enzyme activity, in vitro. Leaf tissues from many species have been shown to convert
ACC to ethylene which is evidence that an ACC-dependent ethylene forming system is
170
functional, in vivo [15]. However, we are not aware of any studies In which ACO
activity, in vitro, has been demonstrated in senescent leaf extracts.
Table 2. Summary of purification properties of three ACC oxidases identified in

mature green and senescent leaf tissue of white clover.
Tissue Hydrophobic Ion-Exchange Molecular Mass (kDa)

(Isoform) Elution Elution
[%(NH4)S04] [NaCI (mM)] Gel Filtration SDS-
PAGE
Mature Green 0.0 260 - 370 37 37

MGJ)
Senescent
(SeI) 0.6 105 37 34
(Sell) 0.0 370 - 480 37 34
To examine further whether any ACC oxidase isoforms coincide with TRAC03
transcript accumulation in senescent leaf tissue, preliminary purification of the enzyme
has been undertaken. Using these procedures, one isoform has been identified in mature
green leaf tissue (MGI), and two in senescent leaf extracts (SeT and Sell). We can
speculate that MGI is encoded for by TRAC02, and TRAC03 encodes one of the
senescent isoforms. Indeed, Southern analysis using the reading frame from TRAC03
indicated that there may be two closely related genes (Hunter, D.A., unpublished data)
which might correspond to Sel and Sell. Southern analysis using the 3' -untranslated
region ofTRAC03 as probe indicates a single gene suggesting that if two closely related
genes are present in white clover, they have diverse 3' -untranslated regions [6].
The results presented here show that the two peaks of ethylene production during
leaf ontogeny coincide with the expression of distinct ACC oxidase genes. Given that
the ethylene produced at each leaf developmental stage in white clover induces quite
separate responses (modulation of leaf growth in the apex; regulation of senescence in
mature tissues), it is interesting to speculate that the regulation of biosynthesis of the
hormone may be intimately linked to its competence to respond to it. An examination of
the molecular basis for the control of transcription for each member will be an important
part in establishing such a link.
7_ Acknowledgements
This work is funded by the New Zealand Foundation for Research, Science and
Technology (Contract Number: C 10 635), and the New Zealand Agricultural and
Pastoral Research Institute (AgResearch) by provision of a PhD study award to D.H. We
thank Prof. S.F. Yang and Dr. A. D. Campbell, Dept. ofVeg. Crops, Univ. of California,
Davis, for the provision of ACC oxidase primers and help with the use of RT-PCR to
generate the reading frame sequences for TRAC02 and TRAC03, and Dr. Dennis
171
Greer, HortResearch, Palmerston North for assistance with the measurement of quantum
efficiency of PSII.
8. References
1. Barry, C.S., Blume, B., Bouzayen, M., Cooper, w., Hamilton, A1. and Grierson, D. (1996)
Differential expression of the I-aminocyclopropane-l-carboxylate oxidase gene family of tomato,
Plant J. 9, 525-535.
2. Bouquin, T., Lasserre, E., Pradier, l, Pech, J-C. and Balague, C. (1997) Wound and ethylene
induction of the ACC oxidase melon gene CM-ACOI occurs via two direct and independent
transduction pathways, Plant Mol. Bioi. 35, 1029-1035
3. Clark, D.G., Richards, C., Hilioti, Z., Lind-Iversen, S. and Brown, K. (1997) Effect of pollination
on accumulation of ACC synthase and ACC oxidase transcripts, ethylene production and flower
petal abscission in geranium (Pelargonium x hortorum L.H. Bailey), Plant Mol. Bioi. 34, 855-865.
4. Dupille, E. and Zacarias, L. (1996) Extraction and biochemical characterization of wound-induced
ACC oxidase from Citrus peel, Plant Sci. 114, 53-60.
5. Fluhr, R. and Mattoo, A.K. (1996) Ethylene - Biosynthesis and perception, Crit. Rev. Plant Sci.
15, 479-523.
6. Hunter, D.A., Yoo, S.D., Butcher, S.M. and McManus, M.T. (1998) Expression of 1-
aminocyclopropane-l-carboxylic acid (ACC) oxidase during leaf ontogeny in white clover, Plant
Physiol. (submitted)
7. John, I., Drake, R., Farrell, A, Cooper, W., Lee, P., Horton, P. and Grierson, D. (1995) Delayed
leaf senescence in ethylene-deficient ACC-oxidase antisense tomato plants: molecular and
physiological analysis, Plant J. 7, 483-490.
8. Kende, H. (1993) Ethylene biosynthesis, Annu. Rev. Plant Physiol. Plant Mol. Bioi. 44,283-307
9. Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A. and Ecker, lR. (1993) CTRI, a negative
10. Kim, S.K., Choi, D" Lee, M.M., Lee, S.H. and Kim, W.T. (1998) Biotic and abiotic stress-
relatedexpression of l-aminocyclopropane-l-carboxylate oxidase gene family in Nicotiana
glutinosa L., Plant Cell Physiol. 39, 565-573.
11. Lasserre, E., Bouquin, T., Hernandez, J.A., Bull, J., Pech, J-C. and Balague, C. (1996) Structure
and expression of three genes encoding ACC oxidase homologs from melon (Cucumis melo L.),
Mol. Gen. Genet. 251,81-90.
12. Lasserre, E., Godard, F., Bouquin, T., Hernandez, J.A, Pech, J-C., Roby, D. and Balague, C.
(1997) Differential activation of two ACC oxidase gene promoters from melon during plant
development and in response to pathogen attack, Mol. Gen.Genet. 256,211-222.
13. Lee, S.H. and Reid, D.M. (1996) The role of endogenous ethylene in the expansion of Helianthus
annuus leaves, Can. J. Bot. 75, 501-508.
14. Liu, J-H., Lee-Tamon, S.H. and Reid, D.M. (1997) Differential and wound-inducible expression of
1-aminocyclopropane-l-carboxylate oxidase genes in sunflower seedlings, Plant Mol. Bioi. 34,
923-933.
15. Osborne, D.1. (1991) Ethylene in leaf ontogeny and abscission, in AK. Mattoo and J.C. Suttle
(eds.), The Plant Hormone Ethylene, CRC Press, Boca Raton, pp. 193-214.
16. Pogson, 8.1., Downs, C.G. and Davies, K.M. (1995) Differential expression of two 1-
aminocyclopropane-l-carboxylic acid oxidase genes in broccoli after harvest, Plant Physiol. 108,
651-657.
17. Roberts, lA, Tucker, G.A. and Maunders, M.l (1985) Ethylene and foliar senescence, in J.A.
Roberts and G.A.Tucker (eds.), Ethylene and Plant Development, Butterworths, London, pp. 267-
275.
18. ten Have, A and Woltering, E.J. (1997) Ethylene biosynthetic genes are differentially expressed
during carnation (Dianthus carophyllus L.) flower senescence, Plant Mol. Bioi. 34, 89-97.
19. Theologis, A (1992) One rotten apple spoils the whole bushel: The role of ethylene in fruit
ripening, Cell 70, 181-184.
172
20. Ververidis, P. and John, P., (1991) Complete recovery in vitro of ethylene-forming enzyme
activity, Phytochemistry 30, 725-727.
Annu. Rev. Plant Physiol. 35, 155-158.
INTERACTION OF ETHYLENE WITH JASMONATES IN THE
REGULATION OF SOME PHYSIOLOGICAL PROCESSES IN PLANTS
M. SANIEWSKI 1, J. UEDA 2 AND K. MIYAMOT0 2

JResearch Institute of Pomology and Floriculture, Pomologiczna 18, 96-
100 Skierniewice, Poland; 2College of Integrated Arts and Sciences,
Osaka Prefecture University, 1-1 Gakuen-cho, Sakai, Osaka 599-8531,
Japan
1. Abstract
Jasmonates are considered to be candidates for a new type of plant hormone. It is well
known that jasmonates stimulate ethylene production in different experimental systems.
Here we review several interesting topics such as the relationships between ethylene and
jasmonates in fruit growth and ripening, in gum induction and in response to physical
injury, pathogen infection and herbivore and insect attack. The role of ethylene in the
senescence and abscission of leaves promoted by jasmonates is presented and the
interaction of ethylene with jasmonates in the conductivity of cells and in tiller
production is also described. Moreover, the important role of jasmonates as signal
molecules in response to stress is reported.
2. Introduction
Ethylene is the most simple olefin and is widely distributed in the plant kingdom as an
important gaseous plant hormone, influencing a diverse range of plant growth and
developmental processes. Jasmonates, mainly jasmonic acid (JA) and methyl jasmonate
(JA-Me), are considered to be candidates for a new type of plant hormone showing
various physiological effects on plant growth and development [1-7]. Recently, there has
been a focus of attention on the interaction between ethylene and jasmonates because of
stimulating effect that jasmonates have on ethylene production. In the previous Ethylene
Symposium, Saniewski [8] reported that jasmonates affect the biosynthesis of ethylene
through stimulation of ACC synthase and ACC oxidase activities, resulting in a large
increase in ethylene production. In this review we look at the interaction of ethylene
with jasmonates in regulation of some physiological processes, and describe their
function as signal molecules.
173
174
3. Relationship between Methyl jasmonate and Ethylene in Fruit Ripening
Apples, similarly to tomatoes, are climacteric fruit. It is well known that young apple
fruit produce large amounts of ethylene [9] and that immature cv. Golden Delicious
apple fruit contain high levels of JA and JA-Me [10]. Methyl jasmonate stimulates
ethylene production, ACC content and ACC oxidase activity in pre climacteric apples
and inhibits these processes in climacteric and postclimacteric apples [8, 11].
Recently, Fan et al. [12] studied changes in endogenous jasmonates during early
development of apple fruit in relation to ethylene production and other physiological
events. The concentration of endogenous JA was 138 ng gO! fresh weight 24 days after
full bloom and decreased as the fruit developed until 136 days after bloom (2.6 ng gO! in
apple harvested 101 days after full bloom). The changes in JA were coincident with
changes in ethylene production, respiration and anthocyanin accumulation during early
developmental stages of apple fruit. They were also consistent with the reported
responses to exogenous jasmonates, suggesting jasmonic acid may be involved in
regulation of early fruit development [12].
To determine whether or not jasmonates playa role in the regulation of climacteric
fruit ripening, the endogenous concentrations of jasmonates were measured during the
onset of ripening of apple cv. Golden Delicious and tomato fruits cv. Cobra [13]. JA
and JA-Me concentrations increased transiently prior to the rapid increase in ethylene
biosynthesis in both apple and tomato fruits and decreased at later stages of fruit
ripening. In apple discs, JA-Me modulated ethylene synthesis depending on
developmental stage and concentration of applied JA-Me. Transient (12 hr) treatment of
preclimacteric apple discs with exogenous JA-Me at low concentrations (1-100 IlM)
promoted ethylene biosynthesis. Activities of both ACC synthase and ACC oxidase
were stimulated by JA-Me at this concentration range. These results suggest jasmonates
may playa role together with ethylene in regulating the early steps of climacteric fruit
ripening [13].
Response of color changes to JA-Me vapor treatment depended on the apple fruit
developmental stage, with the maximum effect occurring as fruit began to produce
ethylene [14]. It is possible that a combination of jasmonate and ethylene could be used
to promote commercially desirable color changes in apples [14].
JA-Me treatment caused a higher respiratory activity and ethylene production in
white strawberries, grown in vitro, while a decrease in CO2 and ethylene evolution was
observed in red ripe and dark-red overripe fruits [15].
4. The interaction of ethylene with jasmonates in response to wounding
The involvement of ethylene in wounding, including physical injury, herbivore or insect

attack and pathogen infection has been intensively reported [16-19]. There are several
reports which describe that ethylene production, ACC content, and activities of ACC
synthase and ACC oxidase are promoted by wounding [20-22]. Jasmonates are also
associated with the wound response and have been shown to strongly induce the
expression of wound- or defense-related genes in plants suffering from physical injury or
175
pathogen infection, resulting in the accumulation of proteinase inhibitors (PI) and other
pathogen-related proteins [17, 18,23, 24]. The interaction of ethylene with jasmonates
during the wound response has also been reported. Ethylene and jasmonates act
together to regulate PI gene expression during the wound response [17]. This effect
could be inhibited by inhibitors of JA and ethylene biosynthesis [17]. Combinations of
ethylene and jasmonates causes the synergistic induction of pathogenesis-related gene
expression including osmotin mRNA [25]. On the other hand, the functional
mechanisms of ethylene and jasmonates in wound response are not clear. Xu et al. [25]
suggested that the binding of ethylene to its receptor on the membrane might sensitize
jasmonate receptors on the membrane. It has also been suggested that ethylene partially
regulates the endogenous level of jasmonates based on a study using inhibitors of
biosynthesis of ethylene and JA [17]. It remains to be demonstrated whether ethylene
acts upstream, downstream or in concert with JA [26].
5. The Interaction of Ethylene with Jasmonates in Gum Induction
Gum is a secretion mainly consisting of polysaccharides exuded onto the surface of fruit
or tree trunks when plants suffer from several kinds of stresses including physical injury,
insect atack and pathogen infection. Exudate gums are complex, branched hetero-
polysaccharides comprising residues of galactose, arabinose and glucuronic acid with
other sugars also present in small or trace quantities [27]. Tulip gum consists of
glucuronoarabinoxylan (GlcN:Ara:Xyl = 1:2:3) in the presence of calcium and
potassium [28]. Gum formation in tulip bulbs or stone fruit trees is induced by ethylene
and the ethylene-releasing compound, ethephon [27,29]. It has been found that JA-Me
causes a strong induction of gum formation in the bulb, stem and the basal part of the
leaves of tulips [30]. Saniewski and W~grzynowicz-Lesiak [31] showed that JA-Me
stimulated ethylene evolution and ACC oxidase activity during gum induction in tulip
stems. The application of ACC caused an evolution of ethylene much higher than that
of JA-Me, but did not induce gum formation. Neither did the endogenous ethylene
induced by auxins, IAA and NAA, induce gummosis in the tulip stems [32]. It has
recently been shown that the application of ACC together with JA-Me greatly
accelerates gum formation in tulip stems in comparison with JA-Me treatment alone
[33]. These results suggest that while JA-Me it stimulates the production of ethylene in
tulip it induces gum formation in tulip stems independently of ethylene. The
relationship between ethylene and jasmonates in gum formation has been clearly shown
in relation to several varieties of stone fruit [34]. The role of ethylene in the process is
that it may promote jasmonate biosynthesis and/or stimulate the susceptibility of plant
tissues to endogenous jasmonates.
6. The Interaction of Ethylene with Jasmonates in Abscission
Abscission is usually evoked at the end of senescence of leaves, flowers and fruit with
the formation of an abscission zone at the base of the organ involved. The abscission
176
zone consists of a few layers of cells whose cell walls undergo intensive digestion
processes leading to loss of adhesion between cells [35]. In some plant tissues, ethylene
promotes senescence when it was exogenously applied, resulting in abscission. JA-Me
promotes senescence and abscission as well. Veda et al. [36, 37] showed that JA-Me
promotes the formation of an abscission zone in bean petiole explants without an
increase in ethylene production. Jasmonates had no effect on the content of non-
cellulosic polysaccharides in the pulvinus and the petiole sides of the abscission zone,
but reduced the total amount of cellulosic polysaccharides. The total activity of
cellulase were dramatically stimulated by JA-Me [36]. JA-Me greatly promoted leaf
abscission of Kalanchoe blossfeldiana at different growth stages commensurate with an
increase in CO 2 evolution and only a slight stimulation of ethylene production. This
suggests that that JA-Me-induced leaf abscission in this plant is not related to ethylene
[38]. In intact or cut shoots of peach, ethylene accelerated the onset of leaf abscission
compared with JA-Me. However, stimulation of leaf abscission in peach shoots was
observed by the application of ethylene together with JA-Me [M. Saniewski, J. Veda, K.
Miyamoto, unpublished results].
7. The Interaction of Ethylene with Jasmonates in Senescence
Senescence is one of the physiological processes programmed into cell death, and is
associated with an increase of ethylene production in some cases. Since JA-Me was first
isolated as a senescence-promoting substance in 1980 [39], jasmonates biosynthesized
via lipid peroxidation of membrane by lipoxygenase and other enzymes have been
considered to play an important role in senescence [40]. Several papers report that JA-
Me stimulates ACC synthase and ACC oxidase activities andlor ethylene production in
olive leaf discs [41] and in detached rice leaves [42], respectively. In contrast, JA-Me
did not affect the ethylene production, ACC oxidase activity and ACC content in intact
tulip leaves [43,44]. Similar observations were found in detached rice leaves [45], and
flag leaves and ears of wheat plants [46]. Judging from these observations, jasmonates
affect the biosynthetic pathway of ethylene resulting in the stimulation of ethylene
production andlor an increase in the sensitivity of plant tissues to ethylene [45, 47].
Although jasmonates elicite similar physiological effects to ethylene, the mechanisms by
whichjasmonates induce senescence might be different from those of ethylene [46].
8. Relationship between Jasmonates and Ethylene in Germination of Seeds
Jasmonates inhibit germination of non-dormant seeds (lettuce, sunflower, rape,

amaranth, flax, oat, wheat, cocklebur, stratified seeds of apple), but stimulate
germination of dormant seeds (Acer tataricum, A. platanoides, Malus domestica [48,
49]. The physiological role of jasmonates in seed germination remains unclear.
K~pczyftski and Bialecka [48] found that the inhibitory effect of JA-Me on Amaranthus
caudatus seed germination was partially or completely reversed (depending on the
concentration of JA-Me applied) by ethephon, ACC and gibberellins - GA3 and GA4+7
177
Nojavan-Asghari and Ishizawa [49] showed that the inhibition of germination of

cocklebur (Xanthium pennsylvanicum) seeds by JA-Me was nullified by exogenous
ethylene. JA-Me inhibited ethylene production before seed germination through both
the inhibition of ACC biosynthesis and the conversion of ACC to ethylene. The authors
suggested that the inhibition of ethylene production by JA-Me results in the retardation
of the germination of cocklebur seeds.
JASMONATES interact
.J.. .J..
increase stimulate ethylene biosynthesis
(increase ACC synthase and ACC
1-+
the sensitivity
to ethylene oxidase activities)
.J.. .J.. .J..
p H Y S I 0 L 0 G I C A L PHENOME N A
and/or
ETHYLENE interact
.J.. .J..
increase the sensitivity to
jasmonates
stimulate jasmonates
biosynthesis 1----+
.J.. .J.. .J.. .J..
P H Y S I 0 L 0 G I CAL P HENOM E N A
Figure 1. Possible mode of the interaction of ethylene withjasmonates in control of physiological processes
9. The Interaction of Ethylene with Jasmonates in Other Physiological Processes
In addition to the interactions between ethylene and jasmonates described above, other
relationships between ethylene and jasmonates have been also reported. JA-Me had
little or no effect on leakage from cells of sunflower seedlings. However, ethylene
synergistically promoted an effect in combination with JA-Me [50]. Dathe et al. [51]
showed an interesting interaction between ethylene and jasmonates in tiller production
of spring barley. The application of JA followed by a treatment with ethephon led to a
significant increase in tiller production. Neither jasmonates nor ethephon alone were
able to cause these effects. The authors suggested that jasmonates appears to increase
the sensitivity of plant tissues to ethylene by influencing the level of other plant
hormones.
10. Possible Mode of Action of the Interaction between Ethylene with Jasmonates
in Physiological Processes
It appears that jasmonates represent an integral part of the signal transduction chain
between stress signal(s) and stress response(s) and that ethylene interacts with
178
jasmonates in many physiological processes. Physiological processes affected by the

compounds may be regulated by a signal network in which individual signals mediated
by ethylene and jasmonates 'cross-talk' [13, 25, 52]. The most difficult problem to
solve is to understand the mechanisms by which ethylene interacts with jasmonates.
Considering the findings described in this review, we propose one possible schema (Fig.
I). Jasmonates may increase the endogenous levels of ethylene and/or might sensitize
ethylene receptors on the membrane. On the contrary, ethylene might also affect the
endogenous levels of jasmonates and/or the binding of ethylene to its receptor on the
membrane might sensitize jasmonates receptors on the membrane.
11. Acknowledgements
This work was partially supported by a Grant No PB 1811P06/95/08 from State

Committee for Scientific Research (Poland) to MS.
12. References
1. Creelman, RA and Mullet, J.E. (1997) Biosynthesis and action of jasmonates in plants, Annu
Rev. Plant Physiol. Plant Mol. Bioi. 48,355-381.
2. Creelman, RA and Mullet, J.E. (1997) Oligosaccharides, brassinolides, and jasmonates:
Nontraditiona regulators of plant growth, development, and gene expression, Plant Cell 9, 211-
1223.
3. Hamberg, M. and Gardner, H.G. (1992) Oxylipin pathway to jasmonates: biochemistry and
biological significance, Biochim. Biophys. Acta 1165, 1-18.
4. Koda, Y. (1992) The role of jasmonic acid and related compounds in the regulation of plant
development, Inter. Rev. Cytol. 135, 155-198.
5. Miyamoto, K., Oka, M., and Ueda, J. (1997) Update on the possible mode of action of the
jasmonates: Focus on the metabolism of cell wall polysaccharides in relation to growth and
development, Physiol. Plant. 100,631-638.
6. Sembdner, G. and Parthier, B. (1993) The biochemistry and the physiological and molecular
actions ofjasmonates, Annu. Rev. Plant Physiol. Plant Mol. BioI. 44, 569-589.
7. Stawick, P.E. (1992) Jasmonates, gene, and fragrant signals, Plant Physiol. 99, 804-807.
8. Saniewski, M. (1997) The role ofjasmonates in ethylene biosynthesis, in AK. Kanellis, C.Chang,
H. Kende and D. Grierson (eds.), Biology and Biotechnology of the Plant Hormone Ethylene,
Kluwer Academic Publishers, Dordrecht, pp. 39-45.
9. Walsh, C.S. and Solomos, T. (1987) Ethylene evolution by apple fruits during their early-season
growth and development, Sci. Hortic. 32, 203-211.
10. Meyer, A, Miersch, 0., B6tttner, C., Dathe, W. and Sembdner, G. (1984) Occurrence of the plant
growth regulator jasmonic acid in plants, J. Plant Growth Regul. 3, 1-8.
11. Fan, X., Mattheis, J.P., Fellman, J.K. and Patterson, M.E. (1997) Effect of methyl jasmonate on
ethylene and volatile production by Summerred apples depends on fruit developmental stage, J.
Agric. Food Chem. 45,208-211.
12. Fan, x., Mattheis, J.P., Fellman, J.K. and Patterson, M.E. (1997) Changt's in jasmonic acid
concentration during early development of apple fruit, Physiol. Plant. 101,328-332.
13. Fan, x., Mattheis, J.P. and Fellman, J.K. (1998) A role ofjasmonates in climacteric fruit ripening,
Planta 204,444-449.
14. Fan, x., Mattheis, J.P. and Fellman, J.K. (1998) Responses of apples to postharvest jasmonate
treatments, J. Amer. Soc. Hort. Sci. 123,421-425.
IS. Perez, AG., SanZo C., Olias, R and Olias, J.M. (1997) Effect of methyl jasmonate on in vitro
strawberry ripening, J. Agric. Food Chern. 45,3733-3737.
179
16. Kacperska, A (1997) Ethylene synthesis and a role in plant responses to different stressors, in
AK. Kanellis, C. Chang, H. Kende and D. Grieson (eds.), Biology and Biotechnology of the Plant
17. O'Donnell, PJ., Calvert, C., Atzom, R, Wastemack, C., Leyser, H.M.O. and Bowles, DJ. (1996)
Ethylene as a signal mediating the wound response to tomato plants, Science 274, 1914-1917.
18. Seo, S., Sano, H., and Ohashi, Y. (1997) Jasmonic acid in wound signal transduction pathways,
Physiol. Plant. 101,740-745.
20. Dunlap, J.R. and Robacker, K.M. (1994) Wound induced ethylene production from excised
muskmelon fruit tissue, J. Hort. Sci. 69, 189-195.
21. Hyodo, H., Hashimoto, C., Morozumi, S., Hu, W. and Tanaka, K. (1993) Characterization and
induction of the activity of l-aminocycIopropane-l-carboxylate oxidase in the wounded mesocarp
tissues ofCucurbita maxima, Plant Cell Physiol. 34, 667-671.
22. We<rzynowicz-Lesiak, E. and Saniewski, M. (1991) The effect of mechanical wounding of
different organs of Hippeastrum x hybr. hort. on ethylene-forming enzyme activity, Bull. Pol.
Acad. Sci., Bioi Sci. 39,373-377.
23. Koiwa, H., Bressan, R.A and Hasegawa, P.M. (1997) Regulation of protease inhibitors and plant
defense, Trends Plant Sci. 2,379-384.
24. Wastemack, C. and Parthier, B. (1997) Jasmonate-signalled plant gene expression, Trends Plant
Sci. 2,302-307.
25. Xu, Y., Chang, P.F.-L., Liu, D., Narasimhan, M.L., Raghothama, K.G., Hasegawa, P.M. and
Bressan, R.A (1994) Plant defense genes are synergistically induced by ethylene and methyl
jasmonate, Plant Cell 6, 1077-1095.
26. Penninckx, l.AM.A., Eggermont, K., Terras, F.RG., Thomma, B.P.H.J., De Samblanx, G.W.,
Buchala, A, Metraux, J.-P., Manners, J.M. and Broekaert, W.F. (1996) Pathogen-induced
systemic activation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent
pathway, Plant Cell 8, 2309-2323.
27. Boothby, D. (1983) Gummosis ofstone-fruit trees and their fruits, J. Sci. Food Agric. 34, 1-7.
28. Saniewski, M., Veda, J., Miyamoto, K. and Horbowicz, M. (1999) Gum induction by methyl
jasmonate in tulip stem: Relevance to its chemical composition, Acta Hortic. (in press).
29. Kamerbeek, G.A. and De Munk, WJ. (1976) A review of ethylene effects in bulbous plants,
Scientia Hortic. 4, 101-115.
30. Saniewski, M. and Puchalski, J. (1988) The induction of gum formation in the leaf, stem and bulb
by methyljasmonate in tulips, Bull. Pol. Acad. Sci., Bioi. Sci. 36,35-38.
31. Saniewski, M. and We<grzynowicz-Lesiak E. (1994) Is ethylene responsible for gum formation
induced by methyl jasmonate in tulip stem?, J. Fruit Ornamental Plant Research 2, 79-90.
32. Saniewski, M., Kawa, L., and We<grzynowicz, E. (1990) Influence of different concentrations of
auxins and silver thiosulphate on stem growth and ethylene production in tulips, Bull. Pol. Acad.
Sci., Bioi. Sci. 38, 51-56.
33. Saniewski, M., Miyamoto, K. and Veda, J. (1998) Gum formation by methyl jasmonate in tulips
shoots is stimulated by ethylene, J. Plant Growth Regul. (in press).
34. Saniewski, M., Miyamoto, K. and Veda, J. (1998) Methyl jasmonate induces gum and stimulates
anthocyanin accumulation in peach shoots, J. Plant Growth Regul. (in press).
35. Sexton, R and Roberts, J.A (1982) Cell biology of abscission, Annu. Rev. Plant Physiol. 33,
133-162.
36. Veda, J., Miyamoto, K. and Hashimoto, M. (1996) Jasmonates promote abscission in bean petiole
explants: Its relationship to the metabolism of cell wall polysaccharides and cellulase activity, J.
Plant Growth Regul. IS, 189-195.
37. Veda, J., Miyamoto, K., Momotani, Y., Kato, J. and Kamisaka, S. (1992) Promotive effect of
jasmonic acid on the abscission of bean petiole explants in relation to the metabolism of cell wall
polysaccharides, in Y. Masuda (ed.), Plant Cell Walls as Biopolymers with Physiological
Functions, Yamada Science Foundation, Osaka, pp. 307-312.
38. Saniewski, M. and We<grzynowicz-Lesiak, E. (1995) Methyl jasmonate-induced leaf abscission in
Kalanchoe blossfeldiana, Acta Hortic. 394,315-324.
180
39. Veda, J. and Kato, l (1980) Isolation and identification of a senescence-promoting substance
from wormwood (Artemisia absinthium L.), Plant Physiol. 66,246-249.
40. Baker, lE., Wang, C.Y. and Terlizzi, D.E. (1985) Delay senescence in carnations by pyrazon,
phenidone analogues, and tiron, HortScience 20, 121-122.
41. Sanz, L.C., Fernandez-Maculet, lC., Gomez, E., Vioque, B. and Olias, J.M. (1993) Effect of
methyl jasmonate on ethylene biosynthesis and stomatal closure in olive leaves, Phytochemistry
33, 285-289.
42. Chou, C.M. and Kao, C.R. (1992) Stimulation of I-aminocyclopropane-I-carboxylic acid
dependent ethylene production in detached rice leaves by methyl jasmonate, Plant Sci. 83, 137-
141.
43. Puchalski, l, Klim, P., Saniewski, M. and Nowacki, l (1989) Studies of some physiological
processes during tulip leaf senescence induced by methyljasmonate, Acta Hortic. 251, 107-114.
44. Puchalski, l, Saniewski, M. and Klim, P. (1985) The effect of methyl jasmonate on tulip leaf
senescence and peroxidase patterns, Acta Hortic. 167,247-257.
45. Tsai, F.-Y., Hung, K.T. and Kao, C.R. (1996) An increase in ethylene sensistivity is associated
withjasmonate-promoted senescence of detached rice leaves, J. Plant Growth Regul. 15,197-200.
46. Beltrano, J., Ronco, M.G., Montaldi, E.R. and Carbone, A. (1998) Senescence of flag leaves and
ears of wheat hastened by methyljasmonate, J. Plant Growth Regul. 17,53-57.
47. Hung, K.T. and Kao, C.H. (1996) Promotive effect of jasmonates on the senescence of detached
maize leaves, Plant Growth Regul. 19,77-83.
48. K,<pczyllski, J. and Bialecka, B. (1994) Stimulatory effect of ethephon, ACC, gibberellin A3 and
~+7 on germination ofmethyljasmonate inhibited Amaranthus caudatus L. seeds, Plant Growth
Regul. 14,211- 216.
49. Nojavan-Asghari, M. and Ishizawa, K. (1998) Inhibitory effect of methyl jasmonate on the
germination and ethylene production in cocklebur seeds, J. Plant Growth Regul. 17, 13-18.
50. Emery, R.lN. and Reid, D.M. (1996) Methyl jasmonate effects on ethylene synthesis and organ-
specific senescence in Helianthus annuus seedlings, Plant Growth Regul. 18, 213-222.
51. Dathe, W. (1992) Effects of jasmonic acid and ethephon on tillering to maturity in spring barley,
Ann Bot. 69, 237-222.
52. Mirjalili, N. and Linden, J.C. (1996) Methyl jasmonate induced production of taxol in suspension
cultures of Taxus cuspidata: Ethylene interaction and induction models, Biotechnol. Prog. 12,
110-118.
ISOLATION OF DEVELOPMENTALLY-REGULATED GENES IN
IMMATURE TOMATO FRUIT: TOWARDS AN UNDERSTANDING OF PRE-
RIPENING DEVELOPMENT
B. JONES, H. ZEGZOUTI, P. FRASSE, AND M. BOUZAYEN

ENSAT-INRA Toulouse, Avenue de l'Agrobiopole BP 107, 31326
Castanet Tolosan Cedex, France
1. Introduction
While the means by which ethylene triggers and co-ordinates climacteric fruit ripening
are becoming clearer, the developmental cues required to signal a readiness to ripen
remain unknown. In climacteric fruit such as the tomato, ethylene production remains at
a basal level and is auto inhibitory throughout early development. Then, at the onset of
ripening, fruit gain the capacity to both respond to and to synthesise dramatically
increased levels of the hormone. This, in tum, results in the changes in gene expression,
which drive the ripening process [1]. Developmental regulation of a competence to
ripen is thought to involve the disappearance, or reduction below a certain threshold, of
ripening inhibitors or conversely the appearance of essential components of the ripening
process. In order to investigate the attainment of a competence to ripen, we have used a
combination of degenerate, gene family-specific primers and mRNA Differential
Display [2, 3] to isolate genes which show either up- or down-regulation prior to the
onset of ripening.
2. Results
2.1. DR CLONES
A number of developmentally-regulated (DR) clones have been isolated including those

with homology to: a H+ transporting ATPase; seed storage proteins; Ca2+/Calmodulin-
dependent, SNF 1 and SIT protein kinases; AP2/EREBP domain containing proteins; and
members of the ARF and AUX/IAA gene families.
2.2. DRI2: A MEMBER OF THE ARF GENE FAMILY
DRI2, the first gene to be further characterised, shows an increased accumulation of its
mRNA at the immature green (\G) stage, a dramatic decline between the IG and mature
green (MG) stages and thereafter an increase in mRNA abundance throughout ripening.
The changes in DR12 mRNA accumulation occur before the onset of increased
181
182
endogenous ethylene production, indicating that DRl2 is developmentally regulated.

DR12 is a tomato homolog of members of the ARF (auxin response factor) protein
family. Members include, ARFI and ARF3 (ETT) [4]. Evidence from mutations in
ARFs indicates that they play key roles in organogenesis and organ patterning. ARF 1
binds to a cis-acting element, TGTCTC, found in the promoters of early auxin-
responsive SAUR, AUXlIAA and auxin-responsive ACC synthase genes [5, 6, 7].
Interestingly, in addition to the developmental regulation, DRl2 was shown to be up-
regulated by auxin and strongly down-regulated by exogenous ethylene (5h, 20ppm).
2.3. ETHYLENE REGULAnON OF AUXIIAA GENE FAMILY MEMBERS
AUXIlAA genes are putative transcription factors and have been shown to form homo-
and heterodimers and to interact with ARFs [5, 8, 9]. In an attempt to understand the
significance of the effect of ethylene on DR12, A UXlIAA homo logs were isolated from
tomato and their expression patterns studied. Tomato AUXlIAA homo logs (DRI-DRll)
show complex patterns of developmental, auxin and ethylene-regulated expression. One
of the most interesting results was that ofDR3 which, in contrast to DR12, was strongly
up-regulated by ethylene.
3. Conclusions
Auxin and ethylene have been shown to interact at several levels [7]. Ethylene
regulation ofDR3 and DRl2 is further evidence of an interaction and another indication
of the complexity of cellular responses to hormone signalling. We are currently using
several techinques including A. tumifaciens-mediated transformation to determine the
significance for tomato fruit development of the developmental and ethylene regulation.
4. References
1. Lelievre, J.M., Latche, A, Jones, B., Bouzayen, M., and Pech, lC. (1997) Ethylene and fruit
ripening. Physiol. Plant. 101,727-739.
2. Liang, P. and Pardee, AB. (1992) Differential display of eukaryotic messenger RNA by means of
the polymerase chain reaction, Science 257, 967-971
3. Zegzouti, H., Marty, C., Jones, B., Bouquin, T., Latche, A, Pech, J.C. and Bouzayen, M. (1997)
Improved screening of cDNAs generated by mRNA differential dispaly enables the selection of true
positives and the isolation of weakly expressed messages, Plant Mol. Bioi. Rep.15, 236-245.
4. Ulmasov, T., Hagen, G. and Guilfoyle, TJ. (1997) ARFl, a transcription factor that binds to auxin
response elements, Science 276, 1865-1868
5. Oeller, P.W., Keller, J.A., Parks, J.E., Silbert, J.E. and Theologis, A (\ 993) Structural
characterization of the early indoleacetic acid-inducible genes, PS-IAA4/5 and PS-IAA6, of pea (P.
sativum 1.), Mol. BioI. 233, 789-998
6. Abel, S., Nguyen, M.D., Chow, W. and Theologis, A (\995) ACS4, a primary indoleacetic acid-
responsive gene encoding l-aminocyc1opropane-I-carboxylate synthase in Arabidopsis thaliana.
Structural characterization, expression in Escherichia coli, and expression characteristics in response
to auxin, J. Bioi. Chem. 270, 19093-19099
7. Sessions, A, Nemhauser, J.1., McColl, A, Roe, J.1., Feldmann, K.A and Zambryski, P.C. (1997)
ETTIN patterns the Arabidopsis floral meristem and reproductive organs, Development 124,4481-
4491
8. Ulmasov, T., Murfett, J., Hagen, G., Guilfoyle, TJ. (1997) AuxllAA proteins repress expression of
reporter genes containing natural and highly active synthetic auxin response elements, Plant Cell 9,
1963-1971
9. Kim, J., Harter, K. and Theologis, A (\997) Protein-protein interactions among the AuxilAA
proteins, Proc. Natl. Acad. Sci. USA 94,1l786-11791
INTERACTION BETWEEN ETHYLENE AND ABSCISIC ACID IN THE
REGULATION OF CITRUS FRUIT MATURATION
F. ALFEREZ AND L. ZACARlAS

/nstituto de Agroquimica y Tecnologia de Alimentos (CS/C), Apartado de
Correos 73, 46100 Burjassot, Valencia, Spain
Fruit ripening is a complex process involving a number of physiological and

biochemical changes which are thought to be under hormonal and environmental
control. Although the ripening of Citrus fruits is not associated with a transient increase
in the biosynthesis of ethylene, recent physiological and molecular evidence has
indicated that this plant hormone may be involved in the control of fruit maturation [I,
2]. Alonso et al [2] isolated a number of ethylene-induced cDNAs in the peel of Navel
oranges and showed that some of the mRNAs corresponding to these cDNAs were up
regulated during fruit maturation and suggested that ethylene is implicated in the
regulation of some aspects of Citrus fruit maturation. Since ethylene production remains
very low during the process, changes in the sensitivity of the tissue to the basal ethylene
levels may operate. Furthermore, Abscisic Acid (ABA) has also been shown to be
involved in the maturation of Citrus fruits but its role is far from understood.
Goldschmidt et al. [3] demonstrated an increase in ABA during natural and ethylene-
induced senescence of Citrus flavedo. Richardson & Cowan [4], comparing changes in
ABA in different Citrus varieties, indicated that full colour was achieved when ABA in
the skin started to decline. We have recently described the characterization of a
spontaneous bud mutation of Navelate orange, named 'Pinalate,' which is affected in
colour development and is ABA-deficient [5]. This mutant provides an interesting
experimental system to study the involvement of ABA in the hormonal mechanisms
governing fruit growth and maturation. In this work we report a comparative analysis of
the maturation process in 'Navelate' oranges (Citrus sinensis L., referred to as wild type,
WT) and 'Pinalate'. The role of ethylene and its potential interaction with ABA in the
regulation of Citrus fruit coloration are discussed.
'Pinalate' mature fruit develops a yellow skin colour. HLPC analysis of the
carotenoid and xanthopyll contents indicated that flavedo tissue (colour part of the skin)
of the mutant accumulated a higher amount of the initial carotenoids. The concentration
of xanthophylls was about 6-times lower than in WT fruits, indicating that the mutation
may have affected in ~-carotene desaturase activity [5]. ABA content in the flavedo
tissue was also substantially reduced [5]. In both genotypes, the initial signal of
degreening took place at the same time, but in 'Pinalate' progressed at a much lower
rate. During transformation from chloroplast to chromoplast the ABA content increased
4-5 times in the WT flavedo but remained very low in the mutant, less than 20% of wild
type. The rate of degreening was also delayed in detached mature-green fruits from the
ABA-deficient mutant, even though ethylene production was higher. The endogenous
ABA content in the flavedo increased approximately two-fold in detached WT fruits but
declined steadily in the mutant. Application of ABA (0,5 mM) to the mutant accelerated
183
184
the rate of fruit degreening, indicating that the mutation did not affect the sensitivity to
ABA. This treatment did not affect WT fruits, suggesting that the endogenous ABA
status at this developmental stage may be sufficient to induce the response. Application
of the ethylene action inhibitor 2,5-norbomadiene (NBD) strongly reduced the rate of
fruit coloration in WT and suppressed by about 50% the increase in ABA respective to
air-treated fruits. In the mutant, however, no effect was observed during the first days of
treatment but thereafter slightly reduced the rate of chlorophyll loss, suggesting that one
of the initial ethylene actions may be in inducing ABA content during the onset of
coloration. In both genotypes, exogenous ethylene (l01l1 r1) counteracted the effect of
NBD on degreening and on ABA content. Prolonged NBD treatment (7-15 days) did
not inhibit the process, since fruit from both genotypes degreened at a lower rate. These
results suggest that factors other than ethylene are also involved in the process.,
probably the low ABA levels in the skin of the fruits (by chemical inhibition in WT or
by genetic lesion in the mutant) may be still sufficient for the process to proceed.
Application of ethylene (10111 r1) accelerated fruit degreening in mature-green fruits of
both genotypes although at lower rate in the mutant, indicating that at least part of the
ethylene action, or at latter stages, may be independent of ABA.
The overall results clearly indicate that a complex hormonal relationship operates
during coloration of Citrus fruits. Ethylene plays a role in inducing chlorophyll
breakdown and also increasing the ABA content in the skin. The observation that the
ethylene-induced effects were similar in the flavedo of the ABA-deficient mutant
indicates that ethylene regulates the process by a direct mechanism and independently of
ABA. It can be suggested that both ethylene and ABA may activate different pathways
in the metabolic sequence leading to fruit coloration. ABA deficiency did not modifY
the initiation of chlorophyll loss but it proceeded to a lower rate. In the ethylene
insensitive mutant ertI-I of Arabidopsis, leaf senescence was delayed but once initiated
it progressed as in the wild type plant, suggesting that ethylene regulates the timing of
leaf senescence [6]. Our results suggest that a similar mechanism may be acting in the
degreening of Citrus fruits, in which ethylene would regulate the initiation and ABA the
rate of the process.
References
1. Goldschmidt, E.E., Huberman, and Goren, R. (1993) Probing the role of endogenous ethylene in the
degreening of citrus fruit with ethylene antagonists, Plant Growth Regul. 12, 325-329.
2. Alonso, J.M., Chamarro, J. and Granell, A. (1995) Evidence for the involvement of ethylene in the
expresion of specific RNAs during maturation of the orange, a non-climacteric fruit, Plant Malec.
Bioi. 29,385-390.
3. Goldschmidt, E.E., Goren, R., Even-Chen, Z. and Bittner, S. (1973) Increase in free and bound
abscisic acid during natural and ethylene induced senescence of Citrus fruit peel, Plant Physiol. 51,
879-882.
4. Richardson, G.R. & Cowan, A.K. (1995) Abscisic acid content of Citrus flavedo in relation to colour
development,J. Hart. Sei.70, 769-773.
5. Zacarias, L., Alferez, F., Mallent, D. and Lafuente, M.T. (1997) Understanding the role of plant
hormone during development and maturation of citrus fruits through the use of mutants, Acta Hortie.
463,89-95.
6. Grbic, L., and Bleecker, A.B. (1995) Ethylene regulates the timing of senescence in Arabidopsis,
Plant J. 8, 595-602.
INTERACTIONS BETWEEN ABSCISIC ACID AND ETHYLENE IN ETHYLENE-
FORMING CAPACITY OF PRECLIMACTERIC APPLE FRUITS
l. LARA 1 AND M. VENDRELL 1.2

IUdL-IRTA, Alcalde Rovira Roure 177,25198 Lieida, Spain, 2ClD-CSIC,
Jordi Girona 18-26, 08034 Barcelona, Spain
1. Introduction
Ethylene plays a key role in ripening of apple fruit. Elucidation of the factors controlling
climacteric ethylene biosynthesis is therefore of interest for achieving a global
knowledge of the processes leading to fruit maturation and ripening.
Interaction with other plant hormones, and speciaIly with abscisic acid (ABA), seems
to be of importance in this regard. It has been reported previously that ABA treatment
enhances ethylene production in apples [4], as well as in other plant tissues [3], although
the mechanism of this enhancement is not well established. Recent work (Lara and
VendreIl, submitted) shows a strong correlation between endogenous ABA and ACC
contents during the preclimacteric period in Granny Smith apple fruits, and sensitivity of
fruit tissues to growth regulators also appears to be a factor controlling climacteric
ethylene biosynthesis and ripening process.
Although ACC synthase (ACS) is recognised to be a major regulatory step in
ethylene biosynthesis, this regulation seems to depend as much on ACS activity as on
the tissue capacity to convert ACC to ethylene. In the present work, the effects of ABA-
and ethylene-treatments on the development of ethylene-forming capacity (EFC) in pulp
and peel tissues of preclimacteric immature as compared to preclimacteric mature apple
fruits are reported. Evidence is provided that ABA treatment results in a specific
increase in ACO protein.
2. Material and Methods
Preclimacteric Granny Smith apple fruits were collected either two months before
commercial harvest (R2) or at commercial harvest (Ho). Immediately after harvest, fruits
were either injected with I mM ABA or exposed for 48 h to 250 Ill. rl ethylene, and
thereafter kept at 20C during three weeks. Ethylene production, EFC and ACC content
were measured periodically in both pulp and peel tissues of four fruits. Total soluble
proteins of samples were blotted onto PVDF. Antibodies raised against apple ACC
oxidase were used to monitor the accumulation of ACO protein in our samples.
ACO protein was not detectable at harvest either in pulp or in peel. However, a
remarkable induction of ACO protein accumulation was found in both pulp and peel of
R2 ABA-treated fruit (Fig. 3), which was not detected either in untreated or in ethylene-
185
186
treated fruit. This pattern was parallel to that observed in EFC (Fig. 2) and in ethylene
production (Fig. 1), as well as in ACC content of pulp (Fig. 4A), proving an accordingly
significant ACS activity. Pulp and peel tissues of Ho fruit were both ABA- and
ethylene-responsive, although response was somewhat more intense in ABA-treated
fruit. Higher ethylene production rates in ethylene-treated as compared to untreated fruit
(Fig. 1) in spite of similar EFC and ACC contents (Fig. 2 and 4) suggest that ACS
activity was also enhanced by ethylene treatment.
A A A
u......
+lmMABA
2]- ~
H.
, +3S0 ...... e~
TbJa,~lIIIerh&rwtJ
1--1..lI*e..... _ABA "'EIIMeDe I
B B B
o 7 14 l..
Dll)'safleJ'harvest
[2J
Days IllIoor '-"-t
o :n
.-
7 14
Ho
'''"'.-==,-":"---:-:-----:o------c'
... _ /
TImstDaysllllerharvesO
I--Untreated "ABA _EtbyIen! I
Figure I. Ethylene Figure 2. EFC in pulp Figure 3. Immunoblot of Figure 4. ACC content
production in H_2 and Ho (A) and peel (B) of H.2 ACO protein in pulp (A) in pulp (A) and peel (B)
Granny Smith apples. and Ho Granny Smith and peel (B) of H-2 and of H-2 and Ho Granny
apples. Ho Granny Smith apples. Smith apples.
4. Acknowledgements
The authors are grateful to Dr. Dilley from Michigan State University (USA) and to Dr.
A. Latche from ENSAT (France) for the generous gift of apple ACO antibody. I. Lara is
a recipient of a grant from INIA and of a TMR-Euroconference Programme (TMR-
ERBFMMACT95-0032) fellowship. This work was supported by project INIA-9672.
5. References
1. Dominguez, M. and Vendrell, M. (1994) Effect of ethylene treatment on ethylene production, EFE
activity and ACC levels in peel and pulp of banana fruit, Postharvest Bio!. Technol. 4, 167-177.
2. McMurchie, E.J., McGlasson ,W.B. and Eaks, I.L. (1972) Treatment of fruit with propylene gives
information about the biogenesis of ethylene, Nature 237, 235-236.
3. Riov, J., Dagan, E., Goren, R. and Yang, S.F. (1990) Characterization of abscisic acid-induced
ethylene production in citrus leaf and tomato fruit tissues, Plant Physiol. 92,48-53.
4. Vendrell, M. and Buesa, C. (1989) Relationship between abscisic acid content and ripening of
apples, Acta Hart. 258, 389-396.
SOIL COMPACTION: IS THERE AN ABA-ETHYLENE RELATIONSHIP
REGULATING LEAF EXPANSION IN TOMATO?
A. HUSSAIN, J.A. ROBERTS, C.R. BLACK AND LB. TAYLOR

Division of Plant Science, School of Biological Science, University of
Nottingham, Sutton Bonington Campus
Compacted soils exhibit increased bulk density and shear strength, resulting in impeded
root growth and a reduced ability to absorb water and nutrients. Our research has
provided good evidence that root-sourced chemical signals co-ordinate plant responses
to soil compaction, and that abscisic acid (ABA) is an important component of this
signalling system. However, although an inverse relationship between xylem sap ABA
concentration and stomatal conductance was demonstrated, root-sourced ABA was not
responsible for the observed inhibition of leaf expansion in barley plants under
compacted soil conditions [2]. Indeed, the increased xylem sap ABA concentration
exhibited by wild type plants were shown to maintain leaf expansion as compared to an
isogenic ABA deficient mutant genotype during "sub-critical" compaction stress.
Subsequent studies using a split-pot approach have shown that the observed reduction in
leaf expansion in compacted soil is mediated by a root-sourced signal, which was
unlikely to be ABA. A possible candidate as the second root-sourced signal is ethylene,
as its production is increased under compacted conditions [3] and it can be transported
from stressed roots to the shoots as its precursor, ACC [I]; this hypothesis is currently
under investigation.
We have developed a novel split-pot approach so as plants develop, their roots
become divided between uncompacted (1.1 g cm3 ) and compacted soil (1.5 g cm 3 ).
This method has enabled tomato to be examined despite its susceptibility to impeded
rooting conditions. This species offers the key advantage that genotypes are available
with limited capabilities for producing ABA and ethylene. Wild type (Ailsa Craig),
ABA deficient mutant (notabilis) and a genetically modified genotype with an impaired
ability to synthesise ethylene (ACO I AS; [1]) were supplied with ethephon (+eth; 400 l.tI r
I), to establish the role of elevated ethylene production, whilst the physiological action
of ethylene was inhibited by applying silver thiosulphate (+STS; I mM).
Differing growth responses were induced, with leaf expansion being greatest in
control plants ACO I AS and least in notabilis (Fig. 1). Ailsa Craig demonstrated an
intermediate rate of leaf expansion, suggesting a positive role for higher xylem sap ABA
concentrations found in this genotype and ACOI As (Fig. 4) as was also the case for
barley [2]. Stomatal conductance and xylem sap ABA concentration were inversely
correlated (Figs 3 and 4).
187
188
Figure 1: Leaf area (cm2)

300 300,,--:::-::-,--------, 300,------,
25 Ailsa Craig 250 AC01"" 250 notabilis
200 200
15 150 150
10 100 100
Control
c'.
D +STS
~o
Qc/,IOOlllo &! IlJ +eth
14m
12 sa e lf31g
fU 14
12 AS -
14
12
a I m30;
10 10 10
8 8 8
6 6 6
4 4 4
2 2 2
o 0 0 --Control
10 20 30 10 20 30 10 20 30
...... +STS
500
Figure 3: Stomatal conductance (mmol m-2 S-l)
Ailsa Craig 500.-:-==-::------,
400 ACOIAS
500
--- +eth
400 ~
400
-' -
300 ~
200
100 100
notabilis
101214 16 182022 24 26 28 30 ~o 1214 1618 202224 262830 010 1214 16 18 20 22 24 26 28 30
Figure 4: Xylem sap ABA concentration (J-lInol m-3)

250 250,..--------,
~-~ :: ~
250 notabilis
200
150
100
ACOhs 50
10 20 30 111 20 30 10 20 30
Day after emergence Day after emergence Day after emergence
Treatment with ethephon greatly reduced leaf expansion in both wild type and ACOI As
plants and increased ethylene evolution from the leaves (Fig. 2). Partial phenotypic
reversion was achieved in notabilis by blocking the action of ethylene with STS,
indicating an inhibitory role for ethylene in mediating leaf growth. The impact of
increased ethylene production on leaf expansion is therefore apparently opposed by the
antagonistic effect of root-sourced ABA, which helps to maintain shoot growth.
References
1. English, P.J., Lycett, G.W., Roberts, J.A. and Jackson, M.B. (1995) Increased I-aminocyclopropane-I-
carboxylic acid oxidase activity in shoots of flooded tomato plants raises ethylene production to
physiological active levels, Plant Physiol. 109, 1435-1440.
2. Mulholland, B.J., Black, C.R., Taylor, LB., Roberts, J.A. and Lenton, J.R. (1996) Effect of soil
compaction on barley (Hordeum vulgare 1.) growth I, Possible role for ABA as a root-sourced
chemical signal, J. Exp. Bot. 47, 551-556.
3. Sarquis, LN., Jordan, W.R. and Morgan P.W. (1991) Ethylene evolution from maize (Zea mays 1.)
seedling roots and shoots in response to mechanical impedance, Plant Physiol. 96, 1171-1177.
USE OF I-METHYLCYCLOPROPENE TO MODULATE BANANA RIPENING
D.C. JOYCE', AJ. MACNISH', PJ. HOFMAN 2 , D.H. SIMONS' AND

M.S. REID3
IThe University of Queensland, Gatton College, QLD 4345, Australia;
2Queensland Horticulture Institute, 19 Hercules Street, Hamilton, QLD
4007, Australia; 3University of California, Davis, CA 95616, U.S.A.
1. Introduction
Premature and rapid ripening are two ethylene-related postharvest problems of banana
fruit. Ethylene binding inhibitors such as diazocyclopentadiene (DACP) delay fruit
ripening, even when applied at late stages [2]. However, constraints prohibit
commercial use of DACP [2]. I-Methylcyclopropene (l-MCP), an alternative and
irreversible ethylene binding inhibitor, prevents fruit ripening [1]. This study
investigated effects of I-MCP applied before or after ethylene gasing.
Mature bananas (Musa sp. cv. 'Williams') were treated with: (i) 0, 3.75, 7.5 or 15 ilL 1-
MCP/L (12 h, 20C), or (ii) 15 ilL I-MCP/L for 0, 3, 6, 9 or 12 h (20C). Half of the
untreated and I-MCP treated fruit from each experiment were then exposed to 100 ilL
ethylene/L (12 h, 20C). Additionally, fruit were treated with 10 mL propylene/L (24 h,
20C) followed by treatment of subsamples with 15 flL I-MCP/L (12 h, 20C)
immediately or at 12 h intervals over 108 h after propylene. Control fruit were untreated,
I-MCP or propylene treated. Fruit were ripened in a completely randomised design at
20C and 70-90% RH, and scored daily for skin colour (l =green - 8=brown) and hand
firmness (1 =hard - 5=over soft). Shelf life (SL) and eating-ripe life (EL) were time
(days) to reach or maintain eating ripe condition (firmness=4 with colour <8),
respectively. Ethylene production was measured for single fruit sealed injars.
3. Results
Treatment with 3.75 flL I-MCP/L extended SL of+ and - ethylene-treated fruit by 4.2-
and l.7-fold, respectively (Fig. IA). Fifteen flL I-MCP/L for 3 h extended SL by 4.6-
fold, versus ethylene only fruit (Fig. 18). Exposure to 15 ilL I-MCP/L immediately, 12,
24, 36,48 or 60 h after propylene treatment extended SL by factors of 4.5, 3.6,3.1, 2.3,
1.3, and 1.2-fold, respectively (Fig. 2). EL of fruit treated with I-MCP 48 h after
propylene treatment (12 h after peak ethylene production) was extended by 4.4-fold.
189
190
40
(AJ
-en
>-
30
III
:E!.
-
20
~
I ii
.<::
en 10
OLL__ ~ ____ ~ ______ ~-L~ __-L__ ~ __ ~ ____ ~
0.00 3.75 7.50 15.00 0 3 6 9 12

Concentration (Ill 1-MCP/l) Exposure time (h)
Figure 1. Shelf life (days) of bananas treated with I-MCP at different
concentrations (A) or exposure times (B), with (e) and without (_)
subsequent exposure to ethylene. Vertical bars represent s.e.m. (n=IO [A],
n=7 [BD.
40 2.0
c:
-en 30 1.5 0
ti:::JC
iU'
eo
~ U.c:
Z. 20
.s; 1.0 c. .><
Ol Ol::J
Cl e :i.
Ol-
e >,
=
0
...J 10 0.5
w
0 0.0
0 12 24 36 48 60 72 84 96 108
Timing of 1-MCP treatment
(hr after propylene gasing)
Figure 2. Longevity (days) as shelf life (e) or eating-ripe life (.) and
ethylene production (bars) of bananas treated with propylene followed by 1-
MCP immediately or at 12 h intervals over 108 h. Vertical lines represent
s.e.m. (n=3). SL and EL for I-MCP controls = 39.0 0.6 and 2.7 0.3 and
propylene = 7.0 0.0 and 4.0 0.6.
4. Conclusion
1-MCP delayed or slowed ripening of prec1imacteric and climacteric bananas,

respectively. 1-MCP treated prec1imacteric fruit eventually ripen, possibly due to
synthesis of new ethylene receptors. I-MCP treatment became less effective as ripening
progressed, especially after peak ethylene production. Nevertheless, I-MCP treatment
extended the EL of fruit when applied at later ripening stages, which may be a
commercial advantage. Thus, I-MCP promises improved control of banana fruit
ripening when applied before (prec1imacteric) or after (climacteric) ethylene gasing.
5. References
1. Serek, M., Sisler, E.C. and Reid, M.S. (1995) I-Methylcyclopropene, a novel gaseous inhibitor of
ethylene action, improves the life of fruits, cut flowers and potted plants, Acta Hart. 394,337-45.
2. Sisler, E.C. and Lallu, N. (1994) Effect of diazocyclopentadiene (DACP) on tomato fruits
harvested at different ripening stages, Post. Bioi. and Techn. 4, 245-54
ENDO-P-MANNANASE ACTIVITY DURING LETTUCE SEED
GERMINATION AT HIGH TEMPERATURE IN RESPONSE TO ETHYLENE
W.M. NASCIMENTO, DJ. CANTLIFFE AND DJ. HUBER

Department of Horticultural Sciences, IFAS, University of Florida,
Gainesville, FL 3261 1-0690, USA
1. Abstract
The role of endo-p-mannanase (EBM) during lettuce seed germination at 35C and the
influence Ie of ethylene in EBM regulation were investigated. Seeds of 'Dark Green
Boston' (DOB) and 'Everglades' (EVE) were germinated in water, 1-
aminocyclopropane-I-carboxylic acid (ACC), or aminoethoxyvinylglycine (A VG).
Seeds were also primed in polyethylene glycol (PEG), or PEG + ACC, PEG + AVG.
Untreated seeds germinated 100% at 20C. At 35C, EVE germinated 100%, whereas
DGB germinated only 4%. Seed priming or adding ACC during incubation increased
germination at 35C. AVG inhibited seed germination ofDGB at 35C. Higher enzyme
activity was observed in EVE compared with DOB seeds. Providing ACC either during
priming or during germination increased EBM activity, whereas AVG decreased
activity. Higher ethylene production was detected in EVE than DOB during
germination at 35C. The results suggest that ethylene overcomes the inhibitory effect
of high temperature in thermosensitive lettuce seeds by weakening of endosperm due to
increased EBM activity.
2. Introduction
The lettuce seed embryo is enclosed within a 2-4 cell layer endosperm that is comprised
mainly of galactomannan polysaccharides. The endosperm delays or prevents
germination, acting as a physical barrier to radicle protrusion, especially under high
temperature conditions. Weakening of the endosperm layer of lettuce seeds is a pre-
requisite to radicle protrusion at high temperatures [5]. Cell wall-associated endo-p-
mannanase was expressed in lettuce seed endosperm prior to radicle protrusion [2].
Exogenous ethylene overcomes the inhibitory effect of high temperature on lettuce seed
germination [I]; however, the role of ethylene is still unknown. We investigated the
influence of ethylene or ACC on endo-p-mannanase activity during germination of
lettuce seed at high temperature.
Seeds from thermosensitive cv. Dark Green Boston (DOB) and thermotolerant cv.
Everglades (EVE), [5] were primed for three days at 15C under constant light in an
aerated solution of polyethylene glycol (PEG), PEG + 10 mM of I-aminocyclopropane-
191
192
I-carboxylic acid (ACC), or PEG + 10 mM of aminoethoxyvinylglycine (A VG). Seeds

were germinated at 20 and 35C under constant light. Nonprimed seeds were also
germinated in water, ACC, or A VG. Endo-~-mannanase activity was assayed by gel-
diffusion [4]. Ethylene was measured using a gas chromatograph equipped with an
alumina column and a flame ionization detector.
Higher endo-~-mannanase (EBM) activity and ethylene production were observed for
seeds germinated at 20 (data not shown) than at 35C. High temperature might reduce
protein synthesis directly or inhibit factors involved in EBM production by the
endosperm. Higher EBM activity was observed in seeds from a thermotolerant
genotype and on seeds primed with ACC (Table I). Greater ethylene production and
seed germination at 35C were also observed under these conditions (Table 1). Sung et
al. [5] reported that thermotolerant or primed seeds required less force to penetrate the
lettuce endosperm than did thermosensitive genotypes or nonprimed seeds. Adding
ACC during seed germination also increased enzyme activity and seed germination at
35C (Table 1). EBM is involved in endosperm cell wall hydrolysis in other species,
causing endosperm weakening [3]. Ethylene exposure led to weakening of lettuce
endosperm tissue; however, this action was not correlated with its effect on germination
[1]. Even so, our results suggest that EBM might be regulated by ACC or ethylene, and
that increased EBM activity before radicle protrusion might contribute to lettuce
endosperm weakening, especially at high temperatures.
Table I. Lettuce seed germination, endo-13-mannanase activity and ethylene production of 'Dark Green
Boston' {DGBl and 'Everglades' {EVE) at 35C.
Germination Mannanase activity Ethylene production
Treatment (%) (pmol min,i) (pi (gseedsr i h i )
DGB EVE DGB EVE DGB EVE
Nonprimed (NP) + H 2O 4 100 00 1.1 0.0 342
NP+ACC 92 100 1.0 1.7 1705 3356
NP+AVG 56 100 0.0 0.0 0.0 0.0
PEG 96 99 1.3 81.1 534 629
PEG+ACC 100 100 2.1 100.3 713 3233
PEG+AVG 93 93 1.1 4.8 0.0 0.0
Enzyme activity and ethylene production were assayed from seeds I h before radicle protrusion
5. References
I. Abeles, F.B. (1986) Role of ethylene in Lactuca sativa cv 'Grand Rapids' seed germination, Plant
Physiol. 81, 780-788.
2. Dutta, S., Bradford, KJ. and Nevins, DJ. (1997) Endo-13-mannanase present in cell wall extracts
oflettuce endosperm prior to radicle emergence, Plant Physio/. 133, 155-161.
3. Groot, S.P.c. and Karseen, C.M. (1987) Gibberellins regulate seed germination in tomato by
endosperm weakening: A study with gibberellin-deficient mutants, Planla 171, 525-531.
4. Still, D.W., Dahal, P. and Bradford, KJ. (1997) A single-seed assay for endo-13-mannanase
activity from tomato endosperm and radicle tissues, Plant Physiol. 113, 13-20.S.
5. Sung, Y., Cantliffe, DJ. and Nagata, R. (1998) Using a puncture test to identify the role of seed
coverings on thermotolerant lettuce seed germination, J. Amer. Soc. Hort Sci. (in press).
ETHYLENE AND GIBBERELLIN IN SECONDARY DORMANCY
RELEASING OF AMARANTHUS CAUDATUS SEEDS
J. K~PCZYNSKI, M. BIHUN
Department of Plant Physiology, University ofSzczecin, Felczaka 3a, 71-
412 Szczecin, Poland
1. Introduction
Although studies on ethylene and seed germination began 70 years ago many questions
remain [1, 2]. Especially the knowledge on the role of ethylene in the release of
secondary dormancy in seeds is insufficient. This work shows reactions of secondary
dormant (thermodormant) Amaranthus caudatus seeds to ethylene, ACC, GA 3, ethylene
+ GA3 and effect of GA3 on ethylene production and ACC oxidase activity in vivo.
To induce secondary dormancy, non-dormant commercially available Amaranthus

caudatus seeds were presoaked for 1 day at 45C in darkness. Seeds were germinated
in darkness at 25C. Ethylene production was measured by withdrawing a I ml sample
into a Hewlett-Packard 5790 gas chromatograph equipped with a flame ionization
detector and Poropack Q packed column. All experiments were repeated twice with 3-5
replications.
3. Results and Conclusions
Ethylene or ACC released secondary dormancy in A. caudatus seeds (Table I). It may
indicate that these seeds have an ethylene-response mechanism and suggest that seeds
do not germinate because of an insufficient level of endogenous ethylene. Likewise,
GA3 at 10.3 M completely released secondary dormancy in these seeds. GA3 at 10.6 M
enhanced ethylene action indicating cooperation between these hormones (Fig. I). ACC
markedly increased ethylene production and slightly seed germination after 16 h of
incubation (Table 2). GA3 did not affect ethylene production, ACC conversion to
ethylene and germination. After 28 h both ACC and GA3 stimulated ethylene
production and seed germination. GA3 enhanced both ACC conversion to ethylene and
germination. Thus GA3 seems to be involved in control of ACC oxidase activity in vivo
in germinating seeds.
193
194
TABLE I. The effect of ethylene, ACC or GA3 on Amaranlhus caudalus seed germination (%) after 2 and 5
days at 25C. Seeds with radicle approximately 2 mm long were considered as germinated. SD for 2 days <
6.4 %; SD for 5 days < 5.1 %.
Days Treatment
Water Ethylene, I fUll ACC, 10-3 M
2 5.4 57.0 30.4 46.8
5 12.6 98.6 82.0 90.8
100
80
;:!e
0
C 60
.2
1;;
c

~
40
0'"
20
0
Ethylene. I pili
LI, 0 + o
..
GAJ.IO.('M 0 0 +
Figure I. The effect of GA3 and ethylene on germination of secondary

dormant Amaranlhus caudalus seeds after 2 (n) and 5 (~ days at 25e. SD <
6.4%.
TABLE 2. The effect of GA3 (10-3 M) and ACC (10-3 M) on ethylene production and germination of
Amaranlhus caudatus seeds at 25C. Seeds with radicles less than 2 mm (radicle protrusion) and longer than
2 mm were counted. For ethylene determinations, 200 seeds were incubated in 4 ml flasks for 2 h at 25e.
SD < 1.3 pMIl 00 seeds/h; SD < l.l %.
Incubation time, hours

16 28
Treatment Ethylene, Radicle, % Ethylene, Radicle, %
pM/IOO seeds/h <2 >2 pM/lOO <2 >2
seeds/h
Water 0.7 o 0 8.6 5.0 2.2
GA3 0.9 0.2 0 15.1 33.4 11.9
ACC 5.1 1.7 0.9 21.8 31.2 10.7
ACC+ GA3 6.8 1.7 0.9 53.1 28.5 20.6
4. References
I. Esashi, Y. (1991) Ethylene and seed germination, in AK. Matoo and J.e. Suttle (eds.), The Plan I
Hormone Elhylene,CRC Press, Boca Raton, pp. 133-157.
2.K~pczynski, J. and K~pczynska, E. (1997) Ethylene in seed dormancy and germination, Physiol. Plan!.
101,720-726.
REGULATION AND FUNCTION OF POLLINATION-INDUCED ETHYLENE
IN CARNATION AND PETUNIA FLOWERS
M. L. JONES', W.R. WOODSON 2 and J.T. L1NDSTROM 3

I Department of Horticulture and Land~cape Architecture, Colorado State
University, Fort Collins, CO 80523, USA; 2Department of Horticulture
and Land~cape Architecture, Purdue University, West Lafayette, IN
47907, USA; 3 Department of Horticulture, University of Arkansas,
Fayetteville, AR 72701, USA
I. Abstract
In many flowers pollination accelerates ethylene biosynthesis and developmental

changes observed during the natural senescence of unpollinated flowers. A burst of
ethylene production from the stigma! style is often the first detectable post-pollination
event. We are interested in the nature of the pollen-pistil interaction that induces
ethylene biosynthesis and the role of ethylene in triggering subsequent post-pollination
phenomena including ovary development and senescence of the corolla. In carnations
we have identified a pollination responsive ACC synthase that is up regulated by I hour
after pollination in styles. We have demonstrated that the regulation of this gene by
pollination is independent of ethylene action, but that ethylene action within the
pollinated style is required to initiate subsequent post-pollination events in the ovary
and petals. Using Petunia hybrida as a model we have shown that pollen-borne ACC is
synthesized in the haploid pollen grain by a pollen specific ACC synthase gene. Using
transgenic plants that fail to accumulate ACC in their pollen we have shown that
pollination-induced ethylene production and ACC synthase mRNA accumulation in the
style is not dependent on ACC in the pollen grain. With the identification of pollination
responsive ACC synthase genes and the use of pollen that is deficient in potential
elicitors it should be possible to identify the primary pollination signal in Petunia and
carnation flowers.
2. Introduction
The pollination of angiosperm flowers initiates a series of developmental processes that

result in the ripening of fruit and dispersal of seeds. In many longer-lived flowers,
pollination accelerates ethylene biosynthesis and developmental changes observed
during the natural senescence of unpollinated flowers. These processes include ovule
differentiation, ovary development, pigmentation changes, corolla senescence and
corolla abscission. While most flowers contain fully developed ovules prior to
pollination, orchids lack ovules at anthesis and ovary development and ovule
195
196
differentiation are induced by pollination [29]. Pollination-induced changes in perianth

pigmentation have been reported in Cymbidium and lupine flowers [22, 30] and
accelerated corolla senescence or wilting has been extensively studied in flowers of
petunia, carnation and orchid [3, 4, 7, 8, 15, 33]. In addition to premature senescence,
flowers such as Digitalis, Cyclamen and Pelargonium abscise their petals shortly after
pollination [9, 21, 25]. The dramatic changes in the perianth induced by pollination are
thought to contribute to the efficiency of pollination by discouraging visits from future
pollinators [23].
3. Pollination-induced Ethylene
In many species, including carnation, petunia, and orchids, an increase in ethylene

biosynthesis from the stigma is the first detectable post-pollination event. This ethylene
production occurs within the first few hours after pollination, prior to pollen
germination [10, 13, 15, 16, 17, 18]. The role of this early stylar ethylene in triggering
post-pollination phenomena like petal senescence is not understood, but there is
increasing evidence that pollination-induced ethylene regulates post-pollination
developmental events. Flowers that are insensitive to ethylene due to treatment with
inhibitors of ethylene action [11] or due to the expression of the mutated ethylene
receptor (etrl-l) [28] do not exhibit pollination-induced corolla senescence. We have
shown that preventing ethylene perception only in the pollinated style by treatment with
DACP also effectively prevents pollination-induced corolla senescence [11]. These
results illustrate the importance of stylar ethylene in regulating post-pollination events.
The inhibition of pollination-induced ethylene by treatment of the style with AVG
(an inhibitor of ACC synthase) indicates that this ethylene biosynthesis is dependent on
ACe synthase activity in the style [10, 31]. In order to investigate the regulation of
ACC synthase by pollination, RT-PCR was utilized to identifY pollination-responsive
ACC synthase genes. In carnations, an ACC synthase (DCACS3, GenBank
#AF041937) was identified that shares 65.8% and 83.8% amino acid identity with
carnation ACC synthases DCACSI and DCACS2 respectively. Very low levels of
DCACS3 mRNA can be detected in unpollinated styles and increase by 1 hour after
pollination (Fig. IA). ACC synthase transcripts from DCACS2 and DCACS3 are also
up-regulated by pollination but correspond to the second and third peaks of ethylene
production detected from pollinated styles [11]. The increase in DCACS3 mRNA
abundance following pollination is independent of ethylene action, as it is not prevented
when pollinated flowers are treated with the ethylene action inhibitor 2,5-
norbornadiene (NBD) (Fig. 1B).
In petunia flowers, ethylene production by the stigma has been shown to increase
within 5 minutes after the application of pollen [18]. This increase in ethylene
production is inhibited by A VG, but not by inhibitors of RNA synthesis [18]. The rapid
nature of the response suggests that ethylene synthesis involves the activation of an
existing enzyme or transcription of existing ACC synthase mRNAs. While the
regulation of most members of the ACC synthase gene family has been found to be at
the level of transcription [12], post-transcriptional regulation of ACC synthase has been
demonstrated [5, 6]. The identification of an ACC synthase gene in petunia with high
197
levels of transcript at anthesis supports the possible post-transcriptional regulation of

ACC synthase by pollination (Data not shown). The regulation of this gene following
pollination is currently being investigated.
Time after pollination (hours)
o 1 4 6 10 12 14 16 18 24 36 48
A.
DCACS1
DCACS2
DCACS3
rRNA
AIR NBD
B. 0 1 6 12 18 24 48 1 6 12 18 24 48
DCACS3
rRNA
Figure lAo Expression of DCACSI, DCACS2, and DCACS3 in carnation styles at

various times after pollination. Gene specific probes containing the 3' untranslated
regions of tbe ACC syntbase cDNAs were used for hybridization. B. Expression of
DCACS3 in carnation styles following pollination in air or 2,5- norbomadiene (NBD).
4. Post-pollination Signaling
The induction of physiological and biochemical processes at sites distal to the initial site
of pollen perception suggests that a translocated signal, which precedes the growing
pollen tube, signals a compatible pollination to the ovary and petals. The identity of this
pollination signal is unclear, but it has been proposed to be auxin [4] or ACC [18, 26,
27] deposited on the stigma by the pollen or the gaseous phytohormone ethylene itself
[1,4,32]. In Phaiaenopsis, it has been proposed that the primary pollination signal, the
signal that induces rapid ethylene biosynthesis from the style, is a pollen-borne factor
that may be distinct from the translocated pollination signal [2, 17]. A secondary signal
is then translocated from the stigma to the ovary and petals coordinating the subsequent
post-pollination events. Evidence for the existence of a translocated pollination signal
has been provided in a series of experiments in which the removal of petunia styles at
time points beyond 6 hours after pollination failed to prevent accelerated corolla
senescence [8].
4.1. PRIMARY POLLINATION SIGNALS

198
In the flowers of carnation [16] and petunia [18], increased stylar ethylene is detectable
within 1 hour after pollination, before any evidence of pollen tube gennination or
penetration of the stigma [13, 16]. This initial burst of ethylene biosynthesis is believed
to be in response to a chemical on the surface of the pollen and not associated with the
growth of pollen tubes. The application of foreign pollen rrom unrelated species or
incompatible petunia pollen elicits the early burst of ethylene production rrom petunia
styles, but this ethylene production is not sustained and does not lead to ovary growth or
premature corolla senescence [10, 20]. Similarly, compatible pollen that has been killed
by heat or radiation induces only transient ethylene production by the style and has no
impact on floral longevity [10]. The application of incompatible Dianthus pollen (sp
87-290) to carnation styles also was found to induce only transient ethylene production
by the style [13]. This transient ethylene production appears to be induced by a pollen
factor rather than a physical contact stimulus, as the application of inert beads to the
styles does not induce ethylene production [Woodson, unpublished]. With the
identification of pollination responsive ACC synthase genes it will be possible to
detennine the nature of the pollen-pistil interaction that results in ethylene biosynthesis
by the style.
"0
E o I
o
u ~cJ
OCACSI
OCACS2
OCACS3
rRNA
Figure 2. Expression of OCACS I, OCACS2, and OCAC3 in carnation styles

from flowers treated with 100 J.lM 2,4-0 or 10 J.lLL-] ethylene for 24h.
4.1.1. Role ofAuxin in Pollination-induced Ethylene

Auxin that is deposited on the stigmatic surface by the pollen grain itself has been
implicated in the induction of early ethylene production by the style. Auxin has been
proposed as a potential pollination signal because the application of auxin to orchid
stigmas leads to increased ethylene production and ovary development similar to that
occurring in response to pollination, and it is known that orchid pollinia contain auxin
[1,34]. In Phalaenopsis, Phal-ACS2 mRNA accumulates in the stigma within 1 hour of
pollination. The exogenous application of auxin to the stigma mimics both pollination
induced ethylene biosynthesis and up-regulation of Phal-ACS2 [2]. In contrast to the
response in orchids, application of auxin to carnation and petunia stigmas has not been
shown to result in increased ethylene production or any other post-pollination
phenomena [18, 19]. The pollination responsive ACC synthase DCACS3, was found to
be up-regulated in the style following uptake of 2,4-0 by the flower (Fig. 2). The
ethylene independent regulation of DCACS3 by pollination and its responsiveness to
199
2,4-D suggests that auxins may play a role in the regulation of post-pollination
development and signaling in carnation flowers, but there is not enough evidence to
determine if auxins are serving as the primary pollination signal.
4.1.2. Role ofACC in Pollination-Induced Ethylene

In carnation and petunia flowers, the application of ACC to the stigma results in a
transient increase in ethylene that is not sustained and does not induce corolla wilting
[10, 19]. This result coupled with the discovery that pollen from different sources
contained varying amounts of ACC led to the proposal that diffusion of ACC from the
pollen to the stigma could account for the portion of ethylene produced by the style
immediately after pollination [26]. Petunia pollen can contain as much as 1500 11mol
ACC/g [10, 20], whereas carnation pollen has less than 25 11mOI ACC/g [l3, 26]. Singh
et al., [20] reported that the endogenous ACC content of pollen correlated with the
amount of ethylene produced by the styles immediately after pollination, and concluded
that this early ethylene was due solely to the conversion of pollen-borne ACC to
ethylene. In support of this conclusion, it is known that an unpollinated petunia stigma
at anthesis already has high levels of ACC oxidase activity and the ability to convert
applied ACC to ethylene [18, 24].
0.8
:i' 0.7
~ 0.6
...
.... 0.5
,e 04
il 0.3
~ 0.2
r.;s 0.1
o
Figure 3. Ethylene production by wild-type Mitchell petunia styles (nL I style)

following pollination with either wild-type Mitchell petunia pollen or
transgenic pollen (AI). Transgenic pollen contains undetectable levels of ACC
due to the pollen specific expression of deaminase.
Contrasting data from experiments by Larsen et al., [13] have shown that Starlight
carnation pollen contains only 4 11mol ACC/g, insufficient ACC to sustain the 1-2111 of
ethylene produced by the style within the fIrst 2 hours after pollination [13]. The
application of AVG, an inhibitor of ACC synthase, to petunia and carnation styles has
been found to effectively block pollination-induced ethylene production by the style,
indicating that this early ethylene is dependent on ACC synthase activity [10, 31]. The
rapid induction of ACC synthase activity in the styles of petunia following pollination
also provides evidence that ACC synthesized in the style rather than pollen-borne ACC
is the precursor of this pollination-induced ethylene [18]. The creation of transgenic
200
lines of Petunia hybrida cv Mitchell with undetectable levels of ACC in the pollen due
to the pollen-specific expression of ACC deaminase has provided the opportunity to
evaluate the role of pollen-borne ACC in pollination-induced stylar ethylene
biosynthesis [14]. The application of transgenic pollen (AI) to wild-type Mitchell
petunia stigmas resulted in the same level of stylar ethylene production as pollinations
with wild-type pollen containing approximately 1600 nmol ACC/ g pollen (Fig. 3).
These pollinations resulted in fertilization and theproduction of viable seed [Data not
shown]. Pollination of 'White Sim' carnations with transgenic petunia pollen also
resulted in accumulation of the pollination responsive ACC synthase transcript
DCACS3 in styles within 2 hr of pollination (Fig. 4). DCACS3 mRNAs were also up-
DCACS3
rRNA
Figure 4. Expression of DCACS3 in carnation styles 2h after the application of pollen.

Pollen sources included two types of Dianthus pollen, cv Starlight and sp. 87-29G that
represent a compatible and an incompatible pollen source, respectively. Wild-type and
low ACC transgenic petunia pollen (AI4) cv Mitchell was also applied.
regulated following the application of wild-type Mitchell petunia pollen and an

incompatible Dianthus pollen (sp 87-29G) to White Sim styles. These recent
experiments provide evidence for the involvement of a pollen-factor in early
pollination-induced ethylene production, but indicate that this elicitor is not ACe.
5. References
1. Arditti,1. (1979) Aspects of the physiology of orchids, Adv. Bot. Res. 7,421-655.
2. Biu, A.Q. and O'Neill, S.D. (1998) Three I-aminocyclopropane-I-carboxylate synthase genes
regulated by primary and secondary pollination signals in orchid flowers, Plant Physiol. 116, 419-
428.
3. Borochov, A. and Woodson, W.R. (1989) Physiology and biochemistry of flower petal senescence,
Hortie. Rev. 11, 15-43.
4. Burg, S.P. and Dijkman, M.J. (1967) Ethylene and auxin participation in pollen induced fading of
Vanda orchids, Plant Physiol. 42,1648-1650.
5. Chappell, J., Hahlbrock, K. and Boller, T. (1984) Rapid induction of ethylene biosynthesis in
cultured parsley cells by fungal elicitor and its relationship to the induction of phenylalanine
ammonia-lyase, Planta 161,475-480.
6. Felix, G., Grosskopf, D.G., Regenass, M., Basse C.W., and Boller T. (1991) Elicitor-induced
ethylene biosynthesis in tomato cells. Characterization and use as a bioassay for elicitor action,
7. Gilissen, L.1.W. (1976) The role ofthe style as a sense-organ in relation to wilting of the flower,
Planta 131,201-202.
8. Gilissen, L.J.W. and Hoekstra, F.A. (1984) Pollination-induced corolla wilting in Petunia hybrida
rapid transfer through the style of a wilting-inducing substance, Plant Physiol75, 496-498.
201
9. Halevy, AH., Whitehead, C.S., and Kofranek, AM. (1984) Does pollination induce corolla
abscission of cyclamen flowers by promoting ethylene production? Plant Physiol. 75, 1090-1093.
10. Hoekstra, FA and Weges, R (1986) Lack of control by early pistillate ethylene of the accelerated
wilting of Petunia hybrida flowers, Plant Physiol. 80,403-408.
II. Jones, M.L. and Woodson, W.R. (1997) Pollination-induced ethylene in carnation. Role of stylar
ethylene in corolla senescence, Plant Physiol. 115,205-212.
12. Kende, H (1993) Ethylene biosynthesis, Ann. Rev. Plant Physiol. 44, 283-307.
13. Larsen, P.B., Ashworth, E.N., Jones, M.L., Woodson, W.R. (1995) Pollination-induced ethylene in
carnation. Role of pollen tube growth and sexual compatibility, Plant Physiol. 108, 1405-1412.
14. Lei, C-H., Lindstrom, IT., and Woodson, W.R. (1996) Reduction of I-aminocyclopropane-l-
carboxylic acid (ACC) in pollen by expression of ACC deaminase in transgenic petunias,
Supplement to Plant Physiol. 111, 149.
15. Nichols, R (1977) Sites of ethylene production in the pollinated and unpollinated senescing
carnation (Dianthus caryophyllus) inflorescence, Planta 135, 155-159.
16. Nichols, R., Bufler, G., Mor, Y., Fujino, D.W., and Reid, M.S. (1983) Changes in ethylene
production and l-aminocyclopropane-I-carboxylate content of pollinated carnation flowers, J.
Plant Grawth Regul. 2, 1-8.
17. O'Neill, S.D., Nadeau, lA, Zhang, X.S., Bui, AQ., and Halevy, AH. (1993) Interorgan
regulation of ethylene biosynthetic genes by pollination, Plant Cell 5,:419-432.
18. Pech, J-C., Latche, A, Larrigaudiere, c., and Reid, M.S. (1987) Control of early ethylene
synthesis in pollinated petunia flowers, Plant Physiol. Biochem. 25,431-437.
19. Reid, M.S., Fujino, D.W., Hoffinan, N.E., and Whitehead, C.S. (1984) I-aminocyclopropane-I-
carboxylic acid (ACC) The transmitted signal in pollinated flower? J. Plant Growth Regul. 3, 189-
196.
20. Singh, A, Evensen, K.B., Kao, T-H. (1992) Ethylene synthesis and floral senescence following
compatible and incompatible pollinations in Petunia inflata, Plant Physiol. 99,38-45.
21. Stead, AD. and Moore, K.G. (1979) Studies on flower longevity in Digitalis: pollination induced
corolla abscission in Digitalis flowers, Planta 146,409-414.
22. Stead, AD. and Reid, M.S. (1990) The effect of pollination on the colour change of the banner
spot of Lupinus albifrons (Bentham) flowers, Ann. Bot. 66, 655-663.
23. Stead, AD. (1992) Pollination-induced flower senescence: a review, Plant Growth Regul. 11, 13-
20.
24. Tang, x., Gomes, AM.T.R., Bhatia, A, Woodson, W.R. (1994) Pistil-specific and ethylene -
regulated expression of I-aminocyc\oporpane-I-carboxylate oxidase genes in petunia flowers,
Plant Cell 6, 1227-1239.
25. Wallner, S., Kassalen, R., Burgood, l, and Craig, R. (1979) Pollination, ethylene production and
shattering in geraniums, HortScience 14, 446.
26. Whitehead, C.S., Fujino, D.W., and Reid, M.S. (1983) Identification of the ethylene precursor, 1-
aminocyclopropane-I-carboxylic acid (ACC), in pollen, Sci. Hortic. 21,291-297.
27. Whitehead, C.S., Fujino, D.W., and Reid, M.S. (1983) The roles of pollen ACC and pollen tube
growth in ethylene production by carnations, Acta Hort. 141, 221-227.
28. Wilkinson, lQ., Lanahan, M.B., Clark, D.G., Bleeke,r AB., Chang, C., Meyerowitz, E.M., Klee,
H.J. (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in
heterologous plants, Nature Biotech. 15,444-447.
29. Wirth, M. and Withner, C.L. (1959) Embryology and development in the Orchidaceae, in c.L.
Withner (ed.), The Orchids: A SCientific Survey, The Ronald Press Company, New York, pp. 155-
188.
30. Woitering, E.1. and Somhorst, D. (1990) Regulation of anthocyanin synthesis in Cymbidium
flowers: effects of emasculation and ethylene, J. Exp. Bot. 136,295-299.
31. Woltering, E.1., Van Hout, M., Somhorst, D., and Harren, F. (1993) Roles of pollination and short-
chain saturated fatty acids in flower senescence, Plant Growth Regul. 12, 1-10.
32. Woltering, E.1., Somhorst, D., and van der Veer, P. (1995) The role of ethylene in interorgan
signaling during flower senescence, Plant Physiol. 109, 1219-1225.
33. Woodson, W.R., Park, K.Y., Drory, A, Larsen, P.B., and Wang, H. (1992) Expression of ethylene
biosynthetic pathway transcripts in senescing carnation flowers, Plant Physiol. 99, 526-532.
34. Zhang, X.S. and O'Neill, S.D. (1993) Ovary and gametophyte development are coordinately
regulated by auxin and ethylene following pollination, Plant CellS, 403-418.
-mERotEoP SlIORT-CHAIN SATURATED FATTY ACIDS IN INDUCING
SENSITIVITY TO ETHYLENE
A. H. HALEVyl and C. s. WHITEHEAD2

J The Hebrew University ofJerusalem, Dept. of Horticulture P.o.B 12,
Rehovot 76100, Israel, 2 Rand Afrikaans University, Dept. of Botany,
Johannesburg, South Africa
1. Abstract
Ethylene is involved in the regulation of many processes in plants. In order for ethylene
to be effective, the tissue must be sensitive to the hormone. In the following, we present
data supporting the role of short-chain fatty acids in inducing the sensitivity to ethylene
in two processes: the pollination-induced petal senescence and the promotion of
flowering in iris.
2. The Role of Short-chain Saturated Fatty Acids in Pollination-induced

Sensitivity to Ethylene
In most flowers, pollination induces considerable acceleration of senescence, which

may be manifested differently in different flowers [for reviews see 3, 6, 15].
In recent years, we chose Phaiaenopsis flowers as the major model system for our
studies on pollination-induced senescence because of their unique properties. The
unpollinated intact flowers are long-lasting and may live for up to 3 months, while
pollination is rapidly followed by the appearance of visible senescence symptoms,
which are detectable within one day. In Phaiaenopsis pollen, germination begins 5 to 6
days, and fertilization more than 40 days, after pollination, whereas senescence
symptoms are observed in less than one day. This indicates that the pollination signal(s)
are transported in orchids soon after pollination, well before pollen germination and
fertilization [13, 19].
Pollination-induced senescence is preceded or accompanied by enhancement of
ethylene production by the flower, and application of ethylene to flowers can mimic the
effects of pollination. It is generally accepted, therefore, that ethylene production is a
major cause for pollination-induced senescence [9]. Our earlier work with cyclamen [5]
and petunia [17] showed that the promotive effect of pollination on corolla abscission
cannot be caused merely by stimulation of ethylene production. Apart from the
promotion of ethylene evolution, pollination also renders the tissue sensitive to
ethylene. This means that ethylene is necessary but not sufficient to induce the
pollination-promoted senescence syndrome by itself. Therefore, it seems that pollination
203
204
induces at least two signals, one is ethylene and the other is a "sensitivity factor" which
renders the tissue sensitive to ethylene.
We have followed the change in ethylene production and sensitivity to ethylene
following Phalaenopsis flower pollination [11]. The sensitivity to external ethylene
was detennined in flowers placed continuously in aminooxy acetic acid (AOA), an
inhibitor of ACC synthase, which eliminated the endogenous ethylene biosynthesis. It
was found that increased sensitivity to ethylene could be detected between 2 to 4 hours
after pollination, and it peaked 6 hours later, while the increase in ethylene production
could be detected only after 12 to 14 hours and it peaks 30 hours after pollination. This
indicates that the "sensitivity signal" is the first signal moving into the petals, long
before the ethylene biosynthesis signal.
It is clear that the pollination induced sensitivity does not depend on ethylene
production, since it occurred also in flowers treated with AOA, which prevents the
increase in ethylene synthesis. The identity of the "sensitivity factor" has been sought.
Results with petunia [6, 17] and Phaiaenopsis indicated that ABA and jasmonic acid
can not be this factor. Application of these regulators increased sensitivity to ethylene,
but their endogenous levels did not increase in the perianth at the time of the increase in
sensitivity. Our results also indicate that ethylene and ACC can not be the pollination
signal inducing sensitivity to ethylene [6, 12].
Another candidate is auxin. Orchid pollen contains substantial amounts of auxin [1,
15] and application of IAA to the stigma of Phalaenopsis flowers mimicked the effect
of pollination on ethylene production and the increase in ACC synthase and Ace
oxidase mRNAs [10]. In other flowers, however, applied auxin did not mimic the
pollination effect [15].
We have presented supporting evidence that short-chain (C 7 to e 10) saturated fatty
acids (SCSF A) and especially octanoic acid (C g) may be the "sensitivity factor" or at
least part of the pollination-induced sensitivity signals. Applications of these acids to
the stigmas of petunia [17] and carnation [18] flowers mimicked the effect of
pollination on sensitivity to ethylene. A substantial increase in the level of these acids
was detected in the stylar exudates and the corolIas a few hours after pollination.
Following pollination these acids are synthesized in the stylar tissue and transported
rapidly to the corollas, where they induced an increase in ethylene sensitivity.
In Phaiaenopsis flowers, application of octanoic acid to the stigmas greatly
enhanced the sensitivity to ethylene of AOA treated flowers. A substantial increase in
octanoic acid and other SCSF As was found in the gynoecia and perianths of pollinated
flowers 6 hours after pollination at the time of the increase in ethylene sensitivity,
followed by a sharp decrease at 12 and 24 hours, at the time of the increase in ethylene
production [4]. These results support the view that these compounds promote flower
senescence by enhancing ethylene sensitivity.
3. The Role of Short-chain Fatty Acids in Promotion of Ethylene-mediated Flower

Induction in Iris
Ethylene is known to stimulate flowering in a number of geophytes [7, 8]. Exposure of

Dutch iris bulbs to ethylene enhances flowering and increasesthe flowering percentage,
205
especially in smaller bulbs, which normally produce only vegetative plants [8]. The
flower-inducing effect of ethylene was found to correlate with an ethylene-induced
increase in respiration similar to that found in other species [7, 8]. We have examined
the possibility that treatment of dormant Dutch iris bulbs with octanoic acid will
increase ethylene sensitivity and improve the stimulating effect of ethylene on flowering
of bulbs of different sizes, and that these acids may playa role in the natural differences
in ethylene sensitivity that exists between bulbs of different sizes [2].
Flowering of precooled iris bulbs (CV. Sapphire Beauty) increased with an increase
in bulb size. In small bulbs flowering was limited to 16% compared to 65% in medium
bulbs. Treatment with ethylene resulted in the stimulation of flowering in bulbs of all
sizes.
Treatment with octanoic acid increased the sensitivity of the bulbs to ethylene. The
biggest effect of octanoic acid on ethylene sensitivity was observed in small bulbs
where both the rate and final percentage of flowering were markedly stimulated.
In determination of the endogenous content of the SCSFAs we have found that
octanoic acid is the most abundant of the SCSFAs in the range of C7.C IO in bulbs of all
sizes, and its endogenous level increases with an increase in bulb size. Since a natural
increase in ethylene sensitivity was observed with an increase in bulb size, and since the
response of bulbs of different sizes to treatment with ethylene correlated well with the
increase in octanoic acid content, it seems that larger bulbs are naturally more sensitive
to ethylene than smaller ones due to a higher octanoic acid content.
4. The Mode of Action of Short-chain Fatty Acids in Increasing the Sensitivity to

Ethylene
The lipid bilayers of biomembranes provide the fluid environment for membrane
protein activity. Therefore, their physical properties are a major factor governing
membrane enzyme activities [14]. We examined whether SCSFAs are able to modulate
membrane lipid order [4]. Different ratios of octanoic acid to the other lipids had no
effect on the polarization value of liposomes and microsomal membranes of
Phalaenopsis petals as measured by 1,6-diphenyl-l,3,5-hexatriene (DPH), a fluorescent
probe that incorporates itself deep within the lipids' hydrophobic core. However, when
we used densyl pyrrolidine (DNSP), which partitions closer to the membrane surface,
we found that at low ratios, octanoic acid decreases liposome and microsomal
membrane polarization values, whereas at high ratios the values were similar to
controls. Thus, octanoic acid seems to affect the order of the lipids just beneath the
phospholipid head groups. This is expected, since octanoic acid is a short fatty acid
(C g), and should affect lipid order only in the region near the membrane surface, not
deep in the hydrophobic core of the lipid bilayer.
We also examined whether the effects of octanoic acid on lipid order also occur in
vivo, following pollination or stigmatic application of octanoic acid. Again, no effect of
pollination and octanoic acid on lipid order was found when measured using DPH.
However, when using DNSP we found that 10 h after pollination, at peak ethylene
sensitivity, there was a significant decrease in the microsomal membrane polarization
206
values in both the column and the perianth. In addition, stigmatic application of
octanoic acid mimicked the effect of pollination on the membrane polarization values.
In carnation flowers and banana fruits, exogenous application of octanoic acid
resulted in an increase in ethylene binding to the tissue [16,18]. In human tissues,
membrane fluidity is known to affect receptor function [14]. We suggest that in a
similar fashion SCSF As affect ethylene sensitivity by increasing the membrane fluidity
in specific regions of the lipid bilayer, thereby increasing ethylene binding to its
membrane associated receptors.
5. Acknowledgement
We would like to acknowledge with great appreciatIOn the excellent work of our
colleagues and graduate students who participated in these studies: Ron Porat, Amihud
Borochov, Hana Spiegelstein (Rehovot, Israel), Louise Botha (Johannesburg, South
Africa) and Sharman O'Neill (Davis, CA, USA).
6. References
1. Arditti, 1. (1979) Aspects of orchid physiology. in H. Woolhousc (ed.). Advances In Botanical

Research, Academic Press, London, pp. 421-655.
2. Botha, M.L., Whitehead, C.S. and Halevy, All (1998) Effect of octanoic acid on ethylene-mediated
flower induction in Dutch iris, Plant Growth Regul. 25. 47-5\.
3. Halevy, AII. and Mayak, S. (1981) Senescence and postharvest physiology of cut flowers, part II,
Hort. Rev. 3,59-143.
4. Halevy A.H., Porat, R., Spiegelstein. H., Boroehov, A.. Botha, L. and Whitehead. C.S. (1996) Short-
chain saturated fatty acids in the regulation of pollination-induced ethylene sensitivity of
Phalaenopsis flowers, Physiol. Plant. 97,469-474
5. Halevy AH .. , Whitehead, C.S. and Kofranek, AM. (1984) Does pollination induce corolla
abscission of cyclamen flowers by promoting ethylene productionry Plant Physiol. 75. 1090-1093.
6. Halevy, A.H. and Whitehead, C.S. (1989) Pollination induced corolla abscission and senescence and
the role of short-chain saturated fatty acids in the process, in D.J. Osborne and M.B. Jackson (eds.).
Cell Separation in Plants, NATO ASI Series, Springer-Verlag, Berlin, 35, 221-331.
7. Han, SS., Halevy, A.B., Sachs. R.M. and Reid, M.S. (1990) Enhancement of growth and flowering
of Trileleie laxa by ethylene,.J. Am. Soc. Hortic. SCI. 115,482-486.
8. Imanishi, H. and Yue. D. (1986) Respiration and carbohydrate changes during ethylene-mediated
flowers induction in Dutch iris, Sci. Hortic. 59. 275-284.
9. Larsen, P.B., Woltering, E.J. and Woodson, W.R. (1993) Ethylene and intcrorgan signaling in
flowers following pollination, in J. Schultz and I. Raskin, (cds). Plant Signals In InteractIOns With
Other Organisms, Current Topics in Planl Physiology. Am. Soc. Plant Physiol. Rockville, MD, II.
171-181.
10. O'Neill, SD, Nadeau, J.A, Zhang, Z.S., Bui. AQ. and Ilalevy, A.H. (1993) Interorgan regulation of
ethylene hiosynthesis genes by pollination. Plant CellS, 419-432.
II. Porat R., t\. Borochov, AH. Halevy and S\). O'NeilL (1994) Pollination induced senescence in
Phalaenopsis petals. The wilting process, ethylene production and sensitivity to ethylene. Planl
Growth Regul. 15, 129-136.
12. Porat, R., Reiss, N., Atzron R.. Halevy. All. and Horochov. A. (1995) Examination of the possible
involvement of lipoxygenase and jasmonates in pollination induced senescence of Phalaenop.Hs and
Dendronium orchid flowers. Physiol. Plant. 94. 205-210.
13. Porat, R. Nadeau, lA., Kirby, J.A., Sutter, E.G. and O'Neill Sf) (1998) Characterization of the
primary pollen signal in the postpollination syndrome of Phalaenop.m flowers, Planl Groll'th Regilt.
24, 109-117.
207
14. Shinizky, M. (1984) Membrane fluidity and cellular functions. in. M. Shinitzky (ed.). Physiology of
J'vfembrane f1uidity, CRC Press, Boca Raton, pp. I-51.
15. Stead, A.D. (1992) Pollination induced flower senescence: a review, Plant Growth Regul. 11,13-20.
16. Whitehead C.S. and Bosse, c.A. (1991) The effect of ethylene and short-chain saturated fatty acids
on ethylene sensitivity and binding in ripening bananas, J. Plant Physiol. 137,358-362.
17. Whitehead S.c. and Halevy, A.H. (1989). Ethylene sensitivity: the role of short-chain saturated fatty
acids in pollination induced senescence of Petunia hyhrida, Plant Growth Regul. 8, 41-54.
18. Whitehead, S.c. and Vaseljevic, D. (1993) Role of short-chain saturated fatty acids in control of
ethylene sensitivity in senescing carnation flowers, Physiol. Plant. 88, 250-342.
19. Zhang, X.S. and O'Neill, SD. (1993) Ovary and gametophytc are coordinately regulated by auxin and
ethylene following pollination, Plant CeliS, 403-418.
APOPTOTIC CELL DEATH IN PLANTS: THE ROLE OF ETHYLENE
E. J. WOL TERING, A. J. DE JONG AND E. T. Y AKIMOVA

Agrotechnological Research Institute (ATO-DLO), PO Box 17, 6700 AA
Wageningen, The Netherlands
I. Abstract
Programmed cell death (PCD) applies to cell death that is a normal part of the life of a
multicellular organism; it results in controlled disassembly of the cell. In animal
systems, PCD is synonymous with apoptosis, a cell death process characterized by a
distinct set of morphological and biochemical features and breakdown of DNA at
internucleosomal sites resulting in a DNA-ladder pattern on agarose gels. These typical
changes are thought to be mediated by a class of specific cysteine proteases called
caspases. Although numerous processes in plants conform to the general definition of
PCD there is no a priori reason that a relationship exists with the caspase-mediated cell
death process in animal cells that is commonly called PCD or apoptosis.
Treatment of tomato suspension cells with chemicals known to induce apoptosis in
animal systems induced cell death. This chemical-induced cell death was accompanied
by development of morphological features typical for animal apoptosis and DNA
laddering indicating that apoptotic cell death was induced. Treatment of the cells with
ethylene or l-aminocyclopropane-I-carboxylic acid (ACC) greatly stimulated, while
inhibitors of ethylene biosynthesis or action effectively blocked chemical-induced cell
death. These results indicate that ethylene is a mediater of apoptotic cell death in plants.
2. Programmed Cell Death and Apoptosis
According to the general definition of programmed cell death (PCD), it applies to cell
death that is a normal part of the life of a multicellular organism, PCD is found
throughout the animal and plant kingdoms. PCD is an active process in which a cell
suicide pathway is activated resulting in controlled disassembly of the cell. Besides cell
death as a result of normal development, cell death resulting from environmental stress
(e.g. infection by pathogenic organisms, wounding and low concentrations of toxins)
often occurs through controlled disassembly of the cell and can therefore also be termed
PCD.
In contrast, when cell death is caused by severe injury such as heating, freezing or high
concentrations of toxic chemicals, it is characterized by cellular swelling and lysis and
called necrosis. Numerous examples of cell death in plant development have been
described that conform to the general definition of PCD. Some examples of cell death
209
210
events in maize that occur at a specific developmental stage were described by Buchner
et al. [2]; among these are:
Roots
Death of root cap cells
Aerenchyma formation following hypoxia
Reproductive organs
Floral organ abortion during male and female flower formation
Megaspore abortion
Tapetal layer degeneration
Shoots
Tracheary element differentiation
Senescence of leaves and other plant parts
Seeds
Degeneration of suspensor and endosperm
Degeneration of aleurone layer during germination
In addition, localized cell death has been described following pathogen assault
(Hypersensitive Response, HR) and treatment with low concentrations of ozone.
Although all these examples of cell death conform to the general definition of PCD, this
does not necessarily mean that cell death occurs in all cases through the same
mechanism.
3. Apoptosis in Animal Cells
In animal cell types, different forms of PCD have been described based on
morphological characteristics of dying cells [3]. In many cases, however, PCD takes
the form of apoptosis and, in animal biology, PCD has become synonymous with
apoptosis. Apoptosis is derived from a Greek word describing the process of leaves
falling from trees or petals falling from flowers. Apoptosis is characterized by a distinct
set of morphological and biochemical features such as cell shrinkage, blebbing of the
plasma membrane, condensation and fragmentation of the nucleus and cleavage of ON A
at internucleosomal sites. The final feature of apoptosis is the fragmentation of the cell
into plasma membrane bound "apototic bodies" that are being phagocytosed by other
cells [22, 23]. Although other forms of animal PCD have been described that do not
conform to the apoptosis features listed above, it is not clear yet whether the different
peD morphologies reflect differences in the underlying molecular mechanism.
Some of the controlling factors in animal apoptosis have recently been identified.
Apoptosis, either induced by developmental factors or by external stimuli, is often
associated with a class of highly speci fie proteases that are now called caspases
(cystenyl aspartate-specific proteases).
Caspases are synthesized as inactive pro-enzymes containing an N-terminal peptide
(prodomain) and a large and small subunit and require aspartic acid at the cleavage site
resembling their own targets. The active caspase is a hetero tetramer containing two
small and two large subunits. Therefore, autoprocessing and trans-activation among
211
caspases appears possible and suggests that caspases act in a cascade of proteolytic
events. All caspases contain a conserved active site motif (QACxG, where x = R, Q or
G). Caspases are thought to be responsible for cleavage of critical substrates including
Poly (ADP-ribose) polymerase, lamins and apoptosis inhibitors like BcI-2 or lAP's
(discussed below) together resulting in breakdown of the nuclear matrix and DNA
yielding the apoptotic morphology. Caspases are among the most specific of proteases
and highly efficient. This is consistent with the observation that apoptosis is not
accompanied by indiscriminate protein digestion rather, only a select set of proteins is
cleaved, resulting in loss or change of function [5, 17].
In animal systems, numerous other mediators of apoptosis have been identified.
Most prominently, a family of proteins related to BcI-2 have been implied in mediation
among others the activity of certain caspases. Bcl-2 family members may be pro- or
anti-apoptotic. Bcl-2 related proteins show homology in 1 to 4 regions designated Bcl-2
homology (BH) domains. A feature of this family is the ability of its members to
interact with each other to form hetero or homo dimers that show structural homology to
channel forming proteins. BcI-2 proteins are predominantly located in the
mitochondrial, ER, and outer nuclear envelope membranes and may in association with
other proteins of this family (e.g. Bcl-XL' Bad, Bax) induce or suppress the release of
e.g. mitochondrial factors. Regulation of transport of small molecules (e.g. cytochrome
C and caspase-like proteases) across the mitochondrial membranes may be one
mechanism by which members of this family could regulate cell death [13].
Another group of endogenous proteins are the lAP's (inhibitors of apoptosis) that
presumably inhibit apoptosis through inhibition of caspase activity. lAP genes were first
isolated from baculoviruses and later also mammalian counterparts were discovered [4].
lAP proteins generally contain a RING-finger motive at their C-terminal thought to be
involved in protein-protein interactions and 2 or 3 imperfect amino acid repeats of
approximately 65 residues in length at their N-terminus (Called B1R domains).
Another protein involved in apoptosis is DAD-l (Defender against Apoptotic cell
Death). The dad-l gene was originally isolated during complementation studies in a
temperature-sensitive mutant hamster cell line that undergoes PCD when incubated at
non-permissive temperatures. The mutant DADI protein, which contains a single amino
acid substitution, rapidly degrades upon shift to this restrictive temperature. This
degradation proceeds the onset of PCD, suggesting that it may be the event that triggers
PCD [16]. Subsequent cloning of the DADI gene from humans, Xenopus leavis, mouse,
Caenorhabditis elegans, rice, Arabidopsis thaliana and pea demonstrated a substantial
evolutionary conservation.
A protein sequence comparison revealed that human DAD-l is 40% identical to the
Saccharomyces cerevisiae OST-2 protein. OST-2 was cloned as a subunit of the yeast
enzyme oligosaccharyltransferase (OST). OST catalyzes the transfer of preassembled
high mannose oligosaccharides to glycosylation sites of newly synthesized proteins in
the lumen of the rough endoplasmic reticulum. Temperature-sensitive OST2 yeast
mutants are defective in N-linked glycosylation of proteins in vivo and in glycosylation
of synthetic peptide substrates in vitro. The assumption that DAD-l represents a
possible fourth subunit of the mammalian OST was confirmed when DAD-l was shown
to copuriry with the other three OST subunits and could be chemically cross-linked to
them [12]. Furthermore, the yeast two-hybrid assay was used to reveal interaction
212
between DAD-I and the OST48 subunit [9], while DAD-I was shown to be an essential
component of the OST complex and is therefore required for oligosaccharyltransferase
activity [20]. The exact role of DAD-I in inhibiting PCD, however, is still not clear.
Whether apoptosis occurs in a specific cell or tissue may depend on a delicate balance
between pro- and anti-apoptotic factors.
4. Apoptotic cell death in plants
A variety of processes that occur during plant development conform to the general
definition of PCD, i.e. cells at a specific location or with a specific function die at a
specific moment in time [2, 10]. This, however does not mean that there is any
relationship to the caspase-mediated process of cell death in animal cells that is
commonly called PCD or apoptosis. To establish whether a particular process
represents true apoptosis it is necessary to determine the involvement of specific
proteases and to study the morphological features of the dying cells. In a recent review
on PCD during plant growth and development, Beers [1] concludes that in some
processes, e.g. mycotoxin-induced cell death in protoplasts and during plant pathogen-
induced cell death, true apoptosis may occur but that in general nonapoptotic PCD
pathways are essential to normal plant growth and development.
The observations that at least in some plant cell death processes (e.g. the
hypersensitive response) a striking similarity to animal apoptotic phenotype exists (e.g.
nuclear condensation and formation ofapoptotic bodies) indicate that a pathway similar
to animal apoptosis may exist in plant cells [IS, 21].
Except for DAD-I, no plant homologs to the key players in animal apoptosis (e.g.
caspases, BcI-2 family proteins) have been described. However, there are sound
indications that a pathway similar to caspase mediated apoptosis exists in plant cells:
Chemical-induced cell death in tomato cell suspensions is accompanied by
characteristic features of apoptosis. Specific caspase inhibitors were shown to be
potent inhibitors of cell death in this system [6].
Bacteria-induced cell death during the HR in tobacco can be blocked by caspase
inhibitors, and caspase-like proteolytic activity has been detected following
infection with tobacco mosaic virus [7].
Transgenic tobacco plants expressing the baculovirus p35 gene, which presumably
codes for an animal caspase inhibitor, showed a delayed HR-cell death after
challenge with virus or bacteria [7].
Use of anti BcI-2 antibodies have suggested that BcI-2 like proteins are present in
plant cells and localize to mitochondria, plastids and nuclei [8].
To increase our understanding of the plant PCD pathway, we studied chemical-

induced cell death in suspension-cultured tomato cells. The cells were treated with
chemicals known to induce apoptosis in animal cells. Several observations indicated
that these cells undergo apoptosis in a way comparable to animal cells [6].
Like in animal systems, treatment of the cells with !J.M concentrations of e.g.
camptothecin (topo-isomerase I inhibitor), staurosporine (protein kinase inhibitor)
213
or fumonisin-B I (fusarium toxin) reproducibly induced cell death (25 to 40% in

24h).
In samples stained with the DNA-specific dye, Hoechst 33258, we observed
characteristic changes in nuclear morphology such as chromatin condensation, and
in some cases fragmentation of the nucleus into distinct DNA-containing
(apoptotic) bodies.
Gel electroforesis of DNA from treated samples showed a DNA laddering pattern
typical for apoptotic cells.
Addition of nM concentrations of specific caspase inhibitors suppressed chemical-
induced cell death.
Together these are sound indications that plant cells may be stimulated to undergo a
cell death process that is similar or at least comparable to animal apoptosis. The results
indicate that caspase-like proteases may be involved. This system was used to study the
possible involvement of ethylene in plant apoptosis.
5. The Role of Ethylene in Plant Apoptosis
If we consider senescence of flower parts such as leaves, flowers or fruits being a form
of PCD than it is obvious that ethylene plays a role. In many species, ethylene is one of
the endogenous signals that mediate senescence processes. If the question is asked if
ethylene is involved in plant apoptosis only few examples can be found in the literature.
Cell death induced by plant pathogens has been shown to yield a number of
characteristic symptoms of apoptosis and recently the role of ethylene in pathogen-
induced cell death has been evaluated in ethylene insensitive NR-tomatoes. Following
infection of these mutants, greatly reduced disease symptoms were observed, indicating
ethylene involvement in (apoptotic) cell death [14]. Also in a number of other systems
where cell death is accompanied by typical apoptotic features, ethylene was associated
with increased cell death.
Cell death during aerenchima formation shows features of apoptosis and was found
to be dependent on ethylene [11].
Cell death during maize endosperm development is accompanied by occurrence of
DNA ladders and was associated with increases in ethylene production. Apoptosis
could be hastened by treatment with ethylene and blocked by ethylene inhibitors
[24].
Flower petal and ovary senescence in pea is accompanied by appearance of
TUNEL positive nuclei and DNA laddering. Inhibitors of ethylene action delayed
senescence processes and blocked DNA degradation. Furthermore, ethylene
treatment induced senescence, DNA breakdown and down regulation of dad-I gene
expression in petals, that could be blocked by ethylene inhibitors [18, 19].
As described above, the tomato suspension culture represents a system where

apoptotic, possibly caspase-mediated, cell death can be induced by chemicals such as
camptothecin, staurosporine or fumonisin B I. We used camptothecin treated cells to
study the possible involvement of ethylene. Camptothecin at concentrations that
214
induced cell death did not stimulate ethylene production (Table 1). This was not due to
the inability of the cells to produce ethylene because treatment with e.g. xylanase did
induce elevated amounts of ethylene. This indicates that the cell death-inducing activity
of camptothecin is not related to increased ethylene biosynthesis.
TABLE I. Effect ofxylanase and camptothecin on ethylene production of

suspension cultured tomato cells.
Treatment Time (h) Ethylene production

(nLig FW/h)
control 0 0.18
4 0.14
8 0.13
12 0.14
Xylanase (10 iJ.g/ml) 4 0.51
8 1.03
12 1.23
Camptothecin (5 J.!M) 4 0.12
8 0.10
12 0.10
TABLE 2. Effect of ethylene, ACC and inhibitors of ethylene biosynthesis and

action on camptothecin-induced cell death in suspension cultured tomato cells.
Treatment Concentration Cell death

(% after 24h}
Control 5
Camptothecin 5iJ.M 26
Ethylene 10 iJ.LlL (liquid phase) 5
ACC 10 J.!M 4
AVO 10iJ.M 4
STS 20iJ.M 5
Camptothecin + Ethylene 5 iJ.M + 10 iJ.LlL 53
Camptothecin + ACC 5iJ.M+IOiJ.M 61
Camptothecin + AVO 5 iJ.M+ 10iJ.M 8
Camptothecin +A VO + Ethylene 5 J.!M + 10 J.!M + 10 iJ.LlL 57
Camptothecin + STS 5 J.!M +20 iJ.M 7
Camptothecin + STS + Ethylene 5 iJ.M + 20 iJ.M + 10 iJ.LlL 8
Treatment of the cells with relatively high concentrations of ethylene did not have
any effect on short term viability of the cells (Table 2). Concentrations up to 100 ppm in
the headspace, giving about 10 ppm in the liquid phase, were applied during 24 h. In
response to this treatment, a significant increase in ACC oxidase activity was measured
within 5h of treatment, indicating that the cells were responsive to the gas (data not
shown). Also addition of ACC to the nutrient medium, despite its stimulating effect on
ethylene production, did not induce cell death. This shows that ethylene is not a primary
trigger of cell death in these cells
When ethylene or ACC were applied to camptothecin-treated cells, a significant
increase in cell death was observed as compared to camptothecin treatment alone (Table
2). Experiments with inhibitors of ethylene production (aminoethoxy vinylglycine
215
[AVG]) or ethylene action (silver thiosulphate [STS]) revealed that ethylene, even the
low basal level (Table 1), apparently is a crucial factor mediating camptothecin-induced
cell death (Table 2).
Presently it is not clear how ethylene interacts with camptothecin-induced cell death.
It seems that exposure to ethylene sensitizes the cells to camptothecin. The established
system will further be exploited to elucidate the role of ethylene in apoptosis and to
isolate genes associated with chemical-induced apoptosis.
6. Acknowledgement
This work was financially supported by c-DLO and EU-FAIR CT 95-0225. Elena
Yakimova was supported by a grant from the International Agricultural Centre,
Wageningen, The Netherlands.
7. References
I. Beers, E.P. (1997) Programmed cell death during plant growth and development, Cell Death and
Difforentiation 4, 649-661.
2. Buckner, B., Janick-Buckner, D., Gray, J. and Johal, G.S. (1998) Cell-death mechanisms in maize,
Trends Plant Science 3, 218-223.
3. Clarke, P.G.H. (1990) Developmental cell death: morphological diversity and multiple
mechanisms, Anat. Embryol. 181, 195-213.
4. Clem, RJ. and Duckett, C.S. (1997) The iap genes: unique arbitrators of cell death, Trends in Cell
Bioi. 7,337-339.
5. Cohen, G.M. (1997) Caspases: the executioners ofapoptosis, Biochem. J. 326, 1-16.
6. De Jong, AJ., Yakimova, E.T., Hoeberichts, F.A, Maximova, E. and Woltering, EJ., Caspase-like
proteases are involved in apoptotic cell death in plants, submitted.
7. Del Pozo, O. and Lam, E. (1998) Caspases and programmed cell death in the hypersensitive
response of plants to pathogens, Curro Bioi. 8,1129-1132.
8. Dion, M., Chamberland, H., St-Michel, C., Plante, M., Darveau, A, Lafontaine, lG., and Brisson,
L.F. (1997) Detection of a homologue ofbcl-2 in plant cells, Biochem. Cell. Bioi. 75,457-461.
9. Fu, J., Ren, M. and Kreibig, G. (1997) Interactions among subunits of the oligosaccharyl
transferase complex, J. Bioi. Chem. 47,29687-29692.
10. Greenberg, J.T. (1996) Programmed cell death: A way oflife for plants, Proc. Natl. Acad. Sci. USA
93, 12094-12097.
II. He, C-J., Morgan, P.W. and Drew M.C. (1996) Transduction of an ethylene signal is required for
cell death and lysis in the root cortex of maize during aerenchima formation induced by hypoxia,
12. Kelleher, OJ. and Gilmore, R. (1997) DAD I , the defender against apoptotic cell death, is a subunit
of the mammalian oligosaccharyltransferase, Proc. Natl. Acad. Sci. USA 94,4994-4999.
13. Kumar, S. (1997) The Bcl-2 family of proteins and activation of the ICE-CED-3 family of
proteases: A balancing act in apoptosis, Cell Death and Differentiation 4, 2-3.
14. Lund, S.T., Stall, R.E. and Klee, HJ. (1998) Ethylene regulates the susceptible respons to pathogen
infection in tomato, Plant Cell to, 371-382.
15. Morel, lB. and Dangl, lL. (1997) The hypersensitive response and the induction of cell death in
plants, Cell Death and Differentiation 4, 671-683.
16. Nakashima, T., Sekiguchi, T., Kuraoka, A, Fukushima, K., Shibata, Y., Komiyama, S. and
Nishimoto, T. (1993) Molecular cloning of a human cDNA encoding a novel protein, DADI,
whose defect causes apoptotic cell death in hamster BHK21 cells, Mol. Cell. BioI. 13,6367-6374.
17. Nicholson, D.W. and Thornberry, N.A. (1997) Caspases: killer proteases, Trends Biochem. Sci. 22,
299-306.
216
18. Orzaez, D. and Granell, A. (1997) The plant homologue of the defender against apoptotic death
gene is down-regulated during senescence of flower petals, FEBS Leu. 404, 275-278.
19. Omiez, D. and Granell, A. (1997) DNA fragmentation is regulated by ethylene during carpel
senescence in Pisum sativum, PlantJ. 11,137-144.
20. Sanjay, A., Fu, J. and Kreibich, G. (1998) DADI is required for the function and the structural
integrity of the oligosaccharyl transferase complex, J. Bioi. Chem. 40, 26094-26099.
21. Wang, 1., Li, J., Bostock, R.M. and Gilchrist, D.G. (1996) Apoptosis: A functional paradigm for
programmed cell death induced by a host-selective phytotoxin and invoked during development,
Plant CellS, 375-391.
22. Wyllie, A.H. (1987) Apoptosis: cell death in tissue regulation, J. Pathol. 153,313.
23. Wyllie, 1995 The genetic regulation of apoptosis, Curro Opinion in Genet. Development 5,97-104
24. Young, T.E., Gallie, D.R. and DeMason, D.A. (1997) Ethylene mediated programmed cell death
during maize endosperm development of wild type and shrunken2 genotypes. Plant Physiol. 115,
737-751.
CLONING OF TOMATO DADI AND STUDY OF ITS EXPRESSION DURING
PROGRAMMED CELL DEATH AND FRUIT RIPENING
F.A. HOEBERICHTS\ L.H.W. VAN DER PLAS 2, and EJ.

WOLTERlNG 1
IAgrotechnological Research Institute A TO-DLO, P.o. Box 17, 6700 AA
Wageningen, The Netherlands; 2Wageningen Agricultural University,
Laboratory of Plant PhYSiology; Arboretumlaan 4, 6703 BD
Wageningen, The Netherlands
1. Abstract
The dad! gene product is involved in suppression of programmed cell death during
Caenorhabditis elegans embryogenesis. Homologues have been cloned from several
animal and plant species. We isolated a dad! cDNA clone from tomato and found that
the predicted gene product shows significant homology with various DAD I proteins.
Northern analysis showed that, during camptothecin-induced programmed cell death in
tomato suspension cells, dad! mRNA levels did not show the expected decrease.
During tomato fruit ripening, expression levels in pericarp tissue incrp<lsed or decreased,
depending on the tomato variety.
2. Introduction
Programmed cell death (PCD) is a process aimed at eliminating harmful or unnecessary

cells during growth and development of multicellular organisms. In animals, a number
of gene products have been reported to be involved in regulating the cell death process.
Many of these genes are highly conserved among invertebrates and vertebrates [I].
As is the case in animals, PCD is indispensable for normal growth and survival of
plants. It plays an essential role in for example xylogenesis, the hypersensitive response,
and embryogenesis [2]. Although various reports show that some characteristics of
PCD (e.g. the occurrence of genomic DNA fragmentation) are shared between animals
and plants [3-6], the only gene involved in animal PCD of which a homologue was
identified in plants so far is dad! (defender against apoptotic cell death). This gene was
originally isolated from a temperature-sensitive mutant hamster cell line that undergoes
PCD when incubated at non-permissive temperature [7]. Subsequent cloning of dad!
from other species demonstrated a substantial evolutionary conservation [8-12].
Moreover, both the Arabidopsis and the C. elegans dad! gene product can efficiently
rescue the mutant hamster cells from apoptosis [9, II]. A role for C. elegans DADI as
a peD suppressor was suggested mainly by studies of transgenic nematodes
217
218
overexpressing dad]. Expression of either human or C. elegans dad] is sufficient to

suppress developmentally PCD in C. elegans embryos [9]. Surprisingly, a protein
sequence comparison revealed that human DADI is 40% identical to the
Saccharomyces cerevisiae OST2 protein. OST2 was cloned as a subunit of the yeast
enzyme oligosaccharyltransferase (OST), which is involved in N-Iinked glycosylation
of nascent polypeptides [13]. The assumption that DAD! represents an essential fourth
subunit of the mammalian OST was confirmed recently [14]. In plants, expression of
dad] was studied during senescence of pea petals. Upon flower anthesis, dad]
expression decreases dramatically in senescing petals. Petals of flowers where
senescence was delayed using ethylene-action inhibitors maintain high levels of dad]
mRNA transcripts [12].
To investigate its possible role in PCD, a dad] cDNA clone was isolated from
tomato. We studied its expression patterns in suspension-cultured tomato cells
undergoing PCD and in ripening tomato fruits.
3. Results
The Le-dad] cDNA was cloned from tomato (Lycopersicon esculentum cv. Prisca)
using degenerate primers and RACE reactions. Comparison of the deduced amino acid
sequence with various other DADI proteins shows that DADI is highly conserved
throughout both the animal and plant kingdoms (Table I).
TABLE 1: Degree of identity and similarity of various DAD proteins, calculated using ClustalW
software. The sequences used in this comparison are from: Lycopersicon esculentum (Le);
Arabidopsis thaliana (At, X95585); Pisum sativum (Ps, U79562); Caenorhabditis elegans (Ce,
X89080) Homo sapiens (Hs, D15057); and Saccharomyces cerevisiae (Sc, U32307).
In our laboratory, we are using camptothecin-treated cell suspensions as a model

system for studying PCD in plants. Camptothecin, a chemical known to induce PCD in
mammalian cells, induces cell death when added to suspension cultured tomato cells.
This cell death is accompanied by typical PCD-related nuclear morphological changes.
Treatment with camptothecin also induces fragmentation of nuclear DNA [15].
Genomic DNA isolated from cells treated with camptothecin shows a ladder of DNA
fragments that differ in size by just under 200 basepairs. This indicates that the DNA is
specifically cut at internucleosomal sites, a PCD hallmark (Fig. 1). These data indicate
that camptothecin induces PCD in suspension cultured tomato cells.
219
~~ Figure 1. Degradation of genomic DNA into

bp nucleosomal fragments of distinct sizes (DNA
laddering). Cells were treated with 10 J.lM of
camptothecin for 48 hrs. Samples were taken after 24
(ca 24h) and 48 (ca 48h) hours. Control samples (non-
treated) cells were taken at the same time points (co
24h, co 48h). According to fluorescein diacetate
viability staining, 69% of the cells had died after 24
hours, 77% after 48 hours, while control cells contained
about 6% dead cells. 5 J.lg of genomic DNA was loaded
on a 1.5% agarose gel, blotted, and hybridised with
Sau3A digested randomly labelled total genomic DNA.
Expression of the Le-dadl gene in amptothecin-treated tomato suspension cells was

investigated by northern analysis. Le-dadl expression hardly changes during peD, and
after 48 hours transcript levels do not structurally differ from those in control cells (Fig.
2).
Focusing on postharvest characteristics of tomato fruits, northern analysis of Le-
dadl mRNA levels during tomato fruit ripening was carried out. In wildtype tomato
fruit, dadl expression did not show a consistent pattern during ripening. Depending on
the tomato variety, transcript levels increased or decreased (Fig. 3).
Figure 2. Expression of Le-dadl during camptothecin-
induced PCD. After camptothecin was added to
suspension-cultured tomato cells (t=0), samples were
t=O
taken at 24 and 48 hours (ca 24h; ca 48h). Samples
from non-treated control cells were taken at the same
time (co 24h; co 48h). Per lane, 14 J.lg of RNA were
separated on agarose gel, transferred to a nylon mem-
brane, and hybridised with a probe, consisting of the
complete Le-dad1 coding region.
4. Discussion
DADI is a protein that is believed to be a conserved peD suppressor [9]. Here, we

show that the identified tomato DADI is highly homologous to other DADI proteins.
Using camptothecin-treated tomato suspension cells, we studied dadl mRNA levels
during peD. It was demonstrated that addition of camptothecin induces the appearance
of typical peD hallmarks, such as internucleosomal DNA degradation, within 24 hours.
Unexpectedly, no correlation between proceeding peD and decreasing levels of dadl
mRNA could be found. Recently, it was shown that DADI is an OST subunit, which
suggests DADI may influence peD only indirectly [13, 14]. Our results advocate this
assumption, rather than supporting DAD1's role as a direct negative peD regulator.
Furthermore, Le-dadl expression does not show a consistent pattern during tomato fruit
ripening, implying that DADI does not have a regulatory role during the ripening
process.
220
MG BR OR RR MG BR OR RR
prisco flom
Figure 3. Expression of Le-dadl in pericarp tissue during tomato fruit rip-

ening. Fruits were harvested from two different varieties (Prisca and Flora) at
four different time points; mature green (MG), breaker (BR), omnge (OR), and
red ripe (RR). Per lane, 121lg of RNA were loaded on gel.
5. Acknowledgements
This work was supported by the E.U. (FAIR CT95-0225).
6. References
1. Vaux, D.L., and Korsmeyer, S.1., (1999) Cell death in development, Cell 96, 245-254.
2. Pennel, RI. and Lamb, C., (1997) Programmed cell death in plants, Plant Cell 9, 1157-1168.
3. Ryerson, D.E. and Heath, M.e., (1996) Cleavage of nuclear DNA into oligonucleosomal fragments
during cell death induced by fungal infection or by abiotic treatments, Plant Cell 8, 393-402.
4. Wang, M., Oppedijk, B., Lu, X., Van Duijn, B. and Schilperoort, R.A., (1996) Apoptosis in barley
aleurone during germination and its inhibition by abscisic acid, Plant Mol BioI 32, 1125-1134.
5. Orzaez, D. and Granell, A., (1997) DNA fragmentation is regulated by ethylene during carpel
senescence in Pisum sativum, Plant Journal 11, 137-144.
6. Yen, C.R. and Yang, C.R., (1998) Evidence for programmed cell death during leaf senescence in
plants, Plant Cell Physiol39, 922-927.
7. Nakashima, T., Sekiguchi, T., Kuraoka, A., Fukushima, K, Shibata, Y., Komiyama, S. and
Nishimoto, T., (1993) Molecular cloning of a human cDNA encoding a novel protein, DADI,
whose defect causes apoptotic cell death in hamster BHK21 cells, Mol Cell 8iol13, 6367-6374.
8. Apte, S.S., Mattei, M.G., Seldin, M.F. and Olsen, B.R, (1995) The highly conserved defender
against the death (DADI) gene maps to human chromosome 14q11-q12 and mouse chromosome
14 and has plant and nematode homologs, FEBS Letters 363,304-306.
9. Sugimoto, A., Hozak, RR, Nakashima, T., Nishimoto, T. and Rothman, J.H., (1995) DAD-I, an
endogenous programmed cell death suppressor in Caenorhabditis elegans and vertebrates, EMBO
J. 14, 4434-4441.
10. Tanaka, Y., Makishima, T., Sasabe, M., ichinose, Y., Shiraishi, T., Nishimoto, T. and Yamada, T.
(1997) Dad-I, a putative programmed cell death suppressor gene in rice, Plant Cell Physiol 38,
379-383.
II. Gallois, P., Makishima, T., Hechtt, V., Despres, B., Laudie, M., Nishimoto, T. and Cooke, R .. ,
(1997) An Arabidopsis thaliana cDNA complementing a hamster apoptosis suppressor mutant,
PlantJ. 11, 1325-1331.
12. Orzacz, D. and Granell, A., (1997) The plant homologue of the defender against apoptotic death
gene is down-regulated during senescence of flower petals, FEBS Letters 404, 275-278.
13. Silberstein, S., Collins, P.G., Kelleher, D.1., and Gilmore, R., (1995) The essential OST2 gene
encodes the 16-kD subunit of the yeast oligosaccharyltransferase, a highly conserved protein
expressed in diverse eucaryotic organisms, J Cell BioI 131, 371-383.
14. Kelleher, D.J. and Gilmore, R., (1997) DADI, The defender against apoptotic cell death, is a
subunit of the mammalian oligosaccharyltransferase, Proc Natl Acad Sci USA 94,4994-4999.
IS. De Jong, A.J., Yakimova, E.T., Hoeberichts, F.A., Maximova, E., and Woltering, E.1., Caspase-
like proteases are involved in apoptotic cell death in plants, submitted
RNASE ACTIVITY IS POST-TRANSLATIONALLY CONTROLLED DURING
THE DARK-INDUCED SENESCENCE PROGRAM
D. R. GALLIE AND S.-c. CHANG

Department of Biochemistry, University of California, Riverside, CA
92507-0129, USA
I. Abstract
The activities of RNases and nucleases in wheat leaves are subject to control by stresses
such as heat shock and prolonged darkness. Examination of one 27 kDa RNase
revealed that heat shock resulted in a reduction of its activity without altering the level
of the protein, suggesting post-translational control. During dark-induced senescence,
all RNase and nuclease activities increase and the increase in 27 kDa RNase activity is
controlled by ethylene. Examination of the 27 kDa RNase revealed that the increase in
its activity was not accompanied by an increase in the level of the protein. Two-
dimensional RNase activity gels and western analysis demonstrated that the 27 kDa
RNase exists as multiple isoforms and that the activity of all isoforms increases during
dark-induced senescence. These observations demonstrate that the increase in 27 kDa
RNase activity is controlled post-translationally but is not achieved through changes in
its isoelectric state.
2. Introduction
The regulation and cellular role of RNases in plants is still poorly understood. For
instance, the RNase(s) involved in mRNA turnover have yet to be identified in plants
or, indeed, in any higher eukaryote. However, RNase activities have been identified
and, in some respects, characterized in several plant species [reviewed in 8]. In wheat,
three RNase activities have been observed [3]. An acidic RNase (approximately 20
kDa) is ubiquitous in plant species that is often localized to the vacuole or endoplasmic
reticulum or secreted from the cell [8]. The other two are neutral RNases that differ both
in size and in their catalytic requirements. One RNase is approximately 27 kDa in size
and is inhibited by salt or MgCI2 whereas the other is composed of a group of RNases
(the major species of which is 26 kDa in size) whose activity is stimulated by salt or
MgCI2 [3]. All three RNase activities are induced as part of the senescence program [4]
as has been shown for specific RNases in Arabidopsis and other species [8, 13]. The
neutral RNases are present at only a low level in untreated wheat leaves but are induced
to a high level during senescence [4].
221
222
We previously observed that heat shock results in a coordinate loss of translational

efficiency and an increase in mRNA stability in plants [7]. mRNA stability increases
following a heat shock and the increase is a function of the severity of the stress [7].
Following a 15 min exposure to 37C, the functional half-life of a reporter mRNA
increased 50%, but increased 5-fold following a 42C heat shock, and nearly 9-fold
following a 45C heat shock. The thermally-induced increase in mRNA half-life could
be a result of two non-mutually exclusive possibilities: a reduction in the amount or
activity of those RNases responsible for mRNA degradation, or a sequestration of
mRNAs from RNase attack.
A number of studies have shown that exposure to heat shock results in profound
changes at almost every level of gene expression including translation. Although heat
shock results in a rapid disassembly of polyribosomes and the repression of translation
from non-hsp mRNAs, these mRNAs are not destroyed, but appear to be maintained in
heat-shock granules (HSGs) that include heat shock proteins [10, 11]. The HSGs
associate with the cytoskeleton forming perinuclear complexes in plants [1, 11], in
invertebrates [2, 9], and vertebrates [6]. The non-hsp mRNAs are subsequently recruited
for translation upon recovery [12]. The sequestration of mRNAs following heat shock
suggests that mechanisms have evolved throughout many species to conserve mRNAs
until recovery ensues.
Our observation that the stability of mRNAs increase in plants following a heat
shock [7] suggested that in addition to the possibility of sequestration, the increase in
stability might result from a decrease in expression and/or the repression of intracellular
RNase activities. Direct analysis of RNase and nuclease activities in wheat leaves
demonstrated that the activity of all detectable RNases decreased following a heat shock
[5]. RNase activity in extracts or following purification was heat stable even following
renaturation from boiling in the presence of SDS, demonstrating that the heat-mediated
reduction in RNase activity in leaves is not a result of thermal lability of the enzyme
itself. Analysis of the 27 kDa neutral RNase by westerns demonstrated that the level of
RNase protein did not decrease following a heat shock, suggesting that the observed
decrease in its activity in heat-shocked leaves may be due to post-translation control [5].
Using two-dimensional (2D) RNase activity gels, three isoforms of this RNase was
observed. 2D gel/western analysis demonstrated that the most acidic isoform
predominated in control leaves whereas the most basic isoform predominated in leaves
following a heat shock which correlated with the heat-shock-induced reduction in
RNase activity and the increase in mRNA half-life [5]. These data suggested that the
heat-induced dephosphorylation of RNase might playa role in the observed decrease in
RNase activity and increase in mRNA stability that occurs as part of the heat shock
response.
The activity or expression of RNase and nucleases in wheat leaves is also induced
following prolonged growth in the dark [3, 4]. Because the observations concerning the
control of RNase activity following a heat shock suggested regulation at the post-
translational level, we examined whether the dark-induced p27 RNase activity involves
changes in its level or activity and whether the induction involves changes in the
distribution of its isoforms using 2D-RNase activity gels and 2D-gel/western analysis.
223
Days of germination
in light: 0 2 4 6 8 10 12 14 16 20
Nucleases
p27 RNase
p27 RNase
1 2 3 4 5 6 7 8 9 10
Days of germination
in dark: 0 2 4 6 8 10 12 14 16 20
Nucleases
p27 RNase
p27 RNase
123 4 5 6 7 8 9 10
Figure 1. p27 RNase activity and protein expression are non-coordinately regulated during dark-induced
senescence. Extracts from seedlings germinated in the light (top two panels) or dark (bottom two panels) were
assayed for p27 RNase activity (top panel in each set) using activity gels and for p27 protein (bottom panel in
each set) using western analysis. 10 ~g of protein was used for western analysis whereas 2 ~g protein was
analyzed in the RNase assay.
3.1. RNASE ACTIVITY GELS, 2D-GEL ELECTROPHORESIS, AND WESTERN

ANALYSIS
RNase activity gels were performed using 12% SDS-PAGE gels containing 100 ~glml
wheat ribosomal RNA as described [5]. For 2D gel electrophoresis, the protein samples
were precipitated with acetone and resuspended in 9.5 M urea with 2% ampholites (a
224
3: 1 mixture of pH 5-8:pH 3-lO ampholites). 5-50 f.lg of protein (depending on the

analysis being performed) was analyzed as described [5]. For western analysis, the
protein was resolved and transferred to nitrocellulose membrane using semi-dry
transblotting. Western analysis was performed as described [5] and the RNase signal
detected using chemiluminescence.
To examine the expression and activity patterns of the p27 RNase in light and dark
grown leaves, wheat seed were germinated under conditions of light or dark up to 20
days. Aqueous extracts made from the leaves/coleoptile collected at intervals (from 2-
20 days) or from seed (for the 0 day time point) were assayed for RNase activity on
12% SOS-PAGE gels containing RNA. Extracts were also resolved on 12% SOS-
PAGE gels that were then transferred to membranes for western analysis using anti-p27
RNase antibodies [5]. No p27 RNase activity was observed in mature seed (see lane 1,
Fig. 1). However, in seed germinated in either the light or dark, p27 RNase activity was
observed by 2 days, which then increase by 4 days. p27 RNase activity decrease to a
low but detectable level during subsequent growth in the light but remained constant in
dark-grown seedlings until 12 days whereupon activity increased substantiaIly.
Nuclease activity was also induced from 14-20 days in the dark. The level of p27
protein in either the light or dark-grown seedlings as revealed by western analysis
followed the activity pattern of RNase in light-grown seedlings but not that of dark-
grown seedlings (Fig. 1). A high level of p27 protein was observed in dry seed
although p27 RNase activity was not detected. The level of p27 protein increased up to
4 days of germination in either the light or dark but then decreased during subsequent
growth. This pattern of expression differs significantly from the changes in activity
observed in dark-grown seedlings, particularly from 14-20 days of growth when an
sharp increase in activity is observed at a time in which the level ofp27 protein remains
constant (Fig. 1). These data suggest that the regulation of p27 RNase activity during
dark-induced senescence is controlled post-translationally.
We had previously observed that heat shock results in a rapid and substantial decrease
in the level ofp27 RNase activity [5] and that p27 is present as multiple isoforms whose
distribution changes following a heat shock [5]. As a heat shock resulted in no change
in the level of p27 protein, a post-translational regulatory mechanism was the most
likely explanation for the heat-shock-induced changes in p27 RNase activity. In order
to examine whether the non-coordinate control ofp27 RNase activity and protein during
dark-induced senescence is controlled post-translationally through alterations in the
distribution of its isoforms, extracts made from light and dark-grown wheat leaves were
assayed for p27 RNase activity using 20 activity gels and for protein using 20-
gel/western analysis. Light grown seedlings shifted into the dark or dark-grown
seedlings shifted into the light were also examined. Multiple isoforms of p27 RNase
activity were observed in either dark-grown seedlings or those initially grown in the
light and then shifted to dark for 12 days (Fig. 2). The number of isoforms observed by
the activity assay is greater than that detected by western analysis as previously
observed [5], suggesting that the additional isoforms are highly active but not abundant
225
(I) (I) (I) (I)

~ ~ ~ ~
~ ~ ~ ~
~ N
p. N
p. N
p.
\I")
\Ci
,
t
\I")
v)
\0
~
0\
rri
~ .:d
ai
~
b/)
c..
a
!::::
CI i3: ;:1
.....
-b ~
~ ~ 0
~
0
\I")
\Ci
\I")
v)
\0
~
~
('l
en
<tS
~
(I) <tS '"
(I)
~
c..
~ ~
~ ...2 r--- 'U
~
(I)
'U r--- ~ r---
~ Z
('l
~
Z
:::I ('l
~
rI)
Z P. P.
0
rI)
Figure 2. The distribution ofp27 RNase isoforms in RNase activity gels (left panels) and western analysis
(right panels) of light and dark-grown seedlings. Soluble protein from wheat leaves were separated using two-
dimensional activity gels or westerns using isoelectric focusing in the first dimension followed by SDS-PAGE
in the second.
226
species of the p27 RNase or that they are immunologically distinct. These isoforms
observed in dark-grown seedlings were also observed at a lower level in dark-grown
seedlings shifted to the light for 12 days. As p27 RNase activity is just detectable in
light-grown seedlings, this indicates that recovery from the dark-induced senescence
program to the level observed in light-grown seedlings requires a period longer than 12
days. Although just detectable, the activity pattern of p27 in light-grown seedlings was
similar to that observed in seedlings subjected to the various dark treatments. Western
analysis indicated that p27 exists as three prominent isoforms in light-grown seedlings
(Fig. 2) as previously observed [5]. The number and distribution of isoforms in dark-
grown seedlings was similar although an additional, basic isoform not observed in light-
grown seedlings was detected (Fig. 2). It is unlikely that this represents the means by
which RNase activity is induced as each individual isoform increases in activity during
dark-induced senescence.
From these observations, we conclude that induction of this ethylene-regulated
RNase is part of the dark-induced senescence program and that its activity is induced
primarily through post-translational means. Because each individual p27 isoform
increases following dark treatment and that changes in its isoelectric state between light
and dark-grown seedlings are minimal, the activation of p27 RNase activity during
dark-induced senescence through changes in its isoelectric state can be ruled out.
5. References
I. Apuya, N.R and Zimmerman, 1.L. (1992) Heat shock gene expression is controlled primarily at
the translational level in carrot cells and somatic embryos, Plant Cell 4, 657-665.
2. Arrigo, A-P. (1987) Cellular localization of HSP23 during Drosophila development and following
subsequent heat shock, Dev. Bioi. 122,39-48.
3. Blank, A and McKeon, T.A (1991) Three RNase in senescent and nonsenescent wheat leaves,
4. Blank, A and McKeon, T.A (1991) Expression of three RNase activities during natural and dark-
induced senescence of wheat leaves, Plant Physiol. 97, 1409-1413.
5. Chang, S.-c. and Gallie, D.R (1997) RNase activity decreases following a heat shock in wheat
leaves and correlates with its post-transcriptional modification, Plant Physiol. 113, 1253-1263.
6. Collier, N.C. and Schlesinger, M.1. (1986) The dynamic state of heat shock proteins in chicken
embryo fibroblasts, J. Cell Bioi. 103, 1495-1507.
7. Gallie, D.R, Caldwell, C., and Pitto, L. (1995) Heat shock disrupts cap and poly(A) tail function
during translation and increases mRNA stability of introduced reporter mRNA, Plant Physiol. 108,
1703-1713.
8. Green, P.l. (1994) The ribonucleases of higher plants, Ann. Rev. Plant Physiol. Plant Mol. Bioi. 45,
421-445.
9. Leicht, B.G., Biessmann, H., Palter, K.B., and Bonner, 1.J. (1986) Small heat shock proteins of
Drosophila associate with the cytoskeleton, Proc. Nat!. Acad. Sci. USA 83, 90-94.
10. Nover, L., Scharf, K.-D., and Neumann, D. (\983) Formation of cytoplasmic heat shock granules
in tomato cell cultures and leaves, Mol. Cell. Bioi. 3, 1648-1655.
II. Nover, L., Scharf, K.-D., and Neumann, D. (1989) Cytoplasmic heat shock granules are formed
from precursor particles and are associated with a specific set ofmRNAs, Mol. Cell. Bioi. 9, 1298-
1308.
12. Storti, RY., Scott, M.P., Rich, A, and Pardue, M.L. (1980) Translational control of protein
synthesis in response to heat shock in D. melanogaster cells, Cell 22, 825-834.
13. Taylor, C.B., Bariola, P.A., del Cardayre, S.B., Raines, R.T., and Green, P.J. (\993) RNS2: a
senescence-associated RNase of Arabidopsis that diverged from the S-RNases before speciation,
Proc. Nat!. Acad. Sci. USA 90, 5118-5122.
ETHYLENE REGULATION OF ABSCISSION COMPETENCE
c.c. LASHBROOK AND H.J. KLEE

Horticultural Sciences Department, University of Florida, 1301 Fifield
Hall, Gainesville, FL. 32611-0690, USA
1. Abstract
Abscission, the process by which plants shed organs, occurs at a specialized site known
as the abscission zone. Plant organ detachment is regulated by multiple developmental,
hormonal and environmental cues. Cotton is an agronomically important crop that
exhibits high rates of premature abscission in response to both biotic and abiotic signals.
The developmental acquisition of abscission competence in cotton is associated with
significant alterations in ethylene biosynthesis and perception in the abscission zone,
adjacent petiole or pedicel tissue, and terminal organ, e.g. leatblade or flower.
Abscission of aerial tissues triggered by environmental cues may be dependent upon
regulated ethylene action in additional organs including roots. Our research aims to
establish the molecular genetic mechanisms by which regulation of ethylene
biosynthesis and perception throughout the cotton plant contributes to abscission
competence. Here, we report on the cloning of four members of the cotton ACC
oxidase gene family from floral abscission zones. Gh-ACO gene expression was
evaluated in multiple tissues of plants engaged in drought stress-mediated leaf
abscission. Gh-AC02 mRNA accumulated in wilting roots and shoots of stressed
plants, declining upon rehydration. Other Gh-ACO mRNAs were not significantly
regulated in these tissues. Accumulation of Gh-AC02 mRNA in wilting roots is
presumed to be dependent upon ACC synthesis catalyzed by one or more root-localized
ACC synthases.
2. Introduction
Ethylene is an integral component of the mechanisms by which plants sense and

respond to their surroundings. The synthesis of ethylene in response to such diverse
stresses as flooding, drought, and dim light illustrates the central role played by this
hormone in coordinating plant responses to the environment. Ethylene also promotes
and integrates many of the developmental transitions within a typical plant life cycle.
Thus, ethylene accelerates seed germination, inhibits shoots elongation, modulates the
timing of senescence and promotes organ detachment [I]. Early plant physiological
analyses of abscission established that the acquisition of abscission competence is
associated with significant changes in ethylene biosynthesis and perception throughout
227
228
tissues of the subtending organ [3,4, 17]. Here, we consider the molecular mechanisms
by which developmental and environmental abscission cues lead to the modulation of
ethylene synthesis and perception, and how in tum regulated ethylene may confer
abscission competence.
3. Ethylene Mediated Abscission Competence as a Whole Plant Process
The abscission zone consists of a tier of morphologically and/or biochemically distinct

cells containing a cell separation layer where enzymically-mediated organ shed occurs.
Many cell wall hydro lases that degrade substrates within the separation layer are auxin-
inhibited and ethylene activated [7, 12, 14, 29]. Prior to abscission, auxin flux from
tissues of the subtending organ maintains the separation layer in an ethylene insensitive
state [2]. Regulated depletion of auxin and synthesis of ethylene subsequently activates
cell wall disassembly within the separation layer, leading to organ shed.
Initiation of the abscission process takes place in non-abscission zone tissues upon
receipt of an abscission stimulus. In a leaf petiole abscising in response to natural
aging, perception of the stimulus may occur within the senescing leaf blade. In a leaf
petiole abscising in response to drought stress, the cue may be perceived in roots far
removed from the abscission zone. How is an abscission stimulus perceived in an aging
leatblade or in a stressed root system processed and transduced into a common response
within a detaching petiole? Significant evidence suggests that ethylene plays a central
role in promoting and coordinating complex abscission responses.
3.l. PERCEPTION OF THE ABSCISSION STIMULUS OCCURS OUTSIDE OF

THE ABSCISSION ZONE
3.1.1. Role of Ethylene Synthesis and Perception Distal to the Abscission zone
Regulated ethylene synthesis and perception in distal tissues prior to organ shed may be
a common feature of plant abscission systems. Beyer [3] demonstrated that detachment
of a cotton leaf at its petiole was dependent upon ethylene perception by the leafblade,
implicating a role for tissues distal to the abscission zone in conferring abscission
competence. Increased ethylene biosynthesis within terminal organs is also observed
prior to organ shed. For example, naturally aging cotton leaves synthesize ethylene for
several days prior to abscission [22]. Ethylene production in petioles increases prior to
natural leaf drop [4]. Up to 10-fold increases in ethylene production are observed in
immature and mature cotton bolls. before abscission and dehiscence, respectively [17,
18]. The purpose of producing ethylene in distal tissues may be to activate cell wall
modifying enzymes in the nearby cell separation layer.
3.1.2. Role ofEthylene Synthesis and Perception Proximal to the Abscission zone
Numerous abscission responses are induced by environmental cues acting proximal to
the site at which organ shed will occur. Jordan et al. [11] have reported that cotton
leaves under water stress are "predisposed" to abscission promotion by ethylene,
implicating a change in ethylene sensitivity within stressed tissues. However, more
attention has been given to the changes in ethylene biosynthesis that occur in tissues
229
proximal to abscission zones destined to abscise. In tomato, flooding of plants results in

shoot epinasty and organ abscission. Three flooding-induced ACC synthases have been
localized to root tissues [23, 24]. ACC flux to aerial portions of the tomato plant and
conversion of ACC to ethylene by ACC oxidase is correlated with the epinastic [5, 8]
and, presumably, abscission responses. One purpose of regulated ethylene biosynthesis
or precursor production in proximal tissues may be to relay abscission signals over
considerable distances to sites of response.
3.2. THE ABSCISSION RESPONSE OCCURS IN THE CELL SEPARATION

LAYER
3.2.1. Role of Ethylene Synthesis and Perception within the Abscission zone
The response of an abscission zone to ethylene is developmentally determined. Leaf
position determines whether or not a cotton organ will detach in response to
exogenously provided ethylene; young leaves are preferentially shed [21, 28]. Floral
buds approaching anthesis rarely shed while the rate of young boll abscission is
maximal within a week after anthesis [9]. Differential ethylene sensitivity within
abscission zones is presumed to be dependent upon the regulated expression of ethylene
receptors. In cotton, at least three ETRI homologs coordinate ethylene perception
processes in flower abscission zones [Lashbrook and Klee; unpublished]. In tomato,
three members of the ethylene receptor gene family are expressed in abscission zones of
leaves and flowers [16, 25, 30, 31]. LeETRI, also known as eTAEI, is expressed at
constitutive levels in all plant tissues surveyed, including leaf and flower abscission
zones [16, 30]. LeETR2 (TFE27) and LeETR3 mRNA levels remain quite uniform
within abscission zones as tomato flowers open, senesce, abscise or set fruit [16]. The
contributions of individual receptors to regulation of ethylene sensitivity within
abscission zones has yet to be established
The origin of ethylene perceived by abscission zone receptors appears to include
hormone synthesized distal to the abscission zone (Section 2.1.1.). Abscission zone
cells also appear to have the capacity to synthesize hormone. Multiple cDNAs
corresponding to ACC synthases and ACC oxidases have been cloned from abscising
cotton abscission zones [Lashbrook and Klee, unpublished; and see Section 3.1.].
4. Abscission-Related Ethylene Biosynthetic Enzymes and Receptors in Cotton
4.1. MOLECULAR CLONING OF ABSCISSION ZONE ACC SYNTHASES, ACC

OXIDASES AND ETHYLENE RECEPTOR HOMOLOGS
A UniZap cDNA library (Stratagene) was prepared from abscission zone mRNA
isolated from ethylene-treated floral explants. Screening of the library with Arabidopsis
ETRI [6], tomato ACC synthase [26] and tomato ACC oxidase [to] led to the isolation
of two receptor homologs, eight ACC synthases and three ACC oxidases. Screening of
the library with a mix of PCR amplification products of reverse-transcribed abscission
zone mRNA yielded an additional ACC oxidase.
230
4.2. ACC OXIDASE GENE EXPRESSION IN COTTON ABSCISSION ZONES
All four Gh-ACO genes were induced in abscission zones of ethylene-treated flower bud
explants, with the mRNA for AC03 accumulating to the highest level (Fig. I).
GhAC01
GhAC02
GhAC03
GhAC04
+
Abscission Status
Figure 1. ACC oxidase mRNA accumulation in cotton buds abscising in

response to C2H.t. The GhAC03 autoradiograph was exposed for one
third the time as the others.
4.3. ACC OXIDASE GENE EXPRESSION IN ROOTS AND SHOOTS DURING

WATER STRESS AND REHYDRAnON
Abscission of cotton leaves and young buds in response to water stress usually occurs
following rehydration [19, 20, 27]. When watering of six-week-old plants with 7-9
expanded leaves was discontinued, moderate leaf wilting was evident by the third day
and severe wilting by the fifth. By day five, abscission of a number of first and second
true leaves had occurred. Rehydration of plants on day five rapidly restored turgor and
initiated the abscission of additional first and second true leaves (data not shown).
Northern analysis of total RNAs isolated from stressed tissues revealed the
accumulation of Gh-AC02 mRNA in wilting roots and epicotyls, with RNA abundance
declining upon plant rehydration (Fig. 2). In contrast, expression of Gh-AC04 was
relatively constitutive throughout water stress and rehydration and Gh-ACOI mRNA
was not detected at all (Fig. 2). These data may suggest that Gh-AC02 is the primary
ACC oxidase enzyme responsible for water stress-induced ethylene production in roots
and shoots of cotton.
231
Cotton abscission is accompanied by significant changes in ethylene metabolism and

sensitivity. Technical advances have provided the molecular genetic tools required to
determine the genes that control these changes and the mechanisms by which changes in
their expression determine where and when cotton organs abscise. Molecular genetic
modification of proteins conferring tissue-specific ethylene insensitivity would
represent an important means of potentially reducing abscission-associated crop losses.
Attempts to identify genes important for abscission have frequently targeted cell
wall hydro lases expressed in abscission zones [12-14, 29]. Molecular genetic
manipulation of one such gene, cell, reduced the incidence of tomato flower abscission
by up to one-third but could not completely inhibit abscission [15]. It is likely that cell
separation is dependent upon multiple cell wall enzymes exhibiting potentially complex
substrate specificities. In view of ample evidence for regulated ethylene sensitivity and
metabolism in tissues distal and proximal to the abscission zone preceding organ shed,
it is reasonable to suspect that transgenic manipulation of ethylene-related genes within
these tissues could modulate abscission incidence. A molecular physiological approach
to the study of ethylene synthesis and perception throughout the whole plant engaged in
organ abscission is a critical step to defining and modifying early determinants of
abscission competence.
Roots Epicotyls
Gh-AC01
Gh-AC02
Gh-AC04
c c c c
=I!! =I!!
0 0
=I!! =I!!
0
"0
0
"0
.:!::: .:!::: ~ "0
>- OJ .:!::: >- >-
0
:;..
ai ai .r::.
!
.r::.
! 0
>-
i ai .r::.
!
.c
!
l\! "S .r::. "0 l\! .r::. "0
~ :E u. <') ~ :E ~ <') ..-
Figure 2. ACC oxidase mRNA accumulation in roots and epicotyls throughout water stress and rehydration.
232
6. Acknowledgements
The technical assistance of Rebecca Laurie is gratefully acknowledged. This work was
funded by a USDAINRICGP Postdoctoral Fellowship (97-35100-4192) to c.c.L. and a
gift from the Monsanto Co. to H.J.K.
7. References
I. Abeles, F.B., Morgan, P.W. and Saltveit, M.E. (1992) Ethylene in Plant Biology, 2nd Edition,
Academic Press, San Diego.
2. Addicott, I'.T. (1982) Abscission, University of California Press, Berkeley.
3. Beyer, E.M. (1975) Abscission: The initial effect of ethylene is in the leaf blade, Plant Physiol. 55,
322-327.
4. Beyer, E.M. and Morgan, P.W. (1971) Abscission: The role of ethylene modification of auxin
transport, Planl Physio/ 48, 208-212.
5. Bradford, KJ. and Yang, S.F. (1980) Xylem transport of I-aminocyelopropane carboxylic acid, an
ethylene precursor, in waterlogged tomato plants. Plant Physiol. 65,322-326.
6. Chang, e., Kwok, S.F., Bleecker, A.B. and Meyerowitz, E.M. (1993) Arabidopsis ethylene
response gene Elrf: similarity of product to two-component regulators. Science 262, 541-544.
7. del Campillo, E. and Bennett, A.R. (1996) Pedicel breakstrength and cellulase gene expression
during tomato flower abscission, Plant Physiol. 111,813- 820.
8. English, PJ., Lycett, G.W., Roberts, JA and Jackson, M.B. (1995) Increased 1-
aminocyclopropane carboxylic acid oxidase activity in shoots of flooded tomato plants raises
ethylene production to physiologically active levels, Plant Physiol. 109,1435-1440
9. Guinn, G. and Brummett, D.L. (1988) Changes in abscisic acid and indoleacetic acid before and
after anthesis relative to changes in abscission rates of cotton fruiting forms, Plant Physiol. 87,
629-631.
10. Holdsworth, MJ., Bird, e.R., Ray, J., Schuch, W. and Grierson, D. (1987) Structure and
expression of an ethylene-related mRNA from tomato, Nuc!. Acids Res. 15,731-739.
II. Jordan, W.R., Morgan, P.W. and Davenport. T.L. (1972) Water stress enhances ethylene-mediated
leaf abscission in cotton, Plant Physiol. 50, 756-758.
12. Kalaitzis, P., Koehler, S.M. and Tucker, M.1.. (1995) Cloning of a tomato polygalacturonase
expressed in abscission, Plant Molec. BioI. 28,647-656.
13. Kalaitzis, P., Solomos, T. and Tucker, M.L. (1997) Three different polygalacturonases are
expressed in tomato leaf and flower abscission. each with a different temporal expression pattern.
14. Lashbrook, c.e., Gonzalez-Bosch, C. and Bennett, A.B. (1994) Two divergent cndo-I3-I,4-
glucanasc genes exhibit overlapping expression in ripening fruit and abscising flowers, Plant Cell
6,1485-1493.
15. Lashbrook, e.C., Giovannoni, JJ., Hall. B.D., Fischer, R.L. and Bennett, A.R. (1998) Transgenic
analysis of tomato endo-I3-I,4-glucana~e gene expression. Role of cell in floral abscission, Plant J.
13,303-310
16. Lashbrook, e.e., Tieman, D.1.. and Klee, HJ. (1998) Differential regulation of the tomato ETR
gene family throughout plant development, Plant J. 15. 243-252.
17. Lipe, J.A. and Morgan, P.W. (1972) Ethylene: Role in fruit abscission and dehiscence proccsses,
Plant Physio/' 50,759-764.
18. Lipe, J.A and Morgan, P.W. (1973) Ethylene. a regulator of young fruit abscission, Plant Physiol.
51,949-953.
19. McMichael, B.\.., Jordan, W.R. and Powell, R.D. (1972) An efTect of water stress on ethylene
production by intact cotton petiolcs, Plant Physiol. 49,658-660.
233
20. McMichael, B.L., Jordan, W.R and Powell, RD. (1973) Abscission process in cotton: induction
by plant water deficit, Agron. J. 65,202-204.
21. Morgan, P.W. and Durham, .JI. (1973) Leaf age and ethylene-induced abscission, Plant Physiol.
52,667-670. .
22. Morgan, P.W., He, C.-J. and Drew, M.C. (1992) Intact leaves exhibit a climacteric-like rise in
ethylene production before abscission, Plant Physiol. 100, 1587-1590.
23. Olson, D.C., Oetiker, J.H. and Yang, S.F. (1995) Analysis of LE-ASC3, a l-aminocyclopropane
carboxylic acid synthase gene expressed during flooding in the roots of tomato plants, J. Bioi.
Chern. 270, 14056-14061.
24. Shiu, O.Y., Oetiker, J.H., Yip, w.K., and Yang, S.F. (1998) The promoter of LE-ACSl, an early
flooding-induced l-amino-cyclopropane-I-carboxylate synthase gene of the tomato, is tagged by a
SOL3 transposon, Proc. Nat. Acad. Sci. U.s.A. 95, 10334-10339.
25. Payton, S., Fray, R.G., Brown, S. and Grierson, D. (1996) Ethylene receptor expression is
regulated during fruit ripening, flower senescence and abscission, Plant Mol. Bioi. 31, 1227-1231.
26. Rottman, W.H., Peter, G.F., Oeller, P.W., Keller, J.A., Shen, N.F., Nagy, B.P., Taylor, L.P.,
Campbell, AD.and Theologis, A (1991) l-aminocyclopropane carboxylate synthase in tomato is
encoded by a mUltigene family whose transcription is induced during fruit and floral senescence,
J. Mol. Bioi. 222,937-961.
27. Stockton, J.R., Donben, L.D. and Walhood, Y.T. (1961) Boll shedding and growth of the cotton
plant in relation to irrigation frequency, Agron. J. 53,272-275.
28. Suttle, J.e. and Hultstrand, J.F. (1991) Ethylene-induced leaf abscission in cotton seedlings: The
physiological bases for age-dependent differences in sensitivity, Plant Physiol. 95,29-33.
29. Tucker, M.L., Sexton, R, del Campi\lo, E. and Lewis, L.N. (1988) Bean abscission cellulase.
Characterization of a cDNA clone and regulation of gene expression by ethylene and auxin, Plant
Physiol. 88, 1257-1262.
30. Zhou, D., Kalaitzis, P., Matoo, AK. and Tucker, M.L. (1996) The mRNA for an Etrl homologue
in tomato is constitutively expressed in vegetative and reproductive tissues, Plant Mol. Bioi. 30,
1331-1338.
31. Zhou, D., Matoo, AK. and Tucker, M.L. (1996) Molecular cloning ofa tomato cDNA encoding an
ethylene receptor, Plant Physiol. 110, 1435.
ROLE OF ETHYLENE SENSITIVITY IN MEDIATING THE CHILLING-
INDUCED LEAF ABSCISSION OF IXORA PLANTS
R. MICHAEU 1, S. PHILOSOPH-HADAS 1, J. RIOy2 AND S. MEIRI

I Department of Postharvest Science of Fresh Produce. ARO. The Volcani
Center. Bet Dagan 50250; and 2The Kennedy-Leigh Centre for
Horticulture Research. Faculty of Agriculture. The Hebrew Universityof
Jerusalem. Rehovot 76100. Israel
1. Abstract
Exposing intact ixora (Ixora coccinea) plants or petiole explants to chilling (3 days/3, 7
or 9C) resulted in 20-80% abscission of mature, non-senescent leaves, manifested only
2 days after transfer to 20e. The degree of leaf abscission increased with reduction of
the chilling temperature. Chilling exposure induced also a significant increase in
ethylene production rates in petiole explants during the initial 4 h after transfer to 20C.
A similar pattern of increased ethylene production was obtained in petiole explants
treated with a-naphthaleneacetic acid (NAA) or with the antioxidant butylated
hydroxyanisole (BHA), although these compounds significantly reduced the chilling-
induced leaf abscission. On the other hand, application of the ethylene biosynthesis
inhibitor, aminoethoxyvinylglycine (AYG), which reduced ethylene production of
petiole explants by 60%, inhibited leaf abscission by 70%. However, treating intact
plants with the ethylene action inhibitor, I-methylcyclopropene (l-MCP) prior to
chilling, completely prevented their chilling-induced leaf abscission. These results
suggest that endogenous ethylene is essential for the chilling-induced leaf abscission.
Exposure of intact plants to exogenous ethylene (3- \0 Ill/I) for 1-3 days or treating
petiole explants with I-aminocyclopropane-l-carboxylic acid (ACC), significantly
enhanced their leaf abscission only when they had been pre-exposed to chilling. These
results indicate that abscission induced by chilling is closely correlated with increased
sensitivity of the abscission zone (AZ) to ethylene rather than with chilling-induced
ethylene production. NAA and BHA inhibited both the chilling-induced and the ACC-
enhanced leaf abscission of petiole explants. This indicates the possible involvement of
oxidative processes, probably of IAA, in the chilling-induced leaf abscission that is
mediated by sensitivity to ethylene. It is therefore proposed, that chilling initially
induces oxidative processes in the AZ, which then reduces IAA levels resulting in
increased sensitivity of the AZ to ethylene, which finally causes leaf abscission.
235
236
2. Introduction
Being of tropical origin, Ixora (lxora coccinea) potted plants exhibit susceptibility to
low temperatures (below 12C), manifested by abscission of mature, non-senescent
green leaves [8]. It is generally agreed that the initial event in chilling injury is a direct
effect of low temperature on cellular constituents, which results in changes in
membrane features and/or conformational changes in enzymes and structural proteins
[11]. This includes also induction of peroxide and IAA oxidase [7] and involvement of
free radicals produced during lipid oxidation [13]. Accumulated evidence suggests that
all these chilling-associated events may be derived from the oxidative stress imposed
initially in the tissue upon exposure to low temperature [3]. It was also shown that
petiole abscission in bean explants was directly associated with oxidative processes
induced by unsaturated fatty acids [18]. Considering these indications, it is possible that
the chilling-induced leaf abscission is also mediated through an oxidative stress.
In addition to cellular events, it is well established that when plants are subjected to
a variety of stresses including chilling, they respond by increased ethylene production
rates [9], observed usually in the post-chilling [9] or during [5] the chilling period.
It is generally accepted that leaf abscission results from an altered balance of auxin
and ethylene in the AZ [2, 4, 6, 10, 14, 16]. Ethylene enhances the abscission of leaves
and fruits by promoting the activity of hydrolytic enzymes, which cause cell separation
in the AZ [1,2,6]. This depends on the sensitivity of the tissue to ethylene, which is
regulated in turn by auxin transport to the AZ [4,14]. Thus, high levels of auxin in the
AZ delay the ethylene-induced rise in the activity of the hydrolytic enzymes [10].
The present study has examined the involvement of ethylene, auxin and oxidative
stress in the chilling-induced leaf abscission of ixora intact plants and petiole explants
following exposure to low temperatures. The results show that chilling-induced leaf
abscission in ixora is mainly derived from increased sensitivity of the AZ to ethylene.
3.1. PLANT MATERIAL
Experiments were performed with mature ixora (lxora coccinea) potted plants. Two
different plant systems were used in the various experiments: 1) intact plants containing
only mature, dark green and fully expanded leaves, after removal of buds, inflorescence
and young leaves. 2) Petiole explants (Fig. lA), containing a 2.5-cm stem segment, two
AZ in the junction between the petiole and the stem, and a 4-5-mm leaf blade section.
3.2. ANATOMICAL CHARACTERIZATION OF THE PETIOLE AZ
Longitudinal sections of the petiole AZ tissue (Fig. IA) were prepared before exposure
of intact plants to chilling, immediately after chilling, and 6 and 48 h after transferring
chilling-treated plants to 20C. AZ sections were immediately fixed in formaldehyde
(37-40%): acetic acid: ethyl alcohol (95%): water, 10:5:50:35 (v/v/v/v) solution and
embedded in paraffm. AZ sections were then cut longitudinally with a rotary
microtome (Spencer 820, American Optical) to 12 /lm sections, and stained with
237
Safranin / Fast green (Sigma, USA). The stained sections were then examined under a
light microscope.
3.3. CHILLING TREATMENTS
Intact plants or petiole explants were exposed in the dark to various chilling
temperatures (3, 7 or 9C) for three days. Control plants or explants were kept for the
desired periods at 20C in the dark. For chilling treatment, petiole explants were placed
in wells (I-cm in depth and O.5-cm in diameter) in a 96-well ELISA plate, containing
300 !ll of 5 mg mr' active chlorine complexed as sodium dichloroisocyanureate (TOG-
6, Assia Reisel, Israel) to avoid contamination. ELISA plates were incubated on a layer
of moistened paper in trays covered with perforated polyethylene to avoid desiccation.
3.4. EVALUATION OF LEAF ABSCISSION
Intact plants or petiole were transferred from the chilling temperature to a standard
observation room, maintained at 20C, 60-70% RH and a 12-h photoperiod at a light
intensity of 14 !lmol m-2 s-1. Leaf abscission following chilling and other treatments
was evaluated daily at the observation room, by monitoring the number of leaves
abscised after slightly shaking intact plants, or applying a slight pressure with the
fingers on the leaf blade edge of petiole explants. Groups of 10 marked leaves in intact
plants or 10 petiole explants (containing 20 AZ's) served as one replicate. Results are
presented as percentage of cumulative leaf abscission at 20C until a steady state level
was reached.
3.5. DETERMINATION OF LEAF SENESCENCE PARAMETERS
Samples of leaf tissues (0.5 g) were extracted by boiling for 30 min in 80% ethanol for
amino acid and chlorophyll determination, as previously described [12]. Water content
of leaves was estimated on the basis of dry weight (DW) according to the equation:
(FW-DW) / (DW).
3.6. APPLICATION OF CHEMICALS
NAA (0.1 mM; Assia-Reisel, Israel), BHA (0.66 mM; Xedafen; Xeda, France), ACC
(0.01 mM; (Sigma, USA) or AVG (0.1 mM; Sigma, USA) were applied to petiole
explants before the chilling treatment. NAA or BHA was applied to intact plants by
spraying leaves in a solution containing 0.02% of the surfactant L-77 (Agan chemicals,
Ashdod, Israel). The petiole explants prepared from the treated plants were placed in
ELISA plates containing organic chlorine (as described in section 3.3), and
subsequently exposed to chilling. ACC or AVG were applied in the wells of the ELISA
plates, and the petiole explants were directly pre incubated in the test solutions for 24 h
at 20C, prior to the chilling treatment.
3.7. DETERMINATION OF ETHYLENE PRODUCTION RATES

238
Samples of three petiole explants were enclosed after chilling in 50-ml Erlenmeyer
flasks on a filter paper moistened with 0.5 ml of distilled water. Flasks were then
covered with parafilm and incubated at 20C. Ethylene production rates were
monitored at hourly intervals (1, 4 and 6 h) during this post-chiIIing period by replacing
the parafilm covers with rubber serum caps for 1 h. Ethylene concentration in the flasks
was then analyzed by injecting a 2-ml gas sample into a gas chromatograph (Varian),
equipped with an alumina column and a flame ionization detector.
4.1. CHARACTERIZATION OF THE CHILLING-INDUCED LEAF ABSCISSION

IN INTACT PLANTS AND PETIOLE EXPLANTS
Exposure of intact ixora plants or petiole explants to chilling temperatures (below 12C)
for 3 days in the dark resulted in a significant increase in leaf abscission (Table 1). Leaf
abscission in intact plants was initially observed 2 days after chilling, reaching a steady
state level during the third day after transferring the plants to the observation room (data
not shown). On the other hand, control non-chiIIed petiole explants exhibited 20% leaf
abscission already after 3 days of dark incubation at 20C prior to their transfer to the
observation room (data not shown), and reached 50% abscission 3 days after being
transferred to 20C in photoperiodic light (Table I). Leaf abscission, which occurred in
control explants without chilling, may be considered as an artifact of the explant system
that is unrelated to their chilling-induced leaf abscission.
The percentage of chilling-induced leaf abscission of both intact plants and petiole
explants increased as the temperature decreased (Table I). Thus, 100% of the leaves
were abscised in plants and explants incubated at 3C for 3 days, while only 35-40%
leaf abscission occurred after incubation of plants at 9C for the same period.
Incubation at 7C for 3 days caused 65% and 75% leaf abscission in intact plants and
petiole explants, respectively (Table 1). This relationship between the severity of the
chilling injury and the severity of the chilling stress is a well-known phenomenon in
various chilling susceptible systems [15].
TABLE 1. Effect of various chilling temperatures on leaf abscission
in intact plants and petiole explants of ixora. Results are expressed as
percentage of cumulative leaf abscission, monitored after 3 days at the
observation room and represent means SE of 3 experiments.
Chilling Leaf abscission (%)

temperature (0C) Intact plants Petiole explants
20 (control) o 505
3 100 100
7 65 10 75 10
9 35 +5 n.d.
Amino acid, chlorophyll and water content were similar in leaves abscised from
chilled intact phillts and in leaves detached from non-chilled intact plants (Table 2). This
indicates that ixora leaves abscised before any senescence symptoms, such as
239
cholorophyll, protein and water loss, could be measured, and hence, this chilling-
induced leaf abscission was not correlated with senescence. Thus, chilling-induced leaf
abscission cannot be explained on the basis of changes in the auxin-ethylene balance
due to senescence [1, 2, 14, 16], but rather on changes induced by the chilling stress
itself.
TABLE 2. A comparison ofleaf senescence parameters between leaves detached from non-chilled plants and
leaves abscised from chilled plants. Parameters were determined on the 2nd day after storage at 20 or 4C
Senescence parameter Type ofleaves

Detached from non-chilled plants Abscised from chilled plants
Amino acids (J..lmol/gFW) 6.63 1.67 6.09 0.37
Chlorophyll (mg/gFW) 1.26 0.14 1.32 0.27
Water content (FW-DW/DW) 2.37 0.42 2.04 0.12
Figure I. Photomicrographs of an ixora petiole explant (A) and of longitudinal sections of the AZ prepared
immediately (8) or 48 h (C & D) following the chilling treatment (3 days at rC). Magnification xlO in (8);
x40 in (C) and (D). G = grove, P = parenchyma cells, V = vascular system.
4.2. CHARACTERIZA nON OF THE ABSCISSION ZONE
The AZ between the petiole and the stem of ixora plants (Fig. I A) is a primary tissue,
since it is present as a clear, distinctive tissue with specific cells also throughout normal
leaf development. Anatomical analysis of petiole AZ excised from non-chilled plants,
240
from plants immediately following chilling (Fig. I B) or plants 6 h after chilling shows,
that it consists of 10-20 layers of specific cells, that differ both in shape and size from
the surrounding parenchymatous cells. Thus, morphological changes in the petiole AZ
could be initially observed only after 48 h of the post-chilling period (Figs. I C, D).
These changes were initially manifested in maceration of the AZ cells (Fig. 1C),
followed later on by enlargement of the grove, leading to formation ofa separation layer
and a fracture that fmally separated completely the stem from the petiole (Fig. I D).
4.3. INVOLVEMENT OF ETHYLENE, AUXIN AND OXIDATIVE STRESS
The involvement of ethylene, auxin (NAA) and the antioxidant BHA in the chilling-
induced leaf abscission was further examined with petiole explants. The chilling stress
resulted in increased ethylene production which peaked 4 h after chilling, reaching rates
of 4-5 nl gFW I hoI (data not shown), and lasted for about 6 h after the termination of the
chilling treatment (Fig. 2A). Such induction of higher ethylene production rates after
chilling stress is a typical response of plants, as to other stresses [9].
AVG significantly reduced ethylene production rates of explants during the first h
(Fig. 2A) and 4 h (data not shown) after chilling, but did not nullify it, while NAA and
BHA had no significant effects on ethylene production monitored either 1 or 6 h after
chilling (Fig. 2A). On the other hand, ACC significantly enhanced ethylene production
in explants for 6 h after chilling, with or without NAA or BHA (Fig. 2A).
The effects of these compounds on leaf abscission of explants are illustrated in Fig.
28. The results show that a 70% leaf abscission was obtained in chilled explants
incubated in water, already two days after the chilling treatment (Fig. 2B). This
chilling-induced leaf abscission was significantly reduced on the second day after
chilling to 30, 2 or 10%, in AVG-, NAA- or BHA-treated explants, respectively (Fig.
2B). This suggests that NAA and BHA inhibited both the chilling-induced and the
ACC-enhanced leaf abscission of petiole explants, with NAA being more effective. On
the other hand, the data show that even the residual ethylene production rate of 1 nl
gFWI h- I , obtained in AVG-treated explants (Fig. 2A), was enough to enable a 30%
leaf abscission (Fig. 2B). It seems, therefore, that NAA and BHA, which did not affect
ethylene production rates of explants (Fig. 2A), were more effective than the ethylene
synthesis inhibitor AVG in reducing the chilling-induced leaf abscission (Fig. 2B).
Since AVG was not effective in completely nullifying endogenous ethylene
production in explants, attempts were made to antagonize ethylene action in intact
plants by exposing them to the relatively new ethylene action inhibitor, I-MCP, which
is supposed to block irreversibly all ethylene receptors [17]. Our data show that the
chilling-induced leaf abscission was totally prevented after exposure of intact plants
(either before or after chilling) to I-MCP. These results clearly indicate that like in
other abscission systems [2, 7, 15, 16], the endogenous ethylene rise induced by chilling
is essential for the abscission process in ixora. However, this ethylene rise cannot
explain solely the leaf abscission induced by the chilling stress, since NAA and BHA
seem to reduce the process through modifying the sensitivity of the AZ to ethylene
rather than by affecting endogenous ethylene levels.
To further confirm this suggestion, we have examined the effect of exogenous
ethylene on leaf abscission of non-chilled and chilled intact plants. Exposure of non-
241
chilled intact plants to ethylene (3-10 11111) for 1-3 days in the dark at 20C did not cause
any leaf abscission [8]. However, exposure of chilled (3 days at 7C) plants to the same
ethylene concentrations significantly enhanced their leaf abscission already on the first
day after chilling (data not shown). These results strongly suggest that the chilling
treatment significantly increases the AZ tissue sensitivity to ethylene.
Three approaches were examined in this study for reduction of the chilling-induced
leaf abscission in petiole explants and intact plants: auxin (NAA), antioxidants (BHA)
and inhibitors of ethylene synthesis (AVG) or action (I-MCP). The results show that
NAA and BHA reduced leaf abscission by reducing the chilling-induced sensitivity of
the AZ to ethylene, whereas ethylene inhibitors reduced the process through their
effects on endogenous ethylene production and action. While the effects of I-MCP [17]
and AVG [9] are well understood, and the NAA effects regarding the AZ sensitivity to
ethylene are well-documented [2, 7, 16], the inhibitory effect of the antioxidant BHA is
relatively new. Our data suggest that oxidative processes [18], imposed initially in the
tissue upon its exposure to low temperatures [11], are involved in the induction period
leading to abscission.
-
""".c 6
I c::::J 1 h
I'I2J111J 6 h
A. _ 100 c:::::J Day 1 B.
-
~Day2
""" 5
I
~
LL
~ ~80
z
-
~4
-
c ~60 fI: -
w 3 ~
z
W
..J
2 -
~40
III
~ -
>
::I:
c(
l-
w i - 20
0 ~rn ~ ~ o r _1'"1 r
Figure 2. Effect of AVa (0.1 mM), NAA (0.1 mM), BHA (0.66 mM) or ACC (0.01 mM) on ethylene
production rates (A) and on the chilling-induced leaf abscission (B) of ixora petiole explants. All compounds
were applied to petiole explants prior to their exposure to chilling (3 days at 7C). Results in (A) represent
means SE oD replicates of3 explants, each consisting of2 AZ's. Results in (B) are expressed as percentage
of cumulative leaf abscission, monitored daily (empty or shaded bars) at the observation room, and represent
means SE of 4 replicates of 10 explants.
In summary, the results of the present study demonstrate that the chilling stress
alters the sensitivity of the AZ to ethylene, most likely through increased oxidative
processes, which may lead in tum to reduction of IAA levels. The increase in the AZ
242
sensitivity to ethylene rather than the chilling-induced initial ethylene burst, seems to
mediate the abscission process manifested in leaf drop within 2-3 days after transfer to
20C. The IAA treatment seems to prevent abscission by maintaining high levels of
endogenous IAA in the AZ, thereby rendering this tissue insensitive to ethylene. The
antioxidant treatment may prevent abscission possibly by suppressing oxidative IAA
catabolism and maintaining its transport throw the AZ.
5. Acknowledgment
Contribution from the Agricultural Research Organization, The Volcani Center, Bet
Dagan, Israel, No. 433-98.
6. References
1. Bayer, Jr., E.M. (1975) Abscission: the initial effect of ethylene is in the leaf blade, Plant Physiol.
55,322-327.
2. Brown, K.M. (1997) Ethylene and abscission, Physiol. Plant. 100,567-576.
3. Doulis, AG., Debian, N., Kingston-Smith, AH. and Foyer, H. (1997) Differential localization of
antioxidants in maize leaves, Plant Physiol. 114, 1031-1037.
4. Ernest, L.C. and Valdovinos, 1.G. (1971) Regulation of auxin levels in Coleus blumei by ethylene,
5. Faragher, J.D., Mor, Y. and Johnson, F. (1987) Role of I-Aminocyclopropane-I-carboxylic acid
(ACC) in control of ethylene production in fresh and cold stored rose flowers, J Exp. Bot. 38,
1839-1840.
6. Goren, R. (1993) Anatomical, physiological, and hormonal aspects of abscission in Citrus. Hort.
ReViews, 15, 145-182.
7. Lyons, J.M. and Asmundson, C.M. (1965) Solidification of saturated/unsaturated fatty acid mixture
and its relationship to chilling sensitivity in plants, J. Amer. Oil Chem. Soc. 42, 1056-1058.
8. Meir, S., Yihye, E., Reuveni, Y. and Philosoph-Hadas, S. (1994) Ethylene and auxin regulation of
chilling-induced leaf abscission in, BioI. Plant. 36, S127.
9. Morgan, P.W. and Drew, M.C. (1997) Ethylene and plant responses to stress,. Physiol. Plant. 100,
620-630.
10. Osborne, DJ. (1991) Ethylene in leaf ontogeny and abscission, in AK. Mattoo and J.C. Suttle
(eds.), The Plant Hormone Ethylene, CRC press, London, pp. 194-214.
11. Parkin, K.L., Marangoni, A, Jackman, R.L., Yada, R.Y. and Stanley, D.W. (1989) Chilling injury:
a review of possible mechanisms, J. Food Biochem. 13, 127-153.
12. Philosoph-Hadas, S., Meir, S. and Abaroni, N. (1991) Effect of wounding on ethylene biosynthesis
and senescence of detached spinach leaves, Physiol. Plant. 83,241-246.
13. Prasad, T.K., Anderson, M.D., Martin, B.A. and Stewart, C.R. (1994) Evidence for chilling-
induced oxidative stress in maize seedlings and a regulatory role for hydrogen peroxide, The Plant
Cell 6, 65-74.
14. Riov, J. and Goren, R. (1979) Effect of ethylene on auxin transport and metabolism in midrib
section in relation to leaf abscission of woody plants, Plant Cell Envir. 2,83-89.
15. Saltveit, M.E. and Morris, L.L. (1990) Overview on chilling injury of horticultural crops, in C. Y.
Wang (ed.), Chilling Injury ofHorticultural Crops, CRC Press, Inc. Boca Raton, pp. 3-15.
16. Sexton, R. (1995) Abscission, in M. Pessarakli (ed.), Handbook of Plant and Crop Physiology,
Marcel Dekker, New York, NY, pp. 497-525.
17. Sisler, E.C. and Serek, M. (1997) Inhibition of ethylene responses in plants at the receptor level:
Recent developments, Physiol. Plant. 100,577-582.
18. Veda 1., Morita, Y. and Kato, 1. (1991) Promotive effect of Cl8-unsaturated fatty acid on the
abscission of bean petiole explants, Plant Cell Physiol. 32, 983-987.
EXPRESSION OF ABSCISSION-RELATED ENDO-~-1,4-GLUCANASES
G. CASADORO, L. TRAINOTTI AND C.A. TOMASIN

Dipartimento di Biologia, Universita' di Padova, Viale G. Colombo 3, 1-
35121 Padova, Italy
I. Abstract
Activation of abscission by ethylene involves the expression of specific hydro lases

whose activity is believed to weaken the structure of cell walls at the level of the zones
where the actual shedding will occurr. To this purpose, the role played by endo-~-I,4-
glucanase (EGase) appears particularly interesting, so two genes encoding abscission
EGases in peach (ppEGl) and in pepper (caEG2), respectively, have been studied.
Promoter analysis for the two genes has been carried out in transgenic plants by
studying the expression of the l3-glucuronidase (GUS) reporter gene driven by the two
promoters. In both cases, a similar pattern of GUS expression was observed in tobacco
and Arabidopsis, respectively. In particular, expression of GUS was observed at the
level of abscission zones, besides other tissues undergoing cell separation events.
Contrary to what occurs in planta, where the expression of the abscission EGase genes
appears to be up-regulated by ethylene, a similar effect was not observed for the studied
chimeric genes in the transgenic plants.
2. Introduction
It has long been known that ethylene is involved in the physiology of abscission [1].
When young and healthy leaves are treated with this gaseous hormone, a special
structure will differentiate at the proximal end of the petiole within a short time from the
beginning of the treatment. Plants prior to the natural shedding of organs also normally
produce this structure, named abscission zone (AZ). It consists of a few layers of ceils,
which undergo a number of metabolic changes finally leading to loss of adhesion and
cell separation [6].
Following activation by ethylene, the cells of an abscission zone will start to express
genes coding for hydrolases such as endo-~-I ,4-glucanases (EGases) and
polygalacturonases [3]. The activity of these enzymes is believed to cause a
dismantling of the cell walls at the level of the abscission zone. Albeit information
about perception of ethylene and early steps of the signal transduction pathway have
recently been obtained [5], the mode by which ethylene activates genes encoding cell
wall hydro lases in such a tissue-specific manner remains unknown.
243
244
To try to elucidate this process, endo-j3-1,4-glucanases have been chosen as model

enzymes since their expression can be highly increased by ethylene in abscission zones
[1, 10]. In particular, it has been shown that specific EGase genes are highly transcribed
in abscission zones of peach and pepper plants. In both species the enzyme endo-j3-1,4-
glucanase is encoded by a mUltigene family whose members are differentially expressed
in different cell separation events. pCell is the transcript that is specifically involved in
the abscission of leaves and fruits of peach [12], while cCel2 is the transcript highly
expressed in abscission zones ofleaves and flowers of pepper [11].
In this study we report data about promoter analysis of the genes encoding pCell
and cCe12, respectively. In particular, this analysis has been carried out in transgenic
plants by studying the expression of the j3-glucuronidase (GUS) reporter gene driven by
different regions of the two promoters.
3. Results
The genes encoding the pCell and cCe12 mRNAs have been used to obtain the
promoters to be analyzed. Genomic clones were isolated and named ppEG 1 (Prunus
persica EGase 1) and caEG2 (Capsicum annuum EGase 2), respectively. A fragment of
1650 bp of the ppEGI gene and a fragment of 1894 bp of the caEG2 gene (Fig. 2),
respectively, were fused to the GUS reporter gene [8] and used to transform by means
of A. tume/adens either tobacco or Arabidopsis plants. Transformation of tobacco was
made with the leaf disc method [4], while Arabidopsis was transformed by the vacuum
infiltration method [2].
The two large promoter fragments gave a similar pattern of GUS expression in
tobacco. Cultivated tobacco is able to shed flowers, while the senescent leaves wilt on
the plant. As expected, the promoters of both abscission EGase genes were able to
drive expression of GUS in abscission zones of flowers. However, expression of GUS
was consistently found with both promoters in other tissues, namely the stigma of
flowers and the cortical cells surrounding the lateral root primordia. Also in
Arabidopsis the two different promoters were able to drive expression of GUS in
abscission events, so the blue colour was observed at the level of abscission zones of the
flower components which are normally shed in this plant, that is sepals, petals and
stamens (Fig. lA). However, contrary to what was found in tobacco, GUS was
expressed in very young anthers, but not in flower stigma (Fig. IB). In tobacco, the
three tissues where expression of GUS was observed are all characterized by high levels
of endogenous EGase activity [12]. This suggests that transcription factors able to
activate a tobacco EGase gene might also be able to bind heterologous EGase
promoters, thus causing expression of GUS in those tissues. As for Arabidopsis, similar
analyses were impossible to perform due to the minute sizes ofthe tissues involved.
In order to try and explain the tissue-specificity of expression of GUS, deletions of
the two promoters (Fig. 2) were used to prepare a series of constructs to be analyzed in
transgenic tobacco. The shortest fragment of ppEG 1 , the chimeric gene 31-GUS, was
able to drive expression of GUS only at the level of the flower abscission zones (Tab.
1). Constructs 30-GUS and 29-GUS, ranging from 599 to 1014 bp, besides the flower
AZ, caused expression of GUS also in the flower stigma. As for the lateral root
245
primordia, the blue colour indicating expression of GUS could be observed only when
the whole promoter region (1650 bp construct 27-GUS) was used.
In the case of the caEG2 deletions, the small promoter region (S-GUS, 391 bp) was
already able to drive expression of GUS similar to that of the large fragment. The only
significant difference between the variously sized fragments was an increase in
promoter strength, which paralleled the increase in promoter size.
The possible ability of ethylene to influence expression of GUS in the transgenic
plants could only be examined in transformants bearing the ppEG I promoter, and the
result was that no apparent promotive effect was observed.
Figure 1. Flowers of transgenic Arabidopsis plant harbouring either 27-GUS or M-GUS stained for GUS
activity. In old flowers (A) the typical blue staining is detected in abscission zones of sepals, petals and
stamens. In very young flowers the blue staining is evident in anthers.
Table I: Schematic representation 6fthe different tissue-specificity of GUS expression shown by

different promoter fragments of the ppEGl gene.
Chimeric gene Fragment length AZ stigma Lateral root

(in bp) primordia
31-GUS 406 +
30-GUS 599 + +
29-GUS 1014 + +
27-GUS 1650 + + +
246
1894 bp 11.....1..
1 .....----II---~I~II-I .. - - - - - I !.....-II-I
1650 bp I
L-GUS 27-GUS
o High homology between I I
ppEG1 and caEG2 868bpl I 1014 bp
M-GUS 29-GUS
1 ERE (ATTTCAAA, 7/8 bp), 599 bp I I
........
391bP .......
senescence type (7) 3O-GUS
S-GUS
406 bp
ERE (GCCGCC, 6/6 bp), 31-GUS
PR type (9)
Pepper caEG2 PeachppEG1
Figure 2. Fragments of the caEG2 and ppEGI promoters that have been fused to the GUS
reporter gene and used to assay their regulatory capacity in either tobacco or Arabidopsis plants.
ERE: ethylene-responsive element; PR: pathogenesis-related.
4. Discussion
Two EGase genes, which are specifically expressed in abscission zones following
activation by ethylene, were isolated and studied in transgenic tobacco and Arabidopsis
with the aim to understand the regulation of their tissue-specific expression. The
promoters of the two genes did not share any apparent sequence similarity, but for a
fragment of about 20 bases in a region not far from the TATA box (Fig. 2) [13]. On this
basis, the only common feature we expected to observe was expression of GUS at the
level of abscission zones, and this was true for both promoters in both tobacco and
Aabidopsis AZs, thus confirming the idea that the two EGase genes encode abscission
EGases.
However, expression of GUS was also seen in other tissues where cell separation
events were going on, and the tissues involved were the same for both promoters. So, in
spite of the poor sequence similarity, the two promoters had the same regulatory ability,
although their behaviour varied in different plants. In particular, while expression of
GUS was observed at the level of the female part (stigma) of the tobacco flowers, in
Arabidopsis the blue colour was observed at the level of the male component (anthers)
of the flower. This finding suggests that the two promoters might be related to more
general senescence processes that require cell separation events. Moreover, it is clear
from these results that the type of plants where the promoters were assayed could play
an important role in determining the type of tissues where the reporter gene could be
expressed. In other words, the heterologous system where the promoters were assayed
did not behave as a passive system reflecting the only regulatory ability of the
introduced foreign promoters.
Contrary to what occurs in planta, where a high rate of expression for both EGase
genes was observed following activation of abscission by ethylene, at least in the case
of the ppEG 1 gene, the promoter seemed to be insensitive to the hormone. A search for
the presence of known ethylene-responsive elements (ERE) showed that in the ppEG 1
promoter (Fig. 2) there was only one ERE of the PR-type [9]. Strictly speaking, in the
promoter of the caEG2 gene there was no ERE, albeit a number of these motifs were
found which had 7 bases out of the 8 bases determined for a senescence-related ERE in
carnation [7].
247
These data suggest that the possible ERE of the two promoters might be located
outside the regions analyzed by us. However, we cannot exclude the possibility that
ethylene actually triggers the abscission genetic programme, a part of which is the
expression of EGase genes whose activation by ethylene would therefore be indirect.
5. Acknowledgments
Our research work is supported by grants from CNR and MURST. We wish to thank
Mr. Franco Fattore for growing and taking care of the pepper and tobacco plants used in
this work. L.T. thanks the TMR-ERBFMMACT95-0032 for providing him with a
fellowship to attend the Ethylene Symposium in Santorini.
6. References
I. Abeles, F.B., Morgan, P.W. and Saltveit, M.E. Jr. (1992) Ethylene in Plant Biology, 2nd edn.
2. Bechtold, N., Ellis, 1. and Pelletier, G. (1993) In planta Agrobacterium mediated gene transfer by
infiltration of adult Arabidopsis thaliana plants,. C.R. Acad. Sci. Paris, Sciences de la Vie/Life
sciences, 316, 1194-1199.
3. Bonghi, c., Rascio, N., Ramina, A. and Casadoro, G. (1992) Cellulase and polygalacturonase
involvement in the abscission of leaf and fruit explants of peach, Plant Mol. Bioi. 20, 839-848.
4. Fisher, D.K. and Guiltinan, M.J. (1995) Rapid, efficient production of homozygous transgenic
tobacco plants with Agrobacterium tumefaciens: a seed-to-seed protocol, Plant Mol. Bioi. Reporter
13,278-289.
5. Fluhr, R. (1998) Ethylene perception: from two-component signal transducers to gene induction,
Trends in Plant Science 3,141-146.
6. Gonzales-Carranza, Z.H., Lozoya-Gloria, E. and Roberts, l.A. (1998) Recent developments in
abscission: shedding light on the shedding process, Trends in Plant Science 3, 10-14.
7. Itzhaki, H., Maxon, J.M. and Woodson, W.R. (1994) An ethylene-responsive enhancer element is
involved in the senescence-related expression of the carnation glutathione-s-transferase CGST!)
gene, Proc.Natl. Acad. Sci. USA 91, 8925-8929.
8. Jefferson, R.A., Kavanagh, T.A. and Bevan, M.W. (1987) GUS fusion: ~-glucuronidase as a
sensitive and versatile gene fusion marker in higher plants, EMBO J. 6, 3901-3907.
9. Ohme-Takagi, M. and Shinshi, H (1995) Ethylene-inducible DNA binding proteins that interact
with an ethylene-responsive element, Plant Cell 7, 173-182.
10. Sexton, R. and Roberts, J.A. (1982) Cell biology of abscission, Annu. Rev. Plant Physiol. 33, 133-
162.
II. Trainorti, L., Ferrarese, L., Poznanski, E. and Dalla Vecchia, F. (1998) Endo-~-I,4-glucanase
activity is involved in the abscission of pepper flowers, J. Plant Physiol. 152,70-77.
12. Trainorti, L., Spolaore, S., Ferrarese, L. and Casadoro, G. (1997) Characterization of ppEGI, a
member ofa multigene family which encodes endo-~-1,4-glucanase in peach, Plant Mol. BioI. 34,
791-802.
13. Trainorti, L., Tomasin, c.A. and Casadoro, G. (1998) Characterization of caEG2, a pepper endo-B-
1,4-glucanase gene involved in the abscission of leaves and flowers, This book.
DIFFERENTIAL DISPLAY AND ISOLATION OF cDNAS CORRESPONDING
TO mRNAS WHOSE ABUNDANCE IS INFLUENCED BY ETHYLENE
DURING PEACH FRUIT LET ABSCISSION
A. RAMINAI, C. BONGHII, J.J. GIOYANNONI 2, B. RUPERTI 1 AND

P. TONUTTI 1
I Department of Environmental Agronomy and Crop Science, University
of Padova, Strada Romea 16-Agripolis-35020 Legnaro, Padova, Italy

2Department of Horticultural Sciences, Texas A&M University, College
Station TX 77843, USA
l. Abstract
A screening via mRNA differential display resulted in the identification and cloning of
nine partial cDNAs corresponding to putative peach ftuitlet abscission-related genes.
Five of the nine genes were induced by propylene mediated abscission and four were
specifically repressed during this process. None of the isolated genes were specifically
induced only in the abscission layer, while at least two corresponded to mRNAs which
accumulate in adjacent tissues. DNA sequence analysis demonstrated that two cDNAs
show homology to major latex and ~ I ,3-glucanase genes. The major latex-like gene is
specifically expressed only in pedicels prior to abscission and is down-regulated by
propylene. The 13 I,3-glucanase transcript accumulation is detected in all examined
tissues following propylene treatment. The major latex protein and ~ I,3-glucanase
genes have been implicated in abscission-related wound healing and plant pathogen
defense, respectively.
2. Introduction
Previous research has shown that exogenous ethylene or propylene hastened peach
ftuitlet abscission, under both field and lab conditions [5, 18]. Ruperti et al. [19]
observed that propylene-flushed peach ftuitlet explants showed a consistent increase in
ethylene biosynthesis in abscission zone (AZ3) and surrounding tissues (Non zones,
NZ) within 12 h of treatment. In many plants, AZs have been shown to respond to both
ethylene and propylene at the molecular level via the induction and accumulation of
specific mRNAs and proteins [7, 13, 19]. So far studies of ethylene-regulated AZ
proteins have been primarily focused on characterization of cell wall hydro lases.
Specifically, 13 1,4-endoglucanase and polygalacturonases have been implicated in
abscission of peach fruit and leaves[5], bean leaves [6, 21] and tomato flowers [8, 10].
249
250
Both enzymes are induced by ethylene and accumulate to high levels in AZs of their
respective tissues [5, 6, 8, 10].
In addition to cell wall hydrolases, a number of additional genes encoding
pathogenesis-related (PR) proteins have been shown to be induced during abscission
and in response to ethylene in bean and elder [7, 20].
In peach, with the exception of hydrolytic enzymes, no knowledge exists regarding
mRNAs and related polypeptides, which accumulate during abscission. In order to
identify mRNAs whose expression is influenced by ethylene during peach fruitlet
abscission we have employed mRNA differential display [11]. Recently this technique
has been used to isolate plant genes that are expressed in a tissue-specific manner [15,
22]. Here we report the cloning of nine partial cDNAs corresponding to novel mRNAs
that show differential accumulation in AZ versus NZs and in response to the ethylene
analog propylene.
3. Results
3.1. COMPARISON OF mRNA POPULATIONS
Combinations of eight random primers and three anchor primers were used for a total of
24 differential display amplifications of each RNA sample (pedicel, AZ3 and mesocarp,
each plus or minus propylene). Approximately 70 bands were amplified with each
primer set on average. Among the estimated 10,080 amplified bands resulting from all
differential display reactions performed, 17 were unique to propylene-treated AZ3 and
NZ RNAs, while 6 were present only in the AZ3 and NZ tissues prior to treatment.
Examples of target differential display-PCR products are shown in Fig. I.
Regions of polyacrylamide gels containing differentially expressed products were
isolated and eluted for DNA, which was re-amplified with the same primers used for the
original differential display reaction.
3.2. ANALYSIS OF mRNA ACCUMULA nON USING DISPLAY -PCR

PRODUCTS AS PROBES
To verify the authenticity of the differential display bands, re-amplified display-PCR

fragments were used to probe total RNA gel-blots, carried out as described by Ruperti et
al. [19], representing AZ3 and NZ tissues plus or minus propylene treatment. All
clones (DD I-DD9) hybridized to RNA species ranging in size from 0.8-1.9 kb. Among
the probes derived from RNAs prior to propylene-treatment, DDl and DD4 were
detected only at time 0, while DD2 and DD3 were down-regulated during the
propylene-induced abscission.
Of the clones selected and derived from propylene-treated RNAs, three (DD5, DD6,
DD7) hybridized to mRNAs which were detected only after induction of the abscission
process, while two (DD8 and DD9) showed some mRNA prior to propylene treatment
and a significant increase of transcript accumulation in association with abscission.
Tissue-specific expression among the three tissues examined was shown only for DDI
and DD4. RNA gel-blot analysis of DDI confirmed the differential display pattern of
251
pedicel-specific mRNA accumulation. The 004 display-PCR product was observed in

both AZ3 and mesocarp, while mRNA accumulation suggests expression primarily in
mesocarp prior to propylene treatment. This result is likely due to PCR normalization
of the AZ3 cDNA. We have observed similar strong display-PCR amplification
products resulting from relatively rare messages as determined from subsequent RNA
gel-blot analysis.
Pd AZ3 M
o 48 o 48 o 48
DDI
DD5
Figure 1. Differential display denaturing polyacrylamide gel exhibiting ethylene-

enhanced or repressed mRNA. Total RNAs from Pedicel (Pd), Abscission zone
(AZ3) and Mesocarp (M) at time zero (0) and after 48 h (48) of propylene treatment
were reverse transcribed with the anchor primer H-TlIG. The resultant cDNAs
were PCR amplified with the same 3' anchor primer and 5'-AAGCTTTGGTCAG-
3' (DOl), or S'AAGCTTGATTGCC-3' (DDS) as random primer, respectively.
Arrows indicate isolated bands.
Propylene-induced clones (005, 006, 007, 008, 009) were detected via display-
PCR in all tissues treated with propylene, and this relative expression pattern was
confirmed via RNA gel-blot analysis. An increasing gradient of hybridization signal
was observed for 006, 007, 008 and 009 from the pedicel, through AZ3 to the
mesocarp, while a similar message accumulation throughout was observed for 005.
3.3. MOLECULAR CLONING AND CHARACTERIZATION OF DIFFERENTIAL

DISPLAY cONA FRAGMENTS
Nine display-PCR fragments derived from four time 0 RNAs, and five 48 hour
propylene-treated RNAs, were cloned, sequenced, and the resulting data utilized in
database searches. Sequence analysis revealed that display-PCR insert sizes ranged
from 184 to 470 bp (including primer sequences) and that these sequences were
predominantly AT-rich.
Based on comparison to the National Center for Biotechnology Information
nonredundant database, only two clones (001 and 005) had significant homology to
252
previously cloned genes. 001 shows significant amino acid homology to the carboxyl-
terminus of a major latex protein from opium poppy (36% identity and 54% similarity;
Papaver somniferum;[14]) and the predicted polypeptide of the Sn-l wound-related
gene from bell pepper (35% identity and 57% similarity; Capsicum annuum; [17]).
The deduced amino acid sequence of the 005 putative coding region shows
similarity to basic 1,3 glucanases from tobacco [16], potato[2] and bean [9]. Conserved
structural features include a protein kinase-phosphorylase site (TER) and a putative C-
terminal extension of 16 amino acids, including a potential glycosylation site (NTTN).
No other DO clone showed significant homology to any sequences in the database at
either the nucleotide or amino acid level.
Southern analyses were carried out to characterize genes corresponding to DOl and
DD5. The hybridization pattern individuated by DDt probe suggests that it is a member
of a small gene family, while 005 strongly recognizes only one DNA fragment for all
restriction enzymes used and one additional weaker fragment with EcoRI indicating the
presence of a single gene and a putative related gene.
4. Discussion
Among the estimated 10,080 bands generated by our peach differential display analysis,
only 0.25% showed significant changes of expression pattern among the six
tissue/treatments analyzed. While DOl is specific to non-propylene treated pedicels,
and DD4 is primarily expressed in untreated mesocarp, no display-PCR products
demonstrating AZ3-specific expression were observed. McManus and Osborne [13]
compared the profiles of polypeptides extracted from pulvinus, AZ and petioles of
ethylene-treated bean leaves and found, apart from some concentration differences, a
similar pattern in all three tissue types suggesting few tissue-specific abscission-related
genes. In addition, Tucker et al. [23] observed that accumulation of cellulase mRNA
(encoding one of the most important enzymes regulating abscission) while most
abundant in bean leaf AZ, was also induced in ethylene-treated stems and petioles. In
summary, data presented here and by others suggests a relatively small repertoire of
abscission-related genes, few of which are truly tissue-specific.
Two of the 9 clones described in this report did show specific expression in the more
cleanly isolated pedicel and mesocarp tissues. mRNAs corresponding to both DOl
(pedicel-specific) and DD4 (mesocarp-specific) were detected only before propylene-
treatment and associated abscission. Subsequent cloning and sequence analysis suggest
that DDt has significant homology with a major latex protein from opium poppy [14]
and the predicted polypeptide of the wound-related Sn-l gene from bell pepper [17].
The poppy and pepper polypeptides are also related and are likely involved in the
sealing off of plant tissue wounds [17]. It would seem plausible that the DOl gene
product would play a similar role during abscission for protection of the exposed
pedicel against infection and wounding after fruit detachment, especially considering
that DDt mRNA accumulates only in the pedicel and prior to abscission. Furthermore,
while DDt may pro-actively protect against the eminent exposure resulting from
abscission, the Sn-l gene product was shown to increase in green fruit after 15 hr of
wounding presumably as a reactive response [17], thus demonstrating a fundamental
253
difference in the regulation of these similar gene products. Finally, Aggelis et al. [I]
have isolated a cONA (MEL 7) from a ripe melon cONA library which also shows
homology to the major latex proteins, and to which they have proposed a similar
protective role. MEL7 mRNA from a ripe melon cONA library accumulates during
early ripening stages and is also present at low levels in other melon tissues. Unlike
001, Mel 7 mRNA is induced by ethylene but also apparently repressed by wounding.
Southern analyses suggest that 001, Mel7, Snl and major latex protein are members of
gene families which, considering different expression, probably have multiple
regulatory motifs, including positive and negative regulation by both wounding and
ethylene.
A series of five propylene-induced clones (DDS - 009) have also been identified
including one (DDS) showing significant homology with basic ~-1 ,3 glucanases from
tobacco, potato, and bean. However gene organization of peach basic ~-1,3 glucanases
appears more similar to that one in bean [9] and tobacco [16] where a single gene and
an additional related gene are present respectively, while differs from that one in potato
where a multigene family is found [2]. Basic ~-I, 3 glucanases are involved in plant
defense against potential pathogens and mRNAs coding for such enzymes have been
shown to be induced by infection, elicitor treatment, ethylene, and wounding [3, 4].
Although ethylene-inducible, DDS did not show tissue-specific expression in that no
difference in mRNA accumulation was observed among pedicels, AZ3 and mesocarp
following ethylene treatment. This lack of specificity suggests that this clone may
accumulate in response to ethylene-regulated process coordinated with the abscission
process. For example, during bean leaf abscission, genes whose products are not likely
directly involved in organ shed, rather in functions related to tissue senescence and
protection against pathogens invasion, are also induced resulting in the accumulation of
pathogenesis-related proteins in the abscission zone and adjacent tissues [7].
Two clones (008 and 009) demonstrate an increasing gradient in mRNA
accumulation from pedicel, through AZ3, to the mesocarp. A similar gradient has been
observed for ethylene content [19], suggesting that expression of the corresponding
genes have not been saturated in their ethylene responses and thus are regulated by
ethylene concentration [12]. Database searches revealed no significant homology for
either of these clones or for 002, 003, 004, or 006. We are currently isolating full-
length cONAs corresponding to these genes in an effort to obtain more complete
sequence information, which may shed light on their respective functions during peach
fruitlet abscission. In addition, to assess at which extent the isolated clones are fruitlet
abscission related, expression analysis in other peach vegetative and reproductive
tissues is in progress.
5. References
1. Aggelis, A, John, I., Karvouni, Z. and Grierson, D. (1997) Characterization of two cDNA clones for
mRNAs expressed during ripening of melon (Cucumis mela L.) fruits, Plant Mol. BioI. 33, 313-322.
2. Beerhues, L. and Kombrink, E. (1994) Primary structure and expression of mRNAs encoding basic
chitinase and 1,3-beta-glucanase in potato, Plant. Mol. Bio.124, 353-367.
3. Boller, T. (1987) Hydralitic enzymes in plant disease resistance, in T. Kosuge and E.W. Nester
(eds.), Plant-Microbe Interactions: Molecular and Genetic Perspectives, Macmillian, New York, pp.
385-413.
254
4. Boller, T. (1988) Ethylene and the regulation of antifungal hydrolases in plants, in BJ. Miflin (ed.),
Oxford Surveys of Plant Molecular and Cell Biology, Oxford University Press, Oxford, pp. 145-174.
5. Bonghi, c., Rascio, N., Ramina, A and Casadoro, G. (1992) Cellulase and polygalacturonase
involvement in the abscission ofleafand fruit explants of peach, Plant Mol. Bioi. 20,839-48.
6. del Campillo, E., Reid, P.D., Sexton, R.and Lewis, L.N. (1990) Occurrence and localization of 9.5
cellulase in abscising and no abscising tissue, Plant Cell 2, 245-254.
7. del Campillo, E. and Lewis, L.N. (1992) Identification and kinetics of accumulation of proteins
induced by ethylene in bean abscission zone, Plant Physiol. 98, 955-961.
8. del Campillo, E. and Bennett, AB. (1996) Pedicel breakstrength and cellulase gene expression
during tomato flower abscission, Plant Physiol. 1I1, 813-20.
9. Edington, B.V., Lamb, CJ. and Dixon, R.A (1991) cDNA cloning and characterization of a putative
1.3-f3-D-glucanase transcript induced by fungal elicitor in bean cell suspension cultures, Plant Mol
Bioi. 16,81-94.
10. Kalaitzsis, P., Koehler, S.M. and Tucker, M.L. (1995) Cloning of tomato polygalacturonase
expressed in abscission, Plant Mol. Bioi. 28,647-656.
II. Liang, P. and Pardee (1992) Differential display of eukaryotic messenger RNA by means of the
polymerase chain reaction, Science 257, 967-971.
12. Lincoln, J.E. and Fischer, R.L. (1988) Diverse mechanisms for the regulation of ethylene-inducible
gene expression, Mol. Gen. Gen. 212, 71-75.
13. McManus, M.T. and Osborne, DJ. (1989) Identification of leaf abscission zone as a specific class of
target cells for ethylene, in DJ. Osborne and M.B. Jackson (eds.), Cell Separation in Plants
Springer-Verlag Berlin, Heindelberg, pp 201-210.
14. Nessler, C.L., Kurz, W.G. and Pelcher, L.E. (1990) Isolation and analysis of the major latex protein
genes of opium poppy, Plant Mol. Bioi. 15, 951-953.
15. Oh, B.J., Balint, D.E. and Giovannoni, lJ. (1995) A modified procedure for PCR-based differential
display and demonstration of use in plants for isolation of genes related to fruit ripening, Plant Mol.
Bioi. Rep. 13, 70-8.
16. Ohme-Takagi, M. and Shinshi, H. (1990) Structure and expression of a tobacco beta-I,3-glucanase
gene, Plant Mol. Bioi. 15,941-946.
17. Pouzeta-Romero, J., Klein, M., Houlne, G., Schantz, M.L., Meyer, B.and Schantz R (1995)
Characterization of a family of genes encoding a fruit specific wound-stimulated protein of bell
pepper (Capsicum annuum): identification of new family of transposable elements, Plant Mol. Bioi.
281011-1025.
18. Ramina, A, Rascio, N. and Masia, A (1989) The abscission process in peach: structural,
biochemical and hormonal aspects, in DJ. Osborne and M.B. Jackson (eds.), Cell Separation in
Plants Springer-Verlag Berlin, Heindelberg, pp 233-238.
19. Ruperti, B., Bonghi, C., Tonutti, P. and Ramina, A (1998) Ethylene biosynthesis in peach fruitlet
abscission, Plant Cell Environ. (in press)
20. Roberts, J.A, Coupe, S.A, Withelaw, C.A. and Taylor, J.E. (1997) Spatial and temporal expression
of abscission-related genes during ethylene-promoted organ shedding, in AK Kanellis, C. Chang, H.
Kende and D. Grierson (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer
Academic Publisher, Dordrecht, pp 185-190.
21. Sexton, R., Tucker, M.L., del CampiIIo, E.and Lewis, L.N. (1989) The cell biology of bean leaf
abscission, in D.l Osborne and M.B. Jackson (eds.), Cell Separation in Plants Springer-Verlag
Berlin, Heindelberg, pp 69-78.
22. Tienam, D. and Handa, AK. (1996) Molecular cloning and characterization of genes expressed
during early tomato (Lycopersicum esculentum Mill.) fruit development by mRNA differential
display, J. Amer. Soc. Hort. Sci. 121, 52-56.
23. Tucker, M.L., Sexton, R., del Campillo, E. and Lewis, L.N. (1988) Bean cellulase. Characterization
of a cDNA clone and regulation of gene expression by ethylene and auxin, Plant Physiol. 88, 1257-
1262.
THE EFFECT OF AUXINS AND ETHYLENE ON LEAF ABSCISSION OF
FICUS BENJAMINA
N.S. AL-KHALIFAH! and P.G. ALDERSON 2

'King Abdulazjz City for Science and Technology (KACST), P.D. Box
6086, Riyadh 11442, Saudi Arabia, 2 University of Nottingham, School of
Biological Sciences, Sutton Bonington Campus, Loughborough, Leics.,
LEI25RD, UK
1. Abstract
Removal of part of the new fully expanded leaf lamina of Ficus benjamina cv. Exotica
had no effect on abscission of the petiole, whereas removal of the whole lamina caused
abscission within 48 hours. One drop (1 1-11 of 0.1 mg!"!) of either indole acetic acid
(IAA), indole butyric acid (IBA) or naphthalene acetic acid (NAA) applied to the
petiole resulted in a delay in its abscission. IAA delayed the abscission for 5 days,
whereas IBA and NAA treated petioles started to abscise after 3 days. By 14 days,
comparable numbers of the IAA and NAA treated petioles had abscised, however less
of the IBA treated petioles had abscised. The time of application of IAA to petioles in
relation to removal of the distal part of the lamina also influenced the delay of
abscission. No accumulation of ethylene was observed when the removed leaf laminas
were held in sealed culture vessels. In contrast, ethylene accumulation occurred in
vitro in sealed culture vessels containing shoots of F. benjamina on MS medium
supplemented with 0.2 mgr! benzylaminopurine (BAP). Sealing and size of culture
vessel significantly enhanced the percentage of leaves which abscised. Injection of
ethylene into cultures immediately after sealing increased abscission, even when the
ethylene inhibitor, silver thiosulphate, was present.
2. Introduction
Leaf abscission is a common response of plants to stress imposed by external or

internal factors, and hormonal, nutritional and other physiological factors interact to
control the onset and rate of abscission [1]. In F. benjamina, abscission has been
related to changes in environmental conditions, e.g. water stress and low light intensity
[10, 13]. Auxin (fAA) is the major growth hormone controlling abscission in many
plants, and when the ability of leaves to produce auxin diminishes, i.e. when they
become senescent, they tend to abscise [I]. Removal of the leaf lamina will lead to
abscission of the remaining petiole, however this can be delayed by applying auxin to
255
256
the petiole. This paper reports a study of the role of auxin in the abscission ofleaves of
F. benjamina by removing its source (leaf lamina) and applying auxins as a substitute,
and on the possible relationship with ethylene production by the system.
3.1. THE EFFECT OF PARTIAL OR COMPLETE REMOVAL OF THE LEAF

LAMINA ON ABSCISSION OF THE PETIOLE
Plants of F. benjamina cv. 'Exotica' were grown in Levington M2 compost (Fisons

UK) in pots in a glasshouse at 20-26C until they were 40-50 cm in height, with
supplementary lighting to provide a photoperiod of 16 hours and light intensity of >80
Ilmolm-2s-1. Three new fully expanded leaves on each of four plants were used for each
of the following treatments: (i) distal y.. of the lamina removed, (ii) distal Yz of the
lamina removed, (iii) distal % of the lamina removed, (iv) the whole lamina removed
and (v) the whole lamina removed and 1 III of 0.1 mgr1 IAA applied to the petiole
stump. The incidence of petiole abscission was recorded for each treatment at intervals
of24 hours up to 120 hours as the cumulative number of petioles which had dropped or
which dropped when lightly touched with forceps.
3.2. THE EFFECT OF TYPE OF EXOGENOUS AUXIN AND TIME OF

APPLICATION ON ABSCISSION OF THE PETIOLE
Leaf lamina were removed leaving petioles which were treated with one drop (l Ill) of
either IAA, IBA or NAA (all at 0.1 mgr 1). Twelve petioles were treated with each
auxin and twelve control petioles did not receive any auxin. Starting at 48 hours from
setting up the treatments, the incidence of abscised petioles was recorded at 24 hour
intervals for 14 days.
Using four plants, 1 III of 0.1 mgr 1 IAA was applied to the petiole of twelve leaves
15 min, 30 min, 1 hour, 2 hours, 24 hours and 48 hours after removal of the lamina.
These treatments were compared to a control (no auxin). Removed laminas were held
in sealed culture vessels for 3 days to monitor ethylene accumulation, as described
below.
3.3. THE EFFECT OF SIZE OF CULTURE VESSEL AND PLANT DENSITY ON

ETHYLENE ACCUMULATION
Single shoots of F. benjamina cv. 'Cleo' were cultured in vitro for 10 weeks in 70 ml
glass jars containing 15 ml MS medium [8] supplemented with 0.2 mgr 1 BAP, or 3
shoots in 350 ml glass jars containing 40 ml of the same medium. At the end of this
period, five of the 70 ml jars and five of the 350 ml jars were sealed with Nescofilm
(Bando Chemicals, Tokyo) for four weeks, after which ethylene was monitored by
taking a 1 ml sample from the head-space of each vessel and injecting it into a gas
chromatograph (GC, PV 4500, Pye-Unicam, Phillips, UK) fitted with an alumina Fl JJ
column (JJ Chromatography Ltd, Kings Lynn, UK) maintained at operating
257
temperature of 110C and equipped with a flame ionisation detector heated to 130C.
Nitrogen and hydrogen were supplied as the carrier gases at flow rate of 40 ml min'!
and an air flow rate of 500 ml min'! was used. The system was calibrated prior to each
reading by injecting 1 ml of 10 ppm ethylene, i.e. ethylene at 1% in nitrogen [7]. The
three treatments comprised normal 70 ml jars, sealed 70 mljars and sealed 350 mljars.
3.4. THE RESPONSE OF F. BENJAMINA CULTURES TO INTERNAL AND

EXTERNAL SOURCES OF ETHYLENE
Shoot tips of 'Cleo' were sub-cultured individually in 100 ml glass jars containing 20
ml MS medium supplemented with 0.2 mgr! BAP and 0.5 mgr! GA3. In one treatment
(STS), the medium was supplemented with 12.5 mlr! silver thiosulphate (stock solution
prepared by dissolving 5 g silver nitrate plus 0.85 g sodium thiosulphate in 1 litre of
water). The cultures were grown for 8 weeks until there were between 4 and 8 leaves
per jar. The numbers of green and abscised leaves were recorded, then 5 replicates of
cultures with and without STS were sealed and the remainder were left unsealed. Eight
weeks after sealing, the numbers of green and abscised leaves were recorded and
ethylene was monitored. The culture vessels which had not previously been sealed
were sealed, and 5 ml of 10 ppm ethylene was injected in three replicates of each of the
four treatments based on the time of sealing and presence of STS, i.e. early versus late
sealing and with and without STS. Three weeks after injecting the ethylene, the
number of green and abscised leaves were recorded and the concentration of ethylene
in culture vessels was monitored.
4. Results
Partial removal of the leaf lamina had no effect on abscission of the petiole (Fig. 1).
Even retention of one quarter of the leaf lamina provided sufficient stimulus for the
petiole not to be abscised. In contrast, removal of the whole leaf lamina caused 100%
abscission within 72 hours. The addition of a drop of IAA delayed abscission for 120
hours, but it eventually reached 100% after 14 days.
All of the auxins tested delayed abscission compared to the control. IAA retarded
abscission for 5 days, whereas IBA and NAA treated petioles started to abscise after 3
days. After 14 days, 78% and 89% of petioles had abscised in the IAA and NAA
treatments respectively, however only 33% of the IBA treated petioles had abscised.
All of the control petioles had abscised by day 5.
The application of auxin to petioles 15 min, 30 min, 1 hour and 2 hours after
removal of the lamina delayed their abscission for 5 days, at which time 10% of each
treatment had abscised (Fig. 2). The control petioles, and those treated after 24 hours
or 48 hours, started to abscise within 3 days. Abscission increased with time showing a
similar response for all treatments, however by day 14 the control treatment had
reached 100% abscission, whereas the 15 min treatment showed at least 50%.
Accumulation of ethylene was not detected in the sealed culture vessels containing
removed laminas.
258
!
100 r--'
Figure J. Effect of
80 I partial or complete
60 !
I
/ removal ofleaf
lamina on the
abscission of
40 I petioles in F.
I r: benjamina cv.
20 I "exotica" (n=12)
fi--. ~-------------(J-
V. lamina
1< ; ; ; ; + ; + ; --+-...J + 114 lamina
0~-4*~**--~~_4--+__+~~1_~--~~
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
o 'I. lamina
Time (days)
whole lamina
100 * whole
lamina+IAA added
80
#. ~
Figure 2. Effect of
c 60 /~------Jl.'/-- ___ -------------~
0 the time of auxin
'w %" K"'"
.!!l
0
U)
..n
40
* k .+-
.....
Xc
application after
removal of leaf

....*"
) f - . -'K . =</'""'
lamina on
20 ~
"*
x abscission of
o
1
---2 3
.....
~
4
----~.~.
_.
5 6 789
petioles in F.
benjamina cv.
10 11 12 13 14 15 "exotica" (n=12)
Time (days) .15 min
0.5 - - - ' - - - ' - - ' - - - " - l + 30 min
o I hour
0.4 x .2 hours
!
tj
~ * 24 hours
0.3 x 48 hours
x
A no auxin
x
0.2
x
0.1 x Figure 3. The
'" x' relationship
0' -L~"'c~ _ _ _ --><~ between ethylene
~~" "~ J' production in the
5
I
-0.1 L _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _~
25 45 65 85
cultures of F.
benjamina and
Total green leaf area (cm~) green leaf area
(Y'=O.0314058
0.5. O.0041X, R=O.614)
0.4
ij
~
0.3 i ....-. Figurei-. The
.
0.2 relationship
0.1 .. between ethylene

production in the
cultures of F.
0 benjamina and the
percentage of
-0.1 80 leaves abscised
0 20 40 60
(Y'=O.0358+0.004
% of leaves abscised
173X, R=O.64 7)
259
The ethylene concentration in sealed 70 ml culture vessels was significantly higher

than in the unsealed vessels and was five times greater than in the sealed 350 ml
vessels. During the period that the vessels were sealed, growth of the cultures (i.e. leaf
number and leaf area) was promoted. At the end of the fourth week, abscission was
stimulated resulting in a reduction in green leaf area, which was correlated with the
increase in ethylene concentration (Fig. 3). However, the total area of the abscised
leaves was not affected by ethylene concentration. The sealing and the volume of the
vessel affected the percentage of leaves, which abscised, and the relationship with
ethylene was significant (p:::;;0.001) (Fig. 4).
Sealing of the culture vessels did not increase the accumulation of ethylene in the
STS treatments, as ethylene production was clearly inhibited by STS in the medium.
The presence of STS removed any differences between the early and late sealed
cultures as regards leaf production and leaf abscission. The injection of ethylene
increased abscission only in cultures, which had been sealed late, with and without
STS.
5. Discussion
Auxin appeared to be responsible for delaying or preventing the abscission of F.

benjamina leaves. Auxins produced in the leaf lamina are transported through the
petiole into the stem and, when the leaf ages or is exposed to removal of the lamina or
physiological damage, the auxin status declines reSUlting in abscission [1, 3]. Removal
of as much as three quarters of the leaf lamina of F. benjamina did not result in
abscission, even after two weeks. This indicates that a small part of the leaf is capable
of producing enough auxin to prevent abscission. Delaying leaf abscission by the
application of auxin on the distal end of the petiole has also been reported for bean and
Coleus [2]. The prolific growth of callus from tissues of F. benjamina in vitro supports
the view that the plant is rich in auxins, and that, as soon as the transport of auxin is
disturbed, abscission will occur.
The time of applying the auxin to the petiole after removal of the leaf lamina
revealed that the abscission zone is "insensitive" to the absence of auxin for up to 2
hours. When auxin was applied at or after 24 hours, there was a delay in the abscission
of some of the petioles as compared with the petioles not receiving any auxin. This
suggests that the lag phase (Stage I) of the time course of abscission of F. benjamina
leaves is less than 24 hours, after which the separation phase (Stage II) takes place
depending on the availability of ethylene either as wound ethylene or applied ethylene,
which is necessary to trigger and complete separation during the ensuing 24 hour
period [9]. Complete separation of 100% of the control (no auxin) petioles of F.
berljamina took between 72 and 96 hours. Osborne [9] reported that full separation of
leaves may take 90 hours, and it is known that the duration of the lag phase is
dependent on the auxin status of the tissue [5].
The abscission of leaves by plants of F. benjamina grown in a glasshouse and
exposed to environmental stress is considered to be ethylene mediated [4, 11]. The
accumulation of ethylene has been reported by Jackson et al. [6] for plants grown in
260
vitro and less so for plants grown in vivo. In the present study, sealing in vitro cultures
of F. benjamina, even though it increased ethylene accumulation and the level of this
accumulation decreased with the increase in volume of culture vessel, did not increase
leaf abscission until the cultures had been sealed for a long time. This suggests that
ethylene may not be the key factor in leaf abscission in F. benjamina in vitro or in vivo.
In the presence of STS there was less accumulation of ethylene in cultures, however
this did not prevent abscission. This supports the findings of Steinitz et al. [12], that
STS did not reduce leaf abscission. It is possible that the conclusion reached by
Addicott [1], namely that ethylene accumulation may follow abscission rather than
preceding it, is more appropriate for F. benjamina, however further experimentation is
required to prove this.
6. References
1. Addicott, F.T. (1991) Abscission: shedding of parts, in AS. Raghavendra (ed.), PhySiology of
Trees, John Wiley & Sons, New York.
2. Devlin, RM., Francis, H. and Witham, R.D. (1983) Plant Physiology. Wadsworth, California.
3. Galston, AW. and Davis, PJ. (1970) Control Mechanisms in Plant Development, Prentice-Hall
Inc., Englewood.
4. Graves, W.R and Gladon, R.I. (1985) Water stress, endogenous ethylene and Ficus ber1famina
leaf abscission, HortScience 20, 273-275.
5. Jackson, M.B. (1970) Ethylene, the natural regulator ofleaf abscission, Nature 225, 1019-1022.
6. Jackson, M.B., Belcher, AR and Brain, P. (1994) Measuring shortcomings in tissue culture
aeration and their consequences for explant development, in PJ. Lumsden, J.R Nicholas and WJ.
Davies (eds.), Physiology, Growth and Development of Plants in Culture, Kluwer Academic
7. Joyce D.C., Reid, M.S. and Evans, RY. (1990) Silver thiosulfate prevents ethylene-induced
abscission in holly and mistletoe, HortScience 25, 90-92.
8. Lemos, E.E.P. and Blake, J. (1994) Leaf abscission in micropropagated sugar apples (Annona
squamosa L.), in PJ. Lumsden, J.R Nicholas and W.J. Davies, WJ. (eds.), Physiology and
Development ofPlants in Culture, Kluwer Academic Publishers, Dordrecht, pp 227-233.
9. Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and bioassay with tobacco
tissue cultures, Physiol Plant. 15,473-497.
10. Osborne, DJ. (1973) Internal factors regulating abscission, in T.T. Kozlowski (ed.), Shedding of
Plant Parts, Academic Press, London.
11. Peterson, J., Sacalis, J.N. and Durkin, DJ. (1980) Promotion of leaf abscission in intact Ficus
benjamina by exposure to water stress, J. Amer. Soc. Hort. Sci. 105, 788-793.
12. Reid, M.S. (1985) Ethylene and abscission, HortScience 20, 45-50.
13. Steinitz, B., Benijaacov, J., Ackerman, A and Hagiladi, A (1987) Dark storage of three cultivars
of bare-root Ficus benjamina foliage plants, Scientia Hort. 32,315-322.
14. Turner, M.A, Reed, D.W. and Morgan, D.L. (1987) A comparison of light acclimatization
methods for reduction of interior leaf drop in Ficus spp, J. Env. Hort. 5, 102-104.
EFFECT OF ETHYLENE ON THE OXIDATIVE DECARBOXYLATION
PATHWAY OF INDOLE-3-ACETIC ACID
R. GOREN, L. WINER AND J. RIOV

The Kennedy-Leigh Centre for Horticultural Research, The Hebrew
University ofJerusalem, Rehovot 76100, Israel
1. Abstract
Auxin-ethylene interactions are involved in various physiological processes. One of the

common examples for this is the abscission process in which ethylene-induced
reduction in auxin level in the abscission zone is a prerequisite for the ability of
ethylene to act directly in this tissue to induce the synthesis of cell wall degrading
enzymes. In Citrus (Citrus sinensis L. Osbeck), ethylene treatment significantly
induces the degradation of indole-3-acetic acid (IAA) via the oxidative
decaroboxylation pathway, resulting in the accumulation of indole-3-carboxylic acid
(lCA). The suggested pathway, leading to the formation of ICA, is as follows:
IAA~indole-3-methanol~indole-3-aldehyde~ICA. In the present study we were able
to verify the above steps by the isolation of the enzymes involved and the identification
of their products. Ethylene has been found to stimulate only the first step of this
pathway, i.e. IAA decarboxylation, which leads to the formation of indole-3-methanol.
It has long been suggested that peroxidase or a specific form of the peroxidase complex
("IAA oxidase") catalyze this step. However, we did not observe any significant effect
of ethylene on the peroxidase system. An alternative possibility that the stimulative
effect of ethylene on IAA catabolism results from increased formation of H20 2, a co-
factor for peroxidase, has been verified either by direct measurements of H20 2 or by
assaying the activity of enzymes which reduced H20 2 or respond to formation of
oxygen species in ethylene-treated tissues. An additional support for this possibility
comes from experiments demonstrating that IAA decarboxylation in control tissue was
enhanced to the level detected in ethylene-treated tissues by application ofH 20 2
2. Introduction
Auxin-ethylene interactions play a role in various physiological processes. A good

example for this is the abscission process, in which auxin retards abscission whereas
ethylene stimulates it. The classical model of natural leaf abscission prostulates that the
elevated level of ethylene in the senescing leaves triggers abscission by lowering auxin
level in the leaf blade and inhibiting its transport to the abscission zone [9, 10]. The
mechanism by which ethylene reduces the endogenous level of indole-3-acetic acid
261
262
(lAA) has been widely investigated. Ethylene has been shown to increase the
conjugation and the decarboxylation of both exogenous and endogenous IAA [11 and
literature cited therein]. Sagee et al. [11] have shown that ethylene significantly
enhanced the catabolism of [14C]IAA to indole-3-carboxylic acid (lCA) in citrus leaf
tissues, indicating that increased oxidative decarboxylation of IAA may be the major
mechanism by which ethylene reduces IAA level in citrus tissues.
In vitro studies of the oxidative decarboxylation of IAA catalyzed by horseradish
peroxidase or cell-free systems indicate that 3-methyleneoxindole and indole-3-
aldehyde (lAId) are the major metabolites [13]. However, if a suitable electron donor is
added to the reaction mixture, a substantial amount of indole-3-methanol (1M) is formed
[6]. 1M and ICA have been established as natural constituents in plant tissues [12, 14]
and these indoles or their glucose esters are formed after application of labelled IAA to
plant organelles and excised tissues other than Citrus [1, 16]. ICA is thought to be
derived from 1M via lAId [6].
The aim of the present research was to elucidate the biochemical pathway of IAA
catabolism leading to the formation ofICA and particularly to define at which step(s) of
this pathway ethylene exerts its stimulative effect.
3.1. PLANT MATERIAL
Leaves from the current year spring flush were taken from established trees of Citrus
sinensis [L.] Osbeck, cv 'Shamouti Orange'. Leaves were separated to midrib and blade
sections after treatment with ethylene.
3.2. ETHYLENE TREATMENT
Whole leaves were treated with 40lll.rl ethylene by means of a flow system. For
studying the effect of ethylene concentration and 2,5-norbomadiene (NBD) on IAA
decarboxylation, leaves were incubated in sealed 20L containers, and ethylene was
injected into the containers to obtain the desired concentration.
3.3. IAA DECARBOXYLATION
Three hundred mg ofleafblade or midrib sections were incubated in 1 ml of20 mM K-

phosphate-citric acid buffer (pH=4.6) with 200,000 dpm of ['4C]IAA (Amersham). The
14C02 released during incubation for 1 h in sealed flasks was trapped by 'Soluene'
(packard) adsorbed on two filter paper discs, 8 mm in diameter. Radioactivity in the
discs was determined by means of a liquid scintillation counter. When the effect of
various inhibitors and cofactors was studied, they were preincubated with the tissue for
30 min before the addition oflabelled IAA.
263
3.4. ENZYME ACTIVITY
3.4.1. Peroxidase
Guaiacol-peroxidase activity was assayed in crude extracts (60 mM K-phosphate buffer,
pH=6.2) or purified fractions by measuring the increase in absorbance at 420 nm
between 15 and 45 sec. after the initiation ofthe reaction.
Peroxidase from different cell compartments was obtained by successive extractions
of midrib tissue as follows: (a) Free space peroxidase by centrifuging at 1,500 x g for 5
min. (b) Ionic bound peroxidase by extraction with 100 mM KCI followed by
centrifugation as above. (c) Cytosolic peroxidase by grinding in K-phosphate buffer.
Peroxidase isozyme pattern was determined by vertical starch gel electrophoresis
[2].
3.4.2. fAA oxidase

IAA oxidase activity was determined in crude extracts (100 mM K-phosphate buffer,
pH=6.0) or purified fractions by measuring the residual IAA in the reaction mixture at
530 nm with Salkowsky reagent.
3.4.3. Glutathione reductase

Glutatione reductase was assayed in crude extracts (60 mM K-phosphate buffer,
pH=6.2) containing 200 mg.ml-1 polyvinylpolypyrrolidone. Activity was determined by
measuring the conversion of NADPH to NADP at 340 nm in the presence of oxidized
glutathione.
3.5. DETERMINATION OF ENDOGENOUS H20 2
H20 2 was determined by two different methods: (a) Horseradish peroxidase-catalyzed

oxidation of scopoletin, which results in the quenching of its flourescence, in the
presence of H20 2 leaking from midrib sections [4]. (b) Oxidation of 3,3'-
diaminobenzidine tetrachloride infiltrated into the tissues. The amount of H20 2 is
evaluated by the area of dark spots appearing as a result of the reagent oxidation.
Incubation of partially purified protein fractions obtained from extracts of midrib tissue
with 1M or lAId revealed the presence of two enzymes in the extracts: (a) 1M oxidase,
which catalyzes the conversion of 1M to lAId (Winer, Goren and Riov, in preparation)
and (b) lAId oxidase, which catalyzes the conversion of lAId to ICA [17]. These
observations confirm that the oxidative decarboxylation of IAA indeed involves the
following steps: IAA~IM~IAld~ICA [6]. Activity of the above two enzymes was
unaffected by ethylene, and, therefore, we focused on the first step of the pathway, i.e.
the decarboxylation of lAA to 1M.
Ethylene treatment increased the decarboxylation of IAA in leaf tissues by many
folds. The effect of ethylene on IAA decarboxylation was more pronounced in midrib
tissue than in leaf blade tissue and all further studies were conducted with midrib tissue.
A time-course study showed that the decarboxylation of IAA was quite rapid, occurring
mostly during the first h after the addition of labelled IAA. IAA decarboxylation
264
increased with the rise of ethylene concentration from zero to 40 /lLr' and then leveled
off. NBD, an inhibitor of ethylene action, blocked the stimulative effect of ethylene on
IAA decarboxylation at 4000 /lLr', indicating that the stimulative effect of ethylene on
IAA decarboxylation is specific.
It has long been suggested that IAA decarboxylation is catalyzed by peroxidase [cf.
2]. Although we observed that ethylene stimulated peroxidase activity by 1.5-fold, it is
not likely that this increase is responsible for the enhanced decarboxylation induced by
ethylene. Peroxidase activity under normal conditions is quite high and, therefore, it
does not seem reasonable that it is the limiting factor in IAA decarboxylation. Ethylene
did not induce significant changes in the peroxidase isozyme profile nor in peroxidase
activity in various cell compartments, ruling out the possibility that ethylene affects a
specific peroxidase, which is responsible for IAA decarboxylation. Furthermore,
comparison of the distribution of IAA oxidase to that of peroxidase in gel filtration
fractions showed a quite similar pattern of distribution.
Phenolic compounds are known to regulate the oxidation of IAA by peroxidase [7].
Accordingly, we studied the effect of chlorogenic acid and caffeic acid, which have
been shown to inhibit peroxidase activity, on ethylene-induced IAA decarboxilation.
Both compounds inhibited completely the reaction, indicating that peroxidase also
catalyzes the ethylene-stimulated IAA decarboxylation.
Since we were unable to obtain significant evidence that increased peroxidase
activity is responsible for the stimulation of IAA decarboxylation by ethylene, we
investigated the possibility that increased formation of H 20 2 following ethylene
treatment is the causal agent for the ethylene effect. Addition of 5 mM H 20 2 to control
and ethylene-treated midrib sections significantly enhanced IAA decarboxylation. In
the presence of H 20 2, IAA decarboxylation in the control was only slightly lower than
that in ethylene-treated tissue. This suggests that H 20 2 may be the limiting factor in
IAA decarboxylation, and that ethylene acts in this system by stimulating its synthesis.
This assumption is supported by the observations that endogenous H 20 2 concentration
in ethylene-treated tissue was significantly higher than that in the control. These
observation are in accordance with previous reports showing elevated H 20 2
concentrations under various conditions which are also characterized by increased
ethylene biosynthesis [5]. A close relationship between the rise of ethylene biosynthesis
and the level of peroxides has been shown to occur during senescence of plant tissues
[15].
Additional evidence for the increase in H20 2 concentration by ethylene is provided
by the significant increase in glutathione reductase activity in ethylene-treated midrib
tissue. Glutathione peroxidases, to which group glutathione reductase belongs, is a
family of multiple isozymes which catalyze the reduction of H20 2, organic
hydroperoxides and lipid hydroperoxide by reduced glutathione, and thus help to protect
the cells against oxidative stress. Increased activity of the enzyme can be considered as
a response to the accumulation of peroxides in the tissues. Meir et al. [8] also observed
an increased activity of glutathione reductase under chilling stress, which also induced
increased IAA decarboxylation.
In conclusion, we provided evidence that the stimulation of the oxidative
decarboxylation pathway of lAA by ethylene involves only increased decarboxylation
of IAA, which leads to the formation of 1M. 1M is then oxidized spontaneously to ICA
265
via lAId. The decarboxylation of IAA is catalyzed by peroxidase, the activity of which
is regulated by the availability of H2 0 2 . The enhancement of IAA decarboxylation was
not accompanied by a significant increase in peroxidase activity. Thus, increased
decarboxylation of IAA by ethylene can be explained by accumulation of H20 2
following treatment with the hormone.
5. References
1. Brown, B.H., Crozier, A, and Sandberg, G. (1986) Catabolism of indole-3-acetic acid in

chloroplast fractions from light-grown Pisum sativum L. seedlings, Plant Cell. Environ. 9, 527-
534.
2. Gaspar, T., Goren, R., Huberman, M., and Dubucq, M. (1978) Citrus leaf abscission. Regulatory
role of exogenous auxin and ethylene on peroxidases and endogenous growth substances, Plant,
Cell Environ. 1, 225-230.
3. Grambow, HJ. and Langenbeck-Schwich, B. (1983) The relationship between oxidase activity,
peroxidase activity, hydrogen peroxide, and phenolic compounds, in the degradation of indole-3-
acetic acid in viiro, Planta 157,131-137.
4. Holm, T.R., George, G.K. and Barcelona, MJ. (1987) Fluorometric determination of hydrogen
peroxide in groundwater, Anal. Chemi. 59, 582-586.
5. Ievinsh, G. and Ozola, D. (1997) Ethylene and the defense against endogenous oxidative stress, in
higher plants, in AK. Kanellis, C. Chang, H. Kende and D. Grierson (eds.), Biology and
Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 217-
228.
6. Langenbeck-Schwich, B. and Grambow, HJ. (1984) Metabolism of indole-3-acetic and indole-3-
methanol in wheat leaf seedlings, Physiol. Plant. 61,125-129.
7. Lee, T.T., Starratt, AN., and Jevnikar, J.J. (1982) Regulation of enzymic oxidation of indole-3-
acetic acid by phenols: structure-activity relationships, Phytochemistry 21,517-523.
8. Meir, S., Michaeli, R., Riov, J. and Philosoph-Hadas, S. (1998) Involvement of oxidative processes
and plant growth substances in the chilling-induced leaf abscission of ixora flowering potted
plants, 17'h Inti. Con! Plant Growth Substances, Chicago.
9. Morgan, P.W. (1984) Is ethylene the natural regulator of abscission? in Y. Fuchs and E. Chalutz
(eds.), Biochemical, Physiological and Applied Aspects of Ethylene, Martinus Nijhoff Dr. Junk,
The Hague, pp. 231-240.
10. Osborne, DJ. (1989) Abscission, CRC Crit. Rev. Plant Sci. 8,103-129.
11. Sagee, 0., Riov, J. and Goren, R. (1990), Ethylene-enhanced catabolism of [14C]indole-3-acetic
acid to indole-3-carboxylic acid in citrus leaf tissues, Plant Physiol. 92,54-60.
12. Sandberg, G., Jensen, E., and Crozier, A (1984) Analysis of indole-3-carboxylic acid in Pinus
sylvestris needles, Phytochemistry 23, 99-102.
13. Sembdner, G., Gross, D., Liebisch, H.-W. and Schneider, G. (1980) Biosynthesis and metabolism
of plant hormones, in 1. MacMillan (ed.), Hormonal Regulation of Development, I. Encyclopedia
of Plant Physiology (New Series), Vol. 9, Springer-Verlag, Berlin, pp. 281-444.
14. Sundberg, B., Sandberg, G. and Jensen, E. (1985) Identification and quantification of indole-3-
methanol in etiolated seedlings of Scots pine (Pinus sylvestris L.), Plant Physiol. 77,952-955.
15. Sylvestre, I., Droillard, M.-J., Bureau, 1.M. and Paulin, A (1989) Effects of the ethylene rise on the
peroxidation of membrane lipids during senescence of cut carnations, Plant Physiol. Biochem. 27,
407-413.
16. Weise, G. and Grambow, HJ. (1986) Indole-3-methanol-p-D-glucoside and indole-3 acitic acid
degradation in wheat leaf segments, Phytochemistry 25, 2451-2455.
17. Winer, L., Riov, J. and Goren, R. (1993) Catabolism of indole-3-acetic acid in citrus leaves:
identification and characterization of indole-3-aldehyde oxidase, Physiol. Plant. 89,220-226.
AN ARABIDOPSIS ETRI HOMOLOGUE IS CONSTITUVEL Y EXPRESSED IN
PEACH FRUIT ABSCISSION ZONE AND MESOCARP
P. TONUTTI, C. BONGHI, B. RUPERTI, A. SCAPIN AND A.

RAMINA
Department of Environmental Agronomy and Crop Science, University of
Padova Agripolis, 35020 Legnaro, Padova, Italy
1. Introduction
Ethylene perception in plants is coordinated by multiple hormonal receptor candidates

sharing sequence similarity with prokaryotic environmental sensor proteins known as
two-component regulators. A series of experimental evidences indicates that
Arabidopsis ETRI plays a primary role in a coordinating ethylene perception and
response [2]. Arabidopsis ETRI represents just one member of a family of ethylene
receptor candidates in this species [3]. The isolation of the Arabidopsis ETR 1 has
facilitated exploitation of other species as model systems for studying ethylene
perception. Arabidopsis ETRI homologues have been identified in several species.
Herein some preliminary data on an Arabidopsis ETRI homologue found in peach are
presented.
2. Results
2.1. PP-ETRI CLONE ISOLATION AND GENE FAMILY ORGANIZATION OF

PEACH ETRI HOMOLOGUE
To isolate Arabidopsis ETRI homologous peach genes, a genomic library from Prunus
persica L. Batsch, cv Springcrest, was constructed in ADASH II vectors. The library
was screened, as described by Sambrook et ai., [4], using a cDNA encoding for ETRI
Arabidopsis [I]. This screen identified 4 positive recombinant phage. These phages,
after digestion by EcoRI, have been analyzed in Southern analysis, carried out with
ETR 1 cDNA, that revealed a 4.3 kb hybridization band in each phage. A partial
sequencing of the PP-ETRI genomic clone pointed out that it included the histidine
kinase domain end and the beginning of the receiver domain. This region showed high
homology with apple [accession number AF 032448] (>90%), tomato [6] and
Arabidopsis [I] (>80%) ETRI. Southern analysis performed using a PP-ETRI cDNA
probe on genomic DNA digested with EcoRI, BamHI and PstI indicates that at least
three or more ETRl Arabidopsis homologous genes exist in peach.
267
268
2.2. PP-ETRI GENE EXPRESSION
PP-ETRI expression has been studied throughout peach fruit development, which is
traditionally divided into four stages (Sl, S2, S3 and S4). Sl and S4 are characterized
by high ethylene biosynthetic rates, whereas during S2 and S3 ethylene biosynthesis
remains at a basal level. Northern analysis, carried out as described by Tonutti et al.,
[5], shows that PP-ETRI mRNA (2.8 kb) is constitutively expressed in mesocarp
throughout fruit development. The same pattern was observed for TAEI (ETRI
homologue in tomato) during tomato fruit ripening [6]. In activated fruitlet abscission
zone (AZ3) and surrounding tissues (pedicel and mesocarp), no difference in terms of
PP-ETRI expression has been observed, although significant changes in ethylene
biosynthesis were recorded. In tomato leaf and flower abscission system (abscission
zone and adjacent tissues), no difference of TAEI mRNA accumulation was detected.
Moreover, treatments with ethylene or inhibitors of its action performed in the same
tissues did not affect TAEI expression level. This would suggest that TAEI
transcription is ethylene-independent [6].
3. Conclusions
An Arabidopsis ETRI homologous clone (PP-ETR1) has been isolated from a peach
genomic library. Southern analysis suggests that at least three or more ETRI related
genes exist in peach. PP-ETRI appears to be constitutively expressed in mesocarp and
in fruitlet abscission system. During the abscission induction, no changes of PP-ETRI
expression were observed in abscission zone and surrounding tissues.
4. Acknowledgements
The authors gratefully acknowledge the gift of the cDNA coding for Arabidopsis ETRI
by Dr. C. Chang, Department of Cell Biology and Molecular Genetics, University of
Maryland, College Park.
5. References
1. Chang, C., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (l993) Arabidopsis ethylene response
gene ETRI: similarity of product to two-component regulators, Science 262, 541-544.
2. Chang, C. and Stuart, R.C.(1998) The two component system, Plant Physiol. 117, 723-731.
3. Sakai, H., Hua, 1., Chen, Q.G., Chang, C., Medrano, L.J. Bleecker, AB. and Meyerowitz, E M.
(l998) ETR2 is an ETRI-Iike gene involved in ethylene signaling in Arabidopsis. Proc. Natl. Acad.
Sci USA 95, 5812-5817.
4. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning a Laboratory Manual, Cold
Spring Harbor Laboratory, New York.
5. Tonutti, P., Bonghi, C., Ruperti, B., Tomielli, G.B and Ramina, A (1997) Ethylene evolution and 1-
aminocyclopropane-I-carboxylate oxidase gene expression during early development and ripening of
peach fruit, J. Amer. Soc. Hort. Sci. 122, 642-647.
6. Zhou, D, Kalaitzis, P., Matoo, AK. and Tucker, M.L. (l996) The mRNA for an ETRI homologue in
tomato is constitutively expressed in vegetative and reproductive tissues, Plant Mol. Bioi. 30, 1331-
1138.
CHARACTERIZATION OF CAEG2, A PEPPER ENDO-B-l,4-GLUCANASE
GENE INVOLVED IN THE ABSCISSION OF LEAVES AND FLOWERS
L. TRAINOTTI, C.A. TOMASIN AND G. CASADORO

Dipartimento di Biologia, Universita' di Padova,
Viale G. Colombo 3, /-35 I 2 I Padova, Italy
1. Introduction and Results
In pepper high amounts of endo-f3-1,4-glucanase (EGase; E.C. 3.2.1.4) activity are

expressed during the abscission of leaves and flowers. Like in other plants, also in
pepper this enzyme is encoded by a mUltigene family and the cCel2 mRNA is the
transcript of the EGase gene specifically expressed at very high levels in leaf and flower
abscission zones (AZ) following activation by ethylene treatments [3]. Very low
amounts of cCel2 mRNA can also be detected in flowers and in roots. In order to
understand the regulation of cCel2 expression, we have isolated its cognate gene, named
caEG2 (f,;;apsicum qnnuum ~ndoQlucanase 2, EMBL accession no.: AJOI0950), and we
have started its characterization. The sequence of a 6632 bp fragment of pepper
genomic DNA revealed that it contains the whole coding region and flanking sequences
at both 5' and 3' ends. After determining the transcription start site at position 3257 by
means of 5' primer extension, the caEG2 coding region was positioned between 59 bp
of 5' untranslated region (UTR) and 272 bp of 3' UTR. The coding region is 100 %
identical to that of the cCel2 cDNA [3] used to isolate this gene, and it appears to be
spaced by 5 introns, the biggest of which is 216 bp long (intron 5) while the smallest
(intron 4) is 81 bp long. The 6 exons are different in size ranging from 93 bp (ex on 3) to
769 bp (exon 6). Intron-exon boundaries follow the Hanley and Schuler [I] rule. They
are conserved among caEG2 and the other two abscission EGase genes known so far in
higher plants (peachppEGI [4] and bean BAClO [2]) but for exon 2 which corresponds
to the sum of exons 2 and 3 of the other two genes (Fig. I).
2 3 4 5 6 7
bean BAC10 Figure J. Comparison of
the pepper caEG2 gene
5 6 7 with other higher plant
peachppEG1 abscission EGase genes:
bean BACIO [2] and
3 4 5 6 peach ppEGJ [4]. Shaded
pepper caEG2 boxes indicate 5' and 3'
UTRs.
O"----_ _ _~1000 bp
The large 5' flanking region (3256 bp) bears no significant homology to any
characterized promoter of genes either regulated by ethylene or more specifically
269
270
involved in the abscission process, but for a short fragment not far from the TATA box
that gives a significant homology score with the peach ppEG 1 promoter (Fig. 2).
1-160 1-150 1-140 1-130

ATGTCCCATTTTGGCGCATTTGATCCCGTGACAAGCATGACA 1P1P~Gl
I I I I I I I I I I I I I I I I I " I I I I I
I I I I I I I I I I I I I I I I I I I I I I I I
TTCGTCTCATTTGTCGCAGTTGATCCCGTGAATTATATTATA c~G2
1-200 1-190 :-180 1-170
Figure 2. Alignment of the ppEGI and caEG2 5' flanking sequences. Positions are
relative to the transcription start site (+ I).
Four GUS fusions have been prepared so that the four chimeric genes contain the 59
bp of 5' UTR plus different portions of the 5' flanking region (3256 bp for the biggest
and 332 bp for the smallest). These constructs have been used to transform tobacco and
Arabidopsis plants that have been analyzed for the expression of GUS. In the
transgenic tobacco plants, which contain the smallest construct the typical blue GUS
staining was detected at the level of flower abscission zones, stigmas and lateral root
primordia, thus showing that 332 bp of 5' flanking region are sufficient to drive
expression of GUS in senescence-related cell separation phenomena. Furthermore,
these results confmn similar data obtained with a large portion of the ppEG 1 promoter
[4]. In Arabidopsis, the smallest construct is sufficient to drive GUS expression at the
level of the abscission zones present in the flower, that is in the AZs of sepals, petals
and stamens. Surprisingly but consistently, GUS expression was also detected in
anthers of young flowers.
Nuclear extracts from abscission zones of pepper leaves were reacted with different
regions of the 5' flanking portion of caEG2 and analyzed in gel shift assays. Only two
fragments named CT23-24 and 108 ranging from -538/-316 and -335/222, respectively,
gave specific band shifts. Experiments are in progress to elucidate the regulatory
mechanism of caEG2 and to better understand the tissue specificity of its expression,
beside its responsiveness to gaseous hormone ethylene.
2. Acknowledgments
Our research is supported by grants from CNR and MURST. L.T. thanks the TMR-
ERBFMMACT95-0032 for providing him with a fellowship to attend the Ethylene
Symposium in Santorini, Greece.
3. References
1. Hanley, B.A., and Schuler, M.A. (1988) Plant intron sequences: evidence for distinct groups of
introns, Nucl. Acids Res. 16, 7159-7174.
2. Koehler, S.M., Matters, O.L., Nath, P., Kemmerer, E. and Tucker, M.L. (1996) The gene promoter
for a bean abscission cellulase is ethylene-induced in transgenic tomato and shows high sequence
conservation with a soybean abscission cellulase, Plant Mol. BioI. 31,595-606.
3. Trainotti, L., Ferrarese, L., Pomanski, E. and Dalla Vecchia, F. (1998) Endo-p-I,4-glucanase activity
is involved in the abscission of pepper flowers, J Plant Physiol. 152, 70-77.
4. Trainotti, L., Spolaore, S., Ferrarese, L. and Casadoro, O. (1997) Characterization of ppEGl, a
member of a muitigene family which encodes endo-p-I,4-glucanase in peach, Plant Mol. BioI. 34,
791-802.
CELLULASE GENE EXPRESSION IN ETHYLENE-TREATED GERANIUM
FLOWERS
Z. HILIOTl, S. LIND-IVERSEN, C. RICHARDS and K. M. BROWN

Department of Horticulture, The Pennsylvania Slate University,
University Park, PA 16802, USA
I. Introduction
Abscission of floral organs after pollination is a common phenomenon in many plant

species. The time between induction and completion of the abscission process varies
widely among species. Generally completion of abscission of floral structures is faster
than abscission of leaves and fruits (2.5-8 h vs 10-48 h) [2]. Anatomical studies in the
abscission zone (AZ) reveal cell separation in the middle lamella and extensive swelling
and disorganization of the semicrystalline bundles, microfibrils, in the primary wall of
the abscission zone cells. It has become evident that hormones participate and have a
regulatory role in abscission. The plant hormone ethylene increases cell expansion,
which generates mechanical forces facilitating cell separation, and increases expression
of genes associated with abscission. Cell wall hydro lases such as cellulases are
commonly associated with abscission [3]. In geranium (Pelargonium xhorlorum),
exogenous application of ethylene induces petal abscission within 2 hours of treatment
[I]. In the present study, the expression of three cellulases, PCXIO, PCX59 and
PCXI02 was investigated in geranium tissues including petal abscission zone. The
effect of ethylene on the mRNA levels of the three cellulases was also determined.
2. Results
In general, the three cellulases showed expression in all tissues of the plant examined
(Figs. I and 2). High level of expression of all three cellulases was found in petal
abscission zones (base of ovary and sepals, basal portion of petals). Expression of
PCXIO, PCX59 and PCXI02 was detected in roots, stems and leaves (Fig. I). Well
developed floral buds at 2-3 days prior to anthesis stage exhibited high level of
expression for all three cellulase genes (Fig. I). In the upper pistil (stigma, style, sterile
ovary, upper half of ovary) both PCX I 02 and PCX59 were highly expressed (Fig. 2).
Ethylene treatment for 45 min decreased the abundance of the three cellulase mRNAs
both in upper pistil and petal AZ (Figs. 2 and I). Interestingly, the abundance of
PCX59 and PCXI02 mRNAs increased after 2 h of ethylene treatment in whole pistils
to exceed levels present in the controls. It is possible that mRNA levels of the third
cellulase, PCX 10 were low and overshadowed by those of PCX 102 since the sizes of
the probes were similar. Expression of PCX I 02 and PCX59 in pistils of harvested
florets enclosed in jars for 2 h (120C) was slightly
lower than that of 0 h controls.
271
272
"0
,-... ::l
.D
,-... on
0
'-'
N
'<T
'-'
N
......
0
0
e ....=
<I' <I'
til
.....
0
-< -< ~
......
00 ~ r:i:
PCX102 368 bp
PCX10 308 bp
PCX59 208 bp
Figure 1. Expression of different cellulases in petal abscission zones (AZ) of florets untreated (0)
and treated with I DI.I-1ethylene for 45 min (45). RNA was also extracted from roots, stems,
leaves and floral buds. Ribonuclease protection assay was used to quantity the mRNA levels of
the cellulases in ten micrograms of total RNA
Whole pistils ,-...

U S-
o 0
N N
o
PCX102 368 bp
PCX59 208 bp
Figure 2. Expression of different cellulases in whole pistils and upper pistil (UP) tissues. Whole pistils were
freshly harvested (0), harvested and treated with I 'J 1.1-1 ethylene for 120 minutes (120), or harvested and
held in air for 120 minutes (120C). Upper pistils were freshly harvested (UP (0 or treated with 111.1-1
ethylene for 45 minutes (UP (45. Levels of the different PCX mRNAs were quantified by ribonuclease
protection assay in ten micrograms of total RNA
3. Conclusions
The expression of PCXIO, PCX59 and PCX102 was not restricted only to petal
abscission zone but was also present in all geranium tissue samples. Ethylene treatment
resulted in reduced expression ofthe cellulases after 45 minutes in both upper and lower
(AZ) pistils (Figs. 1 and 2), but after 120 minutes, the expression rose again to levels
higher than controls (Fig. 2), indicating complex temporal regulation of these genes by
ethylene.
4. References
1. Evensen, K.B., Page, AM., and Stead, AD. (1993) Anatomy of ethylene-induced petal abscission
in Pelargonium xhortorum, Ann. Bot. 71, 559-566.
2. Sexton, R., and Roberts, 1.A (1982) Cell biology of abscission, Annu. Rev. Plant Physiol. 33, 133-
162.
3. Sexton, R., Lewis, L.N., Trewavas, Al, and Kelly, P. (1985) Ethylene and abscission, in lA
Roberts and G.A Tucker (eds.), Ethylene and Plant Development, Butterworths, London, pp. 173-
196.
USE OF I-METHYLCYCLOPROPENE TO PREVENT FLORAL ORGAN
ABSCISSION FROM ETHYLENE-SENSITIVE PROTEACEAE
A.J. MACNISH 1, D.C. JOYCE 1, J.D. FARAGHER2, AND M.S. REID3

iThe University of Queensland, Gatton College, QLD 4345, Australia;
2Institute for Horticultural Development, South Eastern Mail Centre, VIC
3176, Australia; 3University of California, Davis, CA 95616, USA
I. Introduction
Ethylene elicits floral organ abscission from cut inflorescences of some Australian
Proteaceae [I]. A novel ethylene binding inhibitor, I-methylcyclopropene, prevents
abscission for a number of ornamentals [2, 3]. The efficacy of I-MCP in preventing
ethylene-induced floral organ abscission from Australian Proteaceae was determined.
I-MCP concentration, exposure time or temperature experiments were conducted with

Grevillea'Sylvia'. Treatments were: (i) 0,5,10 or 20 nL I-MCP/L (12 h, 20C), (ii) 10
nL I-MCP/L for 0, 3, 6, 9 or 12 h (20C), and (iii) 10 nL I-MCP/L for 12 h at 0, 5, 10
or 20C, respectively. Similarly, Dorrigo waratah (Alloxylon pinnatum), G. 'Sandra
Gordon' and waratah (Telopea speciosissima) inflorescences were treated with 0 or 10
nL I-MCP/L (12 h, 20C). Immediately following I-MCP treatment, half of the
untreated and I-MCP treated inflorescences in each experiment were exposed to 10 ilL
ethylene/L for 12 h at 20C. Inflorescences in vases were then arranged in a completely
randomised design at 22 2C and 70% RH. Vase life was judged as per Figure I and
Table I. Floral organ abscission was assessed daily as proportion of the initial number
(A. pinnatum and T. speciosissima) or on a 1=<10% - 5=>80% scale (Grevillea).
3. Results
I-MCP at low concentration, for short exposure time and at low temperature prevented
flower abscission and extended vase life of ethylene treated G. 'Sylvia' (Fig. I A, B, C,
respectively). Flower wilting, opening and perianth discolouration were not prevented
by I-MCP treatment (data not shown). Similarly, I-MCP provided protection for A.
pinnatum, G. 'Sandra Gordon' and T. speciosissima. Vase lives were longer and
abscission was less compared to inflorescences treated only with ethylene (Table I).
273
274
~
6
~
4
2 7
(A) ~L (C)
o
o 5 10 15 20 0 3 6 9 12 0 5 10 15 20
Concentration (nL 1-MCP/L) Exposure time (h) Temperature eC)
Figure 1. Vase lives of G. 'Sylvia' treated with I-Mep at different concentrations CAl, exposure times (8)
[with C-) and without (e) ethylene] or temperatures (e) [+ I-Mep, + ethylene (_), - I-Mep, + ethylene Ce),
+ I-Mep, - ethylene (..... ), -I-Mep, - ethylene (T)]. Vertical bars indicate s.e.m. (n=IO). Vase life was time to
;:0- 10% flower abscission, moderate wilting, and/or perianth discolouration.
Table 1. Vase lives of A. pinnatum, G. 'Sandra Gordon' and T. speciosissima treated with I-Mep (day 0)
and then ethylene (day I). Floral organ abscission after treatment is presented as a proportion (%) or a score.
Within columns, data followed by a different letter are significantly different (L.SD. P=0.05, n=IO).
Treatment Alloxylon pinnatum Grevillea 'Sandra Gordon' Telopea speciosissima

Vase life Abscission Vase life b Abscission Vase life Abscission
a (days) (%) (days) score C(days) (%)
No ethylene
onL I-MePIL 5.0 ab 2.2 6.0 b 1.0 5.1 ab 3.6
10 nL I-Mep/L 5.8 a 2.0 6.4 a 1.0 5.5 a 1.6
Plus ethylene
onL I-MePIL 4.3 b 3.4 2.0 c 3.3 4.3 b 11.7
10 nL I-Mep/L 5.8 a 0.2 5.8 b 1.0 5.9 a 1.1
Vase life was time to a;:o- 20% perianth abscission,;:O- 10% flower wilting, and/or moderate discolouration; b;:o-
10% flower abscission, moderate wilting or perianth discolouration; or, C;:o- 20% perianth abscission.
4. Conclusion
I-MCP was effective at low concentration (5 nL I-MCP/L), for short exposure time (3
h) or at low temperature (OC) in preventing abscission and thereby extending longevity
of G. 'Sylvia' exposed to ethylene. Treatment was equally effective at 0 and 20C, in
contrast to results for carnation [3]. l-MCP also protected A. pinnatum, G. 'Sandra
Gordon' and T. speciosissima against ethylene. Thus, I-MCP treatment can be used to
prevent floral organ abscission for ethylene-sensitive Australian Proteaceae.
5. References
1. Joyce, D., Jones, R. and Faragher, J. (1993) Postharvest characteristics of native Australian
flowers, Postharvest News and 1riformation 4, 6IN-67N.
2. Serek, M., Sisler, E.C. and Reid, M.S. (1994) Novel gaseous ethylene binding inhibitor prevents
ethylene effects in potted flowering plants, J. Am. Soc. Hort. Scie. 119, 1230-3.
3. Sisler, E.c., Dupille, E., and Serek, M. (1996) Effect of I-methy\cyclopropene and
methylenecyclopropene on ethylene binding and ethylene action on cut carnations. Plant Growth
Regul. 18, 79-86.
EFFECTS OF SELENIUM UPTAKE BY TOMATO PLANTS ON
SENESCENCE, FRUIT RIPENING AND ETHYLENE EVOLUTION
B.PEZZAROSSA 1, F. MALORGI0 2 AND P. TONUTTl 3

Ilstituto per la Chimica del Terreno, CNR, Pisa, Italy 2Dipartimento di
Biologia delle Piante Agrarie, University of Pisa Italy 3 Dipartimento di
Agronomia Ambientale e Produzioni Vegelali, University of Padova, Italy
1. Introduction
Selenium is an essential element for animal nutrition [3], but the metabolic significance
of Se in plants is not well known. In the genus Astragalus Se has been recognized as
micronutrient and its effect on plant growth is different in accumulator and non
accumulator species: in the former Se stimulates growth, whereas in the latter plant
growth is strongly inhibited. Shrift [2] hypothesized that Se is an essential
microelement in the accumulator species. Most of the cultivated plants are non
accumulator and in maize it has been shown that Se can also affect plant development
retarding leaf senescence [5]. Aim of this work was to assess the effect of selenium on
tomato plant growth and yield, on leaf senescence and fruit ripening and the possible
relationship with ethylene biosynthesis.
2. Results
Sodium selenate added to the soil (to give concentrations of 2.5, 5, and 10 ppm of Se)
affected tomato plant growth and development. Although the first inflorescence
appeared at the same time in all plants, 82 days after transplanting only fruits of control
started to ripen. At this date, dry matter weight of roots and fruits was significantly
reduced in all treated plants. A decrease of leaf dry matter weight was observed in
plants grown at 5 and 10 ppm of Se. Only the highest concentration reduced stem dry
weight. In treated plants, selenium accumulated at higher levels in leaves than in fruits:
the higher was the selenate concentration in soil, the higher resulted the selenium
content in leaves (Table I). In fruits of the 10 ppm treated plants the selenium
concentration was lower than that of the 2.5 and 5 ppm treatments (Table. I). A delay
of the onset of senescence and a prolonged life were observed in selenate treated plants:
at 134 days after transplanting, when leaves of control plants appeared totally
desiccated, senescence was advanced in 2.5 ppm treated plants and only some yellowing
was present in the 5 ppm ones. No visible senescence symptoms were observed in 10
ppm treated plants. Moreover, at this date, plants grown at 5 and 10 ppm selenate,
besides immature and mature green fruits, still had several flowers.
Fruits of treated plants (particularly at the highest selenate concentrations) reached
the mature green (MG) stage later than control fruits. In detached fruits the ripening
process was delayed if selenate was present in the growing substrate: compared to
275
276
control, MG and breaker stages lasted longer in all selenate treated fruits. By
comparing ethylene evolution rates of fruits measured at the same ripening phase (Table
2), it appeared that a reduction of the hormone biosynthesis occurred at the Pink stage in
5 and 10 ppm treated fruits and at the Breaker and Red stages only for the highest
concentration. In experiments carried out with tomato fruit disks, incubated up to 24h
in selenate solutions ranging from 0.1 to 10 JlM, no significant effects on ethylene
evolution were observed.
TABLE L Selenium content (Jlglg D.W.) in leaves and

fruits of tomato plants grown at different selenate
concentrations, 82 days after transplanting.
Se (ppm) Leaves Fruits
o 0.95 0.28
2.5 260 71.9
5 282 76.3
10 307 45.2
3. Conclusions
In tomato (a non accumulator specie) plants selenium accumulates particularly in the

leaves. At the concentrations used in this trial symptoms of Se toxicity were not
observed. Besides affecting plant growth, Se is strongly effective in retarding leaf
senescence and delaying fruit ripening. In animals Se, as essential constituent of enzyme
glutathione peroxidase [I], acts as antioxidant decreasing oxidative stress and its anti-
aging effects have been described. Our data show that also in tomato plants Se strongly
affects development and the senescence process. Although Se seems to have no direct
effects on ethylene biosynthesis, a decreasing trend (in 2.5 and 5 ppm treatments) and a
significant reduction (in 10 ppm treatment) of ethylene evolution have been monitored
during fruit ripening. The physiological aspects of this behaviour remain to be
elucidated.
TABLE 2. Comparison of ethylene evolution rates (nl/g/h) of fruits at the same
ripening stage.
Se(ppm) MG Breaker Pink Red
o 0.7 a 13.8 a 44.1 a 19.6 a
2.5 0.6 a 10.1 ab 35.6 ab 29.9 a
5 1.2 a 9.4 ab 16.7 c 17.2 a
10 1.1 a 3.6 b 22.7 b 8.2 b
4. References
I. Rotruc, J.T., Pop, AL., Ganthe, H.E., Swanso, A.B., Hafema, D.G. and Howkstra, W.G. (1973)
Selenium:biochemical role as a component of glutathione peroxidase, Science 179, 588-590.
2. Shrif, A. 1969. Aspects of selenium metabolism in higher plants. Ann. Rev Plant Physiol. 20,475-
494.
3. Underwood EJ. (1977) Trace Elements in lIuman and Animal :Vutrition, 4th cd. Academic Press,
New York.
4. Zasoski, R.J. and Burau, R.G. (1977) A rapid nitric-perchloric acid digestion procedure for multi-
element tissue analysis, Comm. Soil Sci. and Plant Anal. 8,425-436.
5. Zhao-Linchuan, Yu-BingGao, Zhao, L.e., Yu, B.G. (1996) Regulation of maize leaf senescence by
selenium, J. Nanjing Agric. Univ. 19,22-25.
ETHYLENE ENHANCES THE ANTIFUNGAL DlENE CONTENT IN
IDIOBLASTS FROM AVOCADO MESOCARP
D. PRUSKY, A. LEIKIN-FRENKEL AND L. MADI

Department of Postharvest Science of Fresh Produce, The Volcani
Center, Bet Dagan 50250, Israel
1. Abstract
It has previously been demonstrated that exposure of whole avocado fruits cv. Fuerte
to 40 ~I!I ethylene for 3 h enhances the level of antifungal l-acetoxy-2-hydroxy-4-
oxo-heneicosa-12, 15-diene (diene) in the fruit pericarp transiently, without affecting
disease resistance to C. gloeosporioides. Exposure of 1-2 mm slices of fruit pericarp
and mesocarp to ethylene enhanced the level of the antifungal diene in the mesocarp
only. Since most of the antifungal diene in the mesocarp is compartmentalized in
idioblasts the effect of ethylene was tested on isolated idioblasts. Exposure of
idioblasts to ethylene increased the level of antifungal diene twofold within 3 hs.
This effect was temperature dependent. Three hours exposure of idioblasts to
ethylene at 35C doubled the diene content compared to less than 50% increase after
three hours at 20C. Incubation of idioblast with [2_14C] malonyl- CoA or [I_14C]
acetate in the presence of ethylene, showed the incorporation of the label into a
compound that co-chromatographed with the antifungal diene. NMR identified the
compound induced by ethylene and released from the cells as the antifungal diene.
cDNA libraries were constructed from mesocarp tissue of ethylene treated and
untreated fruits. Using the castor stearoyl-acyl carrier protein (ACP) desaturase
gene, a putative stearoyl (ACP) desaturase clone of avocado, was detected.
Transcripts of this clone were 2.5 fold higher in the ethylene treated than in the
untreated tissue. The present report will discuss the possibility that ethylene can
induce the synthesis of the antifungal diene in idioblasts of avocado fruits.
2. Introduction
Colletotrichum gloeosporioides attacks avocado fruits during growth in the orchard.

The pathogen germinates and penetrates unripe fruit but remains quiescent until
harvesting [I]. After harvest, fruit ripening is accompanied by activation of fungal
development and appearance of decay symptoms. Resistance of unripe fruit to
postharvest pathogens is related to the presence of preformed antifungal compounds in
fruit pericarp (peel). The most active of them was found to be an antifungal diene [2].
The level of this compound decreases during ripening thus enabling the activation of the
277
278
quiescent infections and symptom expression [I]. Metabolism of the antifungal diene
and increased susceptibility after harvest is mediated by lipoxygenase. The activity of
this enzyme is, in tum, regulated by the levels of a non-specific inhibitor in the peri carp
identified as epicatechin whose levels decrease markedly in ripe fruits [I].
Enhanced levels of the antifungal diene caused by biotic and abiotic elicitors may
depend on the balance between rates of synthesis and breakdown of the compound [I].
Two possibilities exist for maintaining fungitoxic levels of antifungal compounds in the
tissue of ripening fruits: (I) prevention of catabolism, (ii) induction of synthesis.
Several biotic and abiotic elicitors that increased the levels of the antifungal diene
also led to higher levels of epicatechin [3]. These results seem to imply that abiotic
elicitors may enhance the levels of antifungal diene by inhibiting its catabolism. On the
other hand, increase of antifungal diene may result from the induced synthesis of the
compound. The synthesis of the antifungal diene may originate from acetate and
malonate, like fatty acids, or be a secondary product of lipid metabolism [4].
The location of the sites of biosynthesis of the antifungal compounds in avocado
fruits has never been described. A previous report by Kobiler et al. [5] described the
presence of antifungal compounds compartmentalized in specific oil cells in the
mesocarp of avocado. Interestingly, about 85% of all antifungal compounds within the
mesocarp were located in these cells which suggested the possibility that the synthesis
of antifungal compounds may occur in specific idioblasts. In the present work we have
shown that ethylene treatment that increases the level of the antifungal diene in whole
fruits, has a similar effect on isolated idioblasts. Ethylene enhanced both the
biosynthesis of the diene in the idioblast and the release of antifungal lipids out of the
idioblast. Results suggest that idioblast are important as the source of compounds
involved in the postharvest defense process of avocado fruits.
3.1. RESPONSE OF AVOCADO FRUIT TISSUES TO EXOGENOUS C ZH 4

EXPOSURE
Exposure of freshly harvested unripe avocado fruits to ethylene enhanced the levels of
the antifungal diene in the peri carp and the mesocarp of the fruit 24 h after treatment
[6]. The increase in the level of the antifungal diene in the pericarp was described as a
direct effect of ethylene on the regulation of the breakdown of the antifungal diene in
the tissue. Ardi et al. [6] found that ethylene activated phenyl propanoid metabolism,
especially tlavonone-3-hydroxylase, at a transcriptional level and resulted in an increase
of epicatechin. Present results show that exposure of avocado fruits to 40 fllll C2 H4 for
6 h almost doubled the level of the antifungal diene content in the peri carp in cv. Fuerte
(Fig. I). Concentration of the antifungal diene in the mesocarp of fruits exposed to 40
fll/I C ZH4 for 3 h also increased by 80% (Fig. 2). However, when slices of either
pericarp or mesocarp were sampled from freshly harvested fruits and then exposed to
C ZH 4, only the mesocarp showed a 40% increase in the diene content (Fig. 2). Since
Kobiler and co-workers [5] indicated that 85% of the antifungal diene in the mesocarp is
279
located in idioblast cells, a similar ethylene treatment was applied to isolated idioblast
cells.
1500
1250
:!:
co
.~ 1000
.:: 750 ..... 1.....~ .... .I

.E>
co
.,::l... SOO
.,
c:
0 250
0
0 2 3 4 5 6 7
Time (h)
Figure 1. Antifungal diene content in the avocado fruit pericarp after 40

j.!1!1 ethylene treatment of freshly harvested fruits cv. Fuerte at 20 C. After
each period of treatment, the peri carp was sampled and the diene
extracted. Bars indicate the SE for each sampling time.
~o r-----------------------------------------------~
4000
Z'" 3500
..c:
01
'w 3000
~
..c:
'" 25<)0
~
~2000
01
~
CI> 1!5<lO
C
o
CI>
1000
5<)0
Whole fruit Slices Whole fruit Slices
Pericarp Mesocarp
Figure 2. Antifungal diene content in the peri carp and mesocarp of avocado fruits cv. Fuerte
exposed to ethylene before and after sampling. A. Antifungal diene in the pericarp of freshly
harvested fruits exposed to 40 j.!l/l C2H. for 3 h and on peri carp slices exposed to the same conditions
after sampling. B. Antifungal diene in the mesocarp of freshly harvested fruits exposed to 40 j.!111
C2H4 for 3 h and on mesocarp slices exposed to the same conditions after sampling from the fruit.
Bars indicate the SE for each sampled treatment.
280
The minimal time required for the idioblasts cells to respond to C2H4 stimulus and show
an increase in diene level was 60 min (Fig. 3). Maximal increase of antifungal
compounds was obtained at 35 C. At this temperature antifungal the diene production
increased 2 fold compared to untreated cells. This indicates that an abiotic elicitor like
ethylene is affecting the synthesis in the preformed compound and it is reasonable to
suggest that idioblast are responsive for the modulation of the antifungal diene in the
mesocarp.
3000
.
li
2500
~ 2000
~ 1500
~
:a.
::L. 1000
II
C
.!! 500
c
0
0 50 100 150 200
Tlmelmln)
Figure 3. Antifungal diene content in idioblast of avocado fruit

mesocarp cv. Fuerte exposed for different periods to 40 IJlII C2~ at
20DC. Bars indicate the standard error for each sampling time.
Compartmentation of preformed antifungal compounds in oil cells has been reported

also for other plant [7]. The polyacetylenic compound falcarindiol, is localized in
extracellular oil droplets in carrot root periderm and pericycle [12]. The preformed
antifungal compound gossypol is associated with pigment glands in cotton [13]. The
preformed furanocoumarins from parsley are present in oil ducts and also free in the
host epidermal cells [14]. In all these cases resistance to pathogen by the antifungal
compounds was conferred by high amounts of free and not compartmentalized
compounds.
3.2. INCORPORATION OF [14C] LABELED PRECURSORS TO IDIOBLASTS

COMPOUNDS.
The hypothesis that the antifungal diene is synthesized in idioblast was supported by the
incorporation of [2_14C] malonyl-CoA and [1_14C] acetate into a compound that initially
co-chromatographed with the antifungal diene in TLC, HPLC and was finally
characterized as the antifungal diene (Fig. 4). Ethylene treatment of idioblast cells
incubated in the presence of [1- 14C] acetate and [2- 14C] malonyl CoA enhanced the
incorporation of both labeled materials. Not only the cells incorporated the precursors
but they were also transformed into a compound that co-chromatographed with the
diene by ~LC and HPLC (Fig. 4). Boiled cells did not show any transformation of
labeled precursors in the presence or absence of ethylene (results not shown), indicating
281
that a metabolically active system is involved. When pericarp and mesocarp slices were
exposed to etnylene in the presence of [1_14C] acetate they did incorporate
!! 200
co
c
co
..
:a
150
CC<r<toI
_C2H4
"IIi!
'e-" 100
3
.5
50
i
.3
0
Boiled Ha-Acetate Malonyl-CoA
Figure 4. Effect of ethylene on the incorporation of [14C] labeled

precursors by idioblasts from avocado fruit mesocarp of cv.
Fuerte. Idioblast cells were exposed to 38 !lifl C2H4 at 35C and
after 3h filtered, washed and extracted. The extracts were
analyzed by TLC, the spots with a similar Rf as the diene
standard error for each sampled treatment standard were scraped
off and the incorporated label measured by liquid scintillation
counting. Bars indicate the SE fPr each sampled treatment.
and transform this precursor into a compound that co-chromatograph with the antifungal
diene by TLC. Mesocarp slices transformed 5% of the incorporated material into the
putative diene and pericarp slices transformed only 0.7% of it (Fig. 5). Whereas
purified idiobJast cells transformed 37% of the labeled material into diene under similar
conditions (Fig. 5), indicating the higher efficiency of the cells compared to other
tissues, to transform precursors into the antifungal diene.
The observations of large lipoidal inclusions in the plastid of similar developing oil
cells has led to the conclusion that these organelles also may be involved in oil synthesis
in other cases [8]. Observations in cells of Citrus deliciosa [9] and Poncirus trifoliata
[10] support this conclusion. Terpene-producing trichomes and oil cavities in Citrus
have smooth endoplasmic reticulum, which may be involved in oil synthesis [9, 11] or
in the transport of oil from the plastids to the oil cavity [9].
3.3. EFFECT OF ETHYLENE TREATMENT ON THE EXPORT OF THE DIENE

FROM lDIOBLASTS
Present results indicate that ethylene treatment to pericarp does not induce an increase
in the antifungal diene content unless the treatment is applied to whole fruits. This
suggests that whereas the biosynthesis of the diene occurs in the oil cells, the compound
may be relocated to other parts of the fruits. Ethylene treatment of idioblasts in the
presence of floating mesocarp lipids (FL fraction) enhanced the diene content in the
282
cells and in the lipid media (Table I). The accumulation of the diene in the lipid media
doubled after 6-h treatment compared to a 3-h treatment only. When idioblast cells and
the lipid media were separated before ethylene treatment, no change in the diene level
was observed suggesting that no synthesis of the diene occurs in the lipid media (not
shown results).
40
3S
l 30
=
0
~ 25
i
I
20
15
!l 10
.5
:! 5
.:! 0
Pericalp Mesocarp Idicblas1s
Figure 5. [1_1~C] acetate transfonnation into diene by pericarp, mesocarp

and isolated idioblasts cells from avocado cv. Fuerte exposed to 40 j..llll
ethylene for 3h at 35C. After exposure of equivalent amounts of tissue to
the precursor, they were separated from the incubation medium, washed
and the antifungal diene was extracted. The extracts were applied to TLC
plates, the spots with Rf 0.47 (like the diene standard) were scraped and
the incorporated label measured by liquid scintillation. The acetate
transfonned into diene was calculated as the ratio between the
radioactivity measured in the diene spot related to the total radioactivity
applied to the TLC plate x 100.
Table 1. Effect of ethylene (40 j..LI/l) on the diene content of idioblasts

incubated in the presence of mesocarp lipids*
Diene concentration***
Time Idioblasts** Mesocarp lipids
(h) Control C2H. Control C2H4
3 74045 1250l 00 18720 30032

6 80050 1600l 50 19025 64055
*Mesocarp lipids were separated from the idioblast cells by vaccum filtration
of the floating layer (FL)
** 1-2xl06 cells were incubated in the presence of 2mI of meso carp lipids
,at 35 C for 3 h.
*** Diene concentrations is presented as I-lg per total cells SE j..l
283
The material released in the presence of ethylene treatment was extracted and
fractionated by TLC and NMR identified the component with Rf 0,47 as the described
antifungal diene. The proton NMR spectrum showed 8: 0.90( CH3), 1.32 [(CH2)n,
2.1O(CH3COO-), 2.43(CH2C=O,t) 2.60 (CH2C=O,d), 2.78(bisallylic CH2,t), 3.15
(OH,s), 4.10 (AcO-CH2-), 4.30 (-CHOH m), 5.36 (-CH=CH-,m).
Since neither epicatechin nor lipoxygenase activity could be detected in the
idioblasts cells [5], the increase in the level of the diene is clearly not the result of
inhibition of diene breakdown but the result of direct biosynthesis [1]. This does not
preclude the possibility that other cells have the possibility to synthesize the antifungal
diene, particularly because the increase of the diene at the site of fungal infection in the
fruit peel would need a significant relocation of the antifungal compound. The
elucidation of this process may shed light for understanding the basis of fruit defense
and its possible regulation. Present results provide the basic tools for approaching
deeper studies on the biosynthetic and transport queries, presently in progress.
3.4. BIOSYNTHESIS OF THE ANTIFUNGAL DIENE
The approach to study the biosynthetic pathway include the construction of cDNA
libraries of ethylene and non-ethylene treated fruits, a subtraction library resulting from
the ethylene treated and not treated libraries and the study of expression of putative
genes involved in the biosynthesis of the antifungal diene. As a first stage for the
isolation of genes involved in the biosynthesis of the diene it was tested as an
heterologous probe the castor bean Stearoyl-ACP-desaturase to test the ethylene and
non ethylene eDNA libraries. After screening 4x104 clones in both libraries, 23 clones
of the ethylene treated compared to 5 from the non-ethylene treated cDNA libraries
showed positive reaction to the heterologus probe.
Sequence of one clone showed 80% homology with the Stearoyl-ACP-desaturase
from castor bean, that the putative Stearoyl-ACP-desaturase from avocado is activated
during ethylene treatment. We are in the way to isolate genes more closely related to
the final processes for biosynthesis of the antifungal diene.
4. Acknowle.!lgements
This work was supported by grants funded by BARD, GIARA and CDR-AID
5. References
1. Prusky, D. and N. T. Keen. (1993) Involvement of preformed antifungal compounds and the
resistance of subtropical fruits to fungal decay, Plant Disease 77, 114-119.
2. Prusky, D., Keen, N. T., Sims, 1. 1. and Midland, S. L. (1982) Possible involvement of an
antifiI!1gal compound in latency of Colletotrichum gloeosporioides in unripe avocado fruits,
Phytopathology 72,1578-1582.
3. Karni, L., Prusky, D., Kobiler, I., Bar-Shira, E. and Kobiler, D. (1989) Involvement of epicate chin
in the regulation of antifungal diene concentration during activation of quiescent Colletotrichum
gloeosporioides infections of ripening avocado fruits, Physiol. Mol. Pl. Path. 35, 367-374
4. Oeissman, T.A. and Crout, D.H.O. (1969) Organic Chemistry of Secondary Plant Metabolism.
284
5. Kobiler, 1, Prusky, D., Midland, S., Sims, J.J. and Keen, N. T. (1993) Compartmentation of
antifungal compounds in oil cells of avocado fruit mesocarp and its effect on susceptibility to
Colletotrichum gloeosporioides, Physiol. Mol. Pl. Path. 43, 319-328.
6. Ardi, R., Kobiler, I., Keen, N.T. and Prusky D. (1998) Involvement of epicatechin biosynthesis in
the resistance of avocado fruits to postharvest decay, Physiol. Mol. Pl. Path. (in press).
7. Arnelunxen, F. and Gronau, G. (1969) Elektronmikroscopsche untersuchungen an den Oolzellen
von Acarus calamus L., Zeitscheiftfur Pj1anzenphysiologic 60, S 156-168.
8. Bosabalidis, A and Tsekos, I. (1982) Ultrastructural studies on the secretory cavities of Citrus
deliciosa Ten. II. Development of the essential oil-accumulating in the central space of the gland
and process of active secretion, Protoplasma 112,63-70.
9. Henrich G., Schultze, W. and Wegener, R. (1980) Zur kompartimetierung der synthese von mono-
und sesquiterpenen das atherischen ols bei Poncirus trifoliata, Protoplasma 103,115-129.
10. Thompson w.w., Platt-Aloia, K.A. and Endress, AG. (1976) Ultrastructure of oil gland
development in the leaf of Citrus cinensis L., Bot Gaz 137, 330-340.
11. Garrod, B. and Lewis, B.G. (1980) Probable role of oil ducts in carrot root tissue, Trans. Br.
Mycol. Soc. 75, 166-169.
12. Bell, AA (1969) Phytoalexin production and Verticillium wilt resistance in cotton,
Phytopathology 59,1119-1127.
13. Jahnen, W. and Hahlbrock, K. (1988) Differential regulation and tissue-specific distribution of
enzymes ofphenylpropanoid pathways in developing parsley seedlings, Planta 173,453-458.
14. Folch, J., Lees, M. and Sloane-Stanley, G.A. (1957) A simple method for the isolation and
purification of total lip ides from animal tissues, J. BioI. Chern. 226, 497-509.
15. Prusky, D., Plumbley, R. and Kobiler, I. (1991)Modulation of natural resistance of avocado fruits
to Colletotrichum gloeosporioides by CO2, Physiol. Mol. Pl. Path. 39, 325-334.
16. Platt, K. A and Thompson, W. W. (1992) Idioblast oil cells of avocado: distribution, isolation,
ultrastructure, histochemistry, and biochemistry, Int. J. Plant Sci. 153,301-310.
STIMULATED ETHYLENE PRODUCTION IN TOBACCO (NICOTIANA
TABACUM L., CV. KY 57) LEAVES INFECTED SYSTEMICALLY WITH
CUCUMBER MOSAIC VIRUS YELLOW STRAIN
Z. CHAUDHRY" S. FUJIMOT0 2, S. SATOH 2, T. YOSHIOKA 2, S.

HASE 1 AND Y. EHARAI
JLahoratory of Plant Pathology and 2 Bio-adaptation, Graduate School of
Agricultural Science, Tohoku University, Tsutsumidori-amamiyamachi, I-
I, Aoha-ku, Sendai 981-8555, Japan
l. Abstract
Ethylene production was stimulated in the leaves of tobacco (Nicotiana tabacum L. cv.
Ky 57) infected systemically with cucumber mosaic virus yellow strain (CMV - V). A
transient peak of ethylene production per fresh-weight base appeared 2 weeks after
inoculation when the mosaic symptoms of green, yellow and white sectors covered
about 40% or the leaf area. The increase in ethylene production was accompanied by
the increase in I -aminocyclopropane- I -carboxylate (ACC) content and activities of
ACC synthase and ACC oxidase in systemically-infected leaves. Application of
aminooxyacetic acid or I,IO-phenanthroline suppressed the multiplication of the virus
and development of mosaic symptoms besides ethylene production, suggesting a causal
relationship of the stimulated ethylene production in the symptoms development. A
partial cDNA encoding a putative ethylene receptor was isolated by RT-PCR from
virus-infected tobacco leaves. The abundance of mRNA corresponding to the eDNA
increased during mosaic symptoms development in tobacco leaves after systemic
infection with the virus.
2. Introduction
Virus infection to plants causes a multitude of symptoms, depending on the combination

of host plants and viruses, which ranges from mosaics, necrosis or chlorosis with
growth retardation in infected plants (systemic infection) to necrotic local lesion
formation (hypersensitive local infection). Ethylene production occurs with the onset of
hypersensitive response which results in the formation of necrotic local lesions [1,2,3,
4, 5]. For instance ethylene production from leaves of tobacco cv. Samsun NN
increased several folds 48 h after infection with TMVas compared to the non-infected
leaves [6]. On the other hand, there have been no reports that showed the increased
ethylene production during the systemic infection of virus onto tobacco plants. Balazs el
al. [7] reported no increase of ethylene production in the tobacco plants (cv. Xanthi-nc)
285
286
infected systemically with cucumber mosaic virus (CMV). De Laat and Van Loon [8]
reported that the systemic infection with TMV W U I caused no increase in ethylene
production in tobacco cvs. Samsun and Sam sun NN. Recently, we examined the
ethylene production from tobacco (cv. Ky 57) leaves infected systemically with CMV
yellow strain (CMV-Y) and found an increased ethylene production [9]. Also, we
obtained a partial cDNA from CMV-Y-infected tobacco leaves, which encodes a
putative ethylene receptor, and found that its mRNA abundance increased with the
development of mosaic symptoms.
3. Stimulated Ethylene Production in Tobacco cv. Ky 57 Leaves Infected

Systemically with CMV-Y
Tobacco (Nicotiana tabacum L. cv. Ky 57) seeds were germinated and grown on a peat
moss-based culture medium under a 14-h light (27C) / 10-h (22C) regime. Seedlings
with four leaves were transplanted to soil in I-liter plastic pots and allowed to grow for
3 weeks. Plants with their 6th leaf of about 15 cm in length were inoculated with CMV-
Y or mock onto the 6th leaf. The virus was transported to the upper part of the plants
and caused yellow/white mosaic symptoms on the 7th leaf and above, and the most
severe symptom appeared on the 9th leaf probably because of phyllotaxis [10]. Thus,
the systemic symptoms development was investigated with the 9th leaf.
The mosaic symptoms appeared 5 to 7 days after the inoculation of CMV -Y as
yellow sectors were formed. Then, the relative area of green, yellow and white sectors
changed during the progress of mosaic symptoms over 4 weeks by the transition of
green sectors to yellow ones, then to white ones [10]. The mosaic symptoms developed
about 40% of the leaf area and gained white sectors in addition to green and yellow ones
at 2 weeks after inoculation. The mosaic area covered 80% and 95% of the leaf area 3
and 4 weeks after inoculation, respectively. The leaf of mock control plants remained
healthy green over 4 weeks.
Figure 1 shows changes in fresh weight, ethylene production per leaf base as well as
per fresh-weight base of the 9th leaf of CMY -Y - and mock-inoculated control plants
during 4 weeks after inoculation. The 9th leaf was a meristematic leaf at the time of
inoculation, grew after that and reached its maximum size 3 weeks later in mock control
plants.
Systemic infection of CMV -Y caused growth retardation as one of the major
symptoms in the whole plants and this was also seen with the 9th leaf (Fig. I A). In the
mock control plants, ethylene production expressed per leaf base was small at the time
of inoculation, increased and attained maximum 2 weeks after inoculation, and
decreased thereafter. Ethylene production of the CMV-Y-infected leaf changed
similarly but surpassed that of mock control at the 2nd and 3rd weeks of infection (Fig.
I B). The enhanced ethylene production in CMV -Y-infected leaves was more clearly
demonstrated when the ethylene production was expressed per fresh-weight base (Fig.
lC). In mock control leaves, the rate of ethylene production was highest in the
youngest leaves (0.48 nmolg-1h- 1), and kept to decrease thereafter. In contrast, in CMV-
Y-infected leaves the rate of ethylene production remained high (around 0.4 nmolg-1h- 1)
until the 2nd week of infection. The maximum ethylene production rate of 0.48 nmolg-
287
Ih- 1 was observed on the 2nd week, when the mosaic symptoms developed to about 40%
of the leaf area. The ethylene production rate declined to 0.04 nmolg- 1h- 14 weeks after
inoculation (90 % mosaic symptoms covered the infected leaves).
ACC content was highest (5 nmolg-') in control leaves at the time of inoculation (0
week), rapidly decreased at the 1st week and remained low (below 0.4 nmolg-')
thereafter. In the CMV-Y-infected leaves, ACC content similarly changed, but with a
transient increase at the 2nd week of infection. At that time the ACC content of CMV-
V-infected leaves was five times that of non-infected control ones.
0.5
~u _ 0.4
=...
~0. ...~ 0.3
~IDe 02
~"O .
e
til .:. 0.1
1 4
Weeks after Inoculation
Figure 1. Changes in fresh weight (A), ethylene production per leaf base (8) and ethylene production per
fresh-weight base (C) ofCMV-Y-infected (0) or mock control (e) leaves of tobacco cv. Ky 57.
When ACe contents were compared among different mosaic sectors (green, yellow
and white sector) of CMV -Y-infected leaves and the healthy green tissue of non-
infected leaves at the 2nd week, the green sectors of the CMV-Y-infected mosaic leaves
contained the maximum amount of ACC (3.27 nmolg- 1), followed by the yellow and
white ones that contained 1.43 and 0.30 nmolg-I, respectively. The green sector of the
CMV -Y-infected leaves contained much more ACC than the green tissues of non-
infected control leaves; 3.60 nmolg- 1 vs. 0.60 nmolg-'.
The in vivo ACC synthase activities of leaf tissues were estimated by measuring
ACC production during incubation under N z, which inhibits the oxidative conversion of
288
ACC to ethylene [8]. In the mock control leaves, the activity of ACC production was
low with the rates of 0.067 and 0.005 nmolg-'h-' at the 15t and 2nd weeks of infection,
respectively. Whereas, in CMV -Y-infected leaves, the activity of ACC production was
high with the rates of 0.136 and o. \07 nmolg-'h-' at the 1st and 2nd weeks of infection,
respectively. Furthermore, AOA (aminooxyacetic acid), a competitive inhibitor of ACC
synthase [13], inhibited an accumulation of ACC in the CMV -Y-infected leaves which
were incubated under N2
ACC oxidase activities were extracted from the mock control and CMV -Y-infected
leaves and assayed in vitro. The activities were 2- and 4-fold higher in the CMV -Y-
infected leaves than the mock control ones at 0.7 and 1.6 week of infection,
respectively.
4. Role of Stimulated Ethylene Production in Mosaic Symptom Formation
Ethylene stimulates senescence of leaf tissues causing their color changes from green to
yellow [II]. Pritchard and Ross [12] showed that yellow flecks were induced in
tobacco leaves by treatment with ethylene. Therefore, we suspected that the stimulated
ethylene production has a role in the development of yellow/white mosaics in the
infected leaves of tobacco. Thus, we investigated the effects of AOA or I, I 0-
phenanthroline (Ph) on the development of mosaic symptoms in tobacco cv. Ky 57
leaves infected systemically with CMV-Y. Ph is an inhibitor of ACC oxidase [14, 15].
AOA at 0.5 mM or Ph at I mM were applied to the 7th through 9th leaves on the next
day of CMV -Y inoculation. The application of inhibitors were repeated twice at 2-day
intervals.
It was confirmed that AOA or Ph decreased ethylene production of the 9 th leaf to
the levels similar to and lower than that of the mock control, respectively, at 7th day
after inoculation. The 9th leaf of the plants infected with CMV-Y showed typical
mosaic symptoms at 7th day and later of infection. On the other hand, the leaf treated
with AOA or Ph showed little or no appearance of mosaic symptoms at 7th day, but,
they eventually showed a mosaic development at 12th day of infection. It was evident
that AOA and Ph delayed the appearance of the mosaic symptoms. The results
suggested that the stimulated ethylene production caused by systemic infection with
CMV-Y plays a regulatory role in the development of mosaic symptoms in tobacco cv.
Ky57.
5. Ethylene Receptor Gene in CMV-Y-infected Tobacco cv. Ky 57 Leaves
In order to reveal further the role of stimulated ethylene production in mosaic symptoms
formation, we planned to use transgenic tobacco plants with modified ethylene
perception. As the first step toward such an experiment, we investigated an ethylene
receptor gene by obtaining its cDNA from CMV -Y-infected leaves and finding changes
in its mRNA abundance during the development of mosaic symptoms.
Total RNA was isolated from CMV-Y-infected leaves, on which the green-yellow
mosaic area spread over about 20 % of the leaf area, and used for a template for
289
polymerase chain reaction (PCR) with primers derived from Arabidopsis ETRl gene
[16]. RT-PCR with these primers and total RNA as a template amplified a product of
about 760 bp in size. The PCR product was cloned into pT7 Blue T-Vector (Novagen).
The nucleotide sequences of the insert from 8 independent colonies were determined
and found to be identical.
The cDNA (Accession No. AF039921) has a 723-bp long open reading frame.
Alignments of the cDNA protein showed a close homology to the amino acid residues
110 through 349 of Nr protein in tomato [17], the identity was 94.6 %. Also, the
deduced amino acid sequence has homology to reported ethylene receptor proteins in
the corresponding region; 73.0 % to eTAEI [18] in tomato, 75.1 % to ERS [19] and 73.0
% to ETRI [16] in Arabidopsis, and 71.5 % to NT-ETRI in tobacco [20]. Since Nr in
tomato is a homolog of ERS in Arabidopsis, the cDNA was named pNT-ERS.
A
0.5 .....-------------,
s:::
o'C,' 0.4 1-----1--------1
'-9
:::I~
~..:= 0.3 1 - - - - -
g:a
Q..bI)
~~ 0.2
~'-'
0.11------
0 ....-...._...
mock 0% 20% 50% 80%
B
pNT-ERS
L25
mock 0% 20% 50% 80%
% ofmosalc symptoms in the

whole leaf area
Figure 2. Changes in ethylene production rates (A) and abundance of

mRNA of pNT-ERS (B) in CMV-Y-infected tobacco leaves during
development of mosaic symptoms. In B, the PCR product is 645 bp in
size, and the product of 300 bp in size is that for the ribosormal protein L
25 as the control for PCR efficiency.
Changes in the abundance of mRNA corresponding to pNT-ERS were examined

during mosai(f symptoms development in tobacco leaves after systemic infection with
CMV -Y (Fig. 2). In this experiment, ethylene production occurred most abundantly in
the leaf showing 20%-mosaic area, and it decreased as the mosaic symptoms spread
290
over the leaf area (Fig. 2A). RT-PCR analysis was done with the primers designed
according to the nucleotide sequence of the pNT-ERS cDNA. It was shown that the
mRNA corresponding to pNT-ERS was already present in the healthy non-infected
tobacco leaves but its abundance gradually increased as the mosaic area developed after
systemic infection with CMV-Y (Fig. 2B).
6. Discussion
The present investigation revealed the stimulated ethylene production in tobacco cv. Ky
57 leaves infected systemically with CMV -Y as compared to the non-infected leaves.
Also there were coccomitant increases in ACC content and activities of ACC synthase
and ACC oxidase in the CMV-Y-infected leaves. The results shown in Fig. IB and C
suggested that the enhanced ethylene production in CMV -Y-infected leaves was caused
by the increased activity of ethylene production, but not by a stabilization of the initial
activity existed in the youngest leaves. These findings together indicated that the
enhanced ethylene production in CMV -Y-infected leaves was caused by the increase in
ACC synthase and ACC oxidase activities, resulting in increased turnover of ACe.
The present results contrasted with those reported previously by Balazs et al. [17]
and De Laat and Van Loon [18] in which no increase in ethylene production occurred in
tobacco infected systemicaly with CMV or TMV, respectively. The discrepancy might
result from differences in the combination of host tobacco cultivars and virus species
and strains between the present study and the foregoing ones.
It has been suggested that ethylene plays a role in the systemic acquired resistance,
the induction of expression of genes for pathogenesis-related proteins, or the
development of local lesion symptoms [21]. The present findings showed that ethylene
was synthesized actively in the green sector of the CMV -Y-infected mosaic leaves, as
judged by the highest ACC content in it. Taking into account the observation that
ethylene stimulates senescence of leaf tissues causing their color changes from green to
yellow [II], we can speculate that the ethylene produced abundantly in the green sectors
was probaply responsible for the transition of green sectors to yellow ones, and then to
white ones. Actually, application of ADA or Ph suppressed the development of mosaic
symptoms besides ethylene production, suggesting a causal relationship of ethylene
production in the symptoms development.
We could obtain by PCR-c1oning the cDNA in partial-length for a putative ethylene
receptor, pNT-ERS. The close homology between pNT-ERS and Nr seems to relate to
that both tobacco and tomato plants belong to the same family, Solanaceae. The pNT-
ERS mRNA was already present in the healthy non-infected tobacco leaves but its
abundance increased as the mosaic area developed after systemic infection with CMV-
Y. This change did not agree with that of ethylene production rate, but agreed roughly
with the development of mosaic area; both increasing toward the late stage of systemic
infection with CMV-Y. These observations may imply some relationship between the
expression of pNT-ERS and the development of mosaic symptoms. In the present
study. however, we did not obtain the cDNA for NT-ETR I [20]. It will be of interest to
know the pattern of expression, if any, of the NT-ETR I during mosaic symptom
development in tobacco leaves after systemic infection ofCMV-Y.
291
7. References
1. Nakagaki, Y., Hirai, T. and Stahmann, M.A.(1970) Ethylene production by detached leaves
infected with tobacco mosaic virus, Virology 40,1-9.
2. Gaborjany, R., Balazs, E. and Kiraly, Z. (1971) Ethylene production, tissue senescence and local
virus infections, Acta Phytopathol. Acad Sci. Hung. 6, 51-55.
3. Pritchard, D.W. and Ross, A.P. (1975) The relationship of ethylene to formation of tobacco mosaic
virus lesions in hypersensitive responding tobacco leaves with and without induced resistance,
Virology 64, 295-307.
4. De Laat, A.M.M. Vonk, C.R. and Van Loon, L.C. (1981) Regulation of ethylene biosynthesis in
virus-infected tobacco leaves. I. Determination of the role of methionine as the precursor of
ethylene, Plant Physiol. 68, 256-260.
5. Otsubo, N., Seo, S., Yamashita S., Koga, M. and Ohashi, Y. (1996) Ethylene biosynthesis is
important for necrotic local lesion formation in tobacco, Plant Cell Physiol. 37, s196.
6. De Laat A.M.M. and Van Loon, L.C. (1982) Regulation of ethylene biosynthesis in virus-infected
tobacco leaves. II. Time course of levels of intermediates and in vivo conversion rates, Plant
Physiol. 69,240-245.
7. Balazs, E., Gaborjany, R., Toth, A. and Kiraly, Z. (1969) Ethylene production in Xanthi tobacco
after systemic and local virus infection, Acta Phytopathol. Acad. Sci. Hung. 4, 355-358.
8. De Laat A.M.M. and Van Loon, L.C. (1983) The relationship between stimulated ethylene
production and symptoms expression in virus-infected tobacco leaves, Physiol. Plant Path. 22,
261-273.
9. Chaudhry, Z., Yoshioka, T., Satoh, S., Hase, S. and Ehara, Y. (1998) Stimulated ethylene
production in tobacco (Nicotiana tabacum L. cv. Ky 57) leaves infected systemically with
cucumber mosaic virus yellow strain, Plant Sci. 131, 123-130.
10. Miyashita, K., Fukai, M., Karasawa, A., Hashiba, T. and Ehara, Y. (1994) Virus accumulation in
the leaves showing mosaic symptoms in tobacco plant infected with cucumber mosaic virus, Ann.
Phytopathol. Soc. Jap. 60, 761-762.
11. Abeles, A.B., Morgan, P.W. and Saltveit, M.E., Jr. (1992) Ethylene in Plant Biology, 2nd ed.,
Academic Press Inc., San Diego, CA, U.S.A.
12. Pritchard, D.W. and Ross, A.P. (1975) The relationship of ethylene to formation of tobacco mosaic
virus lesions in hypersensitive responding tobacco leaves with or without induced resistance,
Virology 64,295-307.
14. Apelbaum, A., Burgoon, A.C., Anderson, J.D., Solomos, T. and Lieberman, M. (1981) Some
characteristics of the system converting l-aminocyclopropane-l-carboxylic acid to ethylene, Plant
Physiol. 67, 80-84.
15. Bouzayen, M., Felix, G., Latcht, A., Pech, J-C. and Boller, T. (1991) Iron: an essential cofactor for
the conversion of l-aminocyclopropane-I-carboxylic acid to ethylene, Planta 184,244-247.
16. Chang, C., Kwok, S.P., Bleecker, A.B. and Meyerowitz, E.M. (1993) Arabidopsis ethylene
response gene ETR1: Similarity of product to two-component regulators, Science 262,539-544.
17. Wilkinson, lQ., Lanahan, M.B., Yen, H-C., Giovannoni, lJ. and Klee, H.J. (1995) An ethylene-
inducible component of signal transduction encoded by Never-ripe, Science 270,1807-1809.
18. Zhou, D., Kalaitzis, P., Mattoo, A.K. and Tucker, M. (1996) The mRNA for an ETRI homologue
1331-1338.
19. Hua, J., Chang, C., Sun, Q. and Meyerowitz, E.M. (1995) Ethylene insensitivity conferred by
Arabidopsis ERS gene, Science 269,1712-1714.
20. Knoester, M., Henning, J., Van Loon, L.C., Bol, J.F. and Linthorst, J.M. (1997) Isolation and
characterization of a tobacco cDNA encoding an ETRI homolog (accession no. AF022727) (pGR
97-188), Plant Physiol. 115, 1731.
21. Bol, J.F., Buchel, A.S., Knoester, M., Baladin, T., Van Loon, L.c. and Linthorst, H.J.M. (1996)
Regulation of the expression of plant defence genes, Plant Growth Regul. 18,87-91.
ACC DEAMINASE IS CENTRAL TO THE FUNCTIONING OF PLANT
GROWTH PROMOTING RHIZOBACTERIA
B. R. GLICK, J. LI, S. SHAH, D.M. PENROSE AND B.A. MOFFATT

Department of Bi%gy, University of Waterloo, Waterloo, Ontario,
Canada N2L 3G 1
1. Abstract
In addition to the more well known mechanisms that are used by plant growth
promoting rhizobacteria (PGPR), these organisms contain the enzyme 1-
aminocyclopropane-I-carboxylic acid (ACC) deaminase, which has no known function
in bacteria, and use this enzyme to lower plant ethylene levels resulting in an increase in
root length. Mutants of one PGPR strain that lack ACC deaminase activity were no
longer able to promote the elongation of canola seedling roots. All bacterial isolates
that are able to grow on ACC as a sole nitrogen source contain ACC deaminase and
promote root elongation. The effect of ACC deaminase-containing PGPR on canola
seedlings is identical to the effect of the ethylene inhibitor A VG. Treatment of canola
seeds with ACC deaminase-containing PGPR results in a lowering of ACC levels in
both roots and shoots. When an ACC deaminase gene was expressed in soil
pseudomonads that did not contain this enzyme activity and did not stimulate canola
root elongation, the transformants gained both ACC deaminase activity and canola root
elongation activity. These data are explained in terms of a model in which a PGPR
binds to canola seed coats and, during seed imbibition, the bacterium sequesters and
then hydrolyzes ACC from the seed, thereby lowering the level of ethylene that can
form during early plant development.
2. Introduction
Plant growth promoting rhizobacteria (PGPR) are free-living soil bacteria that bind to
the roots of plants and, using a variety of mechanisms, stimulate plant growth [6].
PGPR can act as biological disease control agents, promote root or shoot growth,
enhance germination, stimulate biological nitrogen fixation by Rhizobia, provide
resistance to a variety of both biotic and abiotic stresses and facilitate the development
of plants from tissue culture [6, 7,18,19].
The enzyme l-aminocyclopropane-I-carboxylate (ACC) deaminase, which cleaves
ACC into ammonia and a-ketobutyrate [15], has been found to be present in a number
of PGPR. However, only plants synthesize ethylene from ACC; although some bacteria
can synthesize ethylene they do so by another mechanism [2,23]. Therefore, it is likely
293
294
that soil bacteria that contain ACC deaminase can lower the level of ACC and hence the
concentration of ethylene in the plants with which they associate. Some of the
properties of this enzyme are summarized below in Table I.
TABLE 1. Reported properties of bacterial ACC

deaminases [14, IS, 16].
- Cleaves ACC to form ammonia and a-ketobutyrate

- Trimer molecular weight - \05 kDa
- Subunit molecular weight -3SkDa
- Requires pyridoxal phosphate
- Sulfhydryl enzyme
- Km for ACC = I-IS mM
- Induced by low levels (i.e., I OOmM) of ACC
- Temperature optimum -30C
- pH optimum -8.5
- Allows bacteria to utilize ACC as sole N source
- Cytoplasmically localized
In an effort to better understand the role of ACC deaminase in the mechanism that some
PGPR use to stimulate plant growth and development, several different types of
experiments were undertaken. (i) Ethylene has previously been shown to be an inhibitor
of root elongation in several different plant systems [1]. However, PGPR, such as
Pseudomonas putida GRI2-2, that contain the enzyme ACC deaminase can lower
ethylene levels within plant roots and shoots by decreasing the plant ACC content (Fig.
1). Consistent with this model, the roots of ethylene sensitive plants (such as canola,
tomato and lettuce) were invariably found to be longer when ACC deaminase-
containing bacteria were added either directly to the seed or to the soil in which the
seeds were later planted [10, 12]. (ii) The PGPR strain P. putida GR12-2 was
chemically mutagenized with nitrosoguanidine and three independent mutants that were
no longer able to proliferate on a minimal medium that contained ACC as a source of
nitrogen were selected [8]. Upon examination of these three mutants it was determined
that they were all devoid of any measurable ACC deaminase activity and they no longer
promoted the elongation of canola roots under gnotobiotic conditions [8]. Thus, in all
three instances, the ability of a PGPR to promote the root elongation of canola seedlings
depended upon the bacterium having ACC deaminase activity. (iii) Our model of plant
growth stimulation by bacterial ACC deaminase predicts that any bacterium that
contains this enzyme and is capable of binding to plant seeds or roots in the soil, should
also be able to lower the ACC content of the seed and/or root and thereby relieve
ethylene inhibition of root growth in plants that are sensitive to ethylene. That is, any
soil bacterium that contains ACC deaminase activity should also have the ability to act
as a PGPR. Consistent with this prediction, we have found that each of the strains of
bacteria that were isolated from seven different soil samples (one strain from each soil
sample) in two geographically disparate locations (i.e., Waterloo, Ontario and Southern
California) were able to utilize ACC as a nitrogen source and to promote canola
295
seedling root elongation under gnotobiotic conditions, i.e., to be a PGPR [9]. (iv) The
increase in the length of the roots of young (five to seven day old) ethylene sensitive
plant seedlings following treatment of the seeds with wild-type P. putida GR12-2 was
similar to the response of these plants when their seeds were treated with the ethylene
inhibitor, L-a-(aminoethoxyvinyl)-glycine, i.e. AVG [12]. Similarly, the plants that
were stimulated to the greatest extent by treatment with either P. putida GR12-2 or
AVG were those that were the most sensitive to root length inhibition by the chemical
ethylene generator ethephon, (2-chloroethyl) phosphonic acid [12]. (v) When an ACC
deaminase gene that was isolated from a strain of Enterobacter cloacae that acts as a
PGPR was introduced on a broad-host-range plasmid [21] into two different soil
pseudomonads that did not have either ACC deaminase or PGPR activity, both of these
bacterial strains acquired both a significant level of ACC deaminase activity and the
ability to promote canola root elongation (Fig. 2).
A B
Seed treabnent Seed treatment
Figure 1. (A) Amount of ACC/~g protein in the roots and (B) root length, of 4.5 day old canola plants grown
under gnotobiotic conditions from seeds treated with MgS04, P. putida OR12-2 or AVO. Error bars indicate
standard error.
The role that the enzyme ACC deaminase plays in the mechanism that PGPR utilize
to promote plant growth may be conceptualized as follows (Fig. 3; [11]): PGPR that are
free living in the soil are motile and can move toward and then bind tightly to the
surface of either a seed or root in their immediate vicinity [5, 13]. Both seed and
(particularly) root exudates can serve as a source of carbon (and possibly nitrogen as
well) for the bacteria that are bound to their surface. In return for the carbon (and
nitrogen) that the bacteria find in the exudate, they in tum may synthesize and secrete
phytohormones, especially indoleacetic acid (IAA); secrete siderophores that can bind
iron and then be taken up by the plant, thus helping to provide the plant with a sufficient
amount of iron from the soil; solubilize phosphate from the soil and make it more
readily available to the plant; and (as described here) lower plant ACC and hence plant
ethylene levels. Some PGPR, such as Azospirillum, may also provide fixed nitrogen to
the plant although the importance of this mechanism to plant growth and development is
controversial [3].
296
E. cloaca. P. pulida P. pulida P. fluor. P. fluor.

CAL2 + ACC-D + ACC-D
Figure 2. The ability of various bacterial strains to promote the elongation of canola roots under gnotobiotic
conditions. Each root elongation experiment included 80-90 seeds per treatment. The growth medium for E.
cloacae, P. putida and P. jluorescens was DF salts [4] containing either 0.2% (w/v) (NH.)2S0. or 3unM
ACC. The entire experiment was repeated twice. E. cloacae CAL2 [21] is a paPR strain that contains ACC
deaminase. The P. putida and P. jluorescens strains were transformed with the same broad-host-range
plasmid vector that was used to introduce the cloned ACC deaminase gene into these strains.
The IAA that is synthesized and secreted by a PGPR bound to the surface of either
the seed or root of a developing plant may be taken up by the plant and, in conjunction
with the endogenous plant IAA, can either stimulate plant cell proliferation and/or
elongation or stimulate the activity of the enzyme ACC synthase to convert S-
adenosylmethionine (SAM) to ACC [17]. Some of the ACC is exuded from plant roots
or seeds (along with other small molecules normally present in seed or root exudates),
taken up by PGPR, and cleaved by the enzyme ACC deaminase. The uptake and
subsequent hydrolysis of ACC by PGPR decreases the amount of ACC outside of the
plant, and to maintain the equilibrium between internal and external ACC levels the
plant exudes increasing amounts of ACC.
As a consequence of providing plants with IAA, PGPR cause plants to synthesize
more ACC_ than they would otherwise need. PGPR then stimulate ACC exudation from
the plant, providing PGPR with a unique source of nitrogen in the form of ACC which
cannot be utilized by the vast majority of soil microorganisms. This enables PGPR to
proliferate under conditions where other soil bacteria cannot grow. The direct
consequences of the interaction ofa plant with an ACC deaminase-containing PGPR are
lowering of the level of ACC within a plant, reduction of the concentration of plant
ethylene and a decreased extent of ethylene inhibition of root elongation.
297
Figure 3. Model of the interaction of

an ACC deaminase-containing PGPR
with a plant seed or root. Following
attachment of the bacterium, it is well
positioned to take up the amino acids
and other small molecules that are
Cell exuded by seeds or roots. The amino
Elongation
and acid tryptophan as well as some other
Proliferation amino acids can stimulate the ability of
"1
the bacterium to synthesize lAA, with,
in some cases, tryptophan being both a
precursor and an inducer of IAA
biosynthesis [20]. The newly
SAM ~ synthesized lAA is secreted by the
bacterium and may be taken up by the
ACC Synthase plant. At low concentrations of lAA
root cells may be stimulated to
proliferate and/or elongate; however,
ACC
high concentrations of IAA stimulate
l~~
ACC synthase thereby increasing the
level of ACe. Some of the ACC may
be converted into malonyl-ACC, (I-
aminobutyric acid or a-aminobutyric
Ethylene acid, or exuded from the plant. In the
1
presence of oxygen, the remainder of
the ACC may be converted to ethylene
by ACC oxidase, with the ethylene
PGPR acting as an inhibitor of root elongation.
Root Elongation In the presence of a PGPR, some of the
exuded ACC is taken up by the
bacterium and hydrolyzed by ACC
deaminase. To maintain the gradient
between internal and external ACC the
plant exudes increasing amounts of
Plant Seed IAA =indoleacetic acid ACC which are continuously removed
or Root ACC = 1 aminocyclopropane- by the bacterium.
1-carboxylic acid
SAM = S-adenosylmethionine
4. Acknowledgements
The work described in this manuscript was supported by the Natural Sciences and
Engineering Research Council of Canada and by Agrium, Inc_ (Saskatoon,
Saskatchewan)_
298
5. References
I. Abeles, F.B., Morgan, P. W. and Saltveit, M.E., Jr. (1992) The biosynthesis of ethylene, in Ethylene
in Plant Biology, 2nd edition, Academic Press, San Diego, pp. 26-55.
2. Billington, D.C., Golding, B.T. and Primrose, S.B. (1979) Biosynthesis of ethylene from
methionine. Isolation of the putative intermediate 4-methylthio-2-oxobutanoate from culture fluids
of bacteria and fungi, Biochem. J. 182,827-837.
3. Boddey, R.M. and Dobereiner, J. (1994) Biological nitrogen fixation associated with graminaceous
plants, in Y. Okon (ed.), Azospirillum Plant Associations, CRC Press, Boca Raton, pp. 119-135.
4. Dworkin, M. and Foster, 1. (1958) Experiments with some microorganisms which utilize ethane
and hydrogen, J. Bacteriol. 75, 592-60 I.
5. Fallik, E., Sarig, S. and Okon, Y. (1994) Morphology and physiology of plant roots associated with
Azospirillum, in Y. Okon (ed.), Azospirillum Plant Associations, CRC Press, Boca Raton, pp. 77-
85.
6. Glick, B.R. (1995) The enhancement of plant growth by free-living bacteria, Can. J. Microbiol. 41,
109-11 7.
7. Glick, B.R. and Bashan, Y. (1997) Genetic manipulation of plant growth-promoting bacteria to
enhance biocontrol ofphytopathogens, Biotechnol. Adv. 15,353-378.
8. Glick, B.R., Jacobson, C.B., Schwarze, M.M.K. and Pasternak, lJ. (1994) I-Aminocyclopropane-
I-carboxylic acid deaminase mutants of the plant growth promoting rhizobacterium Pseudomonas
putida GR12-2 do not stimulate canol a root elongation, Can. J. Microbiol. 40,911-915.
9. Glick, B.R. Karaturovlc, D.M. and Newell, P.c. (1995) A novel procedure for rapid isolation of
plant growth-promoting pseudomonads, Can. J. Microbiol. 41,533-536.
10. Glick, B.R., Liu, C., Ghosh, S. and Dumbroff, E.B. (1997) Early development of canola seedlings
in the presence of the plant growth-promoting rhizobacterium Pseudomonas putida GR 12-2, Soil
BioI. Biochem. 29, 1233-1239.
II. Glick, B.R., Penrose, D.M. and Li, J. (1998) A model for the lowering of plant ethylene
concentrations by plant growth-promoting bacteria, J. Theor. BioI. 190,63-68.
12. HaJI, J.A., Peirson, D., Ghosh, S. and Glick, B.R. (1996) Root elongation in various agronomic
crops by the plant growth promoting rhizobacterium Pseudomonas putida GRI2-2, Isr. J. Plant
Sci. 44: 37-42.
13. Hong, Y., Glick, B.R. and Pasternak, 1.J. (1991) Plant-microbial interaction under gnotobiotic
conditions: A scanning electron microscope study, Curro Microbiol. 23, 111-114.
14. Honma, M. (1985) Chemically reactive sulfhydryl groups of l-aminocyclopropane-1-carboxylate
deaminase, Agric. BioI. Chem. 49, 567-571.
IS. Honma, M. and Shimomura, T. (1978) Metabolism of I-aminocyclopropane-I-carboxylic acid,
Agric. Bioi. Chem. 42, 1825-1831.
16. Jacobson, C.B., Pasternak, 1.1. and Glick, B.R. (1994) Partial purification and characterization of
ACC deaminase from the plant growth-promoting rhizobacterium Pseudomonas putida GRI2-2,
Can. J. Microbial. 40,1019-1025.
17. Kende, H. (1993) Ethylene biosynthesis, Annu. Rev. Plant Physiol. Plant Mol. BioI. 44,283-307.
18. Lazarovits, G. and Nowak, 1. (1997) Rhizobacteria for improvement of plant growth and
establishment, HortScience 32,188-192.
19. Nowak, 1. (1998) Benefits of in vitro ybiotization of plant tissue cultures with microbial inoculants,
In Vitro Cell. Dev. Bioi. 34, 122-134.
20. Patten, C.L. and Glick, B.R. (1996) Bacterial biosynthesis of indole-3-acetic acid, Can. J.
Microbiol. 42, 207-220.
21. Shah, S., Li, J., Moffatt, B.A. and Glick, B.R. (1997) ACC deaminase genes from plant growth
promoting rhizobacteria, in A. Ogoshi, K. Kobayashi, Y. Hemma, F. Kodema, N. Kondo and S.
Akino (eds.) Plant Growth-Promoting Rhizobacteria. Present Status and Future Prospects, OECD,
Paris, pp. 313-315.
22. Shah, S., Li, J., Moffatt, B.A. and Glick, B.R. (1998) Isolation and characterization of ACC
deaminase genes from two different plant growth promoting rhizobacteria, Can. J. Microbial., in
press.
23. Sato, M., Urushizaki, S., Nishiyama, K., Sakai, F. and Ota, Y. (1987) Efficient production of
ethylene by Psuedomonas syringae pv. glycinea which causes halo blight in soybeans, Agric. BioI.
Chem. 51, 1177-1178.
THE ROLE OF ETHYLENE IN THE FORMATION OF CELL DAMAGE
DURING OZONE STRESS
Does ozone induced cell death require concomitant AOS and ethylene production?
R. KETTUNEN, K. OVERMYER AND J. KANGASJARVI

Institute of Biotechnology, University of Helsinki, POB 56 (Viikinkaari 5
D), FIN-00014 Helsinki, Finland
1. Abstract
Ozone (0 3) forms activated oxygen species (AOS) in the apoplasm and causes the plant
cell itself to produce AOS in an oxidative burst. In sensitive plants, this leads to the
formation of hypersensitive response (HR) -like lesions, the formation of which has the
characteristics of programmed cell death. 0 3 exposure upregulates ethylene
biosynthesis; in sensitive plants the elevated level of stress ethylene emission is
correlated with the damage level. If ethylene perception or biosynthesis is prevented the
damage formation is reduced. AOS formation, ethylene biosynthesis and damage
formation show similar spatial distribution in 0 3 treated leaves. Taken together these
findings suggest that both AOS and ethylene together are involved in the induction of
cell death in 0 3 exposed plants.
2. Introduction
Short high concentration peaks of the phytotoxic atmospheric pollutant ozone (0 3)

induce the formation of hypersensitive response (HR) -like lesions in sensitive plants.
Concomitant with the damage induction process are an oxidative burst and stress
ethylene biosynthesis where the levels of ethylene emission early in the course of
exposure determines the extent of damage that appears later. As early as 1976 Tingey et
al. [25] have described the correlation between ethylene and ozone-induced lesion
development and to this day increased stress ethylene evolution remains the best marker
of 0 3 sensitivity [28]. However, the exact role of 0 3 induced stress ethylene in damage
formation has remained unclear.
Ozone requires stomatal gas exchange for entry into the leaf in order to exert its
toxicity in the apoplast. Reactions with extracellular structures result in the production
of activated oxygen species (AOS) such as superoxide anion (02.), hydroxyl radical, and
hydrogen peroxide (H20 2) [9]. These AOS trigger the plant itself to produce an
oxidative burst. The oxidative burst is a key event in the induction of the hypersensitive
response (HR) to incompatible pathogens. The HR is a localized cell death response
299
300
and exhibits characteristics of programmed cell death. Through the activation of a

battery of defenses the HR serves to halt pathogen ingress and results in both local and
systemic immunity [2]. 0 3 acts as an elicitor inducing AOS synthesis in a manner
similar to those seen in plant-pathogen interactions [20, 22]. This suggests that Or
induced and pathogen-induced plant responses may be mechanistically similar and that
0 3 responses and damage are the result of deleterious firing of pathways normally
associated with the HR.
Ethylene has an important role in regulating and modulating plant responses to both
abiotic and biotic stresses (for example, to wounding, hypoxia, heavy metals, and
pathogens) by upregulation of plant defense systems. Some defense genes, such as
genes encoding basic PR proteins are responsive to ethylene [6], while others, typified
for example by Arabidopsis defensin 1.2, require both ethylene and jasmonic acid for
their induction [18]. Among the many roles in plant growth and development exercised
by ethyleri'e two are of particular interest in 0 3 response; ethylene as a regulator of
defense responses and as a regulator of cell death. For example, treating plants with
ethylene 24 hours prior to exposure results in decreased 0 3 damage; ethylene-induced
ascorbate peroxidase activity protected pea plants against the effects of H20 2, the pro-
oxidant herbicide paraquat, and 0 3 [11]. Involvement of ethylene in the regulation of
cell death has been shown during pea carpel senescence [16], in hypoxia-induced
aerenchyma formation of the maize root cortex [7] and in maize endosperm
development [29]. Although ethylene is not necessary for cell death in the HR, it is
formed during this process and has been shown to promote cell death and contribute to
symptom formation in the susceptible response to virulent pathogens [3, 10].
The first committed step in ethylene biosynthesis, conversion of S-adenosyl
methionine (SAM) to I-aminocyclopropane-I-carboxylic acid (ACC) is catalyzed by
ACC synthase (ACS). ACC oxidase (ACO), in turn, oxidizes ACC to ethylene. Both
ACS and ACO are encoded by mUltigene families. These genes show differential
expression during plant growth and development and respond differentially to various
external stimuli [15]. 0 3 induces ethylene synthesis in plants when a threshold
concentration has been exceeded [9, 19,20] via the upregulation ofa specific subset of
biosynthetic genes: these have thus far been shown to include the Arabidopsis AT-ACS6
[27], the tomato LE-ACS2 [26] and LE-ACOJ, and the potato ST-ACS4 and ST-ACS5
[21]
3. Model Plants Used
We have focused on two model plant species in our studies. Tomato (Lycopersicon
esculentum cv. Roma, Ailsa Craig, Pearson) is a classical model system for ethylene
studies. Its ethylene biosynthesis gene families are among the best characterized and
the cultivars available show a good variety of 0 3 susceptibility. Therefore it is most
suited for studies of ethylene biosynthesis. Arabidopsis thaliana ecotype Colombia
(Col-O) is a genetic model plant that is well suited for the study of 0 3 response [23,24]
as well as for the isolation of new mutants. Utilizing this we have isolated from tolerant
background mutants, which form visible damage (HR-like lesions) following a single
peak 0 3 exposure. Arabidopsis also offers a large number of well-characterized
301
mutants including mutants defining the steps involved in ethylene perception and signal
transduction. 03-sensitive mutants, Col-O wildtype (wt), and signal transduction mutants
have been used for the dissection of 0 3 induced defense and cell death pathways.
4.1. ETHYLENE EMISSION IS CORRELATED WITH LEAF INJURY
The correlation between 0 3 sensitivity and ethylene emissions has also been seen in our
model plants. In Arabidopsis, the 0 3 induced ethylene emissions of four different 0 3
sensitive mutant lines and the tolerant Col-O parental line were assayed [17].
Characteristically, the sensitive lines showed either significantly higher ethylene peaks
or prolonged and elevated ethylene emissions as compared to the 0 3 tolerant Col-O. In
these experiments ACC levels and damaged leaf area were also monitored. Ethylene
emissions tightly followed the increased ACC concentrations and the percentage of
damaged leaf area showed good correlation with both the increased ACC levels and
ethylene emission levels.
The 03-induced ethylene biosynthesis can be detected both as the transcriptional
induction of ACO- and ACS-genes, and at protein level as increased enzymatic
activities [26]. Inhibition of ethylene biosynthesis by applying inhibitors, such as the
ACS inhibitor aminoethoxyvinylglycine (AGV) or the ACO inhibitors CoCh and BAS
111..W, during 0 3 stress led to a reduction in the degree of leaf damage. Thus, these
results confirm the earlier observations [12, 14] showing that ethylene biosynthesis is
required for 0 3 damage formation.
4.2. RADICAL PRODUCTION, ETHYLENE BIOSYNTHESIS AND DAMAGE

ARE SPATIALLY RELATED
Several different radicals have been detected during 0 3 breakdown and the Orinduced
oxidative burst [9, 13]. However the mechanism of generation and roles of these
radicals has remained unclear. Using nitro blue tetrazolium (NBT) staining [8] we have
localized O 2- production in nascent lesions of 03-exposed 0 3 sensitive Arabidopsis
mutant line 2-20. O2- production continues in the healthy tissue adjacent to lesions
during lesion growth (Fig. lA and IB).
It should be emphasized that superoxide production, lesion spread, and increased
ethylene emissions all occurred at the same time [17]. In Col-O wt plants production
was localized in discrete points randomly distributed throughout the leaf. Infiltration
with diphenylene iodonium (DPf), an inhibitor of the plasma membrane NADPH
oxidase, dose dependently reduced the extent of 0 3 damage in mutant line 2-20. This
suggests a role for extracellular O2- (and possibly HzO z or other radicals downstream of
Oz) which is derived from the plasma membrane NADPH oxidase. In order to test if
Oz- was sufficient to trigger lesions in line 2-20 we have used an assay where Oz- can
be generated in vitro with xanthine and xanthine oxidase (X/XO) and cell death is
monitored as ion leakage. Such application of XIXO resulted in the dose dependant
induction of cell death in both Col-O and line 2-20. Moderate radical treatment with this
302
system resulted in the differential induction of cell death preferentially in line 2-20 and
thus establishes that exogenously applied extracellular Or is sufficient to trigger the cell
death response in this mutant.
Figure 1. A Light micrograph of a NBT stain visualizing extracellular O2'

production (dark spots indicate O2-) at 4 hrs in 0 3 exposed 0 3 sensitive
Arabidopsis mutant line 2-20. B. UV-epifluorescent micrograph of the same
leaf as in A. UV-excited autofluorescent phenolics compounds (white spots)
define the position of lesions. C. GUS stain visualizing LE-ACOI promoter
activity in 0 3 exposed tomato. D. Typical 03-induced damage pattern of the
same tomato cultivar shown in C, Photographed at 24 hrs. All samples recieved
a 6 hr x 250 ppb 0 3 exposure then were removed to c1eain air. Times indicated
as hrs after exposure begin.
As in Arabidopsis, the spatial localizations of AOS production and damage

corralated well in leaves of tobacco [22]. Also the induction of ethylene biosynthesis
genes appears to be spatially related to AOS and damage formation. In transgenic
tomato plants carrying the ACOI promoter fused to the uidA reporter gene [4], ozone-
induced GUS staining regulated by the ACOI promotor activity had a spatial
distribution similar to that of the damage pattern (Fig. I C and 1D).
4.3. EXOGENOUS ETHYLENE PROMOTES CELL DEATH
In order to test the role of increased ethylene emissions Col-O wt, gthylene insensitive
mutant (ein2-1), and mutant line 2-20 Arabidopsis were exposed first to 0 3 and
subsequently to either ethylene gas or clean air. The ethylene exposed plants showed an
increase in damage as compared to controls that had been exposed to 0 3 alone.
Increased damage was reflected both at the level of increased ion leakage and increased
visible damage. This effect was seen in Col-O wt and line 2-20 mutant plants but not in
the ein2-1 plants. The otherwise tolerant Col-O wt plant exposed to 0 3 and ethylene
303
showed light visible damage and the sensitive mutant showed a marked increase in the
level of damage resulting in nearly complete destruction of the rosette. Furthermore,
when plants were exposed to 0 3 concentrations (>350 ppb) that resulted in visible
damage even in the 0 3 tolerant Col-O, no damage was evident in the ein2-1 mutant
plants.
It has been proposed that ethylene promotes 0 3 toxicity by reacting chemically with
0 3 to produce dangerous activated ethylene radicals which initiate lipid peroxidation
[12, 14]. However, if ethylene were acting as a non-specific agent of oxidative damage
its effect would not be expected to require ethylene perception and signal transduction.
We have shown that the cell death promoting action of exogenously applied ethylene is
blocked in ein2-1. In light of our fmdings and recent evidence implicating ethylene as a
modulator of programmed cell death, we propose that Orinduced ethylene acts as a
modulator of cell death. Signals downstream of the ethylene receptor are one of the
factors required for the activation of a programmed cell death pathway in ozone
exposed plants.
We have also tested the effect of exogenous ethylene (added as ACC) in our X/XO
in vitro cell death assay. Application of exogenous ACC in this system increased the
level of cell death in both mutant 2-20 and the Col-O wt. The effect of ACC was tested
with the ein2-1 mutant and the enhancement ofXIXO induced cell death was found to
depend on ethylene perception, excluding the possibility of a direct effect of ACC or
ethylene per se. Further support for our conclusions has been seen in tomato where it
was shown that norbomadiene, an inhibitor of ethylene perception, blocked 0 3
enhanced increase in ion leakage [1].
Both in vitro and in intact ein2-1 plants there was a tendency towards slightly
elevated cell death (ion leakage) in response to radical treatments. This may suggest a
role for ethylene responsive defenses in preventing oxidative damage. However, it must
be emphasized that this was only detectable by ion leakage and none of the treatments
resulted in visible damage to ein2-1.
In addition to enhanced transcriptional activity of ethylene biosynthesis genes during 0 3

stress, reversible phosphorylation may relate AOS formation and ethylene biosynthesis
at the post-transcriptional level. Enhanced ACS activity could be prevented by addition
of the protein kinase inhibitor K-252a during an 0 3 treatment, and, vice versa, ACS
activity increased when the protein phosphatase inhibitor Calyculin A was added to
non-Ortreated leaves [26]. Similarly, application of protein kinase inhibitors to
soybean cells blocked subsequent production of H20 2 in elicited cells, and phosphatase
inhibitors induced the oxidative burst even in the absence of elicitors [5]. The
interesting question here is whether these two phosphorylation processes are parallel or
dependent on each other. In other words, the effects ofkinase/phosphatase-inhibitors on
signal transduction may influence AOS production, ACS activity, and ethylene
perception as well.
Other questions arise from the close correlation between 03-triggered AOS
production and ethylene with respect to cell death. AOS and ethylene seem to be
304
required for cell death, possibly together with some other yet unknown factors.
Dissection of their interplay during pcd requires detailed studies .
..---
OtherAOS
+
Figure 2. Schematic representation of the processes reviewed in this article.

Abbreviations used: Ag++, silver ions; ACC, I-aminocyclopropane-I-carboxylic
acid; ACS, ACC synthase; ACO, ACC oxidase; AOS, activated oxygen species;
AVG, aminoethoxyvinylglycine; Co++, cobalt ions; CTRI, CONSTIUTIVE
TRIPLE REPSONSE protein; DPI, diphenylene iodonium; EIN2, ETHYLENE
INSENSITIVE 2 protein; KIN, kinase; NBD, norbomadiene; 0,', superoxide
anion; 0 3, ozone; Pase, phosphatase; SAM, S-adenosyl methionine; XlXO,
xanthine Ixanthine oxidase.
6. Acknowledgments
This work was supported by the Academy of Finland grants 43671,33200 and 37995.
7. References
1. Bae, G.Y., Nakajima, N., Ishizuka, K. and Kondo, N. (1996) The role in ozone phytotoxicity of the
evolution of ethylene upon induction of I-aminocyclopropane-I-carboxylic acid synthase by ozone
funigation in tomato plants, Plant Cell Physiol. 37,129-134.
2. Bent, A (1996) Plant disease resistance genes: Function meets structure, Plant CellS, 1757-1771.
3. Bent, AF., Innes, R.W., Ecker, J.R. and Staskawicz, BJ. (1992) Disease development in ethylene-
insensitive Arabidopsis thaliana infected with virulent and avirulent Pseudomonas and
Xantomonas pathogens, Mol. Plant-Microbe Interact. 5, 372-378.
4. Blume, B. and Grierson, D. (1997) Expression of ACC oxidase promoter-GUS fusions in tomato
and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli, Plant J. 12,
731-746.
5. Chandra, S. and Low, P.S. (1995) Role of phosphorylation in elicitation of the oxidative burst in
cultured soybean cells, Proc. Natl. Acad. Sci. USA 92,4120-4123.
305
6. Enyedi, Al, Yalpani, N., Silverman, P. and Raskin, L (1992) Signal molecules in systemic plant
resistance to pathogens and pests, Cell 70, 879-886.
7. He, C.-J., Morgan, P.W. and Drew, M.e. (1996) Transduction of an ethylene signal is required for
ceIl death and lysis in the root cortex of maize during aerenchyma formation induced by hypoxia,
8. Jabs, T., Dietrich, RA and Dangl, J.L. (1996) Initiation of runaway cell death in an Arabidopsis
mutant by extracellular superoxide, Science 273,1853-1855.
9. Kangasjarvi, J., Talvinen, J., Utriainen, M. and Karjalainen, R. (1994) Plant defense systems
induced by ozone, Plant Cell Environ. 17,783-794.
10. Lund, S., Stall, R and Klee, H. (1998) Ethylene regulates the susceptible response to pathogen
infection in tomato, Plant Cel/IO, 371-382.
II. Mehlhorn, H. (1990) Ethylene-promoted ascorbate peroxidase activity protects plants against
hydrogen peroxide, ozone and paraquat, Plant Cell Environ. 13, 971-976.
12. Mehlhorn, H., O'Shea, lM. and Wellburn, AR. (1991) Atmospheric ozone interacts with stress
ethylene formation by plants to cause visible plant injury, J. Exp. Bot. 42, 17-24.
13. Mehlhorn, H., Tabner, B. and Wellburn, AR (1990) Electron spin resonance evidence for the
formation of free radicals in plants exposed to ozone, Physiol. Plant. 79, 377-383.
14. Mehlhorn, H. and Wellburn, AR. (1987) Stress ethylene formation determines plant sensitivity to
ozone, Nature 327, 417-418.
15. Oetiker, lH., Olson, D.C., Shiu, Y. and Yang, S.F. (1997) Differential induction of seven 1-
aminocyclopropane-I-carboxylate synthase genes by elicitor in suspension cultures of tomato,
Plant Mol. BioI. 34, 275-286.
16. Orzaez, D. and GraneIl, A (1997) DNA fragmentation is regulated by ethylene during carpel
senescence in Pisum sativum, Plant J. 11, 137-144.
17. Overmyer, K., Kettunen, R, Kuittinen, T., Saarma, M., Betz, C., Langebartels, C., Sandermann,
H., Jr. and Kangasjarvi, l (1999) The induction of cell death in an ozone-sensitive arabidopsis
mutant: The role ofsuperoxide and ethylene, (Manuscript in preparation).
18. Penninckx, LAM.A., Thomma, B.P.HJ., Buchala, A, Metraux, l-P. and Broekaert, W.F. (1998)
Concomitant activation ofjasmonate and ethylene response pathways is required for induction ofa
plant defensin gene in Arabidopsis, Plant Cel/IO, 2103-2113.
19. Sandermann, H., Jr. (1996) Ozone and plant health, Annu. Rev. Phytopathol. 34, 347-366.
20. Sandermann, H., Jr., Ernst, D., Heller, W. and Langebartels, C. (1998) Ozone: an abiotic elicitor of
plant defence reactions, Trends Plant Sci. 3,47-50.
21. Schlagnhaufer, C.D., Arteca, RN. and Pell, EJ. (1997) Sequential expression of two 1-
aminocyclopropane-I-carboxylate synthase genes in response to biotic and abiotic stresses in
potato (Solanum tuberosum L.) leaves, Plant Mol. BioI. 35, 683-688.
22. Schraudner, M., Moeder, W., Wiese, C., van Camp, W., Inze, D., Langebartels, C. and
Sandermann, H., Jr. (1998) Ozone-induced oxidative burst in the ozone biomonitor plant, tobacco
Bel W3, Plant J. 16,235-246.
23. Sharma, Y. and Davis, K. (1994) Ozone-induced expression of stress-related genes in Arabidopsis
thaliana, Plant Physiol. 105, 1089-1096.
24. Sharma, Y.K., Le6n, J., Raskin, L and Davis, K.R. (1996) Ozone-induced responses in Arabidopsis
thaliana: the role of salicylic acid in the accumulation of defense-related transcripts and induced
resistance, Proc. Natl. Acad. Sci. USA 93, 5099-5104.
25. Tingey, D.T., Standley, C. and Field, R.W. (1976) Stress ethylene evolution: a measure of ozone
effects-on plants, AtmospheriC Environment 10,969-974.
26. Tuomainen, J., Betz, C., Kangasjarvi, J., Ernst, D., Langebartels, e. and Sandermann, H., Jr.
(1997) Ozone induction of ethylene emission in tomato plants: Regulation by differential transcript
accumulation for the biosynthetic enzymes, Plant J. 12,1151-11632.
27. Vabala, J., Schlagnhaufer, C.D. and Pell, EJ. (1998) Induction of an ACC synthase cDNA by
ozone in light-grown Arabidopsis thaliana leaves, Physiol. Plant. 103,45-50.
28. Wellburn, FAM. and Wellburn, AR (1996) Variable patterns of antioxidant protection but
similar ethene emission differences in several ozone-sensitive and ozone-tolerant plant selections,
Plant Cel/ Environ. 19,754-760.
29. Young, T.E., Gallie, D.R and DeMason, D.A. (1997) Ethylene-mediated programmed cell death
during maize endosperm development of wild-type and shrunken2 genotypes, Plant Physiol. lIS,
737-751.
FLOODING-INDUCED SENSITISATION TO ETHYLENE IN RUMEX
PALUSTRIS AND THE POSSIBLE INVOLVEMENT OF A PUTATIVE
ETHYLENE RECEPTOR GENE
W.H. VRIEZEN l.2, C. MARIANIl AND L.A.C.J. VOESENEK 2

IDepartment of Experimental Botany, and 2 Department of Ecology,
University of Nijmegen, Toernooiveld I, 6525 ED, Nijmegen, The
Netherlands
1. Abstract
Rumex palustris, a flooding tolerant plant, increases the petiole elongation rate in
response to complete submergence. This response can be partly mimicked by enhanced
ethylene levels and low oxygen concentrations. A cDNA homologous to the ethylene-
response sensors (ERS/ETRl) from Arabidopsis thaliana was isolated from a R.
palustris cDNA library. This cDNA, RP-ERSl, was 242lbp long and shared 66%
nucleotide homology with ETRI and ERS in their coding regions. The expression level
of RP-ERSI was induced by exposing plants to 3% oxygen and an increase in mRNA
concentration could be detected 20 minutes after the beginning of the treatment,
preceding the first significant increase in elongation that was observed after 40 to 50
minutes. Experiments with ethylene synthesis and action inhibitors demonstrated that a
functioning ethylene signaling pathway is necessary for the stimulation of the petiole
elongation rate by low oxygen concentrations. These results suggest that the regulation
of the RP-ERS I gene plays a role in the strength of the petiole elongation response R.
palustris plants upon flooding.
2. Introduction
Rosettes of wetland Rumex species such as R. palustris accommodate to submergence

by stimulating petiole elongation. This petiole response requires ethylene and
gibberellin [8, 10]. Continues ethylene production and physical entrapment of the gas
causes a 100-fold rise in the endogenous ethylene concentration in R. palustris within
24h of submergence [I, II]. However, an ethylene enriched atmosphere is only
responsible for 80% of the elongation as compared to petiole elongation rate upon
submergence in R. palustris. We found that low oxygen concentrations also enhances
petiole elongation in R. palustris and that this response was ethylene dependent. Low
oxygen sensitised the petiole tissue to ethylene and this increase in responsiveness is
preceded by an increase in the expression level of a gene coding for a putative R.
palustris ethylene receptor.
307
308
A RP-ERSI
28SrRNA
time (h) o 2 3 4 5 6 8 10 12 24 48
B RP-ERSI
28SrRNA
Figure I. RP-ERSI messenger accumulation in petioles (A) and in leaf blades (B) at
different times after submergence.
time (h) after de-submergence 0.5 1 2 4 14 COS24 0.5 2 4 14
6 Air
A RP-ERS.l
4
28S rRNA
B RP-ERSl'
CO S24
28SrRNA
C RP-ERSI
28S rRNA
D RP-ERS1
28SrRNA
Figure 2. RP-ERSI messenger levels in leaves before (CO) and after 24h of submergence (S24) and during
subsequent de-submergence in different atmospheres. De-submergence in: (A) air (21 % oxygen, 0.033% C02
in nitrogen gas); (B) air + 5J.l1l1 ethylene; (C) 3% oxygen, 0.033% C02 in nitrogen gas; (D) 3% oxygen;
0.033% C02 in nitrogen gas + 5J.l1I1 ethylene. The graphs on the right represent the relative mRNA
concentration corrected for the loaded amount of RNA.
309
3. Results
3.1. RP-ERSI mRNA LEVEL IS MODULATED DURING SUBMERGENCE
We isolated a full-length cDNA clone (RP-ERS1; 2421bp long) which shares 66%
nucleotide homology with ETRI [2]. Upon alignment of the deduced amino acid
sequence with other known ethylene-response genes, RP-ERSI appeared to be a
homologue of ERS [4] and like this it lacks the receiver domain which is present in
ETRI. In order to analyse RP-ERSI transcript accumulation under flooding stress, we
performed RNA blot hybridisations with RNA isolated from petioles and leaf blades of
26-to 30-day-old R. paiustris plants. Figure 1 shows that the level of RP-ERSI
transcript (2.4kb) in untreated R. pa/ustris plants (t=Oh; Fig. 1) was low but detectable.
In contrast, when the plants were submerged, an increase in the transcript level could be
observed within 2h of submergence with the highest levels between 3h and 8h under
water. The pattern of mRNA accumulation was similar in both tissues, petioles and leaf
blades, although the overall transcript levels were higher in the petioles.
After lowering the water level to just above the roots (de-submergence), an
immediate decrease in RP-ERSI gene expression in the shoot was observed, and Ih
after de-submergence accumulation of the transcript reached almost the basal level (Fig.
2A). In general, when plants are exposed to flooding stress, endogenous ethylene and
carbon dioxide concentrations increase and the oxygen level declines [9]. The impact of
these changes on the expression level of RP-ERSI was investigated by de-submerging
R. pa/ustris plants in mixtures of these gases in concentrations that mimic partly the
underwater situation. Northern blot analysis of RNA isolated from leaves of plants de-
submerged in air with 5~I/1 ethylene (Fig. 2B) showed that ethylene prevents the mRNA
concentration to decrease to basal levels, as it does in air. De-submergence in an
atmosphere with low oxygen concentration (Figs 2C and 2D) induced the RP-ERSI
transcript levels to values higher than under submergence.
3.2. LOW-Oz-CONCENTRATION-INDUCED PETIOLE ELONGATION
The stimulating effect of ethylene on the petiole elongation in R. palustris is well

described by Voesenek and Blom [10]. Besides ethylene, also low oxygen
concentrations exerted this stimulating effect. Figure 3 shows clearly enhanced petiole
elongation rates at oxygen concentrations between 2 and 11 %. Treatment of R.
pa/ustris plants with inhibitors of ethylene action and biosynthesis showed that petiole
elongation in an atmosphere containing 3% oxygen is induced via ethylene [12]. Figure
4 shows that this growth increase is inhibited by 2, 5-norbornadiene (NBD), a
competitive inhibitor of ethylene action. This effect could be counteracted by applying
ethylene (1 O~l/l), underlining the competitive action of NBD. NBD did not influence
the growth under 21 % oxygen. These observations demonstrated that 3% oxygen
stimulated petiole growth indirectly via the plant hormone ethylene.
310
30 200 A
~
.gc 150
b
c
.9
" 100
..!l
.g
&
~
.~
&
OL-~5~~1~0--~1~5--~20~ 21%02
Oxygen concentration (%)
Figure 4. Elongation of the youngest
Figure 3. Elongation of the youngest petiole (n=8; means SE) of R. palustris in
petiole (n=8; means SE) of R. palustris in an atmosphere containing 21 (A) or 3% O2
response to a range of O2 concentrations. (8) in the presence and absence of 2, 5-
norbomadiene (NBD).
Raskin and Kende [7] showed that in deepwater rice low oxygen levels stimulate
elongation via an increased production of ethylene. In order to test whether low oxygen
levels have an effect on the synthesis rate of ethylene, which in tum generates the
increased petiole growth, we measured the ethylene production rate during treatment
with low oxygen concentrations. The average ethylene production by control plants
was 4.8nll(g DW*h) (SE=1.3nll(g DW*h) during the first 24h. Ethylene production by
plants exposed to 3% oxygen was 3.8nll(g DW*h) (SE=0.6nl/(g DW*h) [13]. In
summary, oxygen exerted its effect on the petiole growth level independently of an
increased ethylene concentration in R. pa/ustris. This was also reflected by the
ethylene-response curves of R. pa/ustris during exposure to 21 and 3% oxygen [12].
The [Rlso of 0.26 0.12JlIlI ethylene under 21% oxygen decreased to 0.04 0.02Jll/l
ethylene during exposure to 3% oxygen. In summary, exposure of R. pa/ustris plants to
low oxygen concentrations increased the rate of the elongation response at basal
ethylene concentration.
3.3. LOW-OTCONCENTRATION-INDUCED RP-ERSI GENE EXPRESSION
Low oxygen concentration induced petiole growth and stimulated also the RP-ERSI
mRNA accumulation (Figs 2 and 3). This correlation suggests a causal relation
between enhanced elongation and receptor gene expression. In this respect we studied
the precise timing of both events. Figure 5 shows that the growth rate increased
significantly after 40 to 50 min of exposure to 3% oxygen. The RP-ERSI messenger
concentration increased within 20 min after the switch to 3% oxygen to a well
detectable level and reaches a maximum after 2h, in this experiment [12].
311
4. Discussion
We showed that RP-ERSI gene activity increased after submergence especially in the
petioles, the tissue with the highest elongation rate. RP-ERSI gene activity is probably
stimulated by accumulated ethylene and low oxygen concentration during
submergence.
Low oxygen concentration alone can also stimulate the petiole elongation response
of R. palustris. This stimulation is nonetheless dependent on ethylene action and takes
place without an increase in ethylene concentration. The RP-ERSI messenger
concentration increased before the first significant increase in growth rate of the
youngest full-grown petiole during
exposure to 3% oxygen (Fig. 5). RP-ERSI ~1.5
exhibit strong sequence homology with
ETRI and the other members of the ~
ethylene receptor gene family from ..c:1.0
Arabidopsis, that are considered to act as
receptors. Therefore, we assume that RP- ~
!
ERS 1 is also an ethylene receptor protein ....l0.5
in R. palustris. The increase of RP-ERSI
mRNA levels upon exposure to low
oxygen concentration and the subsequent
increase of responsiveness to ethylene -80 -40 o 40 80 120
A time (min)
suggests an increase in sensitivity to this
hormone caused by an increased RP-ERSI
concentration of receptor proteins. This mRNA conc.
simple hypothesis, however, does not
agree with recent studies of loss-of- o 20 40 60 120 240 360
B time (min)
function mutations of several Arabidopsis Figure 5. Growth rate (n=5-6; means SE) during 10-
ethylene receptor genes [5]. Single, min intervals of the youngest full-grown leaves of R.
double, triple and quadruple mutant palustris with (closed symbols) and without (open
analysis of four members of the ethylene symbols) 3% oxygen treatment (A). The bats
represent the relative concentration of RP-ERSI
receptor family showed that knocking out messenger after the switch to 3% oxygen (B).
the ethylene receptors leads to constitutive
ethylene responses. This suggests that the ethylene responses are repressed by the
receptors instead of induced. According to this model, RP-ERSl seems to have the
opposite function as the putative ethylene receptors studied in Arabidopsis. Although
this seems unlikely, it is possible to make a model that could explain this function. RP-
ERSl could bind to CTRl (the negative regulator of the ethylene responses; [6]), as do
ETRI and ERS from Arabidopsis [3], but fails to activate it. A higher concentration of
RP-ERS 1 will sequester the free molecules of CTRI available in the cell, thus
abolishing the ethylene response inhibition. However, we have not determined if RP-
ERSl really binds ethylene, nor if it interacts with CTRI. Furthermore, the presence of
unknown regulating factors that can modify the ethylene signal transduction in R.
palustris can not be excluded. Therefore extensive research is necessary to explain the
regulation of the responses induced by the ethylene signal transduction pathway in R.
paiustris.
312
5. Acknowledgements
We thank Kees Blom for critical reading of the manuscript.
6. References
I. Banga, M., SIaa, EJ., BJorn, C.W.P.M. and Voeseriek, L.ACJ. (1996) Ethylene biosynthesis and
accumulation under drained and submerged conditions: A comparative study of two Rumex
species, Plant PJrysiol. 112,229-237.
2. Chang, c., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (1993) Arabidopsis ethylene-
response gene ETR]: Similarity of product to two-component regulators, Science 262, 539-544.
3. Clark, K.L., Larsen, P.B., Wang, X. and Chang, C. (1998) Association of the Arabidopsis CTRI
Raf-like kinase with the ETRI and ERS ethylene receptors, Proc. Natl. Acad. Sci. USA 95, 5401-
5406
4. Hua, J., Chang, C. and Meyerowitz, E.M. (1995) Ethylene insensitivity conferred by Arabidopsis
ERS gene, Science 269, 1712-1714.
5. Hua, J. and Meyerowitz, E.M. (1998) Ethylene responses are negatively regulated by a receptor
gene family in Arabidopsis thaliana, Cell 94, 261-271.
6. Kieber, lJ., Rothenberg, M., Roman, G., Feldmann, K.A and Ecker, J.R. (1993) CTR], a negative
regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raffamily of
protein kinases, Cel/72, 427 -441.
7. Raskin, I. and Kende, H. (1984) Regulation of growth in stem sections of deepwater rice, Planta
160,66-72.
8. Rijnders, lG.H.M., Yang, Y.Y., Kamiya, Y., Takahashi, N., Barendse, G.W.M., Blom, C.W.P.M.
and Voesenek, LACJ. (1997) Ethylene enhances gibberellin levels and petiole sensitivity in
flooding-tolerant Rumex palustris but not in flooding-intolerant R. acetosa, Pianta, 103, 20-25.
9. Stiinzi, J.T. and Kende, H. (1989) Gas in the internal air spaces of deepwater rice in relation to
growth induced by submergence, Plant Cell Physiol. 30,49-56.
10. Voesenek, L.ACJ.and BJorn, C.W.P.M. (1989) Growth responses of Rumex species in relation to
submergence and ethylene, Plant Cell Environ. 12,433-439.
11. Voesenek, LAC.J., Banga, M., Their, R.H., Mudde, C.M., Harren, FJ.M., Barendse, G.W.M. and
BJorn, C.W.P.M. (1993) Submergence-induced ethylene synthesis entrapment, and growth in two
plant species with contrasting flooding resistances, Plant Physiol. 103, 783-791.
12. Voesenek, L.AC.J., Vriezen, W.H., Smekens, MJ.E., Huitink, F.H.M., Bogemann, G.M. and
BJorn, C.W.P.M. (1997) Ethylene sensitivity and response sensor expression in petioles of Rumex
species at low O2 and high CO2 concentrations, Plant Physiol. 114,1501-1509.
13. Vriezen, W.H., Van Rijn, C.P.E., Voesenek, L.ACJ. and Mariani, C. (1997) A homologue of the
Arabidopsis thaliana ERS gene is actively regulated in Rumex palustris upon flooding, Plant 1. 11,
1265-1271.
INTERACTIONS BETWEEN OXYGEN CONCENTRATION AND
CLIMACTERIC ONSET OF ETHYLENE EVOLUTION
T. SOLOMOS
Department of Natural Resource Science and Landscape Architecture.
University of Maryland, College Park. MD 20742
1. Abstract
The most significant action of low oxygen on the senescence of detached plant organs is
the retardation of the onset of the climacteric rise in ethylene evolution. We have
observed that this aspect of low oxygen is saturable, in that for oxygen to delay the
climacteric rise in ethylene evolution in apples and carnation flowers its concentration
must be reduced below about 6.078 kPa. In cut carnation flowers, 4.5% oxygen delays
the accumulation in mRNA of both ACC-oxidase and -synthase by about 6-7 days
beyond that found in air samples. In contrast, low oxygen enhances the activity of
alcohol dehydrogenase (ADH). In flowers kept under 1.52 kPa O2 there is no
accumulation of ACC-synthase or -oxidase transcripts for 17 days, the duration of the
experiment. The data thus indicate that there is a mechanism that responds to low
oxygen by retarding the synthesis of enzymes associated with normal senescence while
at the same time enhancing the synthesis of anoxic proteins, yet without inducing
anaerobic fermentation. Preliminary results indicate that a heme-containing protein
may be involved in the "sensing" of the concentration of oxygen.
2. Introduction
Although the commercial use of controlled atmosphere (CA) storage is very extensive,
the mode of action of low O2 and/or high CO 2 is not well understood. The overt
physiological responses of detached horticultural crops to hypoxic stress include a
retardation of the climacteric rise in ethylene, a decrease in respiration, and a decrease
in the rate of ripening of fruits whose ripening has been initiated either naturally or in
response to exogenous C2 H4 application. At present it is not clear whether these
responses are indirect, due to the inhibitory effects of low O 2 on ethylene action, or
whether they are the direct result of low O 2 itself. The fact that hypoxia engenders
similar respiratory responses in tissues other than fruits where C2 H4 is not at issue, e.g.,
potato tubers and sweet potato roots [I, 6], indicates that hypoxia exerts metabolic
responses beyond those related to the senescence of horticultural crops in general and
fruit ripening in particular.
In this presentation we shall address questions concerning the quantitative aspects of
313
314
hypoxia on the three physiological effects mentioned above.
Firstly, concerning the retarding effects of hypoxia on the onset of the climacteric rise in
Cz~ evolution, it was reported previously that they are saturable, in that before Oz can
induce the delay, its concentration must drop below a certain level [2]. A case in point
occurs in "Gala" apples, where the climacteric onset is delayed when the concentration
of O2 decreases below 6.08 kPa O2 (Fig. 1). In cut carnation flowers the climacteric rise
in CO 2 output, which is the result of the increase in C 2H4 evolution, is delayed when the
Oz concentration drops to 5.07 kPa O2 [3]. The delay in the rise in CZ H4 evolution
cannot be attributed to the restriction of the oxidation of ACC because in initiated
bananas the initial decrease in C2H4 by hypoxia recovers with time, while imposition of
hypoxia at the preclimacteric stage completely suppresses the increase in C 2 H4
evolution for 20 d (Fig. 2). Neither can the retarding effects of hypoxia on the timing of
the climacteric onset of CZH4 evolution be attributed to the inhibition of C2 H4 action,
because hypoxia extends the vase-life of cut carnations to three times that of those
treated with inhibitors of C2~ action [3]. In short, the data indicate that low Oz delays
the onset of the C 2H4 climacteric by inhibiting the developmentally regulated genes that
lead to the induction of CZH4 biosynthesis. In carnation flowers 4.56 kPa O2 delays the
accumulation of the ACC-synthase transcript by about 6-7 days beyond that of the
200
Ii:i00
~12 %0 1 2
160
z
0
0
a:
IU 120 _13%~1
l\ ~ I
I-
~
~
::i!
:J 80
0
0 4% 0 2 1
I-
00
~ 40 .c-- a% 0. I
0 \
It.-lt.-lt.
0
a 20 40 flO 80 100
% OXYGEN
Figure I. Effect of O 2 levels on the onset of the C 2H. climacteric in 'Gala' apples.
flowers kept in air, whereas 1.5% O2 totally suppresses it for 17 days (Fig. 3). Similar
results are also observed with the synthesis of ACC-oxidase transcripts (Fig. 4). These
results verify previous observations showing that O2 concentrations below 5.07 kPa O2
retard the onset of the climacteric rise in C2H4 evolution [3]. The decrease by hypoxia
in the rate of ripening is also saturable. For instance, in avocados, in order that Oz may
315
decrease the rise in the activity and accumulation of protein and mRNA transcripts of
enzymes associated with ripening, its concentration should be decreased below 7.60 kPa
O2 [4]. Furthermore, the degree of inhibition is inversely related to O2 partial pressure.
Collectively, the results indicate that the delaying effects of hypoxia on the timing of the
C2 H4 climacteric are saturable and cannot be attributed to the inhibition of either C2 H4
biosynthesis or action but rather to a slow-down of the developmentally regulated
processes that lead to the induction of ACC-synthase and -oxidase. In addition, the
suppression in initiated fruits of the induction of enzymes associated with ripening is
also saturable.
1.00
0.90
..c:
C)
0.80
0.70
0.60
r\'\'" 1..------"">4-'" ,.. 0,
II1-~
'<t
0.50
:::c
I,
N
0 0.40
c \ ;I
0.30
t
2.53 kPs 0.
0.20
\
!:
0.10
0.00
...
0 4 8 12 16 20
DAYS IN TREATMENT
Figure 2. Effect of2.5% O2 on the rate ofC 2H4 evolution in bananas treated with C 2 H4
ITR:t...2--7-..---Q....;1;.,;,;.5;,..:%.::..2,;;;;O;..;:X..:.,Y~~EN:..:--1"..7--1'_~5 % ~XYG~~
Figure 3. Northern blot of ACC synthase of carnations kept in air, 1.5% O 2, and 4.5% O 2 Numbers at the top
of the lanes indicate days under treatment.
3"16
o A2~ 1.5r OXYGEN 4.5%OXYGEN

...............O""-..;;I4r...-_Z'-""-.,I;2_...l7r...-_1,u.O'--17 I 2 7 10
Figure 4. Northern blot of ACC-oxidase of carnations kept in air, 1.5% O2, and 4.5% O2 . The numbers at the
top of the lanes indicate days under treatment.
Secondly, with respect to the respiratory diminution by low O2, previous results
show that it is biphasic, in that it includes an initial decrease at relatively high O2
concentrations, followed by a rapid decline as O2 approaches zero. Furthermore, the
initiation of the respiratory decrease cannot be attributed either to the resistance of O2
diffusion or to the restriction of cytochrome oxidase [1, 2, 5] but rather to a "regulatory"
protein which has a much lower affinity for O2 than does cytochrome oxidase, and
whose restriction by low O2 leads to a feedback inhibition of the initial steps of glucose
oxidation.
In order to determine the apparent Km for O2 of the "regulatory" protein we used
peeled sweet potato roots, which do not produce C2H4 but which respond to its
exogenous application with a climacteric-type respiratory rise. In addition, the shape of
the curve obtained by plotting the rate of CO 2 output vs. O2 concentration is biphasic
[2].
We developed a model in which a root measured 10 cm. long and 3 cm in radius. In
conformity with the model, we divided it into 29 concentric, hollow cylinders, each 0.1
cm thick. The root in the model also consisted of a solid cylinder at its center. We
solved Fick's time-independent second law of diffusion equation for hollow and solid
cylinders [7]. From the observed rates of CO2 output, the dimensions of the root and the
diffusivity of O2 through the flesh, we calculated both the O2 concentration and the rate
of respiration profiles across the root. The Km for O2 was varied so that the calculated
internal O2 concentration in air equaled that observed experimentally. Figure 5 shows
that when the Km for O2 was 1.78%, the calculated rate of CO 2 output was similar to the
observed rate. It should also be noted that the decrease in the rate of CO2 output
occurred when the O2 concentration decreased below 6%.
3.1. HYPOXIA AND INDUCTION OF ANOXIC ENZYMES
The metabolic ramifications of hypoxia transcend those related to the senescence of

detached plant organs. For instance, pre-treatment of plant tissues with hypoxia
improves their ability to survive subsequent anoxia [8, 9]. These effects involve
317
biochemical responses, such as enhancem~nt of the glycolytic potential with the

synthesis of anoxic enzymes [10], as well as the synthesis ofaerenchyma in roots [11].
Exposure of carnation petals to 1.25 kPa O2 for three days augments the activity of
ADH, which in turn results in a rise in ethanol synthesis and a period of survival in
subsequent anoxia which is longer than that of the flowers that have been kept in air [9].
In the case of avocados, the same range of O2 concentrations, which suppresses the
induction of enzymes associated with ripening induces the synthesis of anoxic isoforms
of ADH [4]. In preclimacteric bananas, hypoxia enhances the activities of pyruvate
decarboxylase and ADH (Fig. 6), as well as sucrose synthase, an anoxic protein [2].
Preliminary results with carnation flowers indicate that the induction of anoxic proteins
appears also to be saturable (unpublished observations).
30 r---------------------------------,
Figure 5. Observed and calculated rates of CO2 output in sweet potatoes as a function of O2
This experimental evidence suggests that in plant tissues there is an oxygen "sensor"
which, on the one hand, suppresses the rate of senescence and, on the other, induces
anoxic proteins. An oxygen "sensor" has been found in Nrfixing bacteria, where it
regulates the expression of the nitrogenase gene [12], and in higher animals, where it
regulates the Erythropoietin gene [13]. It has been demonstrated that the oxygen sensor
is a high-spin iron heme protein [12]. It is thus feasible that the affinity for O2 of the
"sensor" could be reduced by substituting Fe 2+ for either C0 2+ or Ni 2+. If this is the case,
then the addition of the above ions to the holding solution of cut carnations may result
in the induction of anoxic proteins in air. Moreover, Ni 2+ should be a stronger inhibitor
318
than C0 2+. The data presented in Table 1 tend to support this hypothesis.
0.30 1.00
B
[K] 2.52 kP. I PYFlOVA.T':= D~C,<loFlBO)lYLAo!IJ: I
:c
0.24
IA DH AC TlV lTV I .-:c 0.00
"01 ' "":"01

m
"1;:-
0 0.18 0.00
c: >-
oj ,,-.,
.t= ~w
ID IR
0.12 0.40
~ "l
QJ
0 "6
E E
" 0.00
." 0.00
0.00 0.00
00 00
DAYS IN STORAGE DAYS IN STORAGE
Figure 6. Activities of ADH (A) and PDC (B) in bananas kept either in air for 3 days or
2.5% O 2 for 20 days.
Table 1. ADH activity in carnation flowers kept for 3 days in water, 5 mM

CoCh and 5 mM NiCh. The numbers in parentheses are the STD of two
flowers.
Treatment ADH Activity

nmol.ethanol/mg protein/min
Water 4.13 (0.05)
5 mMCoCh 13.03 (2.39)
5mMNiCh 15.24 (1.95)
4. References
1. Solomos, T. (1982) Effects of low O 2 concentration on fruit respiration: Nature of respiratory

diminution, in D.G. Richardson and M. Meheriuk (eds.), Controlled Atmospheres for Storage and
Transport of Perishable Agricultural Commodities, Oregon State University, Timber Press,
Beaverton, pp 161-170.
2. Solomos, T. and Kanellis, AK. (1997) Hypoxia and fruit ripening, in AK. Kanellis, C. Chang, H.
Kende, and D. Grierson (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer
3. Solomos, T. and Gross, K. (1997) Effects of hypoxia on respiration and the onset of senescence in cut
carnation flowers (Dianthus caryophyllus L.), Postharvest BioI. and Technol. 10, 145-153.
4. Kanellis, AK., Solomos, T. and Roubelakis-Angelakis, K.D. (1991) Suppression of cellulase and
polygalacturonase and induction of alcohol dehydrogenase isoenzymes in avocado mesocarp
subjected to low O 2 stress, Plant Physiol. 96, 269-274.
5. Tucker, M.L. and Laties, G.G. (1985) The dual role of oxygen in avocado fruit respiration: Kinetic
analysis and computer modeling of diffusion-affected kinetics, Plant Cell Envir. 8, 117-127.
6. Mapson, L.W. and Robinson, J.E. (1962) Terminal oxidases of potato tuber, Bioch. 1. 82, 19-25.
7. Solomos, T. (1987) Principles of gas exchange in bulky plant tissues, HortSci. 22,766-771.
319
8. Saglio, P.H., Drew, M.C. and Pradet, A. (1988) Metabolic acclimation to anoxia induced by low (2-4
kPa partial pressure) oxygen treatments (hypoxia) in root tips of Zea mays, Plant Physiol. 86,61-66.
9. Chen, X. and Solomos, T. (1966) Effects of hypoxia on cut carnation flowers (Dianthus caryophyl/us
L.): Longevity, ability to survive under anoxia, and activity of alcohol dehydrogenase and pyruvate
kinase, Postharvest BioI. Technol. 7,317-329.
10. Sachs, M.M., Subbaiah, C.C. and Saab, LN. (1996) Anaerobic gene expression and flooding
tolerance in maize, J. Expt. Bot. 47: I-IS.
11. Drew, M.e., Jackson, M.B. and Giffard, S. (1979) Ethylene-promoted adventitious rooting and
development of cortical air spaces (aerenchyma) in roots may be adaptive response to flooding in Zea
mays L., Planta 1536, 217-224.
12. Giles-Gonzalez, M.A., Gonzales, G. and Peruz, M.R. (1995) Kinase activity of oxygen sensor FixL
depends on spin state of its heme iron, Biochemistry 34,232-236.
13. Goldberg, M.A., Dunning, S.P. and Hunn, F. (1988) Regulation of erythropoietin gene. Evidence that
the oxygen sensor is a heme protein, Science 242, 1412-1415.
MANIPULATION OF THE EXPRESSION OF HEME ACTIVATED PROTEIN
HAPSc GENE IN TRANSGENIC PLANTS
W. GHERRABy 1,2, A. MAKRIS 2, 1. PATERAKI 1, M. SANMARTIW, P.

CHATZOPOULOS 4 AND A. K. KANELLIS 1,3,5
ilnstitute of Viticulture, Vegetable Crops and Floriculture, National
Agricultural Research Foundation, PO Box 1841, GR-711 10 Heraklion,
Crete, Greece; 2 Mediterranean Agronomic Institute of Chania, PO Box
85, GR-731 00 Chania, Crete, Greece; 3Institute of Molecular Biology
and Biotechnology, FORTH, PO Box 1527, GR-711 10 Heraklion, Crete,
Greece; 4Dept. of Agricultural Biology and Biotechnology, Agricultural
University of Athens, Iera Odos 75, GR-118 55 Athens, Greece; 5 Dept. of
Pharmaceutical Sciences, Aristotle University ofThessaloniki, GR-540 06
1. Abstract
To better understand the regulation of respiratory metabolism during hypoxia, we have

isolated a gene, HAP5c (Heme Activated Erotein), from Arabidopsis thaliana that
shows 65% amino acid identity with the yeast HAP5, one of the subunits of CCAAT-
binding factor. This binding factor is a transcriptional activator of nucleus encoded-
mitochondrial genes, and genes involved in heme biosynthesis. Transgenic Arabidopsis
thaliana and tobacco plants bearing an antisense to HAP5c and a sense HAP5c,
respectively, have been produced which showed altered growth and flower structure.
The significance of these findings is discussed in relation to fruit ripening and
senescence.
2. Introduction
2.1. REGULATION OF GENE EXPRESSION BY HEME
The term "heme" (an alternative spelling is "heam") is defined by the IUB enzyme
commission as any tetrapyrolic chelate of iron. The four major groups of cytochromes a,
b, c and d are defined as heme proteins, because they contain heme which is a small
organic non-protein portion as a prosthetic group. The latter mayor may not be
covalently bound to the apoprotein depending upon the cytochrome type [6]. Heme
serves also as a prosthetic group in some oxygen-binding proteins such as catalases. Its
function is intimately entwined with that of molecular oxygen. Heme plays a regulatory
role in many different processes in a wild variety of organisms [17], so it is not
321
322
surprising that heme serves as an intermediate in the signaling mechanism for oxygen
levels in yeast cells. Most of the heme activated genes fall into two categories: those
encoding respiratory functions such as the cytochrome subunits, and those encoding
oxidative damage repair functions such as catalase and manganese superoxide
dismutase. On the other hand, the expression of the second set of genes is repressed by
heme. Most of these genes are regulated by the action of ROX 1, encoding the heme-
dependent repressor [10]. The expression of the ROXI gene is transcriptionally
activated by heme [11], thus heme repression of ROX I-regulated genes results from the
heme-dependent transcriptional activation of the repressor gene.
2.2. HEME ACTIY ATED PROTEINS
Two distinct heme activated protein (HAP) complexes: HAPI and HAP2/3/4/5 have
been shown to be heme-dependent transcriptional activators. The properties of these
complexes have been reviewed by Zitomer and Lowery, [24].
In yeast, S. cerevisiae, the CCAAT -binding factor has been shown to be a
heteromeric complex containing HAP2, HAP3, HAP4 and HAP5 [7, 8, 13, 14].
The HAP2, 3 and 4 genes were identified because mutations in any of these genes
abolish the activity of the CCAAT box in vivo, thereby blocking the expression of
nuclear genes encoding mitochondrial proteins and preventing the growth of mutants
on lactate medium [7, 8, 18, 23]. HAP5, on the other hand, was isolated by the two-
hybrid methods using essential core sequences of HAP2 as bait [13]. HAP2, HAP3
and HAPS form a heteromeric complex called HAP2/3/5, in which all the subunits of
the complex are required for the assembly and CCAAT-binding activity [13].
2.3. COUNTERPARTS OF THE HAP2/3/4/S COMPLEX IN OTHER

EUKARYOTES
CCAAT -box -related motifs have also been identified in the promoters of a variety of
vertebrate genes. A range of transcription factors has been shown to bind to CCAAT
boxes, with varying levels of specificity [4, 19], and each is thought to playa distinct
role in gene expression or DNA replication [20].
In mammals, the CCAAT-binding factor is known as CBF (NF-Y or CPl), and
consists also of three subunits: CBF-A, CBF-B and CBF-C. The homologies between
yeast HAP2 and HAP3, and their mammalian counterparts CBF-B and CBF-A
respectively, are sufficiently extensive to allow the assembly of functional hybrids [3].
The identification of the last subunit, CBF-C, confirmed that in mammalians, as well as
in yeast, three subunits are essential for DNA-binding [12].
The rat CBF-C subunit (counterpart of HAPS) allows formation of a protein-DNA
complex with yeast HAP2 and HAP3, suggesting that the DNA-binding and subunit
interaction functions of these polypeptides are interchangeable and their functions are
completely conserved between yeast and rodents [21]. Similar implications have been
made previously, based on the same experiment using human counterparts CBF-B and
CBF-A [2].
Furthermore, homologues of both HAP2 and HAP3 have been isolated from yeast
Schizosaccharomyces pombe [16, 23].
323
2.4. COUNTERPARTS OF THE HAP2/3/4/5 COMPLEX IN PLANTS
A homologue of HAP2 has been reported to be isolated from Brassica napus [1],
and a protein with similarity to HAP3 has been isolated from maize [9].
Recently, the three necessary components of the HAP complex function have been
isolated from Arabidopsis thaliana [5]. Surprisingly, multiple forms of each HAP
homologue were found in Arabidopsis. Three independent Arabidopsis HAP subunit 2
(AtHAP2) cDNAs were cloned by functional complementation of yeast hap2 mutant,
and two independent forms of each of AtHAP3 and AtHAP5 cDNAs (HAP5a and
HAP5b, whose accession numbers are, respectively, Y13725 AND Y13726), were
detected in the expressed sequence tag database. Additional homologues (two of
AtHAP3 and one of AtHAP5) have been identified from available Arabidopsis
genomic sequences.
An Arabidopsis homologue of the HAP5 protein was independently isolated in a
yeast genetic screen as an enhancer of pseudohyphal filamentation [22]. The isolated
gene, which is 625bp, is a third isoform ofHAP5 that may be called HAP5c. The latter
clone has been used in the present study.
In this study, we intend to alter the function of the heteromeric CCAAT-binding
complex by altering the function of its essential component HAP5c by either
antisensing or over-expressing AtHAP5c in Arabidopsis and tobacco plants,
respectively. This approach was based on the fact that yeast mutants ofHAP5 exhibited
retarded growth, thus by altering the expression HAP5 in plants we expect to obtain
transgenic plants with altered growth.
3.1. TRANSFORMATION OF ARABIDOPSIS WITH ANTISENSE TO ATHAP5C
We transformed Arabidopsis plants using the vacuum infiltration method with a

construct consisted of the promoter 35S of cauliflower mosaic virus (CaMV),
downstream of which the open reading frame of cDNA HAP5c was inserted in the
reverse orientation, between the HindIII and XbaI restriction sites in the pGA643 binary
vector.
The growth of plants in the selective media provided initial phenotypic evidence for
the efficient transformation. Further, PCR (Polymerase Chain Reaction) was carried out
using the genomic DNA of transformed Arabidopsis as a template and primers of the
CaMV 35S-promoter and the forward HAP5c, in order to avoid amplification of the
endogenous HAP5c gene. The PCR products were subsequently run on a gel and
hybridized to the cDNA HAP5c probe under high stringency conditions. To confirm
the presence of the expected antisense RNA transcript of HAP5c, and study its effect on
the expression of the endogenous gene, RNA samples from transformed plants as well
as wild type Arabidopsis were isolated, electrophoresized, blotted and hybridized to the
HAP5c probe under high stringent conditions. The transcript of the antisense HAP5c
transgene was detected with a size of around O.6kb in all the transgenic plants that were
324
analyzed, while it was absent in the wild type plants. The transcript of the endogenous
HAP5c was detected, with a size of around O.9kb, relatively in higher amounts in the
wild type than in the transgenic plants.
3.2. EXPRESSION OF THE ANTISENSE HAP5C RESULTED IN DIFFERENT

PHENOTYPES IN INDIVIDUAL PLANTS
Targeting the endogenous HAP5c by expression of its antisense in Arabidopsis resulted

in different types of transgenic plants. The first type did not show any visible effect as
compared to the control (wild type Columbia), despite the presence of the antisense
RNA. The second type of transgenic Arabidopsis manifested slower growth and
therefore, seeds were collected one month later as compared to the control. In the third
type of transgenic Arabidopsis, the phenotype was more accentuated. In addition to the
slow growth, the plants were sterile and dwarf. The leaves were dark-green, small and
wavy. The stems were weak as compared to wild type plants.
3.3. OVEREXPRESSION OF HAP5C IN TRANSGENIC TOBACCO
Tobacco plants [ecotype "Samsun"] were transformed with the Arabidopsis HAP5c
gene using the particle gun bombardment method. The construct consisted of the
promoter 35S transcript of CaMV, downstream of which the full length of the
Arabidopsis HAP5c gene was inserted in the sense orientation between the EcoRI and
Not! restriction sites in the pAM35S plasmid.
Examination of tobacco transgenic plants revealed that all the plants were sterile and
some of them exhibited retarded growth. Three types of abnormalities were observed in
the flowers. The first type of flowers consisted of short stamens, which were unable to
reach the carpel. The second type of flowers showed alterations in the organ identity of
the stamens, which were transformed to carpel structure. Finally, in the third type
flowers, the stamens were transformed in petal-like structure.
Another significant observation about these tobacco plants was the existence of
normal flowers, carrying normal stamens, together with altered flowers in the same
plant. Nevertheless, none of these flowers was able to produce seeds.
4. Discussion
As a first approach in manipulating the expression of the HAP complex in plants, the
Arabidopsis HAP5c was expressed in the antisense and sense orientations in
Arabidopsis and tobacco plants, respectively. Retarded growth and male sterility were
observed in both transgenic plants. It is expected that inhibition of HAP5c expression
would prevent the assembly and functioning of the HAP complex. Consequently, this
would result in the alteration of the function of a wide array of genes including the
mitochondrial inner membrane protein cytochrome c. It is therefore attempting to
speculate that the HAP complex is activating the turnover of some processes occurring
in mitochondria during plant growth and development.
325
HAP complex offers a very promising field of research, in postharvest physiology.

As ripening of many fruits, such as tomatoes, is accompanied by a peak in respiration
(referred to as climacteric) and a concomitant burst of ethylene synthesis, it would be
very interesting to mimic the effect of suppression of HAP5c on fruit ripening and
reduce respiration in order to have fruits with delayed ripening characteristics.
On the other hand, knowing that HAP5c suppression in a plant may result in male
sterility, it could be utilized in producing transgenic plants that are male sterile.
5. Acknowledgments
This work was supported by the grant FAIR95-0225 of the European Commission.
6. References
I. Albani, D.and Robert, L. S. (1995) Cloning and characterization of Brassica napus gene encoding
a homologue of the B subunit of a heteromeric CCAAT -binding factor, Gene 167, 209-213.
2. Becker, D.M., Fikes, J.D. and Guarente, L. (1991) A cDNA encoding a human CCAAT-binding
protein cloned by functional complementation in yeast, Proc. Nat!. Acad Sci.USA 88,1968-1972.
3. Chodosh, L.A, Olesen, J.T., Hahn, S., Baldwin, AS., Guarente, L. and Sharp, P.A. (1988) A yeast
and a human CCAAT-binding protein have heterologous subunits that are functionally
interchangeable, Cel/53, 25-35.
4. Dorn, A, Bollekens, J., Staub, A, Benoist, C. and Mathis, D. (1987) A mUltiplicity of CCAAT
box-binding proteins, Cel/50, 863-872.
5. Edwards, D., Murray, J.A.H. and Smith, AG. (1998) Multiple genes encoding conserved CCAAT-
Box Transcription factor complex are expressed in Arabidopsis, Plant Physiol. 117, 1015-1022.
6. Goodwin and Marcer (1989) Plant Respiration, Introduction to Plant Biochemistry Pergamon
International Library of Science, Oxford.
7. Forsburg, S.L. and Guarente, L. (1989) Communication between mitochondria and the nucleus in
regulation of cytochrome genes in the yeast Saccharomyces cerevisiae, Annu. Rev. Cell. BioI. 5,
153-180.
8. Hahn, M. and Guarente, L. (1988). Yeast HAP2 and HAP3: transcriptional activators in a
heteromeric complex. Science 240, 317-321.
9. Li, x.Y., Mantovani, R. Hoofi, H.R., Andre, I., Benoist, C. and Mathis, D. (1992) Evolutionary
variation of the CCAAT-binding transcription factor NF-Y, Nucleic Acids Res. 20, \087-1091.
10. Lowery, C.V. and Zitomer, R.S. (1984) Oxygen regulation of anaerobic and aerobic genes
mediated by a common factor in yeast, Proc. Natl. Acad Sci. USA. 81, 6129-6133.
11. Lowery, C.V. and Zitomer, R.S. (1988) ROXI encodes heme-induced repression factor regulating
ANB 1 and CYC7 of Saccharomyces cerevisiae, Mol. Cell Bioi. 8,4651-4698.
12. Maity, S.N., Sihna, S., Ruteshouser, E.C. and Crombrugghe, B. (1992) Three different
polypeptides are necessary for DNA-binding of the mammalian heteromeric CCAAT binding
factor, J. Bioi. Chem. 267, 16574-16580.
13. McNabb, D.S., Xing, Y. and Guarente, L. (1995), Cloning of yeast HAPS: a novel subunit of a
heteromeric complex required for CCAAT binding, Genes & Dev 9, 47-58.
14. Olesen, J.T., Hahn, S. and Guarente, L. (1987) Yeast HAP2 and HAP3 activators both bind to the
CYCI upstream activation site, UAS2 in an independent manner, Cell 51, 953-961.
15. Olesen, J.T. and Guarente, L. (1990) The HAP2 subunit of yeast CCAAT transcriptional activator
contains adjacent domains for subunit association and DNA-recognition: model for the HAP2/3/4
complex, Genes and Dev. 4,1714-1729.
16. Olesen, J.T., Fikes, J.D. and Guarente, L. (1991), The Schizosaccharomyces pombe homologue of
Saccharomyces cerevisiae HAP2 revels selective and stringent conservation of the small essential
core protein domain, Mol. Cell. BioI. 11,611-619.
326
17. Padmanaman, G., Vencateswar, V. and Rangarajan, P.N., (1989) Hearn as a multifunctional
regulator, Trends Biochem. Sci. 14, 492-496.
18. Pinkham, J.L., Olesen, J.T. and Guarente, L. (1987) Sequence and nuclear localization of the S.
cerevisiae HAP2 protein, a transcriptional activator, Mol. Cell. Bioi. 7, 578-585.
19. Raymondjean, M., Cereghini, S. and Yaniv, M. (1988) Several CCAAT box binding-proteins
coexist in eucaryotic cells, Proc. Natl. Acad. Sci. USA 85, 757-761.
20. Santoro, C., Mermod, N., Andrews, P.C. and Tjian. R. (1988), A family ofCCAAT box binding
proteins active in transcription and DNA replication: cloning and expression of multiple cDNAs,
Nature 334, 218-224.
21. Sinha, S., Maity, S.N., Lu, J., Ruteshouser, E.C. and Crombrugghe, B. (1995) Recombinant rat
CBF-C, the third subunit of CBFINFY, allows formation of a protein-DNA complex with CBF-A
and CBF-B and with yeast HAP2 and HAP3, Proc. Natl. Acad Sci. USA. 92, 1624-1628.
22. Tili, E. (1997) Isolation of novel Arabidopsis proteins which enhance pseudohyphal formation and
are likely to be candidates in plant development and stress responses, Master thesis, International
Center for Advanced Mediterranean Agronomic Studies, Mediterranean Agronomic Institute of
Chania, Chania, Greece.
23. Xing, Y., Fikes, J.D., and Guarente, L. (1993) Mutations in yeast HAP2IHAP3 define a hybrid
CCAAT box binding domain, EMBD. J. 12,2647-4655.
24. Zitomer, R.S. and Lowery, C.V. (1992) Regulation of gene expression by oxygen in
Saccharomyces cerevisiae, Microbiol. Rev. 56, I-II.
ETHYLENE AND POLYAMINE SYNTHESIS IN CHERIMOYA FRUIT
UNDER HIGH CO 2 LEVELS
Adaptative Mechanism to Chilling Damage
M.T. MUNOZ, M.1. ESCRIBANO AND C. MERODIO

Departamento de Ciencia y Tecnologia de Productos Vegetales, Instituto
del Frio, Ciudad Universitaria, 28040-Madrid, Spain
1. Abstract
In this work, we studied the effect of short-term high CO 2 treatment (20% CO 2 plus 20%
O2 for 3 days) on both ethylene and polyamine synthesis in cherimoya fruit stored at 20 and
6C. The decrease in putrescine content, with no variation in ADC activity, and the
accumulation of both spermidine and spermine confirm the preferential transformation of
the diamine into polyamines in COz-treated fruit. The absence of autocatalytic or basal
ethylene production with no variation in ACC oxidase activity may be due to deviation to
the SAM pool towards polyamine synthesis by high CO2 treatment. These metabolic
changes may be responsible for the effect of high CO2 levels on delaying cherimoya fruit
ripening and maintaining fruit quality during storage at chilling temperature. Our results
are discussed in light of the role attributed to polyamines in cytoplasmic pH regulation.
2. Introduction
The essential biological roles and high sensitivity to external conditions have made
polyamines, ethylene and their biosynthetic enzymes the subject of numerous studies in
postharvest physiology. In addition to their antagonistic effects on ripening and
senescence, polyamines and ethylene have been shown to have a common intermediate in
their biosynthetic routes, namely S-adenosylmethionine (SAM). In this way, a correlation
has been established between polyamine effects and the inhibition of ethylene production
in fruit. Applying polyamines has been shown to inhibit ethylene production in a variety
of plant tissues by reducing the activities of l-aminocyc1opropane-l-carboxylic acid
(ACe) synthase and ACC oxidase [7, 9] and by modulating the flux of SAM towards
polyamine synthesis [5, 10].
Several postharvest technologies, in turn, while conserving fruit quality, enhance
endogenous levels ofpolyamines, primarily spermidine (Spd) and spermine (Spm) [14]. It
appears that high, nonstressing CO2 levels suppresses developmentally regulated
processes which precede and are necessary for the onset of cherimoya fruit ripening [2].
Furthermore, short-term high CO2 treatment at the chilling temperature also improve
327
328
cherimoya tolerance to low temperature storage and effectively retains fruit quality [4].
Such as pretreatment caused a large and transient increase in y-aminobutyric acid (GABA)
levels and provoke the co-ordinated accumulation of some pathogenesis-related proteins
(chitinase-like and [3-glucanase proteins) that was not observed in fruit stored in air [13].
In this work, we investigate the effect of exposure of cherimoya fruit to short-term
high CO2 levels at ripening temperature (20C) and at chilling temperature (6C) on both
ethylene and polyamine synthesis. This work raises a new interesting possibility in
demonstrating that high CO2 seems to reduce ethylene synthesis through increase in Spd
and/or Spm titers. Our results are discussed in light of the role attributed to polyamines in
the perturbations of the homeostasis of the intracellular pH in cherimoyas stored at
chilling temperature.
Cherimoya (Annona cherimola, Mill., cv. 'Fino de Jete') fruit were divided into two groups
and stored in the dark at 20 and 6C. At each temperature, two lots were placed in
separate respiration chambers (20L) in a continuous flow of air or 20% CO 2 plus 20% O 2
for 3 days. Ethylene production and ACC oxidase activity were determined by gas
chromatography. The content in free putrescine (put), Spd and Spm was quantified by
HPLC with fluorescence detection. We have also determined the activity of arginine
decarboxylase (ADC), enzyme responsible for Put synthesis in cherimoya fruit [3], by
isotopic techniques.
4. Results
4.1. ETHYLENE PRODUCTION AND ACC OXIDASE ACTIVITY IN UNTREATED

AND CO2- TREATED FRUIT
After 3 days at 20C the untreated fruit had ripened, showing typical climacteric peak
ethylene production. At ripening temperature, high COz-pretreatment inhibited
autocatalytic ethylene production. Such treated fruit proved to have low ethylene levels,
similar to the figures for freshly harvested fruit. However, ACC oxidase_activity increased
to the same level than in ripe untreated fruit (Table 1).
Untreated fruit stored at 6C maintained low levels of ethylene production and ACC
oxidase activity (Table 1). In COrtreated fruit a drop in ethylene production to nearly
undetectable levels was recorded with no variation in ACC oxidase activity that remained
unchanged with respect to untreated fruit.
4.2. POLYAMINE LEVELS AND ADC ACTIVITY IN UNTREATED AND COr

TREATED FRUIT
At ripening temperature, high CO2-treated fruit showed higher Spd and Spm levels than
untreated fruit. With respect to putrescine synthesis, as shown in Table 2, 3 days of 20%
CO2 treatment constrained Put accumulation, although ADC activity was slightly higher
than in ripe untreated fruit.
329
Table I. Ethylene production and ACC oxidase activity in untreated and

CO2-treated cherimoya fruit stored at ripening and chilling temperatures
Treatment Ethylene production ACC oxidase activity

(!!LI kg I h) (nmoll h I mg)
After harvest 0.53 0.27 44.70 2.90

20"C 22.03 2.44 140.35 3.12
20"C + CO2 0.56 0.06 131.70 13.70
6C 0.63 0.20 38.79 3.00
6C + CQa 0.05 0.01 51.49 6.42
Data are average SE of two separate experiments (n=6)
During storage at 6C, both with and without CO2 treatment, Spd and Spm metabolism
undergoes a significant decrease. However, in CO2-treated fruit both polyamines levels
were 20% higher than the figures for untreated fruit. At chillingJemperature storage the
main features on putrescine synthesis were the steep rise in ADC activity in untreated
cherimoyas and the effect of high CO 2 in suppressing the rapid increase in such activity.
It should be noted that despite the higher ADC activity levels, Put titers in such fruit
remained unchanged after 3 days of storage at 6C. According to these results, the enzyme
ADC could be a good marker for analyzing the susceptibility to stress conditions and for
studying the efficiency of technologies applied to overcome chilling damage.
Table 2. Polyamine levels and ADC activity in untreated and CO2-treated cherimoya fruit stored
at ripening and chilling temperatures
Treatment Spermine Spermidine Putrescine ADC activity

(omoll g fw) (pmoll h I mg )
After 6.55 0.50 113.19 7.99 32.62 1.94 16.31 0.10

harvest 12.33 0.10 89.34 2.31 95.11 3.35 34.14 0.91
20C 15.17 0.57 100.27 0.50 60.58 1.40 38.74 0.50
20C + CO 2 2.48 0.22 67.61 3.91 35.12 0.63 67.16 1.59
6C 3.56 0.42 90.36 1.46 46.43 2.27 21.26 1.75
6C + CO2
Data are average SE of two separate experiments (n=6)

330
5. Discussion
5.1. ETHYLENE AND POLYAMINE SYNTHESIS IN UNTREATED AND CO 2-

TREATED FRUIT STORED AT RIPENING TEMPERATURE
The rate of ethylene production in cherimoya has been shown to be markedly affected by
low O2 or high CO2 concentrations in the atmosphere [12 and references therein].
However, the mechanism whereby high CO 2 regulates ethylene biosynthesis during fruit
ripening is still not understood. At 20C, CO2 pretreatment inhibited autocatalytic
ethylene production, while ACC oxidase activity increase at the same level than in ripe
untreated fruit. Several authors have reported that ACC oxidase transcripts accumulate
earlier than ACC synthase [1], suggesting that stimulation of ACC oxidase leads to ACC
conversion to ethylene, which in turn induces ACC synthase transcripts and generates
more ACC for ethylene production [6]. In cherimoya this chain of events is disrupted by
high CO2 postharvest treatment, indicating low ACC availability for ethylene conversion
prior to ACC synthase induction. The preferential incorporation of Put into Spd and/or
Spm may be responsible for the lower levels of SAM available for endogenous ACe
synthesis and therefore for autocatalytic ethylene production. We assume that at ripening
temperature (Fig. 1) CO2 inhibits autocatalytic ethylene production by maintaining higher
levels of Spd and/or Spm in treated fruit, rather than by directly impacting ethylene
synthesis or action.
5.2. ETHYLENE AND POLYAMINE SYNTHESIS IN UNTREATED AND COT

TREATED FRUIT STORED AT CHILLING TEMPERATURE
At 6C, autocatalytic ethylene production is inhibited through its effect on Ace oxidase
activity. Many reports have shown that ACC conversion to ethylene is the limiting step in
ethylene production at low temperatures [8, 15, 16], whereas ACC synthase is induced by
chilling injury and other kinds of stress [11]. In treated fruit, basal ethylene production
was suppressed along with no variation in AeC oxidase_activity. We suppose (Fig. 1),
that the preferential synthesis of Spd and mainly Spm joint to the low rate of ATP-
utilizing processes at the chilling temperature essentially limits basal ethylene production
in eOTtreated fruit.
Cherimoya fruit is susceptible to chilling injury at 6C and many investigations have

focused on treatments to increase tolerance to chilling injury or to reduce the severity of
the resulting symptoms. It is possible that to improve tolerance to low temperature storage
it could be necessary to keep or activate the defense mechanisms in the fruit. Moreover,
the defense mechanisms trigger by treatments should be related with their ability to
counter the perturbations caused by chilling damage. We observed that high CO2
treatment caused a large and transient increases in GABA and polyamines levels that are
not observed in chilled fruit. Bearing in mind the role attributed to these compounds in pH
regulation, as adaptative responses to stress-related cytosolic acidification, and the
significant movement of cytoplasmic signal to lower Jill values in chilled cherimoya fruit
(unpublished results), it is possible to conclude that the activation of pH regulatory
mechanism is involved in the adaptation of cherimoya fruit to storage at low temperature.
331
I High CO z at 20C I
Methionine Autocatalytic synthesis
_ - - - -X - - - __
ATP - . : 6,:
... ACCS ACCO
1
SAM - - - -.....
~ ACC ----"""P~ Ethylene
SAMDC
1-
SAMdc
ADC
Spd/Spm Putrescine.- - - Arginine
synthase
SPERMIDINE AND SPERMINE
I High CO z at6C I
Methionine
I
ATP --. I
.-
I
ACCS ACCO
1
SAM ------------.~ ACC -----~~ Ethylene
SAMDC
SAMdc
Spd/Spm
Synthase,
I--- Putrescine +-
ADC
- Arginine
Spermidine and Spermine
Figure I. Model of metabolic competition for ethylene and polyamine synthesis in Co,-treated chcrimoya fruit
at ripening (20C) and chilling temperature (6C). ACCS: ACC synthase; ACCO: ACC oxidase; SAMDC: SAM
decarboxylase.
332
7. Acknowledgements
This work as supported by grant from CICYT (ALI96-0506-C03-02).
8. References
1. Avni, A, Bailey, B.A., Mattoo, AK. and Anderson, J.D. (1994) Induction of ethylene biosynthesis in
Nicotiana tabacum by a Trichoderma viride xylanase is correlated to the accumulation of 1-
aminocyclopropane-l-carboxylic acid (ACC) synthase and ACC oxidase transcripts, Plant Physiol.
106, 1049-1055.
2. Del Cura, 8., Escribano, M.I., Zamorano, J.P. and Merodio, C. (1996) High carbon dioxide delays
postharvest changes in RuBPCase and polygalacturonase-related protein in cherimoya peel, J. Am.
Soc. Hort. Sci. 121,735-739.
3. Escribano, M.I., Aguado, P., Reguera, RM. and Merodio, C. (1996) Conjugated polyamine levels and
putrescine synthesis in cherimoya fruit during storage at different temperatures, J. Plant Physiol. 147,
736-742.
4. Escribano, M.I., Del Cura, B., Muiloz, M.T. and Merodio, C (1997). The effect of high carbon dioxide
at low temperature on ribulose 1,5-biphosphate carboxylase and polygalacturonase protein levels in
cherimoya fruit, J. Am. Soc. Hort. Sci. 122, 258-262.
5. Even-Chen, Z., Mattoo, AK. and Goren, R (1982) Inhibition of ethylene biosynthesis by
aminoethoxyvinylglycine and by polyamines shunts label from 3,4-[14C]methionine into spermidine in
aged orange peel discs, Plant Physiol. 69, 385-388.
6. Fluhr, R, and Mattoo, AK. (1996). Ethylene: Biosynthesis and Perception, Crit. Rev. Plant Sci. 15,
479-523.
7. Ke, D. and Romani, R.J. (1988) Effects of spermidine on ethylene production and the senescence of
suspension-cultured pear fruit cells, Plant Physiol. Biach. 26, 109-116.
8. Larrigaudiere, C. and Vendrell, M. (1993) Short-term activation of the conversion of 1-
aminocyclopropane-I-carboxylic acid to ethylene in rewarmed Granny Smith apples, Plant Physiol.
Bioch. 31,585-591.
9. Lee, M.M., Lee, S.H. and Park, K.Y. (1997) Effects of spermine on ethylene biosynthesis in cut
carnation (Dianthus caryophyllus 1.) flowers during senescence, J. Plant Physiol. 151,68-73.
10. Lee, S.H. and Park, K.Y. (1991) Compensatory aspects of the biosynthesis of spermidine in tobacco
cells in suspension culture, Plant and Cell Physiol. 32,523-53 I.
11. Mathooko, F.M. (1996) Regulation of ethylene biosynthesis in higher plants by carbon dioxide,
Postharvest Bioi. Technol. 7, 1-26.
12. Merodio, C. and De La Plaza, J.1. (1997) Cherimoya, in S.K. Mitra (ed.), Postharvest Physiology and
Storage o/Tropical and Subtropical Fruits, CAB international, pp. 269-293.
13. Merodio, C., Munoz, M.T., Del Cura, B., Buitrago, D. and Escribano, M.1. (1998) Effect of high CO2
level on the titres of y-aminobutyric acid, total polyamines and some pathogenesis-related proteins in
cherimoya fruit stored at low temperature, J. Exp. Bot. 49, 1339-1347.
14. Wang, C.Y. (1993) Approaches to reduce chilling injury of fruits and vegetables, Hort. Reviews 15,
63-95.
15. Wang, c.Y. and Adams, D.O. (1982) Ethylene production by chilled cucumbers (Cucumis sativus 1.),
16. Watkins, C.B., Picton, S. and Grierson, D. (1990) Stimulation and inhibition of expression of
ripening-related mRNAs in tomatoes as influenced by chilling temperatures, J. Plant Physiol. 136,
318-323.
EFFECTS OF COPPER AND ZINC ON THE ETHYLENE PRODUCTION OF
ARABIDOPSIS THALIANA
J. MERTENS 1, J. VANGRONSVELD 1, D. VAN DER STRAETEN2

AND M. VAN POUCKE 1
JLimburgs Universitair Centrum, Universitaire Campus, B-3590
Diepenbeek, Belgium, 2Universiteit Gent, Ledeganckstraat 35, B-9000
Gent, Belgium
1. Abstract
The effects of toxic concentrations of the redox active metal copper and the redox
inactive zinc on the ethylene production of intact, seven days old Arabidopsis thaliana
(L.) Heynh. seedlings, were studied kinetically in an open flow system. Major
differences in the metal stimulated increases in ethylene production were found. Using
reaction rate experiments, this stimulation was shown to be entirely enzymatic in case of
zinc treatment and partly enzymatic, partly non-enzymatic in case of copper addition.
The existence of non-enzymatic copper stimulated ethylene production was confirmed
using an oxygen-free atmosphere. By inhibiting ACC synthase activity, ACC could be
indicated as the major precursor of both enzymatic and non-enzymatic copper
stimulated ethylene production.
2. Introduction
Relative to ethylene production under normal conditions, plants produce considerable

amounts of ethylene when stressed by mechanical injury, chemicals, chilling and
freezing, desiccation, waterlogging or pathogens [1, 2, 3, 4]. This increase was called
'stress ethylene'. Various metals stimulate ethylene production in intact plants [5, 6, 4,
7, 8]. It was soon accepted that in higher plants, the ACC dependent ethylene pathway
is involved in this 'stress' ethylene production [4, 9]. However several researchers [10,
11] suggested that metal induced stress-ethylene could be generated in an ACC-
independent manner. Other studies indicated that free-radical generating systems could
be at least partially involved in ethylene production. Unfortunately, the experiments in
these studies were conducted on isolated tissues, such as leaf discs [12], on in vitro
systems containing microsomal membranes [13, 14], or on systems using purified
enzymes [15]. The experiments presented here are performed to investigate the
ethylene production of Arabidopsis thaliana (L.) Heynh. under conditions of metal
toxicity. Copper and zinc were used as a model for comparing the effects of a redox-
active substance (copper) with the effects of redox-inactive substance (zinc).
333
334
Arabidopsis thaliana (L.) Heynh. ecotype C24 was used as plant material. Seeds were
germinated after a 5 day vemalisation treatment at 4 - 7C. Plants were grown
hydroponically in controlled chambers on rockwool using 50 % Hoagland solution, 16
hours light (22C) - 8 hours darkness (17C) cycle, 65 % relative humidity and 150
!lmol m-2.s- 1 fotosynthetically active light. Copper or zinc were applied as sulphates.
All concentrations are final concentrations unless mentioned otherwise. Ethylene was
measured in a flow-through system [16]. Each sample was placed in a 2 liter flask,
flushed with ethylene-free air and allowed to equilibrate for at least two hours prior to
measurement. Ethylene concentration was determined using gas chromatography with
flame ionisation detection. Aqueous solutions 0.1 mM AVG were added exogenously.
4.1. ETHYLENE PRODUCTION OF ARABIDOPSIS
Starting with 4 days old seedlings, the progression of ethylene production was followed
by regular measurements during the following two weeks. Table 1 clearly shows a
high ethylene production at the start of the experiment and a peak on day 11, and a low
production around day 7 and 13.
Table 1. Ethylene production of light grown Arabidopsis

thaliana seedlings at different ages (days after germination;
data SE)
Age (days)
4 0.074 0.016
7 0.013 0.007
II 0.054 0.011
13 0.010 0.008
19 0.032 0.010
The high productions around 4 and 11 days correspond morphologically with the
opening of the hook and expansion of the photosynthetic cotyledons on the one hand
and the emergence of the first leaf pair on the other hand. Usual rates for intact green
seedlings at this developmental stage (8 to 12 days) range from 0.8 nl ethylene.h- l .
gFW I for com to 4.7 nl for wheat and 6.1 nl for soybean. If the ethylene production of
7 and 11 days old Arabidopsis thaliana seedlings is recalculated on a fresh weight basis,
on average 0.7 and 2.0 nl C2Iit .h- l gFW- 1 respectively, is produced, which is in
accordance with the range mentioned above.
335
4.2. EFFECTS OF COPPER AND ZINC ON ETHYLENE PRODUCTION
Cu 2+ or Zn 2+ ions are supplied to the seedlings in concentrations of 25, 100 or 500

J.lM. Both metals cause an increase in ethylene production (Figs la and Ib). However,
the kinetics and intensity of stimulation of ethylene production show marked differences
depending on the metal used. Generally, copper effects are lasting, while effects of zinc
are transient. Application ofthe lowest copper concentration (25 J.lM) causes a five-fold
increase .. With zinc, the lowest concentration (25 J.lM) only slightly increases ethylene
production. By raising the copper concentration to 500 J.lM a ten-fold increase is found.
Increasing the zinc concentration to 500 J.lM only results in a five-fold initial increase.
These results suggest the existence of differences in the way ethylene production
responds to either copper or zinc addition.
0,18
,...., A --0- Control
"i":; 0,16 --0- Cu 25 IJM
0 --<>- Control -I:r- Cu 100 IJM
..:::; 0,14 - C u 500 IJM
-c-Zn25 IJM
q.
'0 0,12 --i:r- Zn 1 00 IJM
E -Zn5001JM
a.
'-"
c 0,1
~:::l' 0,08
'C
~ 0,06
Q.)
cQ.) 0,04
>-
.s:::
ill 0,02
o
0100 200 300 400 0100 200 300 400
Time (minutes) Time (minutes)
Figure I a and I b. Effect of different copper and zinc concentrations on the ethylene production of
Arabidopsis thaliana (copper or zinc were added at 0 minutes, data SE) .
4.3. EFFECT OF TEMPERATURE ON COPPER AND ZINC STIMULATED

ETHYLENE PRODUCTION
Studying the effect of temperature on reaction kinetics allows to differentiate between

enzymatic and non-enzymatic reactions, in vivo as well as in vitro. Generally, a rise or
decrease in temperature should correspond with a certain rise or decrease in reaction
velocity. Theoretical differences have been calculated for a non-enzymatic reaction for
a decrease from 22C to 7C. This decrease in temperature should correspond, in non-
enzymatic reactions, with a decrease in reaction velocity of only 5%. Enzymatically
336
catalysed reactions show much larger decreases or increases as a function of

temperature, in a physiological range. A decrease or increase of 1 C should result in -
at least- a 3-fold decrease or increase, respectively. Experiments were performed
establishing this ratio for a decrease in temperature from 22C to 7C, for 500 IlM of
both zinc and copper. Table 2 shows that zinc-induced ethylene production follows an
enzymatic pathway, as the decrease in reaction velocity is proportionally larger than 3.
In the presence of copper, ethylene is synthesised by a mixed enzymatic - non-
enzymatic system, as the proportional decreases are clearly intermediate between pure
enzymatic and non-enzymatic. From these data it can be calculated, that about 65 % of
the copper-induced ethylene release is produced non-enzymatically.
Table 2. Proportional reduction in reaction rate (22C 17C) for copper or

zinc stimulated etbylene production (data SE)
Time after addition Proportional reduction Proportional reduction

(minutes) (500IlMZn) (500 11M Cu)
180 3.8 0.5 2.0 0.5

210 4.60.7 2.1 0.6
240 4.1 0.6 2.3 0.7
4.4. ETHYLENE PRODUCTION IN AN OXYGEN FREE ATMOSPHERE
In order to confirm the existence of the non-enzymatic production of ethylene, ethylene

production was measured with an non functional ACC-oxidase, due to lack of the
substrate O2, inhibiting the fmal step in ethylene biosynthesis, the whole enzymatic
pathway would be blocked. Addition of 500 IlM copper results in a marked increase in
ethylene production (Fig. 2), while adding 500 IlM zinc has no effect.
4.5. INFLUENCE OF AVG ADDITION ON COPPER INDUCED

ETHYLENE PRODUCTION
AVG is a potent inhibitor of ACC synthase activity. Addition of 0.1 mM AVG to shoot
and root in the presence of 500 IlM copper (Fig. 3), results in a steady decrease of the
ethylene production, starting from a level slightly lower than copper-induced ethylene to
almost no production at all. This result suggests that, when copper is added, ACC is the
major precursor of ethylene in both enzymatic and non-enzymatic conversion. Using
these data one can calculate the amount of ACC converted to ethylene to be
approximately 2.5 nmol.gFW I .
337
'""' 0,18 -r-------------,

~ 0,16 ----- Zn 500 \.1M
q. 0,14 --0- Cu 500 \.1M
~ 0,12
e 0,1
.~ 0,08
~a. 0,06
0,04
~ 0,02
>- o
~
100 200 300 400
Time (minutes)
Figure 2. Effect of anoxia on copper or zinc stimulated ethylene

production in 7 days old Arabidopsis thaliana, (data SE).
5. Conclusion
Zinc and copper induced increases of ethylene production of intact seven days old
Arabidopsis thaliana L. seedlings were shown to be, at least partly, based on diferent
mechanisms. In case of zinc, stimulation is entilely enzymatic while the copper induced
increase should be in part non-enzymatic.
~ 0,18 -r-------------,
~
..:::;
0,16
----- Cu 500 \.1M
--0- Cu 500 \.1M + AVG
~ 0,14
~ 0,12
.sc 0.1
.Q 008
ti '
.g 0,06
a.
Q)
0.04
~ 0,02
~ O+----r--~~--~--_+~
o 100 200 300 400
Time (minutes)
Figure 3. Effect of AVG on copper stimulated ethylene

production in 7 days old Arabidopsis thaliana (data SE)
338
6. References
1. Abeles, B. (1973) Ethylene in Plant Biology, Academic Press, New York.
2. Yang, S.F. and Pratt, HK (1978) The physiology of ethylene in wounded plant tissues, in G Kahl
(ed.), Biochemistry of Wounded Plant Tissues, Walter de Gruyter, Berlin, pp. 595-655.
3. Yu, Y.B. and Yang, S.F. (1980) Biosynthesis of wound ethylene, Plant Physiol. 66,281-285.
4. Hogsett, W.E., Raba, RM. and Tingey, D.T. (1981) Biosynthesis of stress ethylene in soybean
seedlings: Similarities to endogenous ethylene synthesis, Physiol. Plant. 53, 307-614.
5. Lau, O. and Yang, S.F. (1976) Stimulation of ethylene production in the mung bean hypocotyls by
cupric ion, calcium ion and kinetin, Plant Physiol. 57,88-92.
6. Goren, R and Siegel, S.M. (1976) Mercury-induced ethylene formation and abscission in citrus and
coleus explants, Plant Physiol. 57,628-631.
7. Rodecap, KD., Tingey, D.T. and Tibbs, J.H. (1981) Cadmium-induced ethylene production in bean
plants, Z Pjlanzenphysiol. 105,65-74.
8. Fuhrer, l. (1982) Ethylene biosynthesis and cadmium toxicity in leaf tissue of beans, Plant Physiol.
70, 162-167.
9. Yang, S.F. and Hoffinan, N.E. (1984) Ethylene biosynthesis and its regulation in higher plants, Annu.
Rev. Plant Physiol. 35,155-189.
10. Sandmann, G. and Boger, P. (1980) Copper-mediated lipid peroxidation processes in photosynthetic
membranes, Plant Physiol. 66, 797-800.
11. Mattoo, AK, Baker, J.E. and Moline, H.E. (1986) Induction by copper ions of ethylene production
in Spirodela olighorrhiza. Evidence for a pathway independent of I-aminocyclopropane-I-
carboxylic acid, J. Plant Physiol. 123, 193-202.
12. Kacperska, A and Kubacka-Zebalska, M. (I989) Formation of stress ethylene depends both on ACC
synthesis and on the activity of free radical-generating system, Physiol. Plant. 77,231-237.
13. Lynch, D.V., Sridhara, S. and Thompson, lE. (1985) Lipoxygenase-generated hydroperoxides
account for the non-physiological features of ethylene formation from l-aminocyclopropane-I-
carboxylic acid by microsomal membranes of carnations, Planta 164, 121-125.
14. Mc Rae, D.G., Baker, lE. and Thompson, J.E. (1982) Evidence for involvement of the superoxide
radical in the conversion of l-aminocyclopropane-I-carboxylic acid to ethylene by pea microsomal
membranes, Plant Cell Physiol. 23, 375-383.
15. Gardner, H.W. and Newton, l.W. (1987) Lipid hydroperoxides in the conversion of 1-
aminocyclopropane-l-carboxylic acid to ethylene, Phyto. 26,621-626.
16. De Greef, J.A and De Proft, M. (1978) Kinetic measurements of small changes in an open system
designed for plant physiological studies, Physiol. Plant. 42, 79-84.
ETHYLENE DEPENDENT AERENCHYMA FORMATION IS CORRELATED
WITH DIVERSE GENE EXPRESSION PATTERNS
D. B FINKELSTEIN!, S. A. FINLAYSON 1, M. C. DREW 2, W. R.

JORDAN!, R. A. WING 3 AND P. W. MORGAN!
Dept. of Soil & Crop Science i Dept. of Horticultural Scienci, Texas A
&M University, Agronomy Dept. 3, Clemson University
1. Introduction
Previous research has shown that soil compaction and hypoxic soils substantially reduce
crop root profiles [1]. Under both stresses, the roots of maize form air channels known
as aerenchyma by the selective lysis of cortical cells [2]. Both mechanical impedance
and hypoxic stress are mediated by signal transduction pathways which induce ethylene
synthesis, cellulase activity [3] and gene expression. Aerenchyma formation in maize
roots is ethylene-dependent [4]. This process is a gene-driven, tissue-localized process
consistent with the definition of programmed cell death. However, by examining gene
expression in response to other stresses, such as wounding and submergence, distinct
classes of genes emerged. One class of genes is induced primarily by mechanical
impedance. A second class of genes was induced by hypoxia and submergence. Lastly,
genes that are homologs with animal programmed cell death genes were uncovered.
A variety of methods were employed to isolate full length cDNAs and cDNA fragments
that encode genes associated with mechanical impedance, hypoxia, and programmed
cell death. Directed RT-PCR and differential display and cDNA library screening were
the primary methods. RNA was isolated from untreated root tips and from
mechanically impeded root tips of maize. The RNA pools were then reverse transcribed
with polyT primer and PCR amplified with a second random primer. The resultant PCR
products were separated by PAGE and visualized by silver staining. Polymorphic bands
that appeared repeatedly were removed from the gel, re-amplified, ligated into a plasmid
vector, transformed into E. coli, and identified by automated sequencing. Radioactively
labeled cloned were hybridized on total RNA northern blots and visualized by exposure
to X-ray film. Next a cDNA library was constructed from maize root tip mRNA that
was hypoxically treated (2 d 4% O2). Each differential display fragment of interest was
used to probe the library. Clones were tentatively identified by sequencing. Northern
analysis of RNA from diverse ethylene-related stresses were performed using cDNA
clones as probes. Based on the identification of a DADl homolog (defender against
339
340
apoptotic death) which may be a regulator of glycosilation, a tunicamycin treatment was

also performed. Tunicamycin is a specific inhibitor ofN-linked glycosilation.
Table 1. Differential Display and RT-PCR fragments
Designation Size (bp) Induction Homolog
KI2CC 282 Hypoxia tRNA-leueyl synthetase

N4CC 567 Mech.lmp. 60S riboprotein L25
KI6AC-H 458 Hypoxia Zeon gag protein
KI6AC-L 308 Hypoxia Transmembrane protein
K18CA 330 Hypoxia Unknown
AP3GG 603 Hypoxia Unknown
M5CG-C 413 Hypoxia Gag/pol protein
ACC5 228 Hypoxia Musa sp. ACC synthase
CELL 506 Unconfirmed Tomato cellulase 4
Table 2. cDNA Library Clones
Designation Induction Homolog
202 Tunicamycin DAD]

2lH8 Tunicamycin GRANDDAD (unique gene)
26021 Wounding ACCoxidase
IM22 Submergence 60S riboprotein L25
41K16 Weak induction by Tunicamycin and Submergence Cysteine protease
24Ll6 Mech. Impedance, Submergence and Hypoxia Tonoplast Integral Protein
IH22 Wounding LP3 (Pinus drought gene)
31B22 Constitutive Trypsin inhibitor
28L9 Tunicamycin and Submergence SlAH2 (Drosophila gene)
Differential display fragments and cDNA clones are shown in Tables I and 2. Two
gene fragments were identified by sequence homology as retrotransposons, which may
appear anywhere within the genome and which have no known physiological
significance. Therefore, only those fragments of potential physiological interest where
used to find cDNA clones from the hypoxic root tip library. Most of the cDNA clones
examined were primarily induced by submergence or by tunicamycin. Both mechanical
impedance and hypoxia induced the tonoplast integral protein (24Ll6) and the 60S
riboprotein (N4CC/IM22). Only wounding induced the maize LP3 homolog (lH22)
and the ACC synthase gene (26021). Together these gene expression patterns draw
clear distinctions between hypoxia, mechanical impedance and other ethylene-related
stresses such as wounding.
The induction of proteins associated with efficient protein translation, a tRNA
synthetase and a riboprotein, indicate a level of regulation beyond transcription. This
fmding is consistent with other observations in oxygen deprived maize roots [5]. The
tonoplast integral protein was found recently in maize root tips [6] in situ hybridized to
341
proto-xylem, a pre-cell death cell line. Discovery of cell death associated genes such as
the DAD1 homolog and Seven in absentia homolog (Siah2) from Drosophila in our
study suggests plant cell death pathways may include some animal gene homologs.
Of special interest was the unique gene GRANDAD (G protein receptor and
defender against apoptotic cell death) which had a high degree of nucleotide sequence
homology to DAD1 yet is expected to encode an entirely unrelated G protein-coupled
receptor. Using sequencing chemistries that minimize secondary structural problems,
this full-length cDNA was revealed to have a second reading frame. This frame was
interrupted by gt-ag bounded intron-like stretches that contained stop codons. This
second frame, if spliced, would encode a maize DAD1. In fact, the predicted protein
sequence of this putative DAD1 shares slightly more amino acid identity with the
Arabidopsis DAD1 than the uninterrupted partial cDNA DAD1 also cloned here.
4. References
1. Morgan, P.W. and Drew, M.C. (1997) Ethylene and plant responses to stress, Plant Physiol. 100,
620630.
2. He, C.J., Drew, M.C. and Morgan, P.W. (1994) Induction of enzymes associated with Iysigenous
aerenchyma formation in roots of Zea mays L. subjected to mechanical impedance and hypoxia,
Plant Physiol. 112,463472.
3. He, C.J., Morgan, P.W. and Drew, M.C. (1996) Transduction of an ethylene signal is required for
death and lysis in the root cortex of maize during aerenchyma formation induced by hypoxia, Plant
Physiol. 112,463472.
4. Drew, M.C., Jackson, M.B., Giffard, S.C. and Campbell, R. (1981) Inhibition by silver ions of gas
space (aerenchyma) formation in adventitious roots of Zea mays L. subjected to exogenous
ethylene or oxygen deficiency, Planta 153, 217-224.
5. Bailey-Serres J. and Dawe, R.K. (1996) Both 5' and 3' sequences of maize adhl mRNA are
required for enhanced translation under low-oxygen conditions, Plant Physiol. 112, 685-695.
6. Chaumont, F., Barrieu F., Herman E.M. and Chrispeels, M.B. (1998) Characterization of a maize
tonoplast aquaporin expressed in zones of cell division and elongation, Plant Physiol. 117, 1143-
1152.
ETHYLENE BIOSYNTHESIS IN RUMEX PALUSTRlS UPON FLOODING
W.H. VRIEZEN,,2, L.A.C.l VOESENEK2 AND C. MARIANI'

'Department of Experimental Botany, and 2Department of Ecology,
University of Nijmegen, Toernooiveld 1, 6525 ED, Nijmegen, The
Netherlands
1. Introduction
Rumex palustris, is a flooding-resistant semi-terrestrial species that responds to flooding

with rapid growth stimulation of the shoot, especially of the petioles of the youngest
leaves. This induction of cell elongation requires enhanced levels of ethylene and is
furthermore increased when low oxygen concentrations are applied [5]. Under drained
conditions, leaves of R. palustris continuously produces small amounts of ethylene [4].
Upon submergence the production rate remains unchanged, but the ethylene
concentration in the tissues of the plants increases from 0.05 ~I/I to I 111/1 within Ih
This ethylene accumulation can be explained by the reduced diffusion rates of gases in
water [2]. This diffusion barrier can also cause hypoxic conditions in the tissues of
submerged plants [3].
To study the regulation of the genes involved in ethylene biosynthesis, we isolated
cDNAs corresponding to the ACC synthase and ACC oxidase genes and used these to
research the pattern of gene expression in submerged R. palustris plants.
2. Results
Partial cDNAs encoding ACC synthase and ACC oxidase were generated by RT-PCR
on poly(At mRNA from R. palustris leaves. Isolated fragments which showed high
homology to known ACC synthase or ACC oxidase sequences from other species were
subsequently used to isolate full-length clones from a R. palustris cDNA library made
from leaf RNA of plants that were submerged for 24h. One cDNA clone with high
similarity (>65%) to ACC synthases of mustard leaf and soybean (Database accession
numbers: X72676 and X67100) was isolated and was designated RP-ACS1, Two
different, but highly homologous (96%) ACe oxidase cDNAs were isolated and the
genes were designated as RP-ACOI and RP-AC02. These cDNAs were used as a probe
for northern analysis to study the regulation of ethylene biosynthetic genes in petioles of
elongating leaves during submergence of R. palustris. Figure 1 shows that the RP-
ACSI messenger concentration increased transiently during the first hours of the
day under aerated as well as under submerged conditions. Submergence seemed to have
343
344
_.
A aerated conditions B submerged conditions
o 1 2' 3 4 5 Ei 8 10 12 24 Time (h) 0 2 3 4 5 6 8 10 12 24
RP-ACS1
RP-AC01 : _ _
2BS rRNA 1."" w.

I
Figure 1. Time course for mRNA accumulation of ACC synthase and Ace oxidase genes in petioles of R,
paiustris under aerated conditions (A) and under submerged conditions (B),
an inducing effect on the RP-ACSI mRNA concentration after 12h, when compared
with the aerated condition. RP-ACOI expression increased strongly during submergence
and remained at high level at least till 48h after inundation (Fig. lB).
3. Discussion
The ethylene release from aerated R. paiustris plants displayed a circadian rhythm with
a high level of ethylene release during the day and relative low level during night-time
[5]. The RP-ACSI mRNA levels also showed higher levels at the beginning of the day,
which might be a result or the cause of this rhythmic ethylene release. ACC oxidase
mRNA concentration remained at a constant low level under aerated conditions (Fig.
lA), but was clearly induced by submergence. Submergence, however, did not
stimulate the ethylene production rate in R. paiustris [4] suggesting that the increased
ACC oxidase mRNA concentration did not result in a higher ACC oxidase activity.
4. References
1. Banga, M., SIaa, E.J., Blom, C.W.P,M. and Voesenek, L.AC.J. (1996) Ethylene biosynthesis and
accumulation under drained and submerged conditions, Plant Physiol. 112,229-237.
2. Jackson, M.B. (1985) Ethylene and responses of plants to soil waterlogging and submergence,
3. St6nzi, J.T. and Kende, H. (1989) Gas in the internal air spaces of deepwater rice in relation to
growth induced by submergence, Plant Cell Physiol. 30, 49-56.
4. Voesenek, L.A.C.J., Banga, M., Thier, R.H., Mudde, C.M., Harren, F.M., Barendse, G.W.M. and
Blom, C.W.P.M. (1993) Submergence-induced ethylene synthesis, entrapment, and growth in two
plant species with contrasting flooding resistances, Plant Physiol. 103,783-791.
5. Voesenek, L.AC.J., Vriezen, W.H., Smekens, M.J.E., Huitink, F.H.M., Bogemann, G.M. and
Blorn, C.W.P.M. (1997) Ethylene sensitivity and response sensor expression in petioles of Rumex
species at low O2 and high CO2 concentrations, Plant Physiol. 114,1501-1509.
APOPLASTIC ACC IN OZONE- AND ELICITOR- TREATED PLANTS
W. MODER 1, J. KANGASJARVr 2 , E.F. ELSTNER3 , C.

LANGEBARTELS and H. SANDERMANN JR.I
1
IGSF - National Research Center for Environment and Health, Institute

of Biochemical Plant Pathology, D-85764 Neuherberg, Germany;
2Institute of Biotechnology and Division of Genetics, Department of
Biosciences, University of Helsinki, FIN-00014 Helsinki, Finland,
3 Lehrstuhl for Phytopathologie, Technical University Miinchen, D-85350
Weihenstephan, Germany
Emission of the gaseous plant hormone ethylene is a common response of many plant
species to exposure with the air pollutant ozone [I]. The amount of ethylene emitted
correlates well with the degree of necrotic lesions on middle-aged leaves. Ozone-
induced ethylene is formed via the normal biosynthetic pathway. Specific isoforms of
SAM synthetase, ACC oxidase and ACC synthase are induced [2]. The highly selective
response resembles that of plant-pathogen interaction. Here we elaborate on the role of
I-amino-cyclopropane-I-carboxylic acid (ACC), the ethylene precursor, in ozone
responses of plants.
Vicia faba L. cv. Troy and Nicotiana tabacum L. cv. Bel W3 plants are very
sensitive to ozone. After treatment with 120 - 150 nl rl ozone for 5 h, the plants
showed visible necrotic lesions after 24 h. We found maximum induction of ACC
synthase after 2 h and of ACC levels after 3 - 5 h. When the apoplastic washing fluid
(A WF) was obtained from ozone treated leaves,S - 40 % of the total free ACC content
was detected in the apoplast with a delay of 1 - 2 hours (Fig. I).
300 ACC ACC 50 ~

Q) Leaf extract . - -.. Apoplast
40 u:
j ~ 200 "",
1:0. 30 '5
G)-oOJ E
u! 100 20 .s
U.ll! U
<.s 10 ~
o >.-Q----D---{]
o
o 1 234 5 0 1 234 5 0 1 2 3 4 5
Time[h]
Figure I. Time course of ACC synthase activity and ACC content in leaf extract and apoplastic washing fluid
(AWF) of Vicia /aba plants exposed to 120 - 130 nl )" ozone for 5 hours (e). Means <D SE (n=3), (0,
untreated control).
345
346
To evaluate the degree of cytosolic contamination due to the infiltration technique or a

possibly increased membrane permeability caused by the ozone treatment other
constituents of the A WF were examined. The contamination of the A WF with the
cytosolic marker enzyme hexosephosphate isomerase (HPI) was found to be < 0.1 % in
Viciafaba and < 0.5 % in tobacco. Low molecular weight compounds like polyamines
(tobacco) and the major phenolic compounds (kaempferol derivatives, Vida) were also
detected in amounts lower than 1.5 % of the total leaf content.
After infiltration of various elicitors (chitosan, crude cell wall preparations from
Phytophthora megasperma and Colletotrichum lindemuthianum, provided by 1. Ebel
(Miinchen) and H. Kauss (Kaiserslautern), respectively) into the leaf intercellular space
with a blunt tip syringe, apoplastic ACC levels were also elevated. However, there
were distinct differences in the response of the two species towards the various elicitors.
Tobacco showed a strong response to chitosan and the C. lindemuthianum preparation
and only a weak one to the Pmg preparation, whereas Pmg induced the strongest
response in Vidafaba. After 8 h the ACC contents were back to control levels.
Infiltration of ACC (30 11M) with a blunt tip syringe into sectors of the leaf led to
transient increases also in sectors adjacent to the infiltrated area (10 and 20 mm
distance). This corresponds to the results of Spanu and Boller [3] who found elevated
ACC levels in a small distance of necrotic lesions after infection with Phytophthora
irifestans whereas ACC synthase activity was only increased in the necrotic area.
About 70 % of the infiltrated ACC was transformed to ethylene in the first 5 h, the level
of ACC-conjugates was also increased after 5 h.
The above results show that a pronounced portion of the ozone- and elicitor-induced
ACC is exported into the apoplastic fluid ofleaves, where it can serve as a substrate for
ACC oxidase [4] or a peroxidase. ACC may also playa role in short distance signalling
as reported by O'Neill et al. [5] for orchid flower development.
2. References
1. Sandermann, H., Ernst, D., Heller, W. and Langebartels, C. (1998) Ozone: an abiotic elicitor of
plant defence reactions, Trends Plant Sci. 3,47-50.
2. Tuomainen, J., Betz, C., Kangasjllrvi, J., Ernst, D., Yin, Z.H., Langebartels, C. and Sandermann, H.
(1997) Ozone induction of ethylene emission in tomato plants: regulation by differential
accumulation of transcripts for the biosynthetic enzymes, Plant J. 12,1151-1162.
3. Spanu, P. and Boller, T. (1989) Ethylene biosynthesis in tomato plants infected by Phytophthora
infestans, J. Plant Physio!. 134, 533-537.
4. Rombaldi, C., Lelievre, J.-M., Latche, A, Petiprez, M., Bouzayen, M. and Pech, J.C. (1994)
Immuno-cytolocalization of l-aminocyclopropane-1-carboxylic acid oxidase in tomato and apple
fruit, Planta 192,453-460.
5. O'Neill, S.D., Nadeau, JA, Zhang, X.S., Bui, AQ. and Halevy, AH. (1993) interorgan regulation
of ethylene biosynthetic genes by pollination, Plant Cell 5,419-432.
ACC SYNTHASE ISOZYMES OF TOMATO (LE-ACSIB & LE-ACS6) THAT
ARE INDUCIBLE ONLY BY TOUCH
M. TATSUKI AND H. MORI

Graduate Course of Biochemical Regulation, Nagoya University, Nagoya
Japan
In response to mechanical stimuli such as wind or touch, plants undergo physiological

and developmental changes that enhance resistance to subsequent mechanical stress.
This response has been termed thigmomorphogenesis [1]. Because both exogenous
ethylene treatment and touch stimulation lead to a decrease in elongation and radial
expansion, and ethylene release increases after touch stimulation, it has been assumed
that ethylene mediates plant growth response to touch. Ethylene also functions as a
mediator of the emergency response, when plants sense irregular stimuli such as
wounding and invading pathogens. Under these conditions, ethylene induces the
expression of a number of enzymes involved in mechanisms that protect plant
individuals from total death.
To further understand the molecular regulation of ethylene production by external
stimuli, we have isolated cDNA clones (LE-ACSIB, 2, 3, 4, 6) encoding 1-
aminocyclopropane-l-carboxylate synthase (ACS), which is the key enzyme in ethylene
biosynthesis, from tomato [2] and examined the expression of stress-inducible ACS
isogenes in tomato.
Firstly, the expressions of the ACS isogenes in leaves in response to touch stimuli
were investigated (Fig. lA). Ten minutes after touch treatment, LE-ACS6 mRNA
rapidly increased in abundance and then decreased to the basal level within I h. The
mRNA level of LE-ACSI B also increased following touch. The maximum level of LE-
ACSI B transcription was lower than that of LE-ACS6. On the other hand, the level of
LE-ACSI B mRNA remained elevated for up to 1 h, although the mRNA level of LE-
ACS6 had already decreased at I h. The other isogenes (LE-ACS2, 3, 4) were not
detected. PI-II was also not detected in touched leaves (data not shown). This result
suggests that touch treatment does not cause the type of cell damage that induces the
defense genes.
To investigate whether the level of response is affected by the dose of touch stimuli,
the accumulation of transcripts was compared in plants subjected to different intensities
of touch. As the amount of touch stimulation was increased, the expressions of LE-
ACSIB and LE-ACS6 also increased (Fig. IB). These results indicate that the system
that senses the stimuli is capable of detecting differences in the strength of the
stimulation.
347
348
It has been reported that ethylene release increases within 30 min after wounding in
leaves [3]. Therefore, We investigated the expression of LE-ACSIB and LE-ACS6
mRNA in wounded leaves. The levels of the LE-ACSIB and LE-ACS6 mRNA were
increased by wounding and reached a maximum level at 30 min and then gradually
decreased to the control level within 2 h (data not shown).
To clarify the role of LE-ACSIB and LE-ACS6 in the early ethylene production in
wounded fruits, we examined the expression of ACS isogenes in wounded fruits (Fig.
Ie). The mRNA levels of LE-ACSIB and LE-ACS6 increased dramatically 30 min after
wounding, declined slightly at 1 h, and decreased to the control level thereafter. The
LE-ACS2 mRNA began to accumulate about 2 h after wounding, while the LE-ACSJ B
and LE-ACS6 mRNA levels had decreased to their basal levels by this time. These
results indicate that not only the expression of LE-ACS2, but also the expressions of LE-
ACSI Band LE-ACS6 were induced by wounding and that the three ACS isogenes were
sequentially expressed in response to wounding in mature green fruits. Based on these
results, we assume that early ethylene production was caused by the rapid and transient
expression of these isogenes
Because the LE-ACSIB and LE-ACS6 mRNAs were induced by touch stimuli in
leaves, we investigated whether LE-ACSI Band LE-ACS6 were also induced in touched
fruits. LE-ACSIB and LE-ACS6 mRNA were detected 30 min after rubbing and
decreased to the basal level within 4 h. On the other hand, the LE-ACS2 mRNA did not
increase by rubbing (Fig. 1D).
We conclude as follows: The expressions of the LE-ACSI Band LE-ACS6 mRNAs
were rapidly and transiently induced in both seedlings and fruits after touch stimuli that
did not involve cell damage. These results indicate that wounding is not essential for
eliciting the LE-ACSI Band LE-ACS6 mRNAs; on the contrary, LE-ACS2 requires cell
damage for expression. Both LE-ACSI Band LE-ACS6 mRNAs were accumulated in a
dose-dependent manner (Fig. lB). However, the kinetics of LE-ACSI B expression was
slightly different from that of LE-ACS6 in touched seedlings (Fig. lA), and only LE-
ACSIB mRNA was detected in etiolated seedlings (data not shown). These results
suggest that LE-ACSIB and LE-ACS6 may have different signal transduction pathways
and gene regulatory mechanisms.
2. References
I. Biro, R.L. and Jaffe, M.1. (1984) Tigmomorphogenesis: Ethylene evolution and its role in the
changes observed in mechanically perturbed been plants, Physiol. Plant 62, 405-411
2. Mori, H. et. a., (1993) Structural characteristics of ACC synthase isozymes and differential
expression of their genes, in l.C. Pech, A. Latche and C. Balague (eds.), Cellular and Molecular
Aspects of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 1-6
3. 0' Donnell, P.l., et. al. (1996) Ethylene as a signal mediating the wound response of tomato plants,
Science 274,1914-1917
349
ACS1
(C) (D)
ACS1B ACS1
ACS2
Time after Touch (min) ACS2
(8) ACS6
ACS6
ACS1B
o 0.51 2 4
Time after Touch (min)
00.5 1 2 4 6 8 1012
Time after Wounding (h)
ACS6
2X 4X 10X20X
Figure 1. Expression of ACS isogenes by various stimuli. (A): By touch in leaves, (B): Dose response in
leaves, (C): By wounding in mature green fruits, (0): By touch in mature green fruits.
ETHYLENE PERCEPTION IN TOMATO: LOTS OF GENES, LOTS OF
FUNCTIONS
H. KLEE, D. TIEMAN AND C. LASHBROOK

University of Florida, Department of Horticultural Sciences, PO Box
110690, Gainesville, FL 32611, USA
1. Abstract
Significant progress has been made in characterizing the components of ethylene signal
transduction in plants in recent years. The tomato is an excellent model for studying
developmental regulation of ethylene perception. Several ethylene-mediated
developmental processes including fruit ripening, floral abscission and floral senescence
exhibit differential hormone sensitivity. We have focused on characterization of the
family of genes encoding ethylene receptors in tomato. To date, we have identified five
members of this family. The proteins display major structural differences, suggesting
that they may not be entirely functionally redundant. Further, expression of each gene
family member is spatially distinct. The differential expression of these quite divergent
proteins suggests several levels at which regulation of ethylene perception is possible.
2. Introduction
Phytohormones play essential roles in regulating many aspects of plant development.

While regulation of hormone synthesis and catabolism are critical to many aspects of
growth and differentiation, hormone action is also mediated at the level of sensitivity [4,
20]. Sensitivity to hormones is modulated both spatially and temporally during the life
cycle. For example, adjacent cells in an organ can respond differentially to a hormone
as occurs during organ abscission or, sensitivity of an organ to a hormone may change
over time as occurs during fruit ripening. The tomato fruit is an excellent model for
differential regulation of hormone perception during development. The focus of our
laboratory is to define how differential sensitivity to ethylene is regulated during
development of the tomato plant.
Ethylene is a readily diffusible hormone with an important role integrating the
developmental effects of internal signals and external stimuli, regulating such diverse
developmental processes as fruit ripening, abscission, senescence, and defense against
pathogens [1]. In addition to developmental control over ethylene biosynthesis, there is
regulation of its perception in certain tissues. For example, ripening of mature tomato
fruits does not occur uniformly. It initiates within the locule and spreads to the pericarp
where it then proceeds from the blossom end to the stem end. Since ethylene is
351
352
diffusible within the fruit, asynchronous ripening must result from differential ethylene
perception. Modulation of sensitivity also precedes the increase in ethylene synthesis at
the onset of ripening. Experiments conducted on avocado [7], apple [10], and tomato
[22] indicate that immature fruits do not ripen in response to exogenous ethylene.
While these fruits do perceive ethylene, as evidenced by activation of some ethylene-
inducible genes such as ACC oxidase, they do not initiate the developmental sequence
that leads to ripening. Further, exposure of immature fruits to ethylene, while it does
not initiate ripening, does hasten its onset. Thus, immature fruits have a capacity to
measure cumulative exposure to ethylene and use this as a developmental clock.
We identified a tomato mutant that is altered in its ability to perceive ethylene.
Never ripe (Nr) is a semidominant mutant in which fruits fail to ripen [14]. Nr exhibits
a number of pleiotropic effects indicative of ethylene insensitivity throughout the plant
including impaired in floral abscission and significant delays in leaf and flower petal
senescence. The molecular basis for the ethylene insensitivity is a single nucleotide
change that causes a proline to leucine (P36L) change in the ethylene receptor, NR [21].
3. The Arahidopsis ethylene receptor family
In recent years, there has been significant progress in elucidating the ethylene signal
transduction pathway [3, 12]. Several Arahidopsis genes involved in ethylene signal
transduction including CTRI [13], EIN2 (Joe Ecker, personal communication), EIN3
[6], and ETRI [5] have been isolated. One of the mutant alleles of ETRl, etrl-l,
exhibits a complete lack of measurable ethylene response [2]. Schaller et al. have
shown that ETRI is membrane associated, acts as a dimer [18] and, when expressed in
yeast, binds ethylene [17]. Ethylene binding is abolished in ethylene-insensitive mutant
proteins and is localized to the amino terminal transmembrane portion of the sensor
domain. These experiments define ETRI as an ethylene receptor. The ETRI family in
Arabidopsis currently consists of five proteins [11]. The ETRl, ETR2 and EIN4 genes
were initially identified by mutations that cause dominant ethylene insensitivity. The
ERSI gene was identified by its homology to ETRI. Subsequently, it was shown to
confer dominant ethylene insensitivity by use of an engineered mutant trans gene. The
ERS2 gene was identified as an EST with homology to ETRI. The ERS2 protein is
structurally divergent from all of the other genes identified thus far. It is not known
whether this gene encodes a genuine ethylene receptor but an engineered mutant
transgene confers dominant ethylene insensitivity in Arahidopsis [11].
The ETRI protein is homologous to the prokaryotic family of signal transducers
known as two-component regulators. In bacteria, the two components, referred to as the
sensor and the response regulator, act to modulate responses to a wide range of
environmental stimuli [16]. Based on comparisons to the prokaryotic proteins, ETRI
can be structurally separated into three domains. The sensor domain (amino acids 1-
313) contains three closely spaced hydrophobic stretches that have been postulated to
span a membrane. In prokaryotes, this domain is responsible for sensing the ligand. All
of the known mutations ofETRl lie within the three hydrophobic regions. The second
domain has extensive sequence identity to histidine kinases and the protein has been
shown to have in vitro histidine kinase activity [8]. Notably, ETR2 and ERS2 lack the
353
histidine that is autophosphorylated. The third domain is the response regulator. This
region has sequence identity to the response regulator portion of bacterial two-
component systems and contains an aspartate that is phosphorylated in bacterial
proteins. In prokaryotes, there are two classes of these signal-transducing proteins,
those that contain a response regulator domain and those that do not. In bacteria, the
response regulator may act as a modulator of activity by accepting the phosphate
without activating downstream signal transduction components [19]. As in bacteria,
some members of the plant ETRI family are missing the response regulator domain;
ERS 1 and ERS2 proteins lack the third domain while the other three proteins contain it.
That some of these proteins maintain this domain with a high degree of conservation
while others completely lack it, suggests an important but unidentified function for the
response regulator domain.
4. The tomato ethylene receptor family
The well defmed roles of ethylene in mediating tomato fruit ripening, petal wilt and
flower abscission illustrate the advantages of tomato as a model system for studying
ethylene responsiveness. Of particular interest to us have been the dominant alleles of
ETRI [2, 9]. Our work has focused on tomato genes that are homologous to ETRI, their
functions in regulating ethylene perception and the biological consequences of
mutations in gene family members. At the molecular and biochemical level, we first
demonstrated developmental regulation of an ethylene receptor when we showed that
Nr expression is significantly increased during fruit ripening [21]. The low level of Nr
expression in immature fruits followed by a I5-fold rise in expression during ripening
correlates both with the endogenous rate of ethylene synthesis and the known increase
in ethylene responsiveness of developing fruits.
We have isolated four additional members of the tomato Nr gene family. For
consistency in nomenclature, they have been named Le-ETRI-5 in the order of their
cloning. However we continue to refer to Le-ETR3 as Nr. cDNAs for two of the genes,
Le-ETRI (eTAEI) [23] and Le-ETR2 [24], were independently isolated in the lab of
Mark Tucker. There are several structural features that distinguish the individual
members of the tomato ethylene receptor family (Fig. 1). Every Arabidopsis and
tomato protein has conserved all of the amino acids that, when mutated, cause ethylene
insensitivity as well as the cysteines involved in dimerization. All of the proteins that
retain the response regulator domain have conserved the aspartate that can potentially
act as a phosphate receiver. Among the tomato proteins, only NR lacks the response
regulator domain. LeETR5 lacks the histidine as well as the other functional domains
that define the histidine kinase. Molecular modeling programs identify three potential
membrane spanning domains in LeETR 1, LeETR2 and NR and a potential for a fourth
domain in LeETR4 and LeETR5. This extra domain is located within amino terminal
extensions that are absent from the other proteins and appear to target the amino
terminus to the cytoplasm. While we do not yet understand the significance of this
observation, all of the information together indicates that the gene family encodes
proteins that are potentially quite different in structure and perhaps in function.
354
Response
Sensor Histidine Kinase Regulator
LeETRl Hi .. . ,: :J:J:::I::::::IO:L4#(
LeETRl .:::1:::::::'.::1:[':: :::::0::::
NR
LeETR4 .+lilllllllllllllll:JlllE::::II::::::::.:::::::~.::::=:IO!'::::::::~
LeETRS i ::,:::::.. : :::.;:::;' ;:::;mtj::L::
Figure 1. Schematic representation of the structures of the tomato ethylene receptor proteins. The shaded
areas within the first domain represent potential membrane-spanning segments. Shaded areas within the
second domain represent conserved elements of the histidine kinase. The shaded area within the third domain
represents the conserved region of the response regulator, including the aspartate that may become
phosphorylated.
Why would tomato contain five or more receptors to a single hormone? Our
working hypothesis is that different gene family members mediate differential responses
of the plant to ethylene throughout growth and development. Differential responses to
various stimuli may be accomplished via regulated gene expression, homo- vs.
heterodimer formation, different binding constants for ethylene, or specific interactions
with as yet unidentified modulators of activity. Alternatively, the plant may have
evolved five or more ethylene receptors that are functionally redundant. It is also clear
that each gene is regulated in a very different manner. While only Nr is ethylene
regulated, every receptor exhibits distinct spatial regulation. The complement of
receptors differs markedly in each tissue ([15] and D. Tieman, unpublished). The plant
may have evolved each gene to respond to different environmental and developmental
cues in distinct ways. Thus, ability to respond to ethylene by any tissue could be
regulated qualitatively and quantitatively by which receptors are present. Experiments
in progress involve transgenic plants that either over- or under-express each of the gene
family members. Using this reverse genetic approach, we feel that we will be able to
identify unique roles for each receptor, assuming that each does have distinct functions.
355
5. Acknowledgement
We would like to acknowledge the support of the USDA NRI program for support of
this research.
6. References
1. Abeles, F. B., Morgan, P. W. and Saltveit, M. E. (1992) Ethylene in Plant Biology, Ed. 2,
2. Bleecker, A, Estelle, M., Somerville, C. and Kende, H. (1988) Insensitivity to ethylene conferred
by a dominant mutation in Arabidopsis tOOliana, Science 241, 1086-1089.
3. Bleecker, A B. and Schaller, G. E. (1996) The mechanism of ethylene perception, Plant Physiol
111,653-660.
4. Bradford, K. and Trewavas, A (1994) Sensitivity thresholds and variable time scales in plant
hormone action. Plant Physioll05, 1029-lO36.
5. Chang, C., Kwok, S. F., Bleecker, A B. and Meyerowitz, E. M. (1993) Arabidopsis ethylene-
response gene ETRI: similarity of products to two-component regulators, Science 262, 539-544.
6. Chao, Q., Rothenberg, M., Solano, R, Roman, G., Terzaghi, W. and Ecker, J. (1997) Activation of
the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-
INSENSITIVE3 and related proteins, Cell 89, 1133-1144.
7. Eaks, I. L. (1980) Respiratory rate, ethylene production and ripening response of avocado fruit to
ethylene or propylene following harvest at different maturities, J Amer Soc Hort Sci 105, 744-747.
8. Gamble, R, Cornfield, M. and Schaller, G. E. (1998) Histidine kinase activity of the ETRI
ethylene receptor from Arabidopsis, Proc. Nat. Acad. Sci. USA 95, 7825-7829.
9. Guzman, P. and Ecker, 1. (1990) Exploiting the triple response of Arabidopsis to identifY ethylene-
related mutants, Plant Cell 2, 513-523.
10. Harkett, P., Hulme, A, Rhodes, M. and Wooltorton, L. (1971) The threshold value for
physiological action of ethylene on apple fruits, J Food Technol6, 39-45.
II. Hua, 1., Sakai, H., Nourizadeh, S., et al. (1998) EIN4 and ERS2 are members of the putative
ethylene receptor gene family in Arabidopsis, Plant Cell 10, 1321-1332.
12. Kieber,1. J. (1997) The ethylene response pathway in Arabidopsis, Annu. Rev. Plant Physio.l Plant
Mol. BioI. 48,277-296.
13. Kieber, 1. J., Rothenberg, M., Roman, G., Feldmann, K. A and Ecker, J. R (1993) CTRI, a
negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raj
family of protein kinases, Cell 72, 427-441.
14. Lanahan, M. B., Yen, H. -C., Giovannoni, 1. J. and Klee, H. 1. (1994) The Never ripe mutation
blocks ethylene perception in tomato, Plant Cell 6, 521-530.
15. Lashbrook, C., Tieman, D. and Klee, H. (1998) Differential regulation of the tomato ETR gene
family throughout plant development, Plant J. 15,243-252.
16. Parkinson, J. (1993) Signal transduction schemes of bacteria, Cell 73, 857-871.
17. Schaller, G. E. and Bleecker, A B. (1995) Ethylene binding sites generated in yeast expressing the
18. Schaller, G. E., Ladd, A N., Lanahan, M. B., Spanbauer, 1. M. and Bleecker, A B. (1995) The
ethylene response mediator ETRI from Arabidopsis forms a disulfide-linked dimer, J. BioI. Chern.
270, 12526-12530.
19. Stock, 1., Surette, M., Levit, M. and Park, P. (1995) Two-component signal transduction systems:
structure-function relationships and mechanisms of catalysis, in J. Hoch and T. Silhavey (eds.),
Two-component Signal Transduction, ASM Press, Washington, D.C., pp. 25-52.
20. Trewavas, A (1983) Is plant development regulated by changes in the concentration of growth
substances or by changes in the sensitivity to growth substances? TIBS 8,354-357.
21. Wilkinson, 1. Q., Lanahan, M. B., Yen, H. -C., Giovannoni, J. 1. and Klee, H. J. (1995) An
ethylene-inducible component of signal transduction encoded by Never-ripe, Science 270, 1807-
1809.
356
22. Yang, S F. (1987) The role of ethylene and ethylene synthesis in fruit ripening, in W. Thompson,
E. Nothnagel and R. Huffaker (eds.) Plant Senescence: Its Biochemistry and Physiology, The
American Society of Plant Physiologists, Rockville, MD, pp. 156-165.
23. Zhou, D., Kalaitzis, P., Mattoo, AK., and Tucker, M.L. (1996) The mRNA for an ETRl
homologue in tomato is constitutively expressed in vegetative and reproductive tissues, Plant Mol.
BioI. 30, 1331-1338.
24. Zhou, D., Mattoo, AK. and Tucker, M.L. (1996) Molecular cloning of a tomato cDNA encoding
an ethylene receptor, Plant Physiol. 110, 1435-1436.
HORTICULTURAL PERFORMANCE OF ETHYLENE INSENSITIVE
PETUNIAS
D.G. CLARKI, H.J. KLEE2, J.E. BARRETTI, AND T.A. NELLI

I University of Florida, Department of Environmental Horticulture, PO
Box 110670, Gainesville, Florida 32611, USA, 2University of Florida,
Department of Horticultural Sciences, PO Box 110690, Gainesville,
Florida 32611, USA
1. Abstract
To determine the potential for use of biotechnology to produce ethylene insensitive

floriculture crops, we designed several experiments to measure horticultural
performance of transgenic CaMV35S-etrl-1 petunias. Delayed floral senescence is
observed at varying degrees in transgenic plants depending on production environment.
Flowers grown in cooler greenhouse environments show greater delays in pollination-
induced and natural flower senescence than those grown in warmer environments. Fruit
set of self pollinated CaMV35S-etr I-plants was reduced compared to wild type plants,
and was also dependent on production environment. Transgenic plants grown in
warmer environments showed reduced fruit set after self pollination compared to those
grown in cooler environments. Fruit ripening is delayed, and adventitious root
formation is significantly reduced in transgenic CaMV35S-etrl plants compared to wild
type plants. These observations lead us to suggest that tissue specific ethylene
insensitivity will be required to produce ethylene insensitive floriculture crops with
extended flower life.
2. Introduction
The involvement of ethylene in flower senescence has been well documented in a

number of plant species [1,2,3,4,5,6]. Much of the knowledge about ethylene's role
in flower senescence has been gained from studies on species such as carnation, petunia,
orchid, and geranium, and much of the basic research concerning floral senescence and
abscission caused by ethylene has been conducted on factors relating to ethylene
biosynthesis. Recently, Wilkinson et al. [7] showed that the mutant Arabidopsis etrl-I
gene could be transformed into tomato, tobacco, and petunia plants to confer ethylene
insensitive mutant phenotypes to normal plants. More specifically, pollination-induced
flower petal abscission of tomato is inhibited by constitutive expression of etr I-I.
Flower petals on these plants remain turgid more than four times longer than normal
357
358
petals, and remain attached to the plant indefinitely during ovary expansion.
Transformation of etr 1-1 into petunia results in delayed corolla senescence after both
pollination and exogenous ethylene treatment. Normally, petunia flowers treated with
1-2 1-lU- 1 ethylene in a jar for 12-18 hours senesce within 24 hours - pollinated petunia
flowers produce a copious amount of ethylene that leads to accelerated petal wilting in 2
days. etrl-1 petunia flowers show a delayed flower wilting phenotype in response to
ethylene treatment and pollination. Flowers treated with 2 1-lJ.r 1 ethylene do not wilt
until 4 days after the onset of treatment, and in most cases, petal wilting occurs due to
vascular blockage of water in stem vase solutions. Pollinated etr 1-1 flowers last an
average of 4-5 times longer than controls after pollination, and in most cases, petal
wilting occurs due to the developing fruit breaking the vascular connections of the
corolla [7].
Since constitutive expression of etr 1-1 can be used in heterologous plants to obtain
desirable commercial traits, it is likely that physiological processes other than fruit
ripening and flower senescence may also be altered. The key to use of this technology
for control of ethylene sensitivity in commercial floriculture crops will ultimately
depend on critical analysis of transgenic plants under production greenhouse conditions.
To investigate these factors, we have conducted experiments to determine the
horticultural performance of ethylene insensitive petunia plants with regard to floral
senescence as wen as sexual and vegetative reproduction. In conducting these
experiments, we also observed that environmental conditions under which ethylene
insensitive plants are studied have a significant influence on plant responses that are
altered by constitutive ethylene insensitivity.
3. Floral Senescence
In an effort to determine the extent to which conferred ethylene insensitivity influences

floral senescence, we transformed 'V26' petunias with CaMV35S-etrl-l using the
protocol of Jorgensen et al. [8] to produce the line V3-33. We also used a similar
transformed line 44568 [7] as well as a previously unreported line, 44609, which were
both generated in the 'Mitchell Diploid' genetic background. When growing these
plants, we have observed that transgenic plants do not differ from controls in terms of
the time it takes them to grow from seed germination to anthesis of the first flower. Of
the three transgenic lines we have investigated, 44568 produces flowers slightly earlier
than controls, 44609 produces flowers slightly later than controls, and V3-33 flowers
are produced in the same amount of time as controls. These results suggest that the role
of ethylene perception in the floral induction process of petunia is minimal.
In a series of experiments conducted to investigate different factors affecting flower
senescence, we treated excised flowers of all transgenic lines, plus controls, with air or
2 /lLr 1 of ethylene gas for 18 hours, then subsequently monitored them for petal wilting
over five days. Petals on air-treated control flowers consistently wilt within 24-36
hours after the onset of exogenous ethylene treatment whereas transgenic flowers and
air-treated control flowers take four to five days to wilt. We found that flower longevity
of ethylene treated transgenic flowers can be further extended beyond air treated
controls by re-cutting the stems daily to reduce vascular blockage. Eventually
359
transgenic flowers become faded in color or infected with Botrytis before they wilt due
to ethylene treatment. We did not find significant differences between transgenic lines
for the amount of flower life extension after ethylene treatment, but it is likely that the
lack of a photosynthetic carbon source and vascular blockage on excised flowers
hastens their demise and could alter results. It is evident from our observations that
conferred constitutive ethylene insensitivity via these means should be adequate for use
in preventing the detrimental effects of ethylene with commercially important cut
flowers such as carnation and orchid.
Further analysis of ethylene insensitive petunia flowers during normal senescence
and after pollination reveals that there are environmental factors that affect the extent to
which ethylene insensitivity delays floral senescence. When control plants are grown in
a 'normal' greenhouse under Florida conditions (high light intensity, warm
temperatures, high relative humidity), their flowers wilt in five to six days after
anthesis, and approximately two days after pollination. Under 'ideal' conditions (high
light intensity, cool temperatures and moderate relative humidity), their flowers wilt in
six to seven days after anthesis and approximately two days after pollination. Under
'normal' conditions, transgenic flowers last 0.3-0.4X longer than controls after anthesis
and 3-3.5X longer after pollination, but under 'ideal' conditions transgenic flowers last
2-3X longer than controls after anthesis, and up to 8X longer after pollination. We have
also observed that differences exist between transgenic lines for delayed pollination-
induced floral senesence under' ideal' conditions, with 44568 and 44609 flowers lasting
twice as long after pollination as V3-33 flowers. Differences in rate of senescence after
pollination can not be attributed to the fact that 44568 and 44609 originated from
transformation of 'Mitchell Diploid' and V3-33 originated from transformation of
'V26'. Although control plants of these two cultivars have different growth habits
under similar production conditions, they undergo ethylene-induced, pollination-
induced and normal flower senescence at the same rates. Although we do not know the
basis of these differences between plants derived from separate transformation events in
different genetic backgrounds, our data suggest that various levels of ethylene
insensitivity may be conferred in plants, and traditional genetic selection of appropriate
lines will be possible. To date, there have been no reports on the performance of
transgenic CaMV35S-etrl-l plants under different environmental conditions, but our
data clearly indicate that both normal and pollination-induced flower senescence of
petunia are delayed by conferred consitutive ethylene insensitivity. Our data also
suggest that critical field trials must be performed on these plants under different
growing conditions to determine the extent to which they will perform in the production
greenhouse and in the landscape. To the physiological geneticist, these plants should
serve as key experimental tools for use in studying the role of ethylene perception in
plant responses under a wide variety of environmental stimuli.
4. Sexual Reproduction
One of the most important factors determining commercial success of many floriculture
crops is the ability to reproduce a large number of consistent quality seeds. To
determine if ethylene insensitve petunias reproduce normally under different
360
environmental conditions we measured the rate of fruit set, as determined by the

percentage of self-pollinations leading to the production of fruit containing viable seeds.
Under 'normal' and 'ideal' greenhouse conditions, pollinated control petunia flowers
produce fruit containing viable seeds 90 and 95% of the time, respectively. Under
'normal' conditions, fruit set of ethylene insensitive 44568 and 44609 petunias is
reduced by 54% and 23%, respectively compared to controls. Under 'ideal' greenhouse
conditions, 44568 petunias produce 8% fewer fruit containing seeds, and 44609
petunias produce 23% fewer fruit than controls. We have not observed further
decreases in seed yield per fruit produced on transgenic plants, but our data indicate that
additional effort may have to be employed under commercial seed production
conditions to obtain desired numbers of seeds from ethylene insensitive plants.
Currently, research is being conducted in our laboratory to determine whether this
reduction in fruit set may be improved by using ethylene insensitive paternal parents
instead of maternal parents to efficiently produce F I hybrid seeds. The dominant nature
of the etr 1-1 mutation leads us to believe that commercial seed production success can
be achieved in this manner if ethylene does not have a significant role in pollen tube
germination and subsequent growth through the pistil. Although we do not know the
role of ethylene in fruit development of petunia, our data suggest that ethylene may be a
significant factor, especially under adverse environmental conditions.
An observation that could have an important implication for commercial seed
production of ethylene insensitive transgenic floriculture crops concerns fruit ripening.
It is not surprising that petunia plants transformed with CaMV35S-etrl-1 produce fruit
that exhibit delayed ripening. Wilkinson et al. [7] transformed tomato with a nearly
identical genetic construct as the one used in our work with petunia, to confer the
'Never ripe' fruit phenotype. Normally, self pollinated control petunias produce fruit
that turn brown and dehisce approximately 27-28 days after pollination regardless of
whether they are produced under 'normal' or 'ideal' conditions. Self pollinated
ethylene insensitive petunias produce fruit that take approximately 15-20% longer to
ripen than controls. We have also observed that fresh seeds produced from ethylene
insensitive petunias do not germinate well unless they are allowed to sit in storage for a
significant amount of time or treated with GA3 (gibberellin A3). This observation
supports similar findings by Bleecker et at. [9], who showed that fresh seeds from
mutant etr 1-1 Arabidopsis plants required treatment with 5 11M GA3 during seed
imbibition to induce germination at wild type levels. When combined, these results
suggest that ethylene may playa significant role in the maturation of seeds of many
plant species that are sensitive to ethylene. For the commercial seed producer, it means
that efficient production of ethylene insensitive plants via FI hybrid seeds might be best
achieved by using inbred ethylene insensitive lines as the paternal parent in making
crosses in order to offset the delays in fruit ripening and subsequent reduction in seed
germination.
5. Vegetative Reproduction
Another important factor that determines commercial success of many floriculture crops
is the ability to reproduce plants via rooting of vegetative cuttings. The involvement of
361
ethylene in the formation of adventitious roots has been well documented, although
there are various reports of both inhibitory and promotive effects of ethylene on rooting
even within the same species [10]. In a preponderance of commercial floriculture crops,
increased rooting efficiency of cuttings is achieved by the application of auxin at the
onset of propagation. In experiments conducted in our laboratory we observed that
constitutive ethylene insensitivity significantly reduces adventitious root formation in
vegetative petunia cuttings, and cannot be reversed with the application of auxin at
concentrations that significant increase rooting of control cuttings. Cuttings taken from
control petunia plants produce approximately 12X more adventitious roots than 44568
petunias, and after three weeks of propagation, 44568 petunias produce almost no roots.
Treatment with 1000 ~g.g.1 IBA (indole-3-butyric acid) leads to a doubling of the
number of adventitious roots formed by control cuttings whereas no significant increase
is observed on ethylene insensitive 44568 cuttings. Additional experiments conducted
with the ethylene insensitive tomato mutant 'Never ripe' [II) have produced similar
results to those observed with petunia. Cuttings taken from 'Never ripe' plants display
significantly reduced adventitious root formation that cannot be over come with auxin
treatments at concentrations that significantly increase rooting in controls. Interestingly,
'Never ripe' tomato cuttings produce a few adventitious roots whereas ethylene
insensitive petunia cuttings showed an almost complete inhibition in root formation.
This observation could be due to the fact that 'Never ripe' is not as strong a mutation as
etrl-l, and/or because ethylene insensitivity in 44568 petunia is driven by the stronger
CaMV35S promoter, whereas the 'Never ripe' mutation is driven by a weaker
endogenous promoter. When combined, all of these observations suggest that ethylene
plays a central role in adventitious root formation of both tomato and petunia. Future
experiments focused on determining the temporal and spatial regulation of adventitious
root formation in more precise terms are warranted, and could lead to a much clearer
picture of the nature of the interaction between auxin and ethylene in the adventitious
rooting process.
Table I. Effects of constitutive ethylene insensitivity on horticultural performance

characteristics of petunia. Effects denoted by an asterisk (*) have been observed to
vary depending on environmental conditions during plant growth.
Characteristic Effect
delayed
Ethylene-induced floral senescence
Pollination-induced floral senescence delayed
Normal floral senescence delayed
Fruit set slightly reduced
Fruit ripening delayed
Adventitious root formation significantly reduced
362
6. Conclusions
It has been clearly demonstrated that constitutive expression of the mutant elr 1-1 gene
from Arabidopsis in petunia, tomato and tobacco confers ethylene insensitivity that
leads to desirable commercial characters such as delayed fruit ripening and delayed
flower senescence [7]. It is evident from our work on horticultural performance of
ethylene insensitive CaMV35S-etr1-1 petunias that ethylene plays a critical role in many
other physiological factors as well. Although ethylene-induced, pollination-induced,
and normal senescence of these plants is significantly delayed, we have observed that
other physiological responses to ethylene that may hinder the commercial development
of this technology. Among the physiological 'side effects' of constitutive ethylene
insensitivity is a slight reduction in fruit set after self-pollination, delayed fruit ripening,
and significantly reduced adventitious root formation on vegetative cuttings.
Reductions in fruit set and delayed fruit ripening are likely characteristics that can be
overcome in commercial FI hybrid seed production by taking advantage of the
dominant nature of the etr1-1 mutation, and by using inbred ethylene insensitive
paternal parents in making cross-pollinations. Data obtained from experiments on
adventitious root formation clearly indicate that constitutive ethylene insensitivity will
most likely not be a viable technology for use in commercial floriculture crops that are
sensitive to ethylene and reproduced by vegetative propagation. Further research should
be conducted to engineer such crops with ethylene insensitivity driven by tissue specific
gene promoters to allow for normal levels of adventitious root formation.
7. Acknowledgements
The authors wish to thank Erika Gubrium and Donna Clevenger for their assistance in
greenhouse experiments. This research was supported by The Fred C. Gloeckner
Foundation, Inc.
8. References
1. Clark, D.G., Richards, C., Hilioti, Z., Lind-Iversen, S., and Brown, K. (1997] Effect of pollination
on accumulation of ACC synthase and ACC oxidase transcripts, ethylene production and flower
petal abscission in geranium (Pelargonium Xhortorum L.H. Bailey), Plant Mol. BioI. 34,855-865.
2. O'Neill, S.D., Nadeau, lA, Zhang, X.S., Bui, AQ., and Halevy, AH. (1993) Interorgan regulation
of ethylene biosynthetic genes by pollination, Plant CellS, 419-432.
3. Park, K.Y., Drory, A, and Woodson, W.R. (1992) Molecular cloning of an l-arninocyclopropane-
I-carboxylate synthase from senescing carnation flower petals, Plant Mol. BioI. 18,377-386.
4. Singh, A., Evensen, K.B., and Kao, T.H. (1992) Ethylene synthesis and floral senescence following
compatible and incompatible pollinations in Petunia iriflata. Plant Physiol. 99, 38-45.
5. Tang, x.Y., Gomes, AM.T.R., Bhatia, A, and Woodson, W.R. (1994) Pistil-specific and
ethylene-regulated expression of I-arninocyclopropane-I-carboxylate oxidase genes in petunia
flowers, Plant Cell 6, 1227-1239.
6. Woodson, W.R., Park, K.Y., Drory, A, Larsen, P.B., and Wang, H. (1992) Expression of ethylene
biosynthetic pathway transcripts in senescing carnation flowers, Plant Physiol. 99, 526-532.
363
7. Wilkinson, lQ., Lanahan, M.B., Clark, D.G., Bleecker, AB., Chang, c., Meyerowitz, E.M., and
Klee, H.J. (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in
heterologous plants, Nature Biotechn. 15,444-447.
8. Jorgensen, R.A., Cluster, P.O., English, J., Que, Q., and Napoli, C.A (1996) Chalcone synthase
cosuppression phenotypes in petunia flowers: comparison of sense vs. antisense constructs and
single-copy vs. complex T-DNA sequences, Plant Mol. BioI. 31, 957-973.
9. Bleecker, AB., Estelle, M.A, Somerville, c., and Kende H. (1988) Insensitivity to ethylene
conferred by a dominant mutation in Arabidopsis Ihaliana, Science 242, 1086-1089.
) O. Mudge, K. W. () 988) Effect of ethylene on rooting, in T.D. Davis, B.E. Haissig, N. Sankhla, (eds.)
Adventitious Root Formation in Cuttings. Advances in Plant Sciences Series Vol. 2. Dioscorides
Press, Portland, pp. 150-) 61.
II. Lanahan, M.B., Yen, H-C., Giovannoni, J.1., and Klee, H.1. (1994) The never ripe mutation
blocks ethylene perception in tomato, Plant Cell 6, 521-530.
ROLE OF ETHYLENE IN AROMA FORMATION IN CANTALOUPE
CHARENTAIS MELON
A.D. BAUCHOT 1, D.S. MOTTRAM 2, A.T. DODSON 2 AND P. JOHN 1

I Department of Agricultural Botany, School of Plant Sciences, and
2Department of Food Science and Technology, The University of Reading,
Reading RG6 6AS, UK
1. Abstract
The heads pace of ACC oxidase antisense hybrid Cantaloupe Charentais melon has been
sampled, analysed by GC-MS and compared to that of the corresponding non-
transformed hybrid fruit. The main volatiles extracted in non-transformed hybrids fruit
were esters, with an overwhelming contribution by acetates. In antisense hybrid fruit
the total volatiles were 60% to 85% lower than those of the non-transformed hybrids.
Odour values of major esters were calculated. The most potent odorants were ethyl
butanoate and branched-chain esters such as ethyl 2-methylpropanoate and ethyl 2-
methylbutanoate. In transformed melons, potent odorant levels were less than 5% those
of non-transformed hybrids. By contrast, volatiles with low odour values such as 2-
methylpropyl acetate and 2-methylbutyl acetate were a half to a fifth those of non-
transformed hybrids. Analysis of the biosynthetic pathways of the branched-chain
esters that have valine and isoleucine as precursors demonstrates that ethylene
specifically controls the production of the most potent odorants.
2. Introduction
Charentais melons (Cucumis melo L) from the Cantalupensis group are appreciated
because of their very aromatic flavour but their self-life is usually very short. To
improve its storage and handling characteristics, a Charentais melon line has been
recently transformed with an l-aminocyclopropane-I-carboxylic acid oxidase (ACO)
antisense gene, and ripening was delayed via strong reduction of ethylene synthesis [I,
2].
In melon, aroma development is strongly associated with ripening and represents a
major characteristic in the overall quality of the fruit [3]. Esters are the main
components of the melon aroma with a significant proportion of them are branched-
chain esters derived from valine and isoleucine [4, 5]. The availability of antisense fruit
allowed us to investigate which esters were ethylene-dependent.
365
366
3. Materials and methods
3.1. PLANT MATERIAL
This work was carried out on Charentais melons (Cucumis melD var. cantaiupensis,
Naud. cv Vedrandais). The progeny of a line transformed with an ACO gene in
antisense orientation [1] was used as antisense parental line (AS) to generate
transformed FI hybrids. Control melons were bred using the equivalent line without the
ACO antisense gene (nT). Four other parental lines (PLl, PL2, PL3 and PL4)
conferring important agronomic traits (such as resistance to pathogens or improved
agronomic performances) were crossed with the nT and the AS lines. Four non-
transformed hybrids (PLl-nT, PL2-nT, PL3-nT and PL4-nT) and 4 transformed hybrids
(PLl-AS, PL2-AS, PL3-AS and PL4-AS) have been generated. Plants were grown in
Almeria, Spain, by Tezier Iberica following standard cultural practices.
Non-transformed fruit were harvested when their rind turned yellow. Antisense fruit
were harvested when the first leaf next to the fruit yellowed. Headspace analysis was
performed on fruit that were air-freighted to the UK, stored 3 days at l2C and held
overnight at 20C before analysis. The aim of this postharvest storage was to simulate
transport and distribution from production sites to consumption sites.
3.2. AROMA EXTRACTION
Headspace concentration on Tenax TA trapping followed by thermal desorption on GC-

MS. Five plugs (l cm diameter, 2 cm long, about 109 of tissue) were excised from the
equator of each fruit, weighed, and transferred in a 250 mL flask. Headspace volatiles
were purged onto Tenax TA traps as previously described [6]. 1,2-Dicholorobenzene
was added to the trap before the collection as internal standard.
3.3. GAS CHROMATOGRAPHY-MASS SPECTROPHOTOMETRY
All analyses were performed on a Hewlett Packard 5972 mass spectrometer, fitted with
a HP5890 Series II gas chromatograph according to the procedures established in our
laboratory [6].
Volatiles were identified by comparison of each mass spectrum with spectra from
authentic compounds analysed in our laboratory, or with spectra in reference collections
(NISTIEPAINIH Mass Special database). Quantification of the volatiles was based on
the relation between their peak areas and that of the internal standard.
4.1. ESTER ANALYSIS
A total of over 80 compounds were identified in the headspace volatiles of the melons.
The most abundant esters are listed in Table 1. The main compounds identified in non-
transformed Charentais melon headspace were esters, with ethyl acetate, and 2-
367
methylpropyl acetate and 2-methylbutyl acetate, derived from valine and isoleucine
respectively. These 3 esters represented at least 60% of the total volatiles collected
from the non-transformed fruit.
4.2. VARIATION BETWEEN HYBRIDS
Although aroma profiles of the 4 non-transformed hybrids considered showed similar

trends, major quantitative variations were sometimes encountered (Table 1). It could be
attributed to differences in the maturity stages [3], although variations between the
hybrids are likely to be responsible [7].
4.3. EFFECT OF ACO ANTISENSE ON AROMA PROFILE
Despite the variations encountered, the effect of ACO antisense gene was dramatic.
Only 20 to 30% of the total acetates detected in non-transformed fruit were present in
the antisense fruit (Table 1). The effect of the ACO antisense gene was higher on
propanoates and butanoates. It was more marked on PL2-AS and PL4-AS fruit as
compared to PLl-nT and PL3-nT fruit. The significant reduction of ethyl acetate, in
ACO antisense hybrids, shows that the availability of either or both moieties (ethyl and
acetate) of the ester was reduced or that their condensation, catalysed by an alcohol
acetyltransferase [8] is regulated by ethylene.
4.4. ODOUR VALUES
Odour values are used to indicate which compounds have a strong impact in an aroma
[9]. They are obtained by dividing the concentration of the compounds by their known
odour threshold values in water (Table 2). In relative terms, PLl-nT fruit seemed to be
the less aromatic among the 4 non-transformed lines. The efficiency of ACO antisense
gene on aroma quality was highest on the fruit from parental lines PL2 and PL4, with
the odour values of some esters decreasing by more than 90% compared to the
corresponding non-transformed fruit. The ACO antisense gene seemed to be least
effective on fruit from PL3-AS hybrids.
Acetates, showed low odour values and were generally the least depleted by the
ACO antisense gene. Compounds such as ethyl 2-methylpropanoate, ethyl 2-
methylbutanoate and ethyl butanoate could be considered as potent odorants for all non-
transformed hybrids except for PLl-nT. They were the most affected by the
transformation. Valine and isoleucine are the precursors of the branched-chain esters
considered here [5] and as well as their respective isomers: 2-methylpropyl acetate and
2-methylbutyl acetate. For hybrids where the ACO antisense gene induced the most
successful repression of potent aroma, the levels of reduction of ethyl esters (such as
ethyI2-methylpropanoate, ethyl2-methylbutanoate and ethyl butanoate), compared with
those of corresponding acetates show that the pathways leading to each class are not
affected to the same extent.
368
TABLE 1. Main esters identified in the headspace of melon plugs excised from non-transformed (nT)
and ACO antisense (AS) hybrids.
Approximate quantity (ng/g)
Comeound 'Ll-nT 'LI-AS 'L2-nT 'L2-AS 'L3-nT 'L3-AS 'L4-nT 'L4-AS

acetates
ethyl acetate 185 38 322 40 458 189 664 42
I-methylethyl acetate Tr 1 1 2 tr tr tr 1
n-propyl acetate 45 17 44 16 45 4 17 12
2-methylpropyl acetate 147 72 168 105 114 31 94 53
butyl acetate 91 38 146 61 89 21 55 16
2-methylbutyl acetate 128 68 103 34 112 25 71 32
pentyl acetate 3 2 8 2 4 1 2 tr
4-pentenyl acetate 6 tr
hexyl acetate 40 26 84 32 68 11 44 10
3-hexen-l-yl acetate 50 8 105 18 59 7 12 1
heptyl acetate Tr tr 3 I 1 tr 1 tr
octyl acetate 4 3 25 8 8 1 5 1
3-octen-l-yl acetate Tr 2 tr 1 tr
phenylmethyl acetate 24 10 44 33 10 9 7 4
2-phenylethyl acetate 3 2 7 15 2 I 2 I
benzenepropyl acetate 2 tr 3 1 tr I tr tr
total 723 286 1065 369 978 302 974 174
propanoates and methylpropanoates

methyl propanoate 3 6 7 9 2 I I
ethyl propanoate 20 tr 59 4 25 23 41 tr
propyl propanoate Tr tr tr tr
2-methylpropyl propan. 1 1 2 tr tr tr
butyl propanoate I 1 tr tr tr tr
pentylpropanoate tr
methyl 2-methylpropan. 1 1 4 7 16 I 1
ethyl 2-methylpropan. 4 1 36 I 30 7 25 tr
total 30 10 108 24 74 31 68 3
butanoates and methylbutanoates

methyl butanoate 5 8 26 19 11 3 5
ethyl butanoate 67 5 108 6 104 25 96
propyl butanoate 1 1 2 tr 1 tr
2-methylpropyl butanoate 1 I I I 1 tr
butyl butanoate Tr tr tr I tr
ethyl 2-methylbutanoate 14 1 41 I 28 6 39 tr
total 89 15 177 27 145 35 142 2
other esters
methyl pentanoate tr tr tr
ethyl pentanoate I 3 tr I tr
methyl hexanoate I tr 4 I 1 tr tr tr
eth}::l hexanoate 4 tr 27 tr 12 2 23 tr
369
TABLE 2. Odour values of some of the esters identified in the headspace of melon plugs excised from non-
transformed (nn and ACO antisense (AS) hybrids.
Hybrids
Ester Odour Threshold PLI- PLI- PL2- PL2- PL3- PLJ- PIA- PlA-
in Water ~n~g2 nT AS nT AS nT AS nT AS
Ethyl acetate 5 37 8 64 8 92 38 13 8
Butyl acetate 66 1 <1 2 <1 1 <1 1 <1

Ethyl butanoate 1 67 5 108 6 104 25 96 <1
Hexyl acetate 2 20 13 42 16 34 6 22 5
Ethyl hexanoate 1 4 <1 27 <\ 12 2 23 <1
2-Methylpropyl acetate 65 2 1 3 2 2 <I 1 1

Ethyl 2-methyl propanoate 0.1 37 3 361 12 303 68 251 2
2-Methylbutyl acetate 11 12 6 9 3 10 2 6 3
Ethyl 2-methyl butanoate 0. .3 47 2 136 2 93 21 131 <1
5. Conclusions
ACO antisense Cantaloupe melons are less aromatic than non-transformed melon. In
non-transformed melons, branched-chain ethyl esters that are potent odorants are
present at much lower levels than the corresponding acetates. In ACO antisense fruit,
they were far more depleted than acetates. Thus, ethylene seems to enhance the
synthesis of esters having a strong impact on the aroma.
6. Acknowledgements
We would like to thank Tezier for providing the melons. This work was funded by the
European program FAIR CT96-1138.
7. References
1. Ayub, R., Guis, M., Ben Arnor, M, Gillot, L., Roustan, 1. P., Latche, A., Bouzayen, M., and Pech, 1.
C. (1996) Expression of ACC oxidase antisense gene inhibits ripening of Cantaloupe melon fruits,
Nature Biotech. 14, 862-866.
2. Guis, M., Botondi, R., Ben-Arnor, M., Ayub, R., Bouzayen, M., Pech, 1. C., and Latche, A. (1997)
Ripening-associated biochemical traits of Cantaloupe Charentais melons expressing an antisense
ACC oxidase transgene, J. Amer. Soc. Hart. Sci. 122,748-751.
3. Wang, Y., Wyllie, S. G., and Leach, D. N. (1996) Chemical changes during the development and
ripening of the fruit ofCucumis melo (cv Makdimon), J. Agric. Food Chern. 44. 210-216.
4. Yabumoto, K., and Jennings, W. G. (1977) Volatile constituents of Cantaloupe, Cucumis melo, and
their biogenesis, J. Food Sci. 42,32-37.
5. Wyllie, S. G., Leach, D. N., Nonhebel, H. N., and Lusunzi, I. (1996) Biochemical pathways for the
formation of esters in ripening fruit, in A. 1. Taylor and D. S. Mottram (eds.), Flavour Science:
Recent developments, Royal Society of Chemistry, Information Services, Cambridge, UK, pp. 52-57.
370
6. Bauchot A. D., Mottram, D. S., Dodson, A. T., and John, P. (1998) Effect of antisense ACC oxidase
on formation of volatile esters in Cantaloupe Charentais melon (cv Vedrandais), J. Agric. Food
Chem., 46, 4787-4792.
7. Yamaguchi, M., Hughes, D. L., Yabumoto, K., and Jennings, W. G. (1977) Quality of Cantaloupe
muskmelon: variability and attributes, Sci. Hort. 6, 59-70.
8. Ueda, Y., Fujishita, N., Chachin, K. (1997) Presence of alcohol acetyltransferase in melons
(Cucumis melo L.), Postharv. BioI. Techno/lO, 121-126.
9. Teranishi, R., Buttery, R.G., Stern, D.1., and Takeoka, G. (1991) Use of odor thresholds in aroma
research., Food Sci. Technol. 24, 1-5.
GENETIC ENGINEERING OF CANTALOUPE TO REDUCE ETHYLENE
BIOSYNTHESIS AND CONTROL RIPENING
S. K. CLENDENNEN l, J. A. KELLOGG l, K. A. WOLFF l, W.

MATSUMURA l, S. PETERS l, J. E. VANWINKLE\ B. COPES 2, M.
PIEPER2 , AND M. G. KRAMERl
'Agritope, Inc., 16160 SW Upper Boones Ferry Rd., Portland, Oregon,
97224, USA; 1Harris Moran Seed Company, 100 Breen Road, San Juan
Bautista, California, 95045, USA.
1. Abstract
Cantaloupes (Cucumis melD) comprise a large retail market in the US. Postharvest
losses, which are largely attributable to the effects of ethylene, have been estimated to
be near 30%. Ethylene biosynthesis has been manipulated to prolong ripening and
extend the postharvest life of cantaloupe via genetic modification. The T3 bacteriophage
gene product S-adenosylmethionine hydrolase (SAMase) catalyzes the degradation of
SAM, a precursor to ethylene biosynthesis. Because both SAM and ethylene play a
number of important roles in normal plant growth and development, a synthetic
promoter has been designed to restrict SAMase expression to the ripening fruit of
cantaloupe. The ripening phenotype of cantaloupe transformed with a fruit-specific
SAMase expression construct was analyzed in greenhouse and field trials. Results
indicate that the genetically modified cantaloupe expressing SAMase exhibit modified
postharvest characteristics, including a dramatic reduction in ethylene synthesis.
2. Introduction
Practically speaking, all cultivated forms of cantaloupe belong to the highly

polymorphic species Cucumis melD L. that is grown for its sweet edible fruit [I]. The
term cantaloupe pertains to the American usage of the name to describe the netted
melons, also commonly referred to as muskmelon [2]. As a crop, cantaloupes are grown
commercially wherever environmental conditions permit the production of an
economically viable yield. In the United States, the principal fresh market cantaloupe
growing regions are California, Arizona and Texas which produce approximately
96,000 acres out of a total annual acreage of more than 113,000 acres (USDA, 1998).
Cantaloupes comprise a $2.8 billion retail market in the US. It has been estimated that
postharvest losses, which are largely attributable to the effects of ethylene, can reach
30% throughout the distribution chain.
Genetic engineering of plants to manipulate ethylene biosynthesis can lead to
delayed ripening and extended postharvest life in climacteric fruit, which in turn
371
372
reduces post-harvest losses resulting from produce that is overripe and senescent. A
gene derived from E. coli bacteriophage T3 encoding an enzyme capable of degrading
S-adenosylmethionine (SAM) has been introduced into the Cucumis melo genome using
standard Agrobacterium binary vectors. Production of this enzyme, S-
adenosylmethionine hydrolase (SAMase) in fruit alters the ethylene biosynthetic
pathway and causes a modified fruit ripening phenotype in cantaloupe.
3.1. INBRED AND TRANSGENIC CANTALOUPE LINES
Non-transformed cantaloupe lines A and B are proprietary inbred breeding lines

developed by Harris Moran Seed Company, Inc, Modesto, California, USA. Both
inbred lines produce fruit of the "Western Shipper" type; a round shape with a rough
surface and minimal or no sutures. Fruits abscise, or "slip," when ripe, and the
formation of the abscission zone is the primary harvest indicator. Transgenic line A is
derived from a homozygous R 1 progeny selection from an original RO transformant A,
obtained by transformation of the parental inbred line A with binary vector pAG 7162.
Line B is derived from a homozygous R J progeny selection from an original Ro
transformant B, obtained by transformation of the parental inbred line B with binary
vector pAG 7162. As determined by quantitative PCR and Southern blot analysis,
transgenic line A contains two copies ofthe T-DNA insert, while line B contains one. In
both lines the T-DNA insertions are at a single locus and have remained stable over
three generations.
3.2. THE EXPRESSION CONSTRUCT pAG 7162
3.2.1. The Gene EncodingSAMase

The SAMase gene is derived from an E. coli bacteriophage T3 gene that encodes a
functional S-adenosylmethionine hydrolase, or SAMase, protein [3, 4]. The SAMase
encoding trans gene is derived from a previously reported M13 clone [3] modified to
contain a consensus eukaryotic translation initiation site by altering the nucleotide
sequence surrounding the sam ATG start codon [5]. The resulting gene was named
sam-k and was utilized in plasmid pAG 7162 (see Figure 1). The SAMase protein
catalyzes the conversion of S-adenosylmethionine (SAM) to methylthioadenosine and
homoserine, both of which are recycled in separate pathways. SAM is a ubiquitous
nucleotide used in many activities in all cells [6, 7]. In the course of ethylene
biosynthesis, l-aminocyclopropane-l-carboxylic acid (ACC), the immediate precursor
to ethylene, is produced from SAM by the enzyme ACC synthase [8]. As the pool of
SAM is depleted by the action of SAMase, neither ACC nor ethylene are produced.
3.2.2. The E8/E4 Chimeric Promoter

There are many examples of fruit-specific and ripening-associated promoters from
plants. Two well-characterized examples are the promoters associated with the fruit-
specific and ethylene responsive genes E8 and E4 from tomato [9, 10, 11]. Ethylene
373
responsive elements have been identified in the tomato ES and E4 promoters, as wen as
elements governing organ-specificity and association with ripening (see Figure IA).
The promoter from the ripening-associated ES gene was used successfully to drive
expression of SAMase in tomato, resulting in a decrease in ethylene production in the
fruit [5, 12]. For the expression of SAMase in cantaloupe, a novel ethylene responsive
promoter was synthesized from elements of the tomato ES and E4 promoters, as
indicated in Figure lB. The sam-k sequence was fused to the ESlE4 chimeric promoter
and a nos 3' termination sequence from Agrobacterium tumefaciens [13]. The SAMase
expression construct also contains a selection cassette composed of the kan' gene under
transcriptional control of a proprietary constitutive promoter and the gene 7 termination
sequence [14, 15]. Plasmid pAG 7162 was used in the transformation of the A and B
parental lines.
(-2181) ,
(E)
, .
[]----WJ-----......
(0) (R)
Tomato E8
URE DRE
~
Tomato E4
TATA
.......
(E8; -2181 to -1088) (E4; 1150 to ATG)
(E) URE DRE
~--.I ~~----~~
'" ....... _, TATA , /
,/"/
........... ES/E4 promoter
LB selection SAMase RB
Figure 1. Diagram of the components of the chimeric ethylene responsive promoter and the
SAMase expression construct pAG 7162. A) Ethylene responsive elements in the tomato E8 and
E4 promoters (E, URE, and DRE) are represented by gray boxes. In the E4 promoter, both an
upstream responsive element (URE) and a downstream element (DRE) are necessary for ethylene-
responsive expression. Other functional elements in the E8 promoter have been identified as being
responsible for organ specificity (0) or association with ripening (R) [9, 10, II]. B) In pAG 7162,
a translational fusion between the chimeric ethylene-responsive E81E4 promoter and the gene
encoding SAMase as well as a selection cassette are contained between the left and right borders
(LB, RB) of the T-DNA.
4. Results
4.1. EXPRESSION OF SAMASE IN TRANSFORMED PLANTS
Stable integration of the sam-k transgene into the cantaloupe genome results in the
production of a functional SAMase protein. The ES/E4::sam-k translational fusion
present in lines A and B expresses a functional SAMase protein in a fruit specific (not
374
shown) and ethylene responsive manner, as determined by western blot analysis of total
protein from different tissues of field-grown cantaloupe (Fig. 2). Transgenic fruit of
lines A and B initiate expression of the SAMase protein at varying levels in fruit that
has begun to mature (full slip) and continue to express a functional protein in fruit that
is fully mature (post slip).
kd 1 :2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
423--:
31.6-:
[8-
7.6-
Figure 2. Western blot analysis of lines A and B demonstrating ethylene responsive regulation
of sam-k gene expression. lOOg samples of protein extracted from pre-slip, slip and post slip
fruit were resolved on an SDS-PAGE gel and blotted to a nylon membrane. The resulting blot
was probed with a monoclonal antibody specific to the SAMase protein and visualized using
chemiluminescence. Lane I: molecular weight standard. Lane 2 is blank. Lane 3: line B control
immature, Lane 4: line B control full slip, Lane 5: line B control post slip, Lane 6: line B
immature, Lane 7: line B full slip, Lane 8: line B post slip. Lanes 9 and 10 are blank. Lane 11:
line A control immature, Lane 12: line A control full slip, Lane 13: line A control post slip.
Lane 14: line A immature, Lane 15: line A full slip, Lane 16: line A post slip. Lanes 18-25
represent a standard curve containing 20,40,80, 160,320, and 640 pg of SAMase fusion protein
respectively.
4.2. POST HARVEST FRUIT QUALITY EVALUATIONS
Harris Moran Seed Company and Agritope, Inc. have conducted horticultural and
physiological evaluations on lines A and B during the 1997 and 1998 field seasons in
California, Oregon, Arizona and Texas. The parameters evaluated included harvest
maturity (timing from anthesis to full slip), fruit size and weight, fruit firmness, mold
susceptibility, external and internal color, soluble solids, and ethylene production in
harvested fruit. Data collected from these trials, as well as from laboratory analyses
demonstrate that SAMase-expressing cantaloupe lines A and B, except for the intended
impact of SAMase expression on ethylene biosynthesis and related processes, do not
differ from the non-transgenic parental varieties.
4.2.1. Ethylene Biosynthesis

During the 1998 Summer field trail season at the Hermiston Agricultural Research
Center, a detailed analysis of the ethylene production rates in transgenic lines A and B
and their respective controls was carried out. Ethylene data were collected from full slip
fruit using formation of the abscission zone as a harvest indicator. The melons were
acclimated overnight at room temperature (23 D C) after which ethylene measurements
were performed daily for four consecutive days. Ethylene concentrations were
375
determined by gas chromatography and evolution rates were reported as ppmlcm31hr.

Results are shown in Figure 3 and indicate that significant differences exist between
control and transgenic fruit in their ability to produce ethylene. The reduction in
ethylene biosynthesis is evident in the inbred transgenic lines as well as in hybrid
crosses between the transgenic lines and the non-transformed controls.
0.08
0.07
0.06
..s::::
;:;-. 0.05
-E
0
E
0..,
0..,
0.04
0.03
0.02
0.01
o
A control Line 8 B control Line , AXB 8XB 8X,
(n=26) (n=7) (n=47) (n=34) (n=24) (n=12) (n=34)
Figure 3. Mean peak rates of ethylene production in transgenic SAMase cantaloupe lines A and B
and respective controls and hybrids, Ethylene production was measured as described in the text. The
peak rate of ethylene synthesis over four days of measurement was selected for each fruit, and like
samples were pooled and averaged (n=number of fruit in each pool), Controls are represented by
labeled black bars, while transgenic lines are represented by labeled open bars. The transgenic parent
of each hybrid (gray bars) is indicated by underscoring. The black lines represent the standard
deviation of each sample mean.
4.2.2. Maturity
In order to determine if maturity differences exist between transgenic cantaloupe lines A
and B and the respective non-transgenic controls, SAMase positive plants as well as
null plants from segregating populations of lines A and B respectively were flagged in
the field during the 1997 growing season in Hermiston, OR. Open flowers on SAMase
positive and null plants from these populations were then tagged. Several bee boxes
provided the source of pollinators and a count of successful pollinations was made 5-7
days after each tagging. Heat unit accumulation from tagging (pollination) to full slip
was recorded. Results are reported as the percentage of mature (full slip) fruit in each
of the lines after accumulation of the given number of heat units until all tagged fruit
had slipped. Heat units are derived by subtracting the daily minimum temperature from
376
the daily maximum temperature, dividing by two and subtracting a base temperature (in
this case 45F).
TABLE I. Timing, measured in heat units, from pollination until the formation of the fruit abscission zone
(full slip) in control and transgenic cantaloupe
Heat Units: 1009 1074 1160 1227

Genotype
Line A control 16% 31% 49% 6%
Line B control 11% 35% 46% 8%
LineA 8% 17% 67% 8%
LineB 6% 19"10 70% 5%
The results in Table 1 demonstrate that while the onset of maturity is not
significantly delayed in transgenic fruit compared to the respective controls, full
maturity of the transgenic fruit is more concentrated in terms of the percentage of
tagged fruit which reached full slip and that this happens at a greater number of heat
units than the controls. Also, it should be noted that in terms of total heat units required
for the total fruit load to reach maturity there is no difference. Instead, it would appear
that the transgenic fruit matures more uniformly than the controls. Further testing may
help determine if these differences are due to the effects of SAMase expression in the
fruit.
4.2.3. Yield Characteristics

As part of the ongoing horticultural evaluation and phenotype characterization carried
out at the various field test locations, yield characteristics and fruit size distribution has
been evaluated by quantitative harvest at full fruit maturity (i.e. full slip). In the
Oregon, California, and Arizona trials during the spring and summer of 1998, fruit were
harvested on an per plant basis and comparisons made between total number of fruit per
plant, total fruit weight and fruit size distribution. While in some cases there were
significant differences between transgenic and control entries for fruit size and/or yield,
these differences were not consistent over locations and appear to simply be a genotype
by environment interaction resulting at least in part from the process of reducing the
original cantaloupe populations to single plants and the subsequent expansion of these
populations to their current size. This type of result is not unusual in conventional
breeding programs such as backcrossing programs where single plant selections are
made in the process of introgressing new genetic material into standard inbred types
(Copes, 1998, personal communication). There is no evidence to suggest that these
differences are the direct result of SAMase expression.
4.2.4. Other Horticultural Evaluations

As part ofthe post-harvest evaluation of the fruit, measurements of internal and external
fruit firmness, parameters of fruit deterioration, and soluble solids were performed in
three separate field trial locations. At the Davis field site, these post-harvest evaluations
were made over several weeks of post-harvest storage. The following tables (2A
through C) summarize these data. When evaluating external firmness, formation of soft
spots, deterioration of the stem end, and growth of molds, a subjective scale from 1 to 9
377
is used, with 9 being a more desirable state and 5 being the lower limit of commercial
marketability.
TABLE 2. Summary of fruit quality evaluations of cantaloupe Lines A and B and respective controls,
evaluations completed during the 1998 summer field season.
A. Davis, California, summer 1998, Day 0
External Internal Soft Spot Stem End Molds

Genotype Firmness Firmness (1-9) (1-9) (1-9) o Brix
(1-9) (lbs./sq.in.)
Line A Control 8.21 5.50 8.39 8.32 9.00 12.38
Line A 8.07 6.10' 7.87 8.07 8.09 11.70
Line B Control 8.26 5.80 8.05 8.16 9.00 9.01
Line B 8.68 6.77' 8.76' 8.45* 8.95 9.71
B. Davis, California, summer 1998, Day 14

Line A Control 5.71 2.26 5.75' 4.87' 5.01 11.55
lineA 5.65 2.50 4.44 4.18 4.39 12.08
Line B Control 5.68 2.77 5.02 4.64 5.34 8.37
Line B 5.83 3.66' 5.24 5.06 5.02 9.38
C. Davis, California, summer 1998, Day 21

Line A Control 5.03 2.16 4.58' 4.16 4.19 11.35
Line A 4.87 1.97 3.91 3.85 398 11.65
Line B Control 5.39 3.29 4.\0 4.20 3.92 8.54
Line B 5.48 3.36 4.43 4.23 4.25 9.04'
. Means of controls and respective transgenic lines are significantly different at p-O.OS.
5. Discussion
Cantaloupe was transformed with an E8!E4 hybrid promoter SAMase construct, and the
resulting transformants were analyzed for SAMase expression and ripening phenotype
both in greenhouse and field trials. The chimeric promoter in the SAMase expression
construct drives expression of SAMase in a fruit specific and ethylene responsive
manner. By expressing this enzyme in such a regulated manner, fruit of SAMase lines
A and B produce substantially less ethylene than non-transgenic fruit resulting in a
modified ripening and post-harvest phenotype.
SAMase melons show significant reductions in ethylene biosynthesis, both as
inbreds homozygous for the introduced SAMase transgene and as hybrids. SAMase
melons also show minimal delay in the time from pollination to maturity, and the fruit
of the transgenic plants may be characterized as ripening more uniformly in the field.
Other horticultural traits and yield are minimally impacted by SAMase expression, with
the transgenic fruit most often showing no statistical differences from the non-
transformed controls. It was frequently observed that the concentration of soluble
sugars was significantly higher in the transgenic fruit compared with the controls. One
possible explanation may be that fuII slip is achieved by the majority of transgenic fruit
one to three days later than the average control fruit. The additional time on the vine
may aIIow more sugar to accumulate in the fruit before it is harvested. These results are
378
consistent with observations of melons exhibiting dramatically reduced ethylene

biosynthesis as a result of antisense expression of ACC oxidase (ACO) [16]. Ethylene
production was reduced by >99% in the ACO-antisense melons, and flesh firmness was
substantially increased in the transgenic ripe fruit. However, the accumulation of
soluble solids was minimally affected in the transgenic fruit, confirming that sugar
accumulation in melon is independent of ethylene [16].
Using a fruit-specific developmentally regulated SAM degradation strategy as a
means to reduce ethylene biosynthesis in plants has a number of distinct advantages.
The fruit-specific nature of gene expression targets only the SAM found in fruit and
diverted to ACC for ethylene production. The fact that sam-k gene expression follows
the normal pattern of expression of ethylene during the ripening process means that the
SAMase protein is essentially transient and final concentrations in the ripe fruit are
minimal. The use of an enzyme that degrades SAM may allow for the selection of a
broad range of modified ripening phenotypes which can be predictably determined by
the level of SAMase protein expressed. We believe that these benefits will help to
reduce production and handling related losses and produce a higher quality in the crop
as a whole with the concomitant savings in labor and distribution costs. There also
exists the potential to benefit consumers with a longer-lasting, higher-quality product.
6. Acknowledgements
The authors wish to acknowledge the contributions of the Harris Moran breeding staff
and the Agritope research staff, with special thanks to Brenda Lanini of HMSC, Davis,
CA.
7. References
1. Purseglove, J. W. (1968) Tropical Crops. Dicotyledons I. John Wiley and Sons. New York.
2. Everett, T.H. (1981) The New York Botanical Garden Encyclopedia of Horticulture. Garland Press,
New York. pp. 3596
3. Hughes, J.A. et al. (1987) Nucleotide sequence analysis of the coliphage T3 S-adenosylmethionine
hydrolase gene and its surrounding ribonuclease III processing sites, Nuc. Acid Res. 15, 717.
4. Hughes, J.A. et al. (1987) Expression of the cloned coliphage T3 S-adenosylmethionine hydrolase
gene inhibits DNA methylation and polyamine biosynthesis in E. coli. J Bact. 169, 3625-3632.
5. Good, x., Kellogg, J.A., Wagoner, W., Langhoff. D., Matsumura, W. and Bestwick, RK. (1994)
Reduced ethylene synthesis by transgenic cantaloupes expressing S-adenosylmethionine hydrolase,
Plant Mol. Bioi. 26, 781-790.
6. Salvatore, F. et al. (1977) The Biochemistry of Adenosylmethionine, Columbia University Press,
New York.
7. Usdin, E. et al. (1979) Transmethylation. ElsevierlNorth Holland Publishing, New York.
8. Kende, H. (1993) Ethylene biosynthesis, Annu. Rev. Plant Physiol. Plant Mol. Bioi. 44,283-307.
9. Deikman, J., Xu, R, Kneissl, M.L., Ciardi, J.A., Kim, K-N. and Pelah, D. (1998) Separation of cis
elements responsive to ethylene, fruit development, and ripening in the 5'-flanking region of the
ripening-related E8 gene, Plant Mol. Bioi. 37, 1001-1011.
10. Xu, R, Goldman, S., Coupe, S., and Deikman, J. (1996) Ethylene control ofE4 transcription during
tomato fruitripening involves two cooperative cis elements, Plant Mol. Bioi. 31,1117-1127.
11. Deikman, J., Kline, R., Fischer, RL. (1992) Organization of ripening and ethylene regulatory
regions in a fruit-specific promoter from tomato (Lycopersicon esculentum), Plant Physiol. 100,
2013-2017.
379
12. Kramer, M.G., Kellogg, J.A, Wagoner, W., Matsumura, W., Good, x., Peters, S., Clough, G, and
Bestwick, R.K. (1997) Reduced ethylene synthesis and ripening control in tomatoes expressing S-
adenosylmethionine hydrolase, in AK. Kanellis, et al. (eds.), Biology and Biotechnology of the
Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 307-319.
13. Depicker, A, Stachel, S., Dhaese, P., Zambryski, P. and Goodman, H.M. (1983) Nopaline
synthase, transcript mapping and DNA sequence, J. Mol. Appl. Genet. 1,561-573.
14. Beck, E., Ludwig, G., Auerswald, E., Reiss, B., Schaller, H. (1982) Nucleotide sequence and exact
location of the neomycin phosphotransferase gene from transposon Tn5, Gene 19, 327-336.
15. Velten, J., Shell, J. (1985) Selection-expression plasmid vectors for use in genetic transformation of
higher plants, Nucleic Acids Res. 13, 6981-98.
16. Guis, M., Bouquin, T., Zegzouti, H., Ayub, R., Ben Amor, M., Lasserre, E., Botondi, R., Raynal, J.,
Latche, A, Bouzayen, M., Balgue, C., and Pech, J.C. (1997) Differential expression of ACC
oxidase genes in melon and physiological characterization of fruit expressing an antisense ACC
oxidase gene, in AK. Kanellis, et at. (eds.), Biology and Biotechnology of the Plant Hormone
PHYSIOLOGICAL ANALYSIS OF FLOWER AND LEAF ABSCISSION IN
ANTISENSE-ACC OXIDASE TOMATO PLANTS
L. ZACARIAS\ C. WITHELAW 2, D. GRIERSON 2 AND J.A.

ROBERTS 2
/lnstitUlo de Agroquimica y Tecnologia de Alimentos (CSlC), 46100
Burjassot, Valencia, Spain, 2Plant Science Division, School of Biological
Sciences, University of Nottingham, Sutton Bonington Campus,
Loughborough, LEI2 5RD, UK
1. Introduction
The process of abscission is a common feature during plant development by which

flowers, flower parts, leaves, fruits and other organs are shed. Cell separation occurs at
a predeterminated site known as the abscission zone and the process is triggered by
developmental and environmental signals that bring about cell wall dissolution and the
shedding of the organ [5]. The regulatory mechanisms governing abscission are not
completely understood and may vary at different abscission sites and stages in the
plant's life [16]. However it is clear that different hormonal stimuli act in a co-
ordinated manner to determine the timing of abscission and based on their response to
ethylene and indole-3-acetic acid (lAA) abscission-zone cells have been classified as a
particular type of target cell [12].
Ethylene has been recognised as an important abscission-promoting signal and in
different plant species genes whose expression is regulated by this gaseous plant
hormone have been isolated and characterised [4, 8]. However the precise role by
which ethylene regulates the abscission process and whether it acts as an inducer or an
accelerator of cell separation remains unresolved. Analysis of the abscission process in
mutants that exhibit an attenuated capacity to perceive or synthesise ethylene provides a
unique strategy to clarify the role of the hormone in abscission. In the ethylene
insensitive mutant of Arabidopsis thaliana, etrl-I, shedding of the petals and
expression of the I)-glucuronidase reporter gene driven by the chitinase promoter both
took place at the base of the flower abscission-zone but were delayed with respect to the
wild type plant. Similar results were reported in the ein2 mutant, which carries a
mutation conferring near complete ethylene-insensitivity [2]. In the Never ripe mutant
of tomato, ethylene perception is blocked by a lesion in an ethylene receptor gene that is
homologous to the ERS gene of Arabidopsis. This gene is similar to ETRI but lacks the
response domain [\8]. The time course of both 'natural' and ethylene-promoted flower
senescence and abscission was substantially delayed in Nr plants [\ 0, 17] indicating that
ethylene plays a role in regulating these processes in tomato. These observations
suggest that there is not an absolute requirement for ethylene in order for abscission to
take place in Arabidopsis or tomato but further work is necessary to determine whether
381
382
this is a general feature of different species and sites of shedding. Moreover, by

examining mutants where different components of the ethylene perception and signal
transduction pathway are blocked it will be possible to determine whether the abscission
process is always co-ordinated in the same way.
Tomato plants producing reduced levels of ethylene have been generated by
expressing an antisense ACC oxidase (ACO) transgene [6] and the rates of fruit
ripening and leaf senescence have been shown to be retarded in transgenic (ACOI AS)
plants [7, 14]. These ACO 1AS plants provide a useful experimental system to elucidate
the involvement of ethylene in different developmental processes. In this article we
report a physiological analysis of flower and leaf abscission in ACOI As tomato plants.
Our results indicate that reduced ethylene production is accompanied by a reduction in
sensitivity to the gaseous plant hormone.
2. Flower Senescence
To examine the effect of reduced ethylene production on flower senescence, flowers at

the closed bud stage (when the petals start to emerge - described by Barry et aZ. [1] as
Stage 2) or flowers at anthesis (Stage 3) were tagged from both wild-type (WT, cv.
Ailsa Craig) and ACOI As plants. Plants were grown in a growth chamber under
fluorescent light for 16 h at 28C and 8 h dark at 25C. Under these conditions, flowers
of WT plants began to sene see by drying and wilting at the tip of the petals and as the
wilting progressed the corolla became closed and by about five days after anthesis it had
faded. A large proportion of intact WT flowers showed initiation of cell separation and
progressive yellowing of the proximal pedicel and sepals, culminating in flower
abscission. Flowers from the ACOI As plants displayed a significant delay in
senescence and did not wilt in the same manner as WT. The tip of the petals started to
fade by about the fourth day after anthesis and this progressed slowly to the base of the
petals, which remained expanded, turgid and attached more than 7 days later. Two
weeks after anthesis most of the ACOI As flowers had desiccated but were still firmly
attached to the base of the calyx. Only a small proportion of the ACOI As inflorescences
eventually abscised.
3. Abscission of Flower Explants
Separation at the flower abscission zone was examined in explants that either had the
flower removed or still attached to the pedicel. In WT explants in which the flower had
been excised, abscission started after 6 h and 100% separation was achieved within 18
h. In the ACOI AS material abscission progressed at a slower rate and by 72 h only 80%
of the air-treated explants had undergone separation. This delay in abscission was
associated with a 90% reduction in ethylene production by the ACOI As explant tissue
compared to the WT material. Application of ethylene (l01l1 rl) accelerated the rate of
separation in both WT and transgenic phenotypes but the time required to complete
abscission was almost doubled in the ACOI AS plants (Table I).
383
TABLE I. Time required (h) to induce 50% and 100% abscission

by ethylene (I01l1 rl) in abscission-zone explants, with (+) or
without (-) the terminal flower, from wild-type (WT, CV. Ailsa
Craig) and ACO I AS tomato plants.
Abscission WT ACOI As
- flower
50% 3.5 4.7
100% 6.0 11.0
+flower
50% 6.0 11.0
100% 11.0 72.0
If the flower was left attached to the pedicel explant abscission was delayed for up to
24 h in WT plants while in the ACOI As plants the process was suppressed completely.
Ethylene production by the transgenic explants was only 10% of that observed in WT
material. Ethylene accelerated the rate of abscission in flower explants from WT and
ACOI As plants but the transgenic material exhibited a greatly reduced sensitivity to the
hormone (Table 1).
4. Abscission of Leaf Explants
Ethylene production by leaf explants from the WT increased with the onset of
abscission and reached a peak after 3 days. No comparable rise in ethylene synthesis
was observed in explants from ACOI As plants and the level of ethylene production was
only 7% of that seen in WT. The reduced production of ethylene by the transgenic tissue
was accompanied by a suppression of abscission and after 7 days less that 10% of the
explants had abscinded compared with 100% abscission in WT explants by day 5.
Sensitivity to ethylene was also attenuated in leaf explants from the ACOI As plants.
After 2 days of exposure to 1 or 10 J.ll.rl ethylene abscission was 3 and 2.4-times lower,
respectively that in WT explants (Table 2).
5. Conclusion
Transgenic tomato plants expressing an antisense ACO-I gene produce reduced levels
of ethylene during flower senescence and abscission of flowers and leaves. Flower
senescence was considerably delayed in the ACOI As line and proceeded in a different
manner compared with WT plants. Pedicel abscission was delayed or suppressed, in
either the presence or absence of the terminal flower, and abscission of leaf explants
was also retarded. These results clearly indicate that ethylene is the major regulatory
384
signal controlling flower wilting and abscission in tomato and corroborate previous
observations [3].
TABLE 2. Effect of ethylene on abscission of leaf explants

from wild type (WT, cv. Ailsa Craig) or ACOI As tomato
plants. Abscission was determined after 48 h of exposure to
different concentrations of the gas.
Abscission (%)
Ethylene (~111) WT
o 20,0 0,0
36,0 12,0
10 67,5 27,5
During senescence of tomato flowers an increase in the expression of ACC oxidase

genes ACO-I and ACO-3 as well as in ACC oxidase activity has been reported [I]
indicating a spatial and temporal regulation of ACC oxidase during flower senescence.
The delay in the onset of flower senescence observed in the ACOI AS plants reinforces
the key role of ethylene in coordinating the different morphological and physiological
events accompanying flower senescence. This hypothesis is also supported by the fact
that the phenotype exhibited for flower senescence in ACOI AS plants closely resembles
that described for flowers from Nr plants in which ethylene perception is blocked [10,
191-
Separation of the flower abscission-zone explants was influenced by the presence of
the flower. Whereas in the WT explants the process was delayed, in ACOI AS explants
the presence of the terminal flower almost completely suppressed abscission.
Abscission inhibitors such as auxins, present in the flower, have been previously
suggested to regulate the timing of abscission [15]. The interaction between ethylene
and auxin appears to be crucial, since ethylene can increase auxin metabolism and
reduce basipetal auxin transport [3]. In explants from ACOI AS plants ethylene
production was greatly reduced and it is likely that in the presence of the terminal
flower the auxin flux through the abscission zone would be maintained and be
responsible for the observed suppression of abscission. This is consistent with a model
in which, in the absence of the source of inhibitor from the flower, the auxin gradient
would progressively decline and the explants would exhibit an elevated sensitivity to the
low levels of ethylene evolved and abscission would progress at a slow rate.
Interestingly, in the three abscission systems examined (pedicel, flower and leaf
explants) antisense ACOI AS plants displayed a reduced sensitivity to ethylene-induced
separation, although they finally did abscind. The mechanism by which ethylene is
perceived and transduced is not completely understood but genes encoding putative
ethylene receptors have been isolated from Arabidopsis and tomato [11, 13, 18, 20].
Zhou et al. [20] reported that the ETRI gene was constitutively expressed during leaf
abscission and was unaffected by ethylene, silver thiosulfate (an inhibitor of ethylene
action) or IAA. They concluded that the regulation of abscission by ethylene is not
385
related to changes in the expression of the ETRI gene. However the level of the mRNA
encoding the NR gene was higher in the flower-abscission zone than in the distal or
proximal pedicel region and increased specifically during shedding [13]. The
expression of the NR mRNA was developmentally regulated and induced by ethylene
and therefore was proposed to playa role in the autocatalytic mechanism of ethylene
biosynthesis and perception [9, 13]. This model could help to explain the reduced
sensitivity of the ACOl As abscission-zones to ethylene. If the expression of the
ethylene receptor is regulated by ethylene itself it would be predicted that plants
producing very low levels of the gas during the life cycle would exhibit reduced
receptor levels and consequently have a diminish competence to respond to the
hormone. Although a more complex mechanism may dictate the ability of the
abscission-zone cells to perceive and transduce the ethylene signal, the results reported
here indicated that this programme of events is, in part, linked to ethylene biosynthesis.
6. Acknowledgements
The financial support of the Conselleria d'Educaci6 i Cultura (Generalidad Valenciana,

Spain) and the Royal Society (UK) is gratefully acknowledged.
7. References
I. Barry, C.S., Blume, B., Bouzayen, M., Cooper, W., Hamilton A.J. and Grierson, D. (1996)
Differential expression of the I-aminocyclopropane-I-carboxylate oxidase gene family in tomato,
Plant J. 9, 525-535.
2. Bleecker, AB. and Patterson, S.E. (1997) Last exit: senescence, abscission, and meristem arrest in
Arabidopsis, Plant Cell 9, 1169-1179.
3. Brown, K.M. (1997) Ethylene and abscission, Physiol. Plant. 100,567-576.
4. Coupe, S.A, Taylor, J.E. and Roberts, J.A (1997) Temporal and spatial expression of mRNAs
encoding pathogenesis-related proteins during ethylene-promoted leaflet abscission in Sambucus
nigra, Plant Cell and Environ. 20, 1516-1524.
5. Gonzalez-Carranza, Z.H., Lozoya-Gloria, E. and Roberts, J.A. (1998) Recent development in
abscission: shedding light on the shedding process, Trends in Plant Science 3, 10-14.
6. Hamilton, AJ., Lycett, G. W. and Grierson, D. (1990) Antisense gene that inhibits synthesis of the
hormone ethylene in transgenic plants, Nature 346,284-287.
7. John, 1., Drake, R., Farrell, A, Cooper, W., Lee, P., Horton, P. and Grierson, D. (1995) Delayed leaf
senescence in ethylene- deficient ACC-oxidase antisense tomato plants: molecular and physiological
analysis, Plant J. 7,483-490.
8. Kalaitzis, P., Solomos, T. and Tucker, M.L. (1997) Three different polygalacturonases are expressed
in tomato leaf and flower abscission, each with a different temporal expression pattern. Plant Physiol.
113, 1303-1308.
9. Klee, H.J. and Tieman D. (1997) Potential applications of controlling ethylene synthesis and
perception in transgenic plants, in AK. Kanellis, C. Chang, H. Kende and D. Grierson (eds.), Biology
and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publisher, Dordrech, pp. 289-
297.
10. Lanahan, M.B., Yen, H-C., Giovannoni, J.J. and Klee, H.J. (1994) The Never Ripe mutation blocks
ethylene perception in tomato, Plant Cell 6,521-530.
11. Lashbrook, C.c., Tieman, D.M. and Klee, H.J. (1998) Differential regulation of the tomato ErR gene
family throughout plant development, Plant J. 15, 243-252.
12. Osborne, D.J. (1989) Abscission, Curro Rev. Planl Sci. 8,103129.
13. Payton, S., Fray, R.G., Brown, S., and Grierson, D. (1996) Ethylene receptor expression is regulated
during fruit ripening, flower senescence and abscision, Plant Molec. BioI. 31, 1227-1231.
386
14. Picton, S., Barton, S.L., Bouzayen, M., Hamilton, AH. and Grierson, D. (1993) Altered fruit ripening
and leaf senescence in tomatoes expressing an antisense ethylene-forming enzyme transgene, Plant J.
3,469-481.
15. Roberts, J.A, Schindler. C.B. and Tucker, G.A (1984) Ethylene-promoted tomato flower abscission
and the possible involvement of an inhibitor, Planta 160,159-163.
16. Sexton, R. and Roberts, J. A (1982) Cell biology of abscission, Ann. Rev. Plant Physiol. 33, 133-162
17. Tucker, G.A, Schindler. C.B., and Roberts, J.A (1983) Flower abscission in mutant tomato plants,
Planta 160, 164-167.
18. Wilkinson, J.Q., Lanahan, M.B., Yen, H-C., Giovannoni, J.J. and Klee, H.J. (1995) An ethylene-
inducible component of signal transduction encoded by Never-ripe, Science 270,1807-1809.
19. Wilkinson, J.Q., Lanahan, M.B., Clark, D.J., Bleecker, AB., Chang, C., Meyerowitz, E.M. and Klee,
H.J. (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in
heterologous plants, Nature Biotech. 15,444-447.
20. Zhou, D., Kalaitzis, P., Mattoo, A.K., and Tucker, M.L. (1996) The mRNA for the ETRI homologue
in tomato is constitutively expressed in vegetative and reproductive tissues, Plant Molec. Bioi. 30,
1331-1338.
ETHYLENE IN HIGHER PLANTS: BIOSYNTHETIC INTERACTIONS WITH
POLYAMINES AND HIGH-TEMPERATURE-MEDIATED DIFFERENTIAL
INDUCTION OF NRVERSUS TAEl ETHYLENE RECEPTOR
R. A. MEHTA, D. ZHOU" M. TUCKER, A. HANDA 2, T.

SOLOMOS3 , A. K. MATTOO,4
J USDA, Plant Sciences Institute, Building OlOA, Agricultural Research
Center-w, Beltsville, MD 20705, USA, 2Department of Horticulture,
Purdue University, W Lafayette, IN 47907, USA, and 3Department of
Horticulture, University of Maryland at College Park, MD 20742, USA.
4Address correspondence to this author
1. Abstract
We are interested in factors that predispose a fruit or leaf to senesce, and the means by
which these factors could be neutralized in a timely manner. Polyamines - putrescine,
spermidine, spermine - accumulate and function during cell division and growth of the
plant, and act as anti-senescence growth factors. On the other hand, ethylene production
in the fruit is induced after growth and cell expansion are completed, which results in
the promotion of the senescence process. Our experiments were designed to interfere
with the ripening process by increasing the production of polyamines by introducing a
key polyamine gene, S-adenosylmethionine decarboxylase, during the senescence phase
and test if the fruit can reverse a part or parts of the senescence process, maintain or
overaccumulate desirable nutrients, and prolong its shelf-life. Ripening fruits from
transgenic lines accumulate polyamines, whereas the red fruit from the wild-type line
carried through tissue culture had little, if any, spermidine and spermine. Fruit from
some of these transgenic lines accumulate several-fold higher lycopene, appear to store
better, and show delayed ripening and senescence than the fruit from the wild-type
plants. Northern blot analysis showed that the TAEI (ethylene receptor) class of
mRNA is constitutively expressed at fairly constant levels in all examined tissues and
organs. We used a tomato NR (mutated ethylene receptor) gene-probe to analyze
mRNA accumulation for the NR gene. Accumulation of the NR gene transcript was
considerably more variable. Most notable were changes in NR mRNA accumulation
during fruit maturation, and heat stress at 37C. Thus, NR mRNA is differentially
expressed in tomato as compared to the generally
2. Introduction
Ethylene is a simple hydrocarbon, a gas at room temperature, produced by higher plants,

fungi and bacteria (1, 2]. Plants use ethylene as a hormone for regulating diverse
387
388
metabolic processes during plant growth, development and senescence. Its production
is regulated by transcriptional and post-transcriptional controls of two key ethylene-
biosynthesis enzymes, I-aminocyclopropane-l-carboxylate (ACC) synthase and ACC
oxidase [3]. Decreasing the expression oftheir transcripts in transgenic plants produced
via anti-sense RNA technology inhibits ethylene production and fruit ripening [4, 5].
Ethylene action involves several loci in the ethylene transduction pathway, two of which
are erRI [6] - a negative regulator in the ethylene pathway, which encodes a Raf-like
protein kinase, and ErRI, which encodes for a putative transmembrane protein kinase
resembling the prokaryotic two-component signal transducers [7]. Introduction of the
mutant Arabidopsis etrl-l gene into tomato also enabled manipulation of ethylene
responses in higher plants, viz., inhibition of fruit ripening [8]. Ethylene likely
influences plant metabolism via interactions with other plant growth regulators [9], such
as auxins, gibberellins, cytokinins, abscisic acid, brassinosteroids [10], methyljasmonate
[II], polyamines [12], and salicylic acid [13]. Auxins, gibberellins, cytokinins,
brassinosteroids, and polyamines are generally considered as promotors of growth and
development while methyljasmonate, abscisic acid and ethylene promote senescence
and cell death. Plant hormone action seems determined by not only the relative levels
of these growth regulators, but also by the sensitivity of each cell to perceive different
hormones, individually or in a certain combination.
3. Do Polyamines Impact the Ripening Process of Fruits?
A temporal relationship has been observed between polyamines and ethylene during
plant development - this has led to suggestions that changes in the ratio of polyamines
and ethylene levels influence specific physiological processes in plants [14]. Ethylene
and polyamines share a common intermediate, S-adenosylmethionine (SAM), and a
common byproduct, methylthioadenosine [3, 15, 16]. In vitro studies have shown that
polyamines inhibit ethylene biosynthesis in a variety of fruit and vegetative tissues,
while ethylene suppresses the accumulation of polyamines [17, 18]. Polyamines inhibit
ethylene biosynthesis by suppressing the induction of ACe synthase, which catalyzes
the formation of ACC from SAM, and ACe oxidase, which converts ACC into ethylene
[19]. The inhibition of the ethylene biosynthetic pathway generates a feed back causing
SAM to accumulate which is then channeled into polyamine biosynthesis [20, 21].
Polyamines are generated once the diamines, putrescine and cadaverine, are synthesized
from arginine and lysine, respectively [12]. Then, the aminopropyl group from
decarboxylated SAM, formed from SAM by SAM decarboxylase, is donated to
putrescine to form spermidine, and, in turn, spermidine reacts with another aminopropyl
group from decarboxylated SAM to form spermine. Ethylene-mediated suppression of
polyamine biosynthesis is thought to occur by an inhibition of SAM decarboxylase, a
key enzyme in polyamine biosynthesis. These results have led to the hypothesis that
there is a cross-talk between ethylene biosynthesis and polyamines biosynthesis [22].
The nature of the interrelationships between ethylene and polyamines at both the
physiological and biosynthetical levels still remain to be resolved. Although
polyamines have been implicated in many physiological processes in plants, a definite
389
role for these metabolites in plant metabolism, growth and development has not yet
been demonstrated.
Weare interested in factors that predispose a fruit or leaf to senesce, and the means
by which these factors could be neutralized in a timely manner. Polyamines - putrescine,
spermidine, spermine - accumulate and function during cell division and growth of the
plant, and act as anti-senescence growth factors [12]. On the other hand, ethylene
production in the fruit is induced after growth and cell expansion are completed, which
results in the promotion of the senescence process. Our experiments were designed to
interfere with the ripening process by increasing the production of polyamines during
the senescence phase and test if the fruit can reverse a part or parts of the senescence
process [23], maintain or overaccumulate desirable nutrients, and prolong its shelf-life.
Several approaches have been suggested [24] to elucidate the relationships between
polyamines and ethylene: [1] to monitor the levels of polyamines and ethylene, the
corresponding key enzyme activities, and the metabolic flux of radio labeled
metabolites; [2] to develop and use appropriate genetic mutants that show delayed
senescence or a wide variation in their levels of individual polyamines; and [3] to
produce transgenic plants transformed with antisense gene constructs for the key genes
involved, ACC synthase, spermidine synthase or SAM decarboxylase fused to
regulatable promoters. Our approach of choice to address the role of polyamines in fruit
ripening was to introduce and express a reconstructed polyamine-producing gene in the
fruit following initiation of ripening so that polyamines accumulate at a stage when they
are normally at very low levels [24].
4. Tomato Transformed with Yeast SAM Decarboxylase Accumulate Polyamines

in the Fruit
We genetically transformed tomato plants with a construct of S-adenosylmethionine

decarboxylase (SAMdc), the enzyme that catalyzes the first commited step in polyamine
biosynthesis. SAMdc gene was fused to the developmentally (ripening) and ethylene
regulated E-8 promoter [25] to enable accumulation of polyamines in the fruit only upon
ripening. Analysis of such fruit should reveal if continued accumulation of polyamines
interferes with the expression of ethylene biosynthesis genes and the ethylene receptor
gene family, and thereby result in modulating the ripening process. Such transgenic fruit
can also be used as a model to study the role of polyamines in the ripening/senescence
process. For instance, accumulation of polyamines may change the redox of the cells
due to their property of being anti-oxidative in nature [26] and by their ability to
stabilize cellular membranes [27] polyamines may tilt the balance towards anabolic
from catabolic metabolism [23].
Putative transformants were selected using kanamycin marker selection, and the
tissue grown into seedlings. A number of Ro transformed lines showed growth
aberrations and in some cases seeds did not germinate, when grown under greenhouse
conditions. The number of seeds per fruit in some of the transformed lines varied from
2 to 78 as compared to an average of 89 in the non-transformed wild type. This has also
been observed with genetic transformations using other gene constructs.
390
Fruit from the several transformed lines were analyzed for stable integration of the
gene, polyamine content, soluble solids, color development, and shelf-life. Gene
integration was checked by Southern blotting of polymerase chain reaction (PCR)-
amplified tomato genomic DNA (Fig. 1). It is apparent that each transformant
integrated one or more copies of the SAMdc gene. Final confirmation that the Ro lines,
called SAMDCI, 2,6, 10 and 13, had integrated the heterologous SAM decarboxylase
gene in a functional manner was tested by determining the levels of polyamines,
putrescine (Put), spermidine (Spd) and spermine (Spm) in the fruit of these lines as well
as in the SAMDC15 azygous line and non-transformed wild type. The data in Figure 2
indicate that indeed, in the red ripe fruit of some lines, polyamines did accumulate -
lines 1 and 6 preferentially accumulated Put whereas line 2 predominantly accumulated
Spd, Spm being almost undetectable in lines I, 6 and 10. It remains to be determined
why some lines accumulate high putrescine and others spermidine or spermine since the
individual transformants were created using the same gene.
Segregation analyses of selfed-progeny from three independent transgenic lines
show that the chimeric gene is stably maintained and segregates in a normal Mendelian
manner during the sexual propagation. Ripening fruits from transgenic lines accumulate
polyamines, whereas the red fruit from the wild-type line carried through tissue culture
had little, if any, spermidine and spermine. Fruit from some ofthese transgenic lines
kb
c 1 2 6 o 13
1.2
Figure 1. Southern blotting of PeR-amplified DNA from the indicated lines. Line numbers
represent untransformed control (C) and transgenic ~ lines 1,2,6, 10 and 13
accumulate several-fold higher lycopene, appear to store better, and show delayed
ripening and senescence than the fruit from the wild-type plants. Surprisingly, along
with the accumulation of polyamines, the transgenic tomato fruit consistently produced
more ethylene than the control lines. We are presently testing if this phenotype is a
consequence of silencing of the E8 gene. The trans gene acts as a dominant in one line
and as a quantitative trait in another, both of which show similar phenotypes under
greenhouse and field conditions. We are using these high polyamine- accumulating
lines as models to elucidate the role of polyamines in regulating gene expression,
metabolism, growth and development in plants.
391
put
spd
spm
run 300 -
01
el
9'
FW
200
100
o
c 15 1 2 6 10 13
PLANT #
Figure 2. Levels of polyamines, putrescine (put), spermidine (spm) and spermine (spm) in
untransformed control (C), tissue culture generated WT plant (15), and transgenic Ro lines 1,2,6,
10 and 13.
5. Preferential Induction of NR versus TAE! during Ripening and High

Temperature Stress
We have identified two tomato homologues, eTAEI [28] and TFE27 [29], of the
Arabidopsis ETRI ethylene receptor gene. The primary sequence characteristics of
eTAEI and TFE27 suggest that they belong in the same class of ethylene receptors as
ETRI but different from the Arabidopsis ERS gene-product which does not have a
receiver domain [6, 7]. The Never ripe (NR) gene-product from tomato also lacks a
receiver domain and shares higher sequence identity with the ERS genes than with the
ETRI class.
Northern blot analysis showed that the TABI class of mRNA is constitutively
expressed at fairly constant levels in all examined tissues and organs (stems, leaves,
flower pedicels and abscission zones) and under different developmental stages and
environmental stimuli (fruit ripening, auxin and ethylene treatments, and heat and cold
stress) [28; unpublished]. Where examined, mRNA accumulation for TFE27 was very
similar to that for eTAEl. In addition to eTAEI and TFE27, we used a tomato NR
gene-probe to analyze mRNA accumulation for the NR gene. Accumulation of the NR
gene transcript was considerably more variable. Most notable were changes in NR
mRNA accumulation during fruit maturation, and heat stress at 37C (Fig. 3). Thus,
NR mRNA is differentially expressed in tomato as compared to the generally
constitutive eTAEl. Similar results have been obtained by Lashbrook et al. [30].
392
We have introduced into the tomato eTAEI cDNA the same mutation that confers
dominant ethylene-insensitivity in the etrl-l mutant in Arabidopsis. Chimeric gene
constructs have been prepared where the mutant eTAE I gene was fused to either a
Camv 35S, ubiquitin, or a polygalacturonase abscission-specific promoter. These
constructs were transformed into tomato and the transgenic plants are currently being
examined for any alteration in the abscission process and/or fruit ripening.
6. Acknowledgments
We thank Drs. James D. Anderson and Robert Saftner for a critical review of the
original manuscript.
Tomato Leaves
o 5 15 25 37C
TAE1 -I,
::=====::::;=:
NR-
Figure 3. Preferential induction of NR mRNA in

response to heat stress. Two identical RNA blots
were probed separately with cDNA inserts from
TAE] andNR.
7. References
1. Mattoo, AK. and Suttle, J. (1991) The Plant Hormone Ethylene, CRC Press, Boca Raton, pp. 337.
2. Abeles, F. 8., Morgan, P.W. and Saltveit, M. E. Jr (1992) Ethylene in Plant Biology, Academic
Press, San Diego, pp.414.
3. Fluhr, R. and Mattoo, AK. (1996) Ethylene: biosynthesis and perception, Crit. Rev. Plant Sci.,
B.V. Conger (ed.), CRC Press, Inc., Boca Raton, pp. 479-523.
4. Oeller, P.W., Wong, L.M., Taylor, L.P., Pike, D.A. and Theologis, A (1992) Reversible inhibition
of tomato fruit senescence by antisense l-aminocyclopropane-l-carboxylate synthase, Science 254,
437-439.
5. Picton, S., Barton, S., Bouzayen, M., Hamilton, A and Grierson, D. (1993) Altered fruit ripening
and leaf senescence in tomatoes expressing an antisense ethylene-forming enzyme transgene, Plant
J. 3,469-481.
7. Chang, C., Kwok, S.F., Bleecker, A8. and Meyerowitz E.M. (1993) Arabidopsis ethylene-
response gene ETR]: Similarity of product to two-component regulators, Science 262, 539-545.
8. Wilkinson, J.Q., Lanahan, M.B., Clark, D.G., Bleecker, AB., Chang, C., Meyerowitz, E.M. and
Klee, H.1. (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in
heterologous plants, Nature Biotechnol. 15,444-447.
9. Suttle, J.e. (1991) Ethylene interactions with other endogenous growth substances, in AK. Mattoo
393
and J.C. Suttle (eds.), The Plant Hormone Ethylene, CRC Press, Inc., Boca Raton, pp. 115-131.
10. Clouse, S.D. and Sasse, J.M. (1998) Brassinosteroids: Essential regulators of plant growth and
development, Annu. Rev. Plant Physiol. Plant Mol. Bioi. 49,427-451.
11. Creelman, RA, Tierney, M.L. and Mullet, J.E. (1992) Jasmonic acid/methyl jasmonate
accumulate in wounded soybean hypocotyls and modulate wound gene expression, Proc. Natl.
Acad. Sci. USA 89, 4938-4941.
12. Slocum, RD. and Flores, H.E. (1991) (eds), Biochemistry and Physiology of Polyamines, CRC
Press, Boca Raton, pp. 264.
13. Leslie, C.A. and Romani, R.l (1986) Salicylic acid: A new inhibitor of ethylene biosynthesis,
Plant Cell Reports 5, 144-146.
14. Imaseki, H. (1991) The biochemistry of ethylene biosynthesis, in AK. Mattoo and lC. Suttle
(eds.), The Plant Hormone Ethylene, CRC Press, Inc., Boca Raton, pp. 1-20.
15. Mattoo, AK. and White, B. (991) Regulation of ethylene biosynthesis, in AK. Mattoo and J.C.
Suttle, (eds.), The Plant Hormone Ethylene, CRC Press, Inc, Boca Raton, pp. 21-42.
16. Kende, H. (1993) Ethylene biosynthesis, Annu. Rev. Plant Physiol. Plant Mol. Bioi. 44,283-307.
17. Apelbaum, A, Burgoon, AC., Anderson, J.D., Lieberman, M., Ben-Arie, R. and Mattoo, AK.
(1981) Polyamines inhibit biosynthesis of ethylene in higher plant tissue and protoplasts, Plant
Physiol. 68, 453-456.
18. Suttle, J.C. (1981) Effect ofpolyamines on ethylene production, Phytochemistry 20,1477-1480.
19. Li, N., Parsons, B., Liu, D. and Mattoo, AK. (1992) Accumulation of wound-inducible ACC
synthase transcript in tomato fruit is inhibited by salicylic acid and polyamines, Plant Mol. Bioi.
18,477-87.
20. Even-Chen, Z., Mattoo, AK. and Goren, R (1982) Inhibition of ethylene biosynthesis by
aminoethoxyvinylglycine and by polyamines shunts label from 3,4-e 4C)methionine into
spermidine in aged orange peel discs, Plant Physiol. 69,385-388.
21. Roberts, D.R., Walker, M.A., Thompson, lE. and Dumbroff, E.B. (1984) The effects of inhibitors
of polyamine and ethylene biosynthesis on senescence, ethylene production and polyamine levels
in cut carnation flowers, Plant Cell Physiol. 25, 315-322.
22. Mehta, RA, Handa, A and Mattoo, AK. (1997) Interactions of ethylene and polyarnines in
regulating fruit ripening, in AK. KanelIis et al. (eds.), Biology and Biotechnology of the Plant
23. Mehta, RA and AK. Mattoo (1995) Gene expression and protein dynamics during tomato fruit
ripening, in A Ait-Oubahou and M. EI-Otmani (eds.), Postharvest Physiology. Pathology and
Technologies for Horticultural Commodities: Recent Advances, Institut Agronomique et
Veterinaire Hassan II, Agadir, pp. 343-352.
24. Kushad, M.M. and Dumbroff, E.B. (1991) Metabolic and physiological relationships between the
polyamine and ethylene biosynthetic pathways, in RD. Slocum and H.E. Flores (eds.)
Biochemistry and Physiology ofPolyamines, CRC Press, Boca Raton, pp. 77-92.
25. Deikman, l, Kline, R and Fischer, R.L. (1992) Organization of ripening and ethylene regulatory
regions in a fruit-specific promoter from tomato (Lycopersicon esculentum), Plant Physiol. 100,
2013-2017.
26. Drolet, G., Dumbroff, E.B., Legge, RL. and Thompson, lE. (1986) Radical scavenging properties
of polyarnines, Phytochemistry 25, 367-371.
27. Ben-Arie, R, Lurie, S. and Mattoo, AK. (1982) Temperature-dependent inhibitory effects of
calcium and spermine on ethylene biosynthesis in apple discs correlate with changes in microsomal
membrane microviscosity, Plant Science Lett. 24,239-247.
28. Zhou, D., Kalaitzis, P., Mattoo, AK. and Tucker, M.L. (1996) The mRNA for an ETR1 homologue
1331-1338.
29. Zhou, D., Mattoo, AK. and Tucker, M.L. (I996) Molecular cloning of a tomato cDNA (Accession
n. U4279) encoding an ethylene receptor, Plant Physiol. 110, 1435.
30. Lashbrook, C.C., Tieman, D.M. and Klee, H.J. (1998) Differential regulation of the tomato ETR
gene family throughout plant development, Plant J. 15, 243-252.
UNDERSTANDING THE ROLE OF ETHYLENE IN FRUIT SOFTENING
USING ANTISENSE ACC OXIDASE MELONS
M. GUIS, A. LATCHE, M. BOUZAYEN AND J.C. PECH

ENSA T, Avenue de I'Agrobiopole BP 107, Auzeville Tolosan, 31326
Castanet Tolosan Cedex, France
lK.C. ROSE, K.A. HADFIELD AND A.B. BENNETT
Mann Laboratory, Department of Vegetable Crops, University of
California, Davis, CA 95616, USA
1. Introduction
The softening that occurs during the ripening of many fruits is generally attributed to
the degradation of cell wall components, in particular the pectin and the hemicellusose
polymer matrices. Ethylene is assumed to be involved in regulating the softening
process in climacteric fruit, but its precise role remains unclear. Cantaloupe charentais
melons, exhibit remarkably rapid softening, correlating with substantial cell wall
disintegration and a sharp increase in ethylene production [1]. Transgenic ACC oxidase
antisense fruits synthesizing less than 1% of wild type levels of ethylene undergo
minimal softening [2], however a dramatic loss of flesh firmness can be induced by
application of ethylene [3]. The process of cell wall degradation and the expression of
genes encoding cell wall degrading enzymes have been examined and we describe here
the process of cell wall disassembly in these two types of fruits with particular emphasis
on the pectin matrix.
2. Results
In pectin-enriched cell wall fractions obtained as described in Rose et at. [1], the
apparent molecular size of the polymers declined during ripening of wild type fruits.
Mature antisense ACC oxidase fruits exhibited a profile comparable to that of the pre-
climacteric wild type suggesting that substantial pectin depolymerization did not occur
in these fruits. However treatment of transgenic fruits with 50 ppm ethylene for four
days resulted in a reduction in the average Mw of the pectins that was similar to that
observed in the ripe wild type fruit.
Pectin disassembly may be mediated in part by polygalacturonase (PG). Three melon
cDNA clones with significant homology to other PGs were found to be expressed at
high levels during fruit ripening [4]. In the wild type melon fruits, CmPG 1 and CmPG3
were abundantly transcribed at the peak of ethylene production and at a later ripening
stage, but their mRNA levels were low during the ripening of the antisense ACC
395
396
oxidase fruits. Interestingly CmPG2 expression was detected at an early stage of

ripening, well before the onset of ethylene production and its expression was not
affected by ethylene suppression in the transgenic fruits. Application of ethylene
resulted in an increase in mRNA abundance of all three PG genes.
Wild Type Antisense ACC Oxidase Figure 1. RNA expression pattern for
+ C2H4 three PG cDNAs during ripening of
DAP 363840 4346 36 38 40434648 1d 4d wild type and antisense ACC oxidase
melons fruits. RNA extraction was
CmPG1 performed according to Rose et a1. [I].
Total RNA (l51-1g per lane) isolated
from fruit mesocarps were subjected to
CmPG2 a Northern blot analysis using pMPG I,
pMPG2 and pMPG3 as probes as
CmPG3 described in Hadfield et al. [4]. DAP
stands for Days After Pollination.
3. Conclusion
As with many fleshy fruits, Charentais melons undergo rapid softening during ripening
however genetically engineered fruits producing extremely low levels of ethylene
exhibited minimal softening during ripening on the vine. Transgenic fruits do not show
the substantial changes in pectin molecular mass observed in the wild type. Application
of ethylene to these transgenic fruits induced both the loss of firmness and a downshift
in the size of cell wall polymers. These data and analysis of the expression pattern of
PG genes suggest that ethylene plays an important role in regulating cell wall
disassembly in melon. However, the complex regulation of PG gene expression
underlines the participation of other developmental or environmental signals.
4. References
I. Rose, 1.K.C., Hadfield, K.A, Labavitch, J.M., and Bennett, AB. (1998) Temporal sequence of cell
wall disassembly in rapid ripening melon fruit, Plant Physio1. 117,345-361.
2. Ayub, R, Guis, M., Ben Amor, M., Gillot, L., Roustan, J.P., Latch<!, A, Bouzayen, M., and Pech,
J.C. (1996) Expression of an ACC oxidase antisense gene inhibits ripening of cantaloupe melons
fruits, Nature Biotechn. 14, 862-864.
3. Guis, M., Botondi, R, Ben Amor, M., Ayub, R, Bouzayen, M., Pech; J.e., and Latche, A (1997)
Ripening-associated biochemical traits of Cantaloupe Charentais melons expressing an antisense
ACC oxidase transgene, J. Am. Soc. Hortic. Sci. 122, 748-751.
4. Hadfield, K.A., Rose, J.K.C., Yaver, D.S., Berka, RM., and Bennett, AB. (1998)
Polygalacturonase gene expression in ripe melon fruit supports a role for polygalacturonase in
ripening-associated pectin disassembly, Plant Physiol. 117,363-373.
ETHYLENE BIOSYNTHESIS IN TRANSGENIC AUXIN-OVERPRODUCING
TOMATO PLANTS
J.M. CASTELLANO\ J. CHAMARR02 AND B. VIOQUE I

IInst. de La Grasa, CSIC, PO Box, J078 -4 J0 J2 Seville, Spain. 21nst. de
Bioi. Mol. y Cel. de Plantas (UPV-CSIC), Valencia, Spain
1. Introduction
Indole-3-acetic acid (IAA) stimulates ethylene production in a wide variety of plant

tissues and many of the effects of auxin are now attributed to its ability to induce
ethylene production [1]. Evidence indicates that the enzymes involved in ethylene
biosynthesis are sequentially induced in response to auxin treatment [2,3]. Classical
approaches to understand auxin/ethylene interactions rely on exogenous applications of
the hormone. We have initiated studies using transgenic tomato plants (Lycopersicum
escuLentum Mill, cv. Ailsa craig) engineered with the iaaM gene from Agrobacterium
tumefaciens under the control ofthe nonspecific 35S promoter from CaMV, in order to
study the effects ofIAA overproduction on the ethylene biosynthesis pathway.
During fruit growth and development,

400
ethylene production, ACC and MACC 1.0
contents and ACC oxidase activity are :c 300 +
:<)'
similar in transgenic and wild type fruits, ~ 0.8 ~o

despite the higher levels of IAA in transgenic I
0.6
200

fruits (data not shown). However, the 100 j
increase in ethylene production during the
5 0.4
o 3
first stages of ripening is 2-3 times higher in ~ 0.2 o
-100 8
transformed fruits (Fig. 1). At difference
0.0
with ethylene, the increase in IAA level does 'T--,.----.-,---,--.,-.L... -200
not advance the autocatalytic ethylene rise o 50 100 150 200 250
associated with climacteric. As already Time since colour turning (h)
found in other climacteric fruits, the burst in
ethylene production of control and Figure I. Ethylene production during fruit
transformed fruits is coupled with a rise in ripening.
ACC and MACC contents and in ACC
oxidase activity. In transgenic fruits, the levels of ACC and MACC are higher than in
wild type fruits at all stages of ripening (Fig. 2). The ACC oxidase activity reaches
397
398
similar values in both types of fruits, however in transgenic fruits the activity remains at
a high level even at later stages of ripening (Fig. 3). The overproduction of auxin in
:;;- o Control
15 Transformed
~
tIlM 3
"0
'Oil e
1 10 -;
.s:
.-5
2
~ 5 o"
u
u

0 MG B p R RR
150
Figure 3. In vivo ACO activity in tomato fruits
'Oil
1
during ripening. Ripening stages are designed as
100 in figure 2.
~ 50 Figure 2. ACC and MACC contents in

tomato fruits during ripening. Ripening
stages are designed as MG: mature green;
0
B: breaker; P: pink; R: red; RR: red ripe.
MG B P R RR
transgenic tomato plants, a s in tobacco and Arabidopsis [4], also results in the
overproduction of ethylene. The data presented are in agreement with evidence
indicating that auxin-induced ethylene production is associated with an increase in ACC
synthase and ACC oxidase activities [2, 5, 6], and also with a stimulation of ACC N-
maloniltransferase activity by ethylene [7].
3. References
1. Abeles, F.B., Morgan, P.w. and Salveit, M.E. (1992) Ethylene in Plant Biology, Academic Press,
New York.
2. Peck, S.c. and Kende, H. (1995) Sequential induction of the enzymes of ethylene biosynthesis by
indole-3-acetic acid in etiolated peas, Plant Mol. Bioi. 28,293-301.
3. Peck, S.C. and Kende, H. (1997) Regulation of auxin-induced ethylene biosynthesis in etiolated pea
stems, in A.K. Kanellis, C. Chang, H. Kende and D. Grierson (eds.), Biology and Biotechnology of
the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 31-38.
4. Romano, C.P., Cooper, M.L. and Klee, H.J. (1993) Uncoupling auxin and ethylene effects in
transgenic tobacco and Arabidopsis plants, Plant Cell 5,181-189.
5. Kim, W.T., Silverstone, A., Yip, W.P., Dong, J.G. and Yang, S.F. (1992) Induction of 1-
aminocyc1opropane-I-carboxylate synthase mRNA by auxin in mung bean hypocotyls and cultured
apple shoots, Plant Physiol. 98,465-471.
6. Kim, W.T. and Yang, S.F. {I 994) Structure and expression of cDNAs encoding 1-
aminocyc1opropane-I-carboxylate oxidase homologs isolated from excised mung bean hypocotyls,
Planta 194,223-229.
7. Liu, Y., Su, L.Y. and Yang, S.F. (1985) Ethylene promotes the capability to malonylate 1-
aminocyclopropane-I-carboxylic acid and D-aminoacids in prec1imacterics tomato fruits, Plant
Physiol. 77,891-895.
UNPREDICTABLE PHENOTYPE CHANGE CONNECTED WITH
AGROBACTERIUM TUMEFACIENS MEDIATED TRANSFORMATION OF
NON-RIPENING TOMATO MUTANT
G. BARTOSZEWSKI 1, O. FEDOROWICZ I , S. MALEPSZy l , A.

SMIGOCKf, AND K. NIEMIROWICZ-SZCZYTT 1
IDepartment of Plant Genetics, Breeding and Biotechnology, Warsaw
Agricultural University, Poland; 2 Molecular Plant Pathology USDA,
ARS, Beltsville, MD 20705-2350, USA
1. Introduction
The most characteristic feature of the non-ripening (nor) tomato mutant is the yellow
colour of fruits at the stage of full maturity. These fruits do not synthesise climacteric
ethylene or accumulate Iycopene. The nor gene has been subject to intensive studies
due to its impact on ethylene production. The experiments consisted of the
transformation of the nor mutant in order to improve fruit taste and plant resistance.
Plant material: non-ripening (nor) tomato mutant (seeds were kindly provided to our
department by prof. RW Robinson in 1983 and multiplied in plastic greenhouse).
Binary plasmids: pBIl21 with 35SCaMVlbeta-glucuronidase [I]; pRUR528 constructed
on the basis ofpBI121, containing thaumatin II cDNA instead of gus gene [3], (kindly
provided by M.Szwacka); pHSCKn318 carries isopentenyl transferase gene under heat
shock promoter hsp70, constructed on the basis ofpKLYX7 [2], (kindly provided by A.
Smigocki). AlI plasm ids had the same selective marker gene nptIl.
Ploidy level: was estimated by the flow cytometry method.
Seedling segregation: seeds were tested in vitro on agar medium with 75 mg/I
kanamycin.
3. Results
In the experiments carried out recently the nor mutant was transformed with three
Agrobacterium tumefaciens strains which contained different binary plasmids (pBI121,
pRUR528 and pHSCKn312). In total, 18 transgenic plants were generated (5 for
pBIl21,5 for pRUR528 and 8 for pHSCKn312), three of which produced normally
ripening red fruits. All the other transgenic plants (15 individuals) as well as the plants
399
400
regenerated in vitro as a control had green-yellow fruits, typical of the nor mutant.
Each of the transgenic plants with red fruits was obtained as a separate transgenic event,
incorporating different plasmids. Plants with normally ripening red fruits showed some
other morphological changes. Out of three normally ripening plants one was
characterised by changed ploidy level (4x), which had an effect on leaf morphology,
another one was a typical nor mutant and the third was a chimeric plant. Some sectors
of different organs: leaves, stems and flowers of this chimeric plant were hairless. It
was confIrmed by PCR or Southern-blot that transgene integration took place in the
three normally ripening plants.
The segregation of the progeny of two plants was not corresponding to any
mendelian ratio. In the third case however the ratio was 15: 1 (Chi-Square=O.O 1).
Sensitivity of fruits to ethylene and colour of mature fruit as well as transgene
expression will be the object of further study.
4. Conclusions
These results of the experiments are diffIcult to interpret. There are different possible
reasons for phenotype reversion. It suggests the influence of transformation events on
phenotype reversion of the nor mutant, but other reasons can not be excluded. Further
research is needed to check the stability of nor gene and to identify the reasons of
reversion.
5. Acknowledgements
This work was supported by the Polish State Committee for ScientifIc Research Grant
No. 5P06A025 I 1. Grzegorz Bartoszewski was supported by Fellowship of Foundation
for Polish Science.
6. References
I. Jefferson, R.A. Kavanagh, T.A. and Bevan, M.w. (1987) GUS fusions: f3-glucuronidase as
sensitive and versatile gene fusion marker in higher plants, EMBOJ. 6,3901-3907.
2. Smigocki, AC. (1991) Cytokinin content and tissue distribution in plants transformed by a
reconstructed isopentenyl transferase gene, Plant Mol. BioI. 16, 105-115.
3. Szwacka, M., Burza, W., Palucha, A and Malepszy, S. (1997) Transformacja u ogorka Cucumis
sativus L., Biotechnologia 39, 20-26.
ON CHLOROPLAST INVOLVEMENT AND ETHYLENEINITRIC OXIDE
(NOe) STOICHIOMETRY IN FRUIT MATURATION
Y.Y. LESHEMl, R.B.H. WILLS 2 AND V.V. KU 2

JDepartment of Life Sciences. Bar-Ilan University. Ramat Gan 52900.
Israel. 2Department of Food Technology. University of Newcastle.
Ourimbah, NSW 2258, Australia
1. Abstract
In ripening Citrus species fruits - oranges, grapefruit and Pomelit - it was found that
endogenous NO emission is intricately linked to skin-contained chloroplasts. This
surmise is supported by the observation that illumination of immature green as opposed
to yellow fruit markedly enhanced NO emission. In this respect, the most active tissue
was the flavedo which produced 1.5-3.0 x more NO than the colorless albedo. Mode
of interaction with C2 H4 and relative contribution of flavedo-derived NO to the overall
fruit ripening process are discussed.
2. Introduction
The endogenous synthesis of the free radical gas NO and its putative role in control of
fruit maturation, leaf senescence and environmental stress have been documented earlier
[3, 4]. These reports have provided evidence that mode of NO action in the above
processes is mainly by control of C2H4 emission and that under physiological conditions
and exposure to short term stress, a clear ethylenefNO stoichiometry exists. Moreover,
Leshem, Wills and Ku [5] have shown that a single short term NO fumigation of
various fruits significantly enhanced shelf life of both climacteric and non-climacteric
types in which maturation is ordinarily associated with C2H4 upsurge. The present
research endeavored to shed more light on this mechanism, and in particular, to identify
the sub-cellular location of NO synthesis. In view of applied aspects of the problem,
emphasis was laid on fruit maturation with special attention to Citrus spp.
Mode ofC 2H4 and NO determination in ripening fruits have been detailed elsewhere [2,
4]. Modification of the NO probing procedure was insertion of the probe tip into citrus
flavedo which avoided disruption of the aromatic oil glands. In the experiments whose
401
402
results are presented in Figure 1, illumination source at a 150 /lmol sJ m2 (PAR) light
intensity was from a mixed incandescent and fluorescent source.
3.1. PLANT MATERIAL
Citrus fruit possessing a thick rind with clearly demarcated flavedo and albedo were
considered ideal for the study of locale of NO synthesis. Although Citrus as a group is
not a high ethylene producer, it nevertheless does respond to ethylene regulating
treatment [1]. In order to test an experimental surmise that rind-contained chloroplasts
or chromoplasts may playa key role in NO turnover, it was of interest to compare
essentially glaucous citrus fruits to a species that has green pulp and rind but whose
epidermis is protected from light by a dense mat oftrichomes viz. the litchi.
Figure 1 indicates that, as expected in both the sour orange and kiwi, immature fruits
emit more NO than ripe ones. However, the effect of illumination markedly differs in
the two fruit types. On the one hand, in the green 'bald' immature citrus fruit,
illumination significantly raises rate of NO' emission, while in the ripe yellow/orange
colored fruits where the chloroplasts presumably have converted to chromoplasts, this
increase is not observed: with progress of time this even decreases. On the other hand,
in the kiwi, densely covered with light-obstructing trichomes, besides a slight spike
immediately following illumination, rate of NO synthesis remains constant. These
results strongly suggest involvement of chloroplasts in endogenous NO' evolution.
This contention may be borne out by results presented in Table 1 where it is clearly
seen that the colored chlorophyll-containing flavedo tissue emits 1.5-3.0 x more NO
than the white chlorophyll-lacking tissue. Further support to the experimental
hypothesis that chloroplasts may inherently be linked to NO turnover, is the report that
in Pisum sativum foliage, NO application at deleteriously high concentrations, induces
a marked increase of red fluorescence of chlorophyll, this indicating PSII impairment
[3]. Separate experimentation indicated that in fully mature maximally colored fruits,
the difference between albedo and flavedo NO emission markedly diminishes.
Moreover, we also observed that mature fruit pulp emits NO at levels being
approximately those of the albedo.
5. Conclusions
In ripening Citrus fruit skin, a major but not a sole site of NO production is the
chloroplast. However, since the chlorophyll-lacking albedo and also the fruit's interior
do manifest a certain amount of NO emission, and considering their relative percentage
of the volume of the whole fruit, their overall contribution to the total NO pool may be
as great, if not greater, than of flavedo tissue. An alternative site of NO production in
the still green immature fruit may be the green tissue contained in the vesicles of the
403
pulp segments. Preliminary experiments have shown that this tissue is an active NO
producer, rate of production decreasing with degree of ripeness.
Be this as it may, NO participation in the peel de-greening process may have its
commercially positive or negative aspects and, by exogenous application, provide a
means for its regulation.
% ,
, '" ,,'
;;:..::;; immature fruit
=
, '"
rip. fruit
250
,'""
....--- ,"
Isemi-shade I I
...> ...''""
U u [ illuminated
-e
~ U
::s ....u'"
...::s
::s ,.. 200
,,"'v'
,,"
,,
CJ
'-" ...
.;
,; .;'
....=
"
0 .:::
"
.... "'9u
"-I
"-I
e u
I
U
.:: 150
"
.3
z u...
min
Figure 1. Fruit rind color and NO. Effect ofiIlumination on NO emission in ripening sour
orange (c. auranthium) and kiwi (Actinidia chinesis) fruit. Five replicate means. standard
deviations were <12% of given values. Arrows indicate commencement of illumination.
TABLE 1. Comparison of NO emission (x20 I1M.min.gr fresh wt tissue) in flavedo and

albedo in peel of various Citrus species. Five replicate means. Comparative values ..
Type of skin tissue

Tested species
Flavedo Albedo
Grapefruit (C. paradisi cv Ruby) 211 100

Pomelit (C. paradisi x C. maxima cv Goliath) 160 100
Orange (c. sinensis - cv Valencia) 280 100
Standard deviations did not exceed 15% of presented values.

404
6. References
1. Goldschmidt, E.E., Goren, R, and Huberman, M. (1993) Probing the role of endogenous ethylene
in the degreening of citrus fruit with ethylene antagonists, Plant Growth Regul. 12,35-39.
2. Leshem, Y.Y. and Haramaty, E. (1996) The characterisation and contrasting effects of the nitric
oxide free radical in vegetable stress and senescence of Pisum sativum Linn. foliage, 1. Plant
Physiol. 148,258-263.
3. Leshem, Y.Y., Hararnaty, E., I1uz, D., Malik, Z., Sofer, Y., Roitrnan, Z., and Leshem, Y. (1997)
Effect of stress nitric oxide (NO): Interaction between chlorophyll fluorescence, galactolipid
fluidity and Jipoxygenase activity, Plant Physiol. Biochem. 35,573-579.
4. Leshem, Y.Y. and Wills, RB.H. (1998) Harnessing senescence delaying gases nitric oxide and
nitrous oxide: a novel approach to postharvest control of fresh horticultural produce, BioI. Plant.
41,1-10.
5. Leshem, Y.Y., Wills, RB.H., and Ku, V.V. (1998) Evidence for the function of the free radical gas
- nitric oxide (NO ) - as an endogenous maturation and senescence regulating factor in higher
plants, Plant Physiol. Biochem. (in press).
ETHYLENE DELAYS ONSET OF WOOLLY BREAKDOWN IN COLD-
STORED PEACHES
L. SONEGO, A. LERS, A. KHALCHITSKI, Y. ZUTKHI, H. ZHOU, S.

LURIE AND R. BEN-ARIE
Department of Postharvest Science, ARO - The Volcani Center, Bet-
Dagan, 50250, Israel
1. Abstract
'Hermosa' peaches were stored at OC in a flow through system, which supplied

ethylene in air at concentrations of 0, I, 10 or 100 /ll.rl. Fruit were examined during 6
weeks' storage upon removal from OC and after 5 days at 20e. The onset of woolly
breakdown (WB) was delayed and its severity reduced with exposure to IoriO /l1.1- 1
ethylene. Fruit softening was not significantly affected by ethylene treatment.
Polygalacturonase (PG) activity, which was undetectable in control fruit during storage
at OC, was induced by ethylene at DoC and enhanced 5-10 fold after transfer to 20C.
However, PG protein content was unaffected by ethylene treatment. Pectin-methyl-
esterase (PME) content and activity, which increased during cold storage, were not
affected by ethylene treatment. The RNA messages for both pectic enzymes were
detected at all stages of storage and ripening, but were unaffected by ethylene treatment,
as were the messages for ACC synthase and ACC oxidase.
2. Introduction
Woolly breakdown (WB) of peaches and nectarines is a chilling disorder, which

generally develops in susceptible cultivars during shelf-life following 2-3 weeks in cold
storage [8]. Development of the disorder has been attributed to the abnormal
solubilization of cell wall pectins [5], resulting from an imbalance in the activities of PG
and PME which is caused by prolonged exposure to low temperatures [I]. Storage
techniques that have been shown to delay the onset of WB are delayed storage,
intermittent warming and controlled atmosphere with relatively high CO 2 levels [8].
The effectiveness of these techniques appears to be related to their ability to correct the
imbalance in enzyme activity: the first two enable enhanced PG activity during storage
[2] and the third causes inhibition of PME activity [3].
PG mRNA, PG protein and PG activity were all undetectable in nectarines harvested
at the commercial stage of maturity appropriate for cold storage, but were expressed as
the fruit ripened at 20C following harvest (Lurie, unpublished data). In transgenic
tomatoes that are incapable of ethylene synthesis, PG was produced following exposure
405
406
to exogenous ethylene [12]. The production of ethylene by pre climacteric peaches is

extremely low [13]. We have therefore examined the possibility of increasing PG
activity in cold-stored peaches by applying exogenous ethylene, with the intent of
increasing pectin solubility and inhibiting the development of WB. We show that
although ethylene does indeed induce and enhance PG activity, the control of WB is
limited.
3.1. FRUIT SAMPLING AND STORAGE TREATMENTS
Peaches (Prunus persica L. cv. Hermosa) were harvested from a commercial orchard, at
a preclimacteric stage of maturity, and divided into 5 batches - 4 for storage treatments
and one for assessments at harvest and after 5 days ripening at 20C. The fruit was
stored at OC in air tight barrels through which humidified air streams containing 0, I,
10 or 100 IlLrI ethylene passed at a flow rate of 100 ml.min- I . Samples of 20 fruit were
taken from each barrel after 21, 29 and 41 days' storage. Ten fruit were assessed
immediately and 10 were transferred to 200 C for 5 days and then assessed.
3.2. FRUIT ASSESSMENTS AND ENZYME ANALYSIS
Fruit firmness was determined on the opposite pared cheeks of each fruit with a Hunter-
Spring firmness tester, using an 11 mm tip. The development of WB was evaluated
visually on halved fruit as follows: 0 - none, 1- < 25%, 2- 25-50%,3 - 50-75%, 4 > 75%
of the cut surface. Three representative fruits from each sample were chosen for
enzyme analysis. Peeled flesh (40g) from each of these fruits was frozen ,extracted for
PG and PME and assayed as previously described (1). Boiled samples were assayed as
blanks for each determination of enzyme activity. Protein content was determined
according to [4]. A unit of PME activity was defined as a milliequivalent of carboxyl
groups released, per mg protein during one hour. A unit of PG activity was defined as 1
nmol of galacturonic acid released per mg protein during 1 hour.
3.3. RNA EXTRACTION AND NORTHERN BLOT ANALYSES
Total RNA was extracted from one g of freeze-dried peach tissue as described [9].
RNA blots were prepared and hybridized [II] and washed in 0.5 X SSC, 0.1% SDS at
60C. Probes included peach cDNAs of polygalacturonase (PG) [7], pectin esterase
(PE) and ACC synthase (ACS), and the tomato ACC oxidase (ACO) cDNA - generous
gifts of Drs. D. R. Lester, J. Speirs, P. Tonutti, and D. Grierson, respectively.
3.4. PROTEIN EXTRACTION AND WESTERN BLOTTING
Protein was extracted from freeze dried tissue (0.5 g) by grinding in liquid N 2 ,
extracting with Tris-buffered phenol and precipitating with ammonium acetate in
methanol (6). The final pellet was suspended in Laemmli sample buffer and the protein
407
content was determined by the Bio-Rad microassay procedure. For Western blotting,
equal amounts (15)lg) of protein were separated on a 12% SDS/acrylamide gel,
transferred to a nitrocellulose filter and incubated with the primary antibody.
Visualization of the antibody was by the alkaline phosphatase reaction. The antibodies
for PG and PME were kindly supplied by Dr. J. Spiers (CSIRO, Adelaide, Australia).
4. Results
4.1. FRUIT QUALITY
Ethylene application to 'Hermosa' peaches during cold storage, at concentrations up to

100 )lu-1, did not induce any significant fruit softening during 6 weeks' storage (data
not shown). The fruit from all treatments softened to eating ripeness after cold storage,
within 5 days at 20C, with the exception of untreated control fruit after 6 weeks'
storage, which softened only to 50% of its initial value. This inhibition of softening
indicated the woolly texture of the fruit flesh (2) and did not occur in any of the
ethylene treated fruits. The onset of WB after storage was delayed by exposure to
ethylene during storage (Table 1), but after 6 weeks' storage there were no significant
differences in the visible incidence ofWB.
TABLE 1. The effect of ethylene during storage on the development of woolly

breakdown (WB) during subsequent shelf-life at 20De.
Days in storage Ethylene concentration (Ill.l-I)

o I 10 100
29 1.60 b . 0.67 c 0.67 c 0.90bc
41 3.60 a 3.48 a 3.13 a 3.39 a
a-c numbers with different letters differ significantly at p~0.05
4.2. ENZYME ACTIVITY
PME activity in fruits from all treatments increased during cold storage, as previously
shown [1], but decreased during shelf life (data not shown), except after the last
removal from storage, without any significant differences between the treatments until
the last shelf-life period (Table 2). At this time, PME activity continued to increase in
the control fruit, whereas it remained at the same level as upon removal from storage, in
fruit that had been exposed to ethylene.
There was very little PG activity in the fruit at harvest but it increased considerably
during 5 days' shelf-life (Table 3). Even higher values of activity were attained during
shelf-life after 21 days' storage at OCC, although there had been no measurable activity
upon removal from storage. The first significant effect of ethylene on PG activity was
observed after 29 days' cold storage. Upon removal from storage there was still no
activity in control fruit, whereas it increased significantly in treated fruit with each
increment in ethylene concentration. A low activity developed in control fruit during
shelf-life, but in the ethylene-treated fruit it was 5 fold higher, reaching a level similar
to that measured after harvest, irrespective of the level of ethylene applied during cold
408
storage. After 2 additional weeks in storage, PG activity upon removal from storage
was undetectable for all treatments, except 100 Ill.l-l, but during shelf-life activity
increased and, although levels were low, the enzyme was about 10 times more active in
the ethylene-treated fruit than in the untreated control.
TABLE 2. The effect of ethylene application to Hermosa peaches

during storage on the activity of pectin methylesterase (units x 10.3)
after 6 weeks at OC and 5 days at 20C.
Ethylene concentration (~Jl.I.J)

o I 10 100
Storage 0.67b 0.64 b 0.69 b 0.62b
Shelf-life 0.96 a 0.70 b 0.61 b 0.81 ab
a-b numbers with different letters differ significantly at p:S0.05
4.3. EN.lYME CONTENT
The amount of PME protein did not appear to change significantly after harvest,
whatever the storage temperature or ethylene content of the storage atmosphere (Fig. 1).
PG protein, which was undetectable at harvest, accumulated during shelf-life and
storage, but was also unaffected by ethylene treatments.
TABLE 3. The effect of applied ethylene during cold storage on PG activity (units per mg protein) in
Hermosa peaches upon removal from OC and following 5 days at 20C.
41 5 26 34 46
o 0.12 0.00 0.00 d 0.00 5.39 8.09 0.94 b 0.16 b
1 0.00 0.13 c 0.00 6.95 5.22 a 1.36 a
10 0.00 0.18 b 0.00 7.79 5.92 a 1.81 a
100 O.oI 0.25 a 0.20 7.18 5.87 a 1.62 a
N.S. N.S. N.S.
a-d numbers with different letters within a column differ significantly at p:S0.05.
N.S no significant differences at. p:S0.05.
4.4. MESSENGER RNA
The mRNAs of the pectic enzymes behaved similarly in all treatments, but were
differentially affected by storage and shelf-life (Fig. 2). The PME message tended to
decrease as storage progressed, but accumulated somewhat during shelf-life relative to
the storage level. The PG message was detected at harvest and throughout storage, but
was always much stronger during shelf-life. Similarly, messages of both the genes
involved in ethylene synthesis, ACC synthase and ACC oxidase, were unaffected by
ethylene treatment, but were greatly enhanced during shelf-life.
409
Ethylene -++-
02
Ethylene + + + + PG
02 29d 41d
- 5d 5d
Ii PE
202 -5d - - 5d 5d -
ACS
ACO
Figure 1. Western blots of PO and PME protein extracted from Figure 2. Changes in mRNA level of
control fruits and from fruit treated with I f.l1.l- 1 ethylene during genes involved in cell wall
storage at OC and following subsequent shelf-life at 20e. degradation and ethylene biosynthesis
following ethylene treatment during
storage.
5. Discussion
Although the peach is a climacteric fruit, it is considered relatively insensitive to

exogenous ethylene application, in that even concentrations of 100-500 J..lLrl do not
always accelerate the rate of ripening at 20C [8]. Our data support this view with
regard to fruit softening. Nonetheless, applied ethylene enhanced PG activity in fruit
stored at ooe at a level as low as 1 J..lLrl. The fact that fruit softening during storage
was unaffected by ethylene treatment, even though PG activity was enhanced, is in
agreement with the suggestion that PG is not the sole enzyme involved in fruit softening
[10]. The connection between PG activity and development of WB [1-3] is more
difficult to support from these data. After 4 weeks' storage, WB development during
shelf-life was significantly reduced by ethylene application at 1 and 10 J..lLrl, but not so
at 100 J..ll.r 1, where the enhancement of PG activity was greatest during storage.
Moreover, after 6 weeks at oDe, when WB incidence was very high, no control was
achieved due to ethylene treatment, even though PG activity in the treated fruit was still
significantly higher than in the control. The negative results after 6 weeks' storage may
be explained on the basis of the balance between PG and PME activities. Although PG
activity was enhanced by ethylene treatment, it did not reach the postharvest levels
measured in normally ripened fruit after harvest, whereas PME activity was
significantly higher upon removal from storage than at harvest, and even increased
during shelf-life. However, even if this explanation may appear to be in accordance
with our equilibrium theory [2], it does not adequately support the data obtained for
exposure to 100 J..ll.r 1 ethylene after 4 weeks storage. It should be possible to clarify
this point by applying ethylene to fruit stored in a controlled atmosphere with high CO 2 ,
which has been shown to inhibit PME activity [3].
410
The increase in PG activity, induced by exposure to ethylene, was not a result of

induced message or enhanced protein abundance. Moreover, the PG message, which
was present in harvested fruit was not expressed at this time or during subsequent cold
storage. These findings are possible indications of a preharvest inhibitory effect or
suppression of the translation of the message, which is overcome during the ripening
process and can be relieved by applying ethylene, even at oDe. The enhancing effect of
ethylene on PG activity without concurrently affecting PME activity, supports the
suggestion that ethylene may alleviate WB, without completely controlling it.
6. References
I. Ben-Arie, R and Sonego, L. (1980) Pectolytic enzyme activity involved in woolly breakdown of
stored peaches, Phytochemistry 19, 2553-2555.
2. Ben-Arie, R, Sonego, L., Zeidman, M. and Lurie S. (1989) Cell wall changes in ripening peaches,
in D.J. Osborne and M.B. Jackson (eds.), Cell Separation in Plants, NATO AS) series, vol H35,
Springier-Verlag Berlin, pp. 253-262.
3. Ben-Arie, R., Sonego, L., Levin, A. and Lurie, S. (1993) Pectin metabolism in CA-stored
nectarines, Proceedingsfrom the Sixth International Controlled Atmosphere Research Coriference,
Cornell University, Ithaca New York, voL): II (Abstr.)
4. Bradford, M. (1976) A rapid and sensitive method for the quantification of microgram quantities of
protein utilizing the principle of protein-dye binding, Anal. Biochem. 72,248-254.
5. Dawson D.M., Melton L.D. and Watkins C.B. (1992) Cell wall changes in nectarines (Prunus
persica): solubilization and depolymerization of pectic and neutral polymers during ripening and in
mealy fruits, Plant Physiol. 100, 1203-1210.
6. Hurkrnan, W. J. and Tanaka, C. K. (1986) - Solubilization of plant membrane proteins for analysis
by two-dimensional gel electrophoresis, Plant Physiol. 81, 802-806.
7. Lester D.R, Speirs J., Glenda O. and Brady, C.J. (1994) Peach (Prunus persica)
endopolygalacturonase cDNA isolation and mRNA analysis in melting and non-melting peach
cultivars, Plant Physiol. 105,225-231.
8. Lill RE., O'Donoghue E.M. and King lA. (1989) Postharvest physiology of peaches and
nectarines, Hort. Review 11,413-452.
9. Lopez-Gomez R and Gomez-Lim M.A (1992) A method for extracting intact RNA from fruits
rich in polysaccharides using ripe mango mesocarp, HortScience 27, 440-442.
10. Oeller P.W., Wong L.M., Taylor L.P., Pike D. and Theologis A. (1991) Reversible inhibition of
tomato fruit senescence by antisense I-aminocyclopropane I-carboxylate synthase, Science 254,
437-439.
II. Sambrook J., Fritsch E.F. and Maniatis T. (1989) Molecular Cloning, Cold Spring Harbor
Laboratory Press, CSH.
12. Theologis A., Oeller P.W., Wong L.M., Rottman W.H. and Gantz D.M. (1993) Use of a tomato
mutant constructed with reverse genetics to study fruit ripening, a complex development process,
Dev. Gen. 14,282-295.
13. Tonutti P., Bonghi C. and Ramina A. (1996) Fruit firmness and ethylene biosynthesis in three
cultivars of peach (Prunuspersica L. Batsch), J Hor Sci. 71, 141-147.
ETHYLENE REMOVAL BY PEAT-SOIL AND BACTERIA: ASPECTS FOR
APPLICATION IN HORTICULTURE
L. ELSGAARD
Department of Crop Physiology and Soil Science, Danish Institute of
Agricultural Sciences, Foulum, DK-8830 Tjele, Denmark
1. Abstract
The plant hormone ethylene (C 2H 4) may cause an undesirable ripening and senescence
of horticultural produce when it accumulates in transport or storage facilities.
Therefore, the use of biological catalysts for ethylene removal has recently been tested.
It has been found that growing media for potted plants (peat-soil) may consume
ethylene, but only after an initial adaptation period. The present data show that the soil
water content (2.4 to 4.7 mL g.l dry wt soil) only plays a minor role for this
characteristic. Ethylene consumption in peat-soil can be enhanced, however, by plant
growth or the addition of ethylene-oxidizing bacteria. In experiments with Begonia
elatior 'Nielson' the effect of such ethylene consumption has been tested during
conditions of transport simulation (i.e., ethylene exposure in darkness). Although an
enhanced ethylene removal was demonstrated, no effects on the plant quality occurred.
Thus, the ethylene consumption was insufficient to reduce the ethylene concentration (1
ppm) to levels near the threshold limit for the action of ethylene as a plant hormone (ca.
0.01 ppm). While the consumption of ethylene may be insufficient when a passive
scrubber system is applied, the removal of ethylene to extremely low levels is possible
by application of a biofilter with ethylene-oxidizing bacteria. By use of a peat-soil
biofilter with the bacterial strain RD-4, it was possible to remove ethylene from 2 and
117 ppm to levels as low as 0.017 ppm. These results, as well as results from other
biofilters, demonstrate the potential for biological removal of ethylene during storage
and transport of horticultural produce.
2. Introduction
Accumulation of the plant hOimone ethylene may occur during storage of fruits,
vegetables and flowers in closed facilities due to endogenous production by the plant
material [1,22]. To prevent the physiological effect of such ethylene on horticultural
produce (e.g., ripening, abscission and senescence), various procedures have been
applied, for example spraying with silver thiosulfate [5, 6], or use of gaseous ethylene
antagonists, such as 1-methylcyclopropene [28], nitrous oxide [18], or carbon dioxide
[30]. Also, it is common practice in many storage facilities and transport containers to
411
412
reduce the ethylene concentrations by use of ventilation systems [23, 26]. The use of
ventilation may be unsuitable, however, if the temperature or chemical composition of
the open air is different from the atmosphere required for the storage purpose.
Concequently, chemical ethylene scrubbers (ethylene removing devices) are widely
used in storage facilities for horticultural produce [23, 26, 29]. A drawback of such
scrubbers are the cost of operation and the need for replenishment of the ethylene
removing agents [1, 11, 29]. Therefore, the use of biological catalysts for ethylene
removal is an interesting alternative [20,29].
Peat-soil, which is an important medium for plant growth in horticulture [27], has
previously been shown to have a potential for microbial consumption of ethylene - at
least after an adaptation period of several days [12]. Given the sufficiently high
ethylene consumption in the soil of potted plants, this process itself could have the
potential to reduce the ethylene concentration during storage and transport of potted
plants. Notably, for plant-damaging ethylene produced in the soil environment [2, 16],
a beneficial effect of stimulated ethylene consumption in the plant soil could be
envisaged. However, as a more direct approach of ethylene removal, a biofilter based
on ethylene-consuming peat-soil could be applied in horticultural storage facilities
provided that the efficiency of ethylene removal was adequate and stable. The use of
ethylene-oxidizing bacteria (e.g., Mycobacterium E3) in biofilters has been reported [7,
8, 9, 13, 32, 33], but only a few studies have demonstrated a removal of ethylene to
levels near the threshold limit for the plant hormonal response.
In order to improve the ethylene consumption in horticultural peat-soil, an ethylene-
oxidizing bacterium (strain RD-4) was recently isolated and applied to the soil as a
concentrated bacterial suspension [13, IS]. This bioaugmentation was performed for
the pot-soil of Begonia and a peat-soil biofilter. The Begonia were subjected to
transport simulation in the presence of ethylene, while the biofilter was operated as an
ethylene waste gas purification system. Here the results of these recent studies [13, IS]
are surveyed and discussed with respect to their relevance for horticulture. In addition,
new data are presented, which demonstrate the characteristics of microbial ethylene
consumption in peat-soil under different soil water conditions that may occur during the
cultivation of potted plants.
3. Ethylene Removal in Peat-soil
Fresh horticultural peat-soil that is incubated with ethylene has been shown to
develop a microbial capacity for ethylene removal [12]. In samples of peat-soil from
potted plants, this ethylene consumption was even more pronounced [14], probably as a
result of microbial stimulation during plant cultivation (cf. [25]). Also, microbial
ethy lene consumption has been observed in other growing media [31].
One of the factors that affects microbial activity, and which may vary during the
cultivation of potted plants, is the soil water content [19, 24]. To assess the importance
of this factor on the microbial ethylene consumption, a time course experiment was
made with horticultural peat-soil (Sphagnum Blend 2, Pindstrup, Denmark). Peat-soil
(16 g fresh wt; ca. 7 g dry wt), representing a volume of ca. 60 mL, was mixed with
distilled water (8, 16 and 24 mL) and incubated at 20 0 e in 120-mL bottles closed by
413
butyl rubber stoppers. Ethylene was added to headspace concentrations of ca. 70 ppm,
and ethylene depletion in triplicate incubations was followed by GC analysis [15] of
withdrawn gas samples (0.6 mL).
80
60
Ec..
S
Q)
cQ) 40
>.
.s::
ill 20
0'--"'--_...J.-_--'-......--'--4111-'
o 6 12 18 24 30
Time (days)
Figure 1. Time course of ethylene removal in fresh peat-soil

with water contents of (II) 2.4, (....) 3.6 or (e) 4.7 mL per g dry
wtsoil.
TABLE 1. Adaptation period and ethylene consumption rate in peat-soil with

different water contents. Data are mean standard deviation of three time
course experiments. Means followed by different letters (in parentheses) are
significantly different at p=O.OS (Tukey test [3S]).
Water content Adaptation period Consumption rate

(mL.gol dry wt soil) (days) (ppm dayOI)
2.4 18.3 0.4 (a) 8.S 0.9 (b)

3.6 14.2 0.6 (b) 11.1 1.1 (a)
4.7 19.0 1.1 (a) 9.8 0.3 (a,b)
"Defined as the time when 10% of the added ethylene was consumed.
~stimated by linear regression of data following the adaptation period.
Consumption of ethylene commenced after an adaptation period of more than 14

days (Fig. 1). It was found that the intermediate water content of3.6 mL.go! dry wt soil
(equivalent to ca. 40% of the total soil volume) resulted in a shorter adaptation period
and a higher resulting rate of ethylene consumption than the water contents of 2.4 and
4.7 mL.go! dry wt soil (Table 1). However, although the effects of different water
contents were statistically significant, the results deviated by no more than a factor of
414
1.3. It was concluded, therefore, that the water contents usually recommended for
potted plants [24] proved to be suitable for microbial ethylene consumption.
The present data illustrate the long adaptation periods that are generally found for
ethylene consumption in fresh peat-soil [12]. In contrast, ethylene consumption in peat-
soil from potted Begonia [14, IS] and Hibiscus (unpublished data), occurs after a short
(less than 2 days) adaptation period. Hence, the precedent plant growth may result in a
stimulation of the ethylene-consuming soil microorganisms, which largely exceeds the
effects of different soil water conditions in the peat-soil. It is likely that the plant soil
has a higher activity of ethylene-oxidizing microorganisms in response to previous
exposure to ethylene liberated by plant roots or by heterotrophic microorganisms
stimulated by the rhizosphere environment [3, 4]. Yet, although stimulation of ethylene
consumption may occur during plant cultivation, it has been found that bioaugmentation
with ethylene-oxidizing bacteria may further stimulate and improve the ethylene
removal in peat-soil from potted plants [14, 15].
4. Ethylene Removal during Transport Simulation
Transport simulation of potted plants is used to assess the ethylene sensitivity of various
plant species [21, 34]. However, with a sufficient (stimulated) capacity of ethylene
consumption, the plant soil of the tested plants could contribute to a reduction in the
applied ethylene level during transport simulation. This hypothesis was tested by
Elsgaard and Andersen [15]. Briefly, the pot soil of 12 Begonia (from a commercial
grower) were watered (inoculated) with a 25-mL suspension of ethylene-oxidizing
bacteria (strain RD-4) while 12 other plants were watered with 25 mL of tap water
(uninoculated plants). Transport simulation (4 days) actuated for 4 boxes (410 L) with
either 6 inoculated or 6 uninoculated Begonia. The boxes were exposed to airflow with
I ppm ethylene (ca. 164 L.h-') and gas samples (1 mL) for ethylene analysis were
collected at the inlet and the outlet of each box. After 4 days of transport simulation,
significant ethylene consumption (8 to 11%) occurred in the boxes with inoculated
plants, but also in one box with uninoculated plants (9%). In the other box with
uninoculated plants the ethylene consumption was not significant (3%). The average
ethylene consumption in boxes with inoculated plants was ca. 16.4 ilL C2f4.h-' while it
was ca. 9.8 ilL C2f4.h-' in boxes with uninoculated plants. Thus, the overall tendency
was that the bacterial inoculation gave the plant soil a higher capacity of ethylene
removal as would indeed be expected. However, the keeping quality of the Begonia
was generally not affected by the enhanced capacity of ethylene removal [IS]. In
comparison, it has been reported that Begonia are sensitive to ethylene exposure with
quality loss occurring after treatment with only 0.05 ppm ethylene for 3 days [21]. One
reason for the insufficiency of the ethylene removal was the constantly high flow rate
(164 L.h-'), which prevented an accumulative effect of the microbial ethylene
consumption. Thus, if the transport simulation had been performed under conditions
with a non-renewed ethylene atmosphere [17, 34], the ethylene consumption might have
resulted in a significantly lower ethylene concentration with possible impact on the
plant quality.
415
S. Ethylene Removal by Biofilters
Gas removal by biological filters has been reported for several air pollutants including
ethylene [7, 8, 9, 10, 13, 17, 32, 33]. The data in Table 2 illustrate the various outlet
concentrations of ethylene that have been reported for a given inlet concentration in
different filters. It should be stressed, however, that a direct comparison of the
performance of different filters is difficult, or even impossible, unless they have been
operated under exactly the same conditions (i.e., inlet concentration and volume-to-flow
ratio).
TABLE 2. Characteristics of different filters for biological ethylene removal.
Ref. Carrier Bacteria InletC,H, Outlet C,H, Stability"

(ppm) (ppm)
[33] Lava Mycobact. E3 3.2 0.06b Not stable

[33] Perlite Mycobact. E3 3.2 0.27b Not stable
[32] Compost Mycobact. E3 2 0.27c Stable
[8] PUP! Mycobact. E3 122 91.5" No data
[7] GAC f Mycobact. E3 127 19.2& Stable
[13] Peat-soil Strain RD-4 2.05 0.02 Stable
[13] Peatsoil Strain RD-4 117 <0.04 Stable
"Defined as a stable outlet concentration for more than ca. 5 days
bRead from Fig. 3 in [33]
cRead from Fig. 2 in [32]
dPolyurethane foam
cCalculated from the cited removal efficiency of25% [8]
fGranular activated carbon
&Calculated from the cited removal efficiency of 84.9% [7]
As shown in Table 2, the lowest stable outlet concentrations [13,33] are close to the
threshold limit for the action of ethylene as a plant hormone (ca. 0.01 ppm). In the
study of Elsgaard [13], a biofilter was packed (687 cm3 ) with inoculated peat-soil,
prepared by mixing 300 g of peat-soil with 200 mL of distilled water and 100 mL of
bacterial cell suspension (strain RD-4). Ethylene (2.05 ppm) in humid air was applied
to the biofilter at a rate of 73 mL min-I. After operating for 1 h, the biofilter outlet
concentration was 0.23 ppm. This corresponded to a removal efficiency of 89%.
During 16 days of operation (21C), the capacity of ethylene removal gradually
improved and increased to 99% of the incoming concentration. Thus, at the end of the
experiment the biofilter had a stable performance with an outlet concentration of only
0.017 to 0.020 ppm ethylene. When the inlet ethylene level was increased to 117 ppm,
the ethylene concentration at the outlet of the biofilter was below 0.04 ppm after 4 days
of operation. Thus, more than 99.9% of the incoming ethylene was removed by the
biofilter and this performance was stable during operation for more than 75 days. When
the biofilter (operated with 117 ppm ethylene) was transferred from 21 to lOoC, the
416
outlet ethylene concentration increased from <0.04 ppm to 46.6 ppm. However, after 2
days of operation at 10C, the outlet concentration started to decrease and after 18 days
the outlet concentration was 1.6 ppm ethylene, which was equivalent to a removal
efficiency of 98.6% [13]. This indicated that a proliferation of the ethylene-oxidizing
bacteria still occurred at 10C. This observation was encouraging for the practical use
of the isolated bacteria as ethylene scrubbers during storage of horticultural produce,
which is often kept at temperatures below 10C. However, a more detailed study of the
temperature response of the strain RD-4 should be performed before this suitability can
be properly evaluated.
No experiments have been reported, so far, where the performance of ethylene
removing biofilters has been tested under in situ conditions during storage and transport
of horticultural produce. However, given the potential and qualified performance of
various biofilters (Table 2) such experiments should be encouraged.
6. Conclusions
Ethylene can be consumed by peat-soil for horticultural practice. Plant growth in the
peat-soil, or the addition of ethylene-oxidizing bacteria, may enhance this capacity.
Yet, it is not clear whether such ethylene removal may have a beneficial effect on potted
plants in terms of maintaining low ethylene levels in the atmosphere or soil-air. By use
of biofilters with ethylene-oxidizing bacteria, ethylene can be removed to very low
levels (near 0.01 ppm). Experiments designed to test the use of such biofilters ill
storage facilities for horticultural produce are lacking, and should be encouraged.
7. References
I. Abeles, F.B., Morgan, P.W. and Saltweit, M.E. (1992) Ethylene in Plant Biology, 2nd ed.,
2. Arshad, M. and Frankenberger, W.T. (1988) Influence of ethylene produced by soil microorganisms
on etiolated pea seedlings, Appl. Environ. Microbial. 54, 2728-2732.
3. Arshad, M. and Frankenberger, W.T. (1991) Microbial production of plant hormones, Plant Soil
133, 1-8.
4. Arshad, M. and Frankenberger, W. T. (1998) Plant growth-regulating substances in the rhizosphere:
microbial production and functions, Adv. Agron. 62, 45-151.
5. Cameron, AC. and Reid, M.S. (1981) The use of silver thiosulfate anionic complex as a foliar spray
to prevent flower abscission ofzygocactus, HortScience 16, 761-762.
6. Cameron, AC. and Reid, M.S. (1983) Use of silver thiosulfate to prevent flower abscission from
potted plants, Scientia Hortic. 19,373-378.
7. De Heyder, B., Overmeire, A, Van Langenhove, H. and Verstraete, W. (1994) Ethene removal
from a synthetic waste gas using a dry biobed, Biotechn. Bioengin. 44, 642-648.
8. De Heyder, B., Smet, E., Verstraete, W. and Van Langenhove, H. (1992) Biotechnological removal
of ethene from waste gases, in AJ. Dragt and 1. Van Ham (eds.), Biotechniques for Air Pollution
Abatement and Odour Control PoliCies, Elsevier, Amsterdam, pp. 309-313.
9. De Heyder, B., Van Elst, T., Van Langenhove, H. and Verstraete, W. (1997) Enhancement of
ethene removal from waste gas by stimulating nitrification, Biodegradation 8, 21-30.
10. Dragt, A J. and Van Ham, J., (eds.) (1992) Biotechniquesfor Air Pollution Abatement and Odour
Control Policies, Elsevier, Amsterdam.
11. EI Blindi, A, Rigal, L., Malmary, G., Molinier, J. and Torres, L. (1993) Ethylene removal for long
term conservation of fruits and vegetables, Food Quality and Preference 4, 119-126.
417
12. E1sgaard, L. (1996) Ethylene degradation in peat-soil for horticultural practice, Abstracts of the
NATO Advanced Research Workshop on Biology and Biotechnology of the Plant Hormone
Ethylene, Chania, Greece, p. 97.
13. Elsgaard, L. (1998) Ethylene removal by a biofilter with immobilized bacteria, Appl. Environ.
Microbiol. (in press).
14. Elsgaard, L. and Andersen, L. (1997) Microbial ethylene removal in peat-based growing media and
its relevance for horticultural practice, in G. Schmilewski (ed.), Peat in Horticulture -Its Use and
Sustainability, International Peat Society, Jyska, Finland, pp. 36-38.
15. Elsgaard, L. and Andersen, L. (1998) Microbial ethylene consumption in peat-soil during ethylene
exposure of Begonia elatior, Plant and Soil (in press).
16. Frankenberger, W.T. and Arshad, M. (1995) Phytohormones in Soils - Microbial Production and
Function, Marcel Dekker, New York.
17. Frye, R.F., Welsh, D., Berry, T.M., Stevenson, B.A. and McCallum, T. (1992) Removal of
contaminant organic gases from air in closed systems by soil, Soil BioI. Biochem. 24,607-612.
18. Gouble, B., Fath, D. and Soudain, P. (1995) Nitrous oxide inhibition of ethylene production in
ripening and senescing climacteric fruits, Postharvest Bioi. Technol. 5,311-321.
19. Griffin, D.M. (1981) Water and microbial stress, Adv. Microb. Ecol. 5,91-136.
20. Harttnans, S., de Bont, JAM. and Harder, W. (1989) Microbial metabolism of short-chain
unsaturated hydrocarbons, FEMS Microbiol. Rev. 63, 235-264.
21. Heyer, L. (1985) Bud and flower drop in Begonia elatior 'sirene' caused by ethylene and darkness,
Acta Hortic. 167,387-391.
22. Heyer, L. (1995) Investigations of the ethylene build-up during transport of pot plants in controlled
temperature trucks, Postharvest BioI. Technol. 5, 101-108.
23. Knee, M., Proctor, FJ. and Dover, CJ. (1985) The technology of ethylene control: use and removal
in post-harvest handling of horticultural commodities, Ann. Appl. BioI. 107,581-595.
24. Maller, L. (1993) Sphagnum som dyrkningsmedium, Gartner Tidende 3, 62-64 (in Danish).
25. Otani, T. and Ae, N. (1993) Ethylene and carbon dioxide concentrations of soils as influenced by
rhizosphere of crops under field and pot conditions, Plant and Soil 150, 255-262.
26. Rudolphij, lW. and Boerrigter, H.A.M. (1981) Scrubbers voor ethyleen, Bedrijfsontwikkeling 12,
307-312 (in Dutch).
27. Schmilewski, G.K. (1996) Horticultural use of peat, in E. Lappalainen (ed.), Global Peat Resources,
International Peat Society, Jyska, Finland, pp. 327-334.
28. Serek, M., Sisler, E.C. and Reid, M.S. (1994) Novel gaseous ethylene binding inhibitor prevents
ethylene effects in potted flowering plants, J. Amer. Soc. Hort. Sci. 119,1230-1233.
29. Sherman, M. (1985) Control of ethylene in the postharvest environment, HortScience 20, 57-60.
30. Sisler, E.C. and Wood, C. (1988) Interaction of ethylene and CO2, Physiol. Plant. 73,440-444.
31. Turner, M.A., Reed, D.W. and Morgan, D.L. (1988) Ethylene-induced defoliation in Ficus species
and ethylene depletion by soil bacteria in peat-amended media and in vitro, J. Amer. Soc. Hort. Sci.
113, 794-796.
32. Van Ginkel, C.G., Welten, H.GJ. and de Bont, J.A.M. (1987) Growth and stability of ethene-
utilizing bacteria on compost at very low substrate concentrations, FEMS Microbiol. Ecol. 45, 65-
69.
33. Van Ginkel, C.G., Welten, H.GJ., de Bont, lA.M. and Boerrigter, H.A.M. (1986) Removal of
ethene to very low concentrations by immobilized Mycobacterium E3, J. Chem. Tech. Biotechnol.
36, 593-598.
34. Woltering, EJ. (1987) Effects of ethylene on ornamental pot plants: a classification, Scientia
Hortic. 31,283-294.
35. Zar, J.H. (1996) Biostatistical Analysis, 3rd edn., Prentice-Hall, Upper Saddle River, New Jersey.
ETHYLENE DEVELOPMENT IN DIFFERENT CLONES OF 'ANNURCA'
APPLE AND ITS INFLUENCE ON THE BIOSYNTHESIS OF AROMA ESTERS
AND ALCOHOLS
R. LO SCALZO AND A. TESTON I

/. V. TP.A. via G. Venezian, 26-20133 Milano, Italy
1. Abstract
'Annurca' (Malus domestica Borkh) is an apple cv commonly cultivated in Southern

Italy. Its aroma composition is characteristic and completely different from other
apple's cv. The I.S.F. (Experimental Institute of Fruit Growing) in Rome, Italy, has
selected several clones of this cv, in order to attenuate the agronomical 'Annurca'
defects. We studied the headspace composition (ethylene, esters and alcohols) of intact,
unreddened fruits just after harvest and after storage in air or in controlled atmosphere.
Relationships between ethylene amount in the headspace and esters or alcohols
production were evaluated in order to determine the optimum of storability for every
clone and the best aroma retention.
2. Introduction
In the cultivars panorama of Southern Italy the cv 'ANNURCA' apple represents a very
important part, known since ancient Romans times. Today it is the most commonly
grown cultivar in Campania region. It accounts for 95% of Southern Italy and 3-4% of
the national apple production [I].
Just after harvest, the fruits are treated with a special system to obtain their
reddening. The apples are placed on the soil protected only by straw and are daily wet.
This means that the fruits mantain a high quality if they are kept at room temperature
after harvest.
Given the cultivar's importance to Campania's economy, the 'Experimental Institute
of Fruit Growing' at Ciampino, Rome initiated in 1970 a research programme aimed at
attenuating ANNURCA's defects. These efforts have included studies of various
aspects of its biology, breeding and storage [2,3,4].
This cultivar has also been proposed to the European Council for the "Protected
Geographical Indication" (PGI), an European project related to the preservation of local
and characteristic agriculture commodities [5].
Nowadays, great importance is given to the study on aroma composition of fruits
and vegetables for determining the relationship to the ripening, frequently associated
419
420
with the increase in ethylene and other physiological factors (e.g. CO 2 production) [6,
7].
The present study reports the results of a research on the volatile compounds emitted
by 3 different clones of this fruit, before the reddening treatment, during its ripening
period of 26 days at 20C after harvest and 9 days after storage in air (NA) or in
controlled atmosphere (CA). These studies were based on static headspace sampling of
intact fruits for ethylene and dynamic headspace sampling of the same apples for other
volatiles [8].
3. Experimental
3.1. PREPARATION OF HEADSPACE SAMPLES
'ANNURCA' apple fruit were harvested at commercial maturity (Table 1) from trees in
a research orchard (Experimental Institute of Fruit Growing) in Rome, Italy on 15
October 1996. Nine different clones of this cv were studied, here 3 clones have been
considered: one commonly cultivated called 'Standard', the second called 'Bella del
Sud' [4], and the third called 'Clone 7'. Fruits were transported to the laboratory,
conditioned 24 hr at 20C and the collection of headspace samples was started the
following day, and continued at 5, 7, 9, 12, 15, 19, 22 and 26 days at 20C. Two
aliquots of apples were stored respectively in air at 1C (NA) for 6 months and in
controlled atmosphere at 1C (2.0% O2 , 1.2% CO 2) (CA) for 7 months. After the
storage the fruits were conditioned at 20C 24 hr immediately followed by the
collection of headspace samples, continued at 5, 7 and 9 days at 20C.
TABLE 1. Soluble solids, fruit colour, titratable acidity and firmness of "Annurca" apples
harvested 10 October 1996*
Standard Bella del Sud Clone 7
Soluble solids (%) 12.41 0.88 12.41 1.04 14.36 1.32
Colour (CrE) L 73.54 2.23 72.25 2.95 71.38 3.59
a* -11.05 4.l1 -7.85 5.24 -4.51 5.86
b* +36.04 1.88 +35.263.12 +38.53 3.11
Titratable acidity (meq/100g) 13.88 1.14 14.35 1.76 14.59 1.74
Firmness (Newton) 96.30 9.02 93.46 9.02 100.71 10.00
* Values represent averages of 20 individual fruits
Glass jars (5 1) were used for sample collection (about 1 kg ea), the jars were fitted with
teflon lids having 2 gas ports.
For the ethylene analysis, a 5 ml sample of headspace was drawn with a gas-tight
syringe directly from the glass jar kept close for 1 hr and then assayed by GC-FID (see
GC-FID for ethylene).
Each dynamic headspace sampling was conducted for a time of 1 hr at a flow of
purified air of 600 ml min-I. Volatile compounds were collected onto 150 mg of 20-40
mesh activated coconut charcoal cartridges packed in a glass tube (0.6 cm i.d. X 7 cm)
attached at the outlet port on the jar lid. Headspace components were subsequently
desorbed from a trap using 500 f..ll of CH 2Cl 2 in 3 ml vials teflon-fitted, shaken for 40
421
min at room temperature, and then decanted at Oe. For the aroma developing each
CH 2CIz extract was directly introduced in a GC-FID system (see GC-FID for volatiles).
3.2. GC-FID FOR ETHYLENE
The gas samples from the headspace of the fruits were assayed by a gas chromatograph
(DANI, model 3800) equipped with a 1.5 ml loop injection valve, a 2 m stainless steel
Alumina FI (80-100 mesh) column held at 100C,and a FID detector at 250C. Data
were expressed as ppm kg-Ihr- I, normalized per unit time due to collection of the static
headspace.
3.3. GC-FID FOR VOLATILES
Headspace components were separated using a 30 m X 0.53 mm Carbowax 20M (1.00

11m film thickness) wide-bore column and temp. programmed as follows: 50 0 for 5 min,
increased to 200 0 at 3 0 min-I and then at 200 0 for 5 min; the injection port was equipped
with a PTV apparatus, programmed at 50 for 0.5 min, increased at 240 at 270 0 min- 1
and then kept at 240 for 15 min; the FID was at 250; carrier gas was He at 3 ml min l.
The injection vol. was 4 III at a split ratio 1: 15. The identification of compounds was
based both on the comparison of relative retention times with those of authentic
standards and with data from GC-MS analyses, not reported here. The estimates of
concentrations of the headspace compounds were made using response factors
determined from authentic standards combined with fruit weight and air flow rate
through the sampling jars. Concentrations are, therefore, expressed as amount per unit
weight per unit time, i.e. ng kg-lh(l.
3.4. FRUIT COLOUR, SOLUBLE SOLIDS, ACIDITY, FIRMNESS

MEASUREMENTS
'ANNURCA' skin colour and soluble solids was measured using a Minolta CR300
Chroma Meter with CIE L a* b* system. Soluble solids were evaluated with a BS
RFM81 refractometer. Acidity was evaluated with a Metrohm 682 titroprocessor.
Firmness was measured by an Universal Instron Testing Machine, probe 11 mm
diameter, crosshead speed 200 mm min-I, and it was expressed as Newton.
4. Results
Apples were harvested at an acceptable maturity for commercial use (Table I). All the
clones present high firmness, more marked in 'Clone 7', probably due to a lower
ethylene biosynthesis. 'Bella del Sud' shows a better percentage of red surface at
harvest, confirmed by an higher ethylene production and a lower firmness.
At harvest, the three clones present strong differences in ethylene and total aroma
production (Fig. 1). 'Bella del Sud' has a higher ethylene production with a maximum
after 9 days, followed by a decrease. 'Standard' clone produces less ethylene during all
the ripening, with the maximum at the same time and reaching the value of 'Bella del
422
Sud' only at 26 days. 'Clone 7' ethylene biosynthesis has exactly the same changes,
with a general diminution.
The qualitative composition of aroma volatiles (Table 2) was similar to that found in
other studies, except for 8-octalactone, never found in apples [9, IOl.
In Table 2 the volatile production of 'ANNURCA' apple is shown: 16 compounds
were identified and quantified.
TABLE 2. Volatiles from 'Annurca' headspace

Ret. time Compound
5,148 Ethyl butanoate
7,000 Ethyl 2-methylbutanoate
8,512 Butyl propionate
9,148 Butanol*
11,935 Pentanol*
12,633 Ethyl hexanoate
14,458 Hexyl acetate
16,458 Pentyl butanoate
17,562 Hexyl propionate
18,578 Hexanol*
21,033 Hexyl butanoate*
21,847 Ethyl octanoate
23,310 Hexyl isovalerate
29,552 Hexyl hexanoate*
31,102 Octyl butanoate
38,058 B-Octalactone
* Compounds present in relevant quantity
The compounds were mainly alcohols and esters. Among the esters, the butanoates,
characteristic of red-skinned apples [II], the acetates and the ethyl esters have been
considered for the study of change during ripening in relation to ethylene production.
-------------.--------------
I
-'I
CHz~ amount In headlpllC8 after harvest 1000 Total aromas In headspaoe after harvest
80 /_ -+-standa,d::J
_~ ~ . ~--~ :::~:e~SUd\ 800
;#=50 . -.c600
-:r
!:
~40 400
r
__
200
w 1
1_ ._O_-I-~-.~~_-.-._~10-_~-ys-_~~:3l"-._-C~.~-.-.-_~22_-_~26_ L_ ~_~ _____ ~O~~~~~B._: ~.J

Figure 1. Ethylene and total aroma production at harvest.
Changes found in total aroma production of fruit from the different clones followed
a pattern similar to that of ethylene production;, 'Bella del Sud' gives an earlier total
aroma peak at 7 days respect to that of ethylene. 'Clone 7' presents an higher quantity
of volatiles than we expected by the ethylene production, very high at 2 days, reaching
the maximum at 9 days of ripening, with volatile amounts close to 'Bella del Sud',
higher than 'Standard'. The difference in total aroma between 'Standard' and 'Bella del
Sud' reflects the different ethylene production (Fig. 2).
423
After storage, the production of ethylene and volatiles has been considered only for
9 days of ripening at 20C. For NA, the ethylene production shows the peaks for
'Standard' and 'Bella del Sud' at 7 days. In CA the peaks are at 5 days for all the
clones (Fig. 2).
80 CHz=CH2 development after NA 80
80 80

i., 40 1. 40
II
i 201=----...---...-- ~ 20
o~ __ ~~~ __ ~~ __- ,
2 5 8 5
dlplt20'C day t20C
Figure 2. Ethylene production at harvest, NA an CA.
The 3 clones present an higher aroma amount in NA than at harvest, while in CA the
aroma production is very depressed. In NA, for 'Clone 7' a marked decrease is noted
(Fig. 3).
Total aromas In heads pace at harvest Total aromas In heads pace after ~ Total aromas In heads pace after CA
1800
, -+-standard d]
-r:J- BeY. del Sud 1800~
, 1440 , 1800
t
1440 -lfr-Cone7 1440 -+-standerd
1 --0- 8aUa del Sud 1
~ ,I:*""
1080 1080 .-.. ~
1080 ......r-Oone7
..... :i
r--
,0.. no
i!'
720
360 ..
~,
i!' 720
360 - 0 - standard
Bela del Suddl
-6-00ne7
-<I
i!' 360 .--=-.-.. -~.,
0 0 0
2 3 4 5 6 7 8 9 2 3 4 5 6 7 6 9 2 3 4 5 6 7 8 9
days at we days at2O"C days at we
Figure 3. Total aroma production at harvest, after NA and CA.
Alcohols, total esters and butanoates present changes close to total aroma. The acetates
and ethyl esters are characterized by an increase in CA respect to harvest: this fact is
probably due to the accumulation of their precursors during storage, Acetyl-CoA for
acetates and ethanol for ethyl esters [12].
The acetates development present a peak at 7 days for 'Standard' and 'Bella del
Sud' at harvest; 'Clone 7' has the lower production, reflecting the difference in ethylene
biosynthesis. After NA and CA a general decrease is noted for 'Clone 7'. 'Bella del
Sud' shows a maximum at 7 days in NA and CA (Fig. 4).
~
~
30
.c 24
18
!:12
Acetates at harvest
1 __ Standard
-{}- Bella del Sud
--<>- COna 7
II
~
~~ ~
#'
~
-
Acetates after NA
18 ,.....:::.::-:::::::~~=60=_~
12 ,.---- ~
I
--+- standard j 1
-{}- Bella del Sud
-I!r-Cone 7
---------., ~~ ~
f 18
~ 1~0 ,
b I--+-
= :cP---n
Acetates after CA standard
-0-- Bela del Sud
--<>-COne 7
i
II
go ~
23456789
-- ~
..
C 6
O~T-T-T-
234567
______
8
~
9 23456789
,==
days at2O'C days at 20'C days at 20'C
Figure 4. Acetates at harvest, NA and CA.

424
The ethyl esters quantities present a general increase, except for 'Clone 7' in NA, which
shows a constant rate of production. In CA there is a minimum at 5 days for all the
clones, corresponding to ethylene maximum, with a peak for 'Bella del Sud' at 7 days
(Fig. 5).
Ethyl esters at harvest Ethyl e ste rs a fte r CA

120 120
96 96
....
1- 1-
..go ..
-~ .c
.c .c 72 72
72
b. b. jt 48
48 48
c c -0
24 24 24
0
2 3 4 5 6 7 8 9 2 3 4 5 6 7 8 9 2 3 4 5 6 7 8 9
days at 20 CG days at 20'C days at 20C
Figure 5. Ethyl esters after harvest, NA and CA.
5. Discussion and Conclusions
'ANNURCA' apple products a mixture of volatiles, responsible for its typical aroma,
different from other apples' cv. Among the identified compounds, the o-octalactone,
unusual for apple, has been found.
'Bella del Sud' presents an higher production of ethylene than 'Standard, while in
'Clone 7' it is lower. The CA makes the peak of ethylene production earlier than NA,
mantaining the quantitative differences among the clones. The lower ethyl esters
production after CA corresponds to the ethylene peak.
Comparing all the clones, in 'Clone 7' different ethylene levels don't seem to affect
the volatiles biosynthesis, except for the acetates at harvest. This clone is noted also for
its strong decrease in total aroma after NA. The 'Clone 7', for its features of good
storability and aroma production, has to be considered.
CA storage prolonges the fruits mantainment but, also in 'ANNURCA' clones,
decreases the total aroma amount. Only acetates and ethyl esters are increased by CA
storage respect to harvest. This fact is especially noted for 'Bella del Sud'.
6. References
1. Floris, M. (l997) Melo e Pero nella Frutticoltura Italiana ed Europea, Federchimica Agrofarma,
Milano, p. 17.
2. Fideghelli, C., Monastra, F., Della Strada, G., Quarta, R. and Donini, B. (1977) Mutazioni indotte
nelle varieta di melo Annurca, Riv. Ortoflorofrutticoltura Italiana 61 (6),360-367.
3. Lintas, C., Paoletti, F., Cappelloni, M., Gambelli, L., Monastra, F. and Ponziani, G. (1993)
Agronomic, nutritional and texture evaluation of 'Annurca' apple clones, Adv. Hort. Sci. 7, 165-
168.
4. Limongelli, F. and Testoni, A. (1984) Annurca Bella del Sud e Annurca Rossa del Sud, Atti IVTPA
7,139-149.
5. CEE rule nr. 2081/92, Europe Council of 14/0711992 - related to the Protected Geographical
Indication (PGn and Protected Designation of Origin (PDO) of Agricultural Products (Gazzetta
Ufficiale lialiana L208 24/0711992).
425
6. Mattheis, J.P., Fellman, J.K., Chen, P.M. and Patterson, M.E. (1991) Changes in headspace
volatiles during physiological development of Bisbee Delicious apple fruit, 1. Agric. Food Chem.
39,1902-1906.
7. Song, J. and Bangertb, F. (1996) The effect of harvest date on aroma compound production from
'Golden Delicious' apple fruit and relationship to respiration and ethylene production, Postharv.
Bioi. and Technol. 8, 259-269.
8. Mattheis, J.P., Buchanan, D.A., and Fellman, J.K. (1992) Identification of headspace volatile
compounds from 'Bing' sweet cherry fruit, Phytochemistry 31,775-777.
9. Dimick, P.S. and Hoskin, J.C. (1983) Review of apple flavour - State of the art, CRC Crit. Rev.
Food Sci. Nutr. 18,387-409.
10. Paillard, N.M.M. (1990) The flavour of apples, pears and quinces, in J.D. Morton and A.J.
McCleod (eds.), Food Flavours. Part C: The Flavour of Fruits, Elsevier Science Publishers,
Amsterdam, pp. 1-42.
11. Paillard, N.M. (1979) Biosynthese des produits volatiles de la pomme: formation des alcools et des
esters a partir des acides gras, Phytochemistry 18, 1165-1171.
12. Forss, D.A. (1972) Odor and flavor compounds from lipids, in R.T. Holman (ed.), Progress in the
Chemistry of Fats and other Lipids, vol. 13, Pergamon Press, New York, p. 181.
DOES INHmITION OF ACO ACTIVITY IN JAPANESE-TYPE PLUMS
ACCOUNT FOR THE SUPPRESSION OF ETHYLENE PRODUCTION IN
ATTACHED FRUIT BY THE TREE FACTOR AND THE SUPPRESSED
CLIMACTERIC?
The Role of Ethylene in the Tree Factor and Suppressed Climacteric in Japanese-type
Plums
W.B. McGLASSON, N. ABDI AND P. HOLFORD

Centre for Horticulture and Plant Science, University of Western Sydney
Hawkesbury, Locked Bag 1, Richmond NSW, Australia 2753
1. Introduction
Abdi et al. [1] reported that the ripening of attached fruit of some cultivars of Japanese-
type plums is delayed compared to harvested fruit. This phenomenon has been reported
in other species, notably apples, and is ascribed to the presence of an unknown 'tree
factor'. Abdi et al. [1] also described two classes of plums: one class, represented by
the cvv Gulfruby and Beauty, expresses a typical climacteric pattern of respiration and
ethylene production, while the second class, represented by cvv Shiro and Rubyred, has
a suppressed-climacteric phenotype. In this latter phenotype, levels of ethylene
production are low compared to normal, climcateric types. To further elucidate the
physiology of the tree factor and the suppressed-climacteric behaviour we treated fruit
of defined maturity stages with I-methylcyclopropene (I-MCP), an inhibitor of ethylene
action, and propylene [2]. Measurements of ethylene production and respiration were
made within 24 h of harvest and on the 5 subsequent days storage at 20C.
The strength of the tree factor in the cv Beauty is illustrated in Figure 1. The data show
that fruit harvested at weekly intervals and ventilated with ethylene-free air had very
low rates of ethylene production one day (Fig. tA) after harvest but production
gradually increased during the next 5 days depending on the age of the fruit at harvest
(Figs 1 B, C ,D). Fruit harvested 28 days after pit hardening (DAPH) did not produce
detectable amounts of ethylene during the first 6 days after harvest. Fruit harvested 35
DAPH produced significant amounts of ethylene by day 6 and the rates were clearly
higher than for fruit harvested 42 DAPH plus one day at 20C. In turn, fruit harvested
42 DAPH produced considerably more ethylene by day 6 than fruit harvested 48 DAPH
plus one day at 20C. A comparison of ethylene levels between Figure lA and Figures
427
428
IB, C, D clearly demonstrates the release of the fruit from the influence of the tree
factor. The tree factor is also strongly expressed in Rubyred, a cultivar that exhibits the
suppressed climacteric phenotype [1].
I I "F ,.
28 3S 42 49
80
H1
2 10_
~ ~1~--dr9-r~~0~~3rI1~~~2--r-3T~-'--3r~~
; : 70 C
" 60
U 50
40
30
20
Ig+-TI~-'I~-rI~~"F~~T~~T~
36 37 38 39 40 41
80
70 D
60
50
40
30
20
10
O~~Lr~~~~~
43 44 4S 46 47 48
Days after Pit Hardening
Figure 1. Ethylene production by cv Beauty showing the

"tree factor". A shows rates of ethylene production at
20C one day after harvest for fruit harvested at 28, 35, 42
and 49 DAPH B, C and D show ethylene production from
fruit harvested at 28, 35, 42 and 49 DAPH and ripened at
20C on days 2-6 after harvest. The bars represent S.E. of
the means (n=12). Adapted from Abdi et al. [I] with
permission from Elsevier Science."
Abdi et al. [1, 2] showed that a continuous application of propylene advances the
onset of the climacterics in ethylene production and respiration, and hastens skin colour
changes in both Beauty and Rubyred, as expected of climacteric fruit. It is noteworthy
that the peak rates of ethylene production in Rubyred were stimulated by propylene to
rates similar to those seen in normal climacteric types. The application of I-MCP
further highlighted differences in the physiology of the two classes of plums. In
429
Beauty, I-MCP delayed the climacterics and slowed skin colour changes: continuous
application of propylene partly overcame this inhibition. In contrast, I-MCP eliminated
the ethylene and respiratory climacterics in Rubyred and delayed colouring, while the
addition of propylene restored these events and induced the fruit to ripen at about the
same time as fruit ventilated in air. Ethylene production appears to be naturally low in
suppressed-climacteric fruit and in I-MCP-treated fruit there may be too little
endogenous ethylene production to initiate the climacteric. Another action of I-MCP
that was observed in both classes of fruit was the elimination of the initial increase in
respiration typically seen when propylene is applied to preclimacteric fruit. It is evident,
therefore, that an ethylene receptor(s) is required for this response.
It is clear that the ability to produce ethylene is very low in plums with the
suppressed-climacteric phenotype and that this affect continues even as the fruit enter
the autocatalytic phase of ethylene production associated with ripening. However, ACC
accumulated to similar concentrations in fruit of both Beauty and Rubyred [2] whilst on
the tree. Therefore, we propose that inhibition of the conversion of ACC to ethylene is
principally responsible for both the tree factor and the suppressed climacteric
phenotype.
3. References
1. 1.Abdi, N., Holford, P., McGlasson, W.B. and Mizrahi, Y. (1997) Ripening behaviour and
responses to propylene in four cultivars of Japanese type plums, Postharvest Bioi. Technol. 12,21-
34.
2. Abdi, N., McGlasson, W.B., Holford, P., Williams, M. and Mizrahi, Y. (1998) Responses of
climacteric and suppressed-climacteric plums to treatment with propylene and 1-
methylcyclopropene, Postharvest Bioi. Technol. 14,29-39.
SOFTENING IN APPLES AND PEARS: A COMPARATIVE STUDY OF THE
ROLE OF ETHYLENE AND SEVERAL CELL WALL DEGRADING
ENZYMES
M.A. MOYA 1, C. MOGGIA2 , J. EYZAGUIRRE 3 AND P. JOHN4

ILab. Fisiologia Vegetal, lnstituto de Biologia Vegetal y Biotecnologia,
Universidadde Talca, Casilla 747, Talca, Chile, 2Lab. PostCosecha,
Centro de Pomaceas, Facultad de Ciencias Agrarias, Universidad de
Talca, Casilla 747, Talca, Chile, 3Lab. Bioquimica, Dpto. Ciencias
Biologicas, Pontificia Univ. Cat61ica de Chile, Santiago, Chile,
4 Department of Agricultural Botany, School of Plant Sciences, The
University ofReading, Reading RG6 6AS, UK
Apples and pears are climacteric fruit, which show a dramatic rise in ethylene
production and respiration at the onset of ripening. Ethylene induces and coordinates
many changes during the ripening of the fruit, including the development of colour and
aroma, and improvements in flavour and texture [1].
Softening and textural changes are the most important factors that limit storage life
of fruits. These changes could be partly explained by loss of turgor and degradation of
starch, although many authors agree that modifications on the fruit cell wall are the
major causes of softening [2]. Pears and apples soften at different rates and to varying
extents: in general apples soften slowly while pears soften rapidly and with great
intensity. This difference probably reflects the fact that several mechanisms operate
during softening. In order to study the biochemical mechanism involved in the softening
of these fruits, the activity of several cell wall degrading enzymes was followed during
the softening of apples and pears.
Apples (cv. Braeburn, Royal Gala and Fuji) and pears (cv. Beurre Bosc and
Packham's Triumph) were harvested from local orchards. Samples were collected
weekly until harvest day, maturity indexes were measured (fruit firmness and ethylene
production rate), and pulp tissue was frozen in liquid nitrogen and stored at -20C. After
one month of storage (OC, 95% humidity), fruit was removed to room temperature
(15/5 days for applesl pears), and sampled every 2 days.
Cell wall degrading enzymes were extracted by homogenizing frozen pulp tissue (10
g) in 20 ml of extraction buffer (0.1 M sodium citrate pH 4.6, 1M NaCl, 5 mM DTT, 13
mM EDTA and 1% (P/v) insoluble PVP) [3]. The homogenate was centrifuged at 25,000 g
for 20 min. For PG assay, crude extract was previously desalted.
The activity of glycosidases (nmol pNPIh.ml) was measured using the respective p-
nitrophenyl derivates (Sigma) prepared in 50 mM acetate buffer (pH 5). After
incubation (30 min at 37C) the p-nitrophenol liberated was measured at 405 nm.
Polygalacturonase activity (flmol/h.ml) was assayed using polygalacturonic acid
(Sigma) as a substrate (0.05%), and after incubation (30 min, 37C, pH 5) the reduction
power generated was estimated by using the dinitrosalicylic acid method [4].
Pears showed a dramatic reduction in fruit firmness during the postharvest period
while climacteric ethylene is being produced. In cv. Packham's Triumph a clear
increase in the activities of polygalacturonase, a and ~-galactosidase and a-
mannosidase was observed while softening was taking place. In cv. Beurre Bosc the
431
432
activities of a- and J3-galactosidase, a-mannosidase and J3-glucosidase showed a general

increase during softening. No activity was found for cellulase, xylanase, J3-mannosidase
and a-glucosidase enzymes in apple or pear extracts.
The apple cultivars used in this study showed different levels of climacteric
ethylene. Apple fruits showed a smaller reduction in fruit firmness than pears, and
Royal Gala cuitivar, the one with the highest climacteric ethylene level, showed the
most intensive reduction in fruit firmness. In Royal Gala apples an evident increase was
found in J3-glucosidase and polygalacturonase activity during softening, while in
Braeburn and Fuji no clear evidence for the participation of any cell wall degrading
enzyme was observed. No activity for a-mannosidase was found in Royal Gala and
Braeburn apples.
The results shown here indicate that different cell wall degrading enzymes are active
during the softening of apples and pears, suggesting that different mechanisms are
operating, and that ethylene is clearly inducing the softening of these fruits.
This work was supported by Fondecyt 1970586, and a travel fellowship from Fundaci6n Andes (M.A.Moya).
References
1. Abeles, F.B., Morgan, P.W. and Salveit, M.E. (1992) Ethylene in Plant Biology, Second Edition.
Academic Press, London, pp 414.
2. Tucker, G.A. and Grierson, D. (1987) Fruit Ripening, in The Biochemistry ofPlants, Vol 12, Chapter
8, Academic Press, pp 265-318.
3. Lazan, H., Mohd, Z., Liang, K.S. and Lee, K.L. (1989) Polygalacturonase activity and variation in
ripening of papaya fruit with tissue depth and heat treatment, Physiol. Plant. 77,93-98.
4. Muran, S., Sakamoto, R. and Arai, M. (1988) Cellulases of Aspergillus niger, Methods in Enzymology,
160, 274-299.
PACKHAM'S TRIUMPH ROYAL GALA

IOOT'----------r"100
100 , - - - - - - - - - - . , 30000
3000
g l
~ 75
10000
Z
'0 2000
~ so
Ii:
~
10000
'000
!!:
, . . - - - - - - - - - - - r "0 r-----------r OO
0"
'l 300
..-:>r------A 200
-----..'"
"l'OC
600
200
2no
L--~~~ _ _ __ J c
9
DAYS
DAYS
DIFFERENTIAL EFFECTS OF LOW TEMPERATURE INHIBITION ON
KIWIFRUIT RIPENING AND ETHYLENE PRODUCTION
M.D.C. ANTUNES 15 , I. PATERAKf, P. VERVERIDIS 3, A.K.

KANELLIS,2,4 AND E. SFAKIOTAKIS5
1 Universidade do Algarve, u.c. TA., Campus de Gambelas, 8000 FARO-
PORTUGAL; 2Institute of Viticulture and Vegetable Crops, National

Agriculture Research Foundation, PO Box 1841, GR-711 10 Heraklion,
Crete, Greece; 3 Technological Education Institute, School of Agricultural
Technology, Dept. of Plant Sciences, PO Box 140, GR-711 10 Heraklion,
Crete, Greece; 4Dept. of Pharmaceutical Sciences, Aristotle University of
Thessaloniki, GR-540 06 Thessaloniki, Greece; 5Laboratory of Pomology,
School of Agriculture, Aristotle University of Thessaloniki, GR 540 06
1. Abstract
Our previous studies [7] have shown that there is an inhibition of propylene-induced
ethylene production in kiwifruit below a critical temperature range of 11-14.8C. The
aim of this research was to identify the biochemical basis of inhibition of the propylene-
induced ethylene production in kiwifruit, below the above mentioned critical
temperature range. "Hayward" kiwifruit were treated with l301-tl/l propylene or air free
of propylene and ethylene at lOoC and 20C. Ethylene production as well as ACC
synthase and ACC oxidase activities were measured during a period of 312 hours.
Changes in soluble solid content (SSC) and flesh firmness were also monitored during
the same time-course period. RNA blot hybridisations using specific probes for ACC
synthase and ACC oxidase were performed with total RNA from untreated fruit as well
as from those that had received 192 hours of propylene treatment, at 10C and 20C. We
propose that the main reasons for the inhibition of the propylene-induced (autocatalytic)
ethylene production in kiwifruit at low temperature 11C) are: a) primarily the
inhibition of the expression of the propylene-induced ACC synthase gene and b) the
possible post-transcriptional modification(s) of ACC oxidase, since expression of the
propylene-induced ACC oxidase gene existed at the low temperature storage.
2. Introduction
Most of the factors influencing ethylene production, act primarily by enhancing

endogenous levels of ACC via de novo synthesis of ACC synthase [I]. In kiwifruit, low
temperature 11 -I4.8C) blocks initiation of autocatalytic ethylene production
433
434
(induced by propylene) but not ripening [8]. The rate limiting factor was found to be
ACC production rather than ACC oxidase activity.
The aim of this research was to identify the biochemical basis of inhibition of the
propylene-induced ethylene production in kiwifruit, below the above mentioned critical
temperature range.
Kiwifruit (cv. Hayward) were placed at 10 and 20C in 5-litre jars into which a
continuous humidified air stream with or without 130!!1/1 propylene was passed at a rate
of 100mllmin. At periodical intervals, fruits of each treatment were removed from
storage and used for analysis.
ACC synthase was extracted and assayed as described previously [2]. One unit of
ACC synthase activity is defmed as the formation of 1 nmol of ACC/2hrs at 30C.
ACC oxidase was measured in vivo by infiltrating flesh disks with ImM ACC under
vacuum as described elsewhere [5].
Total RNA was isolated from flesh tissue without seeds based on the method of
Slater et al. [6]. RNAs were transferred to nylon membrane and hybridised with
radiolabelled specific probes cDNA MELl [3] for ACC Oxidase and KWACCI [4] for
ACC Synthase. Total RNA extraction and Northern blotting were performed 192 hours
after the commencement of the experiment.
Kiwifruit treated at 20C with propylene, resulted in induced ripening (Fig. lA, B) and
ethylene production (Fig. 1C). Ripening progressed immediately after propylene
treatment, while autocatalysis of ethylene production had a lag period of 72 hours. The
latter event was attributed to the delay found in the induction of ACC synthase activity
(Fig. ID). In contrast, propylene treatment induced ACC oxidase activity with no lag
period (Fig. IE). Moreover, accumulation of ACC synthase and ACC oxidase
transcripts was only evident (Fig. IF) in ethylene-producing kiwifruit at 20C (Fig. lC).
In contrast, kiwifruit treated at 10C with propylene, resulted in a strong inhibition
of ethylene production (Fig. 1C), which was attributed to the low found activities of
both ACC synthase and ACC oxidase (Fig. ID, E). Interestingly, propylene at 10C
induced the appearance ofmRNA of ACC oxidase but not of ACC synthase (Fig. IF).
However, propylene induced ripening of that fruit with almost the same rate found for
the propylene-treated fruit at 20C (Fig. lA, B). It should be noted that during the
whole experimental period (312 hours) the control fruit (treated with air free of
propylene) showed no ripening, ACC synthase or ACC oxidase activities or ethylene
production at either 10 or 20C (Fig. lA, B, C, D, E).
Although decreased temperature (10C) reduces ACC oxidase activity, the fact that
at low temperature mRNA of the propylene-induced ACC oxidase gene is still present,
led us to propose that the main reasons for the inhibition of the propylene-induced
(autocatalytic) ethylene production in kiwifruit at low temperature 11C) are: a)
435
primarily the inhibition of the expression of the propylene-induced ACC synthase gene
and b) the possible post-transcriptional and/or post-translational modification(s) of ACC
oxidase.
12
A
~10 .:: ............................... ~~~....... . 17
2O"C+13Q1nA'cp
Ul B 15
~ 6 ...... 'If!.~+.fi!.. .................

IE
~ 4
.:::.~~+~:.:.::.:
u. 2
........................
~~::=:::~~~ 40 80 120 160 200 240 280 320
40 80 120 1eo 200 240 280 320
HOURS HC:U<S
60
3'" C
o
E"OO t50
~
~250
i
40
"~200 30
~150 LSD I LSol
~
'"
20
"'100
50
~ 10
2trC+~
0
0 40 80 120 180 200 240 280 32. ~o 80 120 160 200 240 280 320
HOl.AS HOURS
.'
II III IV V F
Ace syn thase
Figure I. The effect of temperature (10 and 20C) and propylene (130,.11/1) on firmness (A), SSC (B),
ethylene production (C), ACC synthase (D) and ACC oxidase (E) activities and on the steady state levels of
ACC synthase and ACC oxidase transcripts of harvested 'Hayward' kiwifruit kept in a continuous,
humidified, air stream. F: RNA blot analysis of ACC synthase and ACe oxidase after 192 hours at 10C+air
(I), I OC+ 130!li1 propylene (II), 20C+air (Ill), 20C+ 130!li1 propylene (IV) and after harvest (V), I unit/mg =
Ipmol ACC/mg proteinl2hours. LSD at u=0.05.
5. References
\. Acaster, M. A. and Kende, H. (1983) Properties and partial purification of laminocyc1opropane-l-

carboxylate synthase, Plant Physiol. 72, 139-145.
2. Antunes, M. D. C. and Sfakiotakis, E. M. (1996) Biochemical bases of thermoregulation of ethylene
production and ripening of 'Hayward' kiwifruit, Acta Hart. 444, 541-546.
436
3. Balague, C., Watson, C. F., Turner, A. J., Rouge, P., Picton, S. Pech, J. C. and Grierson, D. (1993)
Isolation of a ripening and wound induced cDNA from cucumis melo L., with homology to the
ethylene-forming enzyme, Eur. J. Biochem. 212, 27-34.
4. Ikoma, Y., Yano, M. and Ogawa, K. (1995) Cloning and expression of genes encoding ACC synthase
in kiwifruit, Acta Hort. 398, 179-186.
5. Metzidakis, J. and Sfakiotakis, E. M. (1993) in J. C. Pech, A. Latche and C. Balague (eds.), Cellular
and Molecular Aspects o/the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp.
142-143.
6. Slater, A., Maunders, M. J., Edwards, K., Schuch, W. and Grierson, D. (1985) Isolation and
characterization of cDNA clones for tomato polygalacturonase and other ripening-related proteins,
Plant Mol. BioI. 5, 137-147.
7. Sfakiotakis, E. M., Antunes, M. D. C., Stavroulakis, G., Niklis, N., Ververidis, P. and Gerasopoulos,
D. (1997) Ethylene biosynthesis and its regulation in ripening 'Hayward' kiwifruit, in A. K. Kanellis,
C. Chang, H. Kende and D. Grierson (eds.), Biology and Biotechnology of the Plant Hormone
Ethylene, Kluver Academic Publishers, Dordrecht, pp. 47-56
8. Stavroulakis, G. and Sfakiotakis, E. M. (1993) Regulation by temperature of the propylene induced
ethylene biosynthesis and ripening in 'Hayward' kiwifruit, in J. C. Pech. A. Latche and C. Balague
(eds.), Molecular Aspects a/the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht,
pp. 142-143.
DIFFERENCES IN COLOUR DEVELOPMENT AND EARLINESS AMONG
PEPINO CLONES SPRAYED WITH ETHEPHON
M. LEIVA-BRONDO, J. PROHENS AND F. NUEZ

Departamento de Biotecnologia. Universidad Politecnica de Valencia,
Camino de Vera 14,46022 Valencia, Spain
1. Introduction
Most pepino (Solanum muricatum Aiton) clones have a long fruit ripening period. This
hampers the introduction of this crop in intensive crop rotations [2]. Time elapsed
between the fruit has reached its full size and ripeness can be extremely long, up to
several months. Prohens et al. [3] have found that sprayings of 2-chloroethyl
phosphonic acid (ethephon) can advance ripening ofcv 'Sweet Round' between 1 and 3
weeks. However, several evidences suggest that there are differences amog different
clones in the response to ethephon [4]. Here we study, in several clones, the differences
induced by ethephon applications on fruit colour, which is the most common used
maturity index for the pepino [1].
2. Materials and methods
We used three clones of pepino ('0902', '2019', '6010) selected for its long ripening
period. Cultivation was performed in an Autumn-Winter cycle [4]. Treatments were:
no ethephon spraying (TO), one single application at 1000 mg/l at 60 (TI), 74 (T2), 88
(T3) days after fruit set, or a threefold application at 60, 74 and 88 days after fruit set
(T4).Ethephon applications were performed with a manual sprayer ensuring that an
uniform layer covered the whole fruit. Colour was measured with a colourmeter
(Minolta RC300). The parameters L*, a*, b* and the hue angle (arctg (b*/a* were
determined.
As a result of ripening in the three clones studied, the hue angle decreased and the
colour changed from green to yellow tones characteristic of the ripe stage (Fig. 1). In
'0902' y '2019' the treatments with ethephon accelerated the change in colour. In these
437
438
125
120 .---------------------------------------------~
QI 115 Clone '0902'
'EI
c
110
'"
QI
:::I
105
100
:I:
95
90
85 ~--------------------------------------------~
. 120
125
115
I~~IS~~i;~li~;::=::::~--~~~~~~;:--l
;;, 110
c
'"
QI
:::I
105
100
::c 95
90
85 ~--------------------------------------------~
l~g l~~~~~i;;;;~==----------~~~~:;~~~l
.
110
105
100
~~
85 +-~ ______ ~~~ __ ~~~_r_r~~~~~ _ _ _ _~~
60 74 88 102 116 130 144 158 172 186 200 214

I _TO _ T 1 -.-T2 _ T 3 ---e-T41
Figure 1. Variation in fruit colour (hue angle) depending on the clone and treatment.
clones the treatment T4 was the most effective in hastening ripening. This allowed an
advance in harvesting of more than 40 days. Regarding the treatments involving a
single ethephon spraying, the most effective treatment for clone'0902' was Tl. For
clone '2019' we did not found differences between the tratments Tl, T2 and T3. We
found no effects as a result of the application of ethephon on the clone '6010'. These
results suggest that there are differences in th physiology of fruit ripening in pepino.
This could be used to select clones with a higher earliness in response to ethephon
applications.
4. References
I. Heyes, J. A., BJaikie, F. H., Downs, C. G. and Sealey, D. F. (1994) Textural and physiological
changes during pepino (Solanum muricatum Ait.) ripening, Scientia Hart. 58, 1-15.
2. Nuez, F. and Ruiz, 1. J. (1996) EI pepino dulce y su cultivo. FAO. Roma Italia.
3. Prohens, J., Ruiz, J. J., Valcarcel, 1. J. V. and Nuez, F. (1997) Hidroxi-MCPA and ethephon can
improve the production of 'Sweet Round'pepino grown in an Autumn-Winter growing cycle, Acta
Hort.463:, 295-300.
4. Prohens, 1., Ruiz, J. 1. and Nuez, F. (1999) Yields, earliness and fruit quality ofpepino clones and
their hybrids in the Autumn-Winter growing cycle, J. Sci. Food Agric. (in press).
S-METHYL-CYSTEINE SULFOXIDE INCREASES DURING POSTHARVEST
STORAGE OF BROCCOLI
Accumulation of alkyl-cysteine derivatives in Crucifers
R. MASUDA, K. KANEKO AND M. SAITO

National Food Research Institute, MAFF Kannondai 1-2-1, Tsukuba,
Japan 305-8642
1. Introduction
Crucifer and Allium plants contained alkyl-cysteine-sulfoxides (ACSO) in their leaves,

flowers and roots. Crucifer vegetables, such as cabbage, radish and cauliflower
accumulate S-methyl-cysteine sulfoxide (MCSO) at high levels, in broccoli floral at
more than 0.5 mg I gfw at harvest. This compound and related metabolites have been
known to decrease cancer incidence in human. Under certain conditions of broccoli
storage at oxygen levels ca. < 0.5%, strong off-odors and off-flavors developed. Their
volatiles included various sulfur-containing compounds [I], formed from MCSO by
cystine lyase at first decomposition step [2]. However, synthetic pathways of MCSO
and other ACSO have not been clarified [3].
We are interested in the genetic control of MCSO contents in crucifers and other
vegetables. We present the changes ofMCSO and this derivative contents during post-
harvest storage of broccoli flowers and radish germination.
2. Results
2.1. BROCCOLI FLOWER
MCSO content during storage for 76 hr at 20 C was decreased to one third of the initial
level under low gas-permeable film wrapped bags (Fig. I). Slightly decrease of MCSO
in the bag with a higher permeable film was observed. Whereas MCSO increased under
non-wrapped conditions at OC and 20C during storage of 126 hr. Separate
experiments showed that MCSO levels were higher in developing leaves than in mature
ones. S-methyl -cysteine (MC) (1.3 mole I gfw ) detected in florets after the long
storage under low oxygen. Cystine lyase activities were not significantly changed
during storage under the conditions tested. Sulfoxidation activities of MC decreased to
zero under low oxygen while unchanged under non-wrapped ( 3 nmole Ihr /gfw).
2.2. RADISH GERMINA nON

439
440
Winter radish (Raphanus sativus Kaiware) seeds rapidly accumulated Meso during
gemination, hypocotyls; 4.0 mole / gfw at 110 hr after sowing at light. Germinating
plants at four days after sowing were transplanted from water to medium including S-
methyl-glutathione (M-GS) or methanol. M-GS (lmM) treated hypocotyls and leaves
accumulated much more Me and slightly Meso than those in water. One % methanol
reduced free amino acids and Meso in all organs.
8.----------------------. Table 1 Effects ofSmethyl-glutathione (M-GS) or

Methanol addition to germination medium (water) on S-
~\
I
" Non wrapped __ -
methyl-cysteine derivatives accumulation.
IffiDle I g fw
"~---- --- M:xIium

Water
Root fiwoootyI
M::SO 1.8OiQ.24 (100) 3.22{).IS (100)
Leaf
3.5(}f!).07 (100)
'-1--'-'---1-._--.___.___._ M: O.17O.01 (100) O.O3O.02(100) O.I&W.03(100)
..0. Oxygen permeated Metharol M::SO O.66OJJ9 (37) 2.420.28 (75) 285O.1O (81)
M: O.l1O.OI (65) O.(1)().02(300) O.I&W.OI (100)
Low Oxyge~-'Q"-O
MGS M:SO o.28O.07( 16) 3.65O.20 (I 13) 3.76O.l7(107)
M: O.3IO.06(1&2) 1.07O.14(J5700) 1.16O.1l (644)
50 100 MGS 0 O.3OO.04 0
Storage (Hr)
Values are meansSE of three determinations.
Figure 1. MCSO changes under various conditions

(0 and 20C) during storage of broccoli flowers of
four determinations
3. Conclusions
These results indicate that MeSO accumulation is related to rapid growth of organs. M-
GS may be a possible precursor of MeSO, but the relationship between methanol
application and MeSO formation was not clear. Germinating Kaiware radish is a good
material for understanding synthetic pathways of S-alkyl-cysteine-sulfoxides.
4. References
l. Hansen, M., Buttery, R. G., Stem, D. J., Cantwell M. I. and Ling L.C.(1992) Broccoli storage
under low-oxygen atmosphere: identification of higher boiling volatiles, J. Agric. Food Chern. 40,
850-852.
2. Marks, H. S., Hilson, 1. A., Leichtweis, H. C. and Stoewsand, G. S. (1992) S-methylcysteine
sulfoxide in Brassica vegetables and formation of methyl methane-thiosulfinate form Brussels
sprouts, J. Agric. Food Chern. 40, 2098-210 1.
3. Lancaster, 1. E. and Shaw, M. L. (1989) Glutamyl peptides in the biosynthesis of S-alk(en)yl-L-
cysteine sulphoxides (flavour precursors) in Allium, Phytochemistry 28, 455-460.
ACTION OF 1,1-DIMETHYL-4-(PHENYLSULFONYL) SEMICARBAZIDE
(DPSS), A NEW ANTISENESCENCE PRESERVATIVE FOR CUT
CARNATION FLOWERS
S. SATOH, M. MIKAMI, S. KIRYU, T. YOSHIOKA AND N. MIDOH*

Laboratory of Bio-adaptation. Graduate School of Agricultural
Science. Tohoku University. Tsutsumidori-amamiyamachi I-I. Aoba-ku.
Sendai 981-8555. and *Meiji Seika Kaisha Ltd. Yokohama. Japan
1. Introduction
Increasing flower's longevity by blockage of the onset of senescence has economical

importance. Currently, STS (silver thiosulfate complex anion), is being used as an anti-
senescence preservative in the cut-flower industry. But, STS contains a heavy metal ion
(Ag+) and has a potential environmental hazard. Therefore, it is desired to have
alternatives to STS, which are safe for organisms and have a less risk for environmental
pollution. DPSS is a novel preservative for cut carnation flowers, which were
developed recently [1] and has just come to the market in Japan. Its activity to retard
carnation flower senescence is compatible to or more than that of STS. DPSS is safe for
organisms including mammals, because its oral and dermal administration causes no
acute toxicity in mice and exerts no mutagenic effects by Ames test.
Previous investigations showed that the inhibition of ethylene production is
responsible for DPSS's antisenescent action in cut carnation flowers [I], and DPSS did
not inhibit the in vitro activities of both ACC synthase and ACC oxidase obtained from
senescing carnation petals [2]. Also, DPSS did not affect the ethylene-induced
senescence in carnation flowers, suggesting no inhibition to the action of ethylene [1].
In the present study, we examined details of the inhibition by DPSS of ethylene
production in carnation flowers.
2. Effects of DPSS on Changes in Ethylene Production, ACC Content and ACC

Synthase Activity
Figure 1 shows changes in ethylene production, ACC content and ACC synthase in cut
carnation (cv. Nora) flowers treated continuously with or without 0.08 mM DPSS at 23-
25C during I-week after the start of the treatment of fully opened flowers. At given
times, ethylene production was measured with whole flowers, and then their petals were
subjected to the assay of ACC content and in vitro ACC synthase activity.
In control flowers, ACC synthase activity and ethylene production showed
simultaneous transient increases, although the former started to increase earlier than the
latter, with their maximum at day 5 when petals began to wilt. ACC content began to
increase gradually from day 5. These changes were similar to those reported previously
[3]. On the other hand, in the DPSS-treated carnation flowers, there was no significant
441
442
increase in the activity of ACC synthase and the amount of ACC, which were most
probably responsible for no induction of ethylene synthesis. The DPSS-treated flowers
remained fresh for more than 2 weeks, but finally lost its freshness by drying-up oftheir
petals. Combined the present findings and foregoing ones, it seems that DPSS exerted
its inhibitory action on ethylene production through the inhibition of the synthesis of
ACC synthase protein.
2.50 r--~-------=------'
2.00 --+-Control
-;:;- ..... O.OSmM DPSS
,,'"
jj { 1.50
.g=a
III E 1.00
.=.
0.50
0.00 ~ _ _--;_ _':::::::'-ii>--_ _ _- _
o 2 3 4 5 6 7
Days
.,.,. 0.8
~ 0.6
1 0.4
~ 0.2
........................................
0
0 2 3 4 5 6
Days
0.04 i----------------,
2 3 4 5 6 7
Days
Figure 1. Changes in ethylene production (top), ACC content (middle) and ACC synthase activity (bottom) in
cut carnation flowers treated continuously with or without 0.08 mM DPSS
3. References
1. Midoh, N., Saijou, Y., Matsumoto, K. and Iwata, M. (1996) Effects of 1,I-dimethyl-4-(phenyl-
sulfonyl)semicarbazide (DPSS) on carnation flower longevity, Plant Growth Regul. 20, 195-199.
2. Satoh, S., Oyamada, N., Yoshioka, T. and Midoh, N. (1997) 1,I-Dimethyl-4-(phenylsulfonyl) semi-
carbazide (DPSS) does not inhibit the in vitro activities of l-aminocyclopropane-l-carboxylate
(ACC) oxidase and ACC synthase obtained from senescing carnation (Dianthus caryophyllus L.)
petals, Plant Growth Regul. 23,191-193.
3. Bufler, G., Mor, Y., Reid, M.S. and Yang, S.F. (1980) Changes in I-aminocyclopropane-l-
carboxylic-acid content of cut carnation flowers in relation to their senescence, Planta 150, 439-442.
DIFFERENCES IN POSTHARVEST CHARACTERISTICS OF MINIATURE
POTTED ROSES (ROSA HYBRIDA)
R. MULLER!, A.S. ANDERSEN!, B.M. STUMMANN2 and M.

SEREK!
JDepartment of Agricultural Sciences, Horticulture, The Royal
Veterinary and Agricultural University, Thorvaldsensvej 57, DK-1871
Frederiksberg C, Denmark, 2 Department of Ecology and Molecular
Biology, Genetics and Microbiology, The Royal Veterinary and
Agricultural University, Thorvaldsensvej 40, DK-1871 Frederiksberg C,
Denmark.
1. Introduction
Miniature potted roses (Rosa hybrida L.) are an important horticultural crop in
Denmark. Leaf yellowing, flower, bud and leaf abscission can be important quality
problems in miniature roses during marketing [2]. Selected cultivars were
characterized with respect to natural ethylene production, endogenous ethylene in
response to postharvest stress, ethylene sensitivity and/or ethylene binding in petal
tissue.
2. Longevity Test
In a longevity test miniature rose cultivars held in ethylene-free air varied dramatically
in their postharvest characteristics. The percentage of good flowers on day 10 and 20
showed significant differences among 9 cultivars of Parade roses (Poulsen Roser,
Fredensborg, Denmark) and among 6 cultivars of Kordana roses (Rosen Kordes,
Sparrieshoop, Germany). In some short-lived cultivars such as 'Bronze', 100% of the
flowers had faded after 12 days. In long-lived cultivars like 'Vanilla' or 'Charming',
less than 10% loss in display quality took place after the same period [I].
3. Ethylene Sensitivity and Ethylene Production
Exposure to exogenous ethylene resulted in distinctly reduced percentage of healthy

open flowers in Parade and in Kordana roses. A concentration of 0.5 J.lL.L-! ethylene
for 6 days resulted in more than 50% faded flowers in 'Bronze' and 'Charming', while
'Pink Marina' only exhibited 30% and 'Vanilla' less than 25% loss. Leaf, bud
abscission and flower senescence was accelerated when plants were exposed to
exogenous ethylene, and there were marked differences in sensitivity and response to
ethylene among cultivars.
443
444
10,---------------,
vanilla Pink Marina Charming Bronze

flower stage
Figure 1. Ethylene production in senescing Figure 2. Ethylene production in open flowers

flowers of Rosa hybrida cultivars expressed on of R .hydrida after 4 days transport simulation.
fresh weight basis. Error bars represent SE. Error bars represent SE.
Ethylene production of excised flowers was measured at 6 stages of development.

In some cultivars flower senescence was accompanied by a clear climacteric rise in
endogenous ethylene (,Bronze, Vanilla'), and in others there was only a moderate or
very low ethylene production (Fig. 1). Simulated transport stress (darkness and
shaking) resulted in significant ethylene production in 'Bronze', but did not distinctly
affect endogenous ethylene in three other cuItivars Ethylene binding in petal tissue,
measured as described in [3], was approximately identical (k.! = 0.14 nL.L- I ) for
cultivars with different postharvest characteristics.
The abundance of ACC oxidase transcripts, detected by a Pelargonium cDNA
sequence, increased concomitantly with the ethylene climacteric in senescing rose
petals. The ACC oxidase transcripts peaked at an earlier flower stage in a short-lived
cuItivar ('Bronze') than in a cultivar with long postharvest life (,Vanilla').
4. Discussion
The results suggest that ethylene is an important natural regulator of rose flower
senescence at least in some cultivars; variation in postharvest life is due to differences
in endogenous ethylene, and in sensitivity to exogenous ethylene. Natural longevity
was not correlated with low sensitivity to ethylene, apparently flower life in the
absence of ethylene was related to timing of the onset of ethylene production. The
cultivar 'Vanilla' with excellent longevity in air was also almost insensitive to
exogenous ethylene and may be useful for improving display life and ethylene
resistance of miniature potted roses.
5. References
I. MOiler, R., Andersen, AS. and Serek, M. (1998) Differences in display life of miniature potted roses
(Rosa hybrida. L.), Scient. Hart. 76, 59-71.
2. Serek, M., Sisler, E.C. and Reid, M. (1996) Ethylene and the postharvest performance of miniature
roses, Acta Hart. 424, 145-149.
3. Sisler, E.C. (1979) Measurement of ethylene binding in plant tissue, Plant Physiol. 64, 538-542.
DRY WEIGHT VARIATIONS AS INFLUENCED BY ETHYLENE INSIDE
TISSUE CULTURE VESSELS
R. JONA AND D.TRAVAGLIO

Dipart. di Colture Arboree, & CVT CNR, Universita di Torino. Via
Leonardo da Vinci 44, 10095 GRUGLIASCO TO, Italy
In previous papers the effect of ethylene developing inside the culture vessel was
reported to produce negative effects on the growth of plant lets [1,2,3,4,5]. In order to
gain more precise information, ethylene was added in controlled quantity by injection in
the culture vessel [6]. It has been observed that the reaction of the various species was
not equally intense. Consequently it appeared interesting to analyse the variations of
the weight of dry matter in species with opposite sensitivity. 46 plantlets grown in vitro
have been used of Malus communis Mill. and of Vitis vinifera L. The plants were
multiplied and grown as usual according to their individual protocols.and singularly
plugged into small cellulose pads (Sorbarod) soaked with the respective basal media,
with the gelling agents omitted. into special 100 ml Erlenmayers with a screw hollow
crown cap with a rubber membrane sealing the hole. From day 0 to day 18, every 3
days, the ethylene produced by each plant, as reaction to the initial addition of 30 III of
ethylene, was measured. From the reported data it clearly appears that ethylene added
at the inception of the experiment, does not affect nor produces reaction in the
grapevine plantlets. Ethylene does not increase into the sealed bottles into which
ethylene has been added preliminarily. Also the dry weight of plantlets along the two
weeks of the experiment do not show any significant variation both in the untreated and
the treated plantlets. Conversely the apple plantlets react sharply to the introduction of
ethylene into the vessel. Synthesis of ethylene is elicited by the aliquot introduced
initially and its quantity increases sharply with the ongoing days. Conversely the dry
weight of the plantlets decreases swiftly on the early days of the treatment and it
remains significantly lower than the initial level along the whole length of the treatment.
The percent of decrease is not constant, though it is always important. From such a
behaviour we may speculate that the loss of dry weight is rather precocious and rapid
and that there are rather important individual variations and no specific trend can be
identified. This may mean that once a platform is reached, no matter how harmed is the
plant, there is no further loss of dry weight. It is conceivable to suppose that, once the
plant is intoxicated by the increase of ethylene, not only the photosynthetic functions
are harmed and inhibited as demonstrated by the decrease of chlorophyll [6], but also
the mechanism of demolition and exploitation of the existing polysaccharides, in order
to balance the lack of newly synthetized sugars, appears to be inhibited. When the
threshold is bypassed the metabolism of the plantlet is so altered that it cannot even lose
(i.e. exploit) the existing dry matter. This experiment was not drawn to verify the level
445
446
of this threshold, but its existence appears rather conceivable. Conversely it is rather
interesting to observe that in the untreated plantlets
,----_._-_. __._-----------_ ..
NO ETHYLENE ADDED; ETHYLENE ADDED
OPEN CAPS
8
7 50 T
40 1
E- "'-1 6 I
6 ~5 30 -;
~
>- ~3
54 i
20 .;.
iJ:>. IJ. .~'

~
irir-i--n+-ii:-THri
Ci '#.2
.. 10 1
U U U U:
0
.,., t-
<'"l
>-
>- >- >- ~
o
-
:!
>- >-
-10 -
-20 1 L.J
Ci Ci Ci
Ci

Ci Ci Days 3 6 9 12 15 18
DApple Grapevine _ _ _ _ _ Apple Grapevine
the behaviour is rather specular. The grapevine do not significantly increase their dry
weight even if the exchanges of gas with the external atmosphere are assured. While the
apple plantlets increase intensely their dry weight just during the short lag of time of the
experiment.
This means that the growth metabolism is more rapid in the apple than in the
grapevine, but it appears also different in its behaviour. On the other hand, it may be
appropriate to remind that not only the growth habit, but also the final results are
different in the two plants.
References
L Jona, R_, Gribaudo, I. and Vigliocco, R. (1984) Effects of naturally produced ethylene in tissue culture
jars, in Y. Fuchs and E. Chalutz (eds.) Ethylene: PhYSiological and Applied Aspects, Kluwer Academic
2. Jona, R., Gribaudo, I. and Vigliocco, R. (1987) Natural development of ethylene in air tight vessels of
GF 677, Plant Micropropagation in Horticultural Industries, Symp. Florizel87 Arion, Belgium
3. Jona, R. and Gribaudo, I. (1990) Ethylene production in tissue culture of peach x almond hybrid,
tomato, sweet cherry and grape, Acta Hort. 280:445-9.
4. Jona, R., Fronda, A., Gallo, A. and Cattro, A (1993) Ethylene accumulation inside the tissue culture
vessel, Acta Hort. 329: 206-8.
5. Jona, R., Fronda, A., Cattro, A. and Gallo, A. (1993) Ethylene synthesis by fruit plants cultured in vitro,
in J. C. Pech at al. (eds.), Cellular and Molecular Aspects of the Plant Hormone Ethylene, Kluwcr
Academic Publishers, Dordrecht, pp. 375-376
6. Jona, R., Callro, A, and Travaglio, D. (1997) Chlorophyll content as index of ethylene inside culture
vessels, Acta Hort. 447, 229-30
Index of Authors
A
Abdi, N., 427 Cobb, B.G., 103
Alderson, P.G., 255 Coonfield, M.L., 59
Alferez, F. ,183 Copes, B., 371
AI-Khalifah, N.S., 255 Cubells-Martinez, X., 137
Alonso, J.M., 137
Andersen, A.S., 443 D
Antunes, M.D.C, 433 De Jong, A. J., 209
Ayub, R., 105 De Martinis, D., 157
De Paepe, A., 71
B De Pauw, I., 71
Barrett, J.E., 357 Dilley, D.R., 7
Bartoszewski, G., 399 Ding, W., 65
Bauchot, A.D., 1,305 Dodson, A.T., 365
Ben-Arie, R., 405 Dourtoglou, Y., I3
Bennett, A.B., 395 Drew, M.C., 145,339
Benvenuto, E., 157
Berkovitz-Simantov, R., 151 E
Bernadac, A., 111 Ehara, Y., 285
Bertran, A., 71 EI Yahyaoui, F., 105
Bidonde, S., 35 Elsgaard, L., 41 1
Bihun, M., 197 Elstner, E.F., 345
Binder, B., 51 Esch, J. J., 51
Black, C.R., 187 Escribano, M.I., 327
Bleecker, A. B., 51 Eyzaguirre, J., 431
Bonghi, c., 31, 249, 267
Botella, J.R., 29 F
Botondi, R. 105 Faragher, J.D., 273
Bouzayen, M., 105, Ill, 181, 395 Fedorowicz, 0., 399
Brown, K.M., 271 Finkelstein, D. B., 339
Finlayson, S.A., 145,339
C Fox, E., 119
Cantliffe, D.J., 191 Frasse, P., 181
Casadoro, G., 243, 269 Friedman, H., 151
Castellano, J.M., 397 Fujimoto, S., 285
Cavallaro, A.S., 29
Cazzonelli, c.1., 29 G
Chamarro, J., 397 Gallie, D.R., 221
Chang, S.c., 65, 221 Gamble, R.L., 59
Chatzopoulos, P., 321 Gherraby, W.. 321
Chaudhry, Z., 285 Giovannoni, J.J., 119,249
Clark, D.G., 357 Glick, B. R., 293
Clendennen, S., 371 Gong, D., 165
447
448
Goren, R., 261 K~pczyilski, J., 193

Granell, A., 137 Kettunen, R., 299
Grierson, D., 381 Khalchitski, A., 405
Guis, M., 105, 395 Kieber, J. J., 37
Kiryu, S., 441
H Klee, H.J., 227, 351, 357
Hadfield, K.A., 395 Koussissi, E., 13
Haegman, M .. , 71 Kramer, M.G., 371
Haenen, I., 157 Ku, V.V., 401
Halevy, A. H., 151,203
Hall, E., 51 L
Hall, M.A., 77 Langebarte1s, e., 345
Handa, A., 387 Lara, I., 185
Hase, S., 285 Larsen, P.B., 65
He, CJ., 103, 145 Lashbrook, C.C., 227, 351
Henderson, J., Latche, A., 35, 105,395
Hilioti, Z., 271 Leclercq, J., 111
Hoeberichts, F.A., 217 Lee, I-J., 145
Hofinan, P.J., 189 Lee, S., 119
Holford, P., 427 Leikin-Frenkel, A., 277
Honma, M., 33 Leiva-Brondo, M., 437
Huber, DJ., 191 Lelievre, J.M., 105
Hunter, D.A., 165 Lers, A., 405
Hussain, A., 187 Leshem, Y.Y., 401
Li, J., 293
I Linden, J.e., 85
Imaseki, H., 21 Lind-Iversen, S., 271
Lindstrom, J.T., 195
J Lo Scalzo, R., 419
Jia, YJ., 33 Lurie, S., 405
John, P., 1,365,431
Jona, R., 445 M
Jones, B., Ill, 181 Macnish, A.J., 189,273
Jones, M.L., 195 Madi, L., 277
Jordan, W. R., 103,339 Makris, A., 321
Joyce, D.e., 189,273 Malepszy, S., 399
Malorgio, F., 275
K Mariani, e., 157,307,343
Kadyrzhanova, D., 7 Masuda, R., 439
Kakuta, Y, 33 Matsui, H., 33
Kaneko, K., 439 Matsumura, W., 371
Kanellis, A.K., 321,433 Matloo, A. K., 387
Kang, B.G., 21 McCully, T.J., 7
Kangasjarvi, J., 299, 345 McGlasson, W.B., 427
Kannan, P., 119 McManus, M.T., 165
Kellogg, K. J. A., 371 Mehta, R. A., 387
449
Meir, S., 151,235 Prohens, J., 437

Merodio, C., 327 Pmsky, D., 277
Mertens, J., 333
Michaeli, R., 235 R
Midoh, N., 441 Ramassamy, S., 35
Mikami, M., 441 Ramina, A., 31, 249, 267
Miyamoto, K., 173 Randlett, M.D., 59
MOder, W., 345 Rasori, A., 31
Moffatt, B. A., 293 Reid, M.S., 189,273
Moggia, c., 431 Reynolds, E.A., 1
Morgan, P. W., 103, 145,339 Richards, C., 271
Mori, H., 21,347 Riov, J., 235, 261
Moshkov, I.E., 77 Roberts, J.A., 187,381
Mottram, D.S., 365 Rodriguez, F. I., 51
Moya, M.A., 431 Rose, J .K.C., 395
Muller, R., 443 Rosenberger, I., 151
Mullet, J.E., 145 Ruperti, 8., 31,249,267
Munoz, M.T., 327
S
N Saito, M., 439
Nascimento, W.M., 191 Sanchez-Ballesta, M.T., 137
Nell, T.A. ,357 Sandermann, Jr. H., 345
Niemirowicz-Szczytt, K., 399 Saniewski, M., 73
Novikova, G.V., 77 Sanmartin, M., 321
Nuez, F., 437 Satoh, S., 285, 441
Scapin, A., 267
o Schaller, G.E., 59
Osborne, D. J., 129 Serek, M., 45, 443
Overmyer, K., 299 Sfakiotakis, E., 433
Shah, S., 293
p
Shockey, J.A., 65
Padmanabhan, V., 119 Simons, D.H., 189
Pan, Z., 65 Sisler, E.C., 45
Park, D.H., 21 Smalle, 1., 71
Pateraki, I., 321,433 Smigocki, A., 399
Pech, J.C., 35, 105, 395 Smith, A.R., 77
Penrose, D. M., 293 Soiomos, T., 313, 387
Peters, S., 371 Sonego, L., 405
Peterson, P. A., 95 Stella, L., 35
Petritis, K., 13 Stummann, 8.M., 443
Pezzarossa, B., 275
Pezzotti, M., 157 T
Philosoph-Hadas, S., 151,235 Tatsuki, M., 347
Phisalaphong, M., 85 Taylor, LB., 187
Pieper, M., 371 Testoni, A., 419
Prescottand, A.G., 1 Tieman, D., 351
450
Tomasin, C.A., 243,269 Yoshioka, T., 285, 441

Tonnuti, P., 31, 249, 267, 275
Tournier, B., 111 Z
Trainotti, L., 243, 269 Zacarias, L., 183,381
Travaglio, D., 445 Zegzouti, H .. , 111, 181
Tucker, M., 387 Zhou, D., 387
Zhou, H., 405
U Zutkhi, Y., 405
Ueda, J., 173
V
Van Caeneghem, W., 71
Van der Plas, L.H.W., 217
Van Der Straeten, D., 71, 333
Van Montagu, M., 71
Van Poucke, M., 333
Vandenbussche, F., 71
Vangronsveld, J., 333
Vanwinkle, J. E., 371
Vendrell, M., 185
Ververidis, P., 433
Vioque, B., 397
Vlachonasios, K., 7
Voesenek, L.ACJ., 307, 343
Vrebalov, J., 119
Vriezen, W.H., 307, 343
W
Wang,Z.,7
Warner, T., 7
Wen, C.K., 65
Whitehead, C. S., 203
Whitelaw, C., 381
Wills, R.B.H., 401
Winer, L., 261
Wing, R. A, 339
Woeste, K.E., 37
Wolff, K. A, 371
Woltering, EJ., 151,209,217
Woodson, W.R., 195
y
Yakimova, E. T., 209
Yoo, S.D., 165
Yoon, I. S., 21
Index of Keywords
A
Abscisic Acid (ABA), 21-25, 184-187, Alpha-aminoisobutyrate, II
204 D-alpha-aminobutyrate, II
-deficient mutant (notabilis), 187 Amaranthus caudatus, 193
-ethylene relationship, 187 I-aminocyclopropane-I-carboxylic
-responsive element, 26 acid (ACC) deaminase, 33-34, 293-
Abscission, 132, 173, 175, 228, 236, 297
246,252-259,273-274,381-384 activity, 294
competence, 227 gene, 296
in tomato, 384 I-aminocyclopropane-I- carboxylate
floral organs, 271 (ACC), 4, 8, 19-20, 31, 33, 72, 74,
flower explants, 382 108,131,185,192,199,214,227,
leaves and flowers, 269 235,240,285,295-297,303,336,
pedicel, 123,383 345,372,388,397,429
petal, 272 apoplastic, 345
-related-p-l,4-glucanases, 243 binding Site, I 1
signal, 135 carboxyl group, 7
zone, 129, 133-134,229,235,239, content, 148, 174, 185-186, 287,
243,249,268,270-271,381,384, 290,294,301,345,441
391 -enhanced leaf abscission, 240
zone ACC synthases, 229 extracellular, 33
zone receptors, 229 -insensitive mutants, 72
zones of pepper, 270 intracellular, 33
Acetates, 422-423 oxidation, 16
Actinidia chinensis (kiwifruit), 46, production, 288
402-403,433 turnover, 290
Activated oxygen species (AOS), 299, (l-aminocyclopropane-1- carboxylate
304 (ACC) oxidase, 1-4, 8-13, 30, 33,
ADC activity, 328-329 35,131,157,185,285,290,297,
Adventitious root, 357, 361 304,313,316,331,345,365,381,
Aerenchyma, 103, 145, 148-149,339 388,395,405,408
Alcohol dexydrogenase (ADH) 317- activity, 2, 4, 7, 15,32, 145, 147,
318 159,167,169,174,193,229,288,
Agrobacterium tumefaciens, 22, 159, 327-330,344,384,397,427,433
182,372-373,399 antisense, 5, 109, 365-369, 383-384,
ain2,72 395-396
D-alanine, II apex-specific, 169
Albedo, 403 cDNAs, 343
Alcohol acetyltransferase, 367 down-regulation, 160
Alcohols, 419, 422 genes, 32,158,165-170,301,343,
Alkyl-cysteine-sulfoxides, 439 366,384
Allium, 439 gene expression, 31, 158-159, 162,
Alloxylon pinnatum 273-274 165,167,230
451
452
gene silencing in transgenic tobacco, Antifungal compounds, 278

159 l-acetoxy-2-hydroxy-4-oxo-
inhibitors, 13 heneicosa-12, 15-diene (diene), 277
mRNA, 145-149, 160,204,230,344 compound gossypol, 280
promoter, 302 antifungal diene, 278, 281
protein, 185 Antirrhinum majus, 151-152
recombinant, 35 Anti senescence preservative, 441
recombinant apple, 14 Antisense plants, 105-109, 121, 125,
site-directed mutagenesis, 7, 8 158-160,321-324,365-369,378,
transcripts, 314, 444 381-385, 389-396
1-aminocyclopropane-1- carboxylate ACC oxidase, 396
(ACC) synthase, 2, 13,21,29,33, ACC oxidase melons, 109, 395-396
37-39,131,174,185,196,204,285, antisense ACO-l gene, 383
290,297,304,315,330,331,343, antisense ACO / AS plants, 384
345,347,372,388,405,408,433, antisense fruit, 365, 366
441 antisense HAP5c, 321
activity, 105, 109-108, 153, 186, Apoplast,2
196,229,287,303,333,336,345, Apoplastic washing fluid (A WF), 345
434, 441-442 Apoptosis, 209, 211, 213
genes, 21, 105, 108, 151-154, 340, Apple, 14,424,432
343,347 fruits, 13
LE-ACSIB, 347, 348 Arabidopsis Ihaliana, 38, 52, 65, 68,
LE-ACS2,348 69, 71- 74, 79-82, 243-246, 270,
LE-ACS2, 3-4, 347 300,302,321,333,337,352-353
LE-ACS6 mRNA, 347 ERS gene, 391
LE-ACS6 mRNAs, 348 ETRI,391
transcripts, 196, 3 14 a-Arabinosidasse, 105, 106
Vr-ACS/,22-23 Arginine decarboxylase (ADC), 328
Vr-ACS6, 22-23, 26 Aroma, 367, 419, 421
Vr-ACS6 of mung bean, 26 biosynthesis 419
Vr-ACS6 promoter activity, 24 extraction, 366
Vr-ACS6 promoter-GUS chimeric Aromatic oil glands, 40 I
gene, 22 Ascorbic acid, I, 2, 18
a-Aminobutyric acid, 297 Autophosphorylation, 59, 61
y-aminobutyric acid (GABA), 328, 330 Auxin, 21-22, 182, 198,204,228,236,
Aminoethoxyvinylglycine (AVG), 151, 240,255-259,361,384,391,398,
191-192,235,240-241,293,336 -response factor, 182
Aminooxyacetic acid (AOA), 204, 288 -induced ethylene production, 21,
Aminotransferases,30 152
Annona cherimola, 328 -inducible gene, 25
Annurca, 419 -responsive element, 25
Anoxia, 337 -specific isogene, 22
enzymes, 3 16 Avocado fruits, 277-278
proteins, 3 13 Azospirillum, 295
Anther, 158, 270
Anthracnose, 95
453
B Cellulase, 129- I 35, 271, 272, 432

ba4 mutant, 95, 97 activity, 131-134,339
BAC library, 120 gene expression, 134, 27 I
Baccatin III, 85 Charentais melons, 366
Bacterial ACC deaminase, 294 Cherimoya, 328-33 I
Banana,46,48,315 fruit ripening, 327
fruit, 189,206 Chilling, 235, 327, 329
fruit ripening, 190 disorder, 405
-treated with propylene, 190 injury, 330
Barren mutant, 96 stress, 239, 24 I
BcI-2,211 temperatures, 238
Begonia etatior, 41 1- 414 -induced leaf abscission, 235-236,
Benzyladenine (BAP), 79 238,240
Benzylaminopurine (BA), 22 Chimeric promoter, 377
BHA, 240, 24 I 2-chloroethyl phosphonic acid
Botrytis, 359 (ethephon), 161, 188,295,437,438
Broccoli,439 chlorophyll, 166, 402
Butanoates, 422 alb binding transcripts, 138
Butylated hydroxyanisole (BHA), 235 degradation, 138
polypeptides, 138
C Chrysanthemyl alcohol, 18
Ca2 +, \03 Cin (cytokinin-insensitive) mutant, 37
antagonists, 15 I, 155 Circadian ethylene rhythms, 149
Cadaverine, 388 Citrus deliciosa, 28 I
Campanula, 48 Citrus, 141,261,281,401
Camptothecin, 213, 218 degreening, 184
-induced programmed cell death, flavedo, 183
217 fruit, I 37, 402
Canola, 293-294 fruit maturation, 183
root elongation, 293 fruits, 183
roots, 296 species, 403
Cantaloupe, 369, 371, 377 Citrus sinensis, 183,261- 262
Capsicum annuum, 244 CMV-Y, 289
Carbamylation, 8 -infected leaves, 286-290
Carnation, 46-48, 195, 198, 3 I 4, 3 I 7 Carbon dioxide (C0 2), I, 7-8, 327-328
flowers, 206, 442 high, 328, 330
Carotene, 13 I activation,7-8, I I
Carotenoid biosynthesis, 139 activation of ACC oxidase, 8
Caspases, 209, 2 I I output, 316
Castor bean, 283 short-term high treatment, 327
CCAAT-binding factor, 321 Cocklebur, 177
Cell death, 214 CoClz, 318
Cell wall, 395 Cold storage, 405, 407
degrading enzymes, 105-106, 43 I Colletotrichum gtoeosporioides, 277
hydro lases, 129, 132,228,23 I, 143, Colletotrichum lindemuthianum, 346
249-250,271,372 Competence to ripen, 181
454
Controlled atmosphere (CA) storage, Dark-induced senescence, 221

313 Dehydroascorbate, 2
Copper, 333-337 Developmentally-regulated (DR)
Cotton, 227-228 clones, 181
abscission, 231 Dianthus caryophyllus, 46-47, 200
ACC oxidase gene, 227 Diazocyclopentadiene (DACP), 46
leaves, 230 Diene,278,282
Crucifer, 439 Differential display, 111,249,339
CTR Digitalis, 196
ctr, 77 1, I-Dimetyl-4-(phenylsulfonyl) semic
ctr mutant, 82 arbazide (DPSS), 441
Ctr mutations, 37 3,3-Dimethylcyclopropene (3,3-
CTR,82 DMCP),48
CTRl, 51, 54, 60, 62, 65-68, 71, Diospyros virginiana, 46
124,304 Diphenylene iodonium, 301
CTRI kinase domain, 67 DNA laddering, 209
ctr1 mutations, 71 Double-mutant analysis, 71
CTRI protein, 37, 51, 63 Dry weight, 445
CTR2,37 Dynamic headspace, 420
cucumber mosaic virus yellow strain
(CMV-Y),285 E
Cucumis me/o, 365-366, 371 E. cloacae, 296
Cut flowers, 151 E. coli,35
Cuttings, 361 bacteriophage T3 gene, 372
Cyclamen, 196 E-8 promoter, 389
Cycloheximide, 23 E8/E4 hybrid promoter, 377
Cyclopropane 1,1 dicarboxylic acid, Ear initiation, 96
13, 16 EFC, 186
Cyclopropane-I-carboxylic acid, 11 ElN
Cyclopropene (CP), 48 ein2,74
Cymbidium, 196 ElN2,51,55,304
Cystenyl aspartate-specific proteases, EIN2 protein, 51
210 ein2-1,302
Cystine lyase activities, 439 ein2-l mutant plants, 303
Cyt-b mediated electron transport, 2 ElN3,51,55
Cytochrome oxidase, 316 EIN3 protein, 51
Cytokinin, 21-22, 25, 37, 79 EIN4, 54,65,66, 71,352
antagonises, 77 elicitors, 346
0'1:okinin-insensitive mutants, Cin, Endo-p-mannanase, 191-192
38 Enterobacter cloacae, 295
Cytoplasmic pH, 327 Epi (Epinastic), 119-120
Epi mutant, 120-122
D EpilEpi, 123
DADl homolog (defender against Epi/Epi; Nr/Nr double-mutant, 119
apoptotic death), 211, 340-341 Epicatechin, 278, 283
dadl gene, 217 Epinasty, 120, 122-123,229
455
ER24,113 modulator of programmed cell

ER43,115 death,303
ERS,122,289,309 mutants, 71
ERSI, 54, 65-71, 352 -overproducers, Eta, 37, 38
ERS 1 and ERS2 proteins, 353 ovule development, 162
ERS2, 54, 65-66, 71, 352 perception in tomato, 351
Esters, 365,419,422 production, 131-132, 145, 151-153,
Ethyl 2-methylbutanoate, 365, 367 166,170,186,191-193,203,214,
Ethyl acetate, 366 238,286-287,290,330,333-337,
Ethyl butanoate, 367 347,375,383,397,423,427,429,
Ethyl esters, 367,422 431-434, 441-444
Ethyl esters after harvest, 424 non-enzymatic production, 336
Ethylene postranscriptional regulation of
action, 45, 149, 151 receptor(s), 45, 59, 63, 67, 65, 104,
GA 3,193 124,178,229,267,285,352,381
agonists, 49 receptor gene, 288
allosteric regulation of ethylene receptor protein, ETR I, 85
analysis, 420 removal, 411-414
bending response, 154 removal by biofilters, 415
binding, 55, 85, 92, 443, 444 -oxidizing bacteria, 412-416
binding assay, 46 -regulated (ER) clones, 116
binding proteins, 113 -regulated cDNA fragments, 112
biological removal, 411 -responsive (ER) genes, 111
biosynthesis, 151, 228, 336, 339, -responsive E8/E4 promoter, 373
343,374,388 -responsive elements, 32, 246
consumption, 411, 414 -responsive genes (ER clones), 113
-dependent, 106, 109 rhythmic production, 147, 148
-dependent cell death, 104 role in gravitropism, 155
-dependent and independent role plant apoptosis, 213
pathways in the melon, 109 seed gennination, 193
down-regulated, 112 sensitivity, 141, 148-149,203,229,
evolution, 188,276 235,384,443,444
flower development in tobacco sensitivity factor, 92
plants, 157 signal transduction, 51, 54, 59, 77,
-fonning capacity, 185 81, 103, 121, 125,307
gasing, 189 stress, 333
j asmonates, 91, 173 synthesis inhibitor, 155
-independent, 106, 109 transfonned plants, 161
-induced IAA decarboxilation, 264 treated transgenic flowers, 358
inhibition, 13 treatments, 391
inhibitors, 154 eti5, 77, 79
insensitivity, 48, 73 Eta mutants, 38
insensitive CaMV35S-etr1-1 eta2,41
petunias, 362 eta2 (ethylene overproducer), 37
insensitive petunia flowers, 357, 359 eta3, 38,40
ETR
456
ETR receptors, 51 abscission, 129

etr, 77, 79 abscission zone, 129
family, 53, 56 colour, 420
etrl,74 expression, 140
ETRl, 51, 59-61, 65, 66, 69, 71, 90, firmness, 376, 395, 406, 420, 431-
122,267-289,309,352,388 433
ETRI gene, 59,289 quality 327-328, 365, 374, 377
etrl-l, 352, 358, 392 pedicel abscission zone, 132
etrl-l gene, 388 ripening, 115, 123,137,174,181,
etrl-l petunia flowers, 358 276,357,361,372,382,391-392,
ETR2, 54, 65-69, 71, 352 437
ETR2, EIN4 and ERS2 receptors, 68 ripening control, 125
Le-ETRI,353 ripening in pepino, 438
Le-ETR2, 353 set, 362
Le-ETR3,353 shedding, 132
LeETR4,353 softening, 405, 409
LeETR5,353 Fruitlet
Extended flower life, 357 abscission, 249, 268
abscission zones, 32
F abscission-related genes, 249
Fe (H)-dependent dioxygenase, I Funiculus, 159
Fe Binding site, 9 Furanocoumarins from parsley, 280
Female
sporogenesis, 157 G
sterility, 162 Galactanase, 105-106
-sterile transgenic plants, 160 a and I3-Galactosidase, 431
Fertilisation, 157, 158,200, 203 I3-Galactosidase, 68, 105, 106, 109,
Ficus benjamina, 255 132
in vitro cultures 257,260 Gibberellins
Flavedo GA 3 ,193
flavedo, 137-138,403 GA3 (gibberellin A3), 360
maturation, 138 signaling pathway, 69
specific genes, 141 Gene-silencing approaches, 162
Flavonone-3-hydroxylase, 278 Genetic engineering, 29, 371
Flooding, 103,307,343 Genetically engineering of cantaloupe,
stress, 309 371
Flower(s), 196,443 Geranium flowers, 271
abscission, 273-274 Germination oflettuce seed, 191
abscission zone, 227, 270, 382 Glucanases
and leaf abscission, 382 abscission-related endo-I3-1 ,4-
development, 158 glucanases 243
senescence, 157,362,357-358,382, endo-I3-I,4-g1ucanase, 244, 269
383,443 pepper endo-/3-1 ,4-glucanase, 269
wilting, 196, 199,273,358,382 13-1,3 gl ucanases, 253
Flowering, 203-204
13 1,3-glucanase genes, 249
Fruit
13-1,3-glucanhydrolase,132
457
13-1,4-glucanhydrolase, 129 high temperature-mediated

Glycosidases, 431 differential induction of NR versus
l3-glucosidase, 432 TAEI ethylene receptor 387
Glutathione peroxidases, 264 Histidine kinase, 54, 59-60, 67, 354
Glutathione reductase, 263 activity, 59,62-63, 66, 352
activity,264 histidine kinase domain of ETR 1, 59
G-proteins, 103 Hormonal interaction, 22
Gramineae, 96 Hydrogen peroxide (H20 2), 19,263,
Granny Smith, 185 299
Grapefruit, 403 Hydroxyl radical, 299
Grapevine, 445 Hypersensitive response, 299
Gravistimulation, 151-153 Hypoxia 103-104,148-149,313-314,
Gravitropic process, 154 316,340
response, 151-152 hypoxic stress, 313
gravity-induced ethylene and IAA, hypoxic treatment, 145
153
gravity-induced ethylene I
asymmetry,154 Indole-3-acetic acid (lAA), 22-23, 96,
GTP binding, 77, 79 151-153,242,256-257,261,263,
GTP-binding protein, 81, 111, 115 255,295-297,381,397
GTP-binding proteins, IAA catabolism, 242, 261
Gum induction, 173 IAA decarboxylation, 261-263,265
GUS, 270 IAA levels, 152
activity, 21-24, 245 IAA oxidase, 261-264
expression, 244, 246 IAA-induced GUS activity, 23
gene, 21 IAA-induced GUS expression, 21
reporter gene, 244 Indole butyric acid (IBA), 255-257,
361
H Indole-3-aldehyde (lAId), 262-263
H20 2 , 261, 264 Indole-3-carboxylic acid (lCA), 261-
Hansenula saturnus, 34 263
Headspace, 419-420 Indole-3-methanol, 262
Heat shock, 222 Idioblast, 278, 280
Heme 1M oxidase, 263
biosynthesis, 321 Inflorescences, 273, 382
-activated protein (HAP), 321 Integument primordia, 159
-containing protein, 313 Interaction ofETRl with CTRl, 62
HAP2/3/4/5 complex, 322 Inter-tissue signalling, 129
HAP5c suppression, 325 inter-tissue signalling control of
HAP5c overexpression, 324 ripening and abscission, 135
Hemicellusose, 395 Iris, 203-204
Hexosephosphate isomerase, 346 Iron, 19
Hibiscus, 414 Isoelectric focusing, 35, 226
Temperature IEF and acidic activity gels, 133
high, 191-192 Isoleucine, 365
high temperature stress, 391 Isopenicillin N synthase, 10
458
Isopentenyl transferase gene, 399 Male sterility, 160, 324

lxora coccinea, 235-236 Malus communis, 445
Malus domestica, 419
J a-Mannosidase, 431-432
Jasmonic acid, 173, 176-178,204 mar 1 mutation, 72
MCSO,440
K Mechanical impedance, 339-340
Kalanchoe blossfeldiana, 176 Megasporocyte, 158
Kinases Megasporogenesis, 157, 160, 162
MAP kinase phosphorylated, 81 Melon, 365, 374, 395
MAP kinase, 51, 54, 60, 81-82 transformed melons, 365
activity, 77,80 Metals, 333, 335
MAPKK kinase, 60, 79, 82 2-Methylbutyl, 365
Kinetin, 23 2-Methylbutyl acetate, 367
Kiwifruit (Actinidia chinesis), 46, I-MethylcycIopropene (I-MCP), 45,
402-403, 433 47-48, 113, 151, 189-190,235,273,
274,427,429
L 2-MethylcycIopropanecarboxylic acid,
Latex protein, 249, 252 18
Leaf 3-Methyleneoxindole, 262
abscission, 227, 237-238, 240, 255 2-Methylpropyl, 365
bud abscission, 443 2-Methylpropyl acetate, 367
development, 166 Methyljasmonate, 85, 86, 87, 92,174
expansion, 187-188 Methy1cycIopropene, 79
lamina, 256 Methylthioadenosine, 388
ontogeny, 166 Microbial ethylene consumption, 412
senescence,237,239,382 Monodehydroascorbate, 3
Lettuce, Mosaic Symptom Formation, 288
seed embryo, 191 mRNA differential display, 181,249
seed germination, 191 mRNA stability, 222
seed germination, 192 Multiprotein bridging factor 1, 113
Lipase activity, 131 Mung bean, 21, 24, 46
Lipoxygenase activity, 283 Musa sapientum, 46-48
Lithospermum erythrorhizon, 86 Musa sp, 189
Longevity test, 443 Muskmelon, 106,371
Low oxygen (0 2), 307- 313, 316, 330, Mycobacterium, 412
439 Myelin basic protein, 80
Low temperature, 274
Lycopene,390 N
Lycopersicon esculentum, 46, 47, 218, Naphthalene acetic acid (NAA), 241,
300,397 255-257
NADPH oxidase, 301
Never ripe (Nr),352
M Never-ripe (NR) gene, 121,391
Maize, 95, 96,340 Never-ripe ethylene receptor, 119
roots, 103 NiC1 2 o,318
459
Nicotiana tabacum, 23, 46, 285-286, Pea,46,48

345 Peach, 31,249-250, 267-268, 405-406,
Nitrosoguanidine, 294 409
NMR,283 ETRI,267
NO, 401,402,403 fruitIet abscission, 253
Non-climacteric,29, 137 abscission EGases genes, 243
non-ripening (nor), 120-124,399 Pear, 43 I, 432
genes, 119 Peat-soil biofilter, 411
(nor) tomato mutant, 399 Pectic enzymes, 405
2, 5-norbomadiene (NBD), 46, 48, 151, Pectin, 395
184,196,262,264,303-304,309 Pectin-methyl-esterase (PM E) 105,
NR 405-409
Nr, 120, 124,353-354,381,391 message, 408
Nr gene, 115 protein, 408
NRmRNA,387 Peiargonium, 196, 444
NrlNr, 123 Peiargonium xhortorum, 271
Nucellus, 158-159 Penicillium citrinum, 33
Pepino, 437
o Pepper abscission (caEG2) genes, 243
O 2- production, 301 Peroxidase, 263, 346
o-Octalactone, 424 Persimmon, 46
Octanoic acid, 204-205 Peat-soil, 412
Odour, 365-369 Petiole elongation, 307
Oil cells, 281 Petunia, (Petunia hybrida) 195, 198,
Oil palm, 129, 135 200,204,357,361
fruit abscission, 134 flowers, 358, 360
Oil synthesis, 281 transformed 'V26', 358
Oligosaccharide fragment, 135 Petunia injlata, 159
Orange, 183,402-403 PGPR,294-297
Ovary, 158, 160, 195,213,271,358 Phaiaenopsis, 197-198,203,204
Ovule development, 159 I, 10-phenanthroline (Ph), 288
Oxidative stress, 236 Phenolic compounds, 346
Oxygen, 317 3-Phenylisoserine,85
Ozone (03), 299-304, 345 Phosphoinositides, 103
0 3 induced ethylene emissions, 30 I Phosphol ipases
0 3 sensitive Arabidopsis mutant, C (PLC), 103
301 D (PLD), 103
Phosphorylation, 67
P phyB mutant, 145
Pseudomonas jluorescens, 296 phyB-l mutant, 147, 149
Pseudomonas put ida, 296 Phytochrome A, 146
Paclitaxel, 85-88 Phytochrome B, 145-146
Palm, 129 Phytochrome B deficient mutant, 149
parB and GH3 auxin-responsive Phytophthora injestans, 346
elements, 26 Phytophthora megasperma, 346
Parenchymatous cells, 240 Pineapple, 29
460
Pistil, 158 Proteaceae, 273

Pisum sativum, 46, 47 14-3-3 Protein family, 69
PLC, 104 Protein
PLD,104 association assays, 65, 67
Plums, 427 protein interactions, 65
Pollen, 95,158,161, 195, 197,360 protein phosphorylation, 77, 79-80,
Pollination, 108, 157, 162, 195,203, 103
357,375,377 Prunus persica, 244, 267, 406
-induced senescence, 203 Pseudomonas putida, 294
-induced, and normal senescence, Putrescine, 327, 329,387-390
362 Pyruvate decarboxylase, 317
Polyacetylenic compound faIcarindiol,
280 R
Polyamine(s), 327, 330, 346, 388, 390 Rafkinase, 54, 69, 82, III
biosynthesis, 327--328, 389 Raphanus sativus, 440
putrescine, 327-329, 387-390 Rehydration, 230
spermidine (Spd), 329-330, 327, Retarded growth, 324
387,388,390 Rhizobacteria (PGPR), 293
spermine, (Spm) 327, 329-330, 387, Rhizobia, 293
390 Ribonuclease protection assay, 272
Polygalacturonase (PG) rin, 120, 124
activity, 105-106, 133-134, 405- Ripening, 29-30, 105-106, 132, 173,
410,431 181,328,352,373,387,390,395,
-abscission-specific promoter, 392 420,429,434
exo-polygalacturonase, 105 apple fruit, 185
exo- and endo-polygalacturonases, attached fruit, 427
129 delayed fruit ripening, 362, 371
gene expression, 134 -inhibitor (rin), 119, 121
isoenzymes, 133 -related ACC oxidase, 8
message, 408, 410 -related genes, 121
protein, 405, 408 RNase, 221, 224, 226
Pomelit, 403 activities, 221, 222
Poncirus trifoliata, 281 Rootorshootgrowth,293
Postharvest life, 444 Rooting, 361
Postharvest storage, 366 Root-sourced ABA, 188
Post-translational control, 221 Rosa hybrida, 46, 443
Potent odorants, 365 Rose
Pre-ripening development, 181 flower, 444
Programmed cell death (PCD), 103, miniature, 46, 443
209,217,339 petals and leaves, 46
Promoter RP-ERSl, 307, 309
analysis, 243 RP-ERSI gene expression, 309
region of Vr-ACS6, 25 RP-ERSI GENE EXPRESSION, 310
Propylene, 249, 250 RubisCO, 138
treatment, 32, 434 Rumex palustris, 307-311, 343, 344
-induced clones, 253
461
s Soluble solid content (SSC), 376, 420,

S. cerevisiae, 35 433
S-adenosylmethionine (SAM), 3, 304, Sorghum, 145
327,372,388 Soybean GH3 promoter, 25
S-adenosylmethionine decarboxylase, Spermidine (Spd), 329, 330, 327, 387,
(SAMdc), 331, 387-389 388,390
S-adenosylmethionine hydrolase Spermine, (Spm) 327-330, 387, 390
(SAMase),371-375 Stearoyl-ACP-desaturase, 283
expression, 374, 376 Stearoyl-acyl carrier protein (ACP)
gene, 372 desaturase gene, 277
melons, 377 Stem bending, 152
SAM synthetase, 345 Stigma, 158
Salicylic acid, 388 Stolon, 166
S-alkyl-cysteine-sulfoxides, 440 Stomatal conductance, 187
Secondary dormant (thermo dormant), Storage, 423
193 Style, 158
Seed germination, 74,176, 191, 193, Submergence, 340, 343
358,360 Sucrose synthase, 317
imbibition, 293 Superoxide anion (0 2) , 299, 304
Selenium, 275 production, 301
Senescence, 170, 173, 175, 197,203, Sweet potato roots, 316
221,226,239,270,275,359,383, Systemic infection, 286
389
corolla, 358 T
leaf tissue, 170 TAEl,391
petal, 123 TATA box, 246
process, 387 TATA box-binding protein, 113
-related genes, 140 Taxane
rose petals, 444 production, 85
Shade avoidance, 145 taxane production in plant cell
Shelflife, 189,401,407 culture, 92
Short-chain fatty acids, 203, 204 Taxol,85
Short-term high CO 2 treatment, 327 Taxus canadensis, 85-86, 92
Signal transduction, 79, 115 Taxus cuspidata, 87
Silver thiosulfate (STS), 187,257,259, Telopea speciosissima, 273
441 Terpene-producing trichomes, 281
Site-directed mutagenesis, 7-8, 59, 67 Thaumatin II cDNA, 399
Situ hybridisation, 159 thi mRNA, 139
slo mutant, 74 Thigmomorphogenesis,347
S-methyl-cysteine sulfoxide (MCSO), Titratable acidity, 420
439 Tobacco, 22-26, 79,157-162,169,212
S-methyl-glutathione, 440 243-244, 146,252,260,285-290,
Snapdragon, 151-154 321,324,346,357,362,398
Softening, 106,395,431 transgenic, 21-26, 157, 159-160,
Soil,187,294,339,411 212,244,246,270,288,324
Solanum muricatum, 437 pistil cDNA library, 162
462
protoplasts, 25 transgenic and mutant tomato, 121

transformed, 22, 324 tobacco, 21-26, 157, 159-160,212,
transgenic, 324 244,246,270,288,324
Tomato, 46, 119, 125, 181,217,275, tomato, 29, 115, 122, 124,302,383,
276,300,347,361,384,381,399 390,397,405
transgenic plants, 29, 115, 122, 124, Transposon, 96
302,383,390,397,405 Tree factor, 428
CTRi-like gene: TCTRi, 123 Triacylglycerol, 131
ethylene receptor, 353 Trifolium repens, 165
fruit, 111, 351 Triple response, 38, 71
fruit ripening, 217 Tunicamycin, 340
mutant, 399 Two-component phosphore lay system,
transformed with yeast SAM 67
decarboxylase, 389 Two-component signal transduction
suspension-cultured tomato cells, systems, 59
218 Two-component system, 62
transformed plants, 389 Two-D gel electrophoresis, 223
Touch stimuli, 347 Two-hybrid assay, 67
Trans -phenyl cyclopropane carboxylic
acid, 13 V
Trans- 2-pheny1cyclopropane -1- Valine, 365
carboxylic acid, 18 Vase life, 273
Transcription factor, 113 Vida/aba, 345, 346
Transcriptional activator, 321 Vigna radiata, 23, 46-47
Transformation events, 400 Virus, 285
Transgenic plants, 21-26, 59,105-109, Vilis vinifera, 445
115-116, 120-125, 157-160, 195, Volatiles, 365-367, 421-424
199-200,212,243-246,270,288, Water stress, 230
321-325,354,357-360,372-38878, Wheat, 222, 224
382-383,387-392,395-400,405 White clover, 165
ACC oxidase antisense fruits, 395 Winter radish, 440
antisense ACC oxidase melons, 105 Woolly breakdown (WB), 405, 407
antisense ACC synthase tomatoes, Wounding, 340
106
Arabidopsis thaliana and tobacco X
plants, 321 Xanthine, 301
auxin-overproducing tomato plants, Xanthine Ixanthine oxidase, 304, 310
397 Xanthium pennsylvanicum, 177
CaMV35S-etrl-1 petunias, 357 Xylanase, 214, 432
cantaloupe, 375 7-xylosyl-l0-deacetyItaxol, 85
explants, 383
flowers, 157,358 y
fruit, 105, 108,375,377,396,397, Yeast two-hybrid assay, 65
398
SAMase cantaloupe, 375 Z
transgenic pollen, 160 Zinc, 333-337

P. John, E. a. Reynolds, A. G. Prescott, A.-d. Bauchot (Auth.), A. K. Kanellis, C. Chang, H. Klee, A. B. Bleecker, J. C. Pech, D. Grierson (Eds.)-Biology and Biotechnology of the Plant Hormone Ethylen

Hochgeladen von

Dokumentinformationen

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

P. John, E. a. Reynolds, A. G. Prescott, A.-d. Bauchot (Auth.), A. K. Kanellis, C. Chang, H. Klee, A. B. Bleecker, J. C. Pech, D. Grierson (Eds.)-Biology and Biotechnology of the Plant Hormone Ethylen

Hochgeladen von

Copyright:

Verfügbare Formate

BIOLOGY AND BIOTECHNOLOGY OF

THE PLANT HORMONE ETHYLENE II

SPRINGER-SCIENCE+BUSINESS MEDIA, B.V.

ISBN 978-94-010-5910-7 ISBN 978-94-011-4453-7 (eBook)

Printed an acid-free paper

1. Biochemical and Molecular Mechanisms of Ethylene Synthesis

ACC oxidase in the biosynthesis of ethylene

Analysis of ACC oxidase activity by site-directed mutagenesis of

Evaluation of novel inhibitors of ACC oxidase possessing

Characterization of the promoter of mungbean auxin-inducible

Searching for the role of ethylene in non-climacteric fruits:

Organization and structure of l-aminocyclopropane-l-carboxylate

Metabolism of l-aminocyclopropane-l-carboxylic acid by

Structural modifications of ACC oxidase during catalytic inactivation 35

2. Perception and Signal Transduction Pathways

Characterization of Arabidopsis ethylene-overproducing mutants 37

Control of ethylene responses at the receptor level 45

The Ethylene Signal Transduction Pathway 51

The role of two-component systems in ethylene perception 59

Protein-protein interactions in ethylene signal transduction in Arabidopsis 65

Ethylene signaling: more players in the game 71

The effect of ethylene and cytokinin on GTP binding and

Ethylene and methyl jasmonate interaction and binding models

Barren mutants in maize - a case study in plant signaling 95

Ethylene signal transduction pathway in cell death during

3. Growth and Development and Fruit Ripening

Ethylene-dependent and ethylene-independent pathways in a

Isolation and characterization of novel tomato ethylene-responsive

Analysis of gene expression and mutants influencing ethylene

Ethylene as the initiator of the inter-tissue signalling and gene

Ethylene perception and response in Citrus fruit 137

Phytochrome B and ethylene rhythms in sorghum: biosynthetic

Involvement of ethylene biosynthesis and action in regulation

Ethylene and flower development in tobacco plants 157

ACC oxidase expression and leaf ontogeny in white Glover 165

Interaction of ethylene with jasmonates in regulation of some

Isolation of developmentally-regulated genes in immature tomato

Interaction between ethylene and abscisic acid in the regulation of

Interactions between abscisic acid and ethylene in ethylene-forming

Soil compaction: Is there an ABA-ethylene relationship regulating

Use of I-methylcyclopropene to modulate banana ripening 189

Endo-J3-mannanase activity during lettuce seed germination at

Ethylene and gibberelin in secondary dormancy releasing

4. Ethylene and Senescence of Plant Organs

Regulation and function of pollination-induced ethylene in

The role of short-chain saturated fatty acids in inducing sensitivity

Apoptotic cell death in plants: The role of ethylene 209

Cloning of tomato DADI and study of its expression during

RNAase activities is post-translationallly controlled during the

Ethylene regulation of abscission competence 227

Role of ethylene sensitivity in mediating the chilling-induced leaf

Expression of abscission-related endo-p-l,4-glucanase 243

Differential display and isolation of cDNAs corresponding

Ramina, A., C. Bonghi, J.J. Giovannoni, B. Ruperti and P. Tonutti

Effect of ethylene on the oxidative decarboxylation pathway

An Arabidopsis ETRI homologue is constituvely expressed in

Characterization of caEG2, a pepper endo-8-1,4-glucanase gene

Cellulase gene expression in ethylene treated geranium flowers 271

Use of I-methylcyclopropene to prevent floral organ abscission

Effects of selenium uptake by tomato plants on senescence,

5. Stress Ethylene: Biochemical and Molecular Approaches

Ethylene enhances the antifungal diene content in idioblasts

Stimulated ethylene production in tobacco (Nicotiana tabacum L.,

ACC deaminase is central to the functioning of plant