Peptides 31 (2010) 394401

Contents lists available at ScienceDirect

Peptides
journal homepage: www.elsevier.com/locate/peptides

Conservation of the egg-laying hormone neuropeptide and attractin pheromone

in the spotted sea hare, Aplysia dactylomela
Scott F. Cummins a,*, Parinyaporn Nuurai a,c, Gregg T. Nagle b, Bernard M. Degnan a
a
School of Biological Sciences, The University of Queensland, Brisbane, QLD 4072, Australia
b
Department of Neuroscience and Cell Biology, University of Texas Medical Branch, Galveston, TX, USA
c
Faculty of Allied Health Sciences, Burapha University, Chonburi, Thailand

A R T I C L E I N F O A B S T R A C T

Article history: In the marine opisthobranch mollusc, Aplysia, secreted peptides and proteins play an essential role in egg
Received 21 April 2009 laying and mate attraction. Aplysia californica egg laying is initiated by secretion of the egg-laying
Received in revised form 10 October 2009 hormone (ELH) peptide while mate attraction is made possible by protein pheromones, such as attractin,
Accepted 13 October 2009
released into the surrounding seawater with the egg cordon. In this study, we investigated the existence
Available online 23 October 2009
of similar egg-laying hormone and attractin products in the spotted sea hare, Aplysia dactylomela, a
species that is widely distributed in almost all tropical and temperate oceans, including Australias Great
Keywords:
Barrier Reef. Immunological analysis revealed that an ELH-like transmitter is present within bag cell
Aplysia
somata and processes of the abdominal ganglion. A molecular genetic approach found that the ELH
Egg-laying hormone
Attractin precursor mRNA is synthesized in the abdominal ganglia and encodes a 36-residue peptide (dELH) that is
Pheromone cleaved from the prohormone prior to secretion. It is most closely related to A. californica and A. brasiliana
Temperature ELH (91.7% identical). We also found that A. dactylomela synthesize an attractin pheromone in the
albumen gland that is released during egg laying. The gene encodes a 58-residue mature protein that is
74.9% similar to A. californica attractin. We demonstrate that an increase in seawater temperature can
disrupt attractins higher order interactions, such as those with the pheromone temptin, and accelerates
attractin degradation. Together, these ndings further expands our understanding of pheromone
intermolecular interactions and presents an opportunity for further study of how increases in sea water
temperature may affect this important marine communication system.
2009 Elsevier Inc. All rights reserved.

1. Introduction
The marine opisthobranch mollusc genus Aplysia provides an
excellent model for the study of peptides involved in molluscan
reproduction, from egg laying to mate attraction. When aplysids
make physical contact with freshly laid egg cordons, an
unidentied contact pheromone is thought to trigger a synchro-
nous discharge of the neuroendocrine bag cells (BCs) of the
abdominal ganglion, resulting in the secretion of a family of
peptides into the hemocoel and the initiation of egg laying [1,11].
The biologically active peptides, including the a-bag cell peptide
(BCP), b-BCP and egg-laying hormone (ELH), are cleaved from a
* Corresponding author at: School of Biological Sciences, Goddard Building, The
University of Queensland, Brisbane, QLD 4072, Australia.
Tel.: +61 7 3365 6016; fax: +61 7 3365 1065.
E-mail addresses: s.cummins@uq.edu.au (S.F. Cummins), fone2526@yahoo.com
(P. Nuurai), gtnagle@utmb.edu (G.T. Nagle), b.degnan@uq.edu.au (B.M. Degnan).
larger ELH precursor protein [28]. The ELH acts on the smooth
muscle of the ovotestis to promote egg release ([11], Fig. 1). The
discovery of ELH in other invertebrates, such as the freshwater
snail Lymnaea stagnalis [30] and the leech Theromyzon tessulatum
[27], illustrates their importance in invertebrate gamete release.
Egg laying is typically preceded by the mating of conspecics,
which provides fresh sperm for egg fertilization. It has become
increasingly evident that water-borne protein pheromones play a
major role in molluscan social behavior, including mate attraction
and mating. Aplysia mate attraction is controlled by a cocktail of
proteins that are released during egg laying [4,5,7,22]. The major
pheromone is attractin, a 58-residue glycosylated protein that was
rst isolated from egg eluates of the North American Pacic Coast
species A. californica, but bioassayed with Aplysia brasiliana, a
species found in the Gulf of Mexico [21]. Analytical studies have
revealed that it represents approximately 20% of the transcripts in
the albumen gland and that the mature protein is secreted from
this gland during egg laying ([13]; Fig. 1). Attractin acts in concert
with the pheromones enticin, temptin and seductin to attract and

0196-9781/$ see front matter 2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.peptides.2009.10.010
 S.F. Cummins et al. / Peptides 31 (2010) 394401
Fig. 1. Schematic representation of Aplysia egg laying and pheromone release. The egg-laying hormone (ELH) peptide is released from bag cells in the abdominal ganglion
(Abg), which acts on the smooth muscle of the ovotestis (Ov) to stimulate egg release, followed by egg fertilization, cordon packaging and egg laying. The pheromone attractin,
and in complex with temptin, is secreted from the albumen gland (AG; represented by *) and released with the egg cordon (EC) that is laid externally in the surrounding
seawater. PH, pheromones.
recruit Aplysia to freshly laid eggs [5,7]. Large breeding aggrega-
tions then form that may last for several days, and contain animals
that alternatively mate and lay eggs.
We have characterized the attractins of ve different Aplysia
species and analyzed the residues that are important for attraction
activity [22]. We had originally hypothesized that each Aplysia
species secretes a unique attractin, but a comparison of all attractin
family members revealed that attractins are not species-specic
but constitute a relatively promiscuous signal. For example, A.
brasiliana are attracted by A. californica attractin and A. vaccaria
attractin, which are 95% and 43% identical to A. brasiliana attractin
[22].
Docking analysis and gel shift assays have demonstrated that
temptin complexes with wild-type attractin (Fig. 1, [9]). Our model
of temptin, based on the class 1 EGF-like domain of brillin, indicates
that it could serve to organize the pheromone complex and facilitate
signaling, by binding to both the pheromone and a cell surface
receptor. These higher order interactions could also function to delay
degradation, where attractin would bind with one conserved face to
temptin, while still displaying the residues on the second helix that
are essential for pheromone activity. We hypothesize that environ-
mental variations could signicantly inuence these intermolecular
interactions and subsequent pheromone organization, ultimately
affecting attractin duration of bioactivity.
Unlike most Aplysiidae species that have a restricted distribu-
tion, A. dactylomela has a worldwide distribution in tropical and
warm temperate waters of the Atlantic and Indo-Pacic [25]. In the
past, they have been used to research novel bioactive molecules
such as defensive secretions [10], cytotoxic sesquiterpenes [12]
and micosporine-like amino acids [2], as well as antibacterial
proteins [20]. Although A. dactylomela are commonly observed egg
laying and in hermaphroditic mating aggregations, the peptides
and proteins controlling these processes have never been
characterized. In the present study we investigated ELH and
attractin of A. dactylomela. We conclude that they are present and
are highly similar to those found in other Aplysia. Moreover, we
nd that at higher ocean temperatures, pheromone organization
within egg eluates is modied and as a result, degradation of
bioactive attractin is enhanced. These results extend upon our
previous studies and provide valuable information for under-
standing reproduction and marine pheromone communication.
2. Materials and methods
2.1. Experimental animals
Adult A. dactylomela (50150 g) were collected from Kings
Beach in Caloundra, Australia. Animals were transferred to the
laboratory and reared for less than one week on a natural daylight
395
cycle and fed with Gracilaria once daily. For dissection of tissues,
animals were injected with 360 mM MgCl2, and then abdominal
ganglia and albumen glands were removed and either xed
overnight in 4% paraformaldehyde or immediately frozen in liquid
nitrogen for storage at 80 8C.
2.2. Immunolocalization of A. dactylomela egg-laying
hormone and attractin
Tissues that had been xed in fresh 4% paraformaldehyde in a
0.1 M phosphate buffer (pH 7.4) for 24 h at 4 8C, were then incubated
in 30% sucrose overnight at 4 8C. Tissues were embedded in O.C.T
compound (Sakura) and stored at 80 8C for less than one week.
Serial sections (20 mm) were cut with a cryostat (Leica), mounted on
SuperFrost Plus slides (Menzel-Glaser). Blocking was performed in
4% bovine serum albumin for 30 min. Sections were rinsed in PBS
(3), incubated overnight at 4 8C in mouse anti-ELH ([19]; 1:200
dilution) or rabbit anti-attractin ([5]; 1:500), rinsed in PBS (3),
incubated in FITC-conjugated goat anti-mouse Ig or goat anti-rabbit
Ig (Sigma) for 1 h at 22 8C, rinsed in PBS (3), and then mounted in
FITC mounting solution (90% glycerol, 4% n-propylgallate in 50 mM
PBS, pH 8.2). Preparations were examined using an Olympus
FluoView confocal microscope (Leeds Instruments), and the image
captured. In preabsorption controls, primary antiserum was
replaced with A. dactylomela ELH or attractin antiserum preincu-
bated with the corresponding antigen (20 mg/ml).
2.3. Oligonucleotide primers
The oligonucleotide primers (Sigma-Genosys) for RT-PCR
identication of A. dactylomela ELH and attractin are OL1OL6,
and primers used for cloning A. dactylomela ELH into the bacterial
expression vector pGEX-2T are OL7OL8.
OL1, AAGCAGTGGTATCAACGCAGAGT17
OL2, TCCGAGACTACGCTTCTACTCCTTACG
OL3, AAGCAGTGGTATCAACGCAGAGT
OL4, CCATTAGTCCAAGAGGTTGCTTAAGG
OL5, TGCTATCATTATCCTCAGTCTCGC
OL6, N(A/T/G/C)GCNY(C/T)TNGTNGCNGCNGTNTTYGC
OL7, CGCGTGGATCCATCTCCATCAACCAGG
OL8, GTCTAGAATTCCTACTTTTGCAAGAGACGC
2.4. Molecular identication and phylogenetic analysis of egg-laying
hormone and attractin genes from A. dactylomela
Total RNA was extracted from abdominal ganglia and albumen
glands using TriReagent (Astral Scientic Pty. Ltd.), following the
396 S.F. Cummins et al. / Peptides 31 (2010) 394401
manufacturers instructions. RNA was resuspended using RNase-
free water. First-strand cDNA was generated by reverse transcrip-
tion of total RNA using an antisense adaptor primer (OL1) and the
Superscript Preamplication System for First Strand Synthesis
(Invitrogen). For ELH, primers were designed to a 370 bp region of
an A. californica ELH (GenBank accession number AAA27746). Two
rounds of PCR were performed. First round PCR used primers OL2
(corresponding to PRLRFYSLR) and OL3, while nested second round
PCR used primers OL2 and OL4 (corresponding to TLSNLLD). For
attractin, primers were designed to A. californica attractin
(GenBank accession number U85586). The 30 region was isolated
by two rounds of PCR. First round PCR used OL5 (corresponding to
AIIILSLA) and OL3, followed by a nested second round PCR using
OL6 (corresponding to ALVAAVFA) and OL3. Each reaction was
performed in a nal concentration of 1 PCR buffer, 1.5 mM MgCl2,
200 mM of each dNTP, 0.5 mM of each primer, 1.25 units of Taq-Ti
polymerase (Fisher Biotech Australia) and ddH2O. First round PCR
conditions consisted of an initial 94 8C for 2 min, then 36 cycles
(94 8C, 60 s; 45 8C, 30 s; 74 8C, 60 s). Second round PCR conditions
consisted of an initial 94 8C for 2 min, then 36 cycles (94 8C, 60 s;
55 8C, 30 s; 74 8C, 60 s), followed by a 7-min extension at 74 8C. PCR
reactions were visualized by 2% agarose gel electrophorsesis and
amplicons of expected size were cloned into the vector pGEM-T
(Promega) and sequenced. Computer analyses of sequences were
performed using BLAST and CLUSTALW for nucleotide and amino
acid alignment.
Conceptual amino acid translations of the ELHs and attractins
were aligned using Clustal X 1.64b [29] to a selection of protein
sequences that closely matched ELH or attractin family members.
Alignments were edited visually in the Sequence Alignment
Program Se-Al v1.d1 [23] and regions of uncertain alignment
were removed. Phylogenetic trees were constructed using MEGA3
software [17] with 1000 bootstrap trials using the neighbor-
joining method [26] and presented with a cutoff bootstrapping
value of 50.
2.5. Biochemical identication of an egg-laying hormone by
matrix-assisted laser desorption/ionization time-of-ight mass
spectrometry (MALDI-TOF MS)
A. dactylomela ELH was analyzed from the abdominal ganglion
by whole cell MALDI-TOF MS. Abdominal ganglia were dissected
from adults after injection of 360 mM MgCl2. Segments were cut
from the region of the rostral margins and processed by the
method of direct MALDI-MS of Floyd et al. [14], with modications.
Salts were eliminated by washing in an aqueous MALDI matrix
solution, 20 mg/ml of 2,5-dihydroxybenzoic acid (Sigma) in 30%
acetonitrile/0.1% TFA. Fine tweezers and needles were used to
desheath and isolate (<1 mm) cells from each segment. Each
sample was then placed onto a MALDI-MS sample plate containing
0.5 ml of matrix solution. After drying at ambient temperature,
samples were analyzed immediately. MALDI-TOF MS was per-
formed on a Voyager-DE STR Biospectrometry workstation
(Applied Biosystems, Australia), equipped with a N2 laser and
pulsed ion extraction accessory. The instrument was calibrated
using a standard peptide mixture (Sigma). Final spectra resulted
from 500 shots, recorded in the reectron mode within a mass
range from m/z 500 to m/z 6000.
2.6. Recombinant egg-laying hormone
A cDNA sequence encoding 36 amino acids of the A. dactylomela
ELH corresponding to Ile1-Lys36 (see Section 3, Fig. 3A) was PCR
amplied using the primers OL7 and OL8, which incorporated
terminal restriction sites for Bam HI and Eco RI sequences.
Reactions were performed in a nal concentration of 1 PCR
buffer, 1.5 mM MgCl2, 200 mM of each dNTP, 0.5 mM of each
primer, 1.25 units of Taq-Ti polymerase and ddH2O. PCR consisted
of 36 cycles, including a 1 min denaturation at 94 8C, a 1 min
annealing at 40 8C, and a 2 min extension at 74 8C. A PCR product of
expected size was gel extracted, double digested, directionally
ligated into a pGEX-2T vector (Pharmacia), and then transformed
into Escherichia coli strain XL1-Blue. Positive recombinant clones
were subjected to plasmid purication and sequencing of inserts.
Positive colonies were sub-cultured in LB medium containing
ampicillin, then expression of a glutathione S-transferase (GST)-
ELH fusion protein was induced with 0.2 mM isopropyl-b-
thiogalactopyranoside (IPTG). GST fusion protein purication
was performed according to the manufacturers instructions
(GE Healthcare) and the integrity of expressed protein veried
by 12% sodium dodecyl sulfatepolyacrylamide gel electrophoresis
(SDSPAGE) with Coomassie Blue staining.
2.7. Egg-laying assay, pheromone secretion and effect of
temperature on attractin
A. dactylomela were induced to lay eggs by injection of 60 mg/ml
A. dactylomela recombinant ELH. One hour after injection, egg
cordons were removed, transferred to 100 ml of ltered seawater
(0.45 mm) for elution, and gently shaken for 30 min. Egg eluates
were removed to a separate container and gently shaken over 24 h
at 22 and 37 8C. Samples were collected at 0, 4, 12 and 24 h post egg
laying (hpel), acidied to a nal concentration of 0.1% TFA, ltered
(0.45 mm), puried on C18 Sep-Pak Vac cartridges, and the sample
eluted with 60% CH3CN/0.1% TFA and lyophilized. SDSPAGE and
immunoblot analyses of concentrated samples (10 mg total) were
performed using antisera raised against attractin; attractin
secretion has been previously demonstrated in A. californica by
RP-HPLC [21]. Briey, peptides and proteins were resuspended in
ltered seawater then mixed with native gel sample buffer (75 mM
TrisHCl, pH 6.8, 50% glycerol, 0.25% bromphenol blue) to a nal
volume of 15 ml. Preparations were applied to a 12% Trisglycine
gel (375 mM TrisHCl, pH 8.0) and run at constant voltage (120 V)
for 60 min. Immunoblot transfer was performed essentially as
previously described [9]. Results were assessed by analysing the
presence or absence of higher order interactions and relative
immunoreactivity. As a negative control, the primary antiserum
was replaced with attractin antiserum preincubated with the
corresponding A. dactylomela antigen (20 mg/ml). Blots were
incubated with SuperSignal chemiluminescence reagent (Pierce);
light emission was detected with autoradiography lms.
3. Results
3.1. Immunolocalization of ELH- and attractin-like peptides
in A. dactylomela
Immunouorescence studies were performed to conrm the
expression and localization of an ELH in abdominal ganglion bag
cells and to identify the expression of an attractin protein within
the albumen gland. We identied an ELH-like peptide strictly
within the neuroendocrine bag cells and in their processes
within the connective tissue sheath overlying the ganglion
(Fig. 2A and B). This conrms the ndings of Chui and
Strumwasser using an immunoperoxidase method [3]. An
antibody specic to the highly conserved IEECKTS region of
A. californica attractin was successfully used to identify
attractin-like immunoreactivity within cells of A. dactylomela
albumen glands, likely secretory cells similar to those found in
A. californica (Fig. 2C). Controls in which antiserum had been
preabsorbed with antigen showed little to no immunoreactivity
for ELH or attractin (Fig. 2D and E).
 S.F. Cummins et al. / Peptides 31 (2010) 394401 397

Fig. 2. Localization of ELH- and attractin-like peptides in Aplysia dactylomela. (A and B) Cryostat sections showing ELH-like peptide immunoreactivity (green) within (A) bag
cell neurons and (B) nerve bers of the abdominal ganglion. (C) Cryostat section showing attractin-like immunoreactivity (green) within the secretory cells of the albumen
gland. Controls show no immunoreactivity for (D) ELH and (E) attractin in their respective organs. Arrows show selected sites of immunoreactivity. Sections were
counterstained with the nuclear uorescent stain 40 ,6-diamidino-2-phenylindole (DAPI). (For interpretation of the references to color in this gure legend, the reader is
referred to the web version of the article.)

3.2. Characterization of A. dactylomela egg-laying hormone
PCR amplication of A. dactylomela abdominal ganglion cDNA,
using primers specic to ELH, generated an amplicon of 370 bp.
This was successfully cloned, sequenced and analyzed for ELH-like
properties. The sequence data has been submitted to the GenBank
database under the accession number FJ872826. We found that the
transcript encoded a partial ELH precursor protein containing an A.
dactylomela epsilon-BCP (de-BCP), acidic peptide (dAP) and a 36-
amino acid ELH (dELH), that are each anked by paired basic
cleavage sites. An alignment of the dELH with other Aplysiidae
ELHs and Lymnaea ELH is shown in Fig. 3A, showing high
conservation. The ELHs characterized are representatives of four of
the ve Aplysia subgenera; Pruvotaplysia (A. parvula); Neoaplysia
(A. californica); Varria (A. brasiliana, A. dactylomela, A. kurodai);
Aplysia (A. vaccaria) [16]. As demonstrated by phylogenetic
analysis, the predicted amino acid sequence of A. dactylomela is
most closely related to A. californica and A. brasiliana ELH (Fig. 3B)
and is 91.7% identical.
MALDI-TOF MS was performed on bag cell segments of the
abdominal ganglion. Essentially all peaks in the mass spectra
presented correspond to the protonated molecular weights. Four
major peaks spanning m/z 30005000 were identied in 10
representative mass spectra (Fig. 3C). Based on the predicted
processed peptides from the cloned and sequenced A. dactylomela
ELH precursor, we could assign the mass peak m/z 4408 to the
dELH. A peptide of 3193 Da could represent dELH cleavage at Leu26,
while an m/z 2976 could be the dAP (data not shown). Also readily
observed were mass peaks putatively assigned on the basis of their
similarity to their counterparts in A. californica mass spectra,
including FMRFa (599) and L3 peptide LUQIN (1200) (data not
shown).
The dELH gene was inserted into a pGEX-2T expression vector
and expressed with GST in E. coli cells. Fusion proteins were puried
and assessed by fractionation in 12% SDSPAGE with Coomassie Blue
staining. Fig. 3D shows a protein band representing GST with dELH
of the predicted molecular mass (29 kDa).
3.3. Characterization of A. dactylomela attractin
A 30 attractin cDNA (539 bp) was identied from the A.
dactylomela albumen gland. Fig. 4A shows an alignment of the
398 S.F. Cummins et al. / Peptides 31 (2010) 394401

Fig. 3. Identication of A. dactylomela egg-laying hormone. (A) Comparative amino acid alignment of A. dactylomela ELH (dELH) with the ELHs of other Aplysia species and
Lymnaea. Amino acids that are identical to A. californica ELH are shaded in red. The amino acid sequence of dELH is predicted from cDNA. (B) Phylogenetic analysis of ELH
sequences. Note that dELH is most closely related to A. californica and A. brasiliana ELH. Scale bar indicates number of amino acid substitutions. (C) Reectron mode spectrum
of the abdominal ganglion in 2,5-dihydroxybenzoic acid indicating a distinct m/z at 4408, representing mature dELH. m/z, mass-to-charge ratio. (D) Sodium dodecyl sulfate
polyacrylamide gel electrophoresis followed by Coomassie Blue staining, showing fusion protein (GST-dELH) at the predicted molecular weight. (For interpretation of the
references to color in this gure legend, the reader is referred to the web version of the article.)

encoded mature protein with known Aplysia attractin family
members and Bursatella attractin. The sequence data has been
submitted to the GenBank database under the accession number
FJ906621. Most signicant, there is high overall conservation,
particularly within the heptapeptide I30EECKTS sequence, charged
surface exposed amino acids (D5, D22, E39), glycosylation site
(N8IT), and six cysteine residues that are known to confer
structural integrity. Most variation is found at the C-terminal
region from residues 4552, where only F46 is conserved with A.
californica. The attractins characterized represent three of the ve
Aplysia subgenera. As demonstrated by phylogenetic analysis, the
A. dactylomela attractin amino acid sequence is most closely
related to A. californica, A. brasiliana and A. fasciata attractin
(Fig. 4B). High levels of carbohydrates in albumen gland meant
that MALDI-MS detection of attractin within this gland was not
possible.
3.4. Effect of temperature on attractin
A. dactylomela recombinant ELH was injected into mature A.
dactylomela to induce egg laying, and then egg eluates were shaken
for 24 h at either 22 or 37 8C. Immunoblotting showed that
attractin is present in egg cordon eluates at 0 h post egg laying
(hpel; Fig. 5), clearly demonstrating that it is released during egg
laying in this species and within higher order interactions which
migrate at a higher molecular weight than attractin alone. This has
been observed in previous immunoassays performed on A.
californica egg eluates [9]. We found that under control conditions
of 22 8C (similar to that in the wild), essentially all immunoreactive
attractin is present within higher order interactions (Fig. 5). Under
these conditions, attractin persisted in complex for at least 24 hpel.
However, when egg eluates were incubated at 37 8C prior to assay,
there was an apparent decrease in attractin complexing by 4 hpel
and a distinct decrease in immunoreactive attractin by 24 hpel
(Fig. 5).
4. Discussion
The results of this study conrm and extend the highly
conserved nature and important role of ELH and attractin in Aplysia
reproduction. Our study of A. dactylomela initially found that an
ELH-like peptide was expressed in the bag cells of the abdominal
ganglion and that an attractin-like protein exists within the
albumen gland. Further examination has provided information
about the structural organization and evolution of these genes, and
further conrmation about potential receptor binding sites
through examination of homologous regions between species.
Homology of these peptides between different species is consistent
 S.F. Cummins et al. / Peptides 31 (2010) 394401 399

Fig. 4. Identication of A. dactylomela attractin. (A) Comparative amino acid alignment of A. dactylomela attractin with the attractins of other Aplysia species and Bursatella.
Amino acids that are identical to A. californica attractin are shaded in red; cysteine residues are shaded in black; and the highly conserved IEECKTS region in Aplysia attractins
is indicated. The amino acid sequence of A. dactylomela attractin is predicted from cDNA. (B) Phylogenetic analysis of attractin sequences. Note that A. dactylomela attractin is
most closely related to A. californica, A. brasiliana and A. fasciata attractins. Scale bar indicates number of amino acid substitutions. (For interpretation of the references to color
in this gure legend, the reader is referred to the web version of the article.)

with subgenus division. A. dactylomela ELH and attractin share 92%
and 74% identity, respectively, with their counterparts in A.
californica. Signicantly, we also show that attractin in egg eluates
is affected by temperature.
4.1. Further evidence for the conservation of the Aplysia
egg-laying hormone
Comparing the primary structure of Aplysia ELH-related
peptides reveals a pattern of highly conserved regions near both
the N and C termini, with most variation in the middle region. A.
dactylomela ELH differs from A. californica and A. brasiliana ELH at
only 3 positions, mainly within the middle segment where dELH
Fig. 5. Effects of temperature on attractin in egg eluates. Egg eluates were collected
and incubated at 22 or 37 8C, for a period of 0, 4, 12 and 24 h post egg laying (hpel).
Each sample was subsequently concentrated (C18 Sep-Pak Vac) to purify peptides
and proteins, then fractionated by 12% SDSPAGE. Concentrated eluates were
probed by immunoblot analysis using attractin antiserum. Attractin was detected
within egg cordon eluates at 0 hpel at molecular weights higher than predicted by
the cDNA (attractin, 6412 Da), reecting higher order interactions which migrate at
a higher molecular weight. Under control conditions (22 8C), attractin was present
and in similar complexes for at least 24 hpel. Egg eluates incubated at 37 8C prior to
assay, however, showed an apparent decrease in higher order interactions by 4 hpel
and a distinct decrease by 24 hpel.
differs at two residues. These data agree with the argument that
ELH forms U-shaped molecules and that conservation within the
residues 114 and 2934 may act as the critical receptor
recognition/binding site [18]. It has been suggested that peptide
chain length may be important for egg-laying activity, which has
been conrmed by previous structure/activity studies using
synthetic ELH analogs to induce egg-laying (reviewed by [18]).
In these studies, removal of the N-terminal amino acid (ELH236) or
extension of the C-terminus by one residue (ELH-Gly37) results in a
loss of egg-laying activity. Similar to all other mature ELH peptides
identied, dELH constitutes a 36-residue basic peptide and
functions by inducing egg laying when injected into animals.
Important to our chemosensory studies, the identication of the
dELH ensures a reliable mechanism for the induction of egg laying
for subsequent collection and analysis of native pheromones
within egg eluates.
ELH precursor proteins typically contain several additional
peptides, including the a-BCP, b-BCP, e-BCP and AP that are
released following cleavage at paired basic amino acid sites [28].
The partial transcript we isolated from A. dactylomela predicts that
in addition to the dELH, a de-BCP and dAP are present that show a
high degree of identity with A. californica e-BCP and AP,
respectively, each with only a few amino acid substitutions. It
has been reported that e-BCP and AP are localized to the same
vesicles as ELH which are all released during the electrical
activation of the bag cell neurons (an afterdischarge). Although no
biological role has been determined for either e-BCP or AP, their
high identity within Aplysia species suggests an important
functional role.
4.2. Further evidence for the conservation of Aplysia attractins
We have identied a single attractin gene encoding an attractin
protein in A. dactylomela, which complements our previous studies
that have identied attractin in ve different species of Aplysia: A.
californica, A. brasiliana, A. fasciata, A. vaccaria, and A. depilans [22],
as well as in Bursatella leachii [8]. Now with the A. dactylomela
attractin, comparative analysis at the primary sequence level
400 S.F. Cummins et al. / Peptides 31 (2010) 394401
further conrms the conservation of the attractin family. First, we
continue to observe considerable conservation and positioning of
six cysteines in all attractins, suggesting that the three disulde
bonds form a similar pattern of connectivity as that found in A.
californica attractin, that is C4C41, C13C33, and C20C26 [15].
Attractins 3D structure, which is compact and has two antiparallel
helices stabilized by three intramolecular disulde bonds [15],
may have been conserved during evolution. Second, we observe
high conservation of three solvent exposed charged residues (Asp5,
Asp/Glu22, and Glu39). Mutating these residues slightly reduces but
does not destroy attractin activity [22]. Finally, conservation of the
sequence Ile30-Glu31-Glu32-Cys33-Lys34-Thr35-Ser36 (IEECKTS) can
now be conrmed in all six Aplysia attractins. The importance of
this region has been shown by site-directed mutagenesis and
bioassay. Altering the three charged amino acids in the IEECKTS
sequence (Glu31, Glu32, Lys34) effectively abolishes attractin
activity [6,22]. Also, a synthetic constrained cyclic peptide that
contains the conserved heptapeptide sequence has previously
been shown to be signicantly attractive in T-maze attraction
bioassays [6]. Its conservation in A. dactylomela supports its
essential role in receptor binding and our observations of
interspecic attraction activity of attractin [21].
Comparative analysis of A. dactylomela attractin shows most
variability within the C-terminal region. It has been established
that attractins compact 3D structure is resistant to degradation at
the N-terminus, but not at the C-terminus [21]. Indeed, attractin is
progressively degraded at the C-terminus, although C-terminal
degradation does not destroy activity as long as the IEECKTS region
is still intact [21]. It is, however, possible that this region may
confer some species-specic information or help to delay
degradation.
4.3. Increasing ocean temperatures could disrupt Aplysia
pheromone communication
Marine animals such as Aplysia depend on the quality of the
water in which they live. Any changes in the waters physical
properties can strongly inuence their productivity, resilience
and ability to transmit chemical cues. Similar to hormones
travelling through our body, molecules released into the
environment are adversely affected by subtle biochemical
changes resulting in, for example, more rapid degradation. Higher
temperatures have been known to accelerate the rate of protein
misfolding and aggregation, and can also lead to chemical
modications such as disulde shufing [24]. All of the protein
pheromones that we have identied to date have conserved
disulde interactions that contribute to their stability. Prior to this
study, there had been little detailed knowledge of the environ-
mental effects, such as temperature, on any aquatic pheromone
communication system.
This study has provided some insight into the impacts of
increasing ocean temperatures on attractin activity. Incubation of
pheromones in egg eluates for 4 h at 37 8C was sufcient to alter
attractins higher order interactions with other biomolecules,
including presumably temptin. This may lead to a decrease in
attractin binding to sensory cells in the target Aplysia or enhance its
degradation. Indeed, we nd that there is relatively less attractin in
egg eluates 24 h after egg laying, and because the antibody was
directed against the receptor binding region, it is reasonable to
assume that bioactivity would be abolished.
In summary, these ndings provide important insight into the
neuroendocrine multitransmitter system that initiates egg laying
and subsequent release of pheromones, including attractin. We
expect that this work will help establish A. dactylomela as an
important model for comparative peptidomic and chemosensory
studies.
Acknowledgments
This research was supported by a University of Queensland
Fellowship to S.F.C, an Australian Research Council grant to B.M.D
and a Thailand Research Fund Royal Golden Jubilee Ph.D.
Scholarship to P.N). The nucleotide sequences of A. dactylomela
ELH and attractin reported in this paper have been submitted to
the GenBankTM/EBI Data Bank with accession nos. FJ872826 and
FJ906621, respectively.
References
[1] Begnoche VL, Moore SK, Blum N, Van Gils C, Mayeri E. Sign stimulus activates a
peptidergic neural system controlling reproductive behavior in Aplysia. J
Neurophysiol 1996;75:21616.
[2] Carefoot TH, Karentz D, Pennings SC, Young CL. Distribution of mycosporine-
like amino acids in the sea hare Aplysia dactylomela: effect of diet on amounts
and types sequestered over time in tissues and spawn. Comp Biochem Physiol
C Toxicol Pharmacol 2000;126:91104.
[3] Chiu AY, Strumwasser F. An immunohistochemical study of the neuropepti-
dergic bag cells of Aplysia. J Neurosci 1981;1:81226.
[4] Cummins SF, Degnan BM, Nagle GT. Characterization of Aplysia Alb-1, a
candidate water-borne protein pheromone released during egg laying. Pep-
tides 2008;29:15261.
[5] Cummins SF, Nichols AE, Amare A, Hummon AB, Sweedler JV, Nagle GT.
Characterization of Aplysia enticin and temptin, two novel water-borne pro-
tein pheromones that act in concert with attractin to stimulate mate attrac-
tion. J Biol Chem 2004;279:2561422.
[6] Cummins SF, Nichols AE, Rajarathnam K, Nagle GT. A conserved heptapeptide
sequence in the waterborne attractin pheromone stimulates mate attraction in
Aplysia. Peptides 2004;25:1859.
[7] Cummins SF, Nichols AE, Warso CJ, Nagle GT. Aplysia seductin is a water-borne
protein pheromone that acts in concert with attractin to stimulate mate
attraction. Peptides 2005;26:3519.
[8] Cummins SF, Schein CH, Xu Y, Braun W, Nagle GT. Molluscan attractins, a
family of water-borne protein pheromones with interspecic attractiveness.
Peptides 2005;26:1219.
[9] Cummins SF, Xie F, de Vries MR, Annangudi SP, Misra M, Degnan BM, et al.
Aplysia temptinthe glue in the water-borne attractin pheromone complex.
FEBS J 2007;274:542537.
[10] Derby CD, Kicklighter CE, Johnson PM, Zhang X. Chemical composition of inks
of diverse marine molluscs suggests convergent chemical defenses. J Chem
Ecol 2007;33:110513.
[11] DesGroseillers L. Molecular aspects of egg-laying behavior in Aplysia califor-
nica. Behav Genet 1990;20:25164.
[12] Dias T, Brito I, Moujir L, Paiz N, Darias J, Cueto M. Cytotoxic sesquiterpenes
from Aplysia dactylomela. J Nat Prod 2005;68:16779.
[13] Fan X, Wu B, Nagle GT, Painter SD. Molecular cloning of a cDNA encoding a
potential water-borne pheromonal attractant released during Aplysia egg
laying. Brain Res Mol Brain Res 1997;48:16770.
[14] Floyd PD, Li L, Moroz TP, Sweedler JV. Characterization of peptides from Aplysia
using microbore liquid chromatography with matrix-assisted laser deso-
rption/ionization time-of-ight mass spectrometry guided purication. J
Chromatogr A 1999;830:10513.
[15] Garimella R, Xu Y, Schein CH, Rajarathnam K, Nagle GT, Painter SD, et al. NMR
solution structure of attractin, a water-borne protein pheromone from the
mollusk Aplysia californica. Biochemistry 2003;42:99709.
[16] Kandel ER. Behavioral Biology of Aplysia. San Francisco: W.H. Freeman & Co;
1979.
[17] Kumar S, Tamura K, Nei M. MEGA3: integrated software for molecular evolu-
tionary genetics analysis and sequence alignment. Brief Bioinform 2004;5:
15063.
[18] Li L, Garden RW, Floyd PD, Moroz TP, Gleeson JM, Sweedler JV, et al. Egg-laying
hormone peptides in the aplysiidae family. J Exp Biol 1999;202:296173.
[19] Liu Z, Sobhon P, Withyachumnarnkul B, Hanna P. Identication of a putative
egg-laying hormone in neural and ovarian tissues of the black tiger shrimp,
Penaeus monodon, using immunocytochemistry. Invert Neurosci 2006;6:416.
[20] Melo VM, Duarte AB, Carvalho AF, Siebra EA, Vasconcelos IM. Purication of a
novel antibacterial and haemagglutinating protein from the purple gland of
the sea hare, Aplysia dactylomela Rang, 1828. Toxicon 2000;38:141527.
[21] Painter SD, Clough B, Garden RW, Sweedler JV, Nagle GT. Characterization of
Aplysia attractin, the rst water-borne peptide pheromone in invertebrates.
Biol Bull 1998;194:12031.
[22] Painter SD, Cummins SF, Nichols AE, Akalal DB, Schein CH, Braun W, et al.
Structural and functional analysis of Aplysia attractins, a family of water-borne
protein pheromones with interspecic attractiveness. Proc Natl Acad Sci USA
2004;101:692933.
[23] Rambaut A, Grassly N, Nee S, Harvey P. Bi-De: an application for simulating
phylogenetic processes. Comput Appl Biosci 1996;12:46971.
[24] Rastogi SC. Cell Biology, third ed., New Age International; 2004. p. 548.
[25] Rudman WB. Aplysia dactylomela Rang, 1828. http://www.seaslugforum.net/
factsheet.cfm?base=aplydact; 1999.
 S.F. Cummins et al. / Peptides 31 (2010) 394401 401

[26] Saitou N, Nei M. The neighbor-joining method: a new method for reconstruct-
ing phylogenetic trees. Mol Biol Evol 1987;4:40625.
[27] Salzet M, Verger-Bocquet M, Vandenbulcke F, Van Minnen J. Leech egg-laying-
like hormone: structure, neuronal distribution and phylogeny. Brain Res Mol
Brain Res 1997;49:21121.
[28] Scheller RH, Jackson JF, McAllister LB, Schwartz JH, Kandel ER, Axel R. A family
of genes that codes for ELH, a neuropeptide eliciting a stereotyped pattern of
behavior in Aplysia. Cell 1982;28:70719.
[29] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUS-
TAL_X windows interface: exible strategies for multiple sequence alignment
aided by quality analysis tools. Nucleic Acids Res 1997;25:487682.
[30] Vreugdenhil E, Jackson JF, Bouwmeester T, Smit AB, Van Minnen J, Van
Heerikhuizen H, et al. Isolation, characterization, and evolutionary aspects
of a cDNA clone encoding multiple neuropeptides involved in the stereotyped
egg-laying behavior of the freshwater snail Lymnaea stagnalis. J Neurosci
1988;8:418491.