Article

Introns Protect Eukaryotic Genomes from

Transcription-Associated Genetic Instability
Graphical Abstract Authors
Amandine Bonnet, Ana R. Grosso,
Abdessamad Elkaoutari, ...,
Vincent Geli, Sergio F. de Almeida,
Benoit Palancade

Correspondence
benoit.palancade@ijm.fr

In Brief
By combining the genetic manipulation of
intron content with genome-wide
analyses in both yeasts and human cells,
Bonnet et al. reveal a function for introns
in counteracting DNA:RNA hybrid
(R-loop) formation and its deleterious
impact on genetic stability.

Highlights
d Introns prevent R-loop and DNA damage accumulation on
highly expressed yeast genes

d Insertion of an intron in an R-loop-prone gene attenuates

R-loop formation

d Spliceosome-dependent mRNP assembly, but not splicing,

prevents R-loop formation

d The role of introns in R-loop prevention has been conserved

from yeasts to human

Bonnet et al., 2017, Molecular Cell 67, 608621

August 17, 2017 2017 Elsevier Inc.
http://dx.doi.org/10.1016/j.molcel.2017.07.002
 Molecular Cell

Article

Introns Protect Eukaryotic Genomes

from Transcription-Associated Genetic Instability
Amandine Bonnet,1,5 Ana R. Grosso,2 Abdessamad Elkaoutari,3 Emeline Coleno,1 Adrien Presle,1 Sreerama C. Sridhara,2
Guilhem Janbon,4 Vincent Geli,3 Sergio F. de Almeida,2 and Benoit Palancade1,6,*
1Institut Jacques Monod, CNRS, UMR 7592, Universite Paris Diderot, Sorbonne Paris Cite, 75013 Paris, France
2Instituto de Medicina Molecular, Faculdade de Medicina da Universidade de Lisboa, 1600-276 Lisboa, Portugal
3Cancer Research Center of Marseille (CRCM), Equipe Labellisee Ligue, U1068 INSERM, UMR7258 CNRS, Institut Paoli-Calmettes, Aix

Marseille University, 13284 Marseille, France

4Institut Pasteur, Unite Biologie des ARN des Pathogenes Fongiques, Departement de Mycologie, 75015 Paris, France
5Present address: Sorbonne Paris Cite, Universite Paris Diderot, INSERM U944, CNRS UMR 7212, Institut Universitaire dHematologie,

Hopital St. Louis, 75010 Paris, France

6Lead Contact

*Correspondence: benoit.palancade@ijm.fr
http://dx.doi.org/10.1016/j.molcel.2017.07.002

SUMMARY or high densities of transcription complexes have been shown

Transcription is a source of genetic instability that
can notably result from the formation of genotoxic
DNA:RNA hybrids, or R-loops, between the nascent
mRNA and its template. Here we report an unex-
pected function for introns in counteracting R-loop
accumulation in eukaryotic genomes. Deletion of
endogenous introns increases R-loop formation,
while insertion of an intron into an intronless gene
suppresses R-loop accumulation and its deleterious
impact on transcription and recombination in yeast.
Recruitment of the spliceosome onto the mRNA,
but not splicing per se, is shown to be critical to
attenuate R-loop formation and transcription-asso-
ciated genetic instability. Genome-wide analyses in
a number of distant species differing in their intron
content, including human, further revealed that
intron-containing genes and the intron-richest ge-
nomes are best protected against R-loop accumula-
tion and subsequent genetic instability. Our results
thereby provide a possible rationale for the conser-
vation of introns throughout the eukaryotic lineage.
INTRODUCTION
Gene expression exposes DNA to potentially harmful agents and
comes into conflict with genome duplication and transmission.
Indeed, pioneering studies in budding yeast revealed that highly
expressed mRNA-coding loci display elevated rates of genomic
rearrangements and mutations, identifying transcription by RNA
polymerase II (Pol II) as an endogenous source of genetic insta-
bility (Thomas and Rothstein, 1989; Datta and Jinks-Robertson,
1995). Such transcription-associated recombination and muta-
genesis events have been observed in several species and pro-
posed to rely on multiple mechanisms. Among them, changes in
chromatin or nuclear organization, local negative super-coiling,
to favor the formation of abnormal DNA structures and/or to pro-
voke transcription/replication collisions. Elevated transcription
would thereby ultimately increase the accessibility of the DNA
to extrinsic genotoxic agents, but also to endogenous nucleases
and DNA-modifying enzymes, subsequently leading to DNA
double-strand breaks (DSBs) and mutations, the hallmarks of
transcription-associated genetic instability (reviewed in Gaillard
et al., 2013).
Among the unwanted intermediates that accumulate at tran-
scribed loci and trigger genome instability, DNA:RNA hybrids
(or R-loops) have recently drawn considerable attention (Sollier
and Cimprich, 2015). R-loops are stable hybrids formed between
the template strand of the transcribed DNA and the nascent
mRNA species, thereby generating a displaced single-stranded
DNA (ssDNA). Hybrid formation was proposed to be influenced
by a number of parameters, including DNA sequence, e.g., GC
skew and AT skew, topological constraints, and transcription
levels (Roy and Lieber, 2009; Ginno et al., 2012; Chan et al.,
2014a; El Hage et al., 2014; Wahba et al., 2016). At certain
genomic locations, natural R-loop formation has been reported
to contribute positively to different nuclear processes, including
transcription initiation and termination (Costantino and Kosh-
land, 2015). However, the R-loop accumulation observed in
mutant or pathological situations can be deleterious for genome
expression and stability. Indeed, R-loops decrease Pol II elonga-
tion efficiency, disturb DNA replication fork progression, and
expose vulnerable ssDNA stretches, thereby triggering gene
expression defects, DSBs, and unwanted recombination events
in several distant eukaryotic species (Chan et al., 2014b; Santos-
Pereira and Aguilera, 2015).
In view of the importance of controlling R-loop metabolism for
maintaining genome homeostasis, hybrid accumulation is natu-
rally restricted not only by dedicated factors, including nucleases
of the RNase H family (Wahba et al., 2011) and helicases (e.g.,
Sen1; Mischo et al., 2011), but also through the tight coordina-
tion of transcription with the assembly and the nuclear export
of mRNPs (messenger ribonucleoparticles) (Santos-Pereira
and Aguilera, 2015). Among other examples, R-loop-dependent
genetic instability has been scored in the absence of several

608 Molecular Cell 67, 608621, August 17, 2017 2017 Elsevier Inc.
factors contributing to proper formation of export-competent
mRNPs, notably the conserved THO/TREX and THSC/TREX-2
complexes (Huertas and Aguilera, 2003; Gonzalez-Aguilera
et al., 2008). In addition, previous studies, including systematic
screens, uncovered elevated levels of R-loops or DNA damage
upon inactivation of splicing factors in both budding yeast and
mammals (Li and Manley, 2005; Paulsen et al., 2009; Chan
et al., 2014a). These observations could reflect an indirect contri-
bution of splicing to the expression of factors targeting R-loops.
However, the fact that the artificial insertion of an intron in a re-
porter gene alleviates the transcriptional defects arising in a
yeast mRNP biogenesis mutant (tho) previously argued in favor
of a protective effect of introns in cis (Bonnet et al., 2015).
Spliceosomal introns are intervening sequences that are
removed from the pre-mRNA molecule by two sequential trans-
esterification reactions requiring the recognition of cis-acting
elements by the spliceosome complex. Since their identification
(Berget et al., 1977; Chow et al., 1977), these sequences have
emerged as a distinctive feature of eukaryotic genomes, even
though their frequency and length greatly vary between organ-
isms. However, their functions, as well as the evolutionary con-
straints that drive their maintenance in genomes, have remained
debated. On the one hand, the presence of introns increases the
regulatability and the coding potential of the genome: introns can
modulate mRNA synthesis rates and stability (Heyn et al., 2015),
in particular through developmentally regulated intron retention
(Braunschweig et al., 2014), and allow alternative splicing events
that contribute to proteome diversity (Nilsen and Graveley,
2010). On the other hand, recent advances in transcriptome
profiling have revealed that a meaningful fraction of exon-intron
junctions is constitutively spliced in mammals and thereby un-
likely to contribute to regulatory events (Ryu et al., 2015).
Furthermore, a large proportion of introns can be removed
from the yeast genome without altering gene expression or cell
fitness (Parenteau et al., 2008, 2011). This paradox prompted
us to question whether introns could have been selected and/
or maintained in eukaryotic genes to counteract R-loop forma-
tion through spliceosome recruitment, further reducing tran-
scription-associated genetic instability.
RESULTS
Intron-Containing Genes Display Decreased R-Loop
and DNA Damage Levels in Yeast
We first analyzed a dataset of budding yeast R-loop-prone sites,
mapped by DNA:RNA hybrid immunoprecipitation (DRIP) using
the S9.6 hybrid-specific antibody in cells mutated for RNases
H (RNH; Wahba et al., 2016). Since R-loops mainly stem
from high levels of transcription (Wahba et al., 2016) and as
intron-containing genes, although representing a minor fraction
(4.4%) of protein-coding loci, are heavily transcribed in yeast
(Ares et al., 1999), we focused our study on highly transcribed
genes (>50 mRNAs/hr). Analysis of this category, which ac-
counts for
50% of the transcriptome, allowed comparison of
equivalent numbers of intronless and intron-containing genes
of similar expression levels (Figure S1A). While the propensity
to form R-loops increased gradually as a function of transcription
for both intronless and intron-containing loci (Figure S1B), the
occurrence of hybrids was significantly reduced among intron-
containing as compared to intronless genes in the highest tran-
scriptional class (>50 mRNAs/hr; Figure 1A). Furthermore, for
R-loop-positive loci of this category, hybrid densities calculated
from DRIP sequencing (DRIP-seq) data were strongly reduced
for intron-containing genes (Figure 1B; Table S1). Differences
in transcription levels, gene length, G-C content, GC skew, or
AT skew did not appear to bias the formation of R-loops on highly
expressed intron-containing genes, since these parameters
were not distinguishable between R-loop-positive and R-loop-
negative loci (Figures S1CS1G). In addition, similar conclusions
could be reached when re-analyzing an alternative dataset of
R-loop-prone sites (Figure S1H), which could be detected in
wild-type (WT) cells using a less stringent DRIP protocol (Chan
et al., 2014a), and further associated with hotspots of genetic
instability (Chen et al., 2016).
To strengthen the relevance of these observations, we then
sought a natural situation where intron-containing and intronless
versions of the same gene could be directly compared for R-loop
formation. Among the numerous gene pairs arising from the
whole-genome duplication event that has occurred in an
ancestor of S. cerevisiae (Byrne and Wolfe, 2005), only one
(RPP1A and RPP1B) corresponded to two highly expressed
loci (>50 mRNAs/hr) with a distinct intron content. Strikingly,
although being more transcribed, the intron-containing RPP1B/
YDL130w gene displayed a lower R-loop density than its intron-
less paralog RPP1A/YDL081c (Figure 1B; Table S1). Intron-con-
taining genes are thereby less prone to accumulate DNA:RNA
hybrids than their intronless counterparts.
To further determine whether the presence of introns is the
direct cause of decreased R-loop formation, we performed
DRIP experiments on a yeast strain (Di) in which introns have
been removed from RPL7A and RPL7B, two intron-containing
genes of the highest transcriptional class (Parenteau et al.,
2011; Figure 1C). In WT cells, our DRIP assay readily detected
RNH-sensitive hybrids on YEF3, one of the intronless genes of
this transcriptional class identified in the DRIP-seq analysis,
but it failed to score any RNH-sensitive signal on both intron-
containing RPL7A and RPL7B loci as well as on an untranscribed
region (Figures 1D1G, top panels). However, intron deletion (Di),
while not causing an increased expression of RPL7A/B (Fig-
ure S1I), was sufficient to trigger a specific appearance of
detectable RNH-sensitive R-loops at these two loci (Figures 1D
and 1E, bottom panels).
We then wondered whether the decreased R-loop accumula-
tion detected on intron-containing genes was associated with a
lowered genetic instability. For this purpose, we intersected the
dataset of R-loop-positive loci with the previously reported
genome-wide map of H2A-Ser129 phosphorylation (g-sites; Stir-
ling et al., 2012). This histone modification is a landmark of DNA
damage, including, but not restricted to, R-loop- and transcrip-
tion-dependent DSBs (Stirling et al., 2012). Although H2A-
Ser129 phosphorylation was not systematically detected on
R-loop-prone loci in WT cells, which are likely to maintain non-gen-
otoxic levels of hybrids, g-sites were found to form with a lower
occurrence (Figure 1H) and at a lower density (Figure 1I) on
intron-containing as compared to intronless genes. This observa-
tion was not merely caused by a difference in the number of
Molecular Cell 67, 608621, August 17, 2017 609
Figure 1. Introns Prevent R-Loop and DNA Damage Accumulation on Highly Transcribed Yeast Genes
(A) Occurrence of DNA:RNA hybrids in intronless and intron-containing genes of the highest transcriptional category (>50 mRNAs/hr), evaluated according to a
dataset of hybrid-prone sites detected in the rnh1D rnh201D mutant (Wahba et al., 2016).
(B) DNA:RNA hybrid densities on intronless and intron-containing hybrid-positive loci from (A). The positions of the pair of paralogous genes RPP1A and RPP1B
are indicated.
(C) Organization of RPL7A and RPL7B loci in WT and Di strains. The positions of the deleted introns (dark orange) are indicated.
(DG) DNA:RNA hybrid detection by DRIP-qPCR (percentage of IP; means and SD are plotted; n = 4) at the indicated loci (D, RPL7A; E, RPL7B; F, intergenic; G,
YEF3) in either WT or Di yeast cells. Values from RNH-treated immunoprecipitations appear as hatched.
(H) Occurrence of g-sites in intronless and intron-containing hybrid-positive loci, evaluated according to a ChIP-ChIP dataset of phosphorylated H2A (Stirling
et al., 2012).
(I) g-site densities on intronless and intron-containing hybrid-positive loci.
*p % 0.05, **p % 0.01, and ***p % 0.001; Fishers exact test (A and H), Mann-Whitney-Wilcoxon test (B), Welchs t test (D and E), and Bootstrapping Method (I).
See also Figure S1.

intronless and intron-containing loci, as proved by data bootstrap- ChIP dataset (Capra et al., 2010; Figures S1J and S1K). Collec-
ping (Figure 1I), and it was further confirmed upon re-analysis of an tively, our results thereby demonstrate that intron-containing loci
alternative phospho-H2A chromatin immunoprecipitation (ChIP)- are specifically protected against R-loop and DNA damage

610 Molecular Cell 67, 608621, August 17, 2017

Figure 2. R-Loop-Forming Reporters Allow Scoring of R-Loop-Associated Phenotypes
(A) Principle of the YAT1 reporter genes. The YAT1 gene was expressed either in vitro from the T7 promoter (pT7) or in yeast cells under the control of the GAL1-
inducible promoter (pGAL1). The GAL-YAT1 reporter was integrated between two direct leu2 repeats (dark gray) to score transcription-associated recombination
(J). The position of the 50 and 30 qPCR amplicons used in (I) is indicated.
(B) Electrophoretic mobility of the T7-YAT1 plasmid, either untranscribed or transcribed by the T7 RNA polymerase (T7 RNA pol) and further treated or not with
RNase H (RNH). Nucleic acids were stained with ethidium bromide. The positions of the distinct T7-YAT1 plasmid species, as well as molecular weight markers
(kb), are indicated.
(C) R-loop-forming YAT1 plasmids (from B) were extracted following electrophoresis and further used for dot blotting with antibodies against DNA:RNA hybrids
(S9.6) or double-stranded DNA (dsDNA).
(D) Detection of DNA:RNA hybrids on in-vitro-transcribed YAT1 by DRIP-qPCR (percentage of IP; n = 3).
(legend continued on next page)

Molecular Cell 67, 608621, August 17, 2017 611

accumulation and that removing introns can be sufficient to trigger
R-loop formation.
A Set of R-Loop-Forming Reporters to Score
R-Loop-Associated Phenotypes
We next asked whether, conversely, the insertion of an intron
could protect against R-loop formation and transcription-associ-
ated genetic instability in pathological situations where R-loops
accumulate. For this purpose, we first designed R-loop-forming
reporters by placing the naturally intronless YAT1 gene, a locus
prone to transcription-associated genetic instability (Chavez
et al., 2001), under the control of promoters driving high levels
of transcription in vitro and in vivo (pT7 and pGAL1, respectively;
Figure 2A), since this gene is not expressed in standard growth
conditions (Bonnet et al., 2015). In vitro transcription of the
pT7-YAT1 reporter plasmid triggered the formation of RNH-sen-
sitive species of decreased electrophoretic mobility (Figure 2B),
a typical feature of R-loop-forming sequences (Yu et al., 2006).
These species were further recognized by the hybrid-specific
S9.6 antibody in a dot blot experiment, demonstrating that
they indeed display R-loops (Figure 2C). In addition, our DRIP
assay probed substantial levels of RNH-sensitive R-loops not
only on this in-vitro-transcribed reporter gene (Figure 2D) but
also in vivo, when YAT1 was expressed in WT yeast cells under
the control of the GAL1 promoter (Figure 2E), confirming its
R-loop-prone character.
The GAL-YAT1 reporter was then expressed in yeast cells
lacking the Mft1 subunit of the THO complex, a conserved
mRNP biogenesis factor previously shown to counteract
R-loop formation (Huertas and Aguilera, 2003). Previous reports
had indicated that THO complex inactivation (tho cells) triggers a
pronounced decrease in the transcription of the GAL-YAT1
construct (Chavez et al., 2001; Bonnet et al., 2015). To evaluate
the amounts of mRNAs available to form hybrids in this mutant,
we measured the levels of chromatin-associated, nascent
mRNAs by implementing a reported procedure (Figure S2A; Car-
rillo Oesterreich et al., 2010). In agreement with this study, the
isolated chromatin fractions were depleted for ribosomal pro-
teins, enriched for Pol II and for unspliced ACT1 transcripts (Fig-
ures S2B and S2C). mRNA quantification from these fractions
further confirmed a decreased production of YAT1 mRNAs in
tho cells (Figure 2F), together with a decreased Pol II occupancy
on the YAT1 gene, as scored by ChIP (Figure 2I). To further quan-
tify the fraction of nascent mRNAs that forms hybrids in this
mutant, R-loop levels were measured by DRIP (Figure 2G)
and further normalized to the amount of nascent YAT1 mRNAs
(Figure 2H). This analysis revealed that nascent YAT1 mRNAs
transcribed under the control of the GAL1 promoter have an
increased propensity to form R-loops in the absence of the
THO complex (Figure 2H). Importantly, decreasing the level of
YAT1 transcription in WT cells by using shorter induction times
on the same reporter gene (WTS; Figure 2F) did not lead to a
similar increase in R-loop formation per mRNA (Figure 2H),
demonstrating that the observed R-loop accumulation is not a
mere consequence of normalization but a phenotype specific
to THO inactivation.
To further evaluate the genetic instability triggered by those
hybrids, we scored recombination occurring between two direct
repeats flanking the GAL-YAT1 sequence (Figure 2A). This sys-
tem detected a strong increase in the number of recombination
events arising specifically when the YAT1 locus is transcribed in
the absence of the THO complex (Figure 2J), in agreement with
earlier reports (Chavez et al., 2001; Huertas and Aguilera, 2003).
Importantly, this transcription-dependent hyper-recombination
phenotype was significantly reduced by in vivo overexpression
of RNase H (RNH1; Figure 2J), to a similar extent as observed
in previous studies (Huertas and Aguilera, 2003; Santos-Pereira
et al., 2013). These results thus demonstrate that hyper-recom-
bination on the YAT1 reporter is a consequence of hybrid accu-
mulation in tho cells. In sum, the use of these hybrid-forming
reporters allows us to monitor R-loop levels and the deleterious
consequences of their accumulation when mRNP biogenesis is
further impaired (tho mutants).
Insertion of Introns within R-Loop-Prone Genes
Is Sufficient to Attenuate R-Loop Formation
Having established that our assays score R-loop-dependent
phenotypes at the GAL-YAT1 locus, we inserted a short intron
derived from the RPL51A gene (Bonnet et al., 2015) at the
YAT1 50 end (Figure 3A), a position typical of intronic locations
within the yeast genome (Lin and Zhang, 2005). We first
confirmed that the RPL51A* intron retained its functionality in
this configuration, by monitoring both spliceosome recruitment
and splicing (Figures S3A and S3B).
We then compared both intron-containing and intronless re-
porters for R-loop formation, transcription, and transcription-
associated recombination (Figures 3B3E). While not modifying
the basal, non-genotoxic, hybrid levels scored at the YAT1 locus
in WT cells, the presence of the intron specifically reduced the
propensity of nascent mRNAs to form the R-loops accumulating
in the absence of the THO complex (Figure 3B). Consistently, the
intron alleviated the deleterious effect of R-loops on transcription

(E) Detection of DNA:RNA hybrids on the GAL-YAT1 gene expressed in WT yeast cells by DRIP-qPCR (percentage of IP; n = 3). Values from RNH-treated im-
munoprecipitations appear as hatched. DRIP signals obtained on two control loci, either highly transcribed (YEF3) or untranscribed (intergenic), are indicated.
(F) Nascent mRNA levels detected in WT or tho (mft1D) yeast cells expressing the GAL-YAT1 gene (qRT-PCR, normalized to ACT1 mRNA values; n = 3). WTS, the
induction of the GAL-YAT1 gene was performed for 30 min instead of 5 hr.
(G) DNA:RNA hybrid detection by DRIP-qPCR in WT or tho yeast cells expressing the GAL-YAT1 gene (percentage of IP; n = 3).
(H) DNA:RNA hybrid formation per nascent mRNA in WT or tho yeast cells expressing the GAL-YAT1 gene. DRIP values (from G) were normalized to the amount of
nascent mRNAs expressed from the corresponding strains (from F).
(I) RNA polymerase II (Pol II) distribution on the GAL-YAT1 gene as determined by chromatin immunoprecipitation (ChIP) in WT or tho yeast cells (percentage of IP;
n = 4).
(J) Recombination frequencies (n = 3) for WT or tho yeast strains expressing the GAL-YAT1 reporter and either an empty vector or an RNH1-overexpressing
construct. The frequency of Leu+ prototrophs arising from recombination upon transcriptional induction (Gal) or repression (Glu, hatched) is indicated.
Means and SD are plotted (*p % 0.05 and **p % 0.01; ns, not significant; Welchs t test). See also Figure S2.

612 Molecular Cell 67, 608621, August 17, 2017

Figure 3. Insertion of an Intron within an R-Loop-Prone Gene Prevents R-Loop Accumulation and Transcription-Associated Genetic
Instability
(A) Principle of the yeast intronless and intron-containing YAT1 reporter genes. Both reporters were integrated between leu2 repeats to score transcription-
associated recombination.
(B) DNA:RNA hybrid formation per nascent mRNA in WT or tho (mft1D) yeast cells expressing the indicated reporter constructs. DRIP/nascent mRNA values were
calculated as in Figure 2H (percentage of IP/mRNA; n = 3), and RNH-treated immunoprecipitations appear as hatched.
(C) Nascent mRNA levels detected in WT or tho yeast cells expressing the indicated reporter constructs (qRT-PCR, normalized to ACT1 mRNA values; n = 3).
(D) Pol II distribution on the reporter genes as determined by ChIP in WT or tho yeast cells (percentage of IP; n = 4). Values for the intronless reporter are the same
as used in Figure 2I.
(E and F) Recombination frequencies (n = 3) for WT, tho (mft1D), sus1D, or sen1-1 yeast strains expressing the indicated constructs. The frequency of Leu+
prototrophs arising from recombination upon transcriptional induction (Gal) or repression (Glu, hatched) of each reporter is indicated. Note that SEN1 inactivation
triggers hyper-recombination in both a transcription-independent and a transcription-dependent manner but that the intron mainly decreases the transcription-
dependent phenotype.
Means and SD are plotted (*p % 0.05, **p % 0.01, and ***p % 0.001; Welchs t test). See also Figures S3 and S4.

in tho mutants, as scored by nascent mRNA quantification (Fig-
ure 3C) and Pol II ChIP (Figure 3D). Finally, the intron virtually
suppressed the unwanted recombination induced on the YAT1
gene by THO inactivation (Figure 3E).
Importantly, the presence of the RPL51A* intron did not affect
R-loop formation in the in vitro transcription assay (Figures S3D
and S3E). In contrast, its protective effect was observed in
distinct in vivo mutant situations associated with R-loop accu-
mulation. Indeed, loss of function of either Hpr1, another THO
complex subunit (Figures S4A and S4B), or Sus1, a subunit of
the THSC/TREX-2 that functions downstream of the THO com-
plex in the mRNP biogenesis and export pathway (Figures 3F
and S4C), similarly triggered transcription defects and hyper-
recombination phenotypes that were reduced in the presence
of the intron. Similarly, inactivation of the R-loop-resolving
Sen1 helicase triggered transcription-dependent recombination
on the YAT1 intronless gene (Figure 3F), in agreement with earlier
studies using alternative reporter systems (Mischo et al., 2011;
Stirling et al., 2012), and this phenotype was partially alleviated
on the intron-containing construct (Figure 3F).
In addition, the effect of the intron was not restricted to the
case of the YAT1 gene. LYS2 is a long gene similarly reported
to display transcription defects and transcription-associated
recombination in tho cells (Chavez et al., 2001), and insertion
of the RPL51A* intron at its 50 end partially rescued these
R-loop-associated phenotypes (Figures S4ES4G). Finally, other
intronic sequences were also tested for their ability to protect
against the consequences of R-loop accumulation. Strikingly,
insertion of the RPL35A or SEC27 natural introns at the 50 end
of the YAT1 reporter (Figure 4A) similarly supported splicing
(Figure S3B), and it further alleviated the deleterious effect of
THO inactivation on transcription (Figure 4B) and recombination

Molecular Cell 67, 608621, August 17, 2017 613

Figure 4. Distinct Intronic Sequences Alleviate R-Loop-Associated Phenotypes
(A) Principle of the reporter constructs used in the different panels. All reporters were further integrated between leu2 repeats to score transcription-associated
recombination.
(B) mRNA levels in tho (mft1D) yeast cells expressing the indicated reporter constructs (qRT-PCR, normalized to ACT1 mRNA values; n = 3).
(C) Recombination frequencies scored upon transcriptional induction for tho yeast strains expressing the indicated constructs (n = 3).
Means and SD are plotted (*p % 0.05 and **p % 0.01; ns, not significant; Welchs t test).
See also Figure S3.
(Figure 4C). In contrast, insertion of an exonic sequence origi-
nating from the intronless RPL4A gene and of similar length as
the RPL51A* intron failed to rescue the decreased transcription
and the hyper-recombination phenotype of tho cells (Figures
4B and 4C). This set of results therefore demonstrates that de
novo insertion of introns in R-loop-prone genes can suppress
the pathological formation of R-loops and their impact on tran-
scription and genetic stability in vivo.
RNP Formation, but Not Splicing Per Se, Attenuates
R-Loop Formation and Genetic Instability
Based on these findings, we used transcription and hyper-
recombination of YAT1 reporters in R-loop-accumulating tho
mutants as a readout of hybrid formation to further decipher
the mechanisms by which introns attenuate R-loop accumula-
tion (Figure 5A). On the one hand, introns could prevent R-loop
formation by recruiting the spliceosome that would directly
antagonize invasion of the pre-mRNA into its DNA template or
further contribute to alternative mRNP assembly pathways
specifically taking over upon impaired mRNP biogenesis (tho
mutants). On the other hand, intron splicing could itself attenuate
R-loop formation by decreasing the sequence homology be-
tween the mRNA and its template. To discriminate between
these two hypotheses, we inserted within the YAT1 reporter
different splice site (SS) mutants of the RPL51A* intron as fol-
lows: (1) a combined mutation of the 50 SS and of the branchpoint
(5II3I), which fully suppresses spliceosome recruitment and im-
pairs splicing (Lacadie and Rosbash, 2005); (2) a deletion of
the 50 SS (D5), which affects early spliceosome assembly and,
subsequently, inhibits the first step of splicing (Lacadie and
Rosbash, 2005); and (3) a mutation of the 30 SS (30 ss*), which
supports early stages of spliceosome formation but prevents
the second step of splicing (Alexander et al., 2010). ChIP exper-
iments revealed that the recruitment of spliceosomal U1 and U2
614 Molecular Cell 67, 608621, August 17, 2017
small nuclear (sn)RNPs was indeed defective for both 50 SS
mutants (D5 and 5II3I) but virtually unaffected for the 30 SS
mutant intron (Figure S3A). In addition, RT-PCR analyses
confirmed that splicing was strongly reduced for the three
mutants (Figure S3B). Strikingly, both 50 SS mutants rescued
neither the transcriptional defect (Figure 5B) nor the hyper-
recombination (Figure 5C) arising at the intronless YAT1 gene
in R-loop-forming tho cells. In contrast, the 30 SS mutant intron
fully rescued both R-loop-associated cellular phenotypes (Fig-
ures 5B and 5C), but it failed to suppress hybrid formation in
the in vitro transcription system (Figures S3D and S3E), demon-
strating that spliceosome recruitment in vivo, but not splicing per
se, is the main cause of R-loop suppression.
To further confirm this finding, we next inserted within the
YAT1 reporter a Tetrahymena group I self-splicing intron, which
readily excises in the context of the YAT1 sequence (Figure S3C)
without recruiting any protein machineries (Chalamcharla et al.,
2010). Self-splicing occurred co-transcriptionally (i.e., on
nascent mRNAs; Figure S3C), but it failed to rescue the impaired
transcription and the hyper-recombination phenotype triggered
by R-loop accumulation (Figures 5B and 5C), confirming that
splicing per se was not sufficient to reduce R-loop formation.
Conversely, artificial tethering of MS2-coat proteins (MS2-CPs)
onto the intronless YAT1 mRNA through two or six MS2-loops
(MS2L) inserted in place of the intron partially rescued the tran-
scriptional defects of tho mutants, as probed by measurement
of mRNA levels (Figure 5D) and Pol II recruitment (Figures S5F
and S5G). The observation of an increased Pol II occupancy
upon MS2-CP binding to MS2-loops rules out the possibility
that the rescue of YAT1 mRNA levels would solely reflect the re-
ported stabilization of MS2-CP-bound RNA species (Garcia and
Parker, 2015). Furthermore, MS2-CP recruitment onto the YAT1
mRNA suppressed the hyper-recombination phenotype caused
by THO inactivation (Figure 5E). In agreement with a direct
Figure 5. Spliceosome-Dependent mRNP Assembly, but Not Splicing Per Se, Is Required to Prevent R-Loop Formation
(A) Principle of the reporter constructs used in the different panels. All reporters were further integrated between leu2 repeats to score transcription-associated
recombination. The inserted sequences do not disturb transcription or recombination at the YAT1 locus in WT cells (see Figures S5BS5E).
(B) mRNA levels in tho (mft1D) yeast cells expressing the indicated reporter constructs (qRT-PCR, normalized to ACT1 mRNA values; n = 3).
(C) Recombination frequencies for tho yeast strains expressing the indicated constructs (n = 3). The frequency of recombination events arising upon tran-
scriptional induction (Gal) or repression (Glu, hatched) is scored for each reporter. The ability to properly recruit the spliceosome and to get spliced is indicated for
each intron tested (see also Figures S3AS3C). 5II3I, D5, and 30 ss* are splice site mutations within the RPL51A* intron (Lacadie and Rosbash, 2005; Alexander
et al., 2010).
(D) mRNA levels in WT or tho yeast cells expressing the indicated reporter constructs (as in B, n = 3).
(E) Recombination frequencies for WT or tho yeast strains expressing the indicated constructs (as in C, n = 3).
(F) DNA:RNA hybrid formation per mRNA in WT or tho yeast cells expressing the indicated reporter constructs (percentage of IP/mRNA; n = 3). The expression of
MS2-coat proteins (MS2-CPs) artificially tethered onto the mRNA through two or six MS2-loops is indicated.
Means and SD are plotted (*p % 0.05, **p % 0.01, and ***p % 0.001; ns, not significant; Welchs t test). See also Figure S5.

suppression of R-loop formation by the presence of MS2-CP
bound to the mRNA, our DRIP assay detected decreased hybrid
levels at the MS2L-YAT1 reporter upon MS2-CP expression (Fig-
ure 5F). Taken together, these experiments support a model in
which introns prevent R-loop formation by recruiting protein fac-
tors that directly antagonize hybridization of the nascent mRNA
onto its template (Figure S5H).
Intron-Rich Genomes Do Not Accumulate R-Loops upon
Impaired mRNP Biogenesis
We then sought to determine whether this function of introns had
been maintained throughout evolution. Since the function of
the THO complex in preventing the accumulation of genotoxic
R-loops on Pol II genes has been conserved from yeast to human
(Huertas and Aguilera, 2003; Domnguez-Sanchez et al., 2011),
we systematically triggered hybrid formation by inactivating its
Hpr1 subunit in a panel of yeasts differing for their intron content,
including intron-poor (C. glabrata and S. cerevisiae) and intron-
rich (S. pombe and C. neoformans) species (Figure 6A). As pre-
viously observed in S. cerevisiae (Garca-Rubio et al., 2008), loss
of HPR1 function triggered a noticeable growth defect in
C. glabrata, S. pombe, or C. neoformans cells (Figures S6A
S6C). Using genomic DNA from cells of these distinct species,
we then detected RNH-sensitive hybrids on dot blots (Figures
S6DS6G), as previously performed for templates forming
R-loops in vitro (as shown in Figure 2C). This analysis readily
detected DNA:RNA hybrids on genomic DNA from WT cells of
these different species, possibly originating from transcription
by all RNA polymerases. Strikingly, THO inactivation, which is
likely to specifically increase Pol II-dependent hybrids, triggered
a clear accumulation of R-loops in intron-poor genomes, e.g., in
C. glabrata (3.3% of intron-containing genes) and S. cerevisiae
(4.4%) (Figures 6B and 6C). However, loss of the THO complex
had little or no effect in yeasts with an elevated proportion of
intron-containing genes, S. pombe (47%) and C. neoformans
(99.5%) (Figures 6D and 6E), revealing an inverse correlation

Molecular Cell 67, 608621, August 17, 2017 615

Figure 6. Intron-Rich Yeast Genomes Do Not Accumulate R-Loops upon Improper mRNP Biogenesis
(A) Occurrence of introns in the genomes of the indicated yeast species. The following metrics are indicated: percentage of intron-containing genes (among
protein-coding genes), mean number of introns (per intron-containing gene), positional bias of the introns (50 , introns preferentially located at the 50 end
of the mRNA). aLinde et al., 2015; bSaccharomyces Genome Database (http://www.yeastgenome.org); cPomBase (http://www.pombase.org); dJanbon et al.,
2014; eLin and Zhang, 2005.
(BE) DNA:RNA hybrid detection by dot blot on genomic DNA from either WT or hpr1 (tho) cells in the indicated species (B, C. glabrata; C, S. cerevisiae; D,
S. pombe; E, C. neoformans). Decreasing amounts of DNA extracts from the indicated cells were probed using antibodies directed against DNA:RNA hybrids (left
panels) or dsDNA (right panels).
(F) DNA:RNA hybrid levels were quantified from (B)(E) using serial dilutions of a reference sample as a standard and normalized to the amount of DNA in each
sample (for each species, n = 3). The accumulation of DNA:RNA hybrids upon THO inactivation (HPR1 knockdown, relative to WT) was plotted as a function of the
fraction of intron-containing genes (among protein-coding genes) in the genomes of the different species.
Means and SD are plotted. The Pearson correlation coefficient is indicated. See also Figure S6.

between hybrid formation and intron content (Figure 6F; Pearson
correlation coefficient = 0.89). Intron-richest genomes are
thereby less prone to accumulate R-loops in a context of defec-
tive mRNP biogenesis.
Intron-Containing Human Genes Display Decreased
Levels of R-Loops and DNA Damage
We then examined various datasets of genome-wide R-loop dis-
tribution obtained from human cells (Ginno et al., 2013; Lim et al.,
2015; Nadel et al., 2015), and we calculated R-loop densities for
intronless and intron-containing genes. The analysis of hybrid-
positive regions in HEK293 cells revealed that R-loop densities
do not vary much among transcribed genes in these cells, as
shown previously (Nadel et al., 2015), but that they are system-
atically lower on intron-containing as compared to intronless
loci (Figures 7A and S7A). This observation was not merely
due to the difference in the number of intronless and intron-con-
taining loci, as proved by data bootstrapping (Figure 7A), and
it was also confirmed by examining independent datasets
obtained from distinct cell types (IMR90, NTERA-2, and human
fibroblasts; Figures S7C, S7E, and S7G). Furthermore, analysis
of potential confounding effects (transcription levels, gene
length, G-C content, and GC skew) for these distinct datasets
did not identify any genomic feature susceptible to bias the for-
mation of R-loops, as shown for highly expressed intron-con-
taining genes (Figures S7B, S7D, S7F, and S7H). In particular,
increased R-loop levels on intronless genes do not seem to be
caused by their reduced length, since R-loop-forming intronless
genes are frequently longer that intronless genes with no detect-
able R-loops (see, for example, Figures S7D, S7F, and S7H,

616 Molecular Cell 67, 608621, August 17, 2017

Figure 7. Intron-Containing Genes Are Protected from R-Loop and DNA Damage Accumulation in Humans
(A) DNA:RNA hybrid densities on intronless and intron-containing hybrid-positive loci, evaluated according to a dataset of hybrid-prone sites detected in HEK293
cells (Nadel et al., 2015) and ranked according to nascent mRNA levels (see also Figure S7A). L, low expression; M, medium expression; H, high expression; VH,
very high expression.
(B) g-H2AX association to intronless and intron-containing hybrid-positive loci from (A), evaluated according to a g-H2AX ChIP-seq dataset obtained from
HEK293 cells (Bunch et al., 2015) and displayed according to expression levels.
(C) Model for the role of introns in R-loop prevention. Intron-mediated recruitment of the spliceosome, and possibly of other factors, would favor RNP formation
and antagonize hybridization of the mRNA onto its DNA template.
***p % 0.001, Bootstrapping Method. See also Figure S7.

length panels). Human intron-containing genes are thereby
less prone to accumulate DNA:RNA hybrids as compared to their
intronless counterparts.
We then compared DNA damage accumulation on intronless
and intron-containing R-loop-forming loci using a genome-
wide g-H2AX map also obtained in the HEK293 cell line (Bunch
et al., 2015). Although g-H2AX accumulation was not system-
atic on R-loop-prone loci, we scored a significantly decreased
signal on intron-containing genes of the highest transcrip-
tion class (Figure 7B), a result that was still significant after
correcting for multiple hypothesis testing (p = 0.0004). These
observations support that, among other features, R-loop accu-
mulation can be a cause of damage accumulation and that
reduced R-loop formation on intron-containing genes also
dampens transcription-associated genetic instability in the
human genome.
DISCUSSION
In this study, we provide multiple lines of evidence supporting
our initial hypothesis that introns protect eukaryotic genomes
from R-loop accumulation and subsequent transcription-associ-
ated genetic instability. First, by modifying the intron content of
budding yeast genes, we have demonstrated that removing
the introns from intron-containing genes is sufficient to trigger
hybrid formation; conversely, inserting an intron within an
intronless R-loop-prone gene suppresses R-loop formation
and hyper-recombination in R-loop-forming mutants. Second,
by comparing distinct yeast species differing for their intron con-
tent in situations of impaired mRNP biogenesis, we have scored
lowered R-loop accumulation in intron-rich genomes. Finally,
genome-wide analyses revealed that intron-containing genes
display decreased R-loop levels and DNA damage as compared
to intronless genes of similar expression, in both yeast and
human cells.
It is noteworthy that the presence of introns is not the only
determinant of R-loop formation in our genome-wide analyses,
as evidenced by the detection of both hybrid-positive intron-
containing genes and hybrid-negative intronless genes (Figures
1A and 7A). However, when R-loops form on intron-containing
loci, e.g., for highly expressed yeast genes or in hybrid-prone
mutants, their levels are strongly attenuated as compared to
those scored on their intronless counterparts (Figures 1B, 3B,
and 7A). The genomic R-loop distribution is thereby likely to be
modulated by the occurrence of introns, together with other
cis-acting determinants previously reported to impact on hybrid
formation. Among them, high levels of transcription from strong
promoters have been shown to drive R-loop accumulation in
yeast (Chan et al., 2014a; Wahba et al., 2016). In addition, the
influence of sequence properties on the propensity to form
R-loops has been pinpointed by different studies: while GC rich-
ness was shown to positively influence R-loop formation both
in vitro on transcribed reporters (Roy and Lieber, 2009) and
in vivo on human promoters (Ginno et al., 2013), A:T tracts
were recently shown to facilitate hybrid accumulation (Wahba
et al., 2016). However, these features are unlikely to account
for the lowered R-loop formation scored on intron-containing
genes in our study. Indeed, (1) intronless genes harbor higher
R-loop densities than intron-containing genes of similar expres-
sion (Figures 1B, 7A, S1C, and S7A), (2) hybrid-positive and

Molecular Cell 67, 608621, August 17, 2017 617

hybrid-negative intron-containing loci do not exhibit differences
in transcription levels or base content (Figures S1CS1G and
S7), and (3) the ability of different intron variants to rescue
R-loop-associated phenotypes when inserted in the YAT1
gene does not correlate with particular sequence properties, be-
sides their ability to recruit proteins onto the mRNA (Figure S5H).
In addition to these cis-acting determinants, trans-acting factors
such as the THO complex can also be predominant players in
R-loop prevention, as shown in the case of the YAT1 gene (Fig-
ure 3). Notably, the functional importance of combining both
trans-acting factors and cis-acting elements such as introns is
further supported by the synergistic effect on R-loop formation
of preventing both THO complex function and spliceosome
binding (Figures 3, 4, and 5).
Regarding the mechanism of R-loop suppression, the only
sequences that could attenuate hybrid formation on the
R-loop-forming YAT1 reporter were either spliceosome-bound
introns (Figures 3, 4, and 5) or MS2-loops bound by MS2-CPs
(Figures 5D5F). This last finding, together with the results ob-
tained with the 30 ss* intron, which recruits the spliceosome
but does not complete splicing, demonstrates that the pres-
ence of proteins bound to the mRNA can be sufficient to restrain
its hybridization onto its DNA template, either by steric hin-
drance or by facilitating mRNA folding, a process previously
demonstrated to modulate R-loop formation (Chen et al.,
2016). However, RNP packaging with MS2-CPs failed to fully
rescue R-loop-associated phenotypes, notably the transcrip-
tional defects caused by hybrid accumulation (Figures S5F
and S5G).
As opposed to the artificial tethering of MS2-CPs, the intron-
mediated binding of splicing factors is likely to facilitate the
recruitment of additional proteins that contribute to the biogen-
esis of a fully packaged mRNP and to its release from the tran-
scription site, thereby preventing R-loop formation. Candidate
proteins that could be recruited onto mRNPs in a splicing-
dependent manner and further preclude hybrid accumulation
include the following: (1) the hnRNP Npl3 and the helicase
Sub2, which contact the spliceosome (Gottschalk et al., 1998;
Lardelli et al., 2010) and whose inactivation triggers R-loop-
dependent genetic instability in yeast (Jimeno et al., 2002; San-
tos-Pereira et al., 2013), and (2) the exon junction complex,
which specifically decorates spliced mRNAs in metazoans (Le
Hir et al., 2016). In addition, several reports have pointed that
the splicing process can interfere with chromatin organization
and/or transcription elongation (de Almeida and Carmo-Fon-
seca, 2014). In particular, splicing has been shown to trigger a
pause in Pol II elongation following the 30 SS (Alexander et al.,
2010; Carrillo Oesterreich et al., 2010). Interestingly, Pol II slow-
down has been shown to suppress certain phenotypes of the
R-loop-forming tho mutants (Jensen et al., 2004; Jimeno et al.,
2008). However, Pol II pausing does not appear to occur in the
second exon of the intron-containing YAT1 reporter (Figure S5I).
In addition, mutation of the intron 30 SS prevents pausing (Alex-
ander et al., 2010) yet suppresses R-loop phenotypes (Figures
5B and 5C). We therefore support a model in which the intron
would prevent R-loop formation by favoring RNP assembly
and not by solely modifying Pol II kinetics (Figure 7C). In the
future, the systematic analysis of the composition of intronless
618 Molecular Cell 67, 608621, August 17, 2017
or intron-containing mRNPs will likely give insights into this func-
tion of introns.
Our results also demonstrate that being protected from R-loop
accumulation, intron-containing loci display lowered levels of
transcription-associated genetic instability (Figures 1H, 3E, 3F,
and 7B). Notably, in our genome-wide analyses, DNA damage
is not systematically detected on R-loop-forming loci, possibly
in relation to their location in the genome, including their distance
and orientation relative to replication origins (Stirling et al., 2012;
Gaillard et al., 2013), or to the action of endogenous RNases H or
other cellular factors that would maintain non-genotoxic levels of
hybrids in WT cells. In situations characterized by stable and/or
increased R-loop levels, the presence of introns would be more
critical to dampen transcription-associated genetic instability, as
evidenced in tho mutants. It is tempting to speculate that this
function of introns could contribute to explain their evolutionary
selection and/or maintenance at certain genomic locations, in
particular within highly expressed yeast genes in which they
are particularly enriched (Figure S1A). Their role in R-loop pre-
vention could further account for their retention at the 50 ends
of genes in intron-poor species (Lin and Zhang, 2005), a
positional bias also observed in intronogenesis assays (Lee
and Stevens, 2016) and that could prevent hybrid formation at
early stages of nascent mRNA synthesis. In certain genetic,
physiological, or stress conditions in which R-loops could reach
genotoxic levels, in particular due to the natural inactivation of
cellular R-loop-antagonizing factors (see, for instance, Jackson
et al., 2014), the presence of introns could thereby prevent
both inappropriate gene expression and acquisition of heritable
mutations.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESSOURCES SHARING
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Yeast Strains and Growth
B Plasmids
d METHOD DETAILS
B DNA:RNA hybrid detection
B Gene expression and splicing analyses
B Bioinformatic analyses of yeast datasets
B Bioinformatic analyses of human datasets
d QUANTIFICATION AND STATISTICAL ANALYSIS
d DATA AND SOFTWARE AVAILABILITY
SUPPLEMENTAL INFORMATION
Supplemental Information includes seven figures and one table and can be
found with this article online at http://dx.doi.org/10.1016/j.molcel.2017.
07.002.
AUTHOR CONTRIBUTIONS
Conceptualization, A.B. and B.P.; Methodology, A.B. and B.P.; Investigation,
A.B., E.C., A.P., S.C.S., G.J., and B.P.; Formal Analysis Yeast Datasets,
A.E. and V.G.; Formal Analysis Human Datasets, A.R.G. and S.F.d.A.;
Writing, B.P.; Visualization, A.B. and B.P.; Funding Acquisition, S.F.d.A.,
V.G., and B.P.; Supervision, V.G., S.F.d.A., and B.P.
ACKNOWLEDGMENTS
We thank S. Abou Elela, A. Aguilera, M. Belfort, E. Bertrand, J.-M. Camadro, V.
Doye, M. Garcia, P. Hieter, D. Koshland, P. Lesage, D. Libri, R. Rothstein, M.
Rougemaille, G. Rabut, J. Rouviere, P. Stirling, F. Stutz, V. Vanoosthuyse, and
M. Wickens for reagents and/or discussion and B. Quioc and F. Moyrand for
technical assistance. This work was supported by CNRS (to B.P.), Fondation
ARC pour la Recherche sur le Cancer (to B.P.), Ligue Nationale contre le Can-
cer (to B.P.; fellowship to A.B. and Equipe Labellisee 2014 to V.G.), EMBO
(short-term fellowship to A.B.), Canceropole PACA (fellowship to A.E.), and
Fundacao para a Ciencia e Tecnologia, Portugal (PTDC/BIM-ONC/0016-
2014 to S.F.d.A. and IF/00510/2014 to A.R.G.). Bioinformatic and computing
support at CRCM was provided by the CRCM Integrative Bioinformatics and
Datacentre IT and Scientific Computing platforms.
Received: September 22, 2016
Revised: May 19, 2017
Accepted: June 30, 2017
Published: July 27, 2017
REFERENCES
Alexander, R.D., Innocente, S.A., Barrass, J.D., and Beggs, J.D. (2010).
Splicing-dependent RNA polymerase pausing in yeast. Mol. Cell 40, 582593.
Ares, M., Jr., Grate, L., and Pauling, M.H. (1999). A handful of intron-containing
genes produces the lions share of yeast mRNA. RNA 5, 11381139.
Bahler, J., Wu, J.Q., Longtine, M.S., Shah, N.G., McKenzie, A., 3rd, Steever,
A.B., Wach, A., Philippsen, P., and Pringle, J.R. (1998). Heterologous modules
for efficient and versatile PCR-based gene targeting in Schizosaccharomyces
pombe. Yeast 14, 943951.
Berget, S.M., Moore, C., and Sharp, P.A. (1977). Spliced segments at the 50
terminus of adenovirus 2 late mRNA. Proc. Natl. Acad. Sci. USA 74,
31713175.
Bonnet, A., Bretes, H., and Palancade, B. (2015). Nuclear pore components
affect distinct stages of intron-containing gene expression. Nucleic Acids
Res. 43, 42494261.
Braunschweig, U., Barbosa-Morais, N.L., Pan, Q., Nachman, E.N., Alipanahi,
B., Gonatopoulos-Pournatzis, T., Frey, B., Irimia, M., and Blencowe, B.J.
(2014). Widespread intron retention in mammals functionally tunes transcrip-
tomes. Genome Res. 24, 17741786.
Bray, N.L., Pimentel, H., Melsted, P., and Pachter, L. (2016). Near-optimal
probabilistic RNA-seq quantification. Nat. Biotechnol. 34, 525527.
Bunch, H., Lawney, B.P., Lin, Y.F., Asaithamby, A., Murshid, A., Wang, Y.E.,
Chen, B.P., and Calderwood, S.K. (2015). Transcriptional elongation requires
DNA break-induced signalling. Nat. Commun. 6, 10191.
Byrne, K.P., and Wolfe, K.H. (2005). The Yeast Gene Order Browser:
combining curated homology and syntenic context reveals gene fate in poly-
ploid species. Genome Res. 15, 14561461.
Capra, J.A., Paeschke, K., Singh, M., and Zakian, V.A. (2010). G-quadruplex
DNA sequences are evolutionarily conserved and associated with distinct
genomic features in Saccharomyces cerevisiae. PLoS Comput. Biol. 6,
e1000861.
Carrillo Oesterreich, F., Preibisch, S., and Neugebauer, K.M. (2010). Global
analysis of nascent RNA reveals transcriptional pausing in terminal exons.
Mol. Cell 40, 571581.
Chalamcharla, V.R., Curcio, M.J., and Belfort, M. (2010). Nuclear expression of
a group II intron is consistent with spliceosomal intron ancestry. Genes Dev.
24, 827836.
Chan, Y.A., Aristizabal, M.J., Lu, P.Y., Luo, Z., Hamza, A., Kobor, M.S., Stirling,
P.C., and Hieter, P. (2014a). Genome-wide profiling of yeast DNA:RNA hybrid
prone sites with DRIP-chip. PLoS Genet. 10, e1004288.
Chan, Y.A., Hieter, P., and Stirling, P.C. (2014b). Mechanisms of genome insta-
bility induced by RNA-processing defects. Trends Genet. 30, 245253.
Chavez, S., Garca-Rubio, M., Prado, F., and Aguilera, A. (2001). Hpr1 is pref-
erentially required for transcription of either long or G+C-rich DNA sequences
in Saccharomyces cerevisiae. Mol. Cell. Biol. 21, 70547064.
Chen, X., Yang, J.R., and Zhang, J. (2016). Nascent RNA folding mitigates tran-
scription-associated mutagenesis. Genome Res. 26, 5059.
Chow, L.T., Gelinas, R.E., Broker, T.R., and Roberts, R.J. (1977). An amazing
sequence arrangement at the 50 ends of adenovirus 2 messenger RNA. Cell
12, 18.
Costantino, L., and Koshland, D. (2015). The yin and yang of R-loop biology.
Curr. Opin. Cell Biol. 34, 3945.
Datta, A., and Jinks-Robertson, S. (1995). Association of increased sponta-
neous mutation rates with high levels of transcription in yeast. Science 268,
16161619.
de Almeida, S.F., and Carmo-Fonseca, M. (2014). Reciprocal regulatory links
between cotranscriptional splicing and chromatin. Semin. Cell Dev. Biol.
32, 210.
Delaveau, T., Davoine, D., Jolly, A., Vallot, A., Rouviere, J.O., Gerber, A.,
Brochet, S., Plessis, M., Roquigny, R., Merhej, J., et al. (2016). Tma108, a
putative M1 aminopeptidase, is a specific nascent chain-associated protein
in Saccharomyces cerevisiae. Nucleic Acids Res. 44, 88268841.
Domnguez-Sanchez, M.S., Barroso, S., Gomez-Gonzalez, B., Luna, R., and
Aguilera, A. (2011). Genome instability and transcription elongation impair-
ment in human cells depleted of THO/TREX. PLoS Genet. 7, e1002386.
El Hage, A., Webb, S., Kerr, A., and Tollervey, D. (2014). Genome-wide distri-
bution of RNA-DNA hybrids identifies RNase H targets in tRNA genes, retro-
transposons and mitochondria. PLoS Genet. 10, e1004716.
ENCODE Project Consortium (2012). An integrated encyclopedia of DNA
elements in the human genome. Nature 489, 5774.
Gaillard, H., Herrera-Moyano, E., and Aguilera, A. (2013). Transcription-asso-
ciated genome instability. Chem. Rev. 113, 86388661.
Garcia, J.F., and Parker, R. (2015). MS2 coat proteins bound to yeast
mRNAs block 50 to 30 degradation and trap mRNA decay products:
implications for the localization of mRNAs by MS2-MCP system. RNA 21,
13931395.
Garca-Rubio, M., Chavez, S., Huertas, P., Tous, C., Jimeno, S., Luna, R., and
Aguilera, A. (2008). Different physiological relevance of yeast THO/TREX sub-
units in gene expression and genome integrity. Mol. Genet. Genomics 279,
123132.
Ghaemmaghami, S., Huh, W.K., Bower, K., Howson, R.W., Belle, A.,
Dephoure, N., OShea, E.K., and Weissman, J.S. (2003). Global analysis of
protein expression in yeast. Nature 425, 737741.
Ginno, P.A., Lott, P.L., Christensen, H.C., Korf, I., and Chedin, F. (2012). R-loop
formation is a distinctive characteristic of unmethylated human CpG island
promoters. Mol. Cell 45, 814825.
Ginno, P.A., Lim, Y.W., Lott, P.L., Korf, I., and Chedin, F. (2013). GC
skew at the 50 and 30 ends of human genes links R-loop formation to
epigenetic regulation and transcription termination. Genome Res. 23,
15901600.
Goebels, C., Thonn, A., Gonzalez-Hilarion, S., Rolland, O., Moyrand, F.,
Beilharz, T.H., and Janbon, G. (2013). Introns regulate gene expression in
Cryptococcus neoformans in a Pab2p dependent pathway. PLoS Genet. 9,
e1003686.
Gonzalez-Aguilera, C., Tous, C., Gomez-Gonzalez, B., Huertas, P., Luna, R.,
and Aguilera, A. (2008). The THP1-SAC3-SUS1-CDC31 complex works in
transcription elongation-mRNA export preventing RNA-mediated genome
instability. Mol. Biol. Cell 19, 43104318.
Molecular Cell 67, 608621, August 17, 2017 619
Gottschalk, A., Tang, J., Puig, O., Salgado, J., Neubauer, G., Colot, H.V.,
Mann, M., Seraphin, B., Rosbash, M., Luhrmann, R., and Fabrizio, P. (1998).
A comprehensive biochemical and genetic analysis of the yeast U1 snRNP re-
veals five novel proteins. RNA 4, 374393.
Halasz, L., Karanyi, Z., Boros-Olah, B., Kuik-Rozsa, T., Sipos, E., Nagy, E., essential yeast gene function with temperature-sensitive mutants. Nat.
Mosolygo-L, A., Mazlo, A., Rajnavolgyi, E., Halmos, G., and Szekvolgyi, L. Biotechnol. 29, 361367.
(2017). RNA-DNA hybrid (R-loop) immunoprecipitation mapping: an analytical
workflow to evaluate inherent biases. Genome Res. 27, 10631073.
Harrow, J., Frankish, A., Gonzalez, J.M., Tapanari, E., Diekhans, M.,
Kokocinski, F., Aken, B.L., Barrell, D., Zadissa, A., Searle, S., et al. (2012).
GENCODE: the reference human genome annotation for The ENCODE
Project. Genome Res. 22, 17601774.
Heyn, P., Kalinka, A.T., Tomancak, P., and Neugebauer, K.M. (2015). Introns
and gene expression: cellular constraints, transcriptional regulation, and
evolutionary consequences. BioEssays 37, 148154.
Holstege, F.C., Jennings, E.G., Wyrick, J.J., Lee, T.I., Hengartner, C.J., Green,
M.R., Golub, T.R., Lander, E.S., and Young, R.A. (1998). Dissecting the regu-
latory circuitry of a eukaryotic genome. Cell 95, 717728.
Huertas, P., and Aguilera, A. (2003). Cotranscriptionally formed DNA:RNA
hybrids mediate transcription elongation impairment and transcription-associ-
ated recombination. Mol. Cell 12, 711721.
Jackson, B.R., Noerenberg, M., and Whitehouse, A. (2014). A novel mecha-
nism inducing genome instability in Kaposis sarcoma-associated herpesvirus
infected cells. PLoS Pathog. 10, e1004098.
Janbon, G., Ormerod, K.L., Paulet, D., Byrnes, E.J., 3rd, Yadav, V., Chatterjee,
G., Mullapudi, N., Hon, C.C., Billmyre, R.B., Brunel, F., et al. (2014). Analysis of
the genome and transcriptome of Cryptococcus neoformans var. grubii re-
veals complex RNA expression and microevolution leading to virulence atten-
uation. PLoS Genet. 10, e1004261.
Jensen, T.H., Boulay, J., Olesen, J.R., Colin, J., Weyler, M., and Libri, D. (2004).
Modulation of transcription affects mRNP quality. Mol. Cell 16, 235244.
Jimeno, S., Rondon, A.G., Luna, R., and Aguilera, A. (2002). The yeast THO
complex and mRNA export factors link RNA metabolism with transcription
and genome instability. EMBO J. 21, 35263535.
Jimeno, S., Garca-Rubio, M., Luna, R., and Aguilera, A. (2008). A reduction in
RNA polymerase II initiation rate suppresses hyper-recombination and tran-
scription-elongation impairment of THO mutants. Mol. Genet. Genomics
280, 327336.
Kim, D.U., Hayles, J., Kim, D., Wood, V., Park, H.O., Won, M., Yoo, H.S., Duhig,
T., Nam, M., Palmer, G., et al. (2010). Analysis of a genome-wide set of gene
deletions in the fission yeast Schizosaccharomyces pombe. Nat. Biotechnol.
28, 617623.
Kitada, K., Yamaguchi, E., and Arisawa, M. (1995). Cloning of the Candida
glabrata TRP1 and HIS3 genes, and construction of their disruptant strains
by sequential integrative transformation. Gene 165, 203206.
Lacadie, S.A., and Rosbash, M. (2005). Cotranscriptional spliceosome assem-
bly dynamics and the role of U1 snRNA:5ss base pairing in yeast. Mol. Cell
19, 6575.
Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and
memory-efficient alignment of short DNA sequences to the human genome.
Genome Biol. 10, R25.
Lardelli, R.M., Thompson, J.X., Yates, J.R., 3rd, and Stevens, S.W. (2010).
Release of SF3 from the intron branchpoint activates the first step of pre-
mRNA splicing. RNA 16, 516528.
Le Hir, H., Sauliere, J., and Wang, Z. (2016). The exon junction complex as a
node of post-transcriptional networks. Nat. Rev. Mol. Cell Biol. 17, 4154.
Lee, S., and Stevens, S.W. (2016). Spliceosomal intronogenesis. Proc. Natl.
Acad. Sci. USA 113, 65146519.
Li, X., and Manley, J.L. (2005). Inactivation of the SR protein splicing factor
ASF/SF2 results in genomic instability. Cell 122, 365378.
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G.,
Abecasis, G., and Durbin, R.; 1000 Genome Project Data Processing
620 Molecular Cell 67, 608621, August 17, 2017
Subgroup (2009). The Sequence Alignment/Map format and SAMtools.
Bioinformatics 25, 20782079.
Li, Z., Vizeacoumar, F.J., Bahr, S., Li, J., Warringer, J., Vizeacoumar, F.S., Min,
R., Vandersluis, B., Bellay, J., Devit, M., et al. (2011). Systematic exploration of
Lim, Y.W., Sanz, L.A., Xu, X., Hartono, S.R., and Chedin, F. (2015). Genome-
wide DNA hypomethylation and RNA:DNA hybrid accumulation in Aicardi-
Goutieres syndrome. eLife 4, e08007.
Lin, K., and Zhang, D.Y. (2005). The excess of 50 introns in eukaryotic ge-
nomes. Nucleic Acids Res. 33, 65226527.
Linde, J., Duggan, S., Weber, M., Horn, F., Sieber, P., Hellwig, D., Riege, K.,
Marz, M., Martin, R., Guthke, R., and Kurzai, O. (2015). Defining the transcrip-
tomic landscape of Candida glabrata by RNA-seq. Nucleic Acids Res. 43,
13921406.
Mischo, H.E., Gomez-Gonzalez, B., Grzechnik, P., Rondon, A.G., Wei, W.,
Steinmetz, L., Aguilera, A., and Proudfoot, N.J. (2011). Yeast Sen1 helicase
protects the genome from transcription-associated instability. Mol. Cell
41, 2132.
Nadel, J., Athanasiadou, R., Lemetre, C., Wijetunga, N.A., O Broin, P., Sato, H.,
Zhang, Z., Jeddeloh, J., Montagna, C., Golden, A., et al. (2015). RNA:DNA hy-
brids in the human genome have distinctive nucleotide characteristics, chro-
matin composition, and transcriptional relationships. Epigenetics Chromatin
8, 46.
Nilsen, T.W., and Graveley, B.R. (2010). Expansion of the eukaryotic proteome
by alternative splicing. Nature 463, 457463.
Parenteau, J., Durand, M., Veronneau, S., Lacombe, A.A., Morin, G., Guerin,
V., Cecez, B., Gervais-Bird, J., Koh, C.S., Brunelle, D., et al. (2008). Deletion
of many yeast introns reveals a minority of genes that require splicing for func-
tion. Mol. Biol. Cell 19, 19321941.
Parenteau, J., Durand, M., Morin, G., Gagnon, J., Lucier, J.F., Wellinger,
R.J., Chabot, B., and Elela, S.A. (2011). Introns within ribosomal protein
genes regulate the production and function of yeast ribosomes. Cell 147,
320331.
Paulsen, R.D., Soni, D.V., Wollman, R., Hahn, A.T., Yee, M.C., Guan, A.,
Hesley, J.A., Miller, S.C., Cromwell, E.F., Solow-Cordero, D.E., et al. (2009).
A genome-wide siRNA screen reveals diverse cellular processes and path-
ways that mediate genome stability. Mol. Cell 35, 228239.
Prado, F., and Aguilera, A. (1995). Role of reciprocal exchange, one-ended in-
vasion crossover and single-strand annealing on inverted and direct repeat
recombination in yeast: different requirements for the RAD1, RAD10, and
RAD52 genes. Genetics 139, 109123.
Quinlan, A.R., and Hall, I.M. (2010). BEDTools: a flexible suite of utilities for
comparing genomic features. Bioinformatics 26, 841842.
Roy, D., and Lieber, M.R. (2009). G clustering is important for the initiation of
transcription-induced R-loops in vitro, whereas high G density without clus-
tering is sufficient thereafter. Mol. Cell. Biol. 29, 31243133.
Ryu, J.Y., Kim, H.U., and Lee, S.Y. (2015). Human genes with a greater number
of transcript variants tend to show biological features of housekeeping and
essential genes. Mol. Biosyst. 11, 27982807.
Santos-Pereira, J.M., and Aguilera, A. (2015). R loops: new modulators of
genome dynamics and function. Nat. Rev. Genet. 16, 583597.
Santos-Pereira, J.M., Herrero, A.B., Garca-Rubio, M.L., Marn, A., Moreno,
S., and Aguilera, A. (2013). The Npl3 hnRNP prevents R-loop-mediated tran-
scription-replication conflicts and genome instability. Genes Dev. 27,
24452458.
Sollier, J., and Cimprich, K.A. (2015). Breaking bad: R-loops and genome
integrity. Trends Cell Biol. 25, 514522.
Stirling, P.C., Chan, Y.A., Minaker, S.W., Aristizabal, M.J., Barrett, I.,
Sipahimalani, P., Kobor, M.S., and Hieter, P. (2012). R-loop-mediated genome
instability in mRNA cleavage and polyadenylation mutants. Genes Dev. 26,
163175.
Thomas, B.J., and Rothstein, R. (1989). Elevated recombination rates in tran-
scriptionally active DNA. Cell 56, 619630.
Wahba, L., Amon, J.D., Koshland, D., and Vuica-Ross, M. (2011). RNase H and
multiple RNA biogenesis factors cooperate to prevent RNA:DNA hybrids from
generating genome instability. Mol. Cell 44, 978988.
Wahba, L., Costantino, L., Tan, F.J., Zimmer, A., and Koshland, D. (2016). S1-
DRIP-seq identifies high expression and polyA tracts as major contributors to
R-loop formation. Genes Dev. 30, 13271338.
Xu, Z., Wei, W., Gagneur, J., Perocchi, F., Clauder-Mu nster, S., Camblong, J.,
Guffanti, E., Stutz, F., Huber, W., and Steinmetz, L.M. (2009). Bidirectional pro-
moters generate pervasive transcription in yeast. Nature 457, 10331037.
Yu, K., Roy, D., Huang, F.T., and Lieber, M.R. (2006). Detection and structural
analysis of R-loops. Methods Enzymol. 409, 316329.
Zhang, Y., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein, B.E.,
Nusbaum, C., Myers, R.M., Brown, M., Li, W., and Liu, X.S. (2008). Model-
based analysis of ChIP-seq (MACS). Genome Biol. 9, R137.
Molecular Cell 67, 608621, August 17, 2017 621
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
anti DNA:RNA hybrids (S9.6) Kerafast Cat# ENH001
anti-dsDNA (HYB331-01) Santa Cruz Cat# sc-58749; RRID: AB_783088
anti-Rpl5 (Delaveau et al., 2016) N/A
anti-Rpl3 DSHB ScRPL3; RRID: AB_1553774
anti-Rpb1 (8WG16) BioLegend Cat# 920102
Peroxidase AffiniPure Goat Anti-Mouse IgG+IgM (H+L) Jackson ImmunoResearch Cat# 115-035-068;
RRID: AB_2338505
Chemicals, Peptides, and Recombinant Proteins
RNase H Sigma Cat# 10786357001
RQ1 RNase-free Dnase Promega Cat# M6101
FastDigest restriction enzymes Thermo Scientific Cat# FD0274, FD0504, FD0684,
FD0774, FD0933
Protein G Sepharose Fast Flow GE Healthcare Cat# 17061801
IgG Sepharose Fast Flow GE Healthcare Cat# 17096901
Critical Commercial Assays
LightCycler 480 SYBR Green I Master Roche Cat# 04887352001
Riboprobe System T7 Promega Cat# P1440
Deposited Data
DRIP-seq in rnh1 rnh201 yeast cells (Wahba et al., 2016) SRA SRA: SRP071346
DRIP-chip in wt yeast cells (Chan et al., 2014a) Array Express ArrayExpress: E-MTAB-2388
transcriptome in wt yeast cells (Xu et al., 2009) Array Express ArrayExpress: E-TABM-590
g-H2A ChIP-chip in wt yeast cells (Stirling et al., 2012) N/A N/A
g-H2A ChIP-chip in wt yeast cells (Capra et al., 2010) N/A N/A
DRIP-seq in human fibroblasts (Ginno et al., 2013) SRA SRA: SRA048940.1
DRIP-seq in NTERA2 human cells (Lim et al., 2015) GEO GEO: GSE57353
RDIP-seq in HEK293 human cells (Nadel et al., 2015) GEO GEO: GSE68953
RDIP-seq in IMR90 human cells (Nadel et al., 2015) GEO GEO: GSE68953
RNA-seq in human fibroblasts (Lim et al., 2015) GEO GEO: GSE57353
RNA-seq in NTERA2 human cells SRA SRA: SRX359337
GRO-seq in HEK293 human cells GEO GEO: GSM1249869 and
GSM1249874
GRO-seq in IMR90 human cells GEO GEO: GSM1055806
g-H2AX ChIP-seq from HEK293 cells (Bunch et al., 2015) GEO GEO: GSE75170
Raw images This paper http://dx.doi.org/10.17632/
b3f8k56vjs.1
Experimental Models: Organisms/Strains
S. cerevisiae: wt (RPL7 RPL20) (Parenteau et al., 2011) JPY10H3
S. cerevisiae: rpl7ADi rpl7BDi (Parenteau et al., 2011) JPY172G2
S. cerevisiae: wt (Bonnet et al., 2015) BY4742
S. cerevisiae: mft1::KanMX (Bonnet et al., 2015) Y10508
S. cerevisiae: hpr1::KanMX (Bonnet et al., 2015) Y14072
S. cerevisiae: sus1::KanMX (Bonnet et al., 2015) YV1542
S. cerevisiae: sen1-1::KanMX (Li et al., 2011) Y12015
S. cerevisiae: YHC1-TAP::His3MX (Ghaemmaghami et al., 2003) U1-TAP
(Continued on next page)

e1 Molecular Cell 67, 608621.e1e6, August 17, 2017

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
S. cerevisiae: LEA1-TAP::His3MX (Ghaemmaghami et al., 2003) U2-TAP
C. glabrata: wt (Kitada et al., 1995) DHTU
C. glabrata: hpr1::TRP1 This study DCghpr1
S. pombe: wt A gift from M. Rougemaille PR167
S. pombe: KanMX::P81nmt1-THOC1 (SpHPR1) A gift from M. Rougemaille PR327
C. neoformans: wt (Goebels et al., 2013) JEC32
C. neoformans: hpr1::NEO This study NE1205
Oligonucleotides
GATCTGCCTTGTATTGTCTTCG SIGMA RPL7A-F
TCAGCGGCCATTGTGATCTT SIGMA RPL7A-R
TTGTAGAGTAAGTAGACCCATA SIGMA RPL7B-F
TCAGTGGACATTATGACGTTGA SIGMA RPL7B-R
GATTGCCGGTGGTAAGAAGA SIGMA YEF3-F
CGTAAGCATCACCCAATTCC SIGMA YEF3-R
GAAACCACGAAAAGTTCACCA SIGMA intergenic-F
AGCTTCTGCAAACCTCATTTG SIGMA intergenic-R
CCTTATACATTAGGTCCTTTGTAGCAT SIGMA GAL1p-F
GATCCGGTCATTATTAATTTAG SIGMA GAL1p-R
ACTGCAGGACACGCTCAAC SIGMA YAT1-50 -F
GTTTTCTGCGGAGAGCACAG SIGMA YAT1-50 -R
CATTGAACGTGCAGACAGG SIGMA YAT1-mid-F
CGGTGTGTTCGAAGTTGATG SIGMA YAT1-mid-R
TCTGTGGTGGTGTCCTCAAG SIGMA YAT1-30 -F
CTTGCTGCCGTTTGAAGATG SIGMA YAT1-30 -R
ACCAAAGCTCCGGAACTAGA SIGMA LYS2-30 -F
AGACCAATCAACACCTGTCCA SIGMA LYS2-30 -R
ACGTTACCCAATTGAACACG SIGMA ACT1-F
AGAACAGGGTGTTCTTCTGG SIGMA ACT1-R
CTAAGTCTCATGTACTAACATCGATTGCTTC SIGMA ACT1intron-F
ACCGGCAAAACCGGCTTTACACATAC SIGMA ACT1intron-R
Recombinant DNA
pRS316-L CEN / URA3 / leu2D30 -leu2D50 (Prado and Aguilera, 1995) N/A
p-GAL-YAT1 CEN / URA3 / GAL1promoter-YAT1 (Bonnet et al., 2015) N/A
p-GAL-[RPL51A*intron]-YAT1CEN / URA3 / GAL1promoter- (Bonnet et al., 2015) N/A
[RPL51A*intron]-YAT1
p-GAL-[RPL35Aintron]-YAT1 CEN / URA3 / GAL1promoter- this study N/A
[RPL35Aintron]-YAT1
p-GAL-[SEC27intron]-YAT1 CEN / URA3 / GAL1promoter- this study N/A
[SEC27intron]-YAT1
p-GAL-[RPL4Aexon]-YAT1 CEN / URA3 / GAL1promoter- this study N/A
[RPL4Aexon]-YAT1
p-GAL-LYS2 CEN / URA3 / GAL1promoter-LYS2 this study N/A
p-GAL-[RPL51A*intron]-LYS2 CEN / URA3 / GAL1promoter- this study N/A
[RPL51A*intron]-LYS2
p-GAL-[RPL51A*intron(5II3I)]-YAT1 CEN / URA3 / GAL1promoter- this study N/A
[RPL51A*intron carrying mutations within the 50 SS and the
branchpoint]-YAT1
p-GAL-[RPL51A*intron(D5)]-YAT1 CEN / URA3 / GAL1promoter- this study N/A
[RPL51A*intron carrying a deletion of the 50 SS]-YAT1
(Continued on next page)

Molecular Cell 67, 608621.e1e6, August 17, 2017 e2

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
p-GAL-[RPL51A*intron(30 ss*)]-YAT1 CEN / URA3 / GAL1promoter- this study N/A
[RPL51A*intron carrying mutations within the 30 SS]-YAT1
p-GAL-[tGpIintron]-YAT1 CEN / URA3 / GAL1promoter- this study N/A
[Tetrahymena GroupI intron]-YAT1
YCplac111-MS2-GFP CEN / LEU2 / GPDpromoter-NLS-HA-(MS2- a gift from E. Bertrand N/A
CP)-GFP
p-GAL-[MS2-loop]x2-YAT1 CEN / URA3 / GAL1promoter- this study N/A
[MS2-loop]x2-YAT1
p-GAL-[MS2-loop]x6-YAT1 CEN / URA3 / GAL1promoter- this study N/A
[MS2-loop]x6-YAT1
p-L-GAL-YAT1 CEN / URA3 / leu2D30 -GAL1promoter-YAT1-leu2D50 this study N/A
p-L-GAL-[RPL51A*intron]-YAT1 CEN / URA3 / leu2D30 - this study N/A
GAL1promoter-[RPL51A*intron]-YAT1-leu2D50
p-L-GAL-[RPL35Aintron]-YAT1 CEN / URA3 / leu2D30 - this study N/A
GAL1promoter-[RPL35Aintron]-YAT1-leu2D50
p-L-GAL-[SEC27intron]-YAT1 CEN / URA3 / leu2D30 -GAL1promoter- this study N/A
[SEC27intron]-YAT1-leu2D50
p-L-GAL-[RPL4Aexon]-YAT1 CEN / URA3 / leu2D30 -GAL1promoter- this study N/A
[RPL4Aexon]-YAT1-leu2D50
p-L-GAL-LYS2 CEN / URA3 / leu2D30 -GAL1promoter-LYS2-leu2D50 this study N/A
p-L-GAL-[RPL51A*intron]-LYS2 CEN / URA3 / leu2D30 - this study N/A
GAL1promoter-[RPL51A*intron]-LYS2-leu2D50
p-L-GAL-[RPL51A*intron(5II3I)]-YAT1 CEN / URA3 / leu2D30 - this study N/A
GAL1promoter-[RPL51A*intron(5II3I)]-YAT1-leu2D50
p-L-GAL-[RPL51A*intron(D5)]-YAT1 CEN / URA3 / leu2D30 - this study N/A
GAL1promoter-[RPL51A*intron(D5)]-YAT1-leu2D50
p-L-GAL-[RPL51A*intron(30 ss*)]-YAT1 CEN / URA3 / leu2D30 - this study N/A
GAL1promoter-[RPL51A*intron(30 ss*)]-YAT1-leu2D50
p-L-GAL-[tGpIintron]-YAT1 CEN / URA3 / leu2D30 -GAL1promoter- this study N/A
[Tetrahymena GroupI intron]-YAT1-leu2D50
p-L-GAL-[MS2-loop]x6-YAT1 CEN / URA3 / leu2D30 -GAL1promoter- this study N/A
[MS2-loop]x6-YAT1-leu2D50
pRS423-GPD-hsRNH1 2m / HIS3 / GPDpromoter-hsRNH1 this study N/A
pCR4-T7-YAT1 T7promoter-YAT1 this study N/A
pCR4-T7-[RPL51A*intron]-YAT1 T7promoter-[RPL51A*intron]-YAT1 this study N/A
pCR4-T7-[RPL51A*intron(5II3I)]-YAT1 T7promoter- this study N/A
[RPL51A*intron(5II3I)]-YAT1
pCR4-T7-[RPL51A*intron(D5)]-YAT1 T7promoter- this study N/A
[RPL51A*intron(D5)]-YAT1
pCR4-T7-[RPL51A*intron(30 ss*)]-YAT1 T7promoter- this study N/A
[RPL51A*intron(30 ss*)]-YAT1
pCR4-T7-[tGpIintron]-YAT1 T7promoter-[Tetrahymena GroupI this study N/A
intron]-YAT1
Software and Algorithms
Bowtie (Langmead et al., 2009) N/A
MACS2 (Zhang et al., 2008) N/A
Kallisto (Bray et al., 2016) N/A
BEDtools (Quinlan and Hall, 2010) N/A
SAMtools (Li et al., 2009) N/A
Other
NucleoSpin RNA II Macherey-Nagel Cat# 740955

e3 Molecular Cell 67, 608621.e1e6, August 17, 2017

CONTACT FOR REAGENT AND RESSOURCES SHARING

Further information and requests for reagents may be directed to and will be fulfilled by the Lead Contact, Benoit Palancade (benoit.
palancade@ijm.fr).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Yeast Strains and Growth

Yeast strains of the distinct species used in this study are listed in the Key Resources Table. Yeast cultures were performed according
to standard procedures. Growth assays were performed by spotting serial dilutions of exponentially-growing cells on solid YPD
medium and incubating the plates at the indicated temperatures.
S. cerevisiae - All the S. cerevisiae strains are isogenic to S288c and were grown at 30 C in standard yeast extract peptone
dextrose (YPD). For GAL1 promoter induction or repression, 2% galactose or 2% glucose, respectively, was added for 5 hr to cells
grown in glycerol-lactate (GGL: 0.17% YNB, 0.5% ammonium sulfate, 0.05% glucose, 2% lactate and 2% glycerol) supplemented
with the required nutrients.
C. glabrata The Cagl0b01617 g ORF was unambiguously identified as the closest ScHPR1 relative in the Candida glabrata
genome and further renamed CgHPR1. A gene replacement cassette was amplified from pFA6a-TRP1 using recombinogenic
primers harboring 80 bases of homology upstream and downstream the CgHPR1 ORF and transformed in the previously described
C. glabrata DHTU strain (Kitada et al., 1995). Correct integration of the cassette was verified by PCR and cells were grown in YPD at
30 C for phenotypic analyses.
S. pombe The SPCP25A2.03/tho1 gene, which encodes the closest Hpr1 ortholog in Schizosaccharomyces pombe, being
essential (Kim et al., 2010), inactivation of SpHPR1 was performed by integrating a P81nmt1 thiamin-repressible promoter (Ba hler
et al., 1998) upstream its coding sequence. The corresponding Pnmt1-SpHPR1 and its parental wild-type strains were kindly provided
by M. Rougemaille (Institut Jacques Monod, Paris, France). For DNA:RNA hybrids analyses, cells were grown for 64h in standard
Edinburgh minimal medium supplemented with the required nutrients in the presence of 20 mg/mL thiamin.
C. neoformans The AFR96461/CNAG_03235/THOC1 gene was annotated as the closest human Hpr1 relative in the Crypto-
coccus neoformans genome and further named CnHPR1 in this study. CnHPR1 inactivation was performed in the parental strain
JEC32 by biolistic transformation integration using a geneticin resistance marker and further verified as previously described
(Goebels et al., 2013). Cells were further grown in YPD at 30 C for phenotypic analyses.

Plasmids
Plasmids used in this study are listed in the Key Resources Table and were constructed using PCR-based molecular cloning tech-
niques. Introns from RPL35A and SEC27, as well as an exonic sequence from RPL4A (1-70), were inserted downstream the ATG
within p-GAL-YAT1. The complete LYS2 CDS was subcloned downstream the GAL1 promoter to generate p-GAL-LYS2. Plasmids
of the p-L-GAL serie (used for hyper-recombination assays) were obtained by subcloning the different GAL1-promoter(+ATG)-YAT1
cassettes from plasmids of the p-GAL serie between the two leu2 repeats of pRS316-L, which share 600pb of homology. Previously
described intron mutations (5II3I and D5; Lacadie and Rosbash, 2005) were integrated in p-GAL-[RPL51A*intron]-YAT1 by PCR-
based mutagenesis. The 30 SS was mutated by introducing a AG- > Ac substitution (Alexander et al., 2010) at the end of the
RPL51A*intron, together with a G- > c substitution at a secondary 30 SS mapped 9 nt downstream. The Tetrahymena GroupI self-
splicing intron sequence was amplified from ptGpI-CUP1 (Chalamcharla et al., 2010) and subcloned between the ATG and the
YAT1 CDS within p-GAL-YAT1. MS2-loop coding sequences were amplified from pIIIA/MS2-1 (a gift from M. Wickens) and inserted
between the ATG and the YAT1 CDS within p-GAL-YAT1. For in vitro transcription, the YAT1 CDS, eventually flanked by wt or mutant
RPL51A* introns, was subcloned downstream the T7 promoter within the pCR4-TOPO vector (Lifetech). For RNH1 overexpression, a
GPDpromoter-hsRNH1 cassette from p425-GPD-hsRNH1 (Wahba et al., 2011) was subcloned in pRS423.

METHOD DETAILS

DNA:RNA hybrid detection

DNA:RNA hybrid immunoprecipitation (DRIP) was performed using the S9.6 DNA:RNA hybrid-specific monoclonal antibody
according to a published procedure (Mischo et al., 2011; Wahba et al., 2016), with the following modifications. Briefly, genomic
DNA was phenol-extracted from exponentially growing yeast cells and isolated by ethanol precipitation. 50 mg of purified DNA
were digested by a cocktail of restriction enzymes (EcoRI, HindIII, XbaI, SspI, BsrGI; FastDigest enzymes; Thermo Scientific) for
30min at 37 C in a total volume of 100 mL, conditions in which complete digestion was observed. Digested DNA samples were further
diluted 4-fold with FA1 buffer (0.1% SDS, 1% Triton, 10 mM HEPES pH 7.5, 0.1% sodium deoxycholate, 275 mM NaCl) and incu-
bated for 16h in the presence of 1.5 mg of S9.6 purified antibody (Kerafast). Immunoprecipitated DNA fragments were further
captured on protein G Sepharose beads (GE Healthcare), washed and purified according to standard ChIP procedures (Bonnet
et al., 2015). Input and immunoprecipitated DNA amounts were quantified by real-time PCR with a LightCycler 480 system (Roche)
using SYBR Green incorporation according to the manufacturers instructions. The amount of DNA in the immunoprecipitated

Molecular Cell 67, 608621.e1e6, August 17, 2017 e4

fraction was divided by the amount detected in the input to evaluate the percentage of immunoprecipitation (% of IP). Specificity of
the DRIP signal was determined by including 10 units of RNase H (Sigma) in the digestion reaction. Free RNA removal did not enhance
the specificity of our DRIP assay, in agreement with previous reports (Wahba et al., 2016; Halasz et al., 2017).
Dot-blot detection of DNA:RNA hybrids was performed as previously described (Wahba et al., 2016). Decreasing amounts of
genomic DNA (prepared as above) were adsorbed onto nylon membranes (Hybond-N+, GE Healthcare) which were incubated
with the following mouse antibodies: anti DNA:RNA hybrids (S9.6; 1:4,000 in TBS, 0.5% Tween-20, 5% skimmed milk); anti
double-stranded DNA (HYB331-01; 1:1,000 in TBS, 0.5% Tween-20, 5% BSA). Following incubation with anti-mouse peroxy-
dase-conjugated antibodies, membranes were imaged on a LAS4000 Imager (Fuji). The DNA:RNA hybrid and total DNA amounts
were determined using serial dilutions of a reference sample as a standard. For each species, specificity of the dot-blot signals
was systematically confirmed by treating the DNA extracts with RNase H (Roche) or RNase-free DNase (Promega) prior to blotting.
For in vitro assays, DNA:RNA hybrids were formed by transcription of the YAT1 sequence placed under the control of the T7 Pro-
moter using the Riboprobe T7 in vitro transcription system (Promega). Free RNA degradation, RNase H treatment and subsequent
plasmid isolation was performed as previously reported (Yu et al., 2006). In vitro transcribed plasmids were either directly used for
DNA:RNA hybrid immunoprecipitation as above, or resolved on 1% stain-free low-melting agarose gels, and further stained with
Ethidium Bromide. For dot-blotting of in vitro formed R-loops, in vitro transcribed plasmids were cut from the agarose gel following
electrophoresis, solubilized and adsorbed onto nylon membranes, as above.

Gene expression and splicing analyses

Total RNAs were directly extracted from yeast cells disrupted by bead beating. For nascent mRNA analysis, chromatin pellets were
isolated using a described procedure (Carrillo Oesterreich et al., 2010) and checked for their protein content by western blot analysis
using the following antibodies: anti-Rpl1 (Delaveau et al., 2016), anti-Rpl3 (DSHB) and anti-Rpb1 (BioLegend). Total or chromatin-
associated mRNAs were then purified using the Nucleospin RNA II kit (Macherey-Nagel) and reverse-transcribed with Super-
script-II reverse transcriptase (Invitrogen). cDNA quantification was achieved by real-time PCR using primers as described in the
Key Resources Table. YAT1-specific primers detected both the unspliced and spliced versions of the reverse-transcribed mRNAs.
ACT1-specific primers were previously described (Alexander et al., 2010). The amounts of the mRNAs of interest were normalized
relative to ACT1 mRNA values (that do not vary between the different strains and growth conditions used in this study), and further
set to 1 for wt cells carrying the intronless GAL-YAT1 reporter. Unless indicated, values obtained for the YAT1-30 amplicon were
displayed.
RNA polymerase II distribution along the genes of interest was determined by ChIP using anti-Pol II largest subunit antibodies (anti-
Rpb1, BioLegend) as previously reported (Bonnet et al., 2015). Input and immunoprecipitated DNA amounts were further quantified
by real-time PCR as above. Spliceosome recruitment was evaluated by ChIP as above except that IgG Sepharose beads (GE Health-
care) were used to capture TAP-tagged U1snRNP or U2snRNP subunits. Splicing efficiencies of the reporter constructs were deter-
mined by semiquantitative PCR using the following intron-flanking primers detecting both unspliced and spliced reverse-transcribed
mRNA variants: CCTTATACATTAGGTCCTTTGTAGCAT (forward) and GTTTTCTGCGGAGAGCACAG (reverse).

Bioinformatic analyses of yeast datasets

A dataset or R-loop-prone sites, obtained by DRIP-seq in the rnh1D rnh201D strain (Wahba et al., 2016) was used to compare hybrid
formation between intronless and intron-containing loci. DNA:RNA hybrid occurrence was determined by intersecting this dataset
with the list of wild-type sacCer3 transcripts (Xu et al., 2009), including intron-containing genes as defined in the Saccharomyces
Genome Database (http//www.yeastgenome.org), using the BEDtools package (Quinlan and Hall, 2010). Only the coding transcripts
corresponding to a single ORF were considered in the analysis. Hybrid-positive and hybrid-negative genes were further divided into
five categories according to their expression levels (transcriptional frequency, mRNAs/hour; Holstege et al., 1998), as previously
described (Chan et al., 2014a; Stirling et al., 2012). For each gene, the number of reads associated with each overlapping DNA:RNA
hybrid-enriched regions was normalized to the total number of reads per run, further weighted by the length of the overlap divided by
the length of the full transcript, and summed to define the R-loop density. The mean R-loop density was averaged from 4 independent
sequencing runs. Alternatively, we used a dataset of R-loop-prone sites obtained by DRIP-chip in wt cells (Chan et al., 2014a), in
which hybrid-enriched regions are characterized by an occupancy score. For each transcript, the scores of each overlapping
hybrid-enriched regions were further weighted by their length divided by the length of the full transcript, and summed to define
the hybrid density. These density values were further averaged from the 2 replicates. The dataset of R-loop positive transcripts
was further intersected to two distinct g-H2A ChIP-chip dataset (Capra et al., 2010; Stirling et al., 2012), in which g-H2A-enriched
regions are characterized by an occupancy score of g-H2A. Transcripts overlapping g-H2A-enriched regions in both ChIP-chip rep-
licates were considered as g-sites-positive. For each transcript, g-H2A densities were calculated using the same rationale as used
above for hybrid densities. Genomic features were assessed across the entire length of each genes according to: percentage of G
and C; (G-C)/(G+C) for GC skew; (A-T)/(A+T) for AT skew.

Bioinformatic analyses of human datasets

Genome-wide R-loop, transcriptome and g-H2AX profiling was assessed using publicly available data, including DRIP-seq data from
human fibroblasts and NTERA2 cells (Ginno et al., 2013; Lim et al., 2015); RDIP-seq data from HEK293 and IMR90 cells (Nadel et al.,

e5 Molecular Cell 67, 608621.e1e6, August 17, 2017

2015); RNA-seq data from human fibroblasts (Lim et al., 2015) and NTERA2 cells (SRA: SRX359337); GRO-seq (genomic run-on) data
from HEK293 (GEO: GSM1249869 and GSM1249874) and IMR90 cells (GEO: GSM1055806); g-H2AX ChIP-seq from HEK293 cells
(Bunch et al., 2015). The quality of high-throughput sequencing data was assessed with FastQC (http://www.bioinformatics.
babraham.ac.uk/projects/fastqc). DRIP-seq and RDIP-seq reads were aligned to the reference human genome (GRCh38/hg38
assembly) with Bowtie (Langmead et al., 2009) and filtered for uniquely aligned reads. Enriched regions were identified using
MACS2 (Zhang et al., 2008), with a false-discovery rate of 0.05 and an absolute change in density higher than 2-fold relative to
the control sample (digested input DNA). R-loops overlapping with signal artifact blacklisted regions were removed (ENCODE Project
Consortium, 2012). Finally, R-loops were assigned to annotated genes from GenCode (GRCh38, release 23) (Harrow et al., 2012)
previously merged into a single model transcript per gene. R-loop density was estimated using only read counts overlapping signif-
icantly enriched regions and normalized as reads per kilobase per million mapped reads (RPKMs). RNA-seq and GRO-seq sequence
reads were pseudo-mapped to the human transcriptome (GRCh38/hg38) using Kallisto (Bray et al., 2016) and gene expression levels
were estimated as transcripts per million (TPMs). R-loop-positive, transcriptionally active genes (expression higher than the 25th
percentile) were split into four equally sized groups: low (L), medium (M), high (H) and very high (VH) expression. To obtain intronless
and intron-containing gene groups with equivalent expression levels, genes with TPMs higher than 32 were removed from the anal-
ysis. For each R-loop-positive gene, the g-H2AX enrichment was further determined as the fold-change in the g-H2AX signal as
compared to the control input. GC features were assessed for each gene co-oriented with transcription using 50bp sliding windows
of 1 bp step size according to: percentage of G and C; (G-C)/(G+C) for GC skew. A set of in-house scripts for data processing and
graphical visualization was written in Bash and in the R environmental language (http://www.R-project.org). SAMtools (Li et al., 2009)
and BEDtools (Quinlan and Hall, 2010) were used for alignment manipulation, filtering steps, file format conversion and comparison of
genomic features.

QUANTIFICATION AND STATISTICAL ANALYSIS

Hyper-recombination rates were defined as the mean of 3 experiments, each one performed with six independent colonies: cells
were plated on SC medium lacking leucine to estimate the number of Leu+ recombinants, while cell survival was estimated following
plating on SC medium. For statistics, n values correspond to the number of biological replicates (e.g., independent yeast cultures).
The following statistical tests were used: Fisher exact test (to compare R-loop/g-sites occurrences between intronless and intron-
containing gene populations; Figures 1 and S1); Bootstrapping Method with 100000 replications of the samples mean to compare
R-loop/g-sites densities of intronless and intron-containing dataset; Figures 1 and 7); Mann-Whitney-Wilcoxon with FDR adjusted
p values (to compare R-loop densities and genomic features of intronless and intron-containing datasets; Figures 1, S1, and S7);
two-sided Welchs t test, allowing unequal variance (other figures). *p % 0.05; **p % 0.01; ***p % 0.001; ns, not significant.

DATA AND SOFTWARE AVAILABILITY

The raw images have been deposited in Mendeley Data and are available at http://dx.doi.org/10.17632/b3f8k56vjs.1.

Molecular Cell 67, 608621.e1e6, August 17, 2017 e6