Beruflich Dokumente
Kultur Dokumente
xiii
xiv Contributors
Jennifer T. Fox
Graduate Field of Biochemistry, Molecular and Cellular Biology, Cornell
University, Ithaca, New York 14853
Zhanjun Hou
Developmental Therapeutics Program, Barbara Ann Karmanos Cancer Institute,
Wayne State University School of Medicine, Detroit, Michigan 48201
Yi-Ching Hsieh
The Cancer Institute of New Jersey, Robert Wood Johnson Medical School,
University of Medicine and Dentistry of New Jersey, New Brunswick,
New Jersey 08903
Ilan Ifergan
The Fred Wyszkowski Cancer Research Laboratory, Department of Biology,
Technion-Israel Institute of Technology, Haifa 32000, Israel
Ann L. Jackman
Institute of Cancer Research, Section of Medicine, Sutton, Surrey, SM2 5NG
United Kingdom
Christopher P. Leamon
Endocyte, Inc., West Lafayette, Indiana 47906
David LaBorde
Department of Neurosurgery and Laboratory of Molecular Neurosurgery and
Biotechnology, Emory University School of Medicine, Atlanta, Georgia 30322
Zigmund Luka
Department of Biochemistry, Vanderbilt University School of Medicine, Nashville,
Tennessee 37232
Robert E. MacKenzie
Department of Biochemistry, McGill University, Montreal, QC, Canada H3G 1Y6
Larry H. Matherly
Developmental Therapeutics Program, Barbara Ann Karmanos Cancer Institute,
Wayne State University School of Medicine, Detroit, Michigan 48201
John J. McGuire
Grace Cancer Drug Center, Roswell Park Cancer Institute, Buffalo, New York 14263
H. F. Nijhout
Department of Biology, Duke University, Durham, North Carolina 27705
Nelson M. Oyesiku
Department of Neurosurgery and Laboratory of Molecular Neurosurgery and
Biotechnology, Emory University School of Medicine, Atlanta, Georgia 30322
Contributors xv
Stephen W. Ragsdale
Department of Biological Chemistry, University of Michigan Medical School,
Ann Arbor, Michigan 48109-0606
M. C. Reed
Department of Mathematics, Duke University, Durham, North Carolina 27705
Michael B. Sawyer
Departments of Experimental Oncology, Cross Cancer Institute, Edmonton,
Alberta T6G 1Z2, Canada and Department of Oncology, University of Alberta,
Edmonton, Alberta T6G 1Z2, Canada
Thomas B. Shea
Center for Cellular Neurobiology and Neurodegeneration Research,
UMassLowell, Lowell, Massachusetts 01854
Nancy E. Skacel
The Cancer Institute of New Jersey, Robert Wood Johnson Medical School,
University of Medicine and Dentistry of New Jersey, New Brunswick,
New Jersey 08903
Patrick J. Stover
Division of Nutritional Sciences, Cornell University, Ithaca, New York 14853
Flaubert Tchantchou
University of Maryland, Baltimore, Maryland
Philip Thomas
CSIRO Human Nutrition, Adelaide BC, Adelaide, South Australia 5000
C. M. Ulrich
Cancer Prevention Program, Fred Hutchinson Cancer Research Center, Seattle,
Washington 98109
Congjun Yao
Department of Neurosurgery and Laboratory of Molecular Neurosurgery and
Biotechnology, Emory University School of Medicine, Atlanta, Georgia 30322
PREFACE
For many years, folic acid, its relatives, and antifolates have been the center
of much attention in one-carbon metabolism and in relation to cancer
research. So much progress has occurred in the last decade in relation to
cancer research and the mechanism of enzyme action as well as in the
mechanism by which folate is transported that the overall subject deserves
a current review.
We begin with contributions on one-carbon metabolism, the methio-
nine cycle, and folate deficiency. The first of these papers is from J. T. Fox
and P. J. Stover entitled Folate-mediated one carbon metabolism.
F. Nijhout, M. C. Reed, and C. M. Ulrich report on Mathematical
models of folate-mediated one-carbon metabolism. This is followed by a
treatise on Folate deprivation, the methionine cycle, and Alzheimers
disease by F. Tchantchou and T. B. Shea. Authors I. Ifergan and Y. G.
Assaraf complete the introductory section with Molecular mechanisms of
adaptation to folate deficiency.
The next group of papers deals with the folate transporter and receptor.
Structure and function of the reduced folate carrier: A paradigm of a major
facilitator superfamily mammalian nutrient transporter is contributed by
L. H. Matherly and Z. Hou. Authors V. L. Damaraju, C. E. Cass, and M. B.
Sawyer review Renal conservation of folates: Role of folate transport
proteins. C. P. Leamon and A. L. Jackman present Exploitation of the
folate receptor in the management of cancer and inflammatory disease.
Another report on cancer is given by C.-O. Evans, C. Yao, D. Leborde, and
N. M. Oyesiku: Folate receptor expression in pituitary adenomas: Cellular
and molecular analysis.
The third and final section concentrates on enzymes. In the first of these,
E. E. Abali, N. E. Skacel, H. Celikkaya, and Y.-C. Hsieh have written on
Regulation of human dihydrofolate reductase activity and expression.
S. W. Ragsdale covers Catalysis of methyl group transfers involving tetra-
hydrofolate and B12. Methyltetrahydrofolate in folate-binding protein
glycine N-methyltransferase is authored by Z. Luka. J. K. Coward and
J. J. McGuire review Mechanism-based inhibitors of folylpoly-g-gluta-
mate synthetase and g-glutamyl hydrolase: Control of folylpoly-g-glutamate
homeostasis as a drug target. P. Thomas and M. Fenech report on
Methyltetrahydrofolate reductase, common polymorphisms, and relation
to disease. This is followed by a contribution from K. E. Christensen
and R. E. McKenzie on Mitochondrial methylenetetrahydrofolate
xvii
xviii Preface
Gerald Litwack
gerry.litwack@gmail.com
Toluca Lake, California
December 8, 2007
C H A P T E R O N E
Folate-Mediated One-Carbon
Metabolism
Jennifer T. Fox* and Patrick J. Stover*,
Contents
I. Overview 2
II. Introduction to Cytoplasmic One-Carbon Metabolism 4
A. Enzymes that generate one-carbon units 5
B. Folate-interconverting enzymes 13
C. Biosynthetic enzymes 18
D. Folate-binding proteins 24
III. Introduction to Mitochondrial One-Carbon Metabolism 24
A. Enzymes that generate one-carbon units 25
B. Folate-interconverting enzymes 27
C. Biosynthetic enzymes 28
IV. Nuclear Folate-Mediated One-Carbon Metabolism 28
Acknowledgments 29
References 29
Abstract
Tetrahydrofolate (THF) polyglutamates are a family of cofactors that carry and
chemically activate one-carbon units for biosynthesis. THF-mediated one-
carbon metabolism is a metabolic network of interdependent biosynthetic path-
ways that is compartmentalized in the cytoplasm, mitochondria, and nucleus.
One-carbon metabolism in the cytoplasm is required for the synthesis of
purines and thymidylate and the remethylation of homocysteine to methionine.
One-carbon metabolism in the mitochondria is required for the synthesis of
formylated methionyl-tRNA; the catabolism of choline, purines, and histidine;
and the interconversion of serine and glycine. Mitochondria are also the primary
source of one-carbon units for cytoplasmic metabolism. Increasing evidence
indicates that folate-dependent de novo thymidylate biosynthesis occurs in
the nucleus of certain cell types. Disruption of folate-mediated one-carbon
metabolism is associated with many pathologies and developmental anomalies,
* Graduate Field of Biochemistry, Molecular and Cellular Biology, Cornell University, Ithaca,
New York 14853
{
Division of Nutritional Sciences, Cornell University, Ithaca, New York 14853
1
2 Jennifer T. Fox and Patrick J. Stover
I. Overview
The reduced tetrahydrofolates (THFs) serve as a family of enzyme
cofactors that chemically activate and carry one-carbon units on the N5 and/
or N10 of THF at the oxidation level of formate (e.g., 10-formylTHF),
formaldehyde (e.g., 5,10-methyleneTHF), or methanol (e.g., 5-methylTHF)
(Appling, 1991; Girgis et al., 1997; Schirch and Strong, 1989; Wagner, 1995).
Folate derivatives also contain a covalently bound polyglutamate peptide of
varying length. Serum folates contain a single glutamate residue, whereas
intracellular folates contain a polyglutamate peptide usually consisting of five
to eight glutamate residues that are polymerized through unusual g-linked\
peptide bonds (Moran, 1999; Shane, 1995). The polyglutamate pep-
tide increases the affinity of THF cofactors for folate-dependent enzymes
and-binding proteins, and prevents their efflux from the cell and intracellular
organelles (Schirch and Strong, 1989). THF polyglutamates are coenzymes
that donate or accept one-carbon units in a network of reactions known as
one-carbon metabolism that occurs in three specific and isolated cellular
compartments: the mitochondria, nucleus, and cytoplasm (Fig. 1.1; Porter
et al., 1985; Shane, 1989; Woeller et al., 2007a). The one-carbon forms of
THF can be interconverted enzymatically (Fig. 1.1), although each cofactor
form is specific to a particular biosynthetic pathway. The formyl group of
10-formylTHF is incorporated into the C2 and C8 of the purine ring
in the cytoplasm and is used to synthesize formylated methionyl-tRNA
in mitochondria (Fig. 1.1). The one-carbon moiety of 5,10-methyleneTHF
is required to convert uridylate to thymidylate, and the one carbon
carried by 5-methylTHF is required to remethylate homocysteine to
methionine. The cellular concentration of folate-binding proteins exceeds
that of folate derivatives, and therefore the concentration of free folate
in the cell is negligible (Schirch and Strong, 1989; Strong et al., 1990;
Suh et al., 2001). This implies that each folate-dependent biosynthetic
pathway competes for a limiting pool of folate cofactors (Scott et al., 1981;
Suh et al., 2001).
Epidemiological studies implicate impaired folate metabolism in several
pathologies and developmental anomalies including neural tube defects
(NTDs) (Scott, 2001; van der Put and Blom, 2000), cardiovascular disease
(Gerhard and Duell, 1999; Lindenbaum and Allen, 1995; Ueland et al., 2000),
Mitochondria Cytoplasm
6
THF
CO2
THF 10
5,10-MethenylTHF 10-FormylTHF
11,12
Formate 10-FormylTHF Purines
fMet-tRNA 7 8 Formate 9
5
THF 13 16
Histidine 5-formylTHF
Purines 14,15 5,10-MethenylTHF
5,10-MethyleneTHF THF
17
THF 17
Dimethylglycine 4 1
Serine Thymidylate
3 2 Serine 5,10-MethyleneTHF
Glycine 16 19
Sarcosine glycine
Sarcosine Glycine 20
Glycine CO2,NH3 5-MethylTHF Methionine
21
16,22
Nucleus Homocysteine AdoMet
5-MethylTHF
5,10-MethyleneTHF
Sequestered AdoHcy
Glycine dUMP
16 19 Methylation reactions
dTMP
Serine
23
THF DHF
Figure 1.1 Compartmentation of folate-mediated one-carbon metabolism in the cytoplasm, mitochondria, and nucleus. One-carbon
metabolism in the cytoplasm is required for the de novo synthesis of purines and thymidylate and for the remethylation of homocysteine to
methionine. One-carbon metabolism in mitochondria generates one-carbon units for cytoplasmic one-carbon metabolism by generating
formate from serine, glycine, sarcosine, and dimethylglycine. One-carbon metabolism in the nucleus synthesizes dTMP from dUMP and
serine. 1, Mitochondrial serine hydroxymethyltransferase; 2, Aminomethyltransferase; 3, Sarcosine dehydrogenase; 4, Dimethylglycine
dehydrogense; 5, 5,10-Methylenetetrahydrofolate dehydrogenase (NAD-dependent); 6, 5,10-Methenyltetrahydrofolate cyclohydrolase;
4 Jennifer T. Fox and Patrick J. Stover
and cancer (Ames, 2001; Blount et al., 1997; Choi and Mason, 2000; Kim,
1999; Pogribny et al., 1995). One-carbon metabolism can be impaired by
folate and other vitamin B deficiencies and/or common, penetrant genetic
mutations and polymorphisms (Bailey, 1995; McNulty, 1995; Scott, 1998;
van der Put and Blom, 2000). However, the biochemical mechanisms and
causal metabolic pathways responsible for the initiation and/or progression of
folate-associated pathologies have yet to be established. In fact, there are still
major gaps in our fundamental understanding of one-carbon metabolism and
its regulation, including the potential for identifying putative missing
enzymes and their associated genes whose discovery may be necessary to
complete the assembly of the folate-dependent metabolic network. This
chapter focuses on our current understanding of mammalian folate-mediated
one-carbon metabolism, its cellular compartmentation, and knowledge gaps
that limit our understanding of folate metabolism and its regulation.
Table 1.1
2. 10-FormylTHF synthetase
a. Reaction 10-FormylTHF synthetase (FTHFS) is a formate-activating
enzyme found in a wide variety of organisms including bacteria, plants, insects,
nematodoes, yeast, and mammals. In eukaryotes, FTHFS activity is found on
the C-terminal domain of the trifunctional enzyme, C1-THF synthase, which
also contains 5,10-methenylTHF cyclohydrolase (MTHFC) and 5,10-methy-
leneTHF dehydrogenase (MTHFD) activities (see Section II:B.1; Howard
et al., 2003). C1-THF synthase is encoded by the Mthfd1 gene. FTHFS
catalyzes the ATP-dependent conversion of THF and formate to
10-formylTHF, ADP, and inorganic phosphate. The reaction is reversible
(Appling, 1991). The enzyme requires monovalent cations (NH4, K, or
Rb) to achieve maximal activity; in Clostridium cylindrosporum and Clostridium
10 Jennifer T. Fox and Patrick J. Stover
acidiurici, these cations serve to maintain the quaternary structure of the enzyme
(Welch et al., 1968) and decrease the Km of formate by stabilizing its
negative charge (Scott and Rabinowitz, 1967). The enzyme also requires a
divalent metal ion, usually Mg2, which is coordinated between the b- and
g-phosphates of the ATP substrate (Himes and Cohn, 1967).
c. Regulation To date, there have been few reports regarding the regula-
tion of FTHFS expression and activity. The enzyme is inhibited by THF and
purine nucleotides (Leaphart et al., 2002; Mackenzie and Baugh, 1980).
Perry et al. (1980) demonstrated that nitrous oxide-induced vitamin B12
deficiency stimulates FTHFS activity in rats. However, these results were
not confirmed by an independent group who showed that nitrous oxide
exposure decreased hepatic C1-THF synthase expression (Barlowe and
Appling, 1988). Mammalian Mthfd1 that encodes all three activities of
cytoplasmic C1-THF synthase is expressed ubiquitously and is transcription-
ally upregulated in response to conditions that require increased DNA
synthesis (Christensen and MacKenzie, 2006). The promoter region of the
rat C1-THF synthase gene contains several transcription factor-binding sites
through which this regulation could occur, including NF-kB, HNF-4a1,
RARa1, C/EBP, and PPAR. However, the rat promoter region does not
share significant homology with the human Mthfd1 promoter region
(Howard et al., 2003). In mice, the upregulation of C1-THF synthase
expression is thought to occur through insulin-like growth factor-1, which
increases the stability of the mRNA transcript (Peri and MacKenzie, 1991).
In yeast, C1-THF synthase mRNA levels are decreased in the presence of
adenine, histidine, methionine, and pantothenic acid (Appling and
Rabinowitz, 1985).
Folate-Mediated One-Carbon Metabolism 11
Formiminotransferaseactivityexistsasapartofabifunctionalenzymecomplexwith
formimidoyltetrahydrofolate cyclodeaminase activity on the C-terminal domain of
the protein, which allows for the rapid conversion of 5-formiminoTHF to 5,10-
methenylTHF (Mackenzie, 1984; Tabor et al., 1952). The bifunctional enzyme is
assembled as a circular tetramer of dimers and channels folate polyglutamates
between catalytic sites (Murley and MacKenzie, 1995). Similarly, formiminogly-
cine, which is a product of purine ring degradation, is also a source of
5-formiminoTHF through the activity of glycine formiminotransferase. As in
histidine catabolism, 5-formiminoTHF is converted to 5,10-methenylTHF and
is available for one-carbon transfer reactions in the cytoplasm (Pricer and
Rabinowitz, 1956).
B. Folate-interconverting enzymes
1. 5,10-MethenylTHF cyclohydrolase and 5,10-methyleneTHF
dehydrogenase
a. Reaction As mentioned above, mammalian C1-THF synthase is a
homodimer and trifunctional enzyme consisting of two functionally inde-
pendent domains encoded by Mthfd1. The C-terminal domain cont-
ains FTHFS activity whereas the N-terminal domain contains MTHFC
and MTHFD activities (Paukert et al., 1976; Tan et al., 1977). MTHFC
catalyzes the reversible interconversion of 10-formylTHF and 5,10-methe-
nylTHF, whereas MTHFD catalyzes the NADP-dependent and reversible
interconversion of 5,10-methenylTHF and 5,10-methyleneTHF.
2. 10-FormyTHF dehydrogenase
a. Reaction 10-FormylTHF dehydrogenase (FDH) catalyzes the irrevers-
ible and NADP-dependent oxidation of 10-formylTHF to THF and
CO2. FDH consists of two functionally distinct domains connected by an
intermediate linker. The C-terminal domain catalyzes an NADP-depen-
dent aldehyde-dehydrogenase reaction, and the N-terminal domain cata-
lyzes the hydrolysis of 10-formylTHF to THF and formate (hydrolase
reaction) (Cook et al., 1991; Donato et al., 2007). Although the two
domains can function independently, the two active sites work in concert
through a 40 -phosphopantetheine swinging arm that is bound through a
phosphoester bond to Ser354; the swinging arm transfers formate between
the two active sites (Donato et al., 2007).
3. 5,10-MethenylTHF synthetase
a. Reaction 5,10-MethenylTHF synthetase (MTHFS, also referred to as
5-formylTHF cycloligase) catalyzes the ATP-dependent and irreversible
conversion of 5-formylTHF to 5,10-methenylTHF. It is the only enzyme
identified to date that utilizes 5-formylTHF as a substrate. Like FTHFS,
MTHFS activity requires Mg2 that is involved in the binding of the ATP
substrate to the enzyme (Chen et al., 2005). The MTHFS reaction and the
SHMT1-catalyzed synthesis of 5-formylTHF from 5,10-methenylTHF
constitute a futile cycle that serves to buffer intracellular 5-formylTHF
concentrations (Stover et al., 1993).
4. 5,10-MethyleneTHF reductase
a. Reaction MTHFR is a flavoprotein consisting of two identical sub-
units. The C-terminal domain of each subunit contains the binding site for
AdoMet, an allosteric inhibitor; the N-terminal domain catalyzes the
NADPH-dependent reduction of 5,10-methyleneTHF to 5-methylTHF
for use in the remethylation of homocysteine to methionine. The MTHFR
reaction is virtually irreversible in vivo and therefore commits one-carbon
units to methionine biosynthesis (Appling, 1991; Wagner, 1995).
50 UTR (Tran et al., 2002). The length of the 50 UTR has been shown to
influence translational efficiency, as longer, more GC-rich UTRs slow the
scanning of the translation initiation machinery (van der Velden and
Thomas, 1999). Multiple polyadenylation signals result in MTHFR tran-
scripts that vary in the length of their 30 UTR. Additionally, two distinct
promoters and translation start sites generate two isoforms of the MTHFR
protein. Transcription initiation from the upstream promoter followed by
translation from the downstream AUG results in the production of a 70 kDa
protein; transcription initiation from the downstream promoter followed by
translation from the upstream AUG generates a 77 kDa protein (Tran et al.,
2002). MTHFR expression from the downstream promoter has been
shown to be regulated by NF-kB in a tissue-specific manner (Pickell
et al., 2005). At the protein level, MTHFR activity is regulated by the
AdoMet/AdoHcy ratio in the cell (Kutzbach and Stokstad, 1971). AdoMet
preferentially binds to MTHFR in the inactive T state and thus increases the
T/R ratio in the cell ( Jencks and Mathews, 1987). Although AdoHcy does
not itself alter MTHFR enzymatic activity, it can reverse the inhibitory
effect of AdoMet by competing for its binding site (Kutzbach and Stokstad,
1971). Recently, phosphorylation of the MTHFR N-terminal domain at
Thr34 was shown to reduce the inhibition of enzymatic activity by AdoMet
by altering the equilibrium between the T and R states of the protein so that
it favors the active R state (Yamada et al., 2005). NADPH, the reducing
equivalent in the MTHFR reaction, binds to R subunits, and thus acts as an
AdoMet antagonist ( Jencks and Mathews, 1987).
cell folate levels (Molloy et al., 1997; Parle-McDermott et al., 2006b). Clini-
cally, C677T has been shown, in some cases, to be associated with an increased
risk for cardiovascular disease (Klerk et al., 2002; Kluijtmans et al., 1996; Morita
et al., 1997), NTDs (Christensen et al., 1999; Ou et al., 1996; van der Put et al.,
1995), cleft lip and palate (Mills et al., 1995; Zhu et al., 2006), thrombosis
(Keijzer et al., 2002; Quere et al., 2002; Zalavras Ch et al., 2002), and schizo-
phrenia (Lewis et al., 2005; Muntjewerff et al., 2005, 2006; Scher et al., 2006). It
has also been shown to be protective against several types of cancers, including
ALL (Skibola et al., 1999), childhood acute leukemia (Wiemels et al., 2001),
and colorectal cancer (Chen et al., 1996; Ma et al., 1997).
Another common MTHFR SNP, A1298C (E429A), exists in strong
linkage disequilibrium with C677T (Stegmann et al., 1999). Unlike C677T
which is located in the N-terminal domain of the protein, A1298C affects
the regulatory (C-terminal) domain of the protein and is therefore catalyti-
cally indistinguishable from the wild-type enzyme (Yamada et al., 2001).
Individuals with the A1298C polymorphism exhibit increased red cell folate
levels but have no significant change in vitamin B12, plasma folate, or
homocysteine levels (Parle-McDermott et al., 2006b). Clinically, the poly-
morphism was shown to be associated with a decreased risk for ALL
(Skibola et al., 1999) and childhood acute leukemia (Wiemels et al., 2001).
C. Biosynthetic enzymes
1. GARFT and AICARFT
a. Reaction De novo purine biosynthesis is a 10-step reaction whereby
5-phosphoribosylpyrophosphate is converted to inosine monophosphate
(IMP), the precursor of adenine and guanine nucleotides. Of the 10 steps
involved in de novo purine biosynthesis, 2 are catalyzed by folate-dependent
enzymes. In the third reaction, GARFT transfers the formyl group of
10-formylTHF to glycinamide ribotide (GAR) to form formylglycinamide
ribonucleotide (FGAR) and THF. In the ninth reaction, AICARFT trans-
fers the formyl group of 10-formylTHF to aminoimidazole carboxomide
ribotide (AICAR) to form formylaminoimidazole carboxomide ribonucle-
otide (FAICAR) and THF. In eukaryotic cells, GARFT and AICARFT
activities are part of multi-functional enzymes. GARFT activity comprises
the C-terminal domain of a protein that also contains the active sites of
GAR synthetase (GARS) and aminoimidazole ribotide synthetase (AIRS)
(Aimi et al., 1990; Schild et al., 1990), and AICARFT resides on the same
polypeptide as IMP cyclohydrolase. Substrate channeling among GARFT,
GARS, and AIRS drives the AICARFT reaction forward by coupling the
energetically unfavorable production of FAICAR to the highly favorable
cyclohydrolase reaction (Wall et al., 2000).
Folate-Mediated One-Carbon Metabolism 19
c. Regulation To date, little is known about the about the tissue specific
or genetic regulation of GARFT and AICARFT expression. The putative
promoter region of the gene encoding GARFT was found to have four SP1
sites, but the importance of these sites in transcriptional control has yet to be
determined. GARFT is developmentally regulated in the human cerebel-
lum, with high expression found during prenatal development, and no
expression detected in that tissue shortly after birth (Brodsky et al., 1997).
2. Thymidylate synthase
a. Reaction Thymidylate synthase (TS) catalyzes the 5,10-methyleneTHF-
dependent conversion of deoxyuridine monophosphate (dUMP) to the DNA
precursor deoxythymidine monophosphate (dTMP). This is the only folate-
dependent reaction whereby the folate cofactor serves both as a one-carbon
donor and source of reducing equivalents. When 5,10-methyleneTHF is
limiting in the cell, TS must compete with MTHFR for this cofactor. Thus,
in addition to its role in DNA synthesis, TS expression may also indirectly
influence homocysteine levels (Trinh et al., 2002).
3. Methionine synthase
a. Reaction Methionine synthase (MS) is a cobalamin (vitamin B12)-
dependent enzyme that, in mammalian tissue, functions within the trans-
methylation cycle by catalyzing the 5-methylTHF-dependent remethylation
of homocysteine to methionine. The MS-catalyzed reaction occurs via three
separate methyl transfer reactions that take place in different binding domains
of the four functional modules that comprise MS. The N-terminal module
utilizes a (Cys)3Zn2 cluster to bind homocysteine. A second module binds
and activates 5-methylTHF for methyl transfer. A third module binds cobal-
amin. The C-terminal module binds S-adenosyl methionine (AdoMet)
and is required for reductive reactivation of the cobalamin cofactor
Folate-Mediated One-Carbon Metabolism 23
(Drennan et al., 1994; Goulding et al., 1997; Katrina Peariso et al., 1998;
Ludwig and Matthews, 1997). Each methyl transfer requires a different
arrangement of modules that is made possible by the interdomain connectors
of the enzyme (Gokhale and Khosla, 2000).
D. Folate-binding proteins
1. Glycine N-methyltransferase
Glycine N-methyltransferase (GNMT) is a relatively abundant methytrans-
ferase that catalyzes the AdoMet-dependent methylation of glycine to
sarcosine. Its metabolic role is to govern transmethylation reactions by
regulating and buffering the AdoMet/AdoHyc ratio. GNMT activity is
allosterically regulated by 5-methylTHF, which is a tight-binding inhibitor
of GNMT. Under conditions of adequate AdoMet concentrations,
AdoMet inhibits MTHFR and limits 5-methylTHF synthesis to decrease
rates of methionine synthesis. GNMT remains active under these conditions
and metabolizes excess AdoMet. In contrast, when AdoMet levels are low,
the production of 5-methylTHF by MTHFR inhibits GNMT activity
and conserves the limited amount of methionine for essential methylation
reactions (Porter et al., 1985).
4. 10-FormylTHF synthetase
The final step in the putative conversion of the hydroxymethyl group of
serine to formate in mitochondria requires the generation of formate from
10-formylTHF (Appling, 1991). This reaction can occur in mitochondria
through the reverse reaction of FTHFS, driven by a favorable ADP/ATP
ratio in mitochondria (Appling, 1991). Mitochondria contain a monofunc-
tional FTHFS enzyme that is encoded by MthfdL1, which is expressed
ubiquitously in mammalian cells (Christensen et al., 2005; Prasannan et al.,
2003; Walkup and Appling, 2005). Further studies of this recently identified
FTHFS enzyme will determine if its primary function is to generate formate
from 10-formylTHF.
B. Folate-interconverting enzymes
1. 5,10-MethenylTHF cyclohydrolase and 5,10-methyleneTHF
dehydrogenase
Human mitochondria contain isozymes of MTHFD and MTHFC activities
encoded by a single gene, Mthfd2, which is believed to have evolved
through gene duplication and mutation of Mthfd1 (Di Pietro et al., 2002,
2004). Mthfd2 does not encode FTHFS activity, and the mitochondrial
MTHFD activity is distinguished from its cytoplasmic counterpart by its
NAD-dependence that serves to drive the reaction in the oxidative direc-
tion to generate 10-formylTHF (Christensen and MacKenzie, 2006).
Mthfd2 is an essential gene during mouse development but is not found in
adult tissues. Its expression appears to be limited to embryonic and trans-
formed cells (Peri and MacKenzie, 1993). Deletion in murine embryonic
fibroblasts creates a glycine auxotrophy, indicating a role for this enzyme in
generating unsubstituted THF for SHMT2 and potentially generating
fomate from serine. Therefore, while a complete folate-dependent pathway
for generating formate from serine exists in embryonic cells, the lack of
identified MTHFD and MTHFC activities in adult tissues represents a gap
in our understanding of mitochondrial folate metabolism and/or the inter-
action between cytoplasmic and mitochondrial one-carbon metabolism in
adult tissues.
28 Jennifer T. Fox and Patrick J. Stover
C. Biosynthetic enzymes
1. Methionyl-tRNAfMet formyltransferase
Protein synthesis in mitochondria and prokaryotes is initiated with formyl-
methionyl-tRNA (fMet-tRNA), which is formed by the 10-formylTHF-
dependent formylation of Met-tRNA-catalyzed methionyl-tRNAfMet
formyltransferase (MFT) (Bianchetti et al., 1977; Takeuchi et al., 1998). This
is the only known biosynthetic reaction that occurs in mitochondria, other
than amino acid interconversion reactions (Fig. 1.1). Although MFT-deficient
Saccharomyces cerevisiae displays normal mitochondrial function and mitochon-
drial protein synthesis (Tibbetts et al., 2003), MFT does offer selective advan-
tage under severe growth conditions (Vial et al., 2003). Formylation of
Met-tRNA confers specificity to its interaction with initiation factor
2 (IF-2); bovine IF-2 binds fMet-tRNA with 25-fold greater affinity than
Met-tRNA and mitochondrial ribosomes bind fMet-tRNA 50-fold tighter
than Met-tRNA in the presence of IF-2 (Spencer and Spremulli, 2004).
ACKNOWLEDGMENTS
This work was supported by PHS DK58144 to PJS.
REFERENCES
Aimi, J., Qiu, H., Williams, J., Zalkin, H., and Dixon, J. E. (1990). De novo purine
nucleotide biosynthesis: Cloning of human and avian cDNAs encoding the trifunctional
glycinamide ribonucleotide synthetase-aminoimidazole ribonucleotide synthetase-
glycinamide ribonucleotide transformylase by functional complementation in E. coli.
Nucleic Acids Res. 18(22), 66656672.
Allegra, C. J., Fine, R. L., Drake, J. C., and Chabner, B. A. (1986). The effect of
methotrexate on intracellular folate pools in human MCF-7 breast cancer cells. Evidence
for direct inhibition of purine synthesis. J. Biol. Chem. 261(14), 64786485.
Ames, B. N. (2001). DNA damage from micronutrient deficiencies is likely to be a major
cause of cancer. Mutat. Res. 475(12), 720.
Anderson, D. D., Woeller, C. F., and Stover, P. J. (2007). Small ubiquitin-like modifier-1
(SUMO-1) modification of thymidylate synthase and dihydrofolate reductase. Clin.
Chem. Lab. Med. 45(12), 17601763.
Anguera, M. C., Suh, J. R., Ghandour, H., Nasrallah, I. M., Selhub, J., and Stover, P. J.
(2003). Methenyltetrahydrofolate synthetase regulates folate turnover and accumulation.
J. Biol. Chem. 278(32), 2985629862.
Anguera, M. C., Field, M. S., Perry, C., Ghandour, H., Chiang, E. P., Selhub, J., Shane, B.,
and Stover, P. J. (2006). Regulation of folate-mediated one-carbon metabolism by
10-formyltetrahydrofolate dehydrogenase. J. Biol. Chem. 281(27), 1833518342.
Angus, S. P., Wheeler, L. J., Ranmal, S. A., Zhang, X., Markey, M. P., Mathews, C. K., and
Knudsen, E. S. (2002). Retinoblastoma tumor suppressor targets dNTP metabolism to
regulate DNA replication. J. Biol. Chem. 277(46), 4437644384.
Appling, D. R. (1991). Compartmentation of folate-mediated one-carbon metabolism in
eukaryotes. FASEB J. 5(12), 26452651.
Appling, D. R., and Rabinowitz, J. C. (1985). Regulation of expression of the ADE3 gene
for yeast C1-tetrahydrofolate synthase, a trifunctional enzyme involved in one-carbon
metabolism. J. Biol. Chem. 260(2), 12481256.
Ash, J., Ke, Y., Korb, M., and Johnson, L. F. (1993). Introns are essential for growth-
regulated expression of the mouse thymidylate synthase gene. Mol. Cell. Biol. 13(3),
15651571.
Ash, J., Liao, W. C., Ke, Y., and Johnson, L. F. (1995). Regulation of mouse thymidylate
synthase gene expression in growth-stimulated cells: Upstream S phase control elements
are indistinguishable from the essential promoter elements. Nucleic Acids Res. 23(22),
46494656.
Ayusawa, D., Shimizu, K., Koyama, H., Kaneda, S., Takeishi, K., and Seno, T. (1986). Cell-
cycle-directed regulation of thymidylate synthase messenger RNA in human diploid
fibroblasts stimulated to proliferate. J. Mol. Biol. 190(4), 559567.
Bailey, L. B. (1995). Folate requirements and dietary recommendations. In Folate in Health
and Disease (L. B. Bailey, ed.). New York, Marcel Dekker, Inc.
Banerjee, R. V., Harder, S. R., Ragsdale, S. W., and Matthews, R. G. (1990). Mechanism of
reductive activation of cobalamin-dependent methionine synthase: An electron para-
magnetic resonance spectroelectrochemical study. Biochemistry 29(5), 11291135.
30 Jennifer T. Fox and Patrick J. Stover
Barlowe, C. K., and Appling, D. R. (1988). Nitrous oxide exposure reduces hepatic C1-
tetrahydrofolate synthase expression in rats. Biochem. Biophys. Res. Commun. 157(1),
245249.
Barlowe, C. K., and Appling, D. R. (1990). Molecular genetic analysis of Saccharomyces
cerevisiae C1-tetrahydrofolate synthase mutants reveals a noncatalytic function of
the ADE3 gene product and an additional folate-dependent enzyme. Mol. Cell. Biol.
10(11), 56795687.
Beardsley, G. P., Moroson, B. A., Taylor, E. C., and Moran, R. G. (1989). A new folate
antimetabolite, 5,10-dideaza-5,6,7,8-tetrahydrofolate is a potent inhibitor of de novo
purine synthesis. J. Biol. Chem. 264(1), 328333.
Bertrand, R., and Jolivet, J. (1989). Methenyltetrahydrofolate synthetase prevents the
inhibition of phosphoribosyl 5-aminoimidazole 4-carboxamide ribonucleotide formyl-
transferase by 5-formyltetrahydrofolate polyglutamates. J. Biol. Chem. 264(15),
88438846.
Bianchetti, R., Lucchini, G., Crosti, P., and Tortora, P. (1977). Dependence of mitochon-
drial protein synthesis initiation on formylation of the initiator methionyl-tRNAf. J. Biol.
Chem. 252(8), 25192523.
Binzak, B. A., Wevers, R. A., Moolenaar, S. H., Lee, Y. M., Hwu, W. L., Poggi-Bach, J.,
Engelke, U. F., Hoard, H. M., Vockley, J. G., and Vockley, J. (2001). Cloning of
dimethylglycine dehydrogenase and a new human inborn error of metabolism, dimethyl-
glycine dehydrogenase deficiency. Am. J. Hum. Genet. 68(4), 839847.
Bissoon-Haqqani, S., Moyana, T., Jonker, D., Maroun, J. A., and Birnboim, H. C. (2006).
Nuclear expression of thymidylate synthase in colorectal cancer cell lines and clinical
samples. J. Histochem. Cytochem. 54(1), 1929.
Blount, B. C., Mack, M. M., Wehr, C. M., MacGregor, J. T., Hiatt, R. A., Wang, G.,
Wickramasinghe, S. N., Everson, R. B., and Ames, B. N. (1997). Folate deficiency
causes uracil misincorporation into human DNA and chromosome breakage: Implica-
tions for cancer and neuronal damage. Proc. Natl. Acad. Sci. USA 94(7), 32903295.
Boorstein, R. J., and Pardee, A. B. (1983). Coordinate inhibition of DNA synthesis and
thymidylate synthase activity following DNA damage and repair. Biochem. Biophys. Res.
Commun. 117(1), 3036.
Bosco, P., Gueant-Rodriguez, R. M., Anello, G., Barone, C., Namour, F., Caraci, F.,
Romano, A., Romano, C., and Gueant, J. L. (2003). Methionine synthase (MTR) 2756
(A ! G) polymorphism, double heterozygosity methionine synthase 2756 AG/methio-
nine synthase reductase (MTRR) 66 AG, and elevated homocysteinemia are three risk
factors for having a child with Down syndrome. Am. J. Med. Genet. A 121(3), 219224.
Brodsky, G., Barnes, T., Bleskan, J., Becker, L., Cox, M., and Patterson, D. (1997). The
human GARS-AIRS-GART gene encodes two proteins which are differentially
expressed during human brain development and temporally overexpressed in cerebellum
of individuals with Down syndrome. Hum. Mol. Genet. 6(12), 20432050.
Brody, L. C., Conley, M., Cox, C., Kirke, P. N., McKeever, M. P., Mills, J. L., Molloy, A. M.,
OLeary, V. B., Parle-McDermott, A., Scott, J. M., and Swanson, D. A. (2002). A
Polymorphism, R653Q, in the trifunctional enzyme methylenetetrahydrofolate dehydro-
genase/methenyltetrahydrofolate cyclohydrolase/formyltetrahydrofolate synthetase is a
maternal genetic risk factor for neural tube defects: Report of the Birth Defects Research
Group. Am. J. Hum. Genet. 71(5), 12071215.
Brown, S. S., Neal, G. E., and Williams, D. C. (1965). Subcellular distribution of some folic
acid-linked enzymes in rat liver. Biochem. J. 97(3), 34C36C.
Bulock, K. G., Beardsley, G. P., and Anderson, K. S. (2002). The kinetic mechanism of the
human bifunctional enzyme ATIC (5-amino-4-imidazolecarboxamide ribonucleotide
transformylase/inosine 50 -monophosphate cyclohydrolase). A surprising lack of substrate
channeling. J. Biol. Chem. 277(25), 2216822174.
Folate-Mediated One-Carbon Metabolism 31
Burzynski, M., Duriagin, S., Mostowska, M., Wudarski, M., Chwalinska-Sadowska, H., and
Jagodzinski, P. P. (2007). MTR 2756 A ! G polymorphism is associated with the risk of
systemic lupus erythematosus in the Polish population. Lupus 16(6), 450454.
Buttlaire, D. H., Himes, R. H., and Reed, G. H. (1976). Formyltetrahydrofolate synthetase-
catalyzed formation of ATP from carbamyl phosphate and ADP. Evidence for a formyl
phosphate intermediate in the enzymes catalytic mechanism. J. Biol. Chem. 251(13),
41594161.
Caperelli, C. A. (1989). Mammalian glycinamide ribonucleotide transformylase. Kinetic
mechanism and associated de novo purine biosynthetic activities. J. Biol. Chem. 264(9),
50535057.
Carreras, C. W., and Santi, D. V. (1995). The catalytic mechanism and structure of
thymidylate synthase. Annu. Rev. Biochem. 64, 721762.
Chasin, L. A., Feldman, A., Konstam, M., and Urlaub, G. (1974). Reversion of a Chinese
hamster cell auxotrophic mutant. Proc. Natl. Acad. Sci. USA 71(3), 718722.
Chen, J., Giovannucci, E., Kelsey, K., Rimm, E. B., Stampfer, M. J., Colditz, G. A.,
Spiegelman, D., Willett, W. C., and Hunter, D. J. (1996). A methylenetetrahydrofolate
reductase polymorphism and the risk of colorectal cancer. Cancer Res. 56(21),
48624864.
Chen, L. H., Liu, M. L., Hwang, H. Y., Chen, L. S., Korenberg, J., and Shane, B. (1997).
Human methionine synthase. cDNA cloning, gene localization, and expression. J. Biol.
Chem. 272(6), 36283634.
Chen, S., Yakunin, A. F., Proudfoot, M., Kim, R., and Kim, S. H. (2005). Structural
and functional characterization of a 5,10-methenyltetrahydrofolate synthetase from
Mycoplasma pneumoniae (GI: 13508087). Proteins 61(2), 433443.
Choi, S. W., and Mason, J. B. (2000). Folate and carcinogenesis: An integrated scheme.
J. Nutr. 130(2), 129132.
Christensen, B., Arbour, L., Tran, P., Leclerc, D., Sabbaghian, N., Platt, R., Gilfix, B. M.,
Rosenblatt, D. S., Gravel, R. A., Forbes, P., and Rozen, R. (1999). Genetic polymorph-
isms in methylenetetrahydrofolate reductase and methionine synthase, folate levels in red
blood cells, and risk of neural tube defects. Am. J. Med. Genet. 84(2), 151157.
Christensen, K. E., and MacKenzie, R. E. (2006). Mitochondrial one-carbon metabolism is
adapted to the specific needs of yeast, plants and mammals. Bioessays 28(6), 595605.
Christensen, K. E., Patel, H., Kuzmanov, U., Mejia, N. R., and MacKenzie, R. E. (2005).
Disruption of the mthfd1 gene reveals a monofunctional 10-formyltetrahydrofolate
synthetase in mammalian mitochondria. J. Biol. Chem. 280(9), 75977602.
Chu, E., Koeller, D. M., Casey, J. L., Drake, J. C., Chabner, B. A., Elwood, P. C., Zinn, S.,
and Allegra, C. J. (1991). Autoregulation of human thymidylate synthase messenger
RNA translation by thymidylate synthase. Proc. Natl. Acad. Sci. USA 88(20), 89778981.
Chu, J., and Dolnick, B. J. (2002). Natural antisense (rTSalpha) RNA induces site-specific
cleavage of thymidylate synthase mRNA. Biochim. Biophys. Acta 1587(23), 183193.
Clarke, R., Smith, A. D., Jobst, K. A., Refsum, H., Sutton, L., and Ueland, P. M. (1998).
Folate, vitamin B12, and serum total homocysteine levels in confirmed Alzheimer
disease. Arch. Neurol. 55(11), 14491455.
Cohen, L., and Mackenzie, R. E. (1978). Methylenetetrahydrofolate dehydrogenase-
methenyltetrahydrofolate cyclohydrolase-formyltetrahydrofolate synthetase from porcine
liver. Interaction between the dehydrogenase and cyclohydrolase activities of the
multifunctional enzyme. Biochim. Biophys. Acta 522(2), 311317.
Col, B., Oltean, S., and Banerjee, R. (2007). Translational regulation of human methionine
synthase by upstream open reading frames. Biochim. Biophys. Acta 1769(910), 532540.
Conrad, A. H. (1971). Thymidylate synthetase activity in cultured mammalian cells. J. Biol.
Chem. 246(5), 13181323.
32 Jennifer T. Fox and Patrick J. Stover
Cook, R. J., Lloyd, R. S., and Wagner, C. (1991). Isolation and characterization of cDNA
clones for rat liver 10-formyltetrahydrofolate dehydrogenase. J. Biol. Chem. 266(8),
49654973.
Cronstein, B. N., Naime, D., and Ostad, E. (1993). The antiinflammatory mechanism of
methotrexate. Increased adenosine release at inflamed sites diminishes leukocyte
accumulation in an in vivo model of inflammation. J. Clin. Invest. 92(6), 26752682.
Davis, S. R., Stacpoole, P. W., Williamson, J., Kick, L. S., Quinlivan, E. P., Coats, B. S.,
Shane, B., Bailey, L. B., and Gregory, J. F., 3rd. (2004). Tracer-derived total and folate-
dependent homocysteine remethylation and synthesis rates in humans indicate that serine
is the main one-carbon donor. Am. J. Physiol. Endocrinol. Metab. 286(2), E272E279.
De Marco, P., Merello, E., Calevo, M. G., Mascelli, S., Raso, A., Cama, A., and Capra, V.
(2006). Evaluation of a methylenetetrahydrofolate-dehydrogenase 1958G>A polymor-
phism for neural tube defect risk. J. Hum. Genet. 51(2), 98103.
DeGregori, J., Leone, G., Ohtani, K., Miron, A., and Nevins, J. R. (1995). E2F-1 accumu-
lation bypasses a G1 arrest resulting from the inhibition of G1 cyclin-dependent kinase
activity. Genes Dev. 9(23), 28732887.
Dervieux, T., Furst, D., Lein, D. O., Capps, R., Smith, K., Walsh, M., and Kremer, J.
(2004). Polyglutamation of methotrexate with common polymorphisms in reduced
folate carrier, aminoimidazole carboxamide ribonucleotide transformylase, and thymidy-
late synthase are associated with methotrexate effects in rheumatoid arthritis. Arthritis
Rheum. 50(9), 27662774.
Di Pietro, E., Sirois, J., Tremblay, M. L., and MacKenzie, R. E. (2002). Mitochondrial
NAD-dependent methylenetetrahydrofolate dehydrogenase-methenyltetrahydrofolate
cyclohydrolase is essential for embryonic development. Mol. Cell. Biol. 22(12),
41584166.
Di Pietro, E., Wang, X. L., and MacKenzie, R. E. (2004). The expression of mitochondrial
methylenetetrahydrofolate dehydrogenase-cyclohydrolase supports a role in rapid cell
growth. Biochim. Biophys. Acta 1674(1), 7884.
Dinopoulos, A., Matsubara, Y., and Kure, S. (2005). Atypical variants of nonketotic
hyperglycinemia. Mol. Genet. Metab. 86(12), 6169.
Donato, H., Krupenko, N. I., Tsybovsky, Y., and Krupenko, S. A. (2007). 10-Formylte-
trahydrofolate dehydrogenase requires a 40 -phosphopantetheine prosthetic group for
catalysis. J. Biol. Chem. 282(47), 3415934166.
Dong, S., Lester, L., and Johnson, L. F. (2000). Transcriptional control elements and
complex initiation pattern of the TATA-less bidirectional human thymidylate synthase
promoter. J. Cell. Biochem. 77(1), 5064.
Doolin, M. T., Barbaux, S., McDonnell, M., Hoess, K., Whitehead, A. S., and
Mitchell, L. E. (2002). Maternal genetic effects, exerted by genes involved in homocys-
teine remethylation, influence the risk of spina bifida. Am. J. Hum. Genet. 71(5),
12221226.
Drennan, C. L., Huang, S., Drummond, J. T., Matthews, R. G., and Lidwig, M. L. (1994).
How a protein binds B12: A 3.0 A X-ray structure of B12-binding domains of methio-
nine synthase. Science 266(5191), 16691674.
Erba, E., Sen, S., Sessa, C., Vikhanskaya, F. L., and DIncalci, M. (1994). Mechanism
of cytotoxicity of 5,10-dideazatetrahydrofolic acid in human ovarian carcinoma
cells in vitro and modulation of the drug activity by folic or folinic acid. Br. J. Cancer
69(2), 205211.
Field, M. S., Szebenyi, D. M., and Stover, P. J. (2006). Regulation of de novo purine
biosynthesis by methenyltetrahydrofolate synthetase in neuroblastoma. J. Biol. Chem.
281(7), 42154221.
Field, M. S., Szebenyi, D. M., Perry, C. A., and Stover, P. J. (2007). Inhibition of 5,10-
methenyltetrahydrofolate synthetase. Arch. Biochem. Biophys. 458(2), 194201.
Folate-Mediated One-Carbon Metabolism 33
Forsthoefel, A. M., Pena, M. M., Xing, Y. Y., Rafique, Z., and Berger, F. G. (2004).
Structural determinants for the intracellular degradation of human thymidylate synthase.
Biochemistry 43(7), 19721979.
Fu, T. F., Maras, B., Barra, D., and Schirch, V. (1999). A noncatalytic tetrahydrofolate tight
binding site is on the small domain of 10-formyltetrahydrofolate dehydrogenase. Arch.
Biochem. Biophys. 367(2), 161166.
Gadangi, P., Longaker, M., Naime, D., Levin, R. I., Recht, P. A., Montesinos, M. C.,
Buckley, M. T., Carlin, G., and Cronstein, B. N. (1996). The anti-inflammatory
mechanism of sulfasalazine is related to adenosine release at inflamed sites. J. Immunol.
156(5), 19371941.
Garcia-Martinez, L. F., and Appling, D. R. (1993). Characterization of the folate-dependent
mitochondrial oxidation of carbon 3 of serine. Biochemistry 32(17), 46714676.
Garrow, T. A., Brenner, A. A., Whitehead, V. M., Chen, X. N., Duncan, R. G.,
Korenberg, J. R., and Shane, B. (1993). Cloning of human cDNAs encoding mitochon-
drial and cytosolic serine hydroxymethyltransferases and chromosomal localization.
J. Biol. Chem. 268(16), 1191011916.
Gaughan, D. J., Barbaux, S., Kluijtmans, L. A., and Whitehead, A. S. (2000). The human
and mouse methylenetetrahydrofolate reductase (MTHFR) genes: Genomic organiza-
tion, mRNA structure and linkage to the CLCN6 gene. Gene 257(2), 279289.
Gerhard, G. T., and Duell, P. B. (1999). Homocysteine and atherosclerosis. Curr. Opin.
Lipidol. 10(5), 417428.
Girgis, S., Suh, J. R., Jolivet, J., and Stover, P. J. (1997). 5-Formyltetrahydrofolate regulates
homocysteine remethylation in human neuroblastoma. J. Biol. Chem. 272(8),
47294734.
Girgis, S., Nasrallah, I. M., Suh, J. R., Oppenheim, E., Zanetti, K. A., Mastri, M. G., and
Stover, P. J. (1998). Molecular cloning, characterization and alternative splicing of the
human cytoplasmic serine hydroxymethyltransferase gene. Gene 210(2), 315324.
Gokhale, R. S., and Khosla, C. (2000). Role of linkers in communication between protein
modules. Curr. Opin. Chem. Biol. 4(1), 2227.
Gorlick, R., Metzger, R., Danenberg, K. D., Salonga, D., Miles, J. S., Longo, G. S., Fu, J.,
Banerjee, D., Klimstra, D., Jhanwar, S., Danenberg, P. V., Kemeny, N., et al. (1998).
Higher levels of thymidylate synthase gene expression are observed in pulmonary as
compared with hepatic metastases of colorectal adenocarcinoma. J. Clin. Oncol. 16(4),
14651469.
Goulding, C. W., Postigo, D., and Matthews, R. G. (1997). Cobalamin-dependent methi-
onine synthase is a modular protein with distinct regions for binding homocysteine,
methyltetrahydrofolate, cobalamin, and adenosylmethionine. Biochemistry 36(26),
80828091.
Guenther, B. D., Sheppard, C. A., Tran, P., Rozen, R., Matthews, R. G., and
Ludwig, M. L. (1999). The structure and properties of methylenetetrahydrofolate reduc-
tase from Escherichia coli suggest how folate ameliorates human hyperhomocysteinemia.
Nat. Struct. Biol. 6(4), 359365.
Gulati, S., Brody, L. C., and Banerjee, R. (1999). Posttranscriptional regulation of mamma-
lian methionine synthase by B12. Biochem. Biophys. Res. Commun. 259(2), 436442.
Harmon, D. L., Shields, D. C., Woodside, J. V., McMaster, D., Yarnell, J. W., Young, I. S.,
Peng, K., Shane, B., Evans, A. E., and Whitehead, A. S. (1999). Methionine synthase
D919G polymorphism is a significant but modest determinant of circulating homocyste-
ine concentrations. Genet. Epidemiol. 17(4), 298309.
Heil, S. G., Van der Put, N. M., Waas, E. T., den Heijer, M., Trijbels, F. J., and Blom, H. J.
(2001). Is mutated serine hydroxymethyltransferase (SHMT) involved in the etiology of
neural tube defects? Mol. Genet. Metab. 73(2), 164172.
34 Jennifer T. Fox and Patrick J. Stover
Herbig, K., Chiang, E. P., Lee, L. R., Hills, J., Shane, B., and Stover, P. J. (2002).
Cytoplasmic serine hydroxymethyltransferase mediates competition between folate-
dependent deoxyribonucleotide and S-adenosylmethionine biosyntheses. J. Biol. Chem.
277(41), 3838138389.
Hilton, J. F., Christensen, K. E., Watkins, D., Raby, B. A., Renaud, Y., de la Luna, S.,
Estivill, X., MacKenzie, R. E., Hudson, T. J., and Rosenblatt, D. S. (2003). The
molecular basis of glutamate formiminotransferase deficiency. Hum. Mutat. 22(1), 6773.
Himes, R. H., and Cohn, M. (1967). Formyltetrahydrofolate synthetase. Magnetic reso-
nance studies of the reaction. J. Biol. Chem. 242(16), 36283635.
Himes, R. H., and Rabinowitz, J. C. (1962). Formyltetrahydrofolate synthetase. III. Studies
on the mechanism of the reaction. J. Biol. Chem. 237, 29152925.
Hishida, A., Matsuo, K., Hamajima, N., Ito, H., Ogura, M., Kagami, Y., Taji, H.,
Morishima, Y., Emi, N., and Tajima, K. (2003). Associations between polymorphisms
in the thymidylate synthase and serine hydroxymethyltransferase genes and susceptibility
to malignant lymphoma. Haematologica 88(2), 159166.
Hori, T., Ayusawa, D., Shimizu, K., Koyama, H., and Seno, T. (1984). Chromosome
breakage induced by thymidylate stress in thymidylate synthase-negative mutants of
mouse FM3A cells. Cancer Res. 44(2), 703709.
Horie, N., Aiba, H., Oguro, K., Hojo, H., and Takeishi, K. (1995). Functional analysis and
DNA polymorphism of the tandemly repeated sequences in the 50 -terminal regulatory
region of the human gene for thymidylate synthase. Cell Struct. Funct. 20(3), 191197.
Horne, D. W., Patterson, D., and Cook, R. J. (1989). Effect of nitrous oxide inactivation of
vitamin B12-dependent methionine synthetase on the subcellular distribution of folate
coenzymes in rat liver. Arch. Biochem. Biophys. 270(2), 729733.
Howard, K. M., Muga, S. J., Zhang, L., Thigpen, A. E., and Appling, D. R. (2003).
Characterization of the rat cytoplasmic C1-tetrahydrofolate synthase gene and analysis
of its expression in liver regeneration and fetal development. Gene 319, 8597.
Huang, T., and Schirch, V. (1995). Mechanism for the coupling of ATP hydrolysis to the
conversion of 5-formyltetrahydrofolate to 5,10-methenyltetrahydrofolate. J. Biol. Chem.
270(38), 2229622300.
Ichinohe, A., Kure, S., Mikawa, S., Ueki, T., Kojima, K., Fujiwara, K., Iinuma, K.,
Matsubara, Y., and Sato, K. (2004). Glycine cleavage system in neurogenic regions.
Eur. J. Neurosci. 19(9), 23652370.
Jacques, P. F., Bostom, A. G., Williams, R. R., Ellison, R. C., Eckfeldt, J. H.,
Rosenberg, I. H., Selhub, J., and Rozen, R. (1996). Relation between folate status, a
common mutation in methylenetetrahydrofolate reductase, and plasma homocysteine
concentrations. Circulation 93(1), 79.
Jencks, D. A., and Mathews, R. G. (1987). Allosteric inhibition of methylenetetrahydrofo-
late reductase by adenosylmethionine. Effects of adenosylmethionine and NADPH on
the equilibrium between active and inactive forms of the enzyme and on the kinetics of
approach to equilibrium. J. Biol. Chem. 262(6), 24852493.
Jenh, C. H., Geyer, P. K., and Johnson, L. F. (1985). Control of thymidylate synthase
mRNA content and gene transcription in an overproducing mouse cell line. Mol. Cell.
Biol. 5(10), 25272532.
Joyce, B. K., and Himes, R. H. (1966). Formyltetrahydrofolate synthetase. Initial velocity
and product inhibition studies. J. Biol. Chem. 241(23), 57255731.
Kang, S. S., Wong, P. W., Zhou, J. M., Sora, J., Lessick, M., Ruggie, N., and Grcevich, G.
(1988). Thermolabile methylenetetrahydrofolate reductase in patients with coronary
artery disease. Metabolism 37(7), 611613.
Katrina Peariso, C. W. G., Huang, S., Matthews, R. G., and Penner-Hahn, J. E. (1998).
Characterization of the zinc binding site in methionine synthase enzymes of Escherichia
coli: The role of zinc in the methylation of homocysteine. J. Am. Chem. Soc. 120(33),
84108416.
Folate-Mediated One-Carbon Metabolism 35
Kawakami, K., and Watanabe, G. (2003). Identification and functional analysis of single
nucleotide polymorphism in the tandem repeat sequence of thymidylate synthase gene.
Cancer Res. 63(18), 60046007.
Kawakami, K., Omura, K., Kanehira, E., and Watanabe, Y. (1999). Polymorphic tandem
repeats in the thymidylate synthase gene is associated with its protein expression in human
gastrointestinal cancers. Anticancer Res. 19(4B), 32493252.
Ke, Y., Ash, J., and Johnson, L. F. (1996). Splicing signals are required for S-phase regulation
of the mouse thymidylate synthase gene. Mol. Cell. Biol. 16(1), 376383.
Kealey, C., Brown, K. S., Woodside, J. V., Young, I., Murray, L., Boreham, C. A.,
McNulty, H., Strain, J. J., McPartlin, J., Scott, J. M., and Whitehead, A. S. (2005).
A common insertion/deletion polymorphism of the thymidylate synthase (TYMS) gene
is a determinant of red blood cell folate and homocysteine concentrations. Hum. Genet.
116(5), 347353.
Keijzer, M. B., den Heijer, M., Blom, H. J., Bos, G. M., Willems, H. P., Gerrits, W. B., and
Rosendaal, F. R. (2002). Interaction between hyperhomocysteinemia, mutated methy-
lenetetrahydrofolatereductase (MTHFR) and inherited thrombophilic factors in recur-
rent venous thrombosis. Thromb. Haemost. 88(5), 723728.
Kempisty, B., Sikora, J., Lianeri, M., Szczepankiewicz, A., Czerski, P., Hauser, J., and
Jagodzinski, P. P. (2007). MTHFD 1958G>A and MTR 2756A>G polymorphisms are
associated with bipolar disorder and schizophrenia. Psychiatr. Genet. 17(3), 177181.
Kim, D. W., Huang, T., Schirch, D., and Schirch, V. (1996). Properties of tetrahydropter-
oylpentaglutamate bound to 10-formyltetrahydrofolate dehydrogenase. Biochemistry 35
(49), 1577215783.
Kim, Y. I. (1999). Folate and cancer prevention: A new medical application of folate beyond
hyperhomocysteinemia and neural tube defects. Nutr. Rev. 57(10), 314321.
Kitchens, M. E., Forsthoefel, A. M., Rafique, Z., Spencer, H. T., and Berger, F. G. (1999).
Ligand-mediated induction of thymidylate synthase occurs by enzyme stabilization.
Implications for autoregulation of translation. J. Biol. Chem. 274(18), 1254412547.
Klein, C., Chen, P., Arevalo, J. H., Stura, E. A., Marolewski, A., Warren, M. S.,
Benkovic, S. J., and Wilson, I. A. (1995). Towards structure-based drug design: Crystal
structure of a multisubstrate adduct complex of glycinamide ribonucleotide transformy-
lase at 1.96 A resolution. J. Mol. Biol. 249(1), 153175.
Klerk, M., Verhoef, P., Clarke, R., Blom, H. J., Kok, F. J., and Schouten, E. G. (2002).
MTHFR 677C ! T polymorphism and risk of coronary heart disease: A meta-analysis.
JAMA 288(16), 20232031.
Kluijtmans, L. A., van den Heuvel, L. P., Boers, G. H., Frosst, P., Stevens, E. M., van
Oost, B. A., den Heijer, M., Trijbels, F. J., Rozen, R., and Blom, H. J. (1996). Molecular
genetic analysis in mild hyperhomocysteinemia: A common mutation in the methylene-
tetrahydrofolate reductase gene is a genetic risk factor for cardiovascular disease. Am. J.
Hum. Genet. 58(1), 3541.
Kounga, K., Vander Velde, D. G., and Himes, R. H. (1995). 18Oxygen incorporation into
inorganic phosphate in the reaction catalyzed by N5,10-methenyltetrahydrofolate
synthetase. FEBS Lett. 364(2), 215217.
Krajinovic, M., Costea, I., and Chiasson, S. (2002). Polymorphism of the thymidylate
synthase gene and outcome of acute lymphoblastic leukaemia. Lancet 359(9311),
10331034.
Kutzbach, C., and Stokstad, E. L. (1971). Mammalian methylenetetrahydrofolate reductase.
Partial purification, properties, and inhibition by S-adenosylmethionine. Biochim.
Biophys. Acta 250(3), 459477.
Lamers, Y., Williamson, J., Gilbert, L. R., Stacpoole, P. W., and Gregory, J. F., 3rd. (2007).
Glycine turnover and decarboxylation rate quantified in healthy men and women using
primed, constant infusions of [1,2-(13)C2]glycine and [(2)H3]leucine. J. Nutr. 137(12),
26472652.
36 Jennifer T. Fox and Patrick J. Stover
Lassen, H. C., Henriksen, E., Neukirch, F., and Kristensen, H. S. (1956). Treatment of
tetanus; severe bone-marrow depression after prolonged nitrous-oxide anaesthesia. Lancet
270(6922), 527530.
Leaphart, A. B., Trent Spencer, H., and Lovell, C. R. (2002). Site-directed mutagenesis of a
potential catalytic and formyl phosphate binding site and substrate inhibition of N10-
formyltetrahydrofolate synthetase. Arch. Biochem. Biophys. 408(1), 137143.
Leclerc, D., Campeau, E., Goyette, P., Adjalla, C. E., Christensen, B., Ross, M.,
Eydoux, P., Rosenblatt, D. S., Rozen, R., and Gravel, R. A. (1996). Human methionine
synthase: cDNA cloning and identification of mutations in patients of the cblG comple-
mentation group of folate/cobalamin disorders. Hum. Mol. Genet. 5(12), 18671874.
Leclerc, D., Wilson, A., Dumas, R., Gafuik, C., Song, D., Watkins, D., Heng, H. H.,
Rommens, J. M., Scherer, S. W., Rosenblatt, D. S., and Gravel, R. A. (1998). Cloning
and mapping of a cDNA for methionine synthase reductase, a flavoprotein defective in
patients with homocystinuria. Proc. Natl. Acad. Sci. USA 95(6), 30593064.
Lewis, S. J., Zammit, S., Gunnell, D., and Smith, G. D. (2005). A meta-analysis of the
MTHFR C677T polymorphism and schizophrenia risk. Am. J. Med. Genet. B Neurop-
sychiatr. Genet. 135(1), 24.
Lim, U., Peng, K., Shane, B., Stover, P. J., Litonjua, A. A., Weiss, S. T., Gaziano, J. M.,
Strawderman, R. L., Raiszadeh, F., Selhub, J., Tucker, K. L., and Cassano, P. A. (2005).
Polymorphisms in cytoplasmic serine hydroxymethyltransferase and methylenetetrahy-
drofolate reductase affect the risk of cardiovascular disease in men. J. Nutr. 135(8),
19891994.
Lin, B. F., Huang, R. F., and Shane, B. (1993). Regulation of folate and one-carbon
metabolism in mammalian cells. III. Role of mitochondrial folylpoly-gamma-glutamate
synthetase. J. Biol. Chem. 268(29), 2167421679.
Lincz, L. F., Scorgie, F. E., Garg, M. B., and Ackland, S. P. (2007). Identification of a novel
single nucleotide polymorphism in the first tandem repeat sequence of the thymidylate
synthase 2R allele. Int. J. Cancer 120(9), 19301934.
Lindenbaum, J., and Allen, R. H. (1995). Clinical spectrum and diagnosis of folate
deficiency. In Folate in Health and Disease (L. B. Bailey, ed.). New York, Marcel
Dekker, Inc.
Liu, Y., Barrett, J. E., Schultz, P. G., and Santi, D. V. (1999). Tyrosine 146 of thymidylate
synthase assists proton abstraction from the 5-position of 20 -deoxyuridine 50 -monopho-
sphate. Biochemistry 38(2), 848852.
Ludwig, M. L., and Matthews, R. G. (1997). Structure-based perspectives on B12-depen-
dent enzymes. Annu. Rev. Biochem. 66, 269313.
Ma, J., Stampfer, M. J., Giovannucci, E., Artigas, C., Hunter, D. J., Fuchs, C.,
Willett, W. C., Selhub, J., Hennekens, C. H., and Rozen, R. (1997). Methylenetetra-
hydrofolate reductase polymorphism, dietary interactions, and risk of colorectal cancer.
Cancer Res. 57(6), 10981102.
Mackenzie, R. E. (1984). Biogenesis and interconversion of substituted tetrahydrofolates.
In Folates and Pterins (R. L. Blakley and S. J. Benkovic, eds.), pp. 255306.
New York, Wiley-Interscience.
Mackenzie, R. E., and Baugh, C. M. (1980). Tetrahydropterolypolyglutamate derivatives as
substrates of two multifunctional proteins with folate-dependent enzyme activities.
Biochim. Biophys. Acta 611(1), 187195.
Mandola, M. V., Stoehlmacher, J., Muller-Weeks, S., Cesarone, G., Yu, M. C., Lenz, H. J.,
and Ladner, R. D. (2003). A novel single nucleotide polymorphism within the 50 tandem
repeat polymorphism of the thymidylate synthase gene abolishes USF-1 binding and
alters transcriptional activity. Cancer Res. 63(11), 28982904.
Mandola, M. V., Stoehlmacher, J., Zhang, W., Groshen, G., Yu, M. C., Iqbal, S.,
Lenz, H. J., and Ladner, R. D. (2004). A 6 bp polymorphism in the thymidylate synthase
gene causes message instability and is associated with decreased intratumoral TS mRNA
levels. Pharmacogenetics 14(5), 319327.
Folate-Mediated One-Carbon Metabolism 37
Marie, S., Heron, B., Bitoun, P., Timmerman, T., Van Den Berghe, G., and Vincent, M. F.
(2004). AICA-ribosiduria: A novel, neurologically devastating inborn error of purine
biosynthesis caused by mutation of ATIC. Am. J. Hum. Genet. 74(6), 12761281.
Matakidou, A., El Galta, R., Rudd, M. F., Webb, E. L., Bridle, H., Eisen, T., and
Houlston, R. S. (2007). Prognostic significance of folate metabolism polymorphisms
for lung cancer. Br. J. Cancer 97(2), 247252.
McGuire, J. J., and Rabinowitz, J. C. (1978). Studies on the mechanism of formyltetrahy-
drofolate synthetase. The Peptococcus aerogenes enzyme. J. Biol. Chem. 253(4),
10791085.
McNulty, H. (1995). Folate requirements for health in different population groups. Br. J.
Biomed. Sci. 52(2), 110119.
Mejillano, M. R., Jahansouz, H., Matsunaga, T. O., Kenyon, G. L., and Himes, R. H.
(1989). Formation and utilization of formyl phosphate by N10-formyltetrahydrofolate
synthetase: Evidence for formyl phosphate as an intermediate in the reaction. Biochemistry
28(12), 51365145.
Meredith, M., Rabaglia, M., and Metz, S. (1995). Cytosolic biosynthesis of GTP and ATP in
normal rat pancreatic islets. Biochim. Biophys. Acta 1266(1), 1622.
Miller, A., and Waelsch, H. (1957). The conversion of urocanic acid to formamidinoglutaric
acid. J. Biol. Chem. 228(1), 365381.
Mills, J. L., McPartlin, J. M., Kirke, P. N., Lee, Y. J., Conley, M. R., Weir, D. G., and
Scott, J. M. (1995). Homocysteine metabolism in pregnancies complicated by neural-
tube defects. Lancet 345(8943), 149151.
Miranda, T. B., and Jones, P. A. (2007). DNA methylation: The nuts and bolts of repression.
J. Cell. Physiol. 213(2), 384390.
Molloy, A. M., Daly, S., Mills, J. L., Kirke, P. N., Whitehead, A. S., Ramsbottom, D.,
Conley, M. R., Weir, D. G., and Scott, J. M. (1997). Thermolabile variant of 5,10-
methylenetetrahydrofolate reductase associated with low red-cell folates: Implications for
folate intake recommendations. Lancet 349(9065), 15911593.
Moran, R. G. (1999). Roles of folylpoly-gamma-glutamate synthetase in therapeutics with
tetrahydrofolate antimetabolites: An overview. Semin. Oncol. 26(2 Suppl. 6), 2432.
Morita, H., Taguchi, J., Kurihara, H., Kitaoka, M., Kaneda, H., Kurihara, Y., Maemura, K.,
Shindo, T., Minamino, T., Ohno, M., Yamaoki, K., Ogasawara, K., et al. (1997).
Genetic polymorphism of 5,10-methylenetetrahydrofolate reductase (MTHFR) as a
risk factor for coronary artery disease. Circulation 95(8), 20322036.
Mostowska, A., Hozyasz, K. K., and Jagodzinski, P. P. (2006). Maternal MTR genotype
contributes to the risk of non-syndromic cleft lip and palate in the Polish population.
Clin. Genet. 69(6), 512517.
Muntjewerff, J. W., Hoogendoorn, M. L., Kahn, R. S., Sinke, R. J., Den Heijer, M.,
Kluijtmans, L. A., and Blom, H. J. (2005). Hyperhomocysteinemia, methylenetetrahy-
drofolate reductase 677TT genotype, and the risk for schizophrenia: A Dutch population
based case-control study. Am. J. Med. Genet. B Neuropsychiatr. Genet. 135(1), 6972.
Muntjewerff, J. W., Kahn, R. S., Blom, H. J., and den Heijer, M. (2006). Homocysteine,
methylenetetrahydrofolate reductase and risk of schizophrenia: A meta-analysis. Mol.
Psychiatry 11(2), 143149.
Murley, L. L., and MacKenzie, R. E. (1995). The two monofunctional domains of octa-
meric formiminotransferase-cyclodeaminase exist as dimers. Biochemistry 34(33),
1035810364.
Nakshatri, H., Bouillet, P., Bhat-Nakshatri, P., and Chambon, P. (1996). Isolation of
retinoic acid-repressed genes from P19 embryonal carcinoma cells. Gene 174(1), 7984.
Navalgund, L. G., Rossana, C., Muench, A. J., and Johnson, L. F. (1980). Cell cycle
regulation of thymidylate synthetase gene expression in cultured mouse fibroblasts.
J. Biol. Chem. 255(15), 73867390.
38 Jennifer T. Fox and Patrick J. Stover
Nijhout, H. F., Reed, M. C., Lam, S. L., Shane, B., Gregory, J. F., 3rd, and Ulrich, C. M.
(2006). In silico experimentation with a model of hepatic mitochondrial folate meta-
bolism. Theor. Biol. Med. Model. 3, 40.
Nikiforov, M. A., Chandriani, S., OConnell, B., Petrenko, O., Kotenko, I., Beavis, A.,
Sedivy, J. M., and Cole, M. D. (2002). A functional screen for Myc-responsive genes
reveals serine hydroxymethyltransferase, a major source of the one-carbon unit for cell
metabolism. Mol. Cell. Biol. 22(16), 57935800.
Noguchi, H., Prem veer Reddy, G., and Pardee, A. B. (1983). Rapid incorporation of label
from ribonucleoside disphosphates into DNA by a cell-free high molecular weight
fraction from animal cell nuclei. Cell 32(2), 443451.
Okamura-Ikeda, K., Hosaka, H., Yoshimura, M., Yamashita, E., Toma, S., Nakagawa, A.,
Fujiwara, K., Motokawa, Y., and Taniguchi, H. (2005). Crystal structure of human
T-protein of glycine cleavage system at 2.0 A resolution and its implication for under-
standing non-ketotic hyperglycinemia. J. Mol. Biol. 351(5), 11461159.
Oltean, S., and Banerjee, R. (2005). A B12-responsive internal ribosome entry site (IRES)
element in human methionine synthase. J. Biol. Chem. 280(38), 3266232668.
Oppenheim, E. W., Adelman, C., Liu, X., and Stover, P. J. (2001). Heavy chain ferritin
enhances serine hydroxymethyltransferase expression and de novo thymidine biosynthesis.
J. Biol. Chem. 276(23), 1985519861.
Ou, C. Y., Stevenson, R. E., Brown, V. K., Schwartz, C. E., Allen, W. P., Khoury, M. J.,
Rozen, R., Oakley, G. P., Jr., and Adams, M. J., Jr. (1996). 5,10 Methylenetetrahydro-
folate reductase genetic polymorphism as a risk factor for neural tube defects. Am. J. Med.
Genet. 63(4), 610614.
Parle-McDermott, A., Mills, J. L., Kirke, P. N., Cox, C., Signore, C. C., Kirke, S.,
Molloy, A. M., OLeary, V. B., Pangilinan, F. J., OHerlihy, C., Brody, L. C., and
Scott, J. M. (2005a). MTHFD1 R653Q polymorphism is a maternal genetic risk factor
for severe abruptio placentae. Am. J. Med. Genet. A 132(4), 365368.
Parle-McDermott, A., Pangilinan, F., Mills, J. L., Signore, C. C., Molloy, A. M., Cotter, A.,
Conley, M., Cox, C., Kirke, P. N., Scott, J. M., and Brody, L. C. (2005b). A polymor-
phism in the MTHFD1 gene increases a mothers risk of having an unexplained second
trimester pregnancy loss. Mol. Hum. Reprod. 11(7), 477480.
Parle-McDermott, A., Kirke, P. N., Mills, J. L., Molloy, A. M., Cox, C., OLeary, V. B.,
Pangilinan, F., Conley, M., Cleary, L., Brody, L. C., and Scott, J. M. (2006a). Confir-
mation of the R653Q polymorphism of the trifunctional C1-synthase enzyme as a
maternal risk for neural tube defects in the Irish population. Eur. J. Hum. Genet. 14(6),
768772.
Parle-McDermott, A., Mills, J. L., Molloy, A. M., Carroll, N., Kirke, P. N., Cox, C.,
Conley, M. R., Pangilinan, F. J., Brody, L. C., and Scott, J. M. (2006b). The MTHFR
1298CC and 677TT genotypes have opposite associations with red cell folate levels. Mol.
Genet. Metab. 88(3), 290294.
Paukert, J. L., Straus, L. D., and Rabinowitz, J. C. (1976). Formyl-methyl-methylenete-
trahydrofolate synthetase-(combined). An ovine protein with multiple catalytic activities.
J. Biol. Chem. 251(16), 51045111.
Pawelek, P. D., and MacKenzie, R. E. (1998). Methenyltetrahydrofolate cyclohydrolase is
rate limiting for the enzymatic conversion of 10-formyltetrahydrofolate to 5,10-methy-
lenetetrahydrofolate in bifunctional dehydrogenase-cyclohydrolase enzymes. Biochemistry
37(4), 11091115.
Paz, M. F., Avila, S., Fraga, M. F., Pollan, M., Capella, G., Peinado, M. A., Sanchez-
Cespedes, M., Herman, J. G., and Esteller, M. (2002). Germ-line variants in methyl-
group metabolism genes and susceptibility to DNA methylation in normal tissues and
human primary tumors. Cancer Res. 62(15), 45194524.
Folate-Mediated One-Carbon Metabolism 39
Pejchal, R., Campbell, E., Guenther, B. D., Lennon, B. W., Matthews, R. G., and
Ludwig, M. L. (2006). Structural perturbations in the Ala ! Val polymorphism of
methylenetetrahydrofolate reductase: How binding of folates may protect against inacti-
vation. Biochemistry 45(15), 48084818.
Peri, K. G., and MacKenzie, R. E. (1991). Transcriptional regulation of murine NADP()-
dependent methylenetetrahydrofolate dehydrogenase-cyclohydrolase-synthetase. FEBS
Lett. 294(12), 113115.
Peri, K. G., and MacKenzie, R. E. (1993). NAD()-dependent methylenetetrahydrofolate
dehydrogenase-cyclohydrolase: Detection of the mRNA in normal murine tissues and
transcriptional regulation of the gene in cell lines. Biochim. Biophys. Acta 1171(3),
281287.
Perry, C., Sastry, R., Nasrallah, I. M., and Stover, P. J. (2005). Mimosine attenuates serine
hydroxymethyltransferase transcription by chelating zinc. Implications for inhibition of
DNA replication. J. Biol. Chem. 280(1), 396400.
Perry, C., Yu, S., Chen, J., Matharu, K. S., and Stover, P. J. (2007). Effect of vitamin B6
availability on serine hydroxymethyltransferase in MCF-7 cells. Arch. Biochem. Biophys.
462(1), 2127.
Perry, J., Deacon, R., Lumb, M., and Chanarin, I. (1980). The effect of nitrous oxide-
induced inactivation of vitamin B12 on the activity of formyl-methenyl-methylenete-
trahydrofolate synthetase, methylene-tetrahydrofolate reductase and formiminotetrahy-
drofolate transferase. Biochem. Biophys. Res. Commun. 97(4), 13291333.
Pfendner, W., and Pizer, L. I. (1980). The metabolism of serine and glycine in mutant lines
of Chinese hamster ovary cells. Arch. Biochem. Biophys. 200(2), 503512.
Pickell, L., Tran, P., Leclerc, D., Hiscott, J., and Rozen, R. (2005). Regulatory studies
of murine methylenetetrahydrofolate reductase reveal two major promoters and NF-
kappaB sensitivity. Biochim. Biophys. Acta 1731(2), 104114.
Pogribny, I. P., Basnakian, A. G., Miller, B. J., Lopatina, N. G., Poirier, L. A., and
James, S. J. (1995). Breaks in genomic DNA and within the p53 gene are associated
with hypomethylation in livers of folate/methyl-deficient rats. Cancer Res. 55(9),
18941901.
Porter, D. H., Cook, R. J., and Wagner, C. (1985). Enzymatic properties of dimethylglycine
dehydrogenase and sarcosine dehydrogenase from rat liver. Arch. Biochem. Biophys. 243
(2), 396407.
Powell, C. M., Rudge, T. L., Zhu, Q., Johnson, L. F., and Hansen, U. (2000). Inhibition of
the mammalian transcription factor LSF induces S-phase-dependent apoptosis by down-
regulating thymidylate synthase expression. EMBO J. 19(17), 46654675.
Prasannan, P., Pike, S., Peng, K., Shane, B., and Appling, D. R. (2003). Human mitochon-
drial C1-tetrahydrofolate synthase: Gene structure, tissue distribution of the mRNA, and
immunolocalization in Chinese hamster ovary calls. J. Biol. Chem. 278(44),
4317843187.
Prem veer Reddy, G., and Pardee, A. B. (1980). Multienzyme complex for metabolic
channeling in mammalian DNA replication. Proc. Natl. Acad. Sci. USA 77(6),
33123316.
Pricer, W. E., Jr., and Rabinowitz, J. C. (1956). Purine fermentation by Clostridium
cylindrosporum. V. Formiminoglycine. J. Biol. Chem. 222(2), 537554.
Pullarkat, S. T., Stoehlmacher, J., Ghaderi, V., Xiong, Y. P., Ingles, S. A., Sherrod, A.,
Warren, R., Tsao-Wei, D., Groshen, S., and Lenz, H. J. (2001). Thymidylate synthase
gene polymorphism determines response and toxicity of 5-FU chemotherapy. Pharma-
cogenomics J. 1(1), 6570.
Qiao, Q. A., Cai, Z. T., Feng, D. C., and Jiang, Y. S. (2004). A quantum chemical study of
the water-assisted mechanism in one-carbon unit transfer reaction catalyzed by glycina-
mide ribonucleotide transformylase. Biophys. Chem. 110(3), 259266.
40 Jennifer T. Fox and Patrick J. Stover
Quere, I., Perneger, T. V., Zittoun, J., Bellet, H., Gris, J. C., Daures, J. P., Schved, J. F.,
Mercier, E., Laroche, J. P., Dauzat, M., Bounameaux, H., Janbon, C., et al. (2002). Red
blood cell methylfolate and plasma homocysteine as risk factors for venous thromboem-
bolism: A matched case-control study. Lancet 359(9308), 747752.
Refsum, H., Ueland, P. M., Nygard, O., and Vollset, S. E. (1998). Homocysteine and
cardiovascular disease. Annu. Rev. Med. 49, 3162.
Relton, C. L., Wilding, C. S., Laffling, A. J., Jonas, P. A., Burgess, T., Binks, K., Tawn, E. J.,
and Burn, J. (2004a). Low erythrocyte folate status and polymorphic variation in folate-
related genes are associated with risk of neural tube defect pregnancy. Mol. Genet. Metab.
81(4), 273281.
Relton, C. L., Wilding, C. S., Pearce, M. S., Laffling, A. J., Jonas, P. A., Lynch, S. A.,
Tawn, E. J., and Burn, J. (2004b). Gene-gene interaction in folate-related genes and risk
of neural tube defects in a UK population. J. Med. Genet. 41(4), 256260.
Renwick, S. B., Snell, K., and Baumann, U. (1998). The crystal structure of human cytosolic
serine hydroxymethyltransferase: A target for cancer chemotherapy. Structure 6(9),
11051116.
Revel, H. R., and Magasanik, B. (1958). The enzymatic degradation of urocanic acid.
J. Biol. Chem. 233(4), 930935.
Rudge, T. L., and Johnson, L. F. (2002). Synergistic activation of the TATA-less mouse
thymidylate synthase promoter by the Ets transcription factor GABP and Sp1. Exp. Cell
Res. 274(1), 4555.
Samsonoff, W. A., Reston, J., McKee, M., OConnor, B., Galivan, J., Maley, G., and
Maley, F. (1997). Intracellular location of thymidylate synthase and its state of phosphor-
ylation. J. Biol. Chem. 272(20), 1328113285.
Scheer, J. B., Mackey, A. D., and Gregory, J. F., 3rd. (2005). Activities of hepatic cytosolic
and mitochondrial forms of serine hydroxymethyltransferase and hepatic glycine concen-
tration are affected by vitamin B-6 intake in rats. J. Nutr. 135(2), 233238.
Scher, A. I., Terwindt, G. M., Verschuren, W. M., Kruit, M. C., Blom, H. J., Kowa, H.,
Frants, R. R., van den Maagdenberg, A. M., van Buchem, M., Ferrari, M. D., and
Launer, L. J. (2006). Migraine and MTHFR C677T genotype in a population-based
sample. Ann. Neurol. 59(2), 372375.
Schild, D., Brake, A. J., Kiefer, M. C., Young, D., and Barr, P. J. (1990). Cloning of three
human multifunctional de novo purine biosynthetic genes by functional complementation
of yeast mutations. Proc. Natl. Acad. Sci. USA 87(8), 29162920.
Schirch, L. (1978). Formyl-methenyl-methylenetetrahydrofolate synthetase from rabbit liver
(combined). Evidence for a single site in the conversion of 5,10-methylenetetrahydro-
folate to 10-formyltetrahydrofolate. Arch. Biochem. Biophys. 189(2), 283290.
Schirch, V., and Strong, W. B. (1989). Interaction of folylpolyglutamates with enzymes in
one-carbon metabolism. Arch. Biochem. Biophys. 269(2), 371380.
Schirch, V., and Szebenyi, D. M. (2005). Serine hydroxymethyltransferase revisited. Curr.
Opin. Chem. Biol. 9(5), 482487.
Scott, J. M. (1998). How does folic acid prevent neural tube defects? Nat. Med. 4(8),
895896.
Scott, J. M. (2001). Evidence of folic acid and folate in the prevention of neural tube defects.
Bibl. Nutr. Dieta. 55(55), 192195.
Scott, J. M., and Rabinowitz, J. C. (1967). The association-dissociation of formyltetrahy-
drofolate synthetase and its relation to monovalent cation activation of catalytic activity.
Biochem. Biophys. Res. Commun. 29(3), 418423.
Scott, J. M., Dinn, J. J., Wilson, P., and Weir, D. G. (1981). Pathogenesis of subacute
combined degeneration: A result of methyl group deficiency. Lancet 2(8242), 334337.
Shane, B. (1989). Folylpolyglutamate synthesis and role in the regulation of one-carbon
metabolism. Vitam. Horm. 45, 263335.
Folate-Mediated One-Carbon Metabolism 41
Shane, B. (1995). Folate chemistry and metabolism. In Folate in Health and Disease
(L. B. Bailey, ed.), pp. 122. New York, Marcel Dekker, Inc.
Shane, B., and Stokstad, E. L. (1985). Vitamin B12-folate interrelationships. Annu. Rev.
Nutr. 5, 115141.
Shim, J. H., Wall, M., Benkovic, S. J., Diaz, N., Suarez, D., and Merz, K. M., Jr. (2001).
Evaluation of the catalytic mechanism of AICAR transformylase by pH-dependent kinetics,
mutagenesis, and quantum chemical calculations. J. Am. Chem. Soc. 123(20), 46874696.
Shivapurkar, N., Tang, Z., Frost, A., and Alabaster, O. (1995). Inhibition of progression of
aberrant crypt foci and colon tumor development by vitamin E and beta-carotene in rats
on a high-risk diet. Cancer Lett. 91(1), 125132.
Skibola, C. F., Smith, M. T., Kane, E., Roman, E., Rollinson, S., Cartwright, R. A., and
Morgan, G. (1999). Polymorphisms in the methylenetetrahydrofolate reductase gene
are associated with susceptibility to acute leukemia in adults. Proc. Natl. Acad. Sci. USA
96(22), 1281012815.
Skibola, C. F., Smith, M. T., Hubbard, A., Shane, B., Roberts, A. C., Law, G. R.,
Rollinson, S., Roman, E., Cartwright, R. A., and Morgan, G. J. (2002). Polymorphisms
in the thymidylate synthase and serine hydroxymethyltransferase genes and risk of adult
acute lymphocytic leukemia. Blood 99(10), 37863791.
Smith, G. K., Mueller, W. T., Benkovic, P. A., and Benkovic, S. J. (1981). On the cofactor
specificity of glycinamide ribonucleotide and 5-aminoimidazole-4-carboxamide ribonu-
cleotide transformylase from chicken liver. Biochemistry 20(5), 12411245.
Song, J. M., and Rabinowitz, J. C. (1993). Function of yeast cytoplasmic C1-tetrahydrofo-
late synthase. Proc. Natl. Acad. Sci. USA 90(7), 26362640.
Song, S., Jahansouz, H., and Himes, R. H. (1993). Solvent oxygen is not incorporated into
N10-formyltetrahydrofolate in the reaction catalyzed by N10-formyltetrahydrofolate
synthetase. FEBS Lett. 332(12), 150152.
Spencer, A. C., and Spremulli, L. L. (2004). Interaction of mitochondrial initiation factor 2 with
mitochondrial fMet-tRNA. Nucleic Acids Res. 32(18), 54645470.
Spivey, H. O., and Merz, J. M. (1989). Metabolic compartmentation. Bioessays 10(4),
127130.
Stead, L. M., Jacobs, R. L., Brosnan, M. E., and Brosnan, J. T. (2004). Methylation demand
and homocysteine metabolism. Adv. Enzyme Regul. 44, 321333.
Stegmann, K., Ziegler, A., Ngo, E. T., Kohlschmidt, N., Schroter, B., Ermert, A., and
Koch, M. C. (1999). Linkage disequilibrium of MTHFR genotypes 677C/T-1298A/C
in the German population and association studies in probands with neural tube defects
(NTD). Am. J. Med. Genet. 87(1), 2329.
Stevens, V. L., McCullough, M. L., Pavluck, A. L., Talbot, J. T., Feigelson, H. S.,
Thun, M. J., and Calle, E. E. (2007). Association of polymorphisms in one-carbon
metabolism genes and postmenopausal breast cancer incidence. Cancer Epidemiol. Bio-
markers Prev. 16(6), 11401147.
Stover, P., and Schirch, V. (1990). Serine hydroxymethyltransferase catalyzes the hydrolysis
of 5,10-methenyltetrahydrofolate to 5-formyltetrahydrofolate. J. Biol. Chem. 265(24),
1422714233.
Stover, P., and Schirch, V. (1991). 5-Formyltetrahydrofolate polyglutamates are slow tight
binding inhibitors of serine hydroxymethyltransferase. J. Biol. Chem. 266(3), 15431550.
Stover, P., and Schirch, V. (1993). The metabolic role of leucovorin. Trends Biochem. Sci.
18(3), 102106.
Stover, P., Kruschwitz, H., and Schirch, V. (1993). Evidence that
5-formyltetrahydropteroylglutamate has a metabolic role in one-carbon metabolism.
Adv. Exp. Med. Biol. 338, 679685.
Strong, W. B., and Schirch, V. (1989). In vitro conversion of formate to serine: Effect of
tetrahydropteroylpolyglutamates and serine hydroxymethyltransferase on the rate of
10-formyltetrahydrofolate synthetase. Biochemistry 28(24), 94309439.
42 Jennifer T. Fox and Patrick J. Stover
Strong, W. B., Tendler, S. J., Seither, R. L., Goldman, I. D., and Schirch, V. (1990).
Purification and properties of serine hydroxymethyltransferase and C1-tetrahydrofolate
synthase from L1210 cells. J. Biol. Chem. 265(21), 1214912155.
Suh, J. R., Herbig, A. K., and Stover, P. J. (2001). New perspectives on folate catabolism.
Annu. Rev. Nutr. 21, 255282.
Sumner, J. S., and Matthews, R. G. (1992). Stereochemistry and mechanism of hydrogen
transfer between NADPH and methylenetetrahydrofolate in the reaction catalyzed by
methylenetetrahydrofolate reductase from pig liver. J. Am. Chem. Soc. 114(18),
69496956.
Swanson, D. A., Liu, M. L., Baker, P. J., Garrett, L., Stitzel, M., Wu, J., Harris, M.,
Banerjee, R., Shane, B., and Brody, L. C. (2001). Targeted disruption of the methionine
synthase gene in mice. Mol. Cell. Biol. 21(4), 10581065.
Szabados, E., Hindmarsh, E. J., Phillips, L., Duggleby, R. G., and Christopherson, R. I.
(1994). 5-Aminoimidazole-4-carboxamide ribotide transformylase-IMP cyclohydrolase
from human CCRF-CEM leukemia cells: Purification, pH dependence, and inhibitors.
Biochemistry 33(47), 1423714245.
Szebenyi, D. M., Liu, X., Kriksunov, I. A., Stover, P. J., and Thiel, D. J. (2000). Structure
of a murine cytoplasmic serine hydroxymethyltransferase quinonoid ternary complex:
Evidence for asymmetric obligate dimers. Biochemistry 39(44), 1331313323.
Szebenyi, D. M., Musayev, F. N., di Salvo, M. L., Safo, M. K., and Schirch, V. (2004).
Serine hydroxymethyltransferase: Role of glu75 and evidence that serine is cleaved by a
retroaldol mechanism. Biochemistry 43(22), 68656876.
Tabor, H., Mehler, A. H., Hayaishi, O., and White, J. (1952). Urocanic acid as an
intermediate in the enzymatic conversion of histidine to glutamic and formic acids.
J. Biol. Chem. 196(1), 121128.
Takeishi, K., Kaneda, S., Ayusawa, D., Shimizu, K., Gotoh, O., and Seno, T. (1985).
Nucleotide sequence of a functional cDNA for human thymidylate synthase. Nucleic Acids
Res. 13(6), 20352043.
Takemura, Y., and Jackman, A. L. (1997). Folate-based thymidylate synthase inhibitors in
cancer chemotherapy. Anticancer Drugs 8(1), 316.
Takeuchi, N., Kawakami, M., Omori, A., Ueda, T., Spremulli, L. L., and Watanabe, K.
(1998). Mammalian mitochondrial methionyl-tRNA transformylase from bovine liver.
Purification, characterization, and gene structure. J. Biol. Chem. 273(24), 1508515090.
Tan, L. U., Drury, E. J., and MacKenzie, R. E. (1977). Methylenetetrahydrofolate
dehydrogenase-methenyltetrahydrofolate cyclohydrolase-formyltetrahydrofolate synthe-
tase. A multifunctional protein from porcine liver. J. Biol. Chem. 252(3), 11171122.
Tatum, C. M., Jr., Benkovic, P. A., Benkovic, S. J., Potts, R., Schleicher, E., and
Floss, H. G. (1977). Stereochemistry of methylene transfer involving 5,10-methylenete-
trahydrofolate. Biochemistry 16(6), 10931102.
Tibbetts, A. S., Oesterlin, L., Chan, S. Y., Kramer, G., Hardesty, B., and Appling, D. R.
(2003). Mammalian mitochondrial initiation factor 2 supports yeast mitochondrial trans-
lation without formylated initiator tRNA. J. Biol. Chem. 278(34), 3177431780.
Titus, S. A., and Moran, R. G. (2000). Retrovirally mediated complementation of the glyB
phenotype. Cloning of a human gene encoding the carrier for entry of folates into
mitochondria. J. Biol. Chem. 275(47), 3681136817.
Tran, P., Leclerc, D., Chan, M., Pai, A., Hiou-Tim, F., Wu, Q., Goyette, P., Artigas, C.,
Milos, R., and Rozen, R. (2002). Multiple transcription start sites and alternative splicing
in the methylenetetrahydrofolate reductase gene result in two enzyme isoforms. Mamm.
Genome 13(9), 483492.
Trimmer, E. E., Ballou, D. P., Ludwig, M. L., and Matthews, R. G. (2001). Folate
activation and catalysis in methylenetetrahydrofolate reductase from Escherichia coli:
Roles for aspartate 120 and glutamate 28. Biochemistry 40(21), 62166226.
Folate-Mediated One-Carbon Metabolism 43
Trinh, B. N., Ong, C. N., Coetzee, G. A., Yu, M. C., and Laird, P. W. (2002). Thymidylate
synthase: A novel genetic determinant of plasma homocysteine and folate levels. Hum.
Genet. 111(3), 299302.
Trivedi, V., Gupta, A., Jala, V. R., Saravanan, P., Rao, G. S., Rao, N. A., Savithri, H. S.,
and Subramanya, H. S. (2002). Crystal structure of binary and ternary complexes of serine
hydroxymethyltransferase from Bacillus stearothermophilus: Insights into the catalytic
mechanism. J. Biol. Chem. 277(19), 1716117169.
Tsybovsky, Y., Donato, H., Krupenko, N. I., Davies, C., and Krupenko, S. A. (2007).
Crystal structures of the carboxyl terminal domain of rat 10-formyltetrahydrofolate
dehydrogenase: Implications for the catalytic mechanism of aldehyde dehydrogenases.
Biochemistry 46(11), 29172929.
Ueland, P. M., Refsum, H., Beresford, S. A., and Vollset, S. E. (2000). The controversy over
homocysteine and cardiovascular risk. Am. J. Clin. Nutr. 72(2), 324332.
Ulrich, C. M., Bigler, J., Velicer, C. M., Greene, E. A., Farin, F. M., and Potter, J. D.,
(2000). Searching expressed sequence tag databases: Discovery and confirmation of a
common polymorphism in the thymidylate synthase gene. Cancer Epidemiol. Biomarkers
Prev. 9(12), 13811385.
Uyeda, K., and Rabinowitz, J. C. (1965). Metabolism of formiminoglycine. Glycine
formiminotransferase. J. Biol. Chem. 240, 17011710.
van der Put, N. M., and Blom, H. J. (2000). Neural tube defects and a disturbed folate
dependent homocysteine metabolism. Eur. J. Obstet. Gynecol. Reprod. Biol. 92(1), 5761.
van der Put, N. M., Steegers-Theunissen, R. P., Frosst, P., Trijbels, F. J., Eskes, T. K., van
den Heuvel, L. P., Mariman, E. C., den Heyer, M., Rozen, R., and Blom, H. J. (1995).
Mutated methylenetetrahydrofolate reductase as a risk factor for spina bifida. Lancet 346
(8982), 10701071.
van der Velden, A. W., and Thomas, A. A. (1999). The role of the 50 untranslated region of
an mRNA in translation regulation during development. Int. J. Biochem. Cell Biol. 31(1),
87106.
Van der Wilt, C. L., Pinedo, H. M., Smid, K., and Peters, G. J. (1992). Elevation of
thymidylate synthase following 5-fluorouracil treatment is prevented by the addition of
leucovorin in murine colon tumors. Cancer Res. 52(18), 49224928.
Vial, L., Gomez, P., Panvert, M., Schmitt, E., Blanquet, S., and Mechulam, Y. (2003).
Mitochondrial methionyl-tRNAfMet formyltransferase from Saccharomyces cerevisiae:
Gene disruption and tRNA substrate specificity. Biochemistry 42(4), 932939.
Volcik, K. A., Shaw, G. M., Zhu, H., Lammer, E. J., Laurent, C., and Finnell, R. H. (2003).
Associations between polymorphisms within the thymidylate synthase gene and spina
bifida. Birth Defects Res. A Clin. Mol. Teratol. 67(11), 924928.
Wagner, C. (1995). Biochemical role of folate in cellular metabolism. In Folate in Health
and Disease (L. B. Bailey, ed.), pp. 2342. New York, Marcel Dekker, Inc.
Walkup, A. S., and Appling, D. R. (2005). Enzymatic characterization of human mitochon-
drial C1-tetrahydrofolate synthase. Arch. Biochem. Biophys. 442(2), 196205.
Wall, M., Shim, J. H., and Benkovic, S. J. (2000). Human AICAR transformylase: Role of
the 4-carboxamide of AICAR in binding and catalysis. Biochemistry 39(37),
1130311311.
Wasserman, G. F., Benkovic, P. A., Young, M., and Benkovic, S. J. (1983). Kinetic
relationships between the various activities of the formyl-methenyl-methylenetetrahy-
drofolate synthetase. Biochemistry 22(5), 10051013.
Welch, W. H., Irwin, C. L., and Himes, R. H. (1968). Observations on the monovalent
cation requirements of formyltetrahydrofolate synthetase. Biochem. Biophys. Res. Commun.
30(3), 255261.
Wiemels, J. L., Smith, R. N., Taylor, G. M., Eden, O. B., Alexander, F. E., and
Greaves, M. F. (2001). Methylenetetrahydrofolate reductase (MTHFR) polymorphisms
44 Jennifer T. Fox and Patrick J. Stover
and risk of molecularly defined subtypes of childhood acute leukemia. Proc. Natl. Acad.
Sci. USA 98(7), 40044009.
Winter-Vann, A. M., Kamen, B. A., Bergo, M. O., Young, S. G., Melnyk, S., James, S. J.,
and Casey, P. J. (2003). Targeting Ras signaling through inhibition of carboxyl methyla-
tion: An unexpected property of methotrexate. Proc. Natl. Acad. Sci. USA 100(11),
65296534.
Wittwer, A. J., and Wagner, C. (1980). Identification of folate binding protein of mitochon-
dria as dimethylglycine dehydrogenase. Proc. Natl. Acad. Sci. USA 77(8), 44844488.
Woeller, C. F., Anderson, D. D., Szebenyi, D. M., and Stover, P. J. (2007a). Evidence for
small ubiquitin-like modifier-dependent nuclear import of the thymidylate biosynthesis
pathway. J. Biol. Chem. 282(24), 1762317631.
Woeller, C. F., Fox, J. T., Perry, C., and Stover, P. J. (2007b). A ferritin-responsive internal
ribosome entry site regulates folate metabolism. J. Biol. Chem. 282(41), 2992729935.
Wolan, D. W., Greasley, S. E., Beardsley, G. P., and Wilson, I. A. (2002). Structural insights
into the avian AICAR transformylase mechanism. Biochemistry 41(52), 1550515513.
Wong, N. A., Brett, L., Stewart, M., Leitch, A., Longley, D. B., Dunlop, M. G.,
Johnston, P. G., Lessells, A. M., and Jodrell, D. I. (2001). Nuclear thymidylate synthase
expression, p53 expression and 5FU response in colorectal carcinoma. Br. J. Cancer
85(12), 19371943.
Yamada, K., Chen, Z., Rozen, R., and Matthews, R. G. (2001). Effects of common
polymorphisms on the properties of recombinant human methylenetetrahydrofolate
reductase. Proc. Natl. Acad. Sci. USA 98(26), 1485314858.
Yamada, K., Strahler, J. R., Andrews, P. C., and Matthews, R. G. (2005). Regulation of
human methylenetetrahydrofolate reductase by phosphorylation. Proc. Natl. Acad. Sci.
USA 102(30), 1045410459.
Yamazaki, A. (1978). Cyclization of 5-amino-1-b-D-ribofuranosylimidazole-4-carboxamide
(AICA-riboside): A Review. J. Heterocycl. Chem. 15, 353.
Zalavras Ch, G., Giotopoulou, S., Dokou, E., Mitsis, M., Ioannou, H. V., Tzolou, A.,
Kolaitis, N., and Vartholomatos, G. (2002). Lack of association between the C677T
mutation in the 5,10-methylenetetrahydrofolate reductase gene and venous thrombo-
embolism in Northwestern Greece. Int. Angiol. 21(3), 268271.
Zhu, J., Ren, A., Hao, L., Pei, L., Liu, J., Zhu, H., Li, S., Finnell, R. H., and Li, Z. (2006).
Variable contribution of the MTHFR C677T polymorphism to non-syndromic cleft lip
and palate risk in China. Am. J. Med. Genet. A 140(6), 551557.
C H A P T E R T W O
Mathematical Models of
Folate-Mediated One-Carbon
Metabolism
H. F. Nijhout,* M. C. Reed, and C. M. Ulrich
Contents
I. Introduction 46
II. Structure and Function of the Cycles 49
III. Why Mathematical Modeling? 51
A. Previous modeling efforts 52
B. Why modeling? 54
C. Difficult issues in modeling 55
D. Advantages of mathematical models 57
E. Kinetics, parameter values, and model structure 59
IV. Model Development 61
V. Blood Versus Intracellular Metabolite Concentrations 66
VI. Modeling GeneGene and GeneEnvironment Interactions 67
VII. Modeling and Simulation have Revealed Novel Homeostatic
Mechanisms 70
VIII. Steady States and Fluctuations 75
IX. Conclusions 77
Acknowledgments 78
References 78
Abstract
Folate-mediated one-carbon metabolism is an unusually complex metabolic
network, consisting of several interlocking cycles, and compartmentation
between cytosol and mitochondria. The cycles have diverse functions, the
primary being thymidylate synthesis (the rate limiting step in DNA synthesis),
the initial steps in purine synthesis, glutathione synthesis, and a host of methyl
transfer reactions that include DNA and histone methylation. Regulation within
the network is accomplished by numerous allosteric interactions in which
45
46 H. F. Nijhout et al.
metabolites in one part of the network affect the activity of enzymes elsewhere
in the network. Although a large body of experimental work has elucidated the
details of the mechanisms in every part of the network, the multitude of
complex and non-linear interactions within the network makes it difficult to
deduce how the network as a whole operates. Understanding the operation of
this network is further complicated by the fact that human populations maintain
functional polymorphisms for several enzymes in the network, and that the
network is subject to continual short and long-term fluctuations in its inputs as
well as in demands on its various outputs. Understanding how such a complex
system operates is possible only by means of mathematical models that take
account of all the reactions and interactions. Simulations with such models can
be used as an adjunct to laboratory experimentation to test ideas and alterna-
tive hypotheses and interpretations quickly and inexpensively. A number of
mathematical models have been developed over the years, largely motivated
by the need to understand the complex mechanisms by which anticancer drugs
like methotrexate inhibit nucleotide synthesis and thus limit the ability of cells
to divide. More recently, mathematical models have been used to investigate
the regulatory and homeostatic mechanisms that allow the system to accom-
modate large fluctuations in one part of the network without affecting critical
functions elsewhere in the network. 2008 Elsevier Inc.
I. Introduction
The origin of our mathematical modeling work stems from an interest in
understanding how genes and the environment interact in the biochemistry of
cells. This led us to study folate and methionine metabolism because this part of
cell metabolism is linked to a diversity of human diseases that have both genetic
and environmental contributing factors. Folate and other B vitamins play
critical roles in the biochemical reactions of one-carbon metabolism that are
related to amino acid metabolism, nucleotide synthesis, and numerous
methyl-transferase reactions, including DNA and protein methylation.
Defects in folate-mediated one-carbon metabolism (FOCM; Table 2.1
lists the acronyms and abbreviation used in this chapter), either due to
mutations in the genes that code for enzymes in the pathway or to deficien-
cies in vitamin cofactors, are associated with megaloblastic anemia, spina
bifida and other neural tube defects, cardiovascular disease, increased sensi-
tivity to oxidative stress, and a variety of neuropsychiatric disorders. FOCM
is also involved in the etiology of colorectal and other types of cancer, and
chemotherapeutic agents, such as methotrexate and 5-fluorouracil, target
FOCM and play a central role in cancer treatment. FOCM is highly com-
plex. It consists of a set of interlocked biochemical cycles (Fig. 2.1) whose
enzymes are subject to complex allosteric regulations. The function of this
complex network is further complicated by the fact that there are genetic
polymorphisms for many of the enzymes in the network, and the functions
Mathematical Models of Folate-Mediated One-Carbon Metabolism 47
of the network are sensitive to the input of various amino acids (glycine,
serine, methionine, and cysteine), B vitamins (folic acid, B6 and B12), and is
affected by environmental factors such as alcohol intake in intricate ways that
alter the normal operation of the network and the risk of disease.
Considerable research over the past 40 years has identified most if not all of
the important details of FOCM. However, a limiting factor of these critical
studies is that they have primarily focused on single reactions and on small
portions of the pathway, and thus provide no means for understanding the
overall functioning of the system. The multiple cycles and pathways of FOCM
together are part of a complex nonlinear system, which is difficult to capture
using purely experimental methods. Mathematical modeling is an approach
that has been particularly useful in the study of complex biological systems
(Edelstein-Keshet, 1988; Murray, 1989). Below we will review how mathe-
matical modeling has been able to confirm key hypotheses about the operation
of various portions of FOCM, and how modeling has provided novel insights
into the properties and consequences of various regulatory mechanisms that
stabilize portions of the network against environmental perturbations.
Table 2.1 Abbreviations and acronyms used in the text and figures
Acronym Name
10f-THF 10-Formyltetrahydrofolate
10f0DHF 10-Formyldihydrofolate
5fTHF 5-Formyltetrahydrofolate (leucovorin)
5mTHF 5-Methyltetrahydrofolate
AICAR P-ribosyl-5-amino-4-imidazole carboxamide
AICART Aminoimidazolecarboxamide ribonucleotide transferase
BET, Bet Betaine
BHMT Betaine-homocysteine methyltransferase
CBS Cystathionine b-synthase
CH:NHTHF 5-Formiminotetrahydrofolate
CHTHF 510-Methenyltetrahydrofolate
CH2-THF 510-Methylenetetrahydrofolate
CTGL g-Cystathionase
Cys Cysteine
Cyst Cystathionine
DHF Dihydrofolate
DHFR Dihydrofolate reductase
DHFS Dihydrofolate synthase
DHPR Dihydropteridine reductase
DMG Dimethylglycine
DMGD Dimethylglycine dehydrogenase
DNMT DNA-methyltransferase
(continued)
48 H. F. Nijhout et al.
Acronym Name
dTMP Deoxythymidine monophophate
dUMP Deoxyuridine monophophate
FOCM Folate-mediated one-carbon metabolism
FR-RFC Folate receptor reduced folate carrier
FTD 10-Formyltetrahydrofolate dehydrogenase
FTD 10-Formyltetrahydrofolate dehydrogenase
FTS 10-Formyltetrahydrofolate synthase
GAR Glycinamide ribonucleotide
GCS g-Glutamylcysteine synthetase
GDC Glycine decarboxylase (glycine cleavage system)
Glut Glutamate
Glut-Cys Glutamyl-cysteine
Gly Glycine
GNMT Glycine N-methyltransferase
GPX Glutathione peroxidase
GR Glutathione reductase
GS Glutathione synthetase
GSH Reduced glutathione
GSSG Oxidized glutathione disulfide
H2CO Formaldehyde
H2O2 Hydrogen peroxide
HCOOH Formate
Hcy Homocysteine
MAT-I Methionine adenosyl transferase I
MAT-II Methionine adenosyl transferase II
MAT-III Methionine adenosyl transferase III
Met Methionine
MS Methionine synthase
MTCH 5,10-Methenyltetrahydrofolate cyclohydrolase
MTD 5,10-Methylenetetrahydrofolate dehydrogenase
MTHFR 5,10-Methylenetetrahydrofolate reductase
MTS 5,10-Methenyltetrahydrofolate synthetase
NADPH Nicotinamide adenine dinucleotide phosphate
NE non-enzymatic conversion
PGT Phosphoribosyl glycinamidetransformylase
SAH S-adenosylhomocysteine
SAHH S-adenosylhomocysteine hydrolase
SAM S-adenosylmethionine
Sarc Sarcosine
SDH Sarcosine dehydrogenase
Ser Serine
SHMT Serinehydroxymethyltransferase
TS Thymidylate synthase
THF Tetrahydrofolate
Mathematical Models of Folate-Mediated One-Carbon Metabolism 49
One-Carbon Metabolism
Folate Methionine Blood
FR-RFC Metin
Gluconeogenesis
ATP
SerOut
THF THF MAT-I
Purine Met SAM
DMG vHCOOH AICART synthesis MAT-III
FTD HCOOH HCOOH
FTD AICAR DNA
DMGD H2C=O
PGT Gly
FTS FTS
NE DMG
DHFR GAR DNMT
Sarc vSer GNMT
10f-THF Ser Ser 10f-THF MS BHMT
SDH Sarc
SHMT SHMT H2C=O
MTCH MTCH Betaine DNA-CH3
vGly NE Methylation
Gly Gly Gly DHF reactions
Blood
mitochondrial folate cycle. The mitochondrial cycle then releases its carbons
to the cytosol as formate (HCOOH in Fig. 2.1). Glycine is also used in the
synthesis of sarcosine by GNMT. Sarcosine, in turn, also enters the mitochon-
dria and eventually yields all but one of its carbons to the mitochondrial folate
cycle. Serine is also used by the CBS reaction which complexes it with
homocysteine to yield cystathionine, which, in turn, is used for the synthesis
of cysteine and glutathione. The one-carbon units held by CH2-THF have
three fates: they can be passed to 5mTHF by MTHFR and subsequently to the
methionine cycle where they are used in a great diversity of methylation
reactions; they can also be passed to 10f-THF and subsequently used for
purine synthesis; finally they can be passed to TS and used to synthesize
dTMP from dUMP. Thus, FOCM plays a critical role in nucleotide synthesis,
and the TS reaction is the rate-limiting step in DNA synthesis (Fukushima
et al., 2003). The cytosolic and mitochondrial SHMT reactions are reversible.
In the forward direction they use serine, and in the backward direction they
use glycine and one-carbon units from the mitochondrial folate cycle to
synthesize serine, which can serve as the basis for gluconeogenesis. Methionine
enters the methionine cycle and is adenosylated by MAT-I and MAT-III
(in the liver; MAT-II is the adenosyl transferase used in other tissues).
S-adenosyl methionine (SAM) serves as the general methyl donor for the
majority of methylation reactions in the cell. About half of the mass of
methionine that enters the methionine cycle leaves via the transulfuration
pathway to cystathionine and cysteine (Finkelstein, 1990; Finkelstein and
Martin, 1986), and the other half is remethylated to methionine by MS and
BHMT, using methyl groups from 5mTHF and betaine, respectively.
If the reactions illustrated in Fig. 2.1 were the only pertinent ones, this
would be a case of complicated but standard biochemistry. However, many
of the metabolites in this system are allosteric activators or inhibitors of
enzymes at some distance in the network. For example, SAM inhibits
BHMT and MTHFR and activates CBS; DHF inhibits MTD, MTCH,
and MTHFR; 5mTHF inhibits GNMT and SHMT (Finkelstein, 2003;
Finkelstein and Martin, 1984; Finkelstein et al., 1972; Jencks and Matthews,
1987; Kluijtmans et al., 1996; Ou et al., 2007; Yamada et al., 2001; Yeo and
Wagner, 1992). Many reactions also depend strongly on the cellular status
for folate and vitamins B6 and B12. In addition, the velocities of many
reactions depend on the concentrations of the substrates that are controlled
by dietary inputs of glycine, serine, glutamate, cysteine and methionine.
These inputs naturally undergo enormous fluctuations so the system is often
far away from steady state (Nijhout et al., 2007b).
It is a significant challenge to understand the biological reasons for the
complicated interlocking cycles, the compartmentalization to the mitochon-
dria, and the multiple reactions by which one substrate can be transformed
into another. Since many parts of the network of FOCM share enzymes and
metabolites, there must be mechanisms that ensure that large variation in a
Mathematical Models of Folate-Mediated One-Carbon Metabolism 51
particular region of the network does not compromise the function in other
regions. Furthermore, the many critical reactions in the network must be
buffered against large and irregular hourly and daily fluctuations in inputs of
amino acids. The overall network is too complex to understand these
regulatory functions by inspection of the reaction diagram alone, or to
deduce the integration of its various functions with any degree of certainty.
The system is well-enough understood that it is possible to develop a
mathematical description of the kinetics of the various individual reactions,
and couple these together into a single mathematical simulation model that
can be used to explore questions about structure and function.
Over the past 5 years, we have developed mathematical models for the
pathways shown in Fig. 2.1, which represents mammalian hepatic one-
carbon metabolism. Hepatic FOCM is what we might call the complete
pathway, in that all known enzymes and reactions operate in the liver. This
is not true for most other tissues. While most FOCM enzymes are also
expressed in the kidney, most other tissues in the body express only a subset
of the enzymes and thus operate on what we might called reduced
FOCM. FOCM is an ancient pathway and we have recently developed
a model for the structure and kinetics of folate metabolism in bacteria
(Leduc et al., 2007 and Fig. 2.6).
A NADPH NADP+
DHFR
DHF THF
Serine
Methionine
Pyrimidine HCOOH
synthesis
dTMP T FTS
M FTD
Glycine SH Purine
CH:NHTHF AICART synthesis
TS
H2C=O AICAR
MS
NE
dUMP PGT 10f-THF
GAR
NADP+ NADPH
5,10-CH=THF MTCH
MTD
Hcy
5,10-CH2-THF 5 mTHF
MTHFR
NADPH NADP+
B NADPH NADP+
AICART DHFR
10-fDHF DHF THF
FDS Serine
Purine Methionine
AICART synthesis
Pyrimidine HCOOH AICAR
dTMP T H2C=O
synthesis M
Glycine SH
FTS PGT
TS
NE
GAR MS
dUMP 10f-THF
NADP+ NADPH
MTD
Hcy
5,10-CH2-THF 5 mTHF
MTHFR
NADPH NADP+
Figure 2.2 Diagrams of two early models of folate metabolism. A, the model of
Jackson (1980). This model also includes synthesis of nucleotides, RNA and DNA, as
well as the transport of folates and methotrexate into the cell, not shown in this
diagram. B, the model of Morrison and Allegra (1989). Full names of the acronyms
of enzymes and metabolites for this and other figures, and the text, are given in
Table 2.1. Redrawn from Jackson (1980) and Morrison and Allegra (1989).
they were generally able to simulate the correct pool sizes of several of the
metabolites, and the time course of inhibition of nucleotide synthesis rates
by treatment with antifolate cancer drugs.
B. Why modeling?
The traditional negative view of mathematical modeling is the following.
If the biology and biochemistry are well understood, then there is no reason
for models. On the other hand, if the biology or biochemistry is not well
understood then there is not enough information to make an accurate
model. Therefore, in either case, mathematical modeling is useless. And,
of course, this negative view is reinforced by poor modeling or modelers
who do not want deal with the full complexity of biological systems. In fact,
many biological systems are partly understood in the sense that there is
good information about many of the components of the systems but
incomplete information about how the components work together to
give rise to functional system properties. This is exactly the case with
FOCM where a great deal of information is available on individual reactions
but there is not much understanding of how the whole system works
together. It is in this intermediate partly understood situation that a
mathematical model can be a valuable, indeed necessary, investigative
tool. To illustrate this point, it is helpful to face how difficult it really is to
understand FOCM.
It is possible to understand a moderately sized traditional biochemical
reaction diagram by walking the diagram. If substrate A goes up then, since
A makes B, we expect B to go up and so forth. However, the existence of
allosteric interactions by which substrates in one part of the network activate
or inhibit enzymes in other parts makes this type of simple reasoning
impossible or at best inconclusive. For example, SAM activates the enzyme
CBS and inhibits the enzyme MTHFR. So, if we moderately increase the
methionine input to the system, will the homocysteine concentration go up
or down? Well, we would expect more mass in all the methionine cycle
metabolites, so [Hcy] should go up. On the other hand, when methionine
input goes up SAM rises appreciably and this will activate CBS, which will
draw down [Hcy]. But since SAM is up, it will inhibit MTHFR, which
will lower [5mTHF]. Since [5mTHF] is lower, the MS reaction will run
more slowly and thus [Hcy] is not used as rapidly and thus should go up. So
what will happen to [Hcy]? It is clear that no amount of verbal reasoning is
going to answer this question, especially since the reactions and the allosteric
interactions are nonlinear. One has to make calculations (and experiments)
about the relative strengths of the competing influences on [Hcy]. Two
other issues make the question even more daunting. First, the answer
may depend on the overall context of the rest of FOCM (see below).
Second, the allosteric activation of CBS and inhibition of MTHFR may
Mathematical Models of Folate-Mediated One-Carbon Metabolism 55
obscure the phenomenon that one wants to study. So, how large should a
model be? This is always a difficult question (though usually not admitted by
modelers), and every modeling attempt answers it explicitly by what is
included and what is excluded. Since our goal is not only to reproduce
experimental or clinical results but also to use the model to understand how
and why they arise, our philosophy is to start with smaller models and
expand to larger models when the smaller ones are well understood and the
expansion to more variables is necessary. Thus, as we outline below in
Section IV, we began with a model of methionine metabolism that had only
four variables (Reed et al., 2004). Then we made a model of the folate cycle
(Nijhout et al., 2004) so we could study the inhibition of DHFR by
methotrexate and the allosteric binding of folates to folate enzymes. Then
we made a larger model combining to two smaller ones so that we could
study the effects of the inhibition of MTHFR by SAM and the inhibition of
GNMT by 5mTHF (Nijhout et al., 2006). There has been a long discussion
in the literature or the role of the folate cycle in mitochondria (Appling,
1991; Christensen and MacKenzie, 2005) so to investigate these questions
we added compartmentation and the mitochondrial reactions (Nijhout
et al., 2007a). At each stage we had to make difficult (imperfect) decisions
about which variables and interactions to include in the models.
We note that this difficulty of knowing where to draw the boundaries is
also a difficulty for the interpretation of laboratory experiments or clinical
observations. In an experiment one changes the system by, say, knocking
out a gene or introducing a chemical that binds to a particular enzyme. One
then measures the changes in a few variables (the results of the experi-
ment) and then makes conclusions about how the system functions. Implic-
itly, one is assuming that everything else besides what one measures is the
same (or can be considered the same), that the knocked out gene did not
affect other genes or that the inhibitor has no other effects but the intended
one. The interpretation of the experiment typically involves implicitly
drawing the boundaries of a model (in the experimenters head) of
which variables are allowed to be included in the interpretation. Thus,
the interpretation of experimental results must always face and answer
(albeit implicitly) the same difficult question of boundaries faced explicitly
in modeling.
The next difficulty is deciding what level of detail to include for individ-
ual reactions in FOCM. An enormous amount of information is available
about enzymes, their genes and conformations and the way that they bind to
substrates. How much of this detail should be included? Our approach is to
use simple Michaelis-Menten kinetics and simple kinetic forms for activa-
tions and inhibitions unless we have good reason to believe that a more
detailed treatment is necessary for important biological functions of FOCM.
For example, we could have modeled the synthesis of SAM from methionine
in liver cells by a simple Michaelis-Menten formula. But we knew from the
Mathematical Models of Folate-Mediated One-Carbon Metabolism 57
Figure 2.3 Diagram of our model of the coupled hepatic folate and methionine cycles.
Not shown in this figure are all the allosteric interactions between metabolites and
various enzymes in the two cycles. Full names of the acronyms of enzymes and
metabolites for this and other figures, and the text, are given in Table 2.1. Redrawn
from Reed et al. (2006).
found that the choices of Vmax values are often constrained by the require-
ment that the model produce the right combination of known metabolite
concentrations, relative flux rates, half-lives, and time-dependent responses
to perturbations in the experimental literature.
When the kinetic mechanism of an enzyme is known we use the
conventional equations for the relevant uni- or bimolecular reaction as
described by Segel (1975). Allosteric activation or inhibition of enzymes
often does not admit to one of the conventional equations. In such cases, we
do a nonlinear regression on the published experimental data and use that as
the empirical equation. In these, as in all, cases, we ensure that the model
operates within the limits of the experimental data. Our models assume that
certain substrates (dUMP, GAR) and energetic metabolites (ATP, NADP,
and NADPH) are constant, so that their effect is absorbed by the Vmax for
the reaction.
At present the model does not contain terms for polyglutamation and
deglutamation. The model also does not contain a nuclear compartment,
although it is known that nuclear compartmentation is important (Appling,
1991; Woeller et al., 2007). We set the total folate level in the cell by
defining the overall size of the folate pool. If we start the simulation with all
folates in one form (e.g., THF or 5mTHF), the reaction kinetics rapidly
redistribute the folates, and the system comes to equilibrium for the differ-
ent folate species in 56 h. The half-life for folate in the body is about 90
days, and the mean residence time for folate is 124212 days (Gregory and
Quinlivan, 2002; Gregory et al., 1998), so for short-term studies like the
ones we do, the assumption of a constant intracellular folate pool seems
reasonable.
Mathematical Models of Folate-Mediated One-Carbon Metabolism 61
The model then, consists of a set of kinetic formulas, one for each
enzyme, that describe the velocity of the reaction as a function of the
concentrations of substrates, products and allosteric regulators, plus a set of
differential equations, one for each variable metabolite, that contain the
kinetic formulas for its synthesis and degradation. In addition, we have
transport functions for amino acids into and out of the cell, and or amino
acids and formate into and out of the mitochondria. The overall system is
solved by numerical integration using a stiff ode solver (because different
quantities tend to vary at very different rates), implemented in MatLab
(The MathWorks). The program allows us to vary inputs of amino acids
and vitamins over time and follow the time-dependent responses of all
metabolites and reaction rates. In addition, the model allows us to simulate
the effects of mutations and of vitamin deficiency (or excess). We have
modeled mutations primarily by altering the Vmax values of the relevant
enzymes. This would correspond to mutations that affect the amount of
active enzyme present (e.g., mutations that affect enzyme expression or
activation). Likewise, we model the effects of variation in non-folate vita-
min cofactors, such as B12 and B6, by altering the Vmax of the corresponding
enzyme(s), assuming in effect that the activity of the enzyme is a function of
the amount of cofactor available.
mechanism for stabilizing mass in the methionine cycle so that the flux out
of the methionine cycle via CBS matches the rate of methionine input into
the cycle without much change in the homocysteine concentration. If it
were not for the allosteric effect of SAM, the homocysteine concentration
would have to rise to drive the CBS reaction.
Our next step was to develop a model for the folate cycle that
contained what at the time we understood to be the important reactions
of that metabolic network (Nijhout et al., 2004). This model incorporated
the finding that folates bind to and inhibit many of the enzymes in the
folate cycle. This binding was believed to provide a reservoir of folates. The
model allowed us to resolve the puzzle as to why enzymes of the folate
cycle should be inhibited by allosteric binding of folates. The model shows
that this nonenzymatic binding greatly reduces the sensitivity of the system
to folate deficiency, because as the total pool of folate diminishes, more
enzyme is released from inhibition, and the reaction velocities are main-
tained because of the increased enzyme activity (Nijhout et al., 2004).
We next modeled the allosteric interactions between the folate and methi-
onine cycles (Fig. 2.11) in order to test the hypothesis of Wagner et al.
(1985) that these interactions serve to stabilize the DNA methylation
reaction rates (Nijhout et al., 2006). Some results of these experiments are
outlined in Section VII below. We subsequently merged our models for the
folate and methionine cycles (Fig. 2.3) to produce an integrated model of
one-carbon metabolism (Reed et al., 2006). This model also incorporated
allosteric interactions between the folate and methionine cycles (inhibition
of MTHFR by SAM and SAH, and inhibition of GNMT by 5mTHF) and
added the ability to vary the rate of input of betaine. We used this model to
simulate the interaction between folate deficiency and the MTHFR C677T
polymorphism and the interaction between folate and vitamin B12 deficien-
cies. Experimentation with this model showed that the inverse relationship
between folate status and homocysteine level is strongest at low folate levels
and disappears at high folate levels. Furthermore, the model shows that as
folate levels in the cell rise, the reactions of the folate cycle slow down. This
is due to the allosteric inhibition of enzymes in the folate cycle by folate
metabolites. This is a consequence of the homeostatic mechanism described
by Nijhout et al. (2004). This mechanism stabilizes the folate cycle at low
and intermediate folate levels, but also predicts that as folate levels rise, the
reaction rates in the folate cycle will slow down. Thus, a prediction of the
model is that a high intracellular folate level can have the same effect as a
folate deficiency. This prediction of the model is now supported by a variety
of clinical and experimental data that show that high doses of folate can have
detrimental effects (Akoglu et al., 2001; Czeizel, 2004; Morris et al., 2005;
Sunder-Plassman et al., 2000; Troen et al., 2006).
We then expanded the model of Reed et al. (2006) to include com-
partmentation of the folate cycle between cytosol and mitochondria
Glycine Serine Methionine
Gluconeogenesis
Metin
THF THF
DMG CO2 CO
2 AICART
Purine
HCOOH HCOOH
synthesis ATP
FTD FTD AICAR +
DMGD NADP
H2C=O
MAT-I
FTS FTS PGT
Sarc NE Methionine SAM
GAR DHFR
MAT-III
Sarc 10f-THF Ser Ser 10f-THF NADPH
DNA
H2C=O
SDH cSHMT Gly
mSHMT DMG
MTCH MTCH NE
Gly DHF GNMT DNMT
Gly Gly BHMT
MS
Gly 5,10-CH=THF 5,10-CH=THF Sarc
Betaine
Pyrimidine DNA-CH
GDC NADPH NADPH 3
synthesis Methylation
MTD MTD dTMP reactions
+
CO2 NADP+ NADP
TS
5,10-CH2-THF 5,10-CH2-THF
dUMP Homocysteine SAH
SAHH
Ser
NADPH H2O
CBS Adenosine
Mitochondria MTHFR 5 mTHF
Cystathionine
+
NADP
Cytosol
5 mTHF
Figure 2.4 Diagram of our model of hepatic FOCM including the mitochondrial compartmentation. Boxed substrates are variables in the
model. Substrates without boxes are constants. Full names of the acronyms of enzymes and metabolites for this and other figures, and the
text, are given in Table 2.1. Redrawn from Nijhout et al. (2007a).
64 H. F. Nijhout et al.
(Nijhout et al., 2007a). This model included terms for the glycine cleavage
system and the metabolism of sarcosine and dimethylglycine in the mito-
chondria, mechanisms for transport of serine and glycine into the cell and
between the cytosol and mitochondria, and terms for the transport of
formate between cytosol and mitochondria (Fig. 2.4). As discussed above,
we discovered that in rapidly dividing cells mitochondria act primarily to
supply formate to the cytosol for purine and pyrimidine synthesis, whereas
in adult cells the mitochondria export no formate but are excess producers
of serine, targeted for gluconeogenesis. We also found that the rate of export
of formate from the mitochondria to the cytosol is remarkably insensitive to
fluctuations in serine and glycine input. This is because both mitochondrial
and cytosolic SHMT reactions are reversible and the rates at which they run
are highly responsive to the relative concentrations of glycine and serine.
The model was used to investigate the effect of varying the relative inputs of
glycine and serine on the rate and direction of the mitochondrial and
cytosolic SHMT reactions, and showed that both SHMT reactions can
reverse and run in the serine synthesis direction when external glycine is
increased replicating the results of Kastanos et al. (1997). This model was
also used to successfully simulate the experiments of MacFarlane et al. (2005)
and Herbig et al. (2002) on the effect of SHMT expression and glycine
availability on SAM.
To investigate the characteristics of FOCM in nonhepatic tissues we
developed a model for epithelial FOCM, which is representative of most
tissues except liver and kidney. Extrahepatic tissues do not express all
enzymes of FOCM, and some enzymes are active at much lower levels
than in the liver (dashed arrows in Fig. 2.5). Epithelia thus run on a reduced
version of the network. This model also includes a term for export of
homocysteine, which is typically exported from extrahepatic tissues for
remethylation in the liver. With this model we have explored the interac-
tion of multiple genetic polymorphisms and the interaction of genetic
and environmental variation on the level of homocysteine, the rates of
methylation, and purine and pyrimidine synthesis (Ulrich et al., 2008).
We have also created a model (Fig. 2.1) that includes the synthesis of
reduced glutathione and exchange of substrates with the blood (Reed
et al., 2008).
FOCM is an ancient pathway and occurs, with variations, in animals,
plants, fungi, and bacteria. Recently, we have developed a model of bacte-
rial FOCM for Rhodobacter capsulatus (Leduc et al., 2007), motivated by the
discovery of a novel flavin-dependent thymidylate synthase (ThyX) that
produces THF rather than DHF upon methylation of dUMP (Fig. 2.6).
This model was used to examine the relative roles of ThyA (TS), ThyX, and
FolA (DHFR) in the mechanism of resistance to antifolates such as
trimethoprim.
Folate cycle Methionine cycle
METin
NADPH NADP+
ATP
DHFR
DHF THF
Serine MAT-II
Purine Methionine SAM
Pyrimidine synthesis
synthesis AICART
HCOOH DNA
T FTD AICAR
dTMP M H2C=O
SH
Glycine
FTS PGT
TS Methylation METH
NE
DNMT
GAR MS reactions
dUMP 10f-THF
Cystathionine
Figure 2.5 Diagram of our mode of epithelial FOCM. This model does not include mitochondrial compartmentation, but does include all
allosteric regulations (not shown in this diagram). Dashed arrows indicate enzymes of low activity in epithelial tissues. Full names of the
acronyms of enzymes and metabolites for this and other figures, and the text, are given in Table 2.1.
66 H. F. Nijhout et al.
Folate
Dihydropteroate
DHFR
FolA DHPR
DHFS
FolC
DHFR
FolA
DHF Pyrimidine THF
synthesis
dTMP Purine
AICART synthesis
Pyrimidine HCOOH PurH Methionine
synthesis ThyX
dTMP Serine AICAR
FTS
dUMP PurU
SHMT Glycine
TS
GlyA GDC PGT
ThyA
GCVT PurN MS
Glycine MetH
GAR
dUMP
Ammonia + CO2
5f-THF 10f-THF
SHMT
MTS
GlyA Hcy
5,10-CH2-THF 5 mTHF
MTHFR
MetF
Figure 2.6 Diagram of our model of bacterial folate metabolism. This mechanism can
synthesize thymidylate but bypass DHF. Redrawn from Leduc et al. (2007).
8000
vGSHout
[SAM] 7500
Concentrations and velocities 200 [cCys]
vCBS
[bCys]
7000
[GSH + GSSG] mM
[GSH + GSSG]
150 6500
6000
100
5500
5000
50
4500
0 4000
0 10 20 30 40 50
Time (h)
Silberberg and Dudman, 2001). In our models, the time required for differ-
ent components of the system to relax to equilibrium is in the order of hours
to days (Fig. 2.7). Given that variation in input into the system is in the order
of hours, it is unlikely that the system is ever at steady state and may actually
exist far from equilibrium most of the time (Nijhout et al., 2007b).
Thus, blood measurements represent some average of what is going on in
different cell types, and one would therefore expect a variable and context-
dependent correlation between blood components (particularly for meta-
bolites that are used in many processes) and the state of a given organ or
cellular metabolic system. Our current intracellular models accurately simu-
late intracellular responses to experimental or clinical intervention, and it is
obviously desirable for a model to also simulate how the levels of commonly
measured blood metabolites will respond. We are beginning to approach this
difficult question of whole body modeling of folate metabolism by allowing
our cytosolic models for hepatic and epithelial FOCM to communicate with
a blood compartment that is subject to dietary input and excretory output.
60
40
Thymidylate
Relative concentration or rate
0
[SAH] [Hcy]
20
C/C
40
C/T
60
T/T
80
T/T (low folate)
100
Figure 2.8 Simulated response of various biomarkers to the MTHFR 677CT polymor-
phism. Folate deficiency exacerbates the effect of the T/T genotype for most biomarkers,
but reverses the effect of the T/T genotype on purine and pyrimidine synthesis.
Figure 2.9 Bivariate graphs showing the interaction of various enzymes in FOCM on
selected traits (Z axes). X and Y axes show variation in the Vmax of the respective
enzymes. This variation could be due to allelic variation or, in the case of MS, to variation
in vitamin B12. The circle shows the location of the normal or wild-type phenotype.
A [Methionine]
160
[SAM]
140 100*[Hcy]
100
80
60
200
B
150
100
50
0
Reaction rates (mM/h)
50 mSHMT
cSHMT
CBS
100
C
200
150
TS
100 AICART
HCOOH/10
DNMT
50
0
0 5 10 15 20
Time (h)
and glycine are the primary methyl donors for FOCM, and methionine is
both a methyl donor and an essential amino acid linking the folate and
methionine cycles. An interesting question is whether and how the stability
of critical reactions in the cycle are maintained when there are large
localized changes in demand, or large localized changes in input.
Perhaps the best way to illustrate the relative stability of some reactions
in the face of variation in inputs is by simulating a day in the life of FOCM.
After each meal with protein, the human body experiences a pulse of amino
acids that lasts about 3 h. We simulated this by pulsing the four amino acids
that serve as inputs for the model (Fig. 2.10). It is evident from the
simulations shown in Fig. 2.10 that some variables change dramatically
with each meal, while others are almost unaffected. The TS and DHFR
reactions are quite stable as are the DNMT rate and the rate of export of
formate from the mitochondria. By contrast, the SHMT reactions fluctuate
greatly as do the concentrations of SAM and homocysteine.
As discussed above (Section III.D), the stability of formate export from
the mitochondria arises from the dynamical interplay between the mito-
chondrial and cytosolic SHMT reactions, whose magnitude and direction
vary with serine and glycine input. The fluctuations in SHMT velocity are a
dynamic homeostatic mechanism that dampens the effects of fluctuations in
glycine and serine input (Nijhout et al., 2007a).
The methylation of DNA is an important function of FOCM, and it seems
reasonable to stabilize these reactions against a variable and often unpredictable
input of methyl groups. Simulations with our models show that the DNMT
reaction is extraordinarily stable against variation in input, and that this stability
arises from two allosteric interactions between the folate cycle and the methi-
onine cycle: SAM inhibits MTHFR and 5mTHF inhibits GNMT (see
Fig. 2.11). Wagner et al. (1985), and Wagner (1995) suggested that the purpose
of these interactions might be to stabilize the rate of DNA methylation. The
general idea of how this mechanism works is easy to understand. If the
concentration of SAM goes up, then MTHFR is inhibited, which causes the
concentration of 5mTHF to fall. When 5mTHF is lower, the inhibition of
GNMT is released causing the rate of the GNMT reaction to go up, utilizing
the extra SAM and allowing the DNMT rate to remain stable. The reverse
scenario explains what happens if SAM goes down.
We experimented with the model shown in Fig. 2.11 by adding and
removing the long-range allosteric regulations in various combinations.
Figure 2.12 shows how the [SAM]/[SAH] ratio and the DNMT reaction
rate vary as a function of methionine input under two scenarios: with all
allosteric interaction present, and with all allosteric interactions absent. It is
clear that the allosteric interactions stabilize the SAM/SAH ratio and the
DNMT reaction rate against variation in methionine input, and that the
effect is most pronounced at low methionine input. This is because under an
optimal supply of methionine the DNMT reaction runs close to saturation,
Mathematical Models of Folate-Mediated One-Carbon Metabolism 73
METin ATP
MAT-I
THF Methionine SAM
MAT-III
NADPH
Sarcosine
MTHFR Betaine DNA-CH3
NADP+
Cystathionine
Figure 2.11 Model of the allosteric regulatory interactions within the methionine
cycle and between the folate and methionine cycles used to study the stability of the
DNMT reaction against fluctuations in methionine input. Thick lines show the alloste-
ric interactions of SAM and 5mTHF. Arrow indicates activation and bars indicate
inhibition. Redrawn from Nijhout et al. (2006).
A
160
140
Methylation rate (mM/h)
120
100
80
Regulated
60 Unregulated
40
B 20
0 20 40 60 80 100 120 140
Methionine input (mM/h)
20
Unregulated
15 Regulated
SAM/SAH ratio
10
0
0 20 40 60 80 100 120 140
Methionine input (mM/h)
Figure 2.12 Effect of allosteric regulation by SAM and 5mTHF on the response of
(A) the [SAM]/[SAH] ratio and (B) the DNMT reaction to variation in methionine
input. Solid line shows the response when all allosteric regulations are in place, and the
dotted line shows the response without allosteric regulation. Allosteric regulation
stabilizes both the [SAM]/[SAH] ration and DNMT reaction at low methionine
input, and thus may be an adaptation to protein starvation.
trap. The rate at which this DHF trap develops is determined by the rate of
the TS reaction. In a rapidly dividing cancer cell, where TS is highly up-
regulated, the DHF trap will develop rapidly, whereas in a non-cancerous,
non-dividing cell it will develop very slowly if at all.
FOCM, and it must be true of most if not all of metabolism. The key
regulatory features of metabolic systems are thus those that stabilize func-
tion, and those that prevent local perturbations from propagating through
the system. As is the case in FOCM, these regulatory mechanisms are not
the emergent properties of large networks, but are evolved adaptations for
specific functions.
IX. Conclusions
FOCM is one of the best studied metabolic systems: all or almost all
enzymes and metabolites in the system are known, as is the structure of
the reaction network. This network is complex and consists of several
intersecting cycles and a large number of complex allosteric regulatory
interactions between metabolites and enzymes. The reactions in this system
are nonlinear, which makes it exceptionally difficult to deduce the proper-
ties of the overall system, the way it is regulated, and the effects of mutations
and nutrient and vitamin deficiencies from the connectivity diagram alone.
The most direct way to understand the function of different parts of a
complex system like FOCM is through computer simulation with a mathe-
matical model. Because FOCM has been so well studied, it has been
possible to construct models that accurately simulate metabolite pools and
reaction velocities, as well as the effects of mutations and vitamin deficien-
cies on markers like homocysteine, TS and methylation capacities.
A mathematical model is an experimental tool that can be used as a
complement to laboratory experimentation or clinical investigation to do
pilot experiments and test hypotheses quickly and inexpensively. When a
new interaction is discovered, or suspected, it can be incorporated into a
preexisting model to determine its effect. We expect that our mathematical
models will evolve in three ways: first by progressive improvement of the
accuracy of the existing models by incorporating details like polyglutamation,
substrate channeling, and compartmentalization; second, by extending the
models to include other related aspects of metabolism, like insulin signaling;
third, by developing additional tissue-specific models, for instance, for the brain
and transport across the bloodbrain barrier, and by linking models for multiple
organ systems together through the circulatory system.
One important purpose of studying FOCM is to understand the rela-
tionship between genetic and environmental variables and disease out-
comes. There are two large steps necessary for this understanding. First,
one needs to understand how genetic and the environmental perturbations
affect the system behavior of FOCM. Second, one needs to understand how
the system changes in FOCM lead to the various disease states. Both are
very difficult questions. Most of our work outlined above has been
78 H. F. Nijhout et al.
ACKNOWLEDGMENTS
We thank Marian Neuhouser, Jess Gregory, Barry Shane, Jill James, and Jon Mattingly for
their advice during the development of the mathematical models of FOCM. This work was
supported by grant DMS-0616710 from the National Science Foundation, and grant RO1
CA 105437 from the National Institutes of Health.
REFERENCES
Akoglu, B., Faust, D., Milovic, V., and Stein, J. (2001). Folate and chemoprevention of
colorectal cancer: Is 5-methyltetrahydrofolate an active antiproliferative agent in folate-
treated colon-cancer cells? Nutrition 17, 652653.
Anderson, D. F., and Mattingly, J. C. (2008). Propagation of fluctuations in biochemical
systems, II: Nonlinear chains. IET Syst. Biol. 1, 313325.
Anderson, D. F., Mattingly, J. C., Nijhout, H. F., and Reed, M. C. (2007). Propagation of
fluctuations in biochemical systems, I: Linear SSC networks. Bull. Math. Biol. 69,
17911813.
Appling, D. (1991). Compartmentation of folate-mediated one-carbon metabolism in
eukaryotes. FASEB J. 5, 26452651.
Bianchi, G., Brizi, M., Rossi, B., Ronchi, M., Grossi, G., and Marchesini, G. (2000).
Synthesis of glutathione in response to methionine load in control subjects and in patients
with cirrhosis. Metabolism 49, 14341439.
Bjarnason, G. A., Jordan, R. C., Wood, P. A., Li, Q., Lincoln, D. W., Sothern, R. B.,
Hrushesky, W. J. M., and Ben-David, Y. (2001). Circadian expression of clock genes in
human oral mucosa and skin association with specific cell-cycle phases. Am. J. Pathol.
158, 17931801.
Christensen, K. E., and MacKenzie, R. E. (2005). Mitochondrial one-carbon metabolism is
adapted to the specific needs of yeast, plants and animals. Bioessays 28, 595605.
Clarke, S., and Banfield, K. (2001). S-Adenosylmethionine-dependent methyltransferases.
In Homocysteine in Health and Disease (R. Carmel and D. W. Jacobsen, eds.),
pp. 6378. Cambridge Univ. Press, Cambridge.
Cook, R. J. (2001). Folate metabolism. In Homocysteine in Health and Disease (R. Carmel
and D. W. Jacobsen, eds.), pp. 113134. Cambridge University Press, Cambridge.
Corrales, F. J., Perez-Mato, I., Sanchez del Pino, M. M., Ruiz, F., Castro, C., Garcia-
Trevijano, E. R., Latasa, U., Martinez-Chantar, M. L., Martinez-Cruz, A., Avila, M. A.,
and Mato, J. M. (2002). Regulation of mammalian liver methionine adenosyltransferase.
J. Nutr. 132, 2377S2381S.
Curtin, K., Bigler, J., Slattery, M. L., Caan, B., Potter, J. D., and Ulrich, C. M. (2004).
MTHFR C677T and A1298C polymorphisms: Diet, estrogen, and risk of colon cancer.
Cancer Epidemiol. Biomarkers. Prev. 13, 285292.
Mathematical Models of Folate-Mediated One-Carbon Metabolism 79
Czeizel, A. E. (2004). The primary prevention of birth defects: Multivitamins or folic acid?
Int. J. Med. Sci. 1, 5061.
Di Pietro, E., Wang, X. L., and MacKenzie, R. E. (2004). The expression of mitochondrial
methylenetetrahydrofolate dehydrogenase-cyclohydrolase supports a role in rapid cell
growth. Biochim. Biophys. Acta 1674, 7884.
Edelstein-Keshet, L. (1988). Mathematical Models in Biology. Random House, New York.
Elowitz, M. B., Levine, A. J., Siggia, E. D., and Swain, P. S. (2002). Stochastic gene
expression in a single cell. Science 297, 11831186.
Fell, D. A. (1992). Metabolic control analysis: A survey of its theoretical and experimental
background. Biochem. J. 286, 313330.
Finkelstein, J. (1990). Methionine metabolism in mammals. J. Nutr. Biochem. 1, 228237.
Finkelstein, J. (2001). Regulation of homocysteine metabolism. In Homocysteine in
Health and Disease (R. Carmel and D. W. Jacobsen, eds.), pp. 9299. Cambridge
Univ. Press, Cambridge.
Finkelstein, J. (2003). Methionine metabolism in liver disease. Am. J. Clin. Nutr. 77,
10941095.
Finkelstein, J., and Martin, J. (1984). Methionine metabolism in mammals: Distribution of
homocysteine between competing pathways. J. Biol. Chem. 259, 95089513.
Finkelstein, J., and Martin, J. (1986). Methionine metabolism in mammals: Adaptation to
methionine excess. J. Biol. Chem. 261, 15821587.
Finkelstein, J. D., Harris, B. J., and Kyle, W. E. (1972). Methionine metabolism in
mammals: Kinetic study of betaine:Homocysteine methyltransferase. Arch. Biochem.
Biophys. 153, 320324.
Finkelstein, J. D., Kyle, W. E., and Harris, B. J. (1974). Methionine metabolism in
mammals: Regulatory effects of S-adenosylmethionine. Arch. Biochem. Biophys. 165,
774779.
Finkelstein, J. D., Harris, B. J., and Martin, J. J. (1982). Methionine metabolism in mammals:
Concentrations of metabolites in rat tissues. Kinetic study of betaine:homocysteine
methyltransferase. J. Nutr. 112, 10111018.
Frosst, P., Blom, H. J., Milos, R., Goyette, P., Sheppard, C. A., Matthews, R. G.,
Boers, G. J. H., Den Heijer, M., Kluijtmans, L. A. J., Van den Heuvel, L. P., and
Rozen, R. (1995). A candidate genetic risk factor for vascular diseaseA common
mutation in methylenetetrahydrofolate reductase. Nat. Genet. 10, 111113.
Fukushima, M., Morita, M., Ikeda, K., and Nagayama, S. (2003). Population study of
expression of thymidylate synthase and dihydropyrimidine dehydrogenase in patients
with solid tumors. Int. J. Mol. Med. 12, 839844.
Gregory, J. F., and Quinlivan, E. P. (2002). In vivo kinetics of folate metabolism. Annu. Rev.
Nutr. 22, 199220.
Gregory, J. F., Williamson, J., Liao, J. -F., Bailey, L. B., and Toth, J. P. (1998). Kinetic
model of folate metabolism in nonpregnant women consuming [2H2] folic acid: Isotopic
labeling of urinary folate and the catabolite para-acetamidobenzoylglutamate indicates
slow, intake-dependent, turnover of folate pools. J. Nutr. 128, 18961906.
Hartl, D. L., Dijkhuizen, D. E., and Dean, A. M. (1985). Limits of adaptation: The evolution
of selective neutrality. Genetics 111, 655674.
Harvey, R. J., and Dev, I. K. (1975). Regulation in the folate pathway of Escherichia coli. Adv.
Enzyme. Regul. 13, 99124.
Herbig, K., Chiang, E.-P., Lee, L.-R., Hills, J., Shane, B., and Stover, P. J. (2002).
Cytoplasmic serine hydroxymethyltransferase mediates competition between folate-
dependent deoxyribonucleotide and S-adenosylmethionine biosynthesis. J. Biol. Chem.
277, 3838138389.
International HapMap Consortium (2007). A second generation human haplotype map of
over 3.1 million SNPs. Nature 449, 851862.
80 H. F. Nijhout et al.
Nijhout, H. F., Reed, M. C., Anderson, D. F., Mattingly, J. C., James, S. J., and
Ulrich, C. M. (2006). Long-range allosteric interactions between the folate and methio-
nine cycles stabilize DNA methylation reaction rate. Epigenetics 1, 8187.
Nijhout, H. F., Reed, M. C., Lam, S.-L., Shane, B., Gregory, J. F., and Ulrich, C. M.
(2007a). In silico experimentation with a model of hepatic mitochondrial folate metabo-
lism. Theor. Biol. Med. Model. 3, 40ff.
Nijhout, H. F., Reed, M. C., and Ulrich, C. M. (2007b). A day in the life of cell metabolism.
Biol. Theor. 2, 124127.
Obama, K., Kanai, M., Kawai, Y., Fukushima, M., and Takabayashi, A. (2002). Role of
retinoblastoma protein and E2F-1 transcription factor in the acquisition of 5-fluorouracil
resistance by colon cancer cells. Int. J. Oncol. 21, 309314.
Ou, X., Yang, H., Ramani, K., Ara, A. I., Chen, H., Mato, J. M., and Lu, S. C. (2007).
Inhibition of human betainehomocysteine methyltransferase expression by
S-adenosylmethionine and methylthioadenosine. Biochem. J. 401, 8796.
Peri, K. G., Belanger, C., and MacKenzie, R. E. (1989). Nucleotide sequence of the human
NAD-dependent methylenetetrahydrofolate dehydrogenase-cyclohydrolase. Nucleic
Acids Res. 17, 8853.
Pogribna, M., Melnyk, S., Pogrybny, I., Chango, A., Yi, P., and James, J. (2001). Homo-
cysteine metabolism in children with down syndrome: In vitro modulation. Am. J. Hum.
Genet. 69, 8895.
Prudova, A., Martinov, M. V., Vitvitsky, V. M., Ataullakhanov, F. I., and Banerjee, R.
(2005). Analysis of pathological defects in methionine metabolism using a simple mathe-
matical model. Biochim. Biophys. Acta 1741, 331338.
Reed, M. C., Nijhout, H. F., Sparks, R., and Ulrich, C. M. (2004). A mathematical model
of the methionine cycle. J. Theor. Biol. 226, 3343.
Reed, M. C., Nijhout, H. F., Neuhouser, M. L., Gregory, J. F., Shane, B., James, S. J.,
Boynton, A., and Ulrich, C. M. (2006). A mathematical model gives insights into
nutritional and genetic aspects of folate-mediated one-carbon metabolism. J. Nutr. 136,
26532661.
Reed, M. C., Thomas, R. L., Pavisic, J., James, S. J., Ulrich, C. M., and Nijhout, H. F.
(2008). A mathematical model of glutathione metabolism. Theoret. Biol. Math. Model.
(in press).
Rockman, M. V., and Wray, G. A. (2002). Abundant raw material for cis-regulatory
evolution in humans. Mol. Biol. Evol. 19, 19912004.
Rodriguez-Caso, C., Montanez, R., Cascante, M., Sanchez-Jimenez, F., and Medina, M. A.
(2006). Mathematical modeling of polyamine metabolism in mammals. J. Biol. Chem.
281, 2179921812.
Rosenblatt, D. (2001). Inborn errors of folate and cobalamin metabolism. In Homocysteine
in Health and Disease (R. Carmel and D. W. Jacobsen, eds.), pp. 244258. Cambridge
Univ. Press, Cambridge.
Segel, I. H. (1975). Enzyme Kinetics. John Wiley & Sons, New York.
Seither, R. L., Trent, D. F., Mikulecky, D. C., Rape, T. J., and Goldman, I. D. (1989).
Folate pool interconversions and inhibition of biosynthetic processes after exposure of
L1210 leukemia cells to antifolatesExperimental and network thermodynamic analyses
of the role of dihydrofolate polyglutamylates in antifolate action in cell. J. Biol. Chem.
264, 1701617023.
Shane, B. (1995). Folate chemistry and metabolism. In Folate in Health and Disease
(L. B. Bailey, ed.), pp. 122. Marcel Dekker, New York.
Sigal, A., Milo, R., Cohen, A., Naama, G. -Z., Klein, Y., Liron, Y., Rosenfeld, N.,
Danon, T., Perzov, N., and Alon, U. (2006). Variability and memory of protein levels
in human cells. Nature 444, 643646.
82 H. F. Nijhout et al.
Contents
I. Introduction 84
II. Folate Metabolism, the Transmethylation Pathway, and AD 85
III. The Transsulfuration PathwayHomocysteine Elimination and
Glutathione Metabolism 90
References 94
Abstract
Folate deficiency is associated with increase in homocysteine levels. Abnormal
plasma levels of that neurotoxic nonproteinogenic amino acid is implicated in
many pathological conditions including cardiovascular diseases, neural tube
defects, and is now recognized as a risk factor in Alzheimers disease (AD)
dementia. Homocysteine elimination is regulated by two metabolic pathways,
namely, the transmethylation and the transsulfuration pathways. Its elimi-
nation via these two metabolic pathways is modulated by folate, a member
of the B-vitamin family. Folate provides, via its metabolic end product
5-methyltetrahydrofolate, a methyl group that is used to reconvert homocyste-
ine back to methionine through the transmethylation pathway. The efficiency of
folate metabolism has an impact on the availability of S-adenosylmethionine,
a compound that is known to activate homocysteine flux through the transsul-
furation pathway and is necessary for utilization of a downstream antioxidant
called glutathione under the catalysis of glutathione S-transferase enzyme.
In this review, we will explore the impact of folate deprivation on the regulation
of the methionine cycle and exhaustively describe different biochemical reac-
tions that are implicated in the regulation of homocysteine elimination and that
folate deficiency influences in AD neuropathology. 2008 Elsevier Inc.
83
84 Flaubert Tchantchou and Thomas B. Shea
I. Introduction
Folate is a member of the B-vitamin family and a carrier of one-carbon
fragments, which it transfers to various biochemical targets. Folate is impor-
tant for the functioning of the central nervous system (CNS) at all ages
(Bottiglieri et al., 1995; Reynolds, 2002). Its metabolism provides a methyl
group, via its metabolite 5-methyltetrahydrofolate, which is necessary for
the remethylation of the neurotoxic amino acid homocysteine back to
methionine, an essential amino acid that plays a key role in the generation
of methyl groups required for numerous biochemical reactions. Substantial
scientific evidence associates folate deficiency to Alzheimers disease (AD).
The deficiency of this B vitamin induces homocysteine accumulation. This
sulfur-containing nonproteinogenic amino acid transitionally exists at the
intersection of the transmethylation and the transsulfuration pathways,
which regulate its elimination (Selhub, 1999).
Hyperhomocysteinemia is associated with an increased risk of several
pathological conditions including vascular diseases and vascular dementia
and has been confirmed in patients with AD and mild cognitive impairment
(MCI) where they represent an independent risk factor (Seshadri et al.,
2002; Shea and Rogers, 2002a). HCY levels in several biological fluids
and tissues represent a predictive index for the incidence of AD and other
dementias. Substantial evidence has established a connection between HCY
metabolism and cognitive function. Abnormal levels of HCY have been
related to multiple cognitive dysfunctions including age-related memory
loss, vascular dementia, and AD (Malaguarnera et al., 2004; OSuilleabhain
et al., 2004; Sachdev et al., 2003). Deficiencies in folic acid are often
observed in the elderly population with a resultant increase in HCY.
They are proposed to be owing to an increasing prevalence of atrophic
gastritis type B, which occurs with a frequency of up to 50% in elderly
subjects (Wolters et al., 2004). The link between increase in homocysteine
levels and AD resulted from the growing recognition that cerebrovascular
disease may promote AD. This idea was taken from studies of HCY and
heart disease research and is being extended to cerebral disorders. This
correlation lays on the fact that plasma HCY maybe directly toxic to
vascular endothelial cells or induces their dysfunction, leading to the loss
of the bloodbrain-barrier function and altered production of nitric oxide.
In addition, HCY crossing the bloodbrain barrier or being released by cells
within the brain could act as a potent neurotoxin (Miller, 1999).
Such neurotoxic effects may be due to the direct interaction of HCY
with plasma membrane components or to the intracellular accumulation
of S-adenosylhomocysteine (SAH). This latter metabolite inhibits the
methylation of catechol substrates resulting in the generation of oxyradicals
and other chemically reactive products that are cytotoxic. Moreover,
Folate Deprivation, the Methionine Cycle, and Alzheimers Disease 85
Dihydrofolate
NADPH + H+
Acetyl-CoA DR; Rx-2
NADP+
ATP
PPi + Pi THF
Methionine
Serine
MAT; Rx-6 HMT; Rx-3
Glycine
CH3-Ac SAM ChaT, Rx15
5,10-methylene THF
CH3- SAMT; Rx-7 Betaine MS/Vit B12; Rx-5
Cg L;
Cystathionine Cysteine
Rx-10
GS; Rx-11
a-KB
H2O2 2H2O
GPx; Rx-12
GsT(E); Rx-14
E+P GSH-E-CDNB GSH GS-SG
CDNB
GR; Rx-13
NADPH + H+
NADP+
(Chan et al., 2006). That observation underscores the importance of folate and
the principal methyl donor SAM in the regulation of acetylcholine levels,
which represents an important the rapeutic approach for age-related neurode-
generation such as AD.
Sherki et al., 2001; Shea et al., 2002). Deficiency in this gene was shown to
promote the increase of oxidative stress (Ramassamy et al., 1999). Moreover,
experimental elevations in glutathione in AD brain were capable of reducing
oxidative damage and therefore represented an attempt to compensate for
increased ROS induced by dietary and genetic deficiency (Huang et al., 2000).
Furthermore, this increase in GSH levels in the nervous system is triggered by
the upregulation of the transcription and activity profile of glutathione
synthase. Glutathione synthase gene and activity displayed differential
compensatory responses to dietary folate and apolipoprotein E deficiency.
A significant increase in transcription of GS is observed only in APOE/
mice and only when they were maintained on folate-deficient diet, suggesting
that the combined impact of diet-induced and genetically induced oxidative
stress is required to induce an increase in transcription. The magnitude of this
combined impact is reflected by a synergistic increase in thiobarbituric acid-
reactive substance levels in brain tissue of APOE/ mice maintained under
folate deficiency. Maintenance of normal mice on dietary folate deficiency also
induces a significant increase in the combined impact of the absence of APOE
and the dietary folate deficiency results in a dramatic increase in TBARs in
brain tissue (Shea and Rogers, 2002b), and further indicates a synergistic
deleterious impact of these dietary folate and genetic deficiencies. Therefore,
the increase in GS transcription and activity in APOE/ mice subjected to
oxidative stress inducing diet correlate with the synergistic increase in TBARs.
But, these increases in both activity and transcription of GS in the brain of
APOE/ mice maintained on folate-deficient diet are unable to compensate
fully for the synergistic increase in oxidative damage. This observation under-
scores the extent of oxidative damage that diet-induced and genetically
induced oxidative stress could cause to brain tissue (Tchantchou et al.,
2004a). These findings highlight the fact that distinct compensatory responses
in an antioxidant-generating enzyme can be invoked depending on the nature
and extent of oxidative stress. The combined efficacy of these responses was
reflected by steady-state levels of glutathione, in that both diet-induced and
genetically induced oxidative stress individually elevated glutathione levels,
whereas the combined impact of both induced an apparent additive increase
(Shea and Rogers, 2002b; Tchantchou et al., 2004a). The cumulative increase
of GSH levels in brain tissues under oxidative damage is suggestive of a possible
alteration of the activity of enzymes that help use glutathione to quench
reactive oxygen species and toxins that induce oxidative damage to the
brain. A recent clinical trial with a small number of cognitively impaired
patients demonstrated that the therapeutic combination of N-acetylcysteine
and B-vitamin supplements (folate and vitamin B12) improved cognitive
status of these hyperhomocysteinemic patients (McCaddon, 2006). In that
combinatorial therapy, which has homocysteine levels lowering properties,
NAC will increase the flow of homocysteine through the transsulfuration
Folate Deprivation, the Methionine Cycle, and Alzheimers Disease 93
pathway leading to an increase in GSH formation while folate and vitamin B12
will regulate homocysteine remethylation via the transmethylation pathway.
The use of N-acetylcysteine in this combinatorial therapy correlates with
previous findings demonstrating that the administration of N-acetylcysteine
to ApoE-deficient mice deprived of folate alleviated oxidative damage and
cognitive decline, and their restored glutathione synthase and GSH levels to
those of normal mice maintained in the presence of folate (Tchantchou et al.,
2005). The activity and the transcription profile of GSH peroxidase which
catalyzes the reaction in which GSH is used to eliminate hydrogen peroxide
and results in the formation of the oxidized form of glutathione (GSSG) and
that of GSH reductase, which catalyzes the reconversion of GSSG to GSH
are elevated in hippocampus and inferior parietal lobule of AD patients
(Aksenov et al., 1998; Lovell et al., 1998). This might reflect the protective
gene response to the increased peroxidation in the brain regions showing
severe AD pathology (Aksenov et al., 1998; Tchantchou et al., 2004a).
The levels of glutathione S-transferase, a protective enzyme against aldehydes
and especially 4-hydroxynonenal (HNE, a marker of lipid peroxidation) are
decreased in the brain and ventricular CSF of autopsied AD (Lovell et al.,
1998). APOE / mice maintained on folate-deficient diet demonstrate
similar increase in the activity of glutathione peroxidase and glutathione
reductase than that of APOE / mice on the complete diet. By contrast,
but consistent with observations made in AD patient brains, APOE / mice
display a significant decrease in glutathione S-transferase activity. The decrease
might be due to the methylation status of this enzyme. The similar increase in
GPx and GR activity, which contributes in recycling the oxidized glutathione
(GSSG) back to the reduced form (GSH), combined with the significant
decrease in GST activity constitutes a justification for the increase GSH levels
in mice brain under oxidative damage (Shea and Rogers, 2002b; Tchantchou
et al., 2004a). The supplementation of APOE / mice with a potent methyl
donor, S-adenosylmethionine, when maintained on folate-deficient diet,
restores GST, GPx, and GR activity (Tchantchou et al., 2006b). This high-
lights the importance of potent methyl donors in the regulation of enzymes
that catalyze reactions involving the utilization of glutathione.
Considering the direct correlation between folate deprivation and
increase homocysteine levels, which exerts its neurotocixity via several
frameworks that include its ability to trigger increase b-amyloid deposition,
free radical formation, or its direct interaction with the plasma membrane,
combinatorial therapeutic approaches (McCaddon, 2006; Tchantchou et al.,
2004b) aiming at preventing homocysteine accumulation while maintaining
a normal methylation status provide a real hope to the management of
AD onset and at least part of the diseases symptoms.
94 Flaubert Tchantchou and Thomas B. Shea
REFERENCES
Aksenov, M. Y., Tucker, H. M., Nair, P., Aksenova, M. V., Butterfield, D. A., Estus, S., and
Markesbery, W. R. (1998). The expression of key oxidative stress-handling genes in
different brain regions in Alzheimers disease. J. Mol. Neurosci. 11, 151164.
Al-Gazali, L. I., et al. (2001). Abnormal folate metabolism and genetic polymorphism of the
folate pathway in a child with Down syndrome and neural tube defect. Am. J. Med.
Genet. 103, 28132.
Anonymous, L. I. (1998). Homocysteine lowering trialists collaboration. Lowering blood
homocysteine with folic acid based supplements: Meta-analysis of randomised trials. BJM
316, 894898.
Bottiglieri, T., Crellin, R., and Reynolds, E. H. (1995). Folate and neuropsychiatry.
In Folate in Health and Disease (L. B. Bailey, ed.), pp. 435462. Marcel Dekker,
New York.
Bronstrup, A., Hages, M., Prinz-Langenohl, R., and Pietrzik, K. (1998). Effects of folic acid
and combinations of folic acid and vitamin B12 on plasma homocysteine concentrations
in healthy young women. Am. J. Clin. Nutr. 68, 11041110.
Brotto, L. D., and Yang, Q. (2000). 5,10-Methylenetetrahydrofolate reductase gene variants
and congenital anomalies: A HuGE review. Am. J. Epidemiol. 151, 862867.
Cantoni, G. L. (1986). The centrality of S-adenosylhomocysteine in the regulation of the
biological utilization of S-adenosylmethionine. In Biological Methylation and Drug
Design, Experimental and Clinical Roles of SAM (C. Borchardt and P. M. Ueland,
eds.), pp. 227237. Humana Press.
Ceballos-Picot, I., Witko-Sarsat, V., Merad-Boudia, M., Nguyen, A. T., Thevenin, M.,
Jaudon, M. C., Zingraff, J., Verger, C., Jungers, P., and Descamps-Latscha, B. (1996).
Glutathione antioxidant system as a marker of oxidative stress in chronic renal failure.
Free Radic. Biol. Med. 21(6), 845853.
Chan, A., Tchantchou, F., Graves, V., Rozen, R., and Shea, T. B. (2006). Dietary
and genetic compromise in folate availability reduces acetylcholine and cognitive
performance: Critical role of S-adenosyl methionine. J. Health Nutr. Aging (in press).
Chen, J., Kyte, C., Valcin, M., Chan, W., Wetmur, J. G., Selhub, J., Hunter, D. J., and
Jing, M. A. (2004). Polymorphisms in the one-carbon metabolic pathway, plasma folate
levels and colorectal cancer in a prospective study. Int. J. Cancer 110(4), 617620.
Devlin, A. M., Arning, E., Bottiglieri, T., Faraci, F. M., Rozen, R., and Lentz, S. R. (2004).
Effect of mthfr genotype on diet-induced hyperhomocysteinemia and vascular function
in mice. Blood 103, 26242629.
Farkas, E., Jong, G. I., Apro, E., De Vos, R. A., Steur, E. N., and Luiten, P. G. (2000).
Similar ultrastructural breakdown of cerebrocortical capillaries in Alzheimers disease,
Parkinsons disease, and experimental hypertension. What is the functional link? Ann.
N. Y. Acad. Sci. 903, 7282.
Fisher, M. C., Zeisel, S. H., Mei-Heng, M., and Sadler, T. W. (2002). Perturbations in
choline metabolism cause neural tube defects in mouse embryos in vitro. FASEB J. 16,
619621.
Fuso, A., Seminara, L., Cavallaro, R. A., DAnselmi, F., and Scarpa, S. (2005). S-adeno-
sylmethionine/homocysteine cycle alterations modify DNA methylation status with
consequent deregulation of PS1 and BACE and beta-amyloid production. Mol. Cell.
Neurosci. 28, 195204.
Gilgun-Sherki, Y., Melamed, E., and Offen, D. (2001). Oxidative stress induced-
neurodegenerative diseases: The need for antioxidants that penetrate the blood brain
barrier. Neuropharmacology 40(8), 959975.
Holcomb, L., Gordon, M. N., McGowan, E., Yu, X., Benkovic, S., Jantzen, P., Wright, K.,
Saad, I., Mueller, R., Morgan, D., Sanders, S., Zehr, C., et al. (1998). Accelerated
Folate Deprivation, the Methionine Cycle, and Alzheimers Disease 95
OSuilleabhain, P. E., Sung, V., Hernandez, C., Lacritz, L., Dewey, R. B., Jr.,
Bottiglieri, T., and Diaz-Arrastia, R. (2004). Elevated plasma homocysteine level in
patients with Parkinson disease: Motor, affective, and cognitive associations. Arch. Neurol.
61, 865868.
Pacheco-Quinto, J., Rodriguez de Turco, E. B., DeRosa, S., Howard, A., Cruz Sanchez, F.,
Sambamurti, K., Refolo, L., Petanceska, S., and Pappolla, M. A. (2006). Hyperhomo-
cysteinemic Alzheimers mouse model of amyloidosis shows increased brain amyloid b
peptide levels. Neurobiol. Dis. 22(3), 651656.
Parihar, M. S., and Hemnani, T. (2004). Alzheimers disease pathogenesis and therapeutic
interventions. J. Clin. Neurosci. 11, 456467.
Raber, J., Wong, D., Buttini, M., Orth, M., Bellosta, S., Pitas, R. E., Mahley, R. W., and
Mucke, L. (1998). Isoform-specific effects of human apolipoprotein E on brain function
revealed in ApoE knockout mice: Increased susceptibility of females. Neurobiol. Proc.
Natl. Acad. Sci. USA 95(18), 1091410919.
Ramassamy, C., Averill, D., Beffert, U., Bastianetto, S., Theroux, L., Lussier-Cacan, S.,
Cohn, J. S., Christen, Y., Davignon, J., Quirion, R., and Poirier, J. (1999). Oxidative
damage and protection by antioxidants in the frontal cortex of Alzheimers disease is
related to the apolipoprotein E genotype. Free Radic. Biol. Med. 27(56), 544553.
Reynolds, E. H. (2002). Benefits and risks of folic acid to the nervous system. J. Neurol.
Neurosurg. Psychiatr. 72, 567571.
Sachdev, P. S., Valenzuela, M. J., Brodaty, H., Wang, X. L., Looi, J., Lorentz, L.,
Howard, L., Jones, M., Zagami, A. S., Gillies, D., et al. (2003). Homocysteine as a risk
factor for cognitive impairment in stroke patients. Dement. Geriatr. Cogn. Disord. 15,
155162.
Scarpa, S., Fuso, A., DAnselmi, F., and Cavallaro, R. A. (2003). Presenilin 1 gene silencing
by S-adenosylmethionine. FEBS Lett. 541, 145148.
Schulz, J. B., Lindenau, J., Seyfried, J., and Dichgans, J. (2000). Glutathione, oxidative stress
and neurodegeneration. Eur. J. Biochem. 267, 49044911.
Selhub, J. (1999). Homocysteine metabolism. Annu. Rev. Nutr. 19, 217246.
Selhub, J., and Miller, J. W. (1992). The pathogenesis of homocysteinemia, interruption of
the coordinate regulation by S-adenosylmethionine of the remethylation and transsul-
furation of homocysteine. Am. J. Clin. Nutr. 55, 131138.
Seshadri, S., Beiser, A., Selhub, J., Jacques, P. F., Rosenberg, H., DAgostino, R. B.,
Wilson, P. W. F., and Wolf, P. A. (2002). Plasma homocysteine as a risk factor for
dementia and Alzheimers disease. N. Engl. J. Med. 346, 476483.
Shea, T. B., and Rogers, E. (2002a). Homocysteine as a risk factor for Alzheimers disease.
N. Engl. J. Med. 25, 2007.
Shea, T. B., and Rogers, E. (2002b). Folate quenches oxidative damage in brains of
apolipoprotein E-deficient mice: Augmentation by vitamin E. Mol. Brain Res. 108, 16.
Shea, T. B., Lyons-Wieler, J., and Rogers, E. (2001). Homocysteine, folate deprivation and
Alzheimer neuropathology. J. Alzheimers Dis. 3, 17.
Shea, T. B., Rogers, E., Ortiz, D., and Sheu, M.-S. (2002). Apolipoprotein E deficiency
promotes increased oxidative stress and compensatory increases in antioxidants in brain
tissue. Free Radic. Biol. Med. 33, 11151120.
Shields, D. C., et al. (1999). The thermolabile variant of methylenetetrahydrofolate
reductase and neural tube defects: An evaluation of genetic risk and the relative impor-
tance of the genotypes of the embryo and the mother. Am. J. Hum. Genet. 64,
10451055.
Storch, K. J., Wagner, D. A., Burke, J. F., and Young, V. R. (1988). Quantitative study
in vivo of methionine cycle in humans using [methyl-2h3]- and [1-13c]methionine.
Am. J. Physiol. 255, E322E331.
Folate Deprivation, the Methionine Cycle, and Alzheimers Disease 97
Tchantchou, F., Graves, M., Ashline, D., Moran, A., Pimenta, A., Ortiz, D., Rogers, E., and
Shea, T. B. (2004a). Increased transcription and activity of glutathione synthase in
response to deficiencies in folate, vitamin E and apolipoprotein E. J. Neurosci. Res. 75,
508515.
Tchantchou, F., Graves, M., Ortiz, D., Rogers, E., and Shea, T. B. (2004b). Dietary
supplementation with 3-deaza adenosine, N-acetyl cysteine, and S-adenosyl methionine
provide neuroprotection against multiple consequences of vitamin deficiency and oxida-
tive challenge: Relevance to age-related neurodegeneration. Neuromol. Med. 6(23),
93104.
Tchantchou, F., Graves, M., Rogers, E., Ortiz, D., and Shea, T. B. (2005). N-acetyl
cysteine alleviates oxidative damage to central nervous system of ApoE-deficient mice
following folate and vitamin E-deficiency. J. Alzheimers Dis. 7(2), 135138.
Tchantchou, F., Graves, M., Ortiz, D., Rogers, E., and Shea, T. B. (2006a). Expression and
activity of methionine cycle genes are altered following folate and vitamin E deficiency:
Differential compensatory responses of normal and apolipoprotein E-deficient mice.
Nutr. Neurosci. 9(12), 1724.
Tchantchou, F., Graves, M., Ortiz, D., Chan, D., Rogers, E., and Shea, T. B. (2006b).
S-adenosyl methionine: A connection between nutritional and genetic risk factors for
neurodegeneration in Alzheimers disease. J. Health Nutr. Aging (in press).
Ulrich, C. M., Robien, K., and Sparks, R. (2002). Pharmacogenetics and folate metabolism:
A promising direction. Pharmacogenomics 3(3), 299313.
Ureno, M., Haruhiko, S., Kenji, K., Masayuki, O., Ichiro, A., and Masanori, H. (2001).
Ultrastructural and permeability features of microvessels in the hippocampus, cerebellum
and pons of senescence-accelerated mice. Neurobiol. Aging 22, 469478.
Watanabe, M., Osada, J., Aratani, Y., Kluckman, K., Reddick, R., Malinow, M. R., and
Maeda, N. (1995). Mice deficient in cystathionine beta-synthase: Animal models for mild
and severe homocyst(e)inemia. Proc. Natl. Acad. Sci. USA 92(5), 15851589.
Wolters, M., Strohle, A., and Hahn, A. (2004). Cobalamin: A critical vitamin in the elderly.
Prev. Med. 39, 12561266.
C H A P T E R F O U R
Contents
I. Folate Metabolism 101
II. Pathological States Associated with Folate Deficiency or
Nutritional Folate Insufficiency 105
A. Folate deficiency, neural tube defects and congenital
heart defects 105
B. Folate deficiency, homocysteinemia, and atherosclerotic
cardiovascular disease 106
III. Molecular Mechanisms of Adaptation to Folate Deprivation 108
A. The role of folate-dependent enzymes in adaptation
to folate deficiency 108
B. Cellular retention of folates: The key role of polyglutamylation 110
C. Overexpression of folate influx systems 112
D. Downregulation of folate efflux systems 123
References 131
Abstract
Folic acid is an essential vitamin for a wide spectrum of biochemical reactions;
however, unlike bacteria and plants, mammals are devoid of folate biosynthesis
and thus must obtain this cofactor from exogenous sources. Therefore, folate
deficiency may impair the de novo biosynthesis of purines and thymidylate and
thereby disrupt DNA and RNA metabolism, homocysteine remethylation, methi-
onine biosynthesis, and subsequent formation of S-adenosylmethionine (the
universal methyl donor) which in turn may lead to altered methylation reac-
tions. This impaired folate-dependent intracellular metabolism can lead to
several key pathologies including, for example, megaloblastic anemia, homo-
cysteinemia, cardiovascular disease, embryonic defects, in particular neural
tube defects (NTDs), congenital heart defects, and possibly cancer. The current
review presents and evaluates the up-to-date knowledge regarding the
* The Fred Wyszkowski Cancer Research Laboratory, Department of Biology, Technion-Israel Institute of
Technology, Haifa 32000, Israel
{
To whom correspondence should be addressed; Email: assaraf@tx.technion.ac.il
99
100 Ilan Ifergan and Yehuda G. Assaraf
Abbreviations
I. Folate Metabolism
Folic acid, the oxidized form of vitamin B9, and its reduced derivative,
tetrahydrofolate (THF; Fig. 4.1), are water-soluble vitamins commonly
termed folates. The term folate stems from the Latin word folium which
means leaf; indeed, folates are present in substantial amounts in green leafy
vegetables. THF cofactors play an essential role as one-carbon donors and
acceptors in several crucial intracellular metabolic reactions. Folic acid is
composed of three covalently linked components: a pteridine ring, p-amino
benzoic acid (PABA) and a glutamate residue (Fig. 4.1). Mammals are able
to synthesize the pteridine ring. However, unlike bacteria and plants,
mammals are devoid of the enzymatic capacity of coupling pteridine to
PABA (Birn, 2006) and thus are absolutely dependent on folate uptake from
exogenous sources. These sources include intestinal uptake of folates bio-
synthesized by intestinal bacterial flora as well as dietary folate intake
particularly from green leafy vegetables, fruits, grain, yeast, liver, and dairy
products (Birn, 2006).
Biologically active folates exist predominantly in the reduced form (i.e.,
the two double bonds on the pteridine ring are enzymatically reduced),
thereby resulting in THF (Adams et al., 1970); Figs. 4.1 and 4.2). Inside the
cell, THF cofactors function as both acceptors and donors of one-carbon
102 Ilan Ifergan and Yehuda G. Assaraf
OH O COOH
5
4
3 N 6 CH2 NH C NH CH
N
CH2 Oxidized folate
H 2N 2 N N 7
1 8 Folic acid CH2
C OH
OH CH33
CH O COOH
N CH2 NH C NH CH
N
CH2 Reduced folate
H2N N N
5-CH3-THF CH2
H
C OH
OH CHO O COOH
N CH2 NH C NH CH
N
CH2 Reduced folate
H2N N N
5-CHO-THF CH2
H
(leucovorin) C OH
O COOH
OH CH22 N
CH C NH CH
N CH2 N C NH CH
N Antifolate
CH2
(DHFR inhibitor)
H2N N N
CH2
Methotrexate C OH
Figure 4.1 Chemical structures of oxidized and reduced folates as well as antifolates.
The one-carbon units donated during purine and thymidylate biosynthesis are
highlighted in gray.
Adaptation to Folate Deprivation 103
units. These one-carbon units are covalently linked to the THF cofactor
and exist as a wide range of oxidized and reduced forms of the one-carbon
moiety, including methyl, formyl and methylene derivatives (Figs. 4.1 and
4.2). The primary source of one-carbon units for mammalian folate metab-
olism is first donated from serine to the pteridine ring of THF thereby
resulting in the formation of glycine and 5,10-methylene-THF, respectively
(Fig. 4.2). The various THF cofactors include 5,10-methylene-THF,
10-formyl-THF, and 5-methyl-THF (the major folate form in the plasma)
serve as one-carbon donors in various biochemical reactions (Carmel et al.,
2003; Qureshi et al., 1994; Scott, 1999) as depicted in Fig. 4.2; specifically,
cytosolic methionine synthase transfers a methyl group from 5-methyl-THF
to homocysteine in a methyl-cobalamin-dependent reaction, thereby result-
ing in the formation of methionine (Fig. 4.2). The latter is further converted
to S-adenosylmethionine (SAM). In the methylation cycle which occurs in
all nucleated cells, SAM serves as the key methyl group donor of most
biological methylation reactions including that of CpG island DNA methyl-
ation that regulates gene expression (Kim, 2004, 2005), protein methylation
GARTF AICARTF
PRPP IMP
THF THF
5 -CHO-THF 10 -CHO-THF
AMP GMP
5-CH3-THF MTHFR 5,10-CH2-THF dUMP
Glycine
SHMT TS
Hcy
Folic
Met acid
SAM
CH3
Cytoplasm
X X
Figure 4.2 Simplified scheme of intracellular folate metabolism in mammalian cells
with emphasis on the de novo biosynthesis of purines and thymidylate. Abbreviations
of the enzymes and intermediate compounds that are involved in these pathways:
AICARTF, aminoimidazole carboxamide ribonucleotide transformylase; DHF, dihy-
drofolate; DHFR, dihydrofolate reductase; FPGS, folylpoly-g-glutamate synthetase;
GARTF, glycinamide ribonucleotide transformylase; GGH, g-glutamyl hydrolase;
Hcy, homocysteine; IMP, inosine monophosphate; Met, methionine; MS, methionine
synthase; MTHFR, methylene-tetrahydrofolate reductase; PRPP, Phosphoribosyl
pyrophosphate; SAM, S-adenosylmethionine; SHMT, serine hydroxymethyltransfer-
ase; THF, tetrahydrofolate; TS, thymidylate synthase.
104 Ilan Ifergan and Yehuda G. Assaraf
failure of neurulation, in which the neural folds do not fuse at the cranial
end of the developing embryo, and hence, these infants lack most or all of
the brain tissue. Infants with anencephaly are stillborn or die shortly after
birth. Spina bifida is a posterior NTD that is caused by the failure of the
neural tube to fuse at the caudal end. Consequently, infants with Spina
bifida can have an open lesion on their spine, where significant damage to
the nerves and spinal cord has occurred or the lesion can be closed. Infants
with spina bifida can survive but are at high risk of developing psychosocial
maladjustments. Maternal nutrition factors contribute significantly to the
various etiologies of NTDs. In a seminal study reported on 1976, Smithells
and colleagues (Smithells et al., 1976) discovered that the diets and postpar-
tum blood of women who had given birth to a fetus with an NTD were
deficient in several micronutrients, particularly folic acid. Over the past two
decades, it has been well established that women can reduce their risk of
having an NTD-affected pregnancy by as much as 5075% by taking folic
acid supplementation. Small nonrandomized studies in women who previ-
ously had NTD-affected pregnancies revealed that intake of folic acid supple-
ments during the periconceptional period resulted in a fourfold reduction in
the NTD recurrence risk (Laurence et al., 1981; Seller and Nevin, 1984;
Smithells et al., 1976, 1981, 1983; Vergel et al., 1990). Moreover, in a
thorough, double-blind, placebo-controlled, randomized trial performed by
the Medical Research Council in the UK it was confirmed that supplemen-
tation with a daily dose of 4 mg folic acid resulted in a beneficial effect of a
threefold reduction in the recurrence risk of NTDs (Group, 1991). However,
it is still unclear as to what are the molecular mechanisms by which folic acid
supplementation markedly decreases the risk of an infant being born with an
NTD or other congenital malformations. Moreover, it is completely unclear
why a significant fraction of women who do take folic acid supplementation
during the periconceptional period give birth to NTD-harboring infants.
disease and vascular thrombosis (Arnesen et al., 1995; Durand et al., 2001;
Graham et al., 1997; Rasouli et al., 2005; Ubbink et al., 1993). Data suggest
that folate deficiency was the most common vitamin deficiency in the United
States, thereby affecting 10% of the population; furthermore, more than 50%
of the children and elderly that live in poverty were folate deficient (Bailey et al.,
1982). These statistics of folate deficiency were found to be true also for other
non-Western countries including, for example, Thailand (Assantachai and
Lekhakula, 2007) and rural areas of India (Pathak et al., 2004). However,
since the mandated fortification of processed grains with folic acid in the United
States and Canada in 1998, the incidence of folate deficiency in most popula-
tions in these countries has dramatically declined ( Joelson et al., 2007).
Epidemiological evidence suggests that hyperhomocysteinemia is an
independent single risk factor for arterial thrombotic diseases such as acute
myocardial infarction, stroke, peripheral ischemic occlusive disorders as
well as venous thromboembolism (Arnesen et al., 1995; Durand et al.,
2001; Graham et al., 1997; Rasouli et al., 2005). In this respect, panoply
of epidemiological studies has accumulated over the past decade; these
studies establish a tight association between homocysteinemia and the
significantly increased risk of atherosclerotic cardiovascular disease. It has
been well established that folate deficiency results in elevated levels of
serum homocysteine (i.e., homocysteinemia). Hence, in folate-deficient
individuals, decreased levels of THF cofactors (e.g., 5-CH3-THF) limit
metabolic flux through the methionine synthase reaction, with conse-
quent accumulation of homocysteine, the substrate of this enzyme.
Importantly however, dietary folate supplementation can readily normalize
plasma homocysteine levels and may thereby reduce the risk of coronary
artery disease (Graham and OCallaghan, 2000). Studies with animal models
of atherosclerosis and thrombosis have provided evidence that even mod-
erate elevation of homocysteine levels can produce damage to vascular
endothelium and can enhance platelet aggregation (Sauls et al., 2004,
2007). These vasotoxic and other deleterious effects of homocysteine
are believed to result from the following characteristics (Ramakrishnan
et al., 2006):
(a) During the oxidation of excess homocysteine to homocystine and
disulphides, reactive oxygen species (ROS) which are potent oxidants
are generated in the blood which can cause severe endothelial injury.
For example, endothelial cell injury due to copper-catalyzed hydrogen
peroxide formation from cytseine has been demonstrated in vitro
(Starkebaum and Harlan, 1986).
(b) Homocysteine can directly interact in a thiolation reaction by binding
to thiol groups of proteins and thereby form disulphides which can
markedly alter the function of various proteins.
108 Ilan Ifergan and Yehuda G. Assaraf
OH CH3 O COOH
N CH2 NH C NH CH
N
CH2
H2N N N
CH2
H
C OH
Folate(glu1) Glutamate
+ O
ATP
FPGS GGH
ADP + Pi
CH3
OH O COOH
N CH2 NH C NH CH
N
CH2
H2N N N
CH2 COOH
H
C NH CH
Folate(glun)
O CH2
CH2
C OH
O
n
Figure 4.3 The reaction of folate polyglutamylation by FPGS and hydrolysis of folate
polyglutamates by GGH. Note that various reduced folate derivatives undergo these
reactions including 5-methyl-THF as depicted in this scheme.
(neutral pH)
Reduced Folate
folates (mM)
(i.e., 5-CH3-THF )
Figure 4.4 Putative transport pathways of folates from the intestinal lumen through
the blood into the cerebrospinal fluid and the brain.
Reduced
folate Folic acid 5-CH3-THF
PCFT FRa
DHFR
GGH
(AFD)
ATP ADP + Pi
Cytoplasm
MRP1,5
BCRP
Figure 4.5 Proposed model for major adaptive responses to folate deficiency. Note
that upward arrows denote upregulation whereas downward arrows denote down-
regulation of the relevant components activity. AFD-Absolute folate deficiency.
below entitled Knockout mice lacking the folic acid-binding protein Folbp1,
currently termed Folr1, the murine homologue of the human FRa). In contrast
to the severe morphogenetic abnormalities of FRa knockout embryos
that die in utero, FRb knockout mouse embryos have been shown to
develop normally (Piedrahita et al., 1999).
Cerebral folate deficiency syndrome and auto-antibodies against folate receptors:
Cerebral folate deficiency (CFD) is defined as any neuropsychiatric syn-
drome associated with low levels of 5-CH3-THF in the cerebrospinal fluid
(CSF) (the active THF cofactor in the blood and CSF) in the presence of
normal folate metabolism outside the CNS, as evidenced by normal folate
levels in serum and erythrocytes, normal hematological values and normal
homocysteine levels. Infantile-onset CFD is a neurological syndrome that
presents 4 to 6 months after birth; the primary manifestations of this type
of CFD are significant irritability, slow head growth, cerebellar ataxia,
psychomotor retardation, pyramidal tract signs in the legs, dyskinesias, and
sometimes seizures (Ramaekers and Blau, 2004; Ramaekers et al., 2002).
Later in infancy, central visual disturbances may become apparent thereby
leading to blindness. Despite these numerous and severe clinical manifesta-
tions, the sole biochemical anomaly consistently identifiable in these CFD
patients is low levels of 5-CH3-THF in the CSF. Maintenance of normal
folate levels in the CSF is primarily attributable to the transport activity of
high affinity FRs that are anchored to the plasma membrane of various
epithelial and mesenchymal cells via a GPI moiety (Fig. 4.4). Membrane-
associated FRa is expressed at substantial levels in the basolateral surface of
the choroid plexus epithelium (Fig. 4.4). 5-CH3-THF binds to FRa with a
very high affinity (KD 0.1 nM) and is then internalized into choroid
epithelial cells via receptor-mediated endocytosis (Fig. 4.4). As discussed
above, reduced folate transport from the plasma into the CSF is apparently a
concentrative process as the ratio of 5-CH3-THF levels in the CSF versus
the plasma is 3:1 (Spector, 1989; Weitman et al., 1992). Following endocy-
tosis and dissociation of 5-CH3-THF from FRa in the cytosol, a fraction of
the endocytotic membrane-bound FRa recycles back to the basolateral cell
surface of the choroid plexus epithelium (Holm et al., 1991); whereas,
another fraction of FRa is sorted out to the apical surface of the choroid,
where it is cleaved from its GPI anchor. Hence, receptor molecules are
released into the CSF while retaining their functional capacity to bind
5-CH3-THF. Then, at the apical surface of the choroid, folate efflux into
the CSF is believed to occur via the bidirectional anion exchanger RFC that
displays a folate transport Km at the micromolar range, consistently reflect-
ing the intracellular concentration of reduced folate cofactors (Assaraf et al.,
2006) (Fig. 4.4). Once in the spinal fluid, 5-CH3-THF is transported into
neuronal tissues via the RFC. Taken together, the above physiological
characteristics clearly establish the central role that FRa plays in the
Adaptation to Folate Deprivation 117
were largely homozygous and were spread out throughout the entire coding
region. Introduction of these mutations into a PCFT expression vector and
their stable transfection into a HeLa subline that is doubly deficient in both
PCFT as well as RFC transport activities allowed for the assessment of the
impact of these congenital PCFT mutations on folate transport at acidic pH.
A complete loss of folic acid transport was observed in four of the five HFM
families; this loss of folate transport was due to decreased transporter stability
and/or plasma membrane trafficking defects inflicted by the amino acid
substitutions in highly conserved transporter regions. Whereas, a few
mutant PCFT transporters retained some residual folate transport activity
at low pH. Moreover, folate transport at acidic pH was markedly impaired
in immortalized lymphocytes from HFM patients. Taken together, these
pioneering studies establish the key role that inactivating PCFT mutations
play in the pathogenesis of HFM. Moreover, it is imperative that these
molecular studies will facilitate the rapid diagnosis and treatment of this
disorder in infants as well as the prenatal identification of families harboring
the mutant PCFT gene and thereby offer proper genetic counseling.
(Backus et al., 2000). Consistent with the efficient folate influx ability of
the RFC, a two- to sevenfold increased transport activity of RFC in
LF-adapted cell lines was observed when compared to their folate-
replete counterparts. Hence, the increased activity of RFC appears to
serve as an important adaptive response to folate deficiency. The
importance of RFC transport activity in folate deplete growth condi-
tions should be studied in regards to the mechanism underlying upre-
gulation or downregulation of this folate transporter gene. Whereas
several transcript variants of the human RFC (regulated by several
promoters) have been identified, promoter B (pB) of the human
RFC was found to drive the expression of one variant which serves
as the major form of the intestinal human RFC (Gong et al., 1999;
Nguyen et al., 1997; Sirotnak and Tolner, 1999; Williams and Flintoff,
1998; Zhang et al., 1998). A recent study aimed at identifying the
minimal promoter region required for basal transcriptional activity of
this promoter undertook a deletion construct analysis of the human
RFC pB and determined their transcriptional activity in colon cancer-
derived Caco-2 cell transfectants (Subramanian et al., 2003). The mini-
mal region required for basal activity of human RFC pB in Caco-2 cells
was identified as a sequence between nucleotides 1088 and 1043.
Moreover, a sequence between nucleotides 141 and 2016 (i.e.,
outside the minimal region of the pB) was found to be responsive to
folate deficiency in Caco-2 cells; this promoter region led to a signifi-
cant and specific upregulation in folate uptake under conditions of
folate deficiency. This upregulation was associated with a parallel
increase in human RFC mRNA and protein levels as well as in the
transcriptional activity of human RFC pB. The identification of puta-
tive folate responsive elements in the human RFC pB may pave the
way for detailed studies aimed at pinpointing the exact role that
transcriptional upregulation of the human RFC plays in adaptation to
cellular conditions of folate deficiency.
(c) As with enhanced RFC transport activity, increased FR levels should
also play a contributing role in the adaptation to folate deficiency
(Fig. 4.5). This is particularly true as FRs mediate the unidirectional
influx of folates and are devoid of the folate efflux component displayed
by the RFC. Consistent with this presumption, it has been recently
shown that introduction of an FRa cDNA into cells that normally lack
receptor expression induced higher proliferation rates and increased
cellular survival under conditions of folate deprivation relative to their
parental counterparts (Antony, 1996). Indeed, a 5.5-fold increased
density of FRs was documented in human tumor xenografts implanted
in folate-deprived mice (Mendelsohn et al., 1996). Interestingly, the
increased density of FRs was associated with a modest reduction in
the affinity of this receptor to folic acid in four out of five tumors,
122 Ilan Ifergan and Yehuda G. Assaraf
(MDR) phenotype upon cancer cells (Szakacs et al., 2006). This transport
activity is clearly exemplified by several MDR transporters including Pgp,
MRP1 (ABCC1), or BCRP (ABCG2/MXR/ABCP), each of which has
been already shown to mediate MDR in cancer cells. The identified genetic
variations of several ABC transporters (Fromm, 2002) may alter the
response to drug treatment. Several members of the ABC superfamily play
a key role in preventing the intestinal absorption of toxic compounds,
including many drugs and food components. Moreover, these transporters
play a key role in a second defense line by protecting vital organs in the body
including the brain, CSF, testis, as well as protecting the fetus against various
highly toxic xenobiotics. Consistent with this protective role of ABC
transporters, knockout mouse models of ABC transporter genes (e.g.,
ABCB1) resulted in an altered (i.e., decreased) bloodbrain barrier function
(Schinkel et al., 1997), intestinal drug absorption ( Jonker et al., 2002;
Sparreboom et al., 1997), fetal drug exposure (Smit et al., 1999), and
drug-induced damage to testicular tubules (Wijnholds et al., 2000). Addi-
tional physiological roles of several ABC transporters include the excretion
of endogenous metabolites from mammalian secretory epithelia, even
against a steep concentration gradient (Borst and Elferink, 2002). Accord-
ingly, ABC transporters play a key physiological role in liver excretion of
bile salts (transported by BSEP, the bile salt export pump, ABCB11),
phosphatidylcholine (MDR3 P-glycoprotein, ABCB4), bilirubin glucuro-
nides (MRP2, ABCC2), and various hydrophobic cytotoxic drugs (MDR1
P-glycoprotein, ABCB1) (Borst and Elferink, 2002). Moreover, ABC
transporters are capable of mediating hydrophobic peptide export such as
gramicidin D or cyclosporin A (transported by ABCB1) (Borgnia et al.,
1996; Sarkadi et al., 1994), peptides for antigen presentation (transported by
heterodimeric ABC transporters TAP1 and TAP2) (Schmitt and Tampe,
2000), and mitochondrial peptides (transported by ABC transporter related
to TAP) (Young et al., 2001). Nuclear receptors play a key role in the
transcriptional regulation of many mammalian ABC transporters; this is
clearly the case for MDR1 and MRP2 (Borst and Elferink, 2002).
riboflavin (vitamin B2) into milk, thereby supplying the suckling infants and
young with this important micronutrient (van Herwaarden et al., 2007).
REFERENCES
Abdel Nour, A. M., Ringot, D., Gueant, J. L., and Chango, A. (2007). Folate receptor and
human reduced folate carrier expression in HepG2 cell line exposed to fumonisin B1 and
folate deficiency. Carcinogenesis 28, 22912297.
Abdul-Ghani, R., Serra, V., Gyorffy, B., Jurchott, K., Solf, A., Dietel, M., and Schafer, R.
(2006). The PI3K inhibitor LY294002 blocks drug export from resistant colon carcinoma
cells overexpressing MRP1. Oncogene 25(12), 17431752.
132 Ilan Ifergan and Yehuda G. Assaraf
Adams, J. F., Tankel, H. I., and MacEwan, F. (1970). Estimation of the total body vitamin
B12 in the live subject. Clin. Sci. 39(1), 107113.
Allegra, C. J., Chabner, B. A., Drake, J. C., Lutz, R., Rodbard, D., and Jolivet, J. (1985).
Enhanced inhibition of thymidylate synthase by methotrexate polyglutamates. J. Biol.
Chem. 260(17), 97209726.
Allegra, C. J., Hoang, K., Yeh, G. C., Drake, J. C., and Baram, J. (1987). Evidence for direct
inhibition of de novo purine synthesis in human MCF-7 breast cells as a principal mode of
metabolic inhibition by methotrexate. J. Biol. Chem. 262(28), 1352013526.
Alperin, J. B., and Haggard, M. E. (1970). Cerebrospinal fluid folate (CFA) and the blood-
brain barrier. Clin. Res. 40, 1823.
Antony, A. C. (1992). The biological chemistry of folate receptors. Blood 79(11),
28072820.
Antony, A. C. (1996). Folate receptors. Annu. Rev. Nutr. 16, 501521.
Arnesen, E., Refsum, H., Bonaa, K. H., Ueland, P. M., Forde, O. H., and Nordrehaug, J. E.
(1995). Serum total homocysteine and coronary heart disease. Int. J. Epidemiol. 24(4),
704709.
Assantachai, P., and Lekhakula, S. (2007). Epidemiological survey of vitamin deficiencies in
older Thai adults: implications for national policy planning. Public Health Nutr. 10(1),
6570.
Assaraf, Y. G. (2006). The role of multidrug resistance efflux transporters in antifolate
resistance and folate homeostasis. Drug Resist. Updat. 9(4-5), 227246.
Assaraf, Y. G. (2007). Molecular basis of antifolate resistance. Cancer Metastasis. Rev. 26(1),
153181.
Assaraf, Y. G., Babani, S., and Goldman, I. D. (1998). Increased activity of a novel low pH
folate transporter associated with lipophilic antifolate resistance in chinese hamster ovary
cells. J. Biol. Chem. 273(14), 81068111.
Assaraf, Y. G., and Goldman, I. D. (1997). Loss of folic acid exporter function with markedly
augmented folate accumulation in lipophilic antifolate-resistant mammalian cells. J. Biol.
Chem. 272(28), 1746017466.
Assaraf, Y. G., Ifergan, I., Kadry, W. N., and Pinter, R. Y. (2006). Computer modelling of
antifolate inhibition of folate metabolism using hybrid functional petri nets. J. Theor. Biol.
240(4), 637647.
Assaraf, Y. G., Rothem, L., Hooijberg, J. H., Stark, M., Ifergan, I., Kathmann, I.,
Dijkmans, B. A., Peters, G. J., and Jansen, G. (2003). Loss of multidrug resistance protein
1 expression and folate efflux activity results in a highly concentrative folate transport in
human leukemia cells. J. Biol. Chem. 278(9), 66806686.
Assaraf, Y. G., and Slotky, J. I. (1993). Characterization of a lipophilic antifolate resistance
provoked by treatment of mammalian cells with the antiparasitic agent pyrimethamine.
J. Biol. Chem. 268(6), 45564566.
B., S. (1995). Folate chemistry and metabolism. In Folate in health and disease.
(L. B. Bailey, ed.), pp. 122. New York, Marcel Dekker.
Backus, H. H., Pinedo, H. M., Wouters, D., Padron, J. M., Molders, N., van Der
Wilt, C. L., van Groeningen, C. J., Jansen, G., and Peters, G. J. (2000). Folate depletion
increases sensitivity of solid tumor cell lines to 5-fluorouracil and antifolates. Int. J. Cancer
87(6), 771778.
Bailey-Dell, K. J., Hassel, B., Doyle, L. A., and Ross, D. D. (2001). Promoter characteriza-
tion and genomic organization of the human breast cancer resistance protein (ATP-
binding cassette transporter G2) gene. Biochim. Biophys. Acta 1520(3), 234241.
Bailey, L. B., Wagner, P. A., Christakis, G. J., Davis, C. G., Appledorf, H., Araujo, P. E.,
Dorsey, E., and Dinning, J. S. (1982). Folacin and iron status and hematological findings
in black and Spanish-American adolescents from urban low-income households.
Am. J. Clin. Nutr. 35(5), 10231032.
Adaptation to Folate Deprivation 133
da Costa, M., Rothenberg, S. P., Sadasivan, E., Regec, A., and Qian, L. (2000). Folate
deficiency reduces the GPI-anchored folate-binding protein in rat renal tubules. Am. J.
Physiol. Cell Physiol. 278(4), C812C821.
da Costa, M., Sequeira, J. M., Rothenberg, S. P., and Weedon, J. (2003). Antibodies to
folate receptors impair embryogenesis and fetal development in the rat. Birth Defects Res.
A Clin. Mol. Teratol. 67(10), 837847.
Dean, M. (2002). The human ATP-binding cassette (ABC) transporter superfamily NCBI
Monographs. National Library of Medicine, Bethesda, MD, USA.
Dean, M., and Allikmets, R. (2001). Complete characterization of the human ABC gene
family. J. Bioenerg. Biomembr. 33(6), 475479.
Deeley, R. G., Westlake, C., and Cole, S. P. (2006). Transmembrane transport of endo- and
xenobiotics by mammalian ATP-binding cassette multidrug resistance proteins. Physiol.
Rev. 86(3), 849899.
Dembo M, S. F. (1984). Membrane transport of folate compounds in mammalian cells.
Dembo M, S. F. (1984). Membrane transport of folate compounds in mammalian cells.
Folate Antagonists as Therapeutic Agents. Vol. 1. New York, Academic.
Doyle, L. A., Yang, W., Abruzzo, L. V., Krogmann, T., Gao, Y., Rishi, A. K., and
Ross, D. D. (1998). A multidrug resistance transporter from human MCF-7 breast cancer
cells. Proc. Natl. Acad. Sci. USA 95(26), 1566515670.
Drori, S., Sprecher, H., Shemer, G., Jansen, G., Goldman, I. D., and Assaraf, Y. G. (2000).
Characterization of a human alternatively spliced truncated reduced folate carrier increas-
ing folate accumulation in parental leukemia cells. Eur. J. Biochem. 267(3), 690702.
Durand, P., Prost, M., Loreau, N., Lussier-Cacan, S., and Blache, D. (2001). Impaired
homocysteine metabolism and atherothrombotic disease. Lab. Invest. 81(5), 645672.
Ee, P. L., Kamalakaran, S., Tonetti, D., He, X., Ross, D. D., and Beck, W. T. (2004).
Identification of a novel estrogen response element in the breast cancer resistance protein
(ABCG2) gene. Cancer Res. 64(4), 12471251.
Elnakat, H., and Ratnam, M. (2004). Distribution, functionality and gene regulation of folate
receptor isoforms: Implications in targeted therapy. Adv. Drug. Deliv. Rev. 56(8), 10671084.
Elnakat, H., and Ratnam, M. (2006). Role of folate receptor genes in reproduction and
related cancers. Front Biosci. 11, 506519.
Elwood, P. C. (1989). Molecular cloning and characterization of the human folate-binding
protein cDNA from placenta and malignant tissue culture (KB) cells. J. Biol. Chem. 264
(25), 1489314901.
Fei, Y. J., Kanai, Y., Nussberger, S., Ganapathy, V., Leibach, F. H., Romero, M. F.,
Singh, S. K., Boron, W. F., and Hediger, M. A. (1994). Expression cloning of a
mammalian proton-coupled oligopeptide transporter. Nature 368(6471), 563566.
Ferguson, P. L., and Flintoff, W. F. (1999). Topological and functional analysis of the human
reduced folate carrier by hemagglutinin epitope insertion. J. Biol. Chem. 274(23),
1626916278.
Fromm, M. F. (2002). The influence of MDR1 polymorphisms on P-glycoprotein expres-
sion and function in humans. Adv. Drug. Deliv. Rev. 54(10), 129512310.
Gatenby, R. A., and Gillies, R. J. (2004). Why do cancers have high aerobic glycolysis?
Nat. Rev. Cancer 4(11), 891899.
Gates, S. B., Mendelsohn, L. G., Shackelford, K. A., Habeck, L. L., Kursar, J. D.,
Gossett, L. S., Worzalla, J. F., Shih, C., and Grindey, G. B. (1996). Characterization of
folate receptor from normal and neoplastic murine tissue: Influence of dietary folate on
folate receptor expression. Clin. Cancer Res. 2(7), 11351141.
Geller, J., Kronn, D., Jayabose, S., and Sandoval, C. (2002). Hereditary folate malabsorption:
Family report and review of the literature. Medicine (Baltimore) 81(1), 5168.
Goldman, I. D. (1971). The characteristics of the membrane transport of amethopterin and
the naturally occurring folates. Ann. NY Acad. Sci. 186, 400422.
Adaptation to Folate Deprivation 135
Goldman, I. D., and Matherly, L. H. (1986). The cellular pharmacology of methotrexate Int.
Encyl. Pharmacol. Ther., Vol. 118. Oxford/NewYork, Pergamon. pp 283302.
Gong, M., Cowan, K. H., Gudas, J., and Moscow, J. A. (1999). Isolation and characteriza-
tion of genomic sequences involved in the regulation of the human reduced folate carrier
gene (RFC1). Gene. 233(1-2), 2131.
Gottesman, M. M., Fojo, T., and Bates, S. E. (2002). Multidrug resistance in cancer: Role of
ATP-dependent transporters. Nat. Rev. Cancer 2(1), 4858.
Graham, I. M., Daly, L. E., Refsum, H. M., Robinson, K., Brattstrom, L. E., Ueland, P. M.,
Palma-Reis, R. J., Boers, G. H. J., Sheahan, R. G., Israelsson, B., Uiterwaal, C. S.,
Meleady, R., et al. (1997). Plasma homocysteine as a risk factor for vascular disease. The
European Concerted Action Project. JAMA 277, 17751781.
Graham, I. M., and OCallaghan, P. (2000). The role of folic acid in the prevention of
cardiovascular disease. Curr. Opin. Lipidol. 11(6), 577587.
Group, V. S. R. (1991). Prevention of neural tube defects: results of the Medical Research
Council Vitamin Study. MRC Lancet Jul 20; 338(8760), 131137.
Gunshin, H., Mackenzie, B., Berger, U. V., Gunshin, Y., Romero, M. F., Boron, W. F.,
Nussberger, S., Gollan, J. L., and Hediger, M. A. (1997). Cloning and characterization of
a mammalian proton-coupled metal-ion transporter. Nature 388(6641), 482488.
Hafkemeyer, P., Dey, S., Ambudkar, S. V., Hrycyna, C. A., Pastan, I., and
Gottesman, M. M. (1998). Contribution to substrate specificity and transport of non-
conserved residues in transmembrane domain 12 of human P-glycoprotein. Biochemistry
37(46), 1640016409.
Hayashi, I., Sohn, K. J., Stempak, J. M., Croxford, R., and Kim, Y. I. (2007). Folate
deficiency induces cell-specific changes in the steady-state transcript levels of genes
involved in folate metabolism and 1-carbon transfer reactions in human colonic epithelial
cells. J. Nutr. 137(3), 607613.
Holm, J., Hansen, S. I., Hoier-Madsen, M., and Bostad, L. (1991). High-affinity folate
binding in human choroid plexus. Characterization of radioligand binding, immunore-
activity, molecular heterogeneity and hydrophobic domain of the binding protein.
Biochem. J. 280(Pt 1), 267271.
Hooijberg, J. H., Broxterman, H. J., Kool, M., Assaraf, Y. G., Peters, G. J., Noordhuis, P.,
Scheper, R. J., Borst, P., Pinedo, H. M., and Jansen, G. (1999). Antifolate resistance
mediated by the multidrug resistance proteins MRP1 and MRP2. Cancer Res. 59(11),
25322535.
Hooijberg, J. H., Jansen, G., Assaraf, Y. G., Kathmann, I., Pieters, R., Laan, A. C.,
Veerman, A. J., Kaspers, G. J., and Peters, G. J. (2004). Folate concentration dependent
transport activity of the Multidrug Resistance Protein 1 (ABCC1). Biochem. Pharmacol. 67
(8), 15411548.
Hooijberg, J. H., Peters, G. J., Assaraf, Y. G., Kathmann, I., Priest, D. G., Bunni, M. A.,
Veerman, A. J., Scheffer, G. L., Kaspers, G. J., and Jansen, G. (2003). The role of
multidrug resistance proteins MRP1, MRP2 and MRP3 in cellular folate homeostasis.
Biochem. Pharmacol. 65(5), 765771.
Hopper, E., Belinsky, M. G., Zeng, H., Tosolini, A., Testa, J. R., and Kruh, G. D. (2001).
Analysis of the structure and expression pattern of MRP7 (ABCC10), a new member of
the MRP subfamily. Cancer Lett. 162(2), 181191.
Horns, R. C., Jr, Dower, W. J., and Schimke, R. T. (1984). Gene amplification in a
leukemic patient treated with methotrexate. J. Clin. Oncol. 2(1), 27.
Ifergan, I., Jansen, G., and Assaraf, Y. G. (2005). Cytoplasmic confinement of breast cancer
resistance protein (BCRP/ABCG2) as a novel mechanism of adaptation to short-term
folate deprivation. Mol. Pharmacol. 67(4), 13491359.
136 Ilan Ifergan and Yehuda G. Assaraf
Ifergan, I., Shafran, A., Jansen, G., Hooijberg, J. H., Scheffer, G. L., and Assaraf, Y. G.
(2004). Folate deprivation results in the loss of breast cancer resistance protein (BCRP/
ABCG2) expression. A role for BCRP in cellular folate homeostasis. J. Biol. Chem.
279(24), 2552725534.
Ishikawa, T. (1992). The ATP-dependent glutathione S-conjugate export pump. Trends
Biochem. Sci. 17(11), 463468.
Jackson, R. C., and Harrap, K. R. (1973). Studies with a mathematical model of folate
metabolism. Arch. Biochem. Biophys. 158(2), 827841.
James, S. J., Basnakian, A. G., and Miller, B. J. (1994). In vitro folate deficiency induces
deoxynucleotide pool imbalance, apoptosis, and mutagenesis in Chinese hamster ovary
cells. Cancer Res. 54(19), 50755080.
Jansen, G., Westerhof, G. R., Jarmuszewski, M. J., Kathmann, I., Rijksen, G., and
Schornagel, J. H. (1990). Methotrexate transport in variant human CCRF-CEM leuke-
mia cells with elevated levels of the reduced folate carrier. Selective effect on carrier-
mediated transport of physiological concentrations of reduced folates. J. Biol. Chem.
265(30), 1827218277.
Joelson, D. W., Fiebig, E. W., and Wu, A. H. (2007). Diminished need for folate
measurements among indigent populations in the post folic acid supplementation era.
Arch. Pathol. Lab. Med. 131(3), 477480.
Jonker, J. W., Buitelaar, M., Wagenaar, E., Van Der Valk, M. A., Scheffer, G. L.,
Scheper, R. J., Plosch, T., Kuipers, F., Elferink, R. P., Rosing, H., Beijnen, J. H., and
Schinkel, A. H. (2002). The breast cancer resistance protein protects against a major
chlorophyll-derived dietary phototoxin and protoporphyria. Proc. Natl. Acad. Sci. USA
99(24), 1564915654.
Jonker, J. W., Merino, G., Musters, S., van Herwaarden, A. E., Bolscher, E., Wagenaar, E.,
Mesman, E., Dale, T. C., and Schinkel, A. H. (2005). The breast cancer resistance
protein BCRP (ABCG2) concentrates drugs and carcinogenic xenotoxins into milk.
Nat. Med. 11(2), 127129.
Jukes, T. H. (1987). Searching for magic bullets: early approaches to chemotherapy-anti-
folates, methotrexatethe Bruce F. Cain memorial award lecture. Cancer Res. 47(21),
55285536.
Kane, M. A., Elwood, P. C., Portillo, R. M., Antony, A. C., Najfeld, V., Finley, A.,
Waxman, S., and Kolhouse, J. F. (1988). Influence on immunoreactive folate-binding
proteins of extracellular folate concentration in cultured human cells. J. Clin. Invest.
81(5), 13981406.
Keppler, D., Leier, I., and Jedlitschky, G. (1997). Transport of glutathione conjugates and
glucuronides by the multidrug resistance proteins MRP1 and MRP2. Biol. Chem. 378(8),
787791.
Kim, Y. I. (2004). Folate and DNA methylation: a mechanistic link between folate
deficiency and colorectal cancer? Cancer Epidemiol. Biomarkers Prev. 13(4), 511519.
Kim, Y. I. (2005). Nutritional epigenetics: Impact of folate deficiency on DNA methylation
and colon cancer susceptibility. J. Nutr. 135(11), 27032709.
Konig, P., Giraldo, R., Chapman, L., and Rhodes, D. (1996). The crystal structure of the
DNA-binding domain of yeast RAP1 in complex with telomeric DNA. Cell 85(1),
125136.
Krishnamurthy, P., and Schuetz, J. D. (2006). Role of ABCG2/BCRP in biology and
medicine. Annu. Rev. Pharmacol. Toxicol. 46, 381410.
Kruh, G. D., and Belinsky, M. G. (2003). The MRP family of drug efflux pumps. Oncogene
22(47), 75377552.
Kusuhara, H., Han, Y. H., Shimoda, M., Kokue, E., Suzuki, H., and Sugiyama, Y. (1998).
Reduced folate derivatives are endogenous substrates for cMOAT in rats. Am J. Physiol
275(4 Pt 1), G789G796.
Adaptation to Folate Deprivation 137
Lacey, S. W., Sanders, J. M., Rothberg, K. G., Anderson, R. G., and Kamen, B. A. (1989).
Complementary DNA for the folate binding protein correctly predicts anchoring to the
membrane by glycosyl-phosphatidylinositol. J. Clin. Invest. 84(2), 715720.
Lamers, Y., Prinz-Langenohl, R., Bramswig, S., and Pietrzik, K. (2006). Red blood cell folate
concentrations increase more after supplementation with [6S]-5-methyltetrahydrofolate
than with folic acid in women of childbearing age. Am. J. Clin. Nutr. 84(1), 156161.
Laurence, K. M., James, N., Miller, M. H., Tennant, G. B., and Campbell, H. (1981).
Double-blind randomised controlled trial of folate treatment before conception to prevent
recurrence of neural-tube defects. Br. Med. J. (Clin. Res. Ed.) 282(6275), 15091511.
Lee, H. C., Shoda, R., Krall, J. A., Foster, J. D., Selhub, J., and Rosenberry, T. L. (1992).
Folate binding protein from kidney brush border membranes contains components
characteristic of a glycoinositol phospholipid anchor. Biochemistry 31(12), 32363243.
Liani, E., Rothem, L., Bunni, M. A., Smith, C. A., Jansen, G., and Assaraf, Y. G. (2003).
Loss of folylpoly-gamma-glutamate synthetase activity is a dominant mechanism of
resistance to polyglutamylation-dependent novel antifolates in multiple human leukemia
sublines. Int. J. Cancer 103(5), 587599.
Lin, B. F., Huang, R. F., and Shane, B. (1993). Regulation of folate and one-carbon
metabolism in mammalian cells. III. Role of mitochondrial folylpoly-gamma-glutamate
synthetase. J. Biol. Chem. 268(29), 2167421679.
Liu, X. Y., and Matherly, L. H. (2002). Analysis of membrane topology of the human
reduced folate carrier protein by hemagglutinin epitope insertion and scanning glycosyl-
ation insertion mutagenesis. Biochim. Biophys. Acta 1564(2), 333342.
Loo, T. W., and Clarke, D. M. (1994). Mutations to amino acids located in predicted
transmembrane segment 6 (TM6) modulate the activity and substrate specificity of
human P-glycoprotein. Biochemistry 33(47), 1404914057.
Lubhy, A. L., Eagle, F. J., Roth, E., and Cooperman, J. M. (1961). Relapsing megaloblastic
anemia in an infant due to a specific defect in gastrointestinal absorption of folic acid.
Am. J. Dis. Child 102, 482483.
Ma, L., Krishnamachary, N., and Center, M. S. (1995). Phosphorylation of the multidrug
resistance associated protein gene encoded protein P190. Biochemistry 34(10), 33383343.
Maliepaard, M., van Gastelen, M. A., Tohgo, A., Hausheer, F. H., van Waardenburg, R. C.,
de Jong, L. A., Pluim, D., Beijnen, J. H., and Schellens, J. H. (2001). Circumvention of
breast cancer resistance protein (BCRP)-mediated resistance to camptothecins in vitro using
non-substrate drugs or the BCRP inhibitor GF120918. Clin. Cancer Res. 7(4), 935941.
Mason, J. B., and Rosenberg, I. H. (1994). Intestinal absorption of folate. In Physiology
of the Gastrointestinal Tract (L. R. Johnson, ed.), pp. 19791995. Raven Press,
New York.
Matherly, L. H., and Goldman, D. I. (2003). Membrane transport of folates. Vitam. Horm.
66, 403456.
McEwan, G. T., Lucas, M. L., Denvir, M., Raj, M., McColl, K. E., Russell, R. I., and
Mathan, V. I. (1990). A combined TDDA-PVC pH and reference electrode for use in
the upper small intestine. J. Med. Eng. Technol. 14(1), 1620.
McGuire, J. J., Russell, C. A., and Balinska, M. (2000). Human cytosolic and mitochondrial
folylpolyglutamate synthetase are electrophoretically distinct. Expression in antifolate-
sensitive and -resistant human cell lines. J. Biol. Chem. 275(17), 1301213016.
McHugh, M., and Cheng, Y. C. (1979). Demonstration of a high affinity folate binder in
human cell membranes and its characterization in cultured human KB cells. J. Biol. Chem.
254(22), 1131211318.
Melnyk, S., Pogribna, M., Miller, B. J., Basnakian, A. G., Pogribny, I. P., and James, S. J.
(1999). Uracil misincorporation, DNA strand breaks, and gene amplification are asso-
ciated with tumorigenic cell transformation in folate deficient/repleted Chinese hamster
ovary cells. Cancer Lett. 146(1), 3544.
138 Ilan Ifergan and Yehuda G. Assaraf
Miyake, K., Mickley, L., Litman, T., Zhan, Z., Robey, R., Cristensen, B., Brangi, M.,
Greenberger, L., Dean, M., Fojo, T., and Bates, S. E. (1999). Molecular cloning of
cDNAs which are highly overexpressed in mitoxantrone-resistant cells: Demonstration
of homology to ABC transport genes. Cancer Res. 59(1), 813.
Mogi, M., Yang, J., Lambert, J. F., Colvin, G. A., Shiojima, I., Skurk, C., Summer, R.,
Fine, A., Quesenberry, P. J., and Walsh, K. (2003). Akt signaling regulates side popula-
tion cell phenotype via Bcrp1 translocation. J. Biol. Chem. 278(40), 3906839075.
Morgillo, F., and Lee, H. Y. (2005). Resistance to epidermal growth factor receptor-targeted
therapy. Drug Resist. Updat. 8(5), 298310.
Nguyen, T. T., Dyer, D. L., Dunning, D. D., Rubin, S. A., Grant, K. E., and Said, H. M.
(1997). Human intestinal folate transport: Cloning, expression, and distribution of
complementary RNA. Gastroenterology 112(3), 783791.
Nozawa, T., Imai, K., Nezu, J., Tsuji, A., and Tamai, I. (2004). Functional characterization
of pH-sensitive organic anion transporting polypeptide OATP-B in human. J. Pharmacol
Exp. Ther. 308(2), 438445.
Ozaki, Y., King, R. W., and Carey, P. R. (1981). Methotrexate and folate binding to
dihydrofolate reductase. Separate characterization of the pteridine and p-aminobenzoyl
binding sites by resonance Raman spectroscopy. Biochemistry 20(11), 32193225.
Ozvegy, C., Litman, T., Szakacs, G., Nagy, Z., Bates, S., Varadi, A., and Sarkadi, B. (2001).
Functional characterization of the human multidrug transporter, ABCG2, expressed in
insect cells. Biochem. Biophys. Res. Commun. 285(1), 111117.
Pathak, P., Kapil, U., Kapoor, S. K., Saxena, R., Kumar, A., Gupta, N., Dwivedi, S. N.,
Singh, R., and Singh, P. (2004). Prevalence of multiple micronutrient deficiencies
amongst pregnant women in a rural area of Haryana. Indian J. Pediatr. 71(11), 10071014.
Paulusma, C. C., Bosma, P. J., Zaman, G. J., Bakker, C. T., Otter, M., Scheffer, G. L.,
Scheper, R. J., Borst, P., and Oude Elferink, R. P. (1996). Congenital jaundice in rats
with a mutation in a multidrug resistance-associated protein gene. Science 271(5252),
11261128.
Piedrahita, J. A., Oetama, B., Bennett, G. D., van Waes, J., Kamen, B. A., Richardson, J.,
Lacey, S. W., Anderson, R. G., and Finnell, R. H. (1999). Mice lacking the folic acid-
binding protein Folbp1 are defective in early embryonic development. Nat. Genet. 23(2),
228232.
Polgar, O., Ozvegy-Laczka, C., Robey, R. W., Morisaki, K., Okada, M., Tamaki, A.,
Koblos, G., Elkind, N. B., Ward, Y., Dean, M., Sarkadi, B., and Bates, S. E. (2006).
Mutational studies of G553 in TM5 of ABCG2: A residue potentially involved in
dimerization. Biochemistry 45(16), 52515260.
Polgar, O., Robey, R. W., Morisaki, K., Dean, M., Michejda, C., Sauna, Z. E.,
Ambudkar, S. V., Tarasova, N., and Bates, S. E. (2004). Mutational analysis of
ABCG2: role of the GXXXG motif. Biochemistry 43(29), 94489456.
Poncz, M., and Cohen, A. (1996). Long-term treatment of congenital folate malabsorption.
J. Pediatr. 129(6), 948.
Qiu, A., Jansen, M., Sakaris, A., Min, S. H., Chattopadhyay, S., Tsai, E., Sandoval, C.,
Zhao, R., Akabas, M. H., and Goldman, I. D. (2006). Identification of an intestinal folate
transporter and the molecular basis for hereditary folate malabsorption. Cell 127(5), 917928.
Qureshi, A. A., Rosenblatt, D. S., and Cooper, B. A. (1994). Inherited disorders of
cobalamin metabolism. Crit. Rev. Oncol. Hematol. 17(2), 133151.
Ramaekers, V. T., and Blau, N. (2004). Cerebral folate deficiency. Dev. Med. Child. Neurol.
46(12), 843851.
Ramaekers, V. T., Hausler, M., Opladen, T., Heimann, G., and Blau, N. (2002). Psycho-
motor retardation, spastic paraplegia, cerebellar ataxia and dyskinesia associated with low
5-methyltetrahydrofolate in cerebrospinal fluid: A novel neurometabolic condition
responding to folinic acid substitution. Neuropediatrics 33(6), 301308.
Adaptation to Folate Deprivation 139
Ramaekers, V. T., Rothenberg, S. P., Sequeira, J. M., Opladen, T., Blau, N.,
Quadros, E. V., and Selhub, J. (2005). Autoantibodies to folate receptors in the cerebral
folate deficiency syndrome. N. Engl. J. Med. 352(19), 19851991.
Ramakrishnan, S., Sulochana, K. N., Lakshmi, S., Selvi, R., and Angayarkanni, N. (2006).
Biochemistry of homocysteine in health and diseases. Indian J. Biochem. Biophys. 43(5),
275283.
Rasouli, M. L., Nasir, K., Blumenthal, R. S., Park, R., Aziz, D. C., and Budoff, M. J.
(2005). Plasma homocysteine predicts progression of atherosclerosis. Atherosclerosis
181(1), 159165.
Ratnam, M., and Freisheim, J. H. (1992). Proteins involved in the transport of folates and
antifolates by normal and neoplastic cells. In Folic Acid Metabolism in Health and
Disease (M. F. Picciano, E. L. R. Stokstad, and J. F. Gregory, eds.), pp. 91120. Wiley-
Liss, Inc, New York.
Ratnam, M., Marquardt, H., Duhring, J. L., and Freisheim, J. H. (1989). Homologous
membrane folate binding proteins in human placenta: Cloning and sequence of a cDNA.
Biochemistry 28(20), 82498254.
Richards, R. G., Brown, O. E., Gillison, M. L., and Sedwick, W. D. (1986). Drug
concentration-dependent DNA lesions are induced by the lipid-soluble antifolate, piri-
trexim (BW301U). Mol. Pharmacol. 30(6), 651658.
Rothem, L., Ifergan, I., Kaufman, Y., Priest, D. G., Jansen, G., and Assaraf, Y. G. (2002).
Resistance to multiple novel antifolates is mediated via defective drug transport resulting
from clustered mutations in the reduced folate carrier gene in human leukaemia cell lines.
Biochem. J. 367(Pt 3), 741750.
Rothenberg, S. P., da Costa, M. P., Sequeira, J. M., Cracco, J., Roberts, J. L., Weedon, J.,
and Quadros, E. V. (2004). Autoantibodies against folate receptors in women with a
pregnancy complicated by a neural-tube defect. N. Engl. J. Med. 350(2), 134142.
Rubin, R. C., Henderson, E. S., Owens, E. S., and Rall, D. P. (1967). Uptake of
methotrexate-3H by rabbit kidney slices. Cancer Res. 27(3), 553557.
Sadasivan, E., and Rothenberg, S. P. (1989). The complete amino acid sequence of a human
folate binding protein from KB cells determined from the cDNA. J. Biol. Chem. 264(10),
58065811.
Saier, M. H., Jr, Beatty, J. T., Goffeau, A., Harley, K. T., Heijne, W. H., Huang, S. C.,
Jack, D. L., Jahn, P. S., Lew, K., Liu, J., Pao, S. S., Paulsen, I. T., et al. (1999). The major
facilitator superfamily. J. Mol. Microbiol. Biotechnol. 1(2), 257279.
Sarkadi, B., Muller, M., Homolya, L., Hollo, Z., Seprodi, J., Germann, U. A.,
Gottesman, M. M., Price, E. M., and Boucher, R. C. (1994). Interaction of bioactive
hydrophobic peptides with the human multidrug transporter. Faseb. J. 8(10), 766770.
Sauls, D. L., Arnold, E. K., Bell, C. W., Allen, J. C., and Hoffman, M. (2007). Pro-
thrombotic and pro-oxidant effects of diet-induced hyperhomocysteinemia. Thromb.
Res. 120(1), 117126.
Sauls, D. L., Boyd, L. C., Allen, J. C., and Hoffman, M. (2004). Differences in the metabolic
response to exogenous homocysteine in juvenile and adult rabbits. J. Nutr. Biochem. 15
(2), 96102.
Sauls, D. L., Lockhart, E., Warren, M. E., Lenkowski, A., Wilhelm, S. E., and Hoffman, M.
(2006). Modification of fibrinogen by homocysteine thiolactone increases resistance to
fibrinolysis: A potential mechanism of the thrombotic tendency in hyperhomocysteine-
mia. Biochemistry 45(8), 24802487.
Schimke, R. T. (1984). Gene amplification in cultured animal cells. Cell 37(3), 705713.
Schinkel, A. H., Mayer, U., Wagenaar, E., Mol, C. A., van Deemter, L., Smit, J. J., van der
Valk, M. A., Voordouw, A. C., Spits, H., van Tellingen, O., Zijlmans, J. M., Fibbe, W. E.,
et al. (1997). Normal viability and altered pharmacokinetics in mice lacking mdr1-type
(drug-transporting) P-glycoproteins. Proc. Natl. Acad. Sci. USA 94(8), 40284033.
140 Ilan Ifergan and Yehuda G. Assaraf
Schmitt, L., and Tampe, R. (2000). Affinity, specificity, diversity: A challenge for the ABC
transporter TAP in cellular immunity. Chembiochem. 1(1), 1635.
Scott, J. M. (1999). Folate and vitamin B12. Proc. Nutr. Soc. 58(2), 441448.
Seither, R. L., Trent, D. F., Mikulecky, D. C., Rape, T. J., and Goldman, I. D. (1989).
Folate-pool interconversions and inhibition of biosynthetic processes after exposure of
L1210 leukemia cells to antifolates. Experimental and network thermodynamic analyses
of the role of dihydrofolate polyglutamylates in antifolate action in cells. J. Biol. Chem.
264(29), 1701617023.
Selhub, J., Dhar, G. J., and Rosenberg, I. H. (1986). Gastrointestinal absorption of antifolates.
Int. Encyl. Pharmacol. Ther. Vol. 118, pp. 147156. Pergamon, Oxford/NewYork.
Selhub, J., and Rosenberg, I. H. (1978). Demonstration of high-affinity folate binding
activity associated with the brush border membranes of rat kidney. Proc. Natl. Acad. Sci.
USA 75(7), 30903093.
Selhub, J., and Rosenberg, I. H. (1981). Folate transport in isolated brush border membrane
vesicles from rat intestine. J. Biol. Chem. 256(9), 44894493.
Seller, M. J., and Nevin, N. C. (1984). Periconceptional vitamin supplementation and the
prevention of neural tube defects in south-east England and Northern Ireland. J. Med.
Genet. 21(5), 325330.
Shane, B. (1989). Folylpolyglutamate synthesis and role in the regulation of one-carbon
metabolism. Vitam. Horm. 45, 263335.
Shayeghi, M., Latunde-Dada, G. O., Oakhill, J. S., Laftah, A. H., Takeuchi, K.,
Halliday, N., Khan, Y., Warley, A., McCann, F. E., Hider, R. C., Frazer, D. M.,
Anderson, G. J., et al. (2005). Identification of an intestinal heme transporter. Cell 122
(5), 789801.
Shen, F., Ross, J. F., Wang, X., and Ratnam, M. (1994). Identification of a novel folate
receptor, a truncated receptor, and receptor type beta in hematopoietic cells: cDNA
cloning, expression, immunoreactivity, and tissue specificity. Biochemistry 33(5),
12091215.
Shen, F., Wu, M., Ross, J. F., Miller, D., and Ratnam, M. (1995). Folate receptor
type gamma is primarily a secretory protein due to lack of an efficient signal for
glycosylphosphatidylinositol modification: Protein characterization and cell type
specificity. Biochemistry 34(16), 56605665.
Sierra, E. E., Brigle, K. E., Spinella, M. J., and Goldman, I. D. (1997). pH dependence of
methotrexate transport by the reduced folate carrier and the folate receptor in L1210
leukemia cells. Further evidence for a third route mediated at low pH. Biochem. Pharma-
col. 53(2), 223231.
Sirotnak, F. M. (1985). Obligate genetic expression in tumor cells of a fetal membrane
property mediating folate. transport: Biological significance and implications for
improved therapy of human cancer. Cancer Res. 45(9), 39924000.
Sirotnak, F. M. (1987). Determinants of resistance to antifolates: Biochemical phenotypes,
their frequency of occurrence and circumvention. NCI Monogr. Volume 1987, (Number
5), 2735.
Sirotnak, F. M., and Tolner, B. (1999). Carrier-mediated membrane transport of folates in
mammalian cells. Annu. Rev. Nutr. 19, 91122.
Smit, J. W., Huisman, M. T., van Tellingen, O., Wiltshire, H. R., and Schinkel, A. H.
(1999). Absence or pharmacological blocking of placental P-glycoprotein profoundly
increases fetal drug exposure. J. Clin. Invest. 104(10), 14411447.
Smithells, R. W., Nevin, N. C., Seller, M. J., Sheppard, S., Harris, R., Read, A. P.,
Fielding, D. W., Walker, S., Schorah, C. J., and Wild, J. (1983). Further experience of
vitamin supplementation for prevention of neural tube defect recurrences. Lancet 1
(8332), 10271031.
Adaptation to Folate Deprivation 141
Smithells, R. W., Sheppard, S., and Schorah, C. J. (1976). Vitamin dificiencies and neural
tube defects. Arch. Dis. Child 51(12), 944950.
Smithells, R. W., Sheppard, S., Schorah, C. J., Seller, M. J., Nevin, N. C., Harris, R.,
Read, A. P., and Fielding, D. W. (1981). Apparent prevention of neural tube defects by
periconceptional vitamin supplementation. Arch. Dis. Child 56(12), 911918.
Sparreboom, A., van Asperen, J., Mayer, U., Schinkel, A. H., Smit, J. W., Meijer, D. K.,
Borst, P., Nooijen, W. J., Beijnen, J. H., and van Tellingen, O. (1997). Limited oral
bioavailability and active epithelial excretion of paclitaxel (Taxol) caused by P-glycopro-
tein in the intestine. Proc. Natl. Acad. Sci. USA 94(5), 20312035.
Spector, R., and Johanson, C. (2006). Micronutrient and urate transport in choroid plexus
and kidney: implications for drug therapy. Pharm. Res. 23(11), 25152524.
Spiegelstein, O., Eudy, J. D., and Finnell, R. H. (2000). Identification of two putative novel
folate receptor genes in humans and mouse. Gene 258(1-2), 117125.
Stanger, O. (2002). Physiology of folic acid in health and disease. Curr. Drug Metab. 3(2),
211223.
Stark, M., Rothem, L., Jansen, G., Scheffer, G. L., Goldman, I. D., and Assaraf, Y. G.
(2003). Antifolate resistance associated with loss of MRP1 expression and function in
Chinese hamster ovary cells with markedly impaired export of folate and cholate.
Mol. Pharmacol. 64(2), 220227.
Starkebaum, G., and Harlan, J. M. (1986). Endothelial cell injury due to copper-catalyzed
hydrogen peroxide generation from homocysteine. J. Clin. Invest. 77(4), 13706.
Stokstad, E. L. R. (1990). In Folic acid metabolism in health and disease (M. F. Picciano,
E. L. R. Stokstad, and J. F. Greogory, eds.), pp. 121. Wiley-Liss, New York.
Subramanian, V. S., Chatterjee, N., and Said, H. M. (2003). Folate uptake in the human
intestine: Promoter activity and effect of folate deficiency. J. Cell. Physiol. 196(2),
403408.
Sun, X. L., and Antony, A. C. (1996). Evidence that a specific interaction between an 18-
base cis-element in the 5-untranslated region of human folate receptor-alpha mRNA
and a 46-kDa cytosolic trans-factor is critical for translation. J. Biol. Chem. 271(41),
2553925547.
Szakacs, G., Paterson, J. K., Ludwig, J. A., Booth-Genthe, C., and Gottesman, M. M.
(2006). Targeting multidrug resistance in cancer. Nat. Rev. Drug. Discov. 5(3), 219234.
Tammur, J., Prades, C., Arnould, I., Rzhetsky, A., Hutchinson, A., Adachi, M.,
Schuetz, J. D., Swoboda, K. J., Ptacek, L. J., Rosier, M., Dean, M., and Allikmets, R.
(2001). Two new genes from the human ATP-binding cassette transporter superfamily,
ABCC11 and ABCC12, tandemly duplicated on chromosome 16q12. Gene 273(1),
8996.
Tannock, I. F., and Rotin, D. (1989). Acid pH in tumors and its potential for therapeutic
exploitation. Cancer Res. 49(16), 43734384.
Trent, J. M., Buick, R. N., Olson, S., Horns, R. C., Jr, and Schimke, R. T. (1984).
Cytologic evidence for gene amplification in methotrexate-resistant cells obtained from
a patient with ovarian adenocarcinoma. J. Clin. Oncol. 2(1), 815.
Ubbink, J. B., Vermaak, W. J., van der Merwe, A., and Becker, P. J. (1993). Vitamin B-12,
vitamin B-6, and folate nutritional status in men with hyperhomocysteinemia. Am. J.
Clin. Nutr. 57(1), 4753.
van Herwaarden, A. E., Jonker, J. W., Wagenaar, E., Brinkhuis, R. F., Schellens, J. H.,
Beijnen, J. H., and Schinkel, A. H. (2003). The breast cancer resistance protein (Bcrp1/
Abcg2) restricts exposure to the dietary carcinogen 2-amino-1-methyl-6-phenylimidazo
[4,5-b]pyridine. Cancer Res. 63(19), 64476452.
van Herwaarden, A. E., Wagenaar, E., Merino, G., Jonker, J. W., Rosing, H.,
Beijnen, J. H., and Schinkel, A. H. (2007). Multidrug transporter ABCG2/breast cancer
142 Ilan Ifergan and Yehuda G. Assaraf
resistance protein secretes riboflavin (vitamin B2) into milk. Mol. Cell Biol. 27(4),
12471253.
Vergel, R. G., Sanchez, L. R., Heredero, B. L., Rodriguez, P. L., and Martinez, A. J. (1990).
Primary prevention of neural tube defects with folic acid supplementation: Cuban
experience. Prenat. Diagn. 10(3), 149152.
Volk, E. L., and Schneider, E. (2003). Wild-type breast cancer resistance protein (BCRP/
ABCG2) is a methotrexate polyglutamate transporter. Cancer Res. 63(17), 55385543.
Walling, J. (2006). From methotrexate to pemetrexed and beyond. A review of the
pharmacodynamic and clinical properties of antifolates. Invest. New Drugs 24(1), 3777.
Wang, X., Shen, F., Freisheim, J. H., Gentry, L. E., and Ratnam, M. (1992). Differential
stereospecificities and affinities of folate receptor isoforms for folate compounds and
antifolates. Biochem. Pharmacol. 44(9), 18981901.
Wang, Y., Zhao, R., and Goldman, I. D. (2004). Characterization of a folate transporter in
HeLa cells with a low pH optimum and high affinity for pemetrexed distinct from the
reduced folate carrier. Clin. Cancer Res. 10(18 Pt 1), 62566264.
Weitman, S. D., Weinberg, A. G., Coney, L. R., Zurawski, V. R., Jennings, D. S., and
Kamen, B. A. (1992). Cellular localization of the folate receptor: potential role in drug
toxicity and folate homeostasis. Cancer Res. 52(23), 67086711.
Wielinga, P., Hooijberg, J. H., Gunnarsdottir, S., Kathmann, I., Reid, G., Zelcer, N., van
der Born, K., de Haas, M., van der Heijden, I., Kaspers, G., Wijnholds, J., Jansen, G.,
et al. (2005). The human multidrug resistance protein MRP5 transports folates and can
mediate cellular resistance against antifolates. Cancer Res. 65(10), 44254430.
Wijnholds, J., deLange, E. C., Scheffer, G. L., van den Berg, D. J., Mol, C. A., van der
Valk, M., Schinkel, A. H., Scheper, R. J., Breimer, D. D., and Borst, P. (2000).
Multidrug resistance protein 1 protects the choroid plexus epithelium and contributes
to the blood-cerebrospinal fluid barrier. J. Clin. Invest. 105(3), 279285.
Williams, F. M., and Flintoff, W. F. (1998). Structural organization of the human reduced
folate carrier gene: Evidence for 50 heterogeneity in lymphoblast mRNA. Somat. Cell
Mol. Genet. 24(3), 143156.
Xiao, X., Tang, Y. S., Mackins, J. Y., Sun, X. L., Jayaram, H. N., Hansen, D. K., and
Antony, A. C. (2001). Isolation and characterization of a folate receptor mRNA-binding
trans-factor from human placenta. Evidence favoring identity with heterogeneous
nuclear ribonucleoprotein E1. J. Biol. Chem. 276(44), 4151041517.
Young, L., Leonhard, K., Tatsuta, T., Trowsdale, J., and Langer, T. (2001). Role of the
ABC transporter Mdl1 in peptide export from mitochondria. Science 291(5511),
21352138.
Zeng, H., Bain, L. J., Belinsky, M. G., and Kruh, G. D. (1999). Expression of multidrug
resistance protein-3 (multispecific organic anion transporter-D) in human embryonic
kidney 293 cells confers resistance to anticancer agents. Cancer Res. 59(23), 59645967.
Zeng, H., Chen, Z. S., Belinsky, M. G., Rea, P. A., and Kruh, G. D. (2001). Transport of
methotrexate (MTX) and folates by multidrug resistance protein (MRP) 3 and MRP1:
Effect of polyglutamylation on MTX transport. Cancer Res. 61(19), 72257232.
Zhang, L., Wong, S. C., and Matherly, L. H. (1998). Transcript heterogeneity of the human
reduced folate carrier results from the use of multiple promoters and variable splicing of
alternative upstream exons. Biochem. J. 332(Pt 3), 773780.
Zhao, R., Gao, F., and Goldman, I. D. (2002). Reduced folate carrier transports thiamine
monophosphate: An alternative route for thiamine delivery into mammalian cells. Am. J.
Physiol. Cell Physiol. 282(6), C1512C1517.
Zhao, R., Min, S. H., Qiu, A., Sakaris, A., Goldberg, G. L., Sandoval, C., Malatack, J. J.,
Rosenblatt, D. S., and Goldman, I. D. (2007). The spectrum of mutations in the PCFT
gene, coding for an intestinal folate transporter, that are the basis for hereditary folate
malabsorption. Blood 110, 11471152.
Adaptation to Folate Deprivation 143
Zhao, R., Russell, R. G., Wang, Y., Liu, L., Gao, F., Kneitz, B., Edelmann, W., and
Goldman, I. D. (2001). Rescue of embryonic lethality in reduced folate carrier-deficient
mice by maternal folic acid supplementation reveals early neonatal failure of hemato-
poietic organs. J. Biol. Chem. 276(13), 102241028.
Zhu, H., Wlodarczyk, B. J., Scott, M., Yu, W., Merriweather, M., Gelineau-van Waes, J.,
Schwartz, R. J., and Finnell, R. H. (2007). Cardiovascular abnormalities in Folr1
knockout mice and folate rescue. Birth Defects Res. A Clin. Mol. Teratol. 79(4), 25768.
Zhu, W. Y., Alliegro, M. A., and Melera, P. W. (2001). The rate of folate receptor alpha
(FR alpha) synthesis in folate depleted CHL cells is regulated by a translational mecha-
nism sensitive to media folate levels, while stable overexpression of its mRNA is mediated
by gene amplification and an increase in transcript half-life. J. Cell. Biochem. 81(2),
205219.
Zhu, W. Y., Bunni, M., Priest, D. G., DiCapua, J. L., Dressler, J. M., Chen, Z., and
Melera, P. W. (2002). Severe folate restriction results in depletion of and alteration in the
composition of the intracellular folate pool, moderate sensitization to methotrexate and
trimetrexate, upregulation of endogenous DHFR activity, and overexpression of metal-
lothionein II and folate receptor alpha that, upon folate repletion, confer drug resistance
to CHL cells. J. Exp. Ther. Oncol. 2(5), 264277.
C H A P T E R F I V E
Contents
I. Introduction 146
II. MFS of Transporters 147
III. Folate Transport in Tissue Folate Homeostasis and Physiology:
Role of Multiple Transport Systems for Folate Uptake and Efflux 150
IV. Role of RFC in Antifolate Chemotherapy 152
V. Functional Properties of RFC 154
VI. Biochemistry of RFC 156
VII. Cloning of RFC cDNAs That Restore Transport to
Transport-Impaired Cultured Cells 158
VIII. Topological Structure of RFC 159
A. Topological structure by HA epitope accessibility
and N-glycosylation scanning mutagenesis 159
B. Topological structure by scanning cysteine
accessibility methods 163
IX. Insights into Structural and Functional Determinants of RFC from
Studies of Mutant RFC Proteins 164
A. Identification of structurally or functionally important amino
acids by selecting for mutant RFCs with antifolate inhibitors 165
B. Identification of structurally or functionally important
amino acids in RFC by homology comparisons and
site-directed mutagenesis 166
C. Deletional and insertional mutagenesis of RFC 167
D. Localization of a substrate-binding domain
by radioaffinity labeling 168
* Developmental Therapeutics Program, Barbara Ann Karmanos Cancer Institute, Wayne State University
School of Medicine, Detroit, Michigan 48201
{
Developmental Therapeutics Program, Barbara Ann Karmanos Cancer Institute, Wayne State University
School of Medicine, Detroit, Michigan 48201
145
146 Larry H. Matherly and Zhanjun Hou
Abstract
Folates are essential for life and folate deficiency contributes to a host of health
problems including cardiovascular disease, fetal abnormalities, neurological
disorders, and cancer. Antifolates, represented by methotrexate, continue to
occupy a unique niche among the modern day pharmacopoeia for cancer along
with other pathological conditions. This article focuses on the biology of the
membrane transport system termed the reduced folate carrier or RFC with a
particular emphasis on RFC structure and function. The ubiquitously expressed
RFC is the major transporter for folates in mammalian cells and tissues. Loss of RFC
expression or function portends potentially profound physiological or develop-
mental consequences. For chemotherapeutic antifolates used for cancer, loss of
RFC expression or synthesis of mutant RFC protein with impaired function results in
antifolate resistance due to incomplete inhibition of cellular enzyme targets and
low levels of substrate for polyglutamate synthesis. The functional properties for
RFC were first documented nearly 40 years ago in murine leukemia cells. Since
1994, when RFC was first cloned, tremendous advances in the molecular biology of
RFC and biochemical approaches for studying the structure of polytopic membrane
proteins have led to an increasingly detailed picture of the molecular structure of
the carrier, including its membrane topology, its N-glycosylation, identification
of functionally and structurally important domains and amino acids, and helix
packing associations. Although no crystal structure for RFC is yet available,
biochemical and molecular studies, combined with homology modeling, based
on homologous bacterial major facilitator superfamily transporters such as LacY,
now permit the development of experimentally testable hypotheses designed to
establish RFC structure and mechanism. 2008 Elsevier Inc.
I. Introduction
Folate is the generic term for water-soluble members of the B class of
vitamins that are required for normal tissue growth and development. Folic
acid is the synthetic form of the metabolically important folates found in cells
that differ in the level of oxidation of the pteridine ring, the nature of the one-
carbon substituent at the N5 and N10 positions, and the extent of g-glutamate
conjugation (Stokstad, 1990). The biological importance of reduced folates
derives from their essential roles in one-carbon transfer leading to thymidylate,
purine nucleotides, serine, and methionine, and in biological methylation
reactions from S-adenosyl methionine (Stokstad, 1990).
Structure and Function of the Reduced Folate Carrier 147
HN N
N CH2 O N CH2 O
H2N N NH H2N N NH
HN HN
N CH2 O CH2 O
H2N N NH H3C N
HN HN
N CH2 O CH2 O
S
O CHO HN C CO2H O H3C N C CO2H
Figure 5.1 Transport substrates for the reduced folate carrier (RFC). Structures are shown for folate and antifolate substrates for RFC.
Structure and Function of the Reduced Folate Carrier 149
(GLUT1) (Hruz and Mueckler, 2001; Salas-Burgos et al., 2004), the human
glucose-6-phosphate transporter (Almqvist et al., 2004; Fiser and Sali,
2003), the rat organic cation transporter-1 (OCT1) (Popp et al., 2005),
the rabbit organic cation transporter-2 (OCT2) (Zhang et al., 2005), and, as
described below, hRFC (Hou et al., 2006; Matherly et al., 2007).
Biochemical and structural data with LacY were used to argue for a
model for lactose/H symport in which the hydrophilic substrate-binding
cavity is alternately accessible to either side of the membrane (alternating
access model) (Abramson et al., 2003). Direct support for this model was
recently described in studies in which almost every residue of Lac Y was
replaced individually with cysteine and tested for reactivity with N-ethyl
maleimide (Kaback et al., 2007). In this report, alkylation of substituted
cysteine residues with NEM was alternately increased on the periplasmic
side of the LacY sugar-binding site in the presence of ligand, accompanying
decreased reactivity on the cytoplasmic side, consistent with a model in
which the sugar-binding site is alternately exposed to either side of the
membrane during transport (Kaback et al., 2007). Similar models were
proposed for GlpT (Huang et al., 2003) and EmrD (Yin et al., 2006).
Specific transport systems for folates include RFC and PCFT, both of
which are reported to be widely expressed (Qiu et al., 2006; Whetstine
et al., 2002; Zhao and Goldman, 2007), but are functionally distinct in that
transport by RFC occurs optimally at neutral pH (7.4) whereas transport
by PCFT is optimal at acidic pH (5.56.5) (Matherly and Goldman, 2003;
Zhao and Goldman, 2007). Other uptake systems include the high-affinity
folate receptors (FRs) (a and b), glycosyl-phosphoinositol-linked proteins
that accumulate folates via an endocytotic process (Matherly and Goldman,
2003; Salazar and Ratnam, 2007), and the organic anion transporters
(OATs) that are expressed in epithelial tissues such as kidney and transport
organic anions in addition to folates (Matherly and Goldman, 2003;
Miyazaki et al., 2004; Zhou and You, 2007), such as bromosulfopthalein,
taurocholate, and probenecid.
Renal tubular secretion and reabsorption of folates in proximal tubules
involve specific roles for folate transporters on the basolateral (e.g., OAT1,
OAT3, and RFC) and apical (e.g., OATP1, FRa, MRP2, and MRP4)
membranes (Nozaki et al., 2004; Russel et al., 2002). Folates are filtered via
the glomerulus and reabsorbed by an FRa-mediated endocytotic process,
then transported into the bloodstream by folate transporters localized to the
basolateral membrane. Both FRa and RFC are also involved in transpla-
cental transport of folates (Barber et al., 1999; Sweiry and Yudlievich, 1985).
The choroid plexus separates the blood compartment from the cerebral
spinal fluid (CSF). 5-Methyl tetrahydrofolate is typically present in CSF at
approximately four times the concentration found in plasma (Spector and
Lorenzo, 1975). FRa is localized to the basal (blood) side of choroid plexus
and likely mediates uptake of folates from blood (Spector and Lorenzo,
1975; Suleiman and Spector, 1981). RFC is localized on the apical mem-
brane of the bulbous microvili of the choroid plexus epithelium adjacent to
the ventricular membrane (Wang et al., 2001), suggesting its role in trans-
porting folates into the CSF at the apical surface. The recent finding that at
least some cases of hereditary folate maladsorption syndrome are accompa-
nied by low levels of central nervous system and plasma folates and a loss of
functional PCFT (Qui et al., 2006) suggests a role of PCFT in CNS folate
transport along with those of FRa and RFC. The possibility that RFC may
also contribute to hereditary folate maladsorption syndrome has been sug-
gested (Said, 2004). Interestingly, RFC was detected in axons and dendrites,
and on the apical membrane of the spinal canal (Wang et al., 2001),
suggesting that this carrier is an important mode of folate transport in
neuronal cells.
For mice in which RFC was inactivated by targeted homologous
recombination (knockout mice), RFC was obligatory for development
because targeting both alleles was embryonic lethal (Zhao et al., 2001b).
However, 10% of RFC-null mice could be brought to live birth by
supplementing the dams with folic acid. These mice subsequently died
152 Larry H. Matherly and Zhanjun Hou
the United States for advanced colorectal cancer (Chu et al., 2003). In 2004,
pemetrexed was approved for pleural mesothelioma in the United States
(Hazarika et al., 2004), and subsequently as a second-line treatment for
nonsmall cell lung cancer (Cohen et al., 2005). MTX has found other
clinical applications including treatment of autoimmune diseases and psori-
asis (Chladek et al., 1998; Giannini et al., 1992).
These classical antifolates are all excellent substrates for cellular uptake
by RFC (Goldman and Matherly, 1985; Goldman and Zhao, 2002; Jansen,
1999; Matherly et al., 2007). Membrane transport of antifolates such as
MTX is critical to drug activity because sufficient intracellular drug is
required to sustain suppression of enzyme targets and to support synthesis
of polyglutamates required for high-affinity inhibition of intracellular
enzymes and sustained drug effects as plasma drug levels decline (Goldman
and Matherly, 1985). Not surprisingly, impaired active transport of MTX
has been identified as an important mechanism of MTX resistance (Goldman
and Matherly, 1985; Matherly et al., 2007; Zhao and Goldman, 2003).
Impaired MTX transport was reported as early as 1962 in MTX-resistant
L5178Y mouse leukemia cells (Fischer, 1962). Decreased MTX transport
by RFC has been reported in cultured murine and human tumor cells
selected in vitro with antifolate (in some cases, with prior exposure to
carcinogen) (Drori et al., 2000; Gong et al., 1997; Jansen et al., 1998;
Rothem et al., 2002, 2003; Roy et al., 1998; Sadlish et al., 2000; Schuetz
et al., 1988; Wong et al., 1999; Zhao et al., 1998a,b, 1999) and in vivo in
MTX-resistant murine leukemia cells from mice treated with MTX che-
motherapy (Sirotnak et al., 1981). In 42 primary osteosarcoma samples from
patients who experienced poor responses to chemotherapy including MTX,
65% showed low-level RFC expression (Guo et al., 1999). Similarly, in
primary acute lymphoblastic leukemia, low levels of RFC were associated
with a poor prognosis (Ge et al., 2007; Gorlick et al., 1997; Levy et al.,
2003).
The MTX-resistant phenotype is frequently complex and involves
elevated or kinetically altered dihydrofolate reductase, and/or decreased
synthesis of MTX polyglutamates in addition to impaired MTX transport
(Goldman and Matherly, 1985; Zhao and Goldman, 2003). Impaired trans-
port that results in a loss of sensitivity to standard doses of antifolate should,
at least in part, be circumvented by increasing extracellular concentrations
of drug. This forces the drug into tumor cells expressing mutated or low
levels of RFC, and involves alternate uptake routes and/or passive diffusion
to a sufficient extent to inhibit intracellular enzymes and/or to support
antifolate polyglutamate synthesis. However, a point is often achieved for
which these elevated extracellular antifolate concentrations are no longer
capable of significantly increasing intracellular drug levels. This is due to
the saturability of RFC, electrical restrictions on net drug accumulation,
and the presence of high-capacity efflux pumps such as the MRPs.
154 Larry H. Matherly and Zhanjun Hou
K N N58
P
D F T T N
G T P S
L R D A
L Y E V R
P
E G L P V
T Q V L R
I V N Y G K
F T W N R Q
E
S N Extracellular F
L V F
E I S S G Q
G T Q V T I A D L
P P M L
M R L H A S Y
I
R V H T R H P 360
40 Q 73 S L 117 A 123 E 178 G 186 N 288 V 310 D 355 H S 418 V S 436
A Y V L V Y Y V A A S I T V Y
M S S F T I Y V A L I F I F
F Y H G Y S V S L L Y S T L F W I T L
G L A L V L L A Y L V L C K I L
Y V L T Q F G L L Y V S
F L V L L L M A A G L L A N S G G A A I A T I I
C V R I V T V A A F F
P W F F I Q F Y
L Y V S A S S W T T V T F
F L V Y S T V W S S A L F N L G
C F S S S F V L F T R V G A
V L L Y W A V F
L T G Q I F V G L A L R A G G S M L
V L
R D L S L L L G A Y A D
R Y L L L F Q F I Q C G
W 1 L 2 L 3 V 4 V 5 L 6 P 7 V 8 L 9 F 10 L 11 L 12
24 S 91 R V 95 R 145 A 159 K 204 R 264 K 328 L 337 L 379 E 394 R 456
R Y T P A R R I K V K
L P H
E A R P L R S P S C
Q V P S K S W
WA R I L Q
K P D R
Cytosol Y Y R D G L E R L A S S R
E V P S M T
E PG Q G F Q I A G
V L P G R
R A F G G H
A V K A
P S S P V M1 F P L L H
N N M R G V E A A S R L G Q A P P Q P R P
E H E
R S K
L A
D
E L D A A Q A L S V Q D K G L G G L Q P A Q
D R G S
T S A S G V A G L S D E P S L P P
R
E
V C
A E L S A P
G Q E F L S
R C R Q S D P Y L A Q A P A P QA A
P
E D A A E P G S A Q A S C L T C P S P T T V
T
C S D G
P Q L A V H P P G V S K L G L Q C L P V
Q
591 Q N V N
Figure 5.2 Topological model for hRFC showing conserved residues between seven species. Topology model for hRFC, depicting 12
TMDs, internally oriented N- and C-termini, an externally oriented N-glycosylation site at Asn-58, and a cytosolic loop connecting TMDs 6
and 7. Amino acids conserved between RFCs from different species as summarized in Fig. 5.3 are depicted as black circles.
Human -------------------- -------------------- ------MVPSSPAVEKQVPV EPGPDPEL-RSWRRLVCYLC FYGFMAQIRPGESFITPYLL 53
Chimpanzee -------------------- -------------------- ------MVPSSPAVEKQVPV EPGPDPEL-RSWRRLVCYLC FYGFMAQIRPGESFITPYLL 53
Cattle -------------------- -------------------- ------MALSVPEVEKQMPA EPQPGHEQ-QSWWCLVFFLC FYGFMAQMRPGESFITPYLL 53
Mouse -------------------- -------------------- ------MVPTGQVAEKQAYE EPRQDHEL-KSWRCLVFYLC FFGFMAQLRPGESFITPFLL 53
Rat -------------------- -------------------- ------MVPTGQVAEKQACE EPRQDREL-KSWRWLVFYLC FFGFMAQLRPGESFITPYLL 53
Hamster -------------------- -------------------- ------MVPTGQVAEKQACE EPRQDREL-KSWRCLVFYLC FFGFMAQLRPGESFITPYLL 53
Xenopus MTQNESDGQALEKSFTVPGI QMTSENGQMKVEQTPSEEQQ FLPVELQSPTVELPSHLEGQ ESPPEEY--TQWKFLLFYLC LYGFMTQLRPGESFITPYLL 98
Zebrafish MVEESTSNERTEDVKEN--- -MTDENGQ------------ --PVENVAPESVILETKEDL EAQTQKT--RTWMWSVVYLC FYGFMVQLKPGEPFITPYLL 80
Chicken -------------------- -MTVPRR------------- ----EPLSSAADMPQQDEGK KPPMETAPEQRWKLQVFYLC FYGFMTQIRPGESFITPYLL 62
Figure 5.3 Species homologies for RFC proteins. GenBank accession numbers are Homo sapiens (human) NP 001069921; Pan troglodytes
(chimpanzee) XP 001157360; Gallus gallus (chicken,) NP 001006513; Danio rerio (zebrafish) XP 687261; Bos taurus (cow)NP 001069921;
161
Rattus norvegicus (Norway rat) NP 001030309; Cricetulus griseus (Chinese hamster) U17566; Mus musculus (mouse) NP 112473; Xenopus laevis
(African clawed frog) NM 001092530.
Human TQAGLVFLLAHTRHP---SS IWLCYAAFVLFRGSYQFLVP IATFQIASSLSKELCALVFG VNTFFATIVKTIITFIVSDV RGLGLPVRKQFQLYSVYFLI 441
Chimpanzee TQAGLVFLLAHTRHP---SS IWLCYAAFVLFRGSYQFLVP IATFQIASSLSKELCALVFG VNTFFATIVKTIITFIVSDV RGLGLPVRKQFQLYSVYFLI 440
Cattle LQAGLVFLMYKT------DD IWLCYAAFVLFRGSYQFLVP IATFQIAASLSQELRALVFG INTFLATVLKTVITLIVSDK RGLGLPVHSQFLVYFVYFLV 438
Mouse IQASLVFCMFQIR------D IWVCYVTFVLFRGAYQFLVP IATFQIASSLSKELCALVFG INTFLATALKTCITLVVSDK RGLGLQVRDQFRIYFIYFLM 440
Rat IQAGLVFCMFQIP------D IWVCYVTFVLFRGAYQFLVP IATFQIASSLSKELCALVFG INTFLATALKTSITLVVSDK RGLGLQVHQQFRIYFMYFLT 440
Hamster IQAGLVFCMYMVHYVTWVHK IWVLYMTYVLFRGAYQFLVP IATFQIASSLSKELCALVFG INTFLATALKTAITLVVSDK RGLGLKVEKQFCIYSVYFMV 441
Xenopus FQAGLLILMNTTE------N IWVCYVAYILFRSSYQFLVP IAIFQIASNLSKELCALVFG VNTFFATILKTIITIIIADK RGLALSVHPQFYVYFVYFTV 481
Zebrafish AQAALLLLMGMTE------D IWVCYVAYALFKGFYQFLVP IAIFQIASSLTKELCALVFG VNTFLGTILKAIITIIVADK RGLALSVHSQFFVYFFYFTL 472
Chicken IQAGLLLFMNTTG------N IWLCYTAYVLFRGSYQFLVP IAIFQIATSLSKELCALVFG VNTFFSTVLKTVITIIVADK RGLGLSVHPQFYVYFSYFSL 484
hRFC (Marchant et al., 2002). Collectively, these studies argue that neither
the cytosolic facing N- nor C-terminus is directly involved in substrate
binding and that, in general, they only slightly influence membrane targeting
and insertion of the carrier.
A prominent feature of the MFS family of transporters involves a con-
necting loop between TMDs 6 and 7 (Fig. 5.2). Both deletion and insertion
mutagenesis strategies have been used to explore the functional and struc-
tural role of this region in RFC. Thus, deletion of 31 of the 66 amino acids
from the TMD6/TMD7 connecting loop in murine RFC (Sharina et al.,
2002) or deletion of up to 45 of the 67 amino acids in the TMD6/TMD7
loop domain from hamster RFC (Sadlish et al., 2002a) preserved membrane
targeting and transport activity. However, larger deletions in the TMD6/
TMD7 linker domain (57 and 5355 amino acids, respectively) abolished
transport activity.
While deletions of 49 or 60 amino acids from the TMD6/TMD7 linker
of hRFC (amino acids 215263 and 204263, respectively) completely
ablated transport of MTX and 5-formyl tetrahydrofolate, replacement of
the deleted segments with nonhomologous 73 or 84 amino acid segments
from another MFS protein, SLC19A2 (transports thiamine; 18% homolo-
gous to hRFC for the TMD6/TMD7 linker region), restored transport (Liu
et al., 2003). Interestingly, maximal transport activities for these insertional
mutants were absolutely dependent on the presence of the highly conserved
204214 peptide and deletion of the 204214 segment alone completely
abolished transport (Liu et al., 2003).
Thus, the primary purpose of the TMD6/TMD7 linker domain is to
ensure the optimal spacing between the two halves of the RFC protein for
carrier function. This appears to be essentially independent of amino acid
sequence, although an important role for amino acids 204214 is implied.
Most recently, TMD16 and TMD712 hRFC half molecules were
cotransfected into hRFC-null K562 cells (Witt et al., 2004). Coexpressed
hRFC half molecules were targeted to the membrane surface where they
restored transport activity with normal kinetics, showed sensitivity to inhi-
bition by NHS-MTX, and exhibited a capacity for trans-stimulation by
preloading with 5-formyl tetrahydrofolate (Witt et al., 2004).
B 2
11
4
12
7 1 3
6
10
8 5
C
Extracellular TMD7 TMD8
20
.1
5.7 Ser313
14
.6
K411 Tyr281
13
.9
18.5
TMD11 Arg373
TMD10
Tyr136 Ile134
Ala135
Arg133
Ser138
Cytosol TMD4
Figure 5.4 Proposed 3-D models of hRFC based on solved crystal structures of LacY
and GlpT and SCAM analysis, and the hypothesized substrate-binding site of hRFC.
A 3-D hypothetical model for hRFC is presented based on structure alignments
between hRFC and LacY and GlpT and fine-tuned based on experimental SCAM
data. Modeling was performed with the Modeller 8v1 auto mode (Marti-Renom
et al., 2000). All models were drawn by PyMol (DeLano, 2002). Panel A depicts a
side view of hRFC for which the extended C-terminal segment is truncated at Lys479.
TMDs 1, 2, 4, and 5 of the N-terminal region and TMDs 7, 8, 10, and 11 of the
C-terminal region are hypothesized to be involved in the formation of the hydrophilic
Structure and Function of the Reduced Folate Carrier 171
cavity for anionic substrate binding (colored as black). TMDs 3, 6, 9, and 12 are likely
buried in the lipid bilayer and do not directly participate in substrate binding (colored as
gray). Panel B depicts a cytosolic view of only the TMD segments (numbered 112 as in
Fig. 5.2) of the hRFC molecule so that the order of helix packing can be easily seen.
TMD shading is the same as in Panel A. Panel C shows an enhanced view of the
hypothetical substrate-binding site, including Lys411, Ser313, Tyr281, and Arg373, as
described in the text. Other residues that may contribute to the substrate-binding
pocket are also shown and include Arg133, Ile134, Ala135, Tyr136, and Ser138. The
physical distances between a-carboxyl groups of Lys411, Ser313, Tyr281, and Arg373
are shown in Angstrom. Adapted from Hou et al. (2006).
172 Larry H. Matherly and Zhanjun Hou
proposed orientations toward the putative hRFC hydrophilic cavity and their
relative proximities in 3-D models (Hou et al., 2006; Matherly et al., 2007;
Fig. 5.4). As described above, Ser313 in TMD8 was previously implicated in
the binding of antifolate substrates for RFC (Deng et al., 2007; Zhao et al.,
1999) and was identified as irreplaceable by scanning cysteine mutagenesis
(Hou et al., 2006). TMD8 abuts TMD5 and, by SCAM, both these regions
are aqueous-accessible and contribute to the substrate-binding pocket in
hRFC (Hou et al., 2006). TMD11 includes Lys411, the primary target for
covalent radioaffinity labeling with NHS-3H-MTX (Deng et al., 2008), and is
aqueous-accessible by SCAM (Hou et al., 2005). Finally, TMD2 flanks
TMD11 and, by homology with LacY (Abramson et al., 2003), lines the
substrate translocation pathway and includes at least one residue (Asp88) that
is essential for transport (Liu and Matherly, 2001).
In initial studies, cysteine-less hRFC was expressed as two (TMD16 and
TMD712) half molecules, each with a cysteine residue inserted at a defined
position in the TMD16 (TMDs 2 or 5) or TMD712 (TMDs 8 or 11)
portions. Altogether, 19 cysteine-substituted TMD16/TMD712 pairs
(175/311, 174/314, 172/315, 171/317, 168/318, 167/321, 164/322,
163/325, 161/326, and 160/326 in TMDs 5/8; 74/415, 74/412, 74/411,
75/408, 78/405, 81/404, 82/404, 84/404, and 85/404 in TMDs 2/11)
were selected for coexpression and cross-linking with homobifunctional
cross-linkers of different lengths [1,1-methanediyl bismethanethiosulfonate,
3 A; o-phenylenedimaleimide, 6 A; p-phenylenedimaleimide, 10 A; and
1,6-bis(maleimido)hexane, 16 A], so to assess helix proximities and tilts in
relation to the putative hRFC hydrophilic cavity. The results unequivocally
establish that the helices of TMDs 5 and 8 are relatively close together at
their extracellular ends (within 10 A), then tilt away from each other toward
the cytoplasmic ends; TMDs 2 and 11 are in proximity at both their
extracellular and cytoplasmic ends (within 10 A). Pro82 in TMD2 may
cause a bend in TMD2, resulting in a lack of cross-linking between the
middle segments of TMDs 2 and 11.
X. Conclusions
Folates are essential for life and folate deficiency contributes to a host of
health problems including cardiovascular disease, fetal abnormalities, neuro-
logical disorders, and cancer (Lucock, 2000; Matherly, 2004). Antifolates,
represented by MTX, continue to occupy a unique niche among the modern
day pharmacopoeia for cancer along with other pathological conditions
(Matherly et al., 2007).
This chapter focuses on the biology of the membrane transport system
termed the reduced folate carrier or RFC with a particular emphasis on
174 Larry H. Matherly and Zhanjun Hou
ACKNOWLEDGMENT
This work was supported by Grant CA53535 from the National Cancer Institute, National
Institutes of Health.
REFERENCES
Abramson, J., Smirnova, I., Kasho, V., Verner, G., Kaback, H. R., and Iwata, S. (2003).
Structure and mechanism of the lactose permease of Escherichia coli. Science 301, 610615.
Almqvist, J., Huang, Y., Hovmoller, S., and Wang, D. N. (2004). Homology modeling of
the human microsomal glucose 6-phosphate transporter explains the mutations that cause
the glycogen storage disease type Ib. Biochemistry 43, 92899297.
Balamurugan, K., and Said, H. M. (2006). Role of reduced folate carrier in intestinal folate
uptake. Am. J. Physiol. Cell Physiol. 291, C189C193.
Barber, R. C., Bennett, G. D., Greer, K. A., and Finnell, R. H. (1999). Expression of
patterns of folate binding proteins one and two in the developing mouse embryo. Mol.
Genet. Metab. 66, 3139.
Barril, X., Aleman, C., Orozco, M., and Luque, F. J. (1998). Salt bridge interactions:
Stability of the ionic and neutral complexes in the gas phase, in solution, and in proteins.
Proteins 32, 6779.
Brigle, K. E., Spinella, M. J., Sierra, E. E., and Goldman, I. D. (1995). Characterization of a
mutation in the reduced folate carrier in a transport defective L1210 murine leukemia cell
line. J. Biol. Chem. 270, 2297422979.
Cao, W., and Matherly, L. H. (2003). Characterization of a cysteine-less human reduced
folate carrier: Localization of a substrate binding domain by cysteine scanning muta-
genesis and cysteine accessibility methods. Biochem. J. 374, 2736.
Cao, W., and Matherly, L. H. (2004). Analysis of the membrane topology for transmem-
brane domains 712 of the human reduced folate carrier by scanning cysteine accessibility
methods. Biochem. J. 378, 201206.
Chang, A. B., Lin, R., Studley, W. K., Tran, C. V., and Saier, M. H. (2004). Phylogeny as a
guide to structure and function of membrane transport proteins. Mol. Membr. Biol.
21, 171181.
Chiao, J. H., Roy, K., Tolner, B., Yang, C. H., and Sirotnak, F. M. (1997). RFC-1 gene
expression regulates folate absorption in mouse small intestine. J. Biol. Chem. 273,
1116511170.
Chladek, J., Martnkova, J., Simkova, M., Vaneckova, J., Koudelkova, V., and
Nozickova, M. (1998). Pharmacokinetics of low doses of methotrexate in patients with
psoriasis over the early period of treatment. Eur. J. Clin. Pharmacol. 53, 437444.
Chu, E., Callender, M. A., Farrell, M. P., and Schmitz, J. C. (2003). Thymidylate synthase
inhibitors as anticancer agents: From bench to bedside. Cancer Chemother. Pharmacol.
52(Suppl 1), S80S89.
Cohen, M. H., Johnson, J. R., Wang, Y. C., Sridhara, R., and Pazdur, R. (2005). FDA drug
approval: Pemetrexed for injection (Alimta) for the treatment of non-small cell lung
cancer. Oncologist 10, 363368.
176 Larry H. Matherly and Zhanjun Hou
DeLano, W. L. (2002). The PyMOL Molecular Graphics System (2002). DeLano Scien-
tific, San Carlos, CA, USA.
Deng, Y., Hou, Z., Cherian, C., Wu, J., Wang, L., Gangjee, A., and Matherly, L. H. (2007).
Identification of human reduced folate carrier (hRFC) substrate binding by site-directed
mutagenesis and affinity labeling strategies. Abstracts, Am. Assoc. Cancer Res. 48, 1355.
Deng, Y., Hou, Z., Wang, L., Cherian, C., Wu, J., Gangjee, A., and Matherly, L. H. (2008).
Role of Lysine 411 in substrate carboxyl group binding to the human reduced
folate carrier, as determined by site-directed mutagenesis and affinity inhibition. Mol.
Pharmacol. 73, 12741281.
Dixon, K. H., Lanpher, B. C., Chiu, J., Kelley, K., and Cowan, K. H. (1994). A novel
cDNA restores reduced folate carrier activity and methotrexate sensitivity to transport
deficient cells. J. Biol. Chem. 269, 1720.
Dodd, J. R., and Christie, D. L. (2001). Cysteine 144 in the third transmembrane domain of
the creatine transporter is located close to a substrate-binding site. J. Biol. Chem.
276, 4698346988.
Drori, S., Jansen, G., Mauritz, R., Peters, G. J., and Assaraf, Y. G. (2000). Clustering of
mutations in the first transmembrane domain of the human reduced folate carrier in
GW1843U89-resistant leukemia cells with impaired antifolate transport and augmented
folate uptake. J. Biol. Chem. 275, 3085530863.
Duch, D. S., Banks, S., Dev, I. K., Dickerson, S. H., Ferone, R., Heath, L. S.,
Humphreys, J., Knick, V., Pendergast, W., Singer, S., Smith, G. K., Waters, K., et al.
(1993). Biochemical and cellular pharmacology of 1843U89, a novel benzoquinazoline
inhibitor of thymidylate synthase. Cancer Res. 53, 810818.
Dunten, R. L., Sahin-Toth, M., and Kaback, H. R. (1993). Role of the charge pair aspartic
acid-237-lysine-358 in the lactose permease of Escherichia coli. Biochemistry 32,
31393145.
Ferguson, P. L., and Flintoff, W. F. (1999). Topological and functional analysis of the human
reduced folate carrier by hemagglutinin epitope insertion. J. Biol. Chem. 274,
1626918278.
Fischer, W. F. (1962). Detective transport of amethopterin (methotrexate) as a mechanism
of resistance to the antimetabolite in L5178Y leukemic cells. Biochem. Pharmacol.
11, 12331234.
Flintoff, W. F., Williams, F. M., and Sadlish, H. (2003). The region between the transmem-
brane domains 1 and 2 of the reduced folate carrier forms part of the substrate-binding
pocket. J. Biol. Chem. 278, 4086740876.
Flintoff, W. F., Sadlish, H., Gorlick, R., Yang, R., and Williams, F. M. (2004). Functional
analysis of altered reduced folate carrier sequence changes identified in osteosarcomas.
Biochim. Biophys. Acta 1690, 110117.
Fiser, A., and Sali, A. (2003). Modeller: Generation and refinement of homology-based
protein structure models. Meth. Enzymol. 374, 461491.
Freisheim, J. H., Ratnam, M., McAlinden, T. P., Prasad, K. M. R., Williams, F. E.,
Westerhof, G. R., Schornagel, J. H., and Jansen, G. (1992). Molecular events in the
membrane transport of methotrexate in human CCRF-CEM leukemia cell lines.
Adv. Enzyme Regul. 32, 1731.
Frillingos, S., Sahin-Toth, M., Wu, J., and Kaback, H. R. (1998). Cys-scanning muta-
genesis: A novel approach to structure function relationships in polytopic membrane
proteins. FASEB J. 12, 12811299.
Ge, Y., Haska, C. L., LaFiura, K., Devidas, M., Linda, S. B., Liu, M., Thomas, R.,
Taub, J. W., and Matherly, L. H. (2007). Prognostic role of the reduced folate carrier,
the major membrane transporter for methotrexate, in childhood acute lymphoblastic
leukemia: A report from the Childrens Oncology Group. Clin. Cancer Res. 13, 451457.
Structure and Function of the Reduced Folate Carrier 177
Giannini, E. H., Brewer, E. J., Kuzmina, N., Shaikov, A., Maximov, A., Vorontsov, I.,
Fink, C. W., Newman, A. J., Cassidy, J. T., and Zemel, L. S. (1992). Methotrexate in
resistant juvenile rheumatoid arthritis. Results of the USAUSSR. double-blind,
placebo-controlled trial. The pediatric rheumatology collaborative study group and the
cooperative childrens study group. N. Engl. J. Med. 326, 10431049.
Gifford, A. J., Haber, M., Witt, T. L., Whetstine, J. R., Taub, J. W., Matherly, L. H., and
Norris, M. D. (2002). Role of the E45K reduced folate carrier gene mutation in
methotrexate resistance in human leukemia cells. Leukemia 16, 23792387.
Goldman, I. D. (1971a). The characteristics of the membrane transport of amethopterin and
the naturally occurring folates. Ann. NY. Acad. Sci. 186, 400422.
Goldman, I. D. (1971b). A model system for the study of heteroexchange diffusion:
Methotrexate-folate interactions in L1210 leukemia and Ehrlich ascites tumor cells.
Biochim. Biophys. Acta 233, 624634.
Goldman, I. D., and Matherly, L. H. (1985). The cellular pharmacology of methotrexate.
Pharmacol. Ther. 28, 77100.
Goldman, I. D., and Zhao, R. (2002). Molecular, biochemical, and cellular pharmacology of
pemetrexed. Semin. Oncol. 29, 317.
Goldman, I. D., Lichtenstein, N. S., and Oliverio, V. T. (1968). Carrier-mediated transport
of the folic acid analogue methotrexate, in the L1210 leukemia cell. J. Biol. Chem.
243, 50075017.
Gong, M., Yess, J., Connolly, T., Ivy, S. P., Ohnuma, T., Cowan, K. H., and Moscow, J. A.
(1997). Molecular mechanism of antifolate transport-deficiency in a methotrexate-
resistant MOLT-3 human leukemia cell line. Blood 89, 24942499.
Gorlick, R., Goker, E., Trippett, T., Steinherz, P., Elisseyeff, Y., Mazumdar, M.,
Flintoff, W. F., and Bertino, J. R. (1997). Defective transport is a common mechanism
of acquired methotrexate resistance in acute lymphocytic leukemia and is associated with
decreased reduced folate carrier expression. Blood 89, 10131018.
Guo, W., Healey, J. H., Meyers, P. A., Ladanyi, M., Huvos, A. G., Bertino, J. R., and
Gorlick, R. (1999). Mechanisms of methotrexate resistance in osteosarcoma. Clin. Cancer
Res. 5, 621627.
Hazarika, R., White, M., Johnson, R. M., and Pazdur, J. R. (2004). FDA drug approval
summaries: Pemetrexed (Alimta). Oncologist 9, 482488.
Henderson, G. B., and Zevely, E. M. (1980). Transport of methotrexate in L1210 cells:
Effect of ions on the rate and extent of uptake. Arch. Biochem. Biophys. 200, 149155.
Henderson, G. B., and Zevely, E. M. (1981). Anion exchange mechanism for transport of
methotrexate in L1210 cells. Biochem. Biophys. Res. Commun. 99, 163169.
Henderson, G. B., and Zevely, E. M. (1982). Functional correlations between the metho-
trexate and general anion transport systems of L1210 cells. Biochem. Int. 4, 493502.
Henderson, G. B., and Zevely, E. M. (1983a). Use of non-physiological buffer systems in the
analysis of methotrexate transport in L1210 cells. Biochem. Int. 6, 507515.
Henderson, G. B., and Zevely, E. M. (1983b). Structural requirements for anion substrates of
the methotrexate transport system of L1210 cells. Arch. Biochem. Biophys. 221, 438446.
Henderson, G. B., and Zevely, E. M. (1984). Affinity labeling of the 50 -methyltetrahydrofolate/
methotrexate transport protein of L1210 cells by treatment with an N-hydroxysuccinimide
ester of [3H]methotrexate. J. Biol. Chem. 259, 45584562.
Henderson, G. B., Zevely, E. M., and Huennekens, F. M. (1979). Photoinactivation of the
methotrexate transpoprt system of L1210 cells by 8-azidoadenosine-50 -monophosphate.
J. Biol. Chem. 254, 99739975.
Henderson, G. B., Grzelakowska-Sztabert, B., Zevely, E. M., and Huennekens, F. M.
(1980a). Binding properties of the 5-methyltetrahydrofolate/methotrexate transport
system in L1210 cells. Arch. Biochem. Biophys. 202, 144149.
178 Larry H. Matherly and Zhanjun Hou
Kneuer, C., Honscha, K. U., and Honscha, W. (2005). Rat reduced folate carrier-1 is
localized basolaterally in MDCK kidney epithelial cells and contributes to the secretory
transport. Cell Tissue Res. 320, 517524.
Kwaw, I., Zen, K. C., Hu, Y., and Kaback, H. R. (2001). Site-directed sulfhydryl labeling of
the lactose permease of Escherichia coli: Helices IV and V that contain the major determi-
nants for substrate binding. Biochemistry 40, 1049110499.
Lawrance, A. K., Deng, L., Brody, L. C., Finnell, R. H., Shane, B., and Rozen, R. (2007).
Genetic and nutritional deficiencies in folate metabolism influence tumorigenicity in Apc
(min/) mice. J. Nutr. Biochem. 18, 305312.
Levy, A. S., Sather, H. N., Steinherz, P. G., Sowers, R., La, M., Moscow, J. A.,
Gaynon, P. S., Uckun, F. M., Bertino, J. R., and Gorlick, R. (2003). Reduced folate
carrier and dihydrofolate reductase expression in acute lymphoblastic leukemia may
predict outcome: A Childrens Cancer Group study. J. Pediatr. Hematol. Oncol. 25,
688695.
Liu, X. Y., and Matherly, L. H. (2001). Functional interactions between Arginine-133 and
Aspartate-88 in the human reduced folate carrier: Evidence for a charge-pair association.
Biochem. J. 358, 511516.
Liu, X. Y., and Matherly, L. H. (2002). Analysis of membrane topology of the human
reduced folate carrier protein by hemagglutinin epitope insertion and scanning glycosyl-
ation insertion mutagenesis. Biochim. Biophys. Acta 1564, 333342.
Liu, X. Y., Witt, T. L., and Matherly, L. H. (2003). Restoration of high level transport
activity by human reduced folate carrier/ThTr1 chimeric transporters: Role of the
transmembrane domain 6/7 linker region in reduced folate carrier function. Biochem. J.
369, 3137.
Loo, T. W., and Clarke, D. M. (1995). Membrane topology of a cysteine-less mutant of
human P-glycoprotein. J. Biol. Chem. 270, 843848.
Loo, T. W., and Clarke, D. M. (2000). Identification of residues within the drug-binding
domain of the human multidrug resistance P-glycoprotein by cysteine-scanning muta-
genesis and reaction with dibromobimane. J. Biol. Chem. 275, 3927239278.
Loo, T. W., and Clarke, D. M. (2001). Determining the dimensions of the drug-binding
domain of human P-glycoprotein using thiol cross-linking compounds as molecular
rulers. J. Biol. Chem. 276, 3687736880.
Lucock, M. (2000). Folic acid: Nutritional biochemistry, molecular biology, and role in
disease processes. Mol. Genet. Metab. 71, 121138.
Ma, D. W., Finnell, R. H., Davidson, L. A., Callaway, E. S., Spiegelstein, O.,
Piedrahita, J. A., Salbaum, J. M., Kappen, C., Weeks, B. R., James, J., Bozinov, D.,
Lupton, J. R., et al. (2005). Folate transport gene inactivation in mice increases sensitivity
to colon carcinogenesis. Cancer Res. 65, 887897.
Marchant, J. S., Subramanian, V. S., Parker, I., and Said, H. M. (2002). Intracellular
trafficking and membrane targeting mechanisms of the human reduced folate carrier in
mammalian epithelial cells. J. Biol. Chem. 277, 3332533333.
Marti-Renom, M. A., Stuart, A. C., Fiser, A., Sanchez, R., Melo, F., and Sali, A. (2000).
Comparative protein structure modeling of genes and genomes. Ann. Rev. Biophys.
Biomol. Struct. 29, 291325.
Matherly, L. H. (2004). Human reduced folate carrier gene and transcript variants: Func-
tional, physiologic, and pharmacologic consequences. Curr. Pharmacogenet. 2, 287298.
Matherly, L. H., and Goldman, I. D. (2003). Membrane transport of folates. Vitam. Horm.
66, 403456.
Matherly, L. H., Czajkowski, C. A., and Angeles, S. M. (1991). Identification of a highly
glycosylated methotrexate membrane carrier in K562 erythroleukemia cells up-regulated
for tetrahydrofolate cofactor and methotrexate transport. Cancer Res. 51, 34203426.
180 Larry H. Matherly and Zhanjun Hou
Matherly, L. H., Hou, Z., and Deng, Y. (2007). Human reduced folate carrier: Translation
of basic biology to cancer etiology and therapy. Cancer Metastasis Rev. 26, 111128.
Merickel, A., Kaback, H. R., and Edwards, R. H. (1997). Charged residues in transmem-
brane domains II and XI of a vesicular monoamine transporter form a charge pair that
promotes high affinity substrate recognition. J. Biol. Chem. 272, 54035408.
Miyazaki, H., Sekine, T., and Endou, H. (2004). The multispecific organic anion transporter
family: Properties and pharmacological significance. Trends Pharmacol. Sci. 25, 654662.
Monahan, B. P., and Allegra, C. J. (2001). Antifolates. In Cancer Chemotherapy
and Biotherapy (B. A. Chabner and D. L. Longo, eds.), 4th edn., pp. 109148.
Lippincott-Raven, Philadelphia.
Moscow, J. A., Gong, M. K., He, R., Sgagias, M. K., Dixon, K. H., Anzick, S. L.,
Meltzer, P. S., and Cowan, K. H. (1995). Isolation of a gene encoding a human reduced
folate carrier (RFC1) and analysis of its expression in transport-deficient, methotrexate-
resistant human breast cancer cells. Cancer Res. 55, 37903794.
Mutch, D. M., Anderle, P., Fiaux, M., Mansourian, R., Vidal, K., Wahli, W.,
Williamson, G., and Roberts, M. A. (2004). Regional variations in ABC transporter
expression along the mouse intestinal tract. Physiol. Genomics 17, 1120.
Nguyen, T. T., Dyer, D. L., Dunning, D. D., Rubin, S. A., Grant, K. E., and Said, H. M.
(1997). Human intestinal folate transport: Cloning, expression, and distribution of
complementary RNA. Gastroenterology 112, 783791.
Nicoll, D. A., Ottolia, M., Lu, L., Lu, Y., and Philipson, K. D. (1999). A new topological
model of the cardiac sarcolemmal Na-Ca2 exchanger. J. Biol. Chem. 274, 910917.
Nozaki, Y., Kusuhara, H., Endou, H., and Sugiyama, Y. (2004). Quantitative evaluation of
the drugdrug interactions between methotrexate and nonsteroidal anti-inflammatory
drugs in the renal uptake process based on the contribution of organic anion transporters
and reduced folate carrier. J. Pharmacol. Exp. Ther. 309, 226234.
Patterson, D., Graham, C., Cherian, C., and Matherly, L. H. (2008). A humanized mouse
model for the reduced folate carrier. Mol. Genet. Metab. 93, 95103.
Popp, C., Gorboulev, V., Muller, T. D., Gorbunov, D., Shatskaya, N., and Koepsell, H.
(2005). Amino acids critical for substrate affinity of rat organic cation transporter 1 line
the substrate binding region in a model derived from the tertiary structure of lactose
permease. Mol. Pharmacol. 67, 16001611.
Prasad, P. D., Ramamoorthy, S., Leibach, F. H., and Ganapathy, V. (1995). Molecular
cloning of the human placental folate transporter. Biochem. Biophys. Res. Commun.
206, 681687.
Price, E. M., Sams, L., Harpring, K. M., Kempton, R. J., and Freisheim, J. H. (1986).
Photoaffinity analogues of methotrexate as probes for dihydrofolate reductase structure
and function. Biochem. Pharmacol. 35, 43414343.
Russel, F. G., Masereeux, R., and van Aubel, R. A. (2002). Molecular aspects of renal
anionic drug transport. Annu. Rev. Physiol. 64(2002), 563594.
Qiu, A., Jansen, M., Sakaris, A., Min, S. H., Chattopadhyay, S., Tsai, E., Sandoval, C.,
Zhao, R., Akabas, M. H., and Goldman, I. D. (2006). Identification of an intestinal folate
transporter and the molecular basis for hereditary folate malabsorption. Cell 127,
917928.
Rong, N., Selhub, J., Goldman, B. R., and Rosenberg, I. H. (1991). Bacterially synthesized
folate in rat large intestine is incorporated into host tissue folate polyglutamates. J. Nutr.
121, 19551959.
Rothem, L., Ifergan, I., Kaufman, Y., Priest, D. G., Jansen, G., and Assaraf, Y. G. (2002).
Resistance to multiple novel antifolates is mediated via defective drug transport resulting
from clustered mutations in the reduced folate carrier gene in human leukemia cell lines.
Biochem. J. 367, 741750.
Structure and Function of the Reduced Folate Carrier 181
Rothem, L., Aronheim, A., and Assaraf, Y. G. (2003). Alterations in the expression of
transcription factors and the reduced folate carrier as a novel mechanism of antifolate
resistance in human leukemia cells. J. Biol. Chem. 278, 89358941.
Roy, Y. G., Tolner, K., Chiao, B., and Sirotnak, J. H. (1998). A single amino acid difference
within the folate transporter encoded by the murine RFC-1 gene selectively alters its
interaction with folate analogues. Implications for intrinsic antifolate resistance and
directional orientation of the transporter within the plasma membrane of tumor cells.
J. Biol. Chem. 273, 25262531.
Russel, F. G., Masereeux, R., and van Aubel, R. A. (2002). Molecular aspects of renal
anionic drug transport. Annu. Rev. Physiol. 64, 563594.
Sadlish, H., Murray, R. C., Williams, F. M., and Flintoff, W. F. (2000). Mutations in the
reduced-folate carrier affect protein localization and stability. Biochem. J. 346, 509518.
Sadlish, H., Williams, F. M., and Flintoff, W. F. (2002a). Cytoplasmic domains of the reduced
folate carrier are essential for trafficking, but not function. Biochem. J. 364, 777786.
Sadlish, H., Williams, F. M., and Flintoff, W. F. (2002b). Functional role of arginine 373 in
substrate translocation by the reduced folate carrier. J. Biol. Chem. 277, 4210542112.
Said, H. M. (2004). Recent advances in carrier mediated intestinal absorption of water
soluble vitamins. Annu. Rev. Physiol. 66, 419446.
Saier, M. H., Jr., Beatty, J. T., Goffeau, A., Harley, K. T., Heijne, W. H., Huang, S. C.,
Jack, D. L., Jahn, P. S., Lew, K., Liu, J., Pao, S. S., Paulsen, I. T., et al. (1999). The major
facilitator superfamily. J. Mol. Microbiol. Biotechnol. 1, 257279.
Salas-Burgos, A., Iserovich, P., Zunia, F., Vera, J. C., and Fischbarg, J. (2004). Predicting the
three dimensional structure of the human facilitative glucose transporter Glut1 by a novel
evolutionary homology strategy: Insights on the molecular mechanism of substrate
migration, and binding sites for glucose and inhibitory molecules. Biophys. J. 87,
29902999.
Salazar, M. D., and Ratnam, M. (2007). The folate receptor: What does it promise in tissue-
targeted therapeutics? Cancer Metastasis Rev. 26, 141152.
Schuetz, J. D., Matherly, L. H., Westin, E. H., and Goldman, I. D. (1988). Evidence for a
functional defect in the translocation of the methotrexate transport carrier in a
methotrexate-resistant murine L1210 leukemia cell line. J. Biol. Chem. 263, 98409847.
Sharina, I. G., Zhao, R., Wang, Y., Babani, S., and Goldman, I. D. (2001). Mutational
analysis of the functional role of conserved Arginine and Lysine residues in transmem-
brane domains of the murine reduced folate carrier. Mol. Pharmacol. 59, 10221028.
Sharina, I. G., Zhao, R., Wang, Y., Babani, S., and Goldman, I. D. (2002). Role of the
C-terminus and the long cytoplasmic loop in reduced folate carrier expression and
function. Biochem. Pharmacol. 63, 17171724.
Sirotnak, F. M. (1985). Obligate genetic expression in tumor cells of a fetal membrane
property mediating folate transport: Biological significance and implications for
improved therapy of human cancer. Cancer Res. 45, 39924000.
Sirotnak, F. M., and Donsbach, R. C. (1974). Stereochemical characteristics of the folate-
antifolate transport mechanism in L1210 leukemia cells. Cancer Res. 34, 371377.
Sirotnak, F. M., Kurita, S., and Hutchison, D. J. (1968). On the nature of a transport
alteration determining resistance to amethopterin in the L1210 leukemia. Cancer Res.
28, 7580.
Sirotnak, F. M., Chello, P. L., Moccio, D. M., Kisliuk, R. L., Combepine, G.,
Gaumont, Y., and Montgomery, J. A. (1979). Stereospecificity at carbon 6 of formylte-
trahydrofolate as a competitive inhibitor of transport and cytotoxicity of methotrexate
in vivo. Biochem. Pharmacol. 28, 29932997.
Sirotnak, F. M., Moccio, D. M., Kelleher, L. E., and Goutas, L. J. (1981). Relative
frequency and kinetic properties of transport-defective phenotypes among methotrexate
resistant L1210 clonal cell lines derived in vivo. Cancer Res. 41, 44424452.
182 Larry H. Matherly and Zhanjun Hou
Sirotnak, F. M., Moccio, D. M., and Yang, C. H. (1984). A novel class of genetic variants of
the L1210 cell up-regulated for folate analogue transport inward. Isolation, characteriza-
tion, and degree of metabolic instability of the system. J. Biol. Chem. 259, 1313913144.
Slotboom, D. J., Konings, W. N., and Lolkema, J. S. (2001). Cysteine-scanning mutagenesis
reveals a highly amphipathic, pore-lining membrane-spanning helix in the glutamate
transporter GltT. J. Biol. Chem. 276, 1077510781.
Spector, C., and Johanson, C. (2006). Micronutrient and urate transport in choroid plexus
and kidney: Implications for drug therapy. Pharm. Res. 23, 25152524.
Spector, R., and Lorenzo, A. V. (1975). Folate transport by the choroid plexus in vivo. Science
187, 540542.
Stokstad, E. L. R. (1990). Historical perspective on key advances in the biochemistry and
physiology of folates. In Folic Acid Metabolism in Health and Disease (M. F. Picciano,
E. L. R. Stokstad, and J. F. Gregory, eds.), pp. 121. Wiley-Liss, New York.
Suleiman, S. A., and Spector, R. (1981). Purification and characterization of a folate binding
protein from porcine choroid plexus. Arch. Biochem. Biophys. 208, 8794.
Sweiry, J. H., and Yudlievich, D. L. (1985). Transport of folates at maternal and fetal sides of
the placenta. Lack of inhibition by methotrexate. Biochim. Biophys. Acta 821, 497501.
Tse, A., Brigle, K., Taylor, S. M., and Moran, R. G. (1998). Mutations in the reduced folate
carrier gene which confer dominant resistance to 5,10-dideazatetrahydrofolate. J. Biol.
Chem. 273, 2595325960.
Wang, Y., Zhao, R., Russell, R. G., and Goldman, I. D. (2001). Localization of the murine
reduced folate carrier as assessed by immunohistochemical analysis. Biochim. Biophys. Acta
1513, 4954.
Westerhof, G. R., Schornagel, J. H., Kathmann, I., Jackman, A. L., Rosowsky, A.,
Forsch, R. A., Hynes, J. B., Boyle, F. T., Peters, G. J., Pinedo, H. M., and Jansen, G.
(1995). Carrier- and receptor-mediated transport of folate antagonists targeting folate-
dependent enzymes: Correlates of molecular-structure and biological activity. Mol.
Pharmacol. 48, 459471.
Whetstine, J. R., Flatley, R. M., and Matherly, L. H. (2002). The human reduced folate
carrier gene is ubiquitously and differentially expressed in normal human tissues: Identi-
fication of seven non-coding exons and characterization of a novel promoter. Biochem. J.
367, 629640.
White, J. C., Bailey, B. D., and Goldman, I. D. (1978). Lack of stereospecificity at carbon
6 of methyltetrahydrofolate transport in Ehrlich ascites tumor cells. J. Biol. Chem.
253, 242245.
Williams, F. M. R., and Flintoff, W. F. (1995). Isolation of a human cDNA that comple-
ments a mutant hamster cell defective in methotrexate uptake. J. Biol. Chem. 270,
29872992.
Williams, F. M. R., Murray, R. C., Underhill, T. M., and Flintoff, W. F. (1994). Isolation of
a hamster cDNA clone coding for a function involved in methotrexate uptake. J. Biol.
Chem. 269, 58105816.
Witt, T. L., and Matherly, L. H. (2002). Identification of lysine-411 in the human reduced
folate carrier as an important determinant of substrate selectivity and carrier function by
systematic site-directed mutagenesis. Biochim. Biophys. Acta 1567, 5662.
Witt, T. L., Stapels, S., and Matherly, L. H. (2004). Restoration of transport activity by co-
expression of human reduced folate carrier half molecules in transport impaired K562
cells: Localization of a substrate binding domain to transmembrane domains 712. J. Biol.
Chem. 279, 4675546763.
Wong, S. C., Proefke, S. A., Bhushan, A., and Matherly, L. H. (1995). Isolation of human
cDNAs that restore methotrexate sensitivity and reduced folate carrier activity in metho-
trexate transport- defective Chinese hamster ovary cells. J. Biol. Chem. 270,
1746817475.
Structure and Function of the Reduced Folate Carrier 183
Wong, S. C., McQuade, R., Proefke, S. A., Bhushan, A., and Matherly, L. H. (1997).
Human K562 transfectants expressing high levels of reduced folate carrier but exhibiting
low transport activity. Biochem. Pharmacol. 53, 199206.
Wong, S. C., Zhang, L., Proefke, S. A., and Matherly, L. H. (1998). Effects of the loss of
capacity for N-glycosylation on the transport activity and cellular localization of the
human reduced folate carrier. Biochim. Biophys. Acta 1375, 612.
Wong, S. C., Zhang, L., Witt, T. L., Proefke, S. A., Bhushan, A., and Matherly, L. H.
(1999). Impaired membrane transport in methotrexate-resistant CCRF-CEM cells
involves early translation termination and increased turnover of a mutant reduced folate
carrier. J. Biol. Chem. 274, 1038810394.
Yang, C.-H., Sirotnak, F. M., and Dembo, M. (1984). Interaction between anions and the
reduced folate/methotrexate transport system in L1210 cell plasma membrane vesicles:
Directional symmetry and anion specificity for differential mobility of loaded and
unloaded carrier. J. Membr. Biol. 70, 285292.
Yang, C. H., Pain, J., and Sirotnak, F. M. (1992). Alteration of folate analogue transport
inward after induced maturation of HL-60 leukemia cells. Molecular properties of the
transporter in an overproducing variant and evidence for down-regulation of its synthesis
in maturating cells. J. Biol. Chem. 267, 66286634.
Yang, R., Sowers, R., Mazza, B., Healey, J. H., Huvos, A., Grier, H., Bernstein, M.,
Beardsley, G. P., Krailo, M. D., Devidas, M., Bertino, J. R., Meyers, P., et al. (2002).
Sequence alterations in the reduced folate carrier are observed in osteosarcoma tumor
samples. Clin. Cancer Res. 9, 837844.
Yin, Y., He, X., Szewczyk, P., Nguyen, T., and Chang, G. (2006). Structure of the
multidrug transporter EmrD from Escherichia coli. Science 312, 741744.
Yu, H., Kono, M., McKee, T. D., and Oprian, D. D. (1995). A general method for mapping
tertiary contacts between amino acid residues in membrane-embedded proteins. Biochemistry
34, 1496314969.
Zeng, F. Y., Hopp, A., Soldner, A., and Wess, J. (1999). Use of a disulfide cross-linking
strategy to study muscarinic receptor structure and mechanisms of activation. J. Biol.
Chem. 274, 1662916640.
Zhang, X., Shirahatti, N. V., Mahadevan, D., and Wright, S. H. (2005). A conserved
glutamate residue in transmembrane helix 10 influences substrate specificity of rabbit
OCT2 (SLC22A2). J. Biol. Chem. 280, 3481334822.
Zhao, R., and goldman, I. D. (2003). Resistance to antifolates. Oncogene 22, 74317457.
Zhao, R., and Goldman, I. D. (2007). The molecular identity and characterization of a
proton-coupled folate transporterPCFT; biological ramifications and impact on the
activity of pemetrexed. Cancer Metastasis Rev. 26, 129139.
Zhao, R., Assaraf, Y. G., and Goldman, I. D. (1998a). A mutated murine reduced folate
carrier (RFC1) with increased affinity for folic acid, decreased affinity for methotrexate,
and an obligatory anion requirement for transport function. J. Biol. Chem. 273,
1906519071.
Zhao, R., Assaraf, Y. G., and Goldman, I. D. (1998b). A reduced carrier mutation produces
substrate-dependent alterations in carrier mobility in murine leukemia cells and metho-
trexate resistance with conservation of growth in 5-formyltetrahydrofolate. J. Biol. Chem.
273, 78737879.
Zhao, R., Gao, F., and Goldman, I. D. (1999). Discrimination among reduced folates and
methotrexate as transport substrates by a phenylalanine substitution for serine within the
predicted eighth transmembrane domain of the reduced folate carrier. Biochem. Pharmacol.
58, 16151624.
Zhao, R., Gao, F., Babani, S., and Goldman, I. D. (2000a). Sensitivity to 5,10-dideazatetra-
hydrofolate is fully conserved in a murine leukemia cell line highly resistant to
184 Larry H. Matherly and Zhanjun Hou
methotrexate due to impaired transport mediated by the reduced folate carrier. Clin.
Cancer Res. 6, 33043311.
Zhao, R., Gao, F., Liu, L., and Goldman, I. D. (2000b). The reduced folate carrier in L1210
murine leukemia cells is a 58 kDa protein. Biochim. Biophys. Acta 1466, 710.
Zhao, R., Gao, F., Wang, P. J., and Goldman, I. D. (2000c). Role of the amino acid 45
residue in reduced folate carrier function and ion-dependent transport as characterized by
site-directed mutagenesis. Mol. Pharmacol. 57, 317323.
Zhao, R., Gao, F., Wang, Y., Diaz, G. A., Gelb, B. D., and Goldman, I. D. (2001a). Impact
of the reduced folate carrier on the accumulation of active thiamin metabolites in murine
leukemia cells. J. Biol. Chem. 276, 11141118.
Zhao, R., Russell, R. G., Wang, Y., Liu, L., Gao, F., Kneitz, B., Edelman, W., and
Goldman, I. D. (2001b). Rescue of embryonic lethality in reduced folate carrier-deficient
mice by maternal folic acid supplementation reveals early neonatal failure of hemato-
poietic organs. J. Biol. Chem. 276, 1022410228.
Zhao, R., Wang, Y., Gao, F., and Goldman, I. D. (2003). Residues 45 and 404 in the
murine reduced folate carrier may interact to alter carrier binding and mobility. Biochim.
Biophys. Acta 1613, 4956.
Zhou, F., and You, G. (2007). Molecular insights into the structure-function relationship of
organic anion transporters OATs. Pharm. Res. 24, 2836.
C H A P T E R S I X
Contents
I. Introduction 186
II. Physicochemical Properties, Protein Binding,
and Water Solubility 186
III. Role of Folates in Genomic Stability 188
IV. Folates and the Kidney 188
V. Folate Transport Proteins 189
A. a-Folate receptor 189
B. Reduced folate carrier 190
C. Proton-coupled folate transporter 191
D. Organic anion transporters and multidrug resistance protein 192
VI. Localization of Putative Folate Transporters in Kidney 192
VII. Clinical Studies of Renal Handling of Folates and Antifolates 193
A. Folates 193
B. Antifolates 194
VIII. Role of Renal Folate Conservation in Ethanol-Related
Folate Deficiency 196
IX. Role of Folate Transport Processes in Renal Conservation
of Folates and Antifolates 197
References 198
Abstract
Folates play vital roles in one-carbon metabolism that produces the early
substrates necessary for nucleotide synthesis and salvage. Folates are essen-
tial vitamins in that humans cannot synthesize them and are totally dependent
on the diet to obtain them. As water-soluble vitamins, they would be easily
filtered by the kidney and lost to the tubular fluid but for a highly efficient renal
conservation mechanism. This renal folate trap is made up of a-folate recep-
tors and reduced folate carriers. The locations of these transporters are such
185
186 Vijaya L. Damaraju et al.
that they direct folate transport from the apical/luminal sides of kidney cells to
the basolateral/plasma sides. In addition, other transporters such as organic
anion transporters and multidrug resistance proteins are also found in kidney
cells and play a role in renal elimination of folate analogues such as antifolate
cancer chemotherapy drugs. This chapter discusses how these transporter
activities manifest themselves in folate and antifolate pharmacokinetics. It also
discusses effects of alcohol on renal reabsorption of folates. 2008 Elsevier Inc.
I. Introduction
This chapter reviews the current understanding of renal handling of
folates in mammals and the molecular processes underlying folate homeo-
stasis. Various folate analogues and their chemical structures and properties
are described briefly followed by a description of the roles that folates play in
one-carbon metabolism, especially their pivotal role in thymidine synthesis.
Then the early studies that demonstrated the kidneys role in maintaining
the bodys folate stores are reviewed.
Roles of several folate transport proteins including a-folate receptors
(aFRs), reduced folate carriers (RFCs), proton-coupled folate transporters
(PCFTs), organic anion transporters (OATs), and multidrug resistance pro-
teins (MRPs) in renal reabsorption are then reviewed. Clinical implications
of renal reabsorption of folates and antifolates are also discussed.
HO O
O
HN
OH
OH 5 O
N 10
N N
H
H2N N N
2-Amino-6-((P-((1,3-dicarboxypropyl)carbamoyl)anilino)methyl)-4-pteridinol
(Folic acid)
HO O
O
HN
OH
N H2 5 O
N 10
N N
H2N CH3
N N
Figure 6.1 Structures of folic acid and derivatives and their role in metabolism.
healthy volunteers and found that at high doses, renal excretion of folic acid
approximated renal excretion of inulin, which provides a measure of renal
glomerular filtration. The same researchers confirmed the earlier study more
accurately using [3H] folic acid with a higher specific activity in studies
using dogs. They also demonstrated that methotrexate (MTX), a folate
analogue used in cancer treatment, displaced [3H] folic acid from the binding
sites for folic acid.
Mechanisms of renal folate reabsorption remained unsolved until the
studies of Selhub et al. (1987) who investigated the roles of aFRs and RFCs
in the process of renal reabsorption. Selhub et al. (1987) showed that renal
clearance was less than that of inulin, suggesting reabsorption. Renal con-
servation of folate occurs by specialized processes that depend on circulating
folate concentrations and appear to involve FRs, RFCs, and possibly the
PCFT/HCP1 systems (Bhandari et al., 1991; Kamen and Caston, 1975;
McMartin et al., 1992; Morshed et al., 1997; Qiu et al., 2006; Sikka and
McMartin, 1998). In addition to the above-mentioned transporters, OATs
and MRPs were shown to have a role in renal folate transport processes.
A concerted action of these proteins is required to provide mammalian cells
with adequate folate cofactors for nucleotide synthesis. Folate uptake pro-
cesses in apical versus basolateral membranes are important determinants of
the vectorial flow of substrates across cells. In addition to maintaining
cellular folate homeostasis, folate membrane transporters play an important
role in antitumor activity of many antifolates used in cancer therapy.
that the affinity of the aFR for a folate derivative was inversely related to its
clearance and, although aFR had the lowest affinity for MTX of the folate
derivatives tested, MTX was also reabsorbed. McMartin et al. (1992) studied
folate transport by human renal proximal tubule epithelial cells (RPTEC)
and demonstrated that aFRs were responsible for folate reabsorption and
showed that this reabsorption was pH dependent being maximal at pH 5.0.
Morshed et al. studied the transepithelial transport of folates using renal
proximal tubule epithelial cells grown on collagen-coated inserts
(McMartin et al., 1992; Morshed et al., 1997). They showed (using probene-
cid as an RFC inhibitor) that folate uptake at apical membranes was due to
aFRs and RFCs, whereas folate transport at basolateral membranes was due
to RFCs. aFRs were localized to brush border membranes of proximal
tubular epithelial cells in human kidney (Weitman et al., 1992). More
recently, the importance of aFRs in renal folate transport and conservation
was demonstrated in mice in which the genes folbp1 and folbp2 were deleted
(Birn et al., 2005). Elevated (100 times higher than in wild type) folate renal
clearances at low and high folate intakes were demonstrated in mice in whom
folbp1 (similar to aFRs in humans) was knocked out thus implicating folbp1 in
folate renal reabsorption. aFRs have high affinities for folic acid and MTX
with Km values of 1 and 100 nM, respectively ( Jansen et al., 1999). aFRs
have higher affinities for a number of folate and antifolate compounds than
bFRs (Brigle et al., 1994). Differences in binding affinities were shown to be
due to amino acid sequence differences in the binding sites between bFRs
(Leu-49, Phe-104, and Gly-164) and aFRs (Ala, Val, and Glu) (Maziarz et al.,
1999). Folate uptake by membrane bound aFRs was postulated to occur by
endocytotic processes. Folates bound to aFRs form vesicles that are then
endocytosed into cytosol, after which acidification releases folates from the
receptor complexes followed by transport into cytosol (Kamen et al., 1988;
Rothberg et al., 1990). The role of potocytosis, which is another uptake
process that has been described in cultured cells (Anderson et al., 1992), in
cellular uptake of folates is considered more controversial than the more
generally accepted endocytotic processes.
Wong et al., 1995), they encode the same protein. RFC exhibits broad
tissue distribution and human RFC transcripts were detected in 68 human
tissues (Whetstine et al., 2002). Immunohistochemistry studies in mice have
demonstrated RFC proteins in brush-border membranes of the jejunum,
ileum, duodenum, and colon and in basolateral membranes of renal tubular
epithelia (Wang et al., 2001). Cell-specific localization and expression of
RFC may reflect its differential roles in relation to tissue needs. RFC is a
facilitative carrier (i.e., nonconcentrative) for folates and other anionic
compounds. RFCs have different affinities for folates compared with
aFRs. Human RFCs have higher affinities for MTX and reduced folates
(Km 15 mM) than for folic acid (Km 100200 mM). In contrast,
aFRs have higher affinities for folic acid (Kd 1 nM) and reduced folates
(5-formyltetrahydrofolate and 5-methylTHF, Kd 1040 nM) than MTX
(Kd 150 nM) (Spinella et al., 1995). For an extensive review of RFCs, see
Matherly (2001) and Matherly and Goldman (2003).
Apical
MRP 2/4
Oat-K1/OAT4
FR
Basolateral
Proximal tubule
cell MRP1
hOAT2/3
RFC
MRP3
(with relatively low activity) in 16 adult males whose age ranged from 22 to
29 years. When they administered 1 mg/kg to subjects, less than 2% of
radioactivity was recovered in the urine after 2 h. After administering
15 mg/kg, 25% of the radioactivity was recovered in the urine. At higher
doses of 150 and 1430 mg/kg, 60% to 70% of the administered radioac-
tivity was recovered in the urine. Based on these results, they concluded that
folic acid was reabsorbed by the kidney. They subsequently replicated these
experiments in vitro using dogs and [3H] folic acid as reported by Goresky
et al. (1963) In this later study, dogs were anaesthetized, their ureters were
catheterized, and [3H] folic acid was injected directly into the renal artery
along with inulin, the latter to serve as a measure of the glomerular filtration
rate. At least 25 urine samples were then collected over the ensuing 10 min.
At high doses, folic acid elimination paralleled and closely approximated
inulin filtration; whereas at low doses, folic acid secretion was substantially
less than that of inulin filtration, suggesting renal reabsorption. Interestingly
when MTX was coadministered with inulin and low dose [3H] folic acid,
the folic acid elimination approximated inulin filtration, suggesting that
MTX competed with folic acid to be reabsorbed. Selhub et al. (1987)
have studied other folate analogues in rats. They administered [3H]
folic acid, 5-methylTHF, or MTX to rats by either intravenous bolus
or continuous infusion found that urinary clearance was least for
5-methylTHF at 0.026 ml/min, followed by 0.343 ml/min for folic acid
and 1.51 ml/min for MTX. Comparing these folate urinary clearances to
the apparent urinary clearance for inulin, it was concluded that all three
folates (folic acid, 5-methylTHF, and MTX) were reabsorbed.
B. Antifolates
In contrast to studies with folates in healthy volunteers which clearly
showed reabsorption, studies in cancer patients receiving therapeutic doses
of antifolates have been less clear with many contradicting results. Calvert
et al. (1977) studied 18 cancer patients receiving MTX treatment either as
continuous intravenous infusion or as bolus. In all but 1 of the 18 patients,
renal MTX clearance was less than the measured glomerular filtration rate,
suggesting renal reabsorption. Hendel and Nyfors (1984) studied renal
clearance of low-dose MTX in 12 patients with psoriasis who were treated
with MTX with doses ranging from 7.5 to 30 mg. They found MTX had its
highest renal clearance at high initial concentrations but as plasma concen-
trations fell so did renal MTX elimination. Similarly in the phase I study of
ZD9331, a folate analogue that cannot be polyglutamated, Goh et al. (2001)
found as the dose of ZD9331 increased, the clearance increased, suggesting
renal reabsorption. As well, Sawyer et al. (2003) in a study of the oral
formulation of ZD9331 found that elevated blood urea nitrogen levels,
Renal Handling of Folates and Antifolates 195
binding. Hamid and Kaur (2005) studied the effect of chronic alcohol
administration on binding of folates to rat renal brush border membranes
and, in contrast to the work of McMartin et al., found a decreased Bmax
without any change in the affinity (Kd). Romanoff et al. (2007) revisited the
issue of alcohols effect on folate transport using cultured human proximal
tubule cells. In their experiments, cells were exposed to alcohol in culture
media either for 1 h or for 5 days. Transport experiments were done on
membrane inserts so that alcohol effects on apical and basolateral transport
could be dissected. They found that alcohol decreased apical transport by
2025% without affecting basolateral transport. They did not find an effect
of alcohol on the Bmax or Kd values of brush border membranes for folate.
After 5 days of exposure, they found an upregulation of both FRs and RFC
levels. In terms of the effects that alcohol has on renal conservation of folate,
there is evidence that acute ethanol exposure decreases renal reabsorption of
folate based on both in vivo and in vitro studies. The in vitro studies have not
yet produced a convincing explanation of the cause of the altered renal
reabsorption.
REFERENCES
Anderson, R. G., Kamen, B. A., Rothberg, K. G., and Lacey, S. W. (1992). Potocytosis:
Sequestration and transport of small molecules by caveolae. Science 255, 410411.
Balinska, M., Nimec, Z., and Galivan, J. (1982). Characteristics of methotrexate polygluta-
mate formation in cultured hepatic cells. Arch. Biochem. Biophys. 216, 466476.
Bhandari, S. D., Joshi, S. K., and McMartin, K. E. (1988). Folate binding and transport by rat
kidney brush-border membrane vesicles. Biochim. Biophys. Acta 937, 211218.
Bhandari, S. D., Fortney, T., and McMartin, K. E. (1991). Analysis of the pH dependence of
folate binding and transport by rat kidney brush border membrane vesicles. Proc. Soc. Exp.
Biol. Med. 196, 451456.
Birn, H. (2006). The kidney in vitamin B12 and folate homeostasis: Characterization of
receptors for tubular uptake of vitamins and carrier proteins. Am. J. Physiol. Ren. Physiol.
291, F22F36.
Birn, H., Nielsen, S., and Christensen, E. I. (1997). Internalization and apical-to-basolateral
transport of folate in rat kidney proximal tubule. Am. J. Physiol. 272, F70F78.
Birn, H., Spiegelstein, O., Christensen, E. I., and Finnell, R. H. (2005). Renal tubular
reabsorption of folate mediated by folate binding protein 1. J. Am. Soc. Nephrol. 16,
608615.
Blount, B. C., and Ames, B. N. (1994). Analysis of uracil in DNA by gas chromatography-
mass spectrometry. Anal. Biochem. 219, 195200.
Bourke, R. S., Chheda, G., Bremer, A., Watanabe, O., and Tower, D. B. (1975). Inhibition
of renal tubular transport of methotrexate by probenecid. Cancer Res. 35, 110116.
Brigle, K. E., Spinella, M. J., Westin, E. H., and Goldman, I. D. (1994). Increased expression
and characterization of two distinct folate binding proteins in murine erythroleukemia
cells. Biochem. Pharmacol. 47, 337345.
Calvert, A. H., Bondy, P. K., and Harrap, K. R. (1977). Some observations on the human
pharmacology of methotrexate. Cancer Treat. Rep. 61, 16471656.
Cha, S. H., Sekine, T., Fukushima, J. I., Kanai, Y., Kobayashi, Y., Goya, T., and Endou, H.
(2001). Identification and characterization of human organic anion transporter 3 expres-
sing predominantly in the kidney. Mol. Pharmacol. 59, 12771286.
Chen, Z. S., Lee, K., Walther, S., Raftogianis, R. B., Kuwano, M., Zeng, H., and
Kruh, G. D. (2002). Analysis of methotrexate and folate transport by multidrug resistance
protein 4 (ABCC4): MRP4 is a component of the methotrexate efflux system. Cancer
Res. 62, 31443150.
Damaraju, V. L., Hamilton, K. F., Seth-Smith, M. L., Cass, C. E., and Sawyer, M. B. (2005).
Characterization of binding of folates and antifolates to brush-border membrane vesicles
isolated from human kidney. Mol. Pharmacol. 67, 453459.
Eichner, E. R., and Hillman, R. S. (1971). The evolution of anemia in alcoholic patients.
Am. J. Med. 50, 218232.
Renal Handling of Folates and Antifolates 199
Eichner, E. R., and Hillman, R. S. (1973). Effect of alcohol on serum folate level. J. Clin.
Invest. 52, 584591.
Evers, R., Zaman, G. J., van Deemter, L., Jansen, H., Calafat, J., Oomen, L. C., Oude
Elferink, R. P., Borst, P., and Schinkel, A. H. (1996). Basolateral localization and export
activity of the human multidrug resistance-associated protein in polarized pig kidney
cells. J. Clin. Invest. 97, 12111218.
Goh, B. C., Ratain, M. J., Bertucci, D., Smith, R., Mani, S., Vogelzang, N. J.,
Schilsky, R. L., Hutchison, M., Smith, M., Averbuch, S., and Douglass, E. (2001).
Phase I study of ZD9331 on short daily intravenous bolus infusion for 5 days every
3 weeks with fixed dosing recommendations. J. Clin. Oncol. 19, 14761484.
Goresky, C. A., Watanabe, H., and Johns, D. G. (1963). The renal excretion of folic acid.
J. Clin. Invest. 42, 18411849.
Halsted, C. H. (1980). Folate deficiency in alcoholism. Am. J. Clin. Nutr. 33, 27362740.
Hamid, A., and Kaur, J. (2005). Kinetic characteristics of folate binding to rat renal brush
border membrane in chronic alcoholism. Mol. Cell. Biochem. 280, 219225.
Hendel, J., and Nyfors, A. (1984). Nonlinear renal elimination kinetics of methotrexate due
to saturation of renal tubular reabsorption. Eur. J. Clin. Pharmacol. 26, 121124.
Hirohashi, T., Suzuki, H., and Sugiyama, Y. (1999). Characterization of the transport
properties of cloned rat multidrug resistance-associated protein 3 (MRP3). J. Biol.
Chem. 274, 1518115185.
Holm, J., Hansen, S. I., and Lyngbye, J. (1980). High-affinity binding of folate to a protein in
serum of male subjects. Clin. Chim. Acta 100, 113119.
Hooijberg, J. H., Broxterman, H. J., Kool, M., Assaraf, Y. G., Peters, G. J., Noordhuis, P.,
Scheper, R. J., Borst, P., Pinedo, H. M., and Jansen, G. (1999). Antifolate resistance
mediated by the multidrug resistance proteins MRP1 and MRP2. Cancer Res. 59,
25322535.
Huang, K. C., Wenczak, B. A., and Liu, Y. K. (1979). Renal tubular transport of metho-
trexate in the rhesus monkey and dog. Cancer Res. 39, 48434848.
Jansen, G., Barr, H., Kathmann, I., Bunni, M. A., Priest, D. G., Noordhuis, P., Peters, G. J.,
and Assaraf, Y. G. (1999). Multiple mechanisms of resistance to polyglutamatable and
lipophilic antifolates in mammalian cells: Role of increased folylpolyglutamylation,
expanded folate pools, and intralysosomal drug sequestration. Mol. Pharmacol. 55,
761769.
Johns, D. G., Sperti, S., and Burgen, A. S. (1961). The disposal of tritiated folic acid injected
intravenously in man. Can. Med. Assoc. J. 84, 7779.
Kamen, B. A., and Caston, J. D. (1975). Identification of a folate binder in hog kidney.
J. Biol. Chem. 250, 22032205.
Kamen, B. A., Wang, M. T., Streckfuss, A. J., Peryea, X., and Anderson, R. G. (1988).
Delivery of folates to the cytoplasm of MA104 cells is mediated by a surface membrane
receptor that recycles. J. Biol. Chem. 263, 1360213609.
Kusuhara, H., Han, Y. H., Shimoda, M., Kokue, E., Suzuki, H., and Sugiyama, Y. (1998).
Reduced folate derivatives are endogenous substrates for cMOAT in rats. Am. J. Physiol.
275, G789G796.
Lacey, S. W., Sanders, J. M., Rothberg, K. G., Anderson, R. G., and Kamen, B. A. (1989).
Complementary DNA for the folate binding protein correctly predicts anchoring to the
membrane by glycosyl-phosphatidylinositol. J. Clin. Invest. 84, 715720.
Liegler, D. G., Henderson, E. S., Hahn, M. A., and Oliverio, V. T. (1969). The effect
of organic acids on renal clearance of methotrexate in man. Clin. Pharmacol. Ther.
10, 849857.
Lu, R., Chan, B. S., and Schuster, V. L. (1999). Cloning of the human kidney PAH
transporter: Narrow substrate specificity and regulation by protein kinase C. Am. J.
Physiol. 276, F295F303.
200 Vijaya L. Damaraju et al.
Masuda, S., Saito, H., Nonoguchi, H., Tomita, K., and Inui, K. (1997). mRNA distribution
and membrane localization of the OAT-K1 organic anion transporter in rat renal tubules.
FEBS Lett. 407, 127131.
Matherly, L. H. (2001). Molecular and cellular biology of the human reduced folate carrier.
Prog. Nucleic Acid Res. Mol. Biol. 67, 131162.
Matherly, L. H., and Goldman, D. I. (2003). Membrane transport of folates. Vitam. Horm.
66, 403456.
Maziarz, K. M., Monaco, H. L., Shen, F., and Ratnam, M. (1999). Complete mapping of
divergent amino acids responsible for differential ligand binding of folate receptors alpha
and beta. J. Biol. Chem. 274, 1108611091.
McMartin, K. E., Collins, T. D., and Bairnsfather, L. (1986). Cumulative excess urinary
excretion of folate in rats after repeated ethanol treatment. J. Nutr. 116, 13161325.
McMartin, K. E., Morshed, K. M., Hazen-Martin, D. J., and Sens, D. A. (1992). Folate
transport and binding by cultured human proximal tubule cells. Am. J. Physiol. 263,
F841F848.
Monjanel, S., Rigault, J. P., Cano, J. P., Carcassonne, Y., and Favre, R. (1979). High-dose
methotrexate: Preliminary evaluation of a pharmacokinetic approach. Cancer Chemother.
Pharmacol. 3, 189196.
Morshed, K. M., Ross, D. M., and McMartin, K. E. (1997). Folate transport proteins
mediate the bidirectional transport of 5-methyltetrahydrofolate in cultured human prox-
imal tubule cells. J. Nutr. 127, 11371147.
Moscow, J. A., Gong, M., He, R., Sgagias, M. K., Dixon, K. H., Anzick, S. L.,
Meltzer, P. S., and Cowan, K. H. (1995). Isolation of a gene encoding a human reduced
folate carrier (RFC1) and analysis of its expression in transport-deficient, methotrexate-
resistant human breast cancer cells. Cancer Res. 55, 37903794.
Muldoon, R. T., and McMartin, K. E. (1994). Ethanol acutely impairs the renal conserva-
tion of 5-methyltetrahydrofolate in the isolated perfused rat kidney. Alcohol. Clin. Exp.
Res. 18, 333339.
Murphy, R. F., Powers, S., and Cantor, C. R. (1984). Endosome pH measured in single cells
by dual fluorescence flow cytometry: Rapid acidification of insulin to pH 6. J. Cell Biol.
98, 17571762.
Nguyen, T. T., Dyer, D. L., Dunning, D. D., Rubin, S. A., Grant, K. E., and Said, H. M.
(1997). Human intestinal folate transport: Cloning, expression, and distribution of
complementary RNA. Gastroenterology 112, 783791.
Prasad, P. D., Mahesh, V. B., Leibach, F. H., and Ganapathy, V. (1994). Functional coupling
between a bafilomycin A1-sensitive proton pump and a probenecid-sensitive folate
transporter in human placental choriocarcinoma cells. Biochim. Biophys. Acta 1222,
309314.
Prasad, P. D., Ramamoorthy, S., Leibach, F. H., and Ganapathy, V. (1995). Molecular
cloning of the human placental folate transporter. Biochem. Biophys. Res. Commun. 206,
681687.
Qiu, A., Jansen, M., Sakaris, A., Min, S. H., Chattopadhyay, S., Tsai, E., Sandoval, C.,
Zhao, R., Akabas, M. H., and Goldman, I. D. (2006). Identification of an intestinal folate
transporter and the molecular basis for hereditary folate malabsorption. Cell 127,
917928.
Ragoussis, J., Senger, G., Trowsdale, J., and Campbell, I. G. (1992). Genomic organization
of the human folate receptor genes on chromosome 11q13. Genomics 14, 423430.
Reidy, J. A. (1987). Folate- and deoxyuridine-sensitive chromatid breakage may result from
DNA repair during G2. Mutat. Res. 192, 217219.
Romanoff, R. L., Ross, D. M., and McMartin, K. E. (2007). Acute ethanol exposure
inhibits renal folate transport, but repeated exposure upregulates folate transport proteins
in rats and human cells. J. Nutr. 137, 12601265.
Renal Handling of Folates and Antifolates 201
Ross, D. M., and McMartin, K. E. (1996). Effect of ethanol on folate binding by isolated rat
renal brush border membranes. Alcohol 13, 449454.
Rothberg, K. G., Ying, Y. S., Kamen, B. A., and Anderson, R. G. (1990). Cholesterol
controls the clustering of the glycophospholipid-anchored membrane receptor for
5-methyltetrahydrofolate. J. Cell Biol. 111, 29312938.
Russell, R. M., Rosenberg, I. H., Wilson, P. D., Iber, F. L., Oaks, E. B., Giovetti, A. C.,
Otradovec, C. L., Karwoski, P. A., and Press, A. W. (1983). Increased urinary excretion
and prolonged turnover time of folic acid during ethanol ingestion. Am. J. Clin. Nutr.
38, 6470.
Sadasivan, E., and Rothenberg, S. P. (1989). The complete amino acid sequence of a human
folate binding protein from KB cells determined from the cDNA. J. Biol. Chem.
264, 58065811.
Said, H. M. (2004). Recent advances in carrier-mediated intestinal absorption of water-
soluble vitamins. Annu. Rev. Physiol. 66, 419446.
Sawyer, M. B., Ratain, M. J., Bertucci, D., Smith, R. P., Schilsky, R. L., Vogelzang, N. J.,
Shulman, K., Douglass, E. C., and Fleming, G. F. (2003). Phase I study of an oral
formulation of ZD9331 administered daily for 28 days. J. Clin. Oncol. 21, 18591865.
Schaub, T. P., Kartenbeck, J., Konig, J., Vogel, O., Witzgall, R., Kriz, W., and Keppler, D.
(1997). Expression of the conjugate export pump encoded by the mrp2 gene in the apical
membrane of kidney proximal tubules. J. Am. Soc. Nephrol. 8, 12131221.
Scheffer, G. L., Kool, M., de Haas, M., de Vree, J. M., Pijnenborg, A. C., Bosman, D. K.,
Elferink, R. P., van der Valk, P., Borst, P., and Scheper, R. J. (2002). Tissue distribution
and induction of human multidrug resistant protein 3. Lab. Invest. 82, 193201.
Selhub, J., and Rosenberg, I. H. (1978). Demonstration of high-affinity folate binding
activity associated with the brush border membranes of rat kidney. Proc. Natl. Acad. Sci.
USA 75, 30903093.
Selhub, J., and Franklin, W. A. (1984). The folate-binding protein of rat kidney. Purifica-
tion, properties, and cellular distribution. J. Biol. Chem. 259, 66016606.
Selhub, J., Emmanouel, D., Stavropoulos, T., and Arnold, R. (1987). Renal folate absorp-
tion and the kidney folate binding protein. I. Urinary clearance studies. Am. J. Physiol.
252, F750F756.
Sikka, P. K., and McMartin, K. E. (1998). Determination of folate transport pathways in
cultured rat proximal tubule cells. Chem. Biol. Interact. 114, 1531.
Soliman, H. A., and Olesen, H. (1976). Folic acid binding by human plasma albumin. Scand.
J. Clin. Lab. Invest. 36, 299304.
Spinella, M. J., Brigle, K. E., Sierra, E. E., and Goldman, I. D. (1995). Distinguishing
between folate receptor-alpha-mediated transport and reduced folate carrier-mediated
transport in L1210 leukemia cells. J. Biol. Chem. 270, 78427849.
Stover, P. J. (2004). Physiology of folate and vitamin B12 in health and disease. Nutr. Rev.
62, S3S12; discussion S13.
Sun, W., Wu, R. R., van Poelje, P. D., and Erion, M. D. (2001). Isolation of a family of
organic anion transporters from human liver and kidney. Biochem. Biophys. Res. Commun.
283, 417422.
Takeda, M., Babu, E., Narikawa, S., and Endou, H. (2002). Interaction of human organic
anion transporters with various cephalosporin antibiotics. Eur. J. Pharmacol. 438,
137142.
Takeuchi, A., Masuda, S., Saito, H., Doi, T., and Inui, K. (2001). Role of kidney-specific
organic anion transporters in the urinary excretion of methotrexate. Kidney Int. 60,
10581068.
Tamura, T., and Halsted, C. H. (1983). Folate turnover in chronically alcoholic monkeys.
J. Lab. Clin. Med. 101, 623628.
202 Vijaya L. Damaraju et al.
Tojo, A., Sekine, T., Nakajima, N., Hosoyamada, M., Kanai, Y., Kimura, K., and
Endou, H. (1999). Immunohistochemical localization of multispecific renal organic
anion transporter 1 in rat kidney. J. Am. Soc. Nephrol. 10, 464471.
Tolner, B., Roy, K., and Sirotnak, F. M. (1998). Structural analysis of the human RFC-1
gene encoding a folate transporter reveals multiple promoters and alternatively spliced
transcripts with 50 end heterogeneity. Gene 211, 331341.
van Aubel, R. A., Smeets, P. H., Peters, J. G., Bindels, R. J., and Russel, F. G. (2002). The
MRP4/ABCC4 gene encodes a novel apical organic anion transporter in human kidney
proximal tubules: Putative efflux pump for urinary cAMP and cGMP. J. Am. Soc.
Nephrol. 13, 595603.
Wang, Y., Zhao, R., Russell, R. G., and Goldman, I. D. (2001). Localization of the murine
reduced folate carrier as assessed by immunohistochemical analysis. Biochim. Biophys. Acta
1513, 4954.
Weitman, S. D., Weinberg, A. G., Coney, L. R., Zurawski, V. R., Jennings, D. S., and
Kamen, B. A. (1992). Cellular localization of the folate receptor: Potential role in drug
toxicity and folate homeostasis. Cancer Res. 52, 67086711.
Whetstine, J. R., Flatley, R. M., and Matherly, L. H. (2002). The human reduced folate
carrier gene is ubiquitously and differentially expressed in normal human tissues: Identi-
fication of seven non-coding exons and characterization of a novel promoter. Biochem. J.
367, 629640.
Williams, F. M., and Flintoff, W. F. (1995). Isolation of a human cDNA that complements a
mutant hamster cell defective in methotrexate uptake. J. Biol. Chem. 270, 29872992.
Wong, S. C., Proefke, S. A., Bhushan, A., and Matherly, L. H. (1995). Isolation of human
cDNAs that restore methotrexate sensitivity and reduced folate carrier activity in metho-
trexate transport-defective Chinese hamster ovary cells. J. Biol. Chem. 270, 1746817475.
Zeng, H., Liu, G., Rea, P. A., and Kruh, G. D. (2000). Transport of amphipathic anions by
human multidrug resistance protein 3. Cancer Res. 60, 47794784.
Zeng, H., Chen, Z. S., Belinsky, M. G., Rea, P. A., and Kruh, G. D. (2001). Transport of
methotrexate (MTX) and folates by multidrug resistance protein (MRP) 3 and MRP1:
Effect of polyglutamylation on MTX transport. Cancer Res. 61, 72257232.
Zettner, A., and Duly, P. E. (1978). The weak binding reaction between folate and human
serum proteins. Ann. Clin. Lab. Sci. 8, 5763.
Zhao, R., and Goldman, I. D. (2007). The molecular identity and characterization of a
proton-coupled folate transporterPCFT; biological ramifications and impact on the
activity of pemetrexed. Cancer Metastasis. Rev. 26, 129139.
Zhao, R., Gao, F., Hanscom, M., and Goldman, I. D. (2004). A prominent low-pH
methotrexate transport activity in human solid tumors: Contribution to the preservation
of methotrexate pharmacologic activity in HeLa cells lacking the reduced folate carrier.
Clin. Cancer Res. 10, 718727.
Zhao, R., Hanscom, M., and Goldman, I. D. (2005). The relationship between folate
transport activity at low pH and reduced folate carrier function in human Huh7
hepatoma cells. Biochim. Biophys. Acta 1715, 5764.
C H A P T E R S E V E N
Contents
I. Introduction 204
II. Aspects of the FR 205
A. FR isoforms 205
B. FR tissue expression 206
III. Exploitation of the FR for Disease Management 208
A. FR role as a biomarker 208
B. Cancer therapy 212
C. Inflammation therapy 223
D. Modulation of FR expression levels 224
IV. Future Prospects 225
References 226
Abstract
Over the last 25 years, the folate receptor (FR) has emerged as an attractive
tumor biomarker with the potential to be exploited for therapeutic purposes.
Increasing evidence suggests that this endocytosing protein can functionally
mediate the cellular uptake and retention of natural folates, certain antifolates,
and folate-drug conjugates; the consequences of the latter two events could
result in biological modulation, including (but not limited to) tumor-targeted
cytotoxicity. Because its tissue expression profile appears to be somewhat
limited to either tissues responsible for whole body retention of folates (e.g.,
kidney and placenta), or certain pathologic tissues (e.g., tumors or activated
macrophages), the FR is believed to be a useful biological target for disease
management. Indeed, recent years have been peppered with reports of novel
FR-targeted therapies, and many have demonstrated impressive in vivo potency,
particularly against tumor xenografts, without the undesirable toxicity that often
203
204 Christopher P. Leamon and Ann L. Jackman
I. Introduction
Folic acid (FA), or vitamin B9, is an essential nutrient required by all
living cells for proper metabolic maintenance of one-carbon pathways as
well as for nucleotide biosynthesis (Clifford et al., 1998). This ligand displays
extremely high affinity (KD 100 pM) for a cell surface-oriented glyco-
protein called the folate receptor (FR), which is a glycosylphosphatidylino-
sitol (GPI)-linked protein that captures its ligands from the extracellular
milieu (Luhrs and Slomiany, 1989). The FR also binds the biologically
active and reduced form of FA, namely 5-methyltetrahydrofolate, with high
affinity (Kamen and Capdevila, 1986). Immediately after binding, the plasma
membrane surrounding the FRligand complex will invaginate to form an
internal vesicle, called an endosome (see Fig. 7.1). The pH of the vesicle
lumen is somewhat lowered through the action of proton pumps that are
colocalized in the endosome membrane, and this acidification presumably
mediates a conformational change in the FR protein to release its bound
ligand to allow for cytosolic entry (Leamon and Reddy, 2004). Whereas all
eukaryotic cells also express an anionic transporter called the reduced folate
carrier (RFC) that functions in a low-affinity, high-capacity mode to deliver
folates to the cytoplasm [see Matherly et al. (2007) for an excellent review],
expression of the FR is believed to afford cells a selective growth advantage
by enabling the capture and utilization of folates, particularly under low
folate physiological conditions (Leamon and Low, 2001).
The FR is also a recognized tumor antigen (Coney et al., 1991; Ross
et al., 1994; Weitman et al., 1992a, 1994), and because of this, methods to
exploit its presence and function have been explored for possible therapeu-
tic value. For example, some laboratories are developing anti-FR antibodies
for diagnostic and therapeutic applications (Buijs et al., 1998; Konner et al.,
2006; van Zanten-Przybysz et al., 1999), whereas others are developing
high-affinity antifolates that can be delivered inside the cell via the FR to
inhibit critical proliferative functions (Gibbs et al., 2005; Henderson et al.,
2006; Jackman et al., 2004; Theti and Jackman, 2004; Theti et al., 2003).
Finally, the FA ligand itself can be covalently modified to deliver a toxic
drug payload to FR expressing cells (Leamon and Low, 2001; Leamon
and Reddy, 2004; Leamon et al., 2007a; Reddy et al., 2005).
The purpose of this chapter is to provide the reader with a basic
understanding of FR biology, what tissues express it, and how this protein
can be exploited for the uptake and/or delivery of active pharmaceutical
Folate Receptor-Based Therapies 205
Antifolate
Drug
Spacer
Folate
FR
Membrane
invagination
Late endosome
(segregation)
H+
H+ H+ Recycling
endosome
Endosome
RFC
Nucleus
agents. Our review will not exhaustively cover this ever expanding field. For
example, topics such as folate-targeted liposomes, nanoparticles, antisense/
gene formulations, or antibody-mediated therapies will not be covered in
this volume. Instead, we intend to focus only on small molecule-based
applications that are currently being evaluated in the clinic, or those that
are at the preclinical stage of development.
exploitation are FR-a and FR-b, both of which possess a GPI anchor and
both are functional for high-affinity FA binding, although they can display
some differences with respect to their affinity for reduced folate cofactors or
antifolates (Salazar and Ratnam, 2007). FR-g is an isoform that can be
detected in some hematopoeitic cells; however, because it is not anchored
to the plasma membrane, this protein is constitutively excreted. For this
reason, FR-g will not be discussed further. Following capture of folate
molecules, membrane-associated FR-a and FR-b appear within endocytic
compartments before they are recycled back to the cell surface. Studies
reviewed by Salazar and Ratnam (2007) suggest that there may be cell type
differences for receptor recycling kinetics that may impact the delivery
efficiency of folate or folate conjugates from the cell surface to the cytoplasm.
B. FR tissue expression
1. Methods
There are a number of relevant reports, some with small sample numbers,
that describe the tissue distribution of FRs. Five broad methods have been
used to compare FR expression levels. These are (1) FR mRNA levels
measured by PCR or in situ hybridization, (2) FR-a protein levels measured
by immunohistochemistry (IHC) using mono- and polyclonal antibodies,
(3) functional FR levels as measured by 3H-FA binding to solubilized
tissue membrane preparations, (4) assessing FR tissue expression in real time
using radiodiagnostic imaging, and (5) quantifying FR expression ex vivo by
flow cytometric methods. Importantly, each method has its own particular
merits and pitfalls. For example, FR expression has been reported to be
controlled at the translational level, at least partly in some cells, thus it might
be expected that mRNA and protein levels may not always correlate. IHC is
less amenable to precise quantitation, particularly when comparing the
results from different studies, but it has the advantage in that FR distribution
within a tissue can be visualized; the latter is probably essential when
considering therapeutic exploitation of FR expression because in normal
polarized tissues, expression of this protein is restricted to the apical (luminal)
membrane surface rather than the blood-accessible, basolateral surface. Total
tissue receptor measurement using 3H-FA has the advantage of measuring
FR that is functional for ligand binding, but this method may be less useful
for (1) polarized normal tissues, (2) assessing the degree of homogeneity
of receptor expression within a tumor, or (3) distinguishing between differ-
ent receptor isoforms. Imaging tissues for FR expression after injection
of an animal or human with a radioactive high-affinity folate-conjugate
has the advantage of measuring FR that is accessible within the blood
stream. Therefore, this latter approach is of high therapeutic relevance
(see Section III.A.2 below); but, it unfortunately cannot quantitate absol-
ute levels of FR protein. Finally, the FR can also be measured by flow
Folate Receptor-Based Therapies 207
3. Cancer expression
Elevated expression of the FR-a occurs in several cancer types, although the
actual frequency and degree of expression reported is variable, in part due to
the different methods used and the small sample numbers in some studies.
Nonmucinous ovarian cancer (the majority of ovarian cancers) was the tumor
type first to be associated with overexpression (Campbell et al., 1991).
Initially, this was in the form of reports that a monoclonal antibody (mAb;
MOv18) raised against a membrane preparation from an ovarian tumor,
detected a glycoprotein present in most ovarian tumors (Miotti et al., 1987;
Veggian et al., 1989); furthermore, it was later shown that this antigen was a
high-affinity folate-binding protein (FBP) with an amino acid sequence
identical to FBPs found in placenta and KB (human nasopharyngeal carci-
noma) tumor cells (Campbell et al., 1991; Coney et al., 1991). Several studies
confirmed that 8090% of these tumors overexpress FR-a (Parker et al.,
2005; Toffoli et al., 1997; Wu et al., 1999). Other gynecological cancers (e.g.,
50% of serous uterine tumors) also overexpress the receptor (Allard et al.,
2007; Dainty et al., 2007; Marziarz et al., 1999; Wu et al., 1999). Although the
endometrioid histological subtype may express the receptor less frequently, it
is by far the most common form of uterine cancer and therefore a consider-
able number of uterine cancer patients may benefit from some form of
FR-targeted therapy. Other tumors reported to overexpress FR-a to varying
frequencies include pediatric ependymal brain tumors, breast, colon, renal
and lung tumors, and mesothelioma (Parker et al., 2005).
208 Christopher P. Leamon and Ann L. Jackman
1. Immunohistochemistry
IHC has proven to be beneficial for the selection of patients that are more
likely to respond to a given therapy. Indeed, the HercepTest IHC screen,
which is used for selecting patients with Her-2 expressing breast cancer
( Jacobs et al., 1999), enables the clinician to predict with reasonable cer-
tainly which patients may not benefit from Herceptin therapy. A related test
has also been developed for the immunohistochemical detection of the FR.
Thus, polyclonal rabbit antiserum was produced using bovine milk soluble
folate-binding protein as the antigen. Due to the high degree of homology
between the human FR and folate-binding proteins from various sources,
Folate Receptor-Based Therapies 209
the affinity-purified IgG fraction from this antiserum (herein called PU17)
adequately detects the presence of FR in formalin-fixed, paraffin-embedded
tissues (Endocyte, Inc.). PU17 was selected as the probe to validate the first
FR IHC method to be clinically used. Importantly, the scoring methodol-
ogy is based on a 0 to 3 scale (similar to HercepTest ), and the technique
is both robust and sensitive. Normal kidney cortex serves as the positive
tissue control (3), whereas normal skeletal muscle is the negative tissue
control (zero). To date, this assay has been used to screen well over 100
patients for eligibility related to the clinical testing of potent folate-targeted
agents (vide infra).
2. Radiodiagnostic imaging
Nuclear medicine has both therapeutic and diagnostic value. The latter can
be important for the noninvasive measuring of FR expression within a
given tissue or organ. Applications with anti-FR monoclonal antibodies
or derivatives have been tried clinically with limited success due to their
(1) prolonged circulation times owing to their rather large molecular size,
(2) potential immunogenicity (possibly requiring humanization), (3) cost of
goods, and (4) suboptimal tumor to nontarget tissue ratios (T/NT) (Buijs
et al., 1998; Colcher et al., 1990; Modorati et al., 1994; Seccamani et al.,
1989; van Zanten-Przybysz et al., 1999). Thus, more focus has recently been
directed toward the use of smaller FA-based imaging agents that do not
suffer from such limitations. Numerous folate-targeted small molecule
agents have been produced to date (Antich et al., 1994; Guo et al., 1999;
Ilgan et al., 1998; Leamon et al., 2002; Linder et al., 2000; Mathias and
Green, 1998; Mathias et al., 1996, 1998, 2000; Muller et al., 2004, 2006c;
Reddy et al., 2004; Wang et al., 1996), but one of the earlier compounds to
be investigated was a diethylenetriaminepentaacetic acid derivative of FA
(DTPA-folate). This molecule was found to efficiently chelate Indium-111
to produce a highly water-soluble, FR-targeted radiodiagnostic agent that
rapidly bound to the FR-expressing tissues but also rapidly cleared from the
circulation following intravenous administration (Mathias et al., 1998).
111In-DTPA-folate was clinically tested through Phase 2 and found to be
safe and useful for the identification of FR-positive lesions (Siegel et al.,
2003). Most importantly, the performance of this agent provided the
needed proof of concept data to support ongoing efforts toward the devel-
opment of FA-based therapeutics. Interestingly, DTPA-folate was not
developed any further; instead, it was replaced with a peptidic analogue of
FA that could efficiently chelate Technetium-99m. This new agent, herein
called EC20, is cheaper to produce, and a greater radiation dose can be
given to patients (to increase image resolution) because 99mTc has a much
shorter half-life compared to 111In (6 h vs 2.8 days, respectively) (Leamon
et al., 2002; Reddy et al., 2004). To date, more than 250 patients in Phase
1 and 2 trials have safely received 99mTc-EC20 for the purpose of identifying
210 Christopher P. Leamon and Ann L. Jackman
Table 7.1 Reasons FolateScan may be better than IHC for detecting the FR in tissues
Performance
criteria FolateScan IHC
Assessment of Real-time tissue analysis Archived tissue
FR status
Specimen Whole body imaging Selected tissue specimen
analyzed
Functionality Binds to functional FR Detects functional and
nonfunctional FR
Specificity Can bind to FR-a and Validated FR-b IHC is
FR-b not available
Accessibility Reveals accessible tissue Indiscriminant (e.g.,
sites normal lung)a
a
see Fig. 7.1.
Folate Receptor-Based Therapies 211
Figure 7.2 FolateScan versus IHC. Top panel, FolateScan image of a cancer-free
patient showing no uptake in normal lung and marked uptake in normal kidney.
Bottom panel, IHC image of normal human lung tissue stained with an anti-FR
probe. White arrow, alveolar cell wall; scale bar, 20 mm.
is not yet known, this approach could easily be tested clinically since the
safety of pemetrexed in humans has been established. Admittedly, if this
maneuver (or a related one) should work in humans, higher doses of
radiation could potentially be administered for (1) increasing the resolution
of imaging FR-positive tumors and possibly, (2) enabling the development
of folate-targeted radiotherapy.
3. Prognostic applications
The FR is well-known to be upregulated in select cancers of epithelial
origin (Parker et al., 2005). Furthermore, higher expression levels have also
been associated with aggressively growing cancers (Bottero et al., 1993;
Campbell et al., 1991; Hartmann et al., 2007; Ross et al., 1994; Toffoli
et al., 1997, 1998). Recently, it was proposed that this relationship may
possibly be used for prognostic purposes (Hartmann et al., 2007). For
example, using a sensitive IHC staining method, the intensity of FR
expression was found to strongly correlate with therapeutic outcome of
patients with invasive breast cancers. Thus, cancer in 81% of women
bearing high expressing malignancy was found to recur as opposed to 38%
of women bearing low expressing disease (Hartmann et al., 2007). Similarly,
high FR expression was observed more often in poorly differentiated
endometrial cancers and tumors with serous histology (Allard et al., 2007).
The authors concluded that FR expression is both a biomarker associated
with endometrial cancer as well as a prognostic factor associated with
adverse outcome. Likewise, FR expression seemingly predicted the recur-
rence of colorectal carcinomas (Nitzkorski et al., 2007). Notably, while the
prognostic importance of FR expression may not be universal among all
human cancer types (Zhai et al., 2007), it may find utility in helping the
clinician choose the best treatment option for his/her patients.
B. Cancer therapy
1. High-affinity antifolates
a. History There has been a history of research in folate metabolism and
the discovery of antifolate drugs that goes back to the 1940s, when cytotoxic
drug therapy was in its infancy. The first reported antifolate, aminopterin,
was quickly succeeded by its N10-methylated counterpart, methotrexate
(MTX), a molecule that remains widely used in clinical practice to this day.
These drugs mimic the structure of key folate intermediates to inhibit the
activity of dihydrofolate reductase (DHFR). 5-Fluorouracil (5-FU) has a
pyrimidine rather than a folate structure, and one of its active metabolites
(FdUMP) potently inhibits thymidylate synthase (TS). This enzyme
requires the cofactor, 5,10-methylene tetrahydrofolate, for activity and
this folate-dependency has been exploited for the development of the
folate-based TS inhibitors, CB3717, raltitrexed (Tomudex; ZD1694),
Folate Receptor-Based Therapies 213
pemetrexed, and plevitrexed (see Figs. 7.3 and 7.4). While there is no doubt
that drugs targeted at folate metabolism continue to make important con-
tributions to cancer treatment, the fact remains that they are cytotoxic
molecules that can not adequately distinguish tumor from normal tissue.
In fact, little opportunity exists for producing tumor-selective cytotoxicity
with this class of agents because (1) both DHFR and TS are expressed in
normal and malignant proliferating tissue and (2) the major plasma
TS inhibitors
Thd
TK
5, 10-CH2FH4
FH2 salvage
pathway
dUMP TMP
TS
de novo pathway
dUrd
TTP
dUrd (plasma) (DNA synthesis)
Figure 7.3 Pathways for thymidylate synthesis. Thymidylate can be synthesized via
the de novo and the salvage pathways. When TS is inhibited, the substrate dUMP
accumulates in cells and effluxed into the plasma. TS, thymidylate synthase; TK,
thymidine kinase; 5,10-CH2FH4, 5,10-methylene tetrahydrofolic acid; FH2, dihydro-
folate; Thd, thymidine; TMP, thymidylate; TTP, thymidine triphosphate, dUMP,
deoxyuridylate; dUrd, deoxyuridine.
CH
NH2 H O H2C C H
CH3 COOH COOH
N N N
N N HN N
COOH O COOH
O
H2N N N H2N N
CB3717
Methotrexate
CH
C F H
O H O H2C
CH3 COOH N COOH
N HN N
HN N NH
S COOH O
O N
H3C N CH3 N
H3C N N
Raltitrexed (TomudexTM; ZD1694) Plevitr exed (BGC 9331; ZD9331)
CH
C H
H H2C COOH
O O N
N COOH N H COOH
HN O N
HN O COOH
HO O
H2N N N N COOH
H
BGC 945
Pemetrexed (AlimtaTM; LY231514)
A431
100 A431-FBP
50
25
0
0.0001 0.001 0.01 0.1 1 10 100
BGC945 concentration ( M)
10
A431
Growth inhibitory IC50 ( M)
A431-FBP + FA
1 KB + FA
A431-FBP
0.1 KB
0.01
0.001
0.0001
7
ed
5
71
xe
xe
94
ex
re
re
B3
C
itr
tit
et
BG
C
ev
al
Pl
R
Pe
10 * 10
Plasma Plasma
8 8
Plasma dUrd (mM)
Plasma dUrd (mM)
6 6
4 4
2 2
0 0
0 50 0 50
BGC 9331 (mg/kg) BGC 945 (mg/kg)
40 Tumor 40 Tumor
* *
Tumor dUrd (mM)
Tumor dUrd (mM)
30 30
20 20
10 10
0 0
0 50 0 50
BGC 9331 (mg/kg) BGC 945 (mg/kg)
Figure 7.6 Plasma and tumor deoxyuridine (dUrd) levels 24 h after dosing KB tumor-
bearing mice with 50 mg/kg BGC 9331 (plevitrexed) or BGC 945. Each bar represents
the mean SEM for n 1018 mice from three to four independent experiments. *p <
0.05 compared with controls. Elevated plasma dUrd is a pharmacodynamic endpoint of
TS inhibition in proliferating tissues such as gut and bone marrow, while elevated
tumor dUrd is a marker of TS inhibition in the tumor.
Folate Receptor-Based Therapies 219
levels were less than 25 nM at 16 h (Gibbs et al., 2005). Phase 1 clinical studies
with BGC 945 are planned for 2008, and some of the issues relating to
evaluation of this first in man FR-targeted TS inhibitor are discussed in a
recent review ( Jackman et al., 2007b).
2. Folate-targeted chemotherapy
a. Modular design The success of FolateScan (99mTc-EC20; see Section
III.A.2) helped to prove that an FA conjugate could rapidly and easily
penetrate solid tumor tissue in patients. This finding prompted some to
investigate folates ability to deliver potent therapeutic molecules to can-
cer. Yet, initial attempts toward producing active and specific folate-drug
conjugates met with limited success (Leamon and Reddy, 2004). Endo-
cyte, Inc. has remained very active in this area of research, and following
years of troubleshooting and numerous structure-activity studies, some
general rules for producing successful lead conjugates have emerged.
For example, many small molecule cytotoxics (both naturally occurring
and synthetic) are highly lipophilic. This property is typically beneficial to
an agent that must penetrate through the bilayer of a cell before exerting
biological activity, but it becomes an unfavorable trait as one considers
(1) the difficulties of formulating the agent for parenteral administration
and (2) the potential off-target toxicities that usually emerge when the
drug indiscriminately enters normal cells. Whereas FA is appreciably water
soluble at physiological pH owing to its two glutamyl-based carboxylic
acid groups, direct covalent attachment of a drug to either one of those
carboxyl sites does not ensure aqueous solubility of the resulting conju-
gate. Such a result is in fact quite rare. Instead, a hydrophilic spacer can
be placed in-between the folate and drug moieties to effectuate high
water solubility (Leamon et al., 2006). A second benefit that a spacer offers
is to physically separate the targeting moiety (folate) from the drug payload
to maximize its potential to bind to the FR. The spacers composition
can widely vary because peptides, polymers, and even polycarboxylic
acid structures have been found to be very effective (Endocyte, Inc.,
unpublished data).
In addition to a spacer, all highly potent small molecular weight folate
drug conjugates have thus far been constructed with a biologically cleavable
linker (Ladino et al., 1997; Leamon et al., 2005, 2006, 2007a,b; Reddy et al.,
2006, 2007a,b). Referring back to Fig. 7.1, folate conjugates are endocy-
tosed into the cell after binding to the FR. Within the vesicular compart-
ments, the conjugates are exposed to a mildly acidic as well as reducing
environment (Leamon and Reddy, 2004). It was once assumed that the low
pH inside the endosomes triggered a conformational change in the FR to
afford release of the bound folate (or folatedrug conjugate). This event
likely occurs for some of the reduced folates that can bind to the FR with
reasonable affinity, like 5-methyltetrahydrofolate; but for FA, which is the
220 Christopher P. Leamon and Ann L. Jackman
fully oxidized, highest affinity ligand to the FR (and the form of folate that
is most commonly used in the construction of folatedrug conjugates),
endosomal release from the FR may not be very efficient. Evidence
supporting this theory has come from acid-stripping recycling studies with
3H-FA (Kamen et al., 1988), and more recently, with studies using FA-
H2N N N
H
Spacer Linker Drug
N N
N
O
OH
(Reddy et al., 2007b). Throughout this unrelenting venture, this team has
repeatedly observed marked antitumor effect against FR-expressing tu-
mors across multiple animal models using well-tolerated treatment regimens
(e.g., cures are typically observed under conditions that cause little to no
weight loss). A typical example of this phenomenon is shown in Fig. 7.8.
Here, a folate conjugate of a powerful antimicrotubule agent was adminis-
tered intravenously to mice bearing well-established subcutaneous human
tumor xenografts. Following a brief three times per week, 2-week schedule,
animals were declared tumor-free (Panel A). In fact, the tumors never
recurred up to the 110 day study endpoint (not shown); furthermore, the
activity was not accompanied by any weight loss (Panel B), and it was
A 1600
1400
Tumor volume (mm3)
1200
1000 0/5 cures
800
600
400 5/5 cures
200
0
10 20 30 40 50 60
PTI (days)
B 25
15
(%) Weight change
15
25
10 20 30 40 50 60
PTI (days)
3. Folate-targeted immunotherapy
A successful cancer immunotherapy may be one that teaches the immune
system to recognize and destroy malignant tumor cells while simultaneously
building a long-lasting antitumor memory (Blattman and Greenberg, 2004).
To date, one particular approach has been reported whereby folate is used to
deliver a hapten (fluorescein, or FITC) molecule to FR-positive tumors
(Lu and Low, 2002; Lu et al., 2004, 2005, 2006). This immunotherapy is
composed of an FITC-based vaccine, the targeted small molecule conjugate,
EC17 (folateFITC), and immunostimulatory cytokine(s). The vaccine
component is formulated with a Th1-biased adjuvant to stimulate the
production of antihapten antibodies. Following the formation of an anti-
FITC titer, which generally takes a few weeks, the folateFITC conjugate is
administered subcutaneously to stimulate the formation of a bispecific
molecular bridge between the tumor surface FR and endogenous anti-
FITC antibodies. This process effectively marks the tumor cells for
immune recognition and also initiates a specific antitumor response that
can be potentially enhanced upon costimulation with the cytokines inter-
leukin-2 and interferon-a (Lu and Low, 2002; Lu et al., 2004, 2005, 2006).
A Phase 1 safety trial for this program, called FolateImmune, was
successfully completed in 2007 (Amato et al., 2005; Messmann et al.,
2007). At present, evaluation of this targeted hapten therapy continues in
Phase 2 clinical trials of renal cell carcinoma, an immune-responsive cancer
with 64% FR positivity (Endocyte, internal communications).
C. Inflammation therapy
As discussed above (Section IIA), the two principal tissue-associated FR
isoforms are FR-a and FR-b. Despite their different tissue expression
profiles, both isoforms can efficiently bind the FA ligand as well as drug
conjugates thereof. FR-a is indeed more prevalent among epithelial-based
pathologies, but its b counterpart has been found in some solid cancers as
well as AML samples (Ross et al., 1994, 1999). Interestingly, FR-b was also
identified on the surface of activated (not resting) macrophages, particularly
in the inflamed tissues from rheumatoid arthritis patients (Nakashima-
Matsushita et al., 1999).
While its role, or physiological relevance, has not yet been firmly
established, it is known that FR-b can be targeted with folatedrug con-
jugates. For example, 99mTc-EC20 (FolateScan; see Section III.A.2) was
reported to concentrate in the livers, spleens, and arthritic extremities of
adjuvant-induced arthritic rats via a folate-dependent mechanism (Turk
et al., 2002). The uptake within these tissues was also shown to be due to
resident ED2-positive macrophages. Similarly, near-infrared fluorescent-
labeled folate probes were reported to accumulate within the inflamed
224 Christopher P. Leamon and Ann L. Jackman
REFERENCES
Allard, J. E., Risinger, J. I., Morrison, C., Young, G., Rose, G. S., Fowler, J., Berchuck, A.,
and Maxwell, G. L. (2007). Overexpression of folate binding protein is associated with
shortened progression-free survival in uterine adenocarcinomas. Gynecol. Oncol. 107(1),
5257.
Amato, R. J., Fagbeyiro, B., Messmann, R., and Low, P. S. (2005). Phase I trial of EC90
(keyhole-limpet hemocyanin fluorescein isothiocyanate conjugate) with GPI-0100 adju-
vant followed by EC17 (folate-fluorescein isothiocyanate conjugate) in patients (pts) with
metastatic renal cell carcinoma (MRCC). J. Clin. Oncol. 23, 2590.
Antich, P., Kulkarni, P. V., Constantinescu, A., Prior, J., Nguyen, T., Anderson, J.,
Weitman, S., Kamen, B. A., and Parkey, R. W. (1994). Imaging of folate receptors
with I-125 labeled folate using small animal imaging system built with plastic scintillating
optical fibers. J. Nucl. Med. 35, 222 (abstract).
Antony, A. C., Kane, M. A., Portillo, R. M., Elwood, P. C., and Kolhouse, J. F. (1985).
Studies of the role of a particulate folate-binding protein in the uptake of
5-methyltetrahydrofolate by cultured human KB cells. J. Biol. Chem. 260, 1491114917.
Bavetsias, V., Marriott, J. H., Melin, C., Kimbell, R., Matusiak, Z. S., Boyle, F. T., and
Jackman, A. L. (2000). Design and synthesis of cyclopenta[g]quinazoline-based antifo-
lates as inhibitors of thymidylate synthase and potential antitumor agents. J. Med. Chem.
43, 19101926.
Bavetsias, V., Skelton, L. A., Yafai, F., Mitchell, F., Wilson, S. C., Allan, B., and
Jackman, A. L. (2002). The design and synthesis of water-soluble analogues of
CB30865, a quinazolin-4-one-based antitumor agent. J. Med. Chem. 45, 36923702.
Birn, H., Selhub, J., and Christensen, E. I. (1993). Internalization and intracellular transport
of folate-binding protein in rat kidney proximal tubule. Am. J. Physiol. 264, C302C310.
Birn, H., Nielsen, S., and Christensen, E. I. (1997). Internalization and apical-to-basolateral
transport of folate in rat kidney proximal tubule. Am. J. Physiol. 272, F70F78.
Blattman, J. N., and Greenberg, P. D. (2004). Cancer immunotherapy: A treatment for the
masses. Science 305, 200205.
Bottero, F., Tomassetti, A., Canevari, S., Miotti, S., Menard, S., and Colnaghi, M. I. (1993).
Gene transfection and expression of the ovarian carcinoma marker folate binding protein
on NIH/3T3 cells increases cell growth in vitro and in vivo. Cancer Res. 53, 57915796.
Buijs, W. C., Tibben, J. G., Boerman, O. C., Molthoff, C. F., Massuger, L. F.,
Koenders, E. B., Schijf, C. P., Siegel, J. A., and Corstens, F. H. (1998). Dosimetric
analysis of chimeric monoclonal antibody cMOv18 IgG in ovarian carcinoma patients
after intraperitoneal and intravenous administration. Eur. J. Nucl. Med. 25, 15521561.
Campbell, I. G., Jones, T. A., Foulkes, W. D., and Trowsdale, J. (1991). Folate-binding
protein is a marker for ovarian cancer. Cancer Res. 51, 53295338.
Chattopadhyay, S., Wang, Y., Zhao, R., and Goldman, I. D. (2004). Lack of impact of the
loss of constitutive folate receptor alpha expression, achieved by RNA Interference, on
the activity of the new generation antifolate pemetrexed in HeLa cells. Clin. Cancer Res.
10, 79867993.
Folate Receptor-Based Therapies 227
Chen, W. T., Mahmood, U., Weissleder, R., and Tung, C. H. (2005). Arthritis imaging
using a near-infrared fluorescence folate-targeted probe. Arthritis Res. Ther. 7,
R310R317.
Clarke, S. J., Jackman, A. L., and Judson, I. R. (1993). The history of the development and
clinical use of CB 3717 and ICI D1694. Adv. Exp. Med. Biol. 339, 277287; discussion
289-290.
Clifford, A. J., Arjomand, A., Dueker, S. R., Schneider, P. D., Buchholz, B. A., and
Vogel, J. S. (1998). The dynamics of folic acid metabolism in an adult given a small
tracer dose of 14C-folic acid. Adv. Exp. Med. Biol. 445, 239251.
Colcher, D., Bird, R., Roselli, M., Hardman, K. D., Johnson, S., Pope, S., Dodd, S. W.,
Pantoliano, M. W., Milenic, D. E., and Schlom, J. (1990). In vivo tumor targeting of a
recombinant single-chain antigen-binding protein. J. Natl. Cancer Inst. 82, 11911197.
Coney, L. R., Tomassetti, A., Carayannopoulos, L., Frasca, V., Kamen, B. A.,
Colnaghi, M. I., and Zurawski, V. R. J. (1991). Cloning of a tumor-associated antigen:
MOv18 and MOv19 antibodies recognize a folate-binding protein. Cancer Res.
51, 61256132.
Dainty, L. A., Risinger, J. I., Morrison, C., Chandramouli, G. V., Bidus, M. A., Zahn, C.,
Rose, G. S., Fowler, J., Berchuck, A., and Maxwell, G. L. (2007). Overexpression of
folate binding protein and mesothelin are associated with uterine serous carcinoma.
Gynecol. Oncol. 105, 563570.
Elnakat, H., and Ratnam, M. (2004). Distribution, functionality and gene regulation of
folate receptor isoforms: Implications in targeted therapy. Adv. Drug Deliv. Rev. 56,
10671084.
Elnakat, H., and Ratnam, M. (2006). Role of folate receptor genes in reproduction and
related cancers. Front. Biosci. 11, 506519.
Elwood, P. C., Kane, M. A., Portillo, R. M., and Kolhouse, J. F. (1986). The isolation,
characterization, and comparison of the membrane-associated and soluble folate-binding
proteins from human KB cells. JBC 261, 1541615423.
Forster, M. D., Mitchell, F., Valenti, M., and Jackman, A. L. (2005). Measurement of
tumour and plasma dUrd levels indicate highly targeted inhibition of thymidylate
synthase in a-folate receptor overexpressing tumour by the novel antifolate, BGC 945.
Clin. Cancer Res. 11(24), 9013s.
Forster, M. D., Ormerod, M. G., Agarwal, R., Kaye, S. B., and Jackman, A. L. (2007). Flow
cytometric method for determining folate receptor expression on ovarian carcinoma
cells. Cytometry A 71A, 945950.
Garin-Chesa, P., Campbell, I., Saigo, P. E., Lewis, J. L., Old, L. J., and Rettig, W. J. (1993).
Trophoblast and ovarian cancer antigen LK26. Am. J. Pathol. 142, 557567.
Gibbs, D. D., Theti, D. S., Wood, N., Green, M., Raynaud, F., Valenti, M., Forster, M. D.,
Mitchell, F., Bavetsias, V., Henderson, E., et al. (2005). BGC 945, a novel tumor-
selective thymidylate synthase inhibitor targeted to alpha-folate receptor-overexpressing
tumors. Cancer Res. 65, 1172111728.
Guo, W., Hinkle, G. H., and Lee, R. J. (1999). 99mTc-HYNIC-folate: A novel receptor-
based targeted radiopharmaceutical for tumor imaging. J. Nucl. Med. 40, 15631569.
Hartmann, L. C., Keeney, G. L., Lingle, W. L., Christianson, T. J., Varghese, B.,
Hillman, D., Oberg, A. L., and Low, P. S. (2007). Folate receptor overexpression is
associated with poor outcome in breast cancer. Int. J. Cancer 121, 938942.
Henderson, E. A., Bavetsias, V., Theti, D. S., Wilson, S. C., Clauss, R., and Jackman, A. L.
(2006). Targeting the alpha-folate receptor with cyclopenta[g]quinazoline-based inhibi-
tors of thymidylate synthase. Bioorg. Med. Chem. 14, 50205042.
Henderson, G. B., Zevely, E. M., and Huennekens, F. M. (1980). Irreversible inactivation of
methotrexate transport system of L1210 cells by carbodiimide-activated substrates. J. Biol.
Chem. 255, 48294833.
228 Christopher P. Leamon and Ann L. Jackman
Henderson, G. B., Tsuji, J. M., and Kumar, H. P. (1988). Mediated uptake of folate by a
high-affinity binding protein in sublines of L1210 cells adapted to nanomolar concentra-
tions of folate. J. Membrane Biol. 101, 247258.
Holm, J., Hansen, S. I., Hoier-Madsen, M., and Bostad, L. (1992). A high affinity folate
binding protein in proximal tubule cells of human kidney. Kidney Int. 41, 5055.
Ilgan, S., Yang, D. J., Higuchi, T., Zareneyrizi, F., Bayham, H., Yu, D., Kim, E. E., and
Podoloff, D. A. (1998). 99mTc-Ethylenedicysteine-folate: A new tumor imaging agent.
Synthesis, labeling and evaluation in animals. Cancer Biother. Radiopharm. 13, 427435.
Jackman, A. L., Taylor, G. A., Calvert, A. H., and Harrap, K. R. (1984). Modulation of anti-
metabolite effects. Effects of thymidine on the efficacy of the quinazoline-based thymi-
dylate synthetase inhibitor, CB3717. Biochem. Pharmacol. 33, 32693275.
Jackman, A. L., Theti, D. S., and Gibbs, D. D. (2004). Antifolates targeted specifically to the
folate receptor. Adv. Drug Deliv. Rev. 56, 11111125.
Jackman, A. L., Forster, M., Mitchell, F., Ruddle, R., Valenti, M., Eccles, S., Schurig, J.,
and Raynaud, F. (2007a). Preclinical pharmacokinetics and pharmacodynamics of BGC
945: A unique tumour targeted thymidylate synthase inhibitor by virtue of its selective
uptake by the folate receptor. Proc. Am. Assoc. Cancer Res. Abstract #3191.
Jackman, A. L., Forster, M., and Ng, M. (2007b). Targeting thymidylate synthase by antifo-
late drugs for the treatment of cancer. In Cancer Drug Design and Discovery
(S. Neidle, Ed.), pp 198226, 2008, Academic Press (Elsevier).
Jacobs, T. W., Gown, A. M., Yaziji, H., Barnes, M. J., and Schnitt, S. J. (1999). Specificity of
HercepTest in determining HER-2/neu status of breast cancers using the United States
Food and Drug Administration-approved scoring system. J. Clin. Oncol. 17, 19831987.
Jansen, G., Kathmann, I., Rademaker, B. C., Braakhuis, B. J. M., Westerhof, G. R.,
Rijksen, G., and Schornagel, J. H. (1989). Expression of a folate binding protein in
L1210 cells grown in low folate medium. Cancer Res. 49, 19591963.
Jansen, G., Barr, H., Kathmann, I., Bunni, M. A., Priest, D. G., Noordhuis, P., Peters, G. J.,
and Assaraf, Y. G. (1999). Multiple mechanisms of resistance to polyglutamatable and
lipophilic antifolates in mammalian cells: Role of increased folylpolyglutamylation,
expanded folate pools, and intralysosomal drug sequestration. Mol. Pharmacol. 55, 761769.
Kamen, B. A., and Capdevila, A. (1986). Receptor-mediated folate accumulation is regu-
lated by the cellular folate content. Proc. Natl. Acad. Sci. USA 83, 59835987.
Kamen, B. A., Wang, M. T., Streckfuss, A. J., Peryea, X., and Anderson, R. G. W. (1988).
Delivery of folates to the cytoplasm of MA104 cells is mediated by a surface membrane
receptor that recycles. J. Biol. Chem. 263, 1360213609.
Kane, M. A., Portillo, R. M., Elwood, P. C., Antony, A. C., and Kolhouse, J. F. (1986). The
influence of extracellular folate concentration on methotrexate uptake by human KB
cells. J. Biol. Chem. 261, 4449.
Kelley, K. M., Rowan, B. G., and Ratnam, M. (2003). Modulation of the folate receptor
alpha gene by the estrogen receptor: Mechanism and implications in tumor targeting.
Cancer Res. 63, 28202828.
Konner, J. A., Ahmed, S., Gerst, S., Vander Els, N., Pezzuli, S., Sabbatini, P., Hensley, M.,
Dupont, J., Tew, W., and Aghajanian, C. (2006). Phase I study of MORAb-003,
a humanized anti-folate receptor-alpha monoclonal antibody, in platinum resistant
ovarian cancer. J. Clin. Oncol. 24, 5027.
Ladino, C. A., Chari, R. V. J., Bourret, L. A., Kedersha, N. L., and Goldmacher, V. S.
(1997). Folate-maytansinoids: Target-selective drugs of low molecular weight. Int. J.
Cancer 73, 859864.
Leamon, C. P., and Low, P. S. (2001). Folate-mediated targeting: From diagnostics to drug
and gene delivery. Drug Discov. Today 6, 4451.
Leamon, C. P., and Reddy, J. A. (2004). Folate-targeted chemotherapy. Adv. Drug Deliv.
Rev. 56, 11271141.
Folate Receptor-Based Therapies 229
Mathias, C. J., Wang, S., Lee, R. J., Waters, D. J., Low, P. S., and Green, M. A. (1996).
Tumor-selective radiopharmaceutical targeting via receptor-mediated endocytosis of
Gallium-67-deferoxamine-folate. J. Nucl. Med. 37, 10031008.
Mathias, C. J., Wang, S., Waters, D. J., Turek, J. J., Low, P. S., and Green, M. A. (1998).
Indium-111-DTPA-folate as a potential folate-receptor-targeted radiopharmaceutical.
J. Nucl. Med. 39, 15791585.
Mathias, C. J., Hubers, D., Low, P. S., and Green, M. A. (2000). Synthesis of [(99m)Tc]
DTPA-folate and its evaluation as a folate-receptor-targeted radiopharmaceutical.
Bioconjug. Chem. 11, 253257.
Messmann, R., Amato, R., Hernandez-McClain, J., Conley, B., Rogers, H., Lu, J.,
Low, P., Bever, S., and Morgenstern, D. (2007). A phase II study of FolateImmune
(EC90 with GP10100 adjuvant followed by EC17) with low dose cytokines interleukin-
2 (IL-2) and interferon-{alpha} (IFN-{alpha}) in patients with refractory or metastatic
cancer. J. Clin. Oncol. 25, 13516.
Miotti, S., Canevari, S., Menard, S., Mezzanzanica, D., Porro, G., Pupa, S. M.,
Regazzoni, M., Tagliabue, E., and Colnaghi, M. I. (1987). Characterization of human
ovarian carcinoma-associated antigens defined by novel monoclonal antibodies with
tumor-restricted specificity. Int. J. Cancer 39, 297303.
Modorati, G., Brancato, R., Paganelli, G., Magnani, P., Pavoni, R., and Fazio, F. (1994).
Immunoscintigraphy with three step monoclonal pretargeting technique in diagnosis of
uveal melanoma: Preliminary results. Br. J. Ophthalmol. 78, 1923.
Muller, C., Dumas, C., Hoffmann, U., Schubiger, P. A., and Schibli, R. (2004). Organo-
metallic 99mTc-technitium(I) and Re-rhenium(I)-folate derivatives for potential use in
nuclear medicine. J. Organomet. Chem. 689, 47124721.
Muller, C., Bruhlmeier, M., Schubiger, P. A., and Schibli, R. (2006a). Effects of antifolate
drugs on the cellular uptake of radiofolates in vitro and in vivo. J. Nucl. Med. 47,
20572064.
Muller, C., Hohn, A., Schubiger, P. A., and Schibli, R. (2006b). Preclinical evaluation of
novel organometallic 99mTc-folate and 99mTc-pteroate radiotracers for folate receptor-
positive tumour targeting. Eur. J. Nucl. Med. Mol. Imaging 33, 10071016.
Muller, C., Schubiger, P. A., and Schibli, R. (2006c). Synthesis and in vitro/in vivo evaluation
of novel 99mTc(CO)3-folates. Bioconjug. Chem. 17, 797806.
Muller, C., Schibli, R., Forrer, F., Krenning, E. P., and de Jong, M. (2007). Dose-
dependent effects of (anti)folate preinjection on (99m)Tc-radiofolate uptake in tumors
and kidneys. Nucl. Med. Biol. 34, 603608.
Nagai, T., Tanaka, M., Tsuneyoshi, Y., Matsushita, K., Sunahara, N., Matsuda, T.,
Yoshida, H., Komiya, S., Onda, M., and Matsuyama, T. (2006). In vitro and in vivo
efficacy of a recombinant immunotoxin against folate receptor beta on the activation and
proliferation of rheumatoid arthritis synovial cells. Arthritis Rheum. 54, 31263134.
Nagayoshi, R., Nagai, T., Matsushita, K., Sato, K., Sunahara, N., Matsuda, T.,
Nakamura, T., Komiya, S., Onda, M., and Matsuyama, T. (2005). Effectiveness of
anti-folate receptor beta antibody conjugated with truncated Pseudomonas exotoxin in
the targeting of rheumatoid arthritis synovial macrophages. Arthritis Rheum. 52,
26662675.
Nakashima-Matsushita, N., Homma, T., Yu, S., Matsuda, T., Sunahara, N., Nakamura, T.,
Tsukano, M., Ratnam, M., and Matsuyama, T. (1999). Selective expression of folate
receptor beta and its possible role in methotrexate transport in synovial macrophages from
patients with rheumatoid arthritis. Arthritis Rheum. 42, 16091616.
Nitzkorski, J. R., Paty, P. B., Klimstra, D. S., Low, P. S., Tang, L. H., Franklin, W. A.,
Prendergast, F. G., Murphy, L., Landmann, R. G., Weiser, M. R., et al. (2007). Patterns
of immunohistochemical expression of folate receptor alpha (FRa) in colorectal
Folate Receptor-Based Therapies 231
epithelium and its neoplasms. Paper presented at: United States and Canadian Academy
of Pathology Annual Meeting (San Diego, CA).
Parker, N., Turk, M. J., Westrick, E., Lewis, J. D., Low, P. S., and Leamon, C. P. (2005).
Folate receptor expression in carcinomas and normal tissues determined by a quantitative
radioligand binding assay. Anal. Biochem. 338, 284293.
Paulos, C. M., Turk, M. J., Breur, G. J., and Low, P. S. (2004). Folate receptor-mediated
targeting of therapeutic and imaging agents to activated macrophages in rheumatoid
arthritis. Adv. Drug Deliv. Rev. 56, 12051217.
Paulos, C. M., Varghese, B., Widmer, W. R., Breur, G. J., Vlashi, E., and Low, P. S. (2006).
Folate-targeted immunotherapy effectively treats established adjuvant and collagen-
induced arthritis. Arthritis Res. Ther. 8, R77.
Pillai, M. R., Chacko, P., Kesari, L. A., Jayaprakash, P. G., Jayaram, H. N., and
Antony, A. C. (2003). Expression of folate receptors and heterogeneous nuclear ribonu-
cleoprotein E1 in women with human papillomavirus mediated transformation of cervi-
cal tissue to cancer. J. Clin. Pathol. 56, 569574.
Prasad, P. D., Ramamoorthy, S., Moe, A. J., Smith, C. H., Leibach, F. H., and
Ganapathy, V. (1994). Selective expression of the high-affinity isoform of the folate
receptor (FR-alpha) in the human placental syncytiotrophoblast and choriocarcinoma
cells. Biochim. Biophys. Acta 1223, 7175.
Reddy, J. A., Allagadda, V. M., and Leamon, C. P. (2005). Targeting therapeutic and
imaging agents to folate receptor positive tumors. Curr. Pharm. Biotechnol. 6, 131150.
Reddy, J. A., Haneline, L. S., Srour, E. F., Antony, A. C., Clapp, D. W., and Low, P. S.
(1999). Expression and functional characterization of the beta-isoform of the folate
receptor on CD34() cells. Blood 93, 39403948.
Reddy, J. A., Xu, L. C., Parker, N., Vetzel, M., and Leamon, C. P. (2004). Preclinical
evaluation of (99m)Tc-EC20 for imaging folate receptor-positive tumors. J. Nucl. Med.
45, 857866.
Reddy, J. A., Westrick, E., Vlahov, I., Howard, S. J., Santhapuram, H. K., and
Leamon, C. P. (2006). Folate receptor specific anti-tumor activity of folate-mitomycin
conjugates. Cancer Chemother. Pharmacol. 58, 229236.
Reddy, J. A., Dorton, R., Westrick, E., Dawson, A., Smith, T., Xu, L. C., Vetzel, M.,
Kleindl, P., Vlahov, I. R., and Leamon, C. P. (2007a). Preclinical evaluation of EC145,
a folate-vinca alkaloid conjugate. Cancer Res. 67, 44344442.
Reddy, J. A., Westrick, E., Santhapuram, H. K., Howard, S. J., Miller, M. L., Vetzel, M.,
Vlahov, I., Chari, R. V., Goldmacher, V. S., and Leamon, C. P. (2007b). Folate
Receptor-specific antitumor activity of EC131, a folate-maytansinoid conjugate. Cancer
Res. 67, 63766382.
Rettig, W. J., Cordon-Cardo, C., Koulos, J. P., Lewis, J. L., Jr., Oettgen, H. F., and
Old, L. J. (1985). Cell surface antigens of human trophoblast and choriocarcinoma
defined by monoclonal antibodies. Int. J. Cancer 35, 469475.
Ross, J. F., Chaudhuri, P. K., and Ratnam, M. (1994). Differential regulation of folate
receptor isoforms in normal and malignant tissues in vivo and in established cell lines.
Physiologic and clinical implications. Cancer 73, 24322443.
Ross, J. F., Wang, H., Behm, F. G., Mathew, P., Wu, M., Booth, R., and Ratnam, M.
(1999). Folate receptor type beta is a neutrophilic lineage marker and is differentially
expressed in myeloid leukemia. Cancer 85, 348357.
Salazar, M. D., and Ratnam, M. (2007). The folate receptor: What does it promise in tissue-
targeted therapeutics? Cancer Metastasis Rev. 26, 141152.
Sausville, E., LoRusso, P., Quinn, M., Forman, K., Leamon, C., Morganstern, D.,
Bever, S., and Messmann, R. (2007). A phase I study of EC145 administered weeks
1 and 3 of a 4-week cycle in patients with refractory solid tumors. J. Clin. Oncol. 25, 2577.
232 Christopher P. Leamon and Ann L. Jackman
Seccamani, E., Tattanelli, M., Mariani, M., Spranzi, E., Scassellati, G. A., and Siccardi, A. G.
(1989). A simple qualitative determination of human antibodies to murine immunoglo-
bulins (HAMA) in serum samples. Int. J. Rad. Appl. Instrum. B 16, 167170.
Shih, C., and Thornton, D. E. (1999). Preclinical pharmacology studies and the clinical
development of a novel multitargeted antifolate, MTA (LY231514). In Anticancer
Drug Development Guide: Antifolate Drugs in Cancer Therapy (A. L. Jackman, Ed.),
pp. 183201. Humana Press, New Jersey.
Siegel, B. A., Dehdashti, F., Mutch, D. G., Podoloff, D. A., Wendt, R., Sutton, G. P.,
Burt, R. W., Ellis, P. R., Mathias, C. J., Green, M. A., et al. (2003). Evaluation of 111In-
DTPA-folate as a receptor-targeted diagnostic agent for ovarian cancer: Initial clinical
results. J. Nucl. Med. 44, 700707.
Theti, D. S., and Jackman, A. L. (2004). The role of alpha-folate receptor-mediated transport
in the antitumor activity of antifolate drugs. Clin. Cancer Res. 10, 10801089.
Theti, D. S., Bavetsias, V., Skelton, L. A., Titley, J., Gibbs, D., Jansen, G., and
Jackman, A. L. (2003). Selective delivery of CB300638, a cyclopenta[g]quinazoline-
based thymidylate synthase inhibitor into human tumor cell lines overexpressing the
alpha-isoform of the folate receptor. Cancer Res. 63, 36123618.
Toffoli, G., Cernigoi, C., Russo, A., Gallo, A., Bagnoli, M., and Boiocchi, M. (1997).
Overexpression of folate binding protein in ovarian cancers. Int. J. Cancer 74, 193198.
Toffoli, G., Russo, A., Gallo, A., Cernigoi, C., Miotti, S., Sorio, R., Tumolo, S., and
Boiocchi, M. (1998). Expression of folate binding protein as a prognostic factor for
response to platinum-containing chemotherapy and survival in human ovarian cancer.
Int. J. Cancer 79, 121126.
Tran, T., Shatnawi, A., Zheng, X., Kelley, K. M., and Ratnam, M. (2005). Enhancement of
folate receptor alpha expression in tumor cells through the glucocorticoid receptor:
A promising means to improved tumor detection and targeting. Cancer Res. 65, 44314441.
Turk, M. J., Breur, G. J., Widmer, W. R., Paulos, C. M., Xu, L. C., Grote, L. A., and
Low, P. S. (2002). Folate-targeted imaging of activated macrophages in rats with
adjuvant-induced arthritis. Arthritis Rheum. 46, 19471955.
Turk, M. J., Waters, D. J., and Low, P. S. (2004). Folate-conjugated liposomes preferentially
target macrophages associated with ovarian carcinoma. Cancer Lett. 213, 165172.
van Zanten-Przybysz, I., Molthoff, C. F. M., Visser, G. W. M., Verheijen, R. M. H.,
Plaizer, M. A. B. D., Pijpers, R., Kenemans, P., and Roos, J. C. (1999). 131I-labeled
chimeric monoclonal antibody MOv18 in ovarian cancer patients: A pilot study. Tumor
Target. 4, 179188.
Veggian, R., Fasolato, S., Menard, S., Minucci, D., Pizzetti, P., Regazzoni, M.,
Tagliabue, E., and Colnaghi, M. I. (1989). Immunohistochemical reactivity of a mono-
clonal antibody prepared against human ovarian carcinoma on normal and pathological
female genital tissues. Tumori 75, 510513.
Wang, S., Lee, R. J., Mathias, C. J., Green, M. A., and Low, P. S. (1996). Synthesis,
purification, and tumor cell uptake of 67Ga-deferoxamine-folate, a potential radiophar-
maceutical for tumor imaging. Bioconjug. Chem. 7, 5662.
Weitman, S. D., Lark, R. H., Coney, L. R., Fort, D. W., Frasca, V., Zurawski, V. R., and
Kamen, B. A. (1992a). Distribution of the folate receptor GP38 in normal and malignant
cell lines and tissues. Cancer Res. 52, 33963401.
Weitman, S. D., Weiberg, A. G., Coney, L. R., Zurawski, V. R., Jennings, D. S., and
Kamen, B. A. (1992b). Cellular localization of the folate receptor: Potential role in drug
toxicity and folate homeostasis. Cancer Res. 52, 67086711.
Weitman, S. D., Frazier, K. M., and Kamen, B. A. (1994). The folate receptor in central
nervous system malignancies of childhood. J. Neurooncol. 21, 107112.
Westerhof, G. R., Jansen, G., van Emmerik, N., Kathmann, I., Rijksen, G., Jackman, A. L.,
and Schornagel, J. H. (1991). Membrane transport of natural folates and antifolate
Folate Receptor-Based Therapies 233
Contents
I. Introduction 236
II. Methods 238
A. Cell culture 238
B. Stable transfection 238
C. Western blotting procedures 238
D. Cell proliferation assay 239
E. Soft agar colony assay 239
F. BrdU incorporation assay 239
G. Flow cytometric assessment of PCNA expression 239
H. Folic acid binding 240
I. Quantitative RT-qPCR 240
J. Statistical analyses 240
III. Result 242
A. Tumor classification 242
B. FRa mRNA expression in NF adenomas 242
C. Expression of FRa protein 242
D. Assessment of FRa-binding capacity 246
E. Immunohistochemical analysis of FRa expression 247
F. Selection of clones of aT3-1 cells stably expressing FRa
and mFRa 249
G. FRa induces cell proliferation in aT3-1 cells 250
H. FRa induces cell cycle progression and PCNA expression 251
I. FRa promotes growth in soft agar assay 251
J. [3H]Folic acid binding 252
K. FRa induces aT3-1 cell growth through NOTCH3 pathway 252
L. In vivo imaging of FR expression 258
235
236 Chheng-Orn Evans et al.
Abstract
Clinically nonfunctional pituitary adenomas cause hypopituitarism or compres-
sion of regional structures. Unlike functional tumors, there is no available
medical treatment or specific imaging technique for these tumors. We have
recently discovered that both folate receptor (FR)a mRNA and protein are
uniquely overexpressed in nonfunctional pituitary tumors, but not in functional
adenomas. We hypothesized that FRa may hold significant promise for medical
treatment by enabling novel molecular imaging and targeted therapy. Here, we
used murine pituitary tumor cell line aT3-1 as a model to investigate the
biological significance of FRa and its mutant FR67. We demonstrate that over-
expression of FR facilitated tumor cell growth and anchorage-independent
growth in soft agar. More colonies were observed in FR overexpressing cells
than in mutant FR67 clones in soft agar. Cell proliferation rate was increased,
the percentage of cells in S-phase was increased, and high PCNA staining was
detected in cells overexpressing the receptor. In aT3-1 cells transfected with
mutant FR67, cell proliferation rate was reduced, the percentage of cells resid-
ing in S-phase was slightly decreased, and low PCNA staining was observed. By
real-time quantitative PCR, the genes involved in NOTCH3 pathway including
NOTCH3, HES-1, and TLE2 were altered; the mRNA expression of FGFR1 was
upregulated, and ERb mRNA was downregulated in FR overexpressing cells. Our
findings suggest that FRa plays a role in pituitary tumor formation, and this
effect may in part be due to its regulation of the NOTCH3 pathway. 2008
Elsevier Inc.
I. Introduction
Pituitary tumors are mostly benign adenomas arising from adenohypo-
physeal cells in the anterior pituitary. They comprise 10% of all brain tumors
and occur in 20% of the population. They cause significant morbidity by
compression of regional structures and the inappropriate expression of
pituitary hormones (Asa, 1998; Greenman and Melmed, 1996). Functional
tumors, such as GH and ACTH adenomas, give rise to severe life-threatening
clinical syndromes, such as Acromegaly or Cushings disease, and PRL
adenomas result in impaired reproduction. However, 30% of all anterior
pituitary adenomas are termed nonfunctional (NF) pituitary adenomas due
to their lack of clinical hormone hypersecretion (Asa and Kovacs, 1992).
Clinically, NF tumors manifest as hypopituitarism or visual field defects due
to regional compression of the optic chiasm (Asa and Ezzat, 1998; Asa and
Kovacs, 1992; Black et al., 1987; Katznelson et al., 1993). The NF tumors are
uniquely heterogeneous (Table 8.1). They typically are quite large and cause
Folate Receptor Expression in Pituitary Adenomas 237
II. Methods
A. Cell culture
Cells (aT3-1) were maintained in monolayer culture in high-glucose
DMEM (Invitrogen, Carlsbad, California) with 10% FBS and were grown
in folate-free RPMI with 5% FBS for all the experiments in humidified
5% CO2 at 37 C. Cells were routinely passaged with 0.5 mmol/liter
EDTA in phosphate-buffered saline. Cell numbers were determined by
hemocytometer.
B. Stable transfection
The cells were plated in 35-mm culture wells at 5 105 cell/ml and cultured
for 1 day. The following day, the transfections were performed by a lipofection
method (LipofectamineTM 2000, Invitrogen). DNA (4 mg) was mixed
with 10 ml of LipofectamineTM 2000 in 500 ml of Opti-MEM , and added
to the cell. The cells were passaged at 1:10 dilution into fresh growth medium
24 h after transfection. Zeocin, 300 mg/ml was added for stable selection.
I. Quantitative RT-qPCR
Expression of the selected genes was quantified using RT-qPCR analysis.
Briefly, total RNA was isolated using the Trizol reagent (Invitrogen) and
was reverse transcribed using Supersript II RT (Invitrogen). Specific pri-
mers were designed using Primer3 software (MIT Whitehead Institute,
http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and listed in
Table 8.2. All PCR reactions were performed in GeneAmp 5700 sequence
detection system (Applied Biosystems) and repeated in three separate
experiments, each sample was run in duplicate. b-Actin and b-tubulin
were used as internal control. Cycle threshold (Ct) values were obtained
and the relative differences in expression between groups were determined
using the 2(ddCT) formula, where ddCT (Ct gene of interest Ct
actin or tubulin in experimental sample) (Ct gene of interest Ct actin or
tubulin in untransfected, untreated aT 3-1 cells sample).
J. Statistical analyses
Results are expressed as mean SEM. Differences were assessed by one-
way Anova to all results except the binding assay where student t-test was
used. p < 0.05 was considered to be statistically significant.
Table 8.2 Primer sequences used for quantitive RT-qPCR
III. Result
In a previous study (Evans et al., 2001), we used cDNA microarray
analysis and RT-qPCR to compare expression profiles of 7075 genes in the
normal pituitary with that in different adenomas, including NF, PRL-
producing adenomas, GH-producing adenomas, and ACTH-secreting ade-
nomas. In those experiments, we found that the FRa gene was significantly
overexpressed in NF adenomas. Next, we characterized the expression of
FRa in NF and NF, PRL, GH, and ACTH pituitary adenomas (Evans
et al., 2003). The identification of FRa may further elucidate the pathways
of pituitary oncogenesis and provide effective therapeutic treatment to
pituitary tumors.
We show some of the importance results of our previous study (Evans
et al., 2003) in following sections.
A. Tumor classification
The clinical and pathological characteristics of the 39 adenomas used in the
study are listed in Table 8.3. Ten of the NF adenomas were not positive
with anterior pituitary hormone histochemistry and were designated immu-
nohistochemically negative (NF) tumors. Thirteen NF tumors stained
with one or more anterior pituitary hormones and were designated immu-
nohistochemically positive (NF). Six were classified as PRL, five as GH,
and five as ACTH-positive adenomas. With the exception of two with
cavernous sinus invasion, all tumors were noninvasive as defined by histo-
logical and radiological criteria. Other clinical features related to the tumor
are noted in Table 8.3. Five normal pituitary controls were obtained from
the National Hormone and Pituitary Program, National Institute of Diabe-
tes and Digestive and Kidney Diseases.
Table 8.3 Clinical and pathological characteristics of adenomas from patients used
in the study (Evans et al., 2003)
FR expression in NF immunohistochemically
positive by RT-qPCR
200
FR message (relative to control)
160
120
80
40
0
Con 65 77 174 143 89 91 100 112 69 60 198 208 138
NF immunohistochemically positive samples
A
kDa
40.0
28.8
N1 N3 65 68 93 74 164 153 155 104 105 75
B
kDa
40.0
28.8
77 138 174 143 89 91 100 112 69 60 198 208 65
C D
kDa kDa
40.0 40.0
28.8 28.8
65 183 192 123 196 168 65 232 137 239 126
Figure 8.2 (AD) Western blot of FRa expression in pituitary adenomas. Total protein
(10 mg) of each sample was separated by a 15% SDS-PAGE. Immunodetection was
carried out using a polyclonal antibody, rabbit antihuman FRa IgG, as described
in Methods and Materials. Panel (A) showed FRa expression in two normal pituitaries,
one NF (65), and nine NF adenomas. Panel (B) showed FRa expression in 13 NF
adenomas. Panel (C) showed FRa expression in one NF (65), two PRL (183 and 192),
and three GH-secreting adenomas (123, 196, 168), whereas panel (D) showed one NF
(65) and four ACTH-secreting adenomas (232126).
246 Chheng-Orn Evans et al.
20 *
10
10
n= 5 10 13 6 5 5
Control NF NF+ PRL GH ACTH
Tumor type
Figure 8.3 Box plots representing the FRa protein expression by adenoma subtypes,
by Western blot. A horizontal line in each box represents the median value of FRa
protein expression of each group. Box, the 25th and 75th percentile range of scores.
Whiskers, the highest and lowest values. Numbers of pituitaries tested in each group
were n 5 for controls, 10 for NF, 13 for NF, 6 for PRL, 5 for GH, and 5 for
ACTH-secreting adenomas. *, in NF adenomas, FRa was significantly overexpressed
compared with controls ( p 0.014), PRL ( p 0.009), GH ( p 0.014), and ACTH-
secreting adenomas ( p 0.007). **, in NF adenomas, FRa was significantly over-
expressed compared with controls ( p 0.001), NF ( p 0.041), PRL ( p 0.001),
GH ( p 0.001), and ACTH-secreting adenomas ( p 0.001).
adenomas was properly folded and had the potential to transport folates,
specific binding of folic acid was measured in the various tumors for which
sufficient tissue was available (37 pituitary tumors and 5 normal pituitaries).
In the five normal pituitary controls, folic acid binding was 0.94.8 pmol/
mg protein, with a mean of 2.2 pmol/mg protein (Fig. 8.4). In the 10 NF
samples, binding ranged from 1.6 to 136.1 pmol/mg protein, which was
0.7- to 62-fold greater than the mean of the controls. The 13 NF
adenomas bound between 7.6 and 242.7 pmol/mg protein, which was 3-
to 110-fold higher than the mean of control samples. Folic acid binding was
very low (0.022.1 pmol/mg protein) in five PRL, five GH, and four
ACTH-secreting adenomas.
* **
Folic acid binding
100
(pmol/mg)
50
***
0
n= 5 10 13 5 5 4
Control NF NF+ PRL GH ACTH
Tumor type
Figure 8.4 Box plots representing folic acid binding to FRa by adenomas subtypes.
A horizontal line in each box represents the median value of folic acid binding to FRa of
each group. Box, the 25th and 75th percentile range of scores. Whiskers, the highest and
lowest values. Numbers of pituitaries tested in each group were n 5 for normal
pituitary controls, 10 for NF, 13 for NF, 5 for PRL, 5 for GH, and 4 for ACTH-
secreting adenomas. *, in NF adenomas, folate binding was significantly different
from controls ( p 0.007), PRL ( p 0.003), GH ( p 0.003), and ACTH-secreting
adenomas ( p 0.002). **, in NF adenomas, folate binding was significantly different
from controls ( p 0.001), PRL ( p 0.001), GH ( p 0.001), and ACTH-secreting
adenomas ( p 0.001). ***, in PRL adenomas, folate binding was significantly different
from controls ( p 0.047).
248 Chheng-Orn Evans et al.
Figure 8.5 IHC demonstrating cytoplasmic FRa in anterior pituitary gland and
pituitary adenomas. Ovarian adenocarcinoma served as a positive control for FRa
receptor IHC. Strong immunoreactivity for FRa was present on the luminal membrane
of ovarian adenocarcinoma glands and, to a lesser extent, within the cytoplasm (A; arrow).
Ovarian adenocarcinoma did not show any immunoreactivity when the primary antibody
directed against FRa was replaced with PBS (B; negative control). Normal (nonneoplas-
tic) anterior pituitary gland showed focal weak staining for FRa in glandular cells but
Folate Receptor Expression in Pituitary Adenomas 249
none in stromal cells (C; arrow). NF adenomas that did not show any evidence of
hormone production by IHC were all immunoreactive for FRa, with the intensity of
staining various from strong (D) to moderate (E). Immunoreactivity for FRa was limited
to the cytoplasm of adenoma cells and not present in stromal cells or blood vessels. NF
adenomas that showed only focal, weak immunoreactivity for hormones (IHC for LH
shown by arrow in panel F) also showed strong cytoplasmic expression FRa (G). Pituitary
adenomas such as a prolactinoma showing cytoplasmic immunoreactivity for PRL by IHC
(H), but did not show appreciable cytoplasmic FRa (I).
250 Chheng-Orn Evans et al.
FRa
1 -5 -3 1 4 9 1 7
3- eo wt -1 -1 7- -1 -2
aT pZ wt Rwt R6 67 67
FR FR F F F R F R
b-Actin
Figure 8.6 Representative Western blot analysis of FRa protein (A) and b-actin
protein (B) expression in aT3-1 cells, pZeo-transfected cells, FRa-transfected clones
(FRwt-3, FRwt-11, FRwt-14) and mutation in FR67-transfected clones (FR67-9,
FR67-11, FR67-27).
40
FRwt-11
Cell numbers (104)
30 FRwt-14
FRwt-3
20 pZeo
Cell
FR67-27
10 FR67-11
FR67-9
0
0 2 4 6 8 10
Days
Figure 8.7 Overexpression of FRa induces cell growth in aT3-1 cells. Cells (aT3-1)
and single clone of stable cells overexpressing FRa and mutant FR67, at an initial
concentration of 0.2 105/ml, were harvested at time points indicated and counted.
Shown are mean values SD from three independent experiments, each performed in
triplicate.
larger than 20 cells formed in 2 weeks was counted. The cell growth in soft
agar was significantly increased in FRa overexpressing cells compared with
parent and pZeo cells ( p < 0.001). The cells transfected with mutant FR67
formed a significantly lower number of colonies compared with parent and
pZeo cells ( p < 0.01) (Fig. 8.9). These results suggest that overexpression of
FRa in aT3-1 cells may induce cellular transformation, and the FR67
mutation abrogates this ability of FRa.
300 300
40
30 200
Histogram
Histogram
Histogram
200
20
100 100
10 0.06 49.00 48.57
100 101 102 103 104 100 101 102 103 104 100 101 102 103 104
FL1-H: PCNA-FITC FL1-H: PCNA-FITC FL1-H: PCNA-FITC
Negative control T3-1 pZeo
250
250 250
200
200 200
Histogram
Histogram
Histogram
150
150 150
100 100
100
58.80 62.00 59.92
50 50 50
100 101 102 103 104 100 101 102 103 104 100 101 102 103 104
FL1-H: PCNA-FITC FL1-H: PCNA-FITC FL1-H: PCNA-FITC
FRwt-3 FRwt-11 FRwt-14
250
300 250
200
200
150 200
Histogram
Histogram
Histogram
150
100 100
38.75 100 44.65 46.70
50 50
100 101 102 103 104 100 101 102 103 104 100 101 102 103 104
FL1-H: PCNA-FITC FL1-H: PCNA-FITC FL1-H: PCNA-FITC
FR67-9 FR67-11 FR67-27
Figure 8.8 Flow cytometric measurement of PCNA in stably transfected and nontrans-
fected aT3-1 cells. (A) The negative control was stained with the FITC-conjugated
isotype control mAb; (B) Nontransfected aT3-1 cells; (C) pZeo cells; (D) FRwt-3
cells; (E) FRwt-11 cells; (F) FRwt-14 cells; (G) FR67-9 cells; (H) FR67-11 cells;
(I) FR67-27 cells. The results shown are representative of three different experiments.
A p < 0.01
p < 0.001
250
200
Colony numbers
150
100
50
0
T3 pZeo FRwt-3 FRwt-11 FRwt-14 FR67-9 FR67-11 FR67-27
T3-1 pZeo
Figure 8.9 Overexpression of FRa in aT3-1 cells induces soft agar formation. Control
clone (aT3-1, pZeo), FRa overexpressing clones, and mutant FR67 overexpressing
clones were seeded in triplicate into 0.3% agar in six-well plates at 5 103/ml.
(A) After 15 days of culture, colonies containing more than 20 cells were enumerated.
Results are mean SD for three separate experiments. (B) After 15 days of culture, the
plates were counted and photographed. Representative results from three independent
experiments are shown.
Folate Receptor Expression in Pituitary Adenomas 255
20
15 *
10
*
5
0
aT3-1 pZEO FRwt-3 FRwt-11 FRwt-14 FR67-9 FR67-11 FR67-27
5
Figure 8.10 Solubilized folic acid binding. Solubilized folic acid binding was as described
in Materials and Methods (Section H). Mean value are from two independent experiments.
*p < 0.05, compare with untransfected aT3-1, transfected pZeo, and FR67 cells.
showed no ectopic FRa mRNA expression (data not shown). Three groups
of cells (FRwt, FR67, and control cells) demonstrated similar level of
endogenous FRa expression by using murine cDNA primers (data not
shown).
Interestingly, NOTCH3 mRNA expression was significantly induced in
FRwt clones ( p < 0.001) compared to that of pZeo clone. The expression
of NOTCH3 mRNA was decreased in mutant FR67 clones, but no
statistical difference was observed between FR67 group and pZeo clone
(Fig. 8.11A). HES-1 mRNA was increased in FR67 mutant clones ( p <
0.01, comparing to pZeo cells) (Fig. 8.11B) but not in FRwt clones. No
detectable mRNAs expression of DLK1 and PIT1 were observed in these
three groups of cells. There was no marked difference of the ASCL-1
expression among these cells (data not shown).
FGFR1 mRNA expression was increased in FRwt clones ( p < 0.05)
compared to that in pZeo. No significant change of FGFR1 expression was
found in FR67 mutant clones (Fig. 8.11C). While ESR1 mRNA expres-
sion showed no difference among pZeo, FRwt, and FR67 cells, the
substantially reduced ESR2 mRNA expression was observed in FRwt
clones ( p < 0.001). A lesser degree of reduced ESR2 mRNA expression
was detected in FR67 mutant clones ( p < 0.01) compared to that of pZeo
(Fig. 8.11D). However, no substantial changes of PTTG1 and EGFR were
observed in either FRwt clones or FR67 mutant clones compared to the
control cells (data not shown).
However, most of the genes involved in Wnt pathway, including
SFRP1, b-catenin, PITX2, cyclin D1, and RB1 mRNA expression
demonstrated no significant difference among three groups of cells. While
TLE2 mRNA expression exhibited an increasing tendency in all FRwt
clones compared to pZeo, no statistical difference was noticed (Fig. 8.11E).
Surprisingly, a substantial higher expression of TLE mRNA was observed in
256 Chheng-Orn Evans et al.
FR67 mutant clones compared to that in pZeo cells ( p < 0.05). TLE2
mRNA resembled HES-1 mRNA in their expression pattern among all the
cells studied.
A ND
p < 0.001
Notch 3 mRNA expression (fold change)
7 Tubulin
6 Actin
0
pZeo FRwt-3 FRwt-11 FRwt-14 FR67-9 FR67-11 FR67-27
B P < 0.01
Tubulin
Actin
HES-1 mRNA expression (fold change)
ND
4
0
pZeo FRwt-3 FRwt-11 FRwt-14 FR67-9 FR67-11 FR67-27
Figure 8.11 (continued )
Folate Receptor Expression in Pituitary Adenomas 257
C ND
FGFR1 mRNA expression (fold change)
2.0 P < 0.05
Tubulin
Actin
1.5
1.0
0.5
0.0
pZeo FRwt-3 FRwt-11 FRwt-14 FR67-9 FR67-11 FR67-27
D p < 0.05
2.00 Tubulin
ESR2 mRNA expression (fold change)
Actin
1.50
1.00
0.50
0.00
pZeo FRwt-3 FRwt-11 FRwt-14 FR67-9 FR67-11 FR67-27
(continued)
258 Chheng-Orn Evans et al.
3.50 ND
3.00
2.50
*
2.00
1.50
1.00
0.50
0.00
pZeo FRwt-3 FRwt-11 FRwt-14 FR67-9 FR67-11FR67-27
* Wt-11 vs pZeo p < 0.05 (TLE2/actin)
Figure 8.11 mRNAs expression of NOTCH3 (A), HES-1 (B), FGFR1 (C), ESR2 (D),
and TLE2 (E) in FRa overexpressing and mutant FR67 overexpressing cells compared
with control pZeo cells. All measurements are shown relative to the expression levels of
actin and tubulin. Values are based on three independent experiments, each performed
in duplicate.
IV. Discussion
Our result demonstrates that FRa overexpression induces growth in
the NF pituitary tumor cell line aT3-1 in physiological folic acid culture
condition and soft agar. The increased cell growth in FRwt cells were
further confirmed by BrdU incorporation assay (BrdU is only incorporated
into the DNA of proliferating cells) and PCNA staining (PCNA is a nuclear
antigen that is only expressed in proliferating cells and absent in resting
cells). These results indicate that FRa overexpression may confer a growth
advantage to pituitary tumor cells. Our data are in agreement with the
observation that transfection of FRa in NIH/3T3 cells is associated with an
Tc-99m FolateScan
Protocol
2 IV injections 13 minutes
apart:
(1) 1 mg folic acid
(2) 12 mL/0.1 mg Gadolinium-enhanced MRI Tc-99m Folatescan whole body
Folatescan Patient 2: Folate-Receptor negative
(EC20) labeled with 1525
mCi Tc-99m
12 h postinjection:
Whole body imaging
SPECT/CT images follow
whole body
Gadolinium-enhanced MRI
Tc-99m Folatescan whole body
Patient 1 Patient 2
Coronal Coronal
10 mg 20 mg 10 mg 20 mg
Western blot analysis FR+ Sagittal Western blot analysis FR Sagittal
Folate-receptor positive Folate-receptor negative
10/1 SPECT in target/background 1/1 SPECT in target/background
CT correlation confirms uptake in pituitary CT correlation guides search for uptake
increased growth rate both in vitro and in vivo (Bottero et al., 1993). Our data
are further supported by the study in the epithelial ovarian cancer that
demonstrates that FRa overexpression is significantly correlated with the
percentage of cells in the S-phase (Toffoli et al., 1997). Therefore, FRa
overexpression may present a stimulus for cell growth in NF pituitary
tumors.
The degree of FRa expression is associated with biological aggressive-
ness of ovarian neoplasms and suggests an involvement of FRa in neoplastic
progression (Toffoli et al., 1997). Functional downregulation of FRa with
specific intracellular expression of single-chain antibodies (intrabody) in
ovarian cancer cells was accompanied by reduced cell proliferation and
adhesion also supports the role of FRa in cancer progression (Figini et al.,
2003). Antisense oligonucleotides targeted to the FRa induced a dose-
dependent decrease in breast cancer cell survival. Jhaveri et al. (2004)
indirectly confirms the importance of FRa in cancer development. Alternate
mechanisms of FRa enhancement of cell proliferation have been eluci-
dated; for instance, FRa is partitioned in cellular-membrane domains in
close physical and functional association with the src-family member p53
56 lyn and the Gai-3 subunit of heterotrimeric G-proteins (Miotti et al.,
2000) and FRa expression transcriptionally regulates the expression of the
tumor suppressor gene caveolin-1 (Bagnoli et al., 2000). Upregulated FRa
has been associated with two pathways by statistical analysis of RT-qPCR
Folate Receptor Expression in Pituitary Adenomas 261
ACKNOWLEDGMENTS
We gratefully acknowledge financial assistance to Nelson M. Oyesiku, MD, PhD, FACS,
from the National Institutes of Health (R01-NS5143901). We thank the Department of
Neuropathology, Emory University Hospital, for the histology and IHC analysis.
REFERENCES
Antony, A. C. (1992). The biological chemistry of folate receptors. Blood 79, 28072820.
Asa, S. (1998). Tumors of the Pituitary Gland. Armed Forces institute of Pathology,
Washington, DC.
Asa, S. L., and Ezzat, S. (1998). The cytogenesis and pathogenesis of pituitary adenomas.
Endocr. Rev. 19, 798827.
Asa, S. L., and Kovacs, K. (1992). Clinically non-functioning human pituitary adenomas.
Can. J. Neurol. Sci. 19, 228235.
Asa, S. L., Cheng, Z., Ramyar, L., Singer, W., Kovacs, K., Smyth, H. S., and Muller, P.
(1992). Human pituitary null cell adenomas and oncocytomas in vitro: Effects of
264 Chheng-Orn Evans et al.
Grbavec, D., Lo, R., Liu, Y., and Stifani, S. (1998). Transducin-like enhancer of split 2,
a mammalian homologue of Drosophila Groucho, act as a transcriptional repressor, interacts
with hairy/enhancer of split proteins, and is expressed during neuronal development.
Eur. J. Biochem. 258, 339349.
Greenman, Y., and Melmed, S. (1996). Diagnosis and management of nonfunctioning
pituitary tumors. Annu. Rev. Med. 47, 95106.
Hasson, P., and Paroush, Z. (2006). Crosstalk between the EGFR and other signalling
pathways at the level of the global transcriptional corepressor Groucho/TLE. Br. J. Cancer
94, 771775.
Horejsi, V., Drbal, K., Cebecauer, M., Cerny, J., Brdicka, T., Angelisova, P., and
Stockinger, H. (1999). GPI-microdomains: A role in signalling via immunoreceptors.
Immunol. Today 20, 356361.
Hough, C., Cho, K., Zonderman, A., Schwartz, D., and Morin, P. (2001). Coordinately
up-regulated genes in ovarian cancer. Cancer Res. 61, 38693876.
Ilangumaran, S., He, H., and Hoessli, D. (2000). Microdomains in lymphocyte signalling:
Beyond GPI-anchored proteins. Immunol. Today 21, 27.
Jhaveri, M., Rait, A., Chung, K., Trepel, J., and Chang, E. (2004). Antisense oligonucleo-
tides targeted to the human alpha folate receptor inhibit breast cancer cell growth and
sensitize the cells to doxorubicin treatment. Mol. Cancer Ther. 3, 15051512.
Kane, M. A., Portillo, R. M., Elwood, P. C., Antony, A. C., and Kolhouse, J. F. (1986). The
influence of extracellular folate concentration on methotrexate uptake by human KB
cells. Partial characterization of a membrane-associated methotrexate binding protein.
J. Biol. Chem. 261, 4449.
Katznelson, L., Alexander, J. M., and Klibanski, A. (1993). Clinical review 45: Clinically
nonfunctioning pituitary adenomas. J. Clin. Endocrinol. Metab. 76, 10891094.
Kelley, K., Rowan, B., and Ratnam, M. (2003). Modulation of the folate receptor alpha
gene by the estrogen receptor: Mechanism and implications in tumor targeting. Cancer
Res. 63, 28202828.
Luhrs, C. A., Raskin, C. A., Durbin, R., Wu, B., Sadasivan, E., McAllister, W., and
Rothenberg, S. P. (1992). Transfection of a glycosylated phosphatidylinositol-anchored
folate-binding protein complementary DNA provides cells with the ability to survive in
low folate medium. J. Clin. Invest. 90, 840847.
Mathias, C. J., and Green, M. A. (1998). A kit formulation for preparation of [(111)In]In-
DTPA-folate, a folate-receptor-targeted radiopharmaceutical. Nucl. Med. Biol. 25,
585587.
Mathias, C. J., Wang, S., Waters, D. J., Turek, J. J., Low, P. S., and Green, M. A. (1998).
Indium-111-DTPA-folate as a potential folate-receptor-targeted radiopharmaceutical.
J. Nucl. Med. 39, 15791585.
McCabe, C., Boelaert, K., Tannahill, L., Heaney, A., Stratford, A., Khaira, J., Hussain, S.,
Sheppard, M., Franklyn, J., and Gittoes, N. (2002). Vascular endothelial growth factor,
its receptor KDR/Flk-1, and pituitary tumor transforming gene in pituitary tumors.
J. Clin. Endocrinol. Metab. 87, 42384244.
McCabe, C., Khaira, J., Boelaert, K., Heaney, A., Tannahill, L., Hussain, S., Mitchell, R.,
Olliff, J., Sheppard, M., Franklyn, J., and Gittoes, N. (2003). Expression of pituitary
tumour transforming gene (PTTG) and fibroblast growth factor-2 (FGF-2) in human
pituitary adenomas: Relationships to clinical tumour behaviour. 1: Clin Endocrinol (Oxf ).
2003 Feb. 58, 141150.
Miotti, S., Canevari, S., Menard, S., Mezzanzanica, D., Porro, G., Pupa, S. M.,
Regazzoni, M., Tagliabue, E., and Colnaghi, M. I. (1987). Characterization of human
ovarian carcinoma-associated antigens defined by novel monoclonal antibodies with
tumor-restricted specificity. Int. J. Cancer 39, 297303.
266 Chheng-Orn Evans et al.
Miotti, S., Bagnoli, M., Tomassetti, A., Colnaghi, M. I., and Canevari, S. (2000). Interaction
of folate receptor with signaling molecules lyn and G(alpha)(i-3) in detergent-resistant
complexes from the ovary carcinoma cell line IGROV1. J. Cell Sci. 113, 349357.
Moreno, C. S., Evans, C. O., Zhan, X., Okor, M., Desiderio, D. M., and Oyesiku, N. M.
(2005). Novel molecular signaling and classification of human clinically nonfunctional
pituitary adenomas identified by gene expression profiling and proteomic analyses. Cancer
Res. 65, 1021410222.
Onguru, O., Scheithauer, B., Kovacs, K., Vidal, S., Jin, L., Zhang, S., Ruebel, K., and
Lloyd, R. (2004). Analysis of epidermal growth factor receptor and activated epidermal
growth factor receptor expression in pituitary adenomas and carcinomas. Mod. Pathol. 17,
772780.
Orr, R. B., and Kamen, B. A. (1994). UMSCC38 cells amplified at 11q13 for the folate
receptor synthesize a mutant nonfunctional folate receptor. Cancer Res. 54, 39053911.
Orr, R. B., and Kamen, B. A. (1995). Identification of a point mutation in the folate receptor
gene that confers a dominant negative phenotype. Cancer Res. 55, 847852.
Rijnboutt, S., Jansen, G., Posthuma, G., Hynes, J. B., Schornagel, J. H., and Strous, G. J.
(1996). Endocytosis of GPI-linked membrane folate receptor-alpha. J. Cell Biol. 132,
3547.
Rochman, H., Selhub, J., and Karrison, T. (1985). Folate binding protein and the estrogen
receptor in breast cancer. Cancer Detect Prev. 8, 7175.
Ross, J. F., Chaudhuri, P. K., and Ratnam, M. (1994). Differential regulation of folate
receptor isoforms in normal and malignant tissues in vivo and in established cell lines.
Physiologic and clinical implications. Cancer 73, 24322443.
Semba, S., Han, S. Y., Ikeda, H., and Horii, A. (2001). Frequent nuclear accumulation of
beta-catenin in pituitary adenoma. Cancer 91, 4248.
Shen, F., Ross, J. F., Wang, X., and Ratnam, M. (1994). Identification of a novel folate
receptor, a truncated receptor, and receptor type beta in hematopoietic cells: cDNA
cloning, expression, immunoreactivity, and tissue specificity. Biochemistry 33, 12091215.
Sun, X. L., Murphy, B. R., Li, Q. J., Gullapalli, S., Mackins, J., Jayaram, H. N.,
Srivastava, A., and Antony, A. C. (1995). Transduction of folate receptor cDNA into
cervical carcinoma cells using recombinant adeno-associated virions delays cell prolifera-
tion in vitro and in vivo. J. Clin. Invest. 96, 15351547.
Sun, X. L., Jayaram, H. N., Gharehbaghi, K., Li, Q. J., Xiao, X., and Antony, A. C. (1999).
Modulation of the cytotoxicity of 30 -azido-30 -deoxythymidine and methotrexate after
transduction of folate receptor cDNA into human cervical carcinoma: Identification of a
correlation between folate receptor expression and thymidine kinase activity. Cancer Res.
59, 940946.
Toffoli, G., Cernigoi, C., Russo, A., Gallo, A., Bagnoli, M., and Boiocchi, M. (1997).
Over-expression of folate binding protein in ovarian cancers. Int. J. Cancer 74, 193198.
Wang, D., Zhang, H., Lang, F., and Yun, C. (2007). Acute activation of NHE3
by dexamethasone correlates with activation of SGK1 and requires a functional gluco-
corticoid receptor. Am. J. Physiol. Cell Physiol. 292, C396C404.
Yamada, S., Asa, S. L., Kovacs, K., Muller, P., and Smyth, H. S. (1989). Analysis of hormone
secretion by clinically nonfunctioning human pituitary adenomas using the reverse
hemolytic plaque assay. J. Clin. Endocrinol. Metab. 68, 7380.
C H A P T E R N I N E
Contents
I.
Introduction 268
II.
Structure and Binding of Dihydrofolate, MTX, and NADPH 269
III.Mechanism of DHFR Catalysis 272
IV.Alternative Substrates: Folic Acid and Dihydrobiopterin 273
V.Genomic Organization of DHFR 274
VI.Human Dihydrofolate Reductase Pseudogenes 276
VII.Transcriptional Regulation 276
VIII.Polymorphisms of DHFR 280
A. 19-bp deletion polymorphism in human DHFR intron-1 281
B. DHFR copy number variation in 9-bp tandem repeats 282
IX. Posttranscriptional Regulation of DHFR 283
X. Translational Regulation of DHFR 283
Acknowledgments 287
References 287
Abstract
Dihydrofolate reductase (DHFR) enzyme catalyzes tetrahydrofolate regenera-
tion by reduction of dihydrofolate using NADPH as a cofactor. Tetrahydrofolate
and its one carbon adducts are required for de novo synthesis of purines and
thymidylate, as well as glycine, methionine and serine. DHFR inhibition causes
disruption of purine and thymidylate biosynthesis and DNA replication, leading
to cell death. Therefore, DHFR has been an attractive target for chemotherapy of
many diseases including cancer. Over the following years, in order to develop
better antifolates, a detailed understanding of DHFR at every level has been
undertaken such as structure-functional analysis, mechanisms of action, tran-
scriptional and translation regulation of DHFR using a wide range of technolo-
gies. Because of this wealth of information created, DHFR has been used
The Cancer Institute of New Jersey, Robert Wood Johnson Medical School, University of Medicine and
Dentistry of New Jersey, New Brunswick, New Jersey 08903
267
268 Emine Ercikan Abali et al.
I. Introduction
The enzyme dihydrofolate reductase (DHFR, 5,6,7,8-tetrahydrofolate:
NADP oxidoreductase, EC 1.51.3) catalyzes the reduction of dihydrofolate
(H2F) to tetrahydrofolate (H4F) utilizing NADPH as a cofactor. H4F and its
derivatives are essential cofactors in the synthesis of thymidylate, purines, and
some amino acids (Figs. 9.1A and 9.2A) (Blakley and Cocco, 1984; Futterman,
1957; Osborn and Huennekens, 1958). Inhibition of DHFR results in a
depletion of the reduced folate pools, inhibition of DNA synthesis, and cell
death. Due to its biological significance, DHFR has proven to be an important
target of antineoplastic, antiprotozoal, antifungal, and antimicrobial drugs in
addition to its use for the treatment of other nonmalignant diseases, such as
arthritis.
Antifolates are the oldest of the antimetabolite class of anticancer drugs
and have been used in the clinic for more than four decades. The first
clinically useful antifolate was aminopterin, a tight binding inhibitor of
DHFR. Treatment with aminopterin led to the first-ever remissions in
childhood leukemia. Soon after, methotrexate (MTX) replaced aminopterin
based on animal studies showing that MTX had a better therapeutic index.
Over the following years, in order to develop better antifolates, a detailed
understanding of DHFR at every level has been undertaken such as structure
functional analysis, mechanisms of action, transcriptional and translation regu-
lation of DHFR using a wide range of technologies. Because of this wealth of
information created, DHFR has been used extensively as a model system
for enzyme catalysis, investigating the relations between structure in silico
structure-based drug design, transcription from TATA-less promoters, regu-
lation of transcription through the cell cycle, and translational autoregulation.
In this review, the current understanding of human DHFR is summar-
ized. We begin with the structure and kinetic mechanism of enzyme of
DHFR. The review then concentrates on the genomic organization, poly-
morphisms, transcriptional, and translational regulation of DHFR. We refer
readers to earlier reviews that discuss many aspects of DHFR regulation for
additional in-depth analysis (Azizkhan et al., 1993; Banerjee et al., 2002;
Blakley, 1995; Cody and Schwalbe, 2006; Hammes-Schiffer and Benkovic,
2006; Schnell et al., 2004; Slansky and Farnham, 1996).
Human Dihydrofolate Reductase 269
A O
O OH
O
O OH
NH2 NH OH NH
4 N 9 OH 4 N 9 OH
N 5 6 N N 5 6 NH
10
2 7 O 2 7 O
H2N N N H2N N N
1 8 1
H
8
Pteridine pABA Glu
pABG
Methotrexate (MTX) Dihydrofolate (H2F)
O
4
NH2
H2N 5
N N
O O 8 Adenine
Nicotinamide 2
N
6
N
O P O P O N
O O
O O
O
HO OH HO O P OH
O
Phosphoribose
NADPH
F
h a
f NADPH
C
e
g
c d
Loop I b
B
E
Antifolate
Figure 9.1 (A) Structures and atomic numbering of methotrexate (MTX), dihydro-
folate (H2F), and NADPH. (B) a-Carbon representation of human DHFR complexed
with NADPH and MOT, a furo analog of folate (N-[(4-phenyl)carbonyl]-L-glutamic
acid). b-Sheets are labeled with lower case letters and a-helices are labeled with upper
case letters (PDB code 1hfq) (Cody et al., 1998).
A B
O H O H
4 R2
N R2 4 N
6
HN 5 6 HN 5 H
2 7 2 7
H2N N N H H2N N N
1 1
HH N 4 5 H H2N 4 5
8 2 8
6 + 6
O 2 N 2
O N
R1 R2
B
E NADPH
H2F
98 mM1 s1 94 s1 1360 s1 37 s1
+
E NADP
E NADPH H4F
4.4 mM1 s1
E NADPH EH F
H4F 4
100 s1
Figure 9.2 (A) Reduction of H2F by DHFR. (B) Kinetic scheme of the catalytic cycle
of DHFR denoted as E. The five kinetic intermediates and the rate constants at pH 7.65
at 20 C are shown (Blakley, 1995).
packed against the b-sheet core (Fig. 9.1B). The helix aE0 , which is imme-
diately after aE is perpendicular to aE and may have emerged due to five
residue insertion in human DHFR relative to bacterial enzymes (Davies
et al., 1990). In addition, vertebrate including human DHFR has one left-
handed, type II polyproline-like helix, which is not present in E. coli.
Another deviation from E. coli DHFR is the presence of a cis-peptide linkage,
one between residues Arg65 and Pro66. The other cis-peptide linkage is a
conserved structural feature of all DHFRs and is between residues Gly116
and Gly117, which are near the nicotinamide-binding site (Blakley, 1995;
Cody and Schwalbe, 2006; Davies et al., 1990). The active site cleft is formed
at the junction of two subdomains: a larger subdomain that binds the
adenosine portion of NADPH and the smaller loop domain. The active
site is enclosed in a large hydrophobic pocket surrounded by the a-helix B,
the central b-sheets (a, e, and b) and the loop 1. Two polar groups, Glu30 and
Arg70 at each end, seal this hydrophobic pocket. The acidic residue, Glu30
interacts with the 2-amino group and N3 of the pteridine ring folate and
the 2-amino group and N1 of MTX. The basic group, Arg70 interacts
with the a-carboxylate of the glutamate moiety of both the substrate and
the inhibitor. The nicotinamide moiety also resides in this deep hydrophobic
pocket in the vicinity of the substrate, but the rest of the NADPH binds in an
extended conformation with the 20 -phosphoADP-ribose moiety occupying
a cleft which includes the carboxy-terminal ends of five strands of b-sheet
(Cody et al., 1992).
The conformation of vertebrate DHFRs including human DHFR is
more rigid than E. coli DHFR. However, the amino acids required for
catalysis and the general features of the secondary structures, as well as the
kinetic pathways are all conserved throughout the evolution with the
exception of the flexibility of the enzymes between vertebrates and E. coli.
Comparison of crystal structures of DHFR reveals that unlike E. coli
DHFR, vertebrate DHFRs lack loop 1 motion and subdomain rotation
(Met20 loop in E.coli) structures (Sawaya and Kraut, 1997). While there are
no obvious structural explanation for the lack of subdomain rotation in
vertebrates, there are three structural differences between vertebrate and
E. coli DHFR that may give rise to the rigidity of vertebrate DHFRs:
insertion of a left-handed polyproline-type helix in vertebrate DHFRs
loop 1, Gly20 in the loop 1 of vertebrate DHFR instead of an asparagine
which creates a stable b-hairpin, and the truncation of the vertebrates GH
loop preventing the formation of hydrogen bonds with loop 1.
The structures of folate and MTX are essentially the same except for the
4-amino group and a methyl group attached to N10 in MTX instead of a
4-oxo group and hydrogen attached to N10 of folate (Fig. 9.1A). However,
MTX binding to human DHFR is quite different than that of folate,
consequently making different interactions with the active site residues.
MTX is protonated at the N1 position of the pteridine ring and is also
272 Emine Ercikan Abali et al.
rotated 180 about the C6C9 as compared with the pteridine ring of folate.
As a result, the carboxylate group of Glu30 interacts with the 2-amino
group and N3 in the case of folate and N1 and the 2-amino group of MTX.
These differences form the basis for the extremely tight binding of MTX
(Ki 1.2 pM) as compared to folate (Km 0.08 mM) (Ercikan et al.,
1993b).
Binding affinity of DHFR and the turnover for the reduction of folate
by DHFR is much lower towards folate than the natural substrate, H2F. The
basis for this discrepancy is due to the formation of a dead-end complex of
E:NADP:folate, from which either ligand can dissociate very slowly to form
productive enzyme complex (Blakley, 1995).
DHFR also catalyzes the reduction of dihydrobiopterin (BH2) to tetra-
hydrobiopterin (BH4), which serves as a cofactor in nitric oxide (NO)
synthesis (Abelson et al., 1978). Dysregulation of NO synthesis by endothe-
lial NO synthase (eNOS) has been implicated in the development of
atherosclerosis. Restoration of NO synthesis may be critical for prevention
and treatment of cardiovascular diseases. NO is synthesized by eNOS using
the cofactor BH4. During vascular oxidative stress, BH4 is oxidized to BH2
making BH4 limiting, thus impairing eNOS function. BH2 is reduced to
BH4 by DHFR, suggesting a key role of this enzyme in maintaining BH4
levels (Chalupsky and Cai, 2005).
The dissociation constant of H2F (Kd 0.12 mM) from DHFR is
250-fold lower than that of BH2 (Kd 31 mM) (Tsay et al., 1990). A possible
explanation for the reduced rate of reduction of BH2 is the lack of the
paraaminobenzoylglutamate (pABG) in BH2 which has been shown to
induce a closed conformation in the active site of DHFR, hence retention
of the substrate in the active site for the reduction reaction (Shrimpton
et al., 2003).
B IV III II I +1
GGGGCGGGGGGGCGGGGCCTCGCACAAATGGGGACGAGGGGGGCGGGGCGGCCACAATTTCGCGCCAAACTTGA DHFR coding
CCCCGCCCCCCCGCCCCGGAGCGTGTTTACCCCTGCTCCCCCCGCCCCGCCGGTGTTAAAGCGCGCTTTGAACT non-coding
Figure 9.3 (A) Genomic organization of dhfr is drawn according to the scale. The
number of nucleotides between each circle is 100. Nuclease resistant region is under-
lined and the nucleosomes are shown as large cylinders. Transcription factors are
represented as follows: The two overlapping E2F sites are indicated as two small
cylinders flanking the major transcription site of DHFR. Small rectangular boxes
represent the overlapping GC boxes. The two large black boxes represent the first
two exons of DHFR. (B) The bidirectional core promoter is enlarged to show this
region in detail. The consensus sequences of four G/C box recognition sequences for
Sp factor binding region are boxed. The two overlapping E2F recognition site are
underlined. Major transcription start site is shown as 1.
276 Emine Ercikan Abali et al.
both repression and activation of transcription (Fry et al., 1999; Schilling and
Farnham, 1994). In mouse embryo fibroblasts (MEFS) lacking both p107
and p130, unlike thymidylate synthase, thymidine kinase and ribonucleo-
tide reductase that are E2F-regulated genes involved in DNA replication,
DHFR was not derepressed in G0G1, but was the only gene that was
prematurely induced after serum stimulation. In addition, DHFR was
normally regulated in Rb negative MEFS (Hurford et al., 1997). Chang
et al. (2001) speculate that these puzzling findings are due the unique
arrangement of Sp1 and E2F sites in the dhfr promoter.
Recent studies have shown that Sp1 and E2F cooperate in regulating dhfr
gene expression through directly interacting with each other and also
through the master regulator, tumor suppressor protein, Rb and two
other Rb homologues, p107 and p130, collectively known as pocket
proteins. Rb and the other related pocket proteins bind to members of
the E2F family of transcription factors and regulate cell cycle progression
from G1 to S (Nevins, 2001). E2F13 are known to bind Rb and they are
known as activators of transcription, whereas E2F4 and 5 are repressors and
they are bound to p107 or p130, the other pocket proteins. Rb accom-
plishes transcriptional repression by recruiting a myriad of corepressors to
E2F-regulated promoters (Roberts and Orkin, 2004). In quiescent or
terminally differentiated cells, E2F4 or E2F5 are bound to p107 or p130.
Phosphorylation status of Rb changes during the cell cycle. The hyperpho-
sphorylated Rb is inactive and is predominantly found in proliferating cells,
whereas the hypophosphorylated active form is abundant in quiescent or
differentiating cells. Mitogenic stimulation of quiescent cells induces activa-
tion of cyclin D-dependent kinase (cdk) 4(6) which phosphorylate pRb
leading to dissociation of Rb from E2F, allowing free E2F to activate
transcription of genes involved in cell cycle progression and in DNA
replication. For example, DHFR activity during this transition from G1
to S increases by tenfold. The biological relevance of the Rb-E2F pathway
is emphasized by the fact that in many cancers this pathway is dysregulated
leading to an increase in free E2F activity. According to the current
model, in G0 and early G1, chromatin modifiers such as the Sin3B-HDAC
complex, members of the ATP-dependent complex SWI/SNF, and histone
H3 methyltransferase are in complex with p130, masking the transactivation
domain of E2F, thereby repressing transcription. In mid to late G1, p130 is
replaced by p107 and then by Rb in the late G1 and S phases. After
mitogenic simulation, cyclin-dependent kinases 4 and 6 are activated by
cyclin D, which in turn phosphorylates pocket proteins. This allows the
switch from repressive E2Fs to activating E2Fs and the recruitment of
histone acetyltransferase leading to G1S transition (Fig. 9.4).
Just like E2Fs, Sp1 has been reported to interact directly with pRb and
p107 as well as E2F13 and HDAC (Chang et al., 2001; Noe et al., 1998).
While Rb protein induces Sp1 driven transcription, HDAC represses
Human Dihydrofolate Reductase 279
Suv39H1
HDAC mSin3B-HDAC
Rb P p130
SWI/SNF
E2F-
SP1 4,5 DP1 G0
Rb
Suv39H1
HDAC mSin3B-HDAC
Rb P Rb
SWI/SNF
E2F-
SP1 4,5 DP1 Early G1
p130
Cyclin D
CDK4 P P P P
Rb
Rb P P P P
Rb Rb
E2F- SWI/SNF E2F-
SP1 DP1
4,5 SP1 1-3 DP1
HAT HAT
E2F-
4,5
Late G1
Figure 9.4 A model for E2Fs and Sp1 mediated transcriptional regulation of dhfr. The
bent arrow represents the major transcription start site. In G0 and early G1, chromatin
modifiers such as the Sin3B-HDAC complex and histone H3 methyltransferase are in
complex with p130, masking the transactivation domain of E2F, thereby repressing
transcription. In mid to late G1, p130 is replaced by p107 and then by Rb in the late G1
and S phases. After mitogenic simulation, cyclin-dependent kinases 4 and 6 are acti-
vated by cyclin D, which in turn phosphorylates pocket proteins. This allows the switch
from repressive E2Fs to activating E2Fs and the recruitment of histone acetyltransferase
leading to G1S transition. Sp1 interacts directly with pRb and p107 as well as E2F13
and HDAC. While Rb protein induces Sp1 driven transcription, HDAC represses
transcription.
that homozygote 19-bp deletion increased DHFR message levels about 1.5-
to 5-fold compared to nondeletion controls (Parle-McDermott et al., 2007;
Xu et al., 2007). Furthermore, in Irish population 19-bp deletion allele is a
maternal protective allele, that is, NTD-risk pregnancy was lower in mothers
with the deletion allele. The differences between the two studies were the
size and the genetic background of the two populations under study and the
folate supplementation. While the Irish study had more patients, they did not
correlate folate levels with outcome. Johnson group had patients with mixed
ethnicity, but measured folate levels of mothers. In another study, the 19-bp
deletion was not associated with spina bifida risk in mothers and children
DHFR expression was similar in patients with the deleted allele to that of the
patients with the wild-type genotype (van der Linden et al., 2007).
DHFR 19-bp deletion polymorphism was also found to increase the risk
of preterm delivery and low birth weight in the presence of low dietary folate
( Johnson et al., 2005). Furthermore, this polymorphism was associated
with low homocysteine, with decreased risk of cardiovascular and congenital
abnormalities ( Johnson et al., 2005; Wald et al., 2002) and with greater breast
cancer risk in multivitamin users (Xu et al., 2007).
Combinational polymorphism studies analyzed whether folate-related
enzymes were involved autism disorders, impaired social communication,
and interactions with restricted behavior patterns due to neuro-
developmental defects (Olney et al., 1981; Tunnicliff and Ngo, 1977).
The risk of autism was studied in relation to several folate-related gene
variants present in methionine synthase reductase, methionine synthethase,
reduced folate carrier, glutamate carboxypeptidase II, methylene tetrahydro-
folate reductase, and the DHFR 19-bp deletion. Analysis of the individual
folate polymorphisms showed that only the 19-bp DHFR deletion was a
significant risk factor for autism (Padmanabhan and Shafiullah, 2003).
the presence and absence of MTX (Cowan et al., 1986; Domin et al., 1982).
Therefore, having ruled out transcriptional changes and stability changes as
causing the rapid increase in DHFR upon exposure to MTX, our laboratory
and others (Chu et al., 1993; Ercikan et al., 1993a) began to explore the role
of a translational mechanism in the induction.
Using rabbit reticulocyte in vitro translation assays and UV cross-linking
assays, our laboratory has demonstrated that addition of exogenous DHFR
to its own mRNA inhibits its translation, and DHFR protein can bind its
own cognate mRNA (Ercikan et al., 1993a; Ercikan-Abali et al., 1997).
More detailed analysis localized the DHFR/RNA interaction to a 100 bp
region within the coding region (Ercikan-Abali et al., 1997). Based on these
reports, a translational model emerged to explain elevated DHFR protein
levels that involved an autoregulatory translation process. This model pro-
poses that human DHFR protein can bind to its cognate mRNA and thereby
inhibit its own translation. Addition of the inhibitor MTX (or substrate), via
a conformational change (Appleman et al., 1988; Bystroff and Kraut, 1991)
associated with its binding to DHFR, disrupts the DHFR proteinmRNA
complex, and allows translation to resume. Others (Tai et al., 2004) have used
gel shift and nitrocellulose filter-binding assays to localize the binding site to
an 82 nucleotide sequence corresponding to nucleotides 401482 in the
coding region. So far, only one study demonstrated in vivo functional
biological activity of this sequence. The 82-nucleotide sequence was placed
upstream of a luciferase gene and transfected into human colon RKO cells.
Upon MTX exposure, a twofold increase in the 82-nucleotide heterologous
luciferase construct versus no change in controls was reported (Tai et al.,
2004). Computer modeling of mRNA folding within the 100-bp binding
region of DHFR revealed two possible stemloop structures suitable for
DHFR protein binding.
With respect to identifying the amino acids in DHFR that are associated
with the rapid induction of DHFR in response to MTX, divergent results
were published by groups investigating this question. Tai et al. (McPherson
et al., 1999; Tai et al., 2002) utilized binding assays to identify critical amino
acid residues on human DHFR protein that mediate RNA recognition
(McPherson et al., 1999; Tai et al., 2002). Using site-directed mutagenesis,
RNA gel mobility shift assays and RNA nitrocellulose filter-binding assays,
Tai et al. (2002) investigated the ability of variant His-tagged DHFRs to
bind to DHFR mRNA. They identified the only cysteine residue in
DHFR, Cys6 as being essential for RNA recognition. Moreover, they
reported that mutations at Ile7, Arg28, and Phe34 greatly reduced
mRNA-binding activity, but did not directly show whether these residues
are important for the functional upregulation of DHFR by impairing MTX
binding to DHFR protein that relieves the translational inhibition.
To identify key amino acids on DHFR associated with the functional
upregulation response, Skacel et al. (2005) took two different approaches
Human Dihydrofolate Reductase 285
from the binding assay used by Tai et al. One approach was to use site-
directed mutagenesis to identify the specific amino acids in the DHFR
protein that are involved in the upregulation of DHFR. The second
approach was the use of different antifolates that differ in their mode of
binding to the active site of DHFR to determine structureactivity in
relation to the upregulation of DHFR. The reasoning was that antifolates
with diverse structure would affect the translational upregulation of DHFR
differently, providing additional information on the active site amino acids
involved. A mammalian cell culture system was established to study changes
in DHFR protein levels upon exposure to MTX. Chinese hamster ovary
cells lacking DHFR were transfected with wild-type and mutants of human
DHFR fused to EGFP, to identify amino acids essential for increases in the
DHFR response to MTX. Although many mutants tested by two groups
were similar, their conclusions differed (Skacel et al., 2005; Tai et al., 2002).
The discrepancy may be explained by the different methods used by the two
groups; one looking at the RNAprotein binding and the other at the
upregulation of DHFR protein induced by antifolates.
Based on results from our functional study, three amino acids, all associated
with the NADPH-binding site, Glu30, Leu22, and Ser118 were shown to be
involved in the upregulation of DHFR by MTX and a new model for
translational regulation of DHFR was proposed. Glu30Ala, Ser118Ala, and
Leu22Arg, demonstrate little to no detectable changes in DHFR protein levels
in response to MTX exposure. These mutant DHFRs were also analyzed for
their induction to the antifolates trimetrexate, raltitrexed, and pemetrexed.
When transfectants containing wild-type DHFREGFP were exposed to
each of the four antifolates, significant increases in cellular DHFREGFP
fusion protein levels were observed. The response of variants Glu30A, Ser118-
Ala, and Leu22Arg to all four antifolates was significantly reduced. In contrast,
while Cys6 mutants were induced by MTX and trimetrexate, they remain
unchanged when treated with raltitrexed and pemetrexed.
In addition to identifying three amino acids required for the functional
upregulation of DHFR (detailed below), this study contributed to our
understanding of the general nature of the interaction between antifolate,
DHFR protein, and the upregulation response. The ability of DHFR to be
upregulated by MTX was found to be independent of the catalytic activity
of DHFR. Among the three DHFR mutants that did not upregulate, one
was catalytically inactive (Glu30Ala), one had poor catalytic activity
(Leu22Arg), and one had similar kinetic properties to DHFR (Ser118Ala).
Second, although antifolate binding to DHFR is necessary for the transla-
tional upregulation response, the strength of the binding to DHFR did not
correlate with the upregulation response. Mutant DHFRs with decreased
MTX binding, some as much as 150- to 10,000-fold decreases, were equally
upregulated in response to MTX as wild-type DHFR protein. An illustra-
tive example of this is the double mutant DHFR Leu22Phe/Phe31Ser
286 Emine Ercikan Abali et al.
MTX
DHFR
DHFR
Increase in DHFR
protein levels
Figure 9.5 A model for the translational upregulation of DHFR by antifolates. The
cartoon portrays two conformers of DHFR protein: One bound to NADPH, and the
other bound to DHFR mRNA. These two conformers are in equilibrium and can
interconvert. Binding of MTX or dihydrofolate to the DHFRmRNA complex leads to
a conformational change releasing the mRNA, and resulting in translational derepres-
sion and resumption of DHFR synthesis.
Human Dihydrofolate Reductase 287
ACKNOWLEDGMENTS
We regret that many important references could not be cited, or were cited indirectly by
citing review particles due to space limitations. This work was supported by Grant CA 08010
from the United States Public Health Service (to J. R. B.) and Department of Medicine
Grant from UMDNJ (to E. A. E.). We gratefully acknowledge helpful discussions with
Dr. Joseph Bertino, Dr. Debabrata Banerjee, and Dr. Vivian Cody for providing the ribbon
diagram of human dihydrofolate reductase.
REFERENCES
Abelson, H. T., Spector, R., Gorka, C., and Fosburg, M. (1978). Kinetics of tetrahydro-
biopterin synthesis by rabbit brain dihydrofolate reductase. Biochem. J. 171, 267268.
Adams, M., Lucock, M., Stuart, J., Fardell, S., Baker, K., and Ng, X. (2007). Preliminary
evidence for involvement of the folate gene polymorphism 19 bp deletion-DHFR in
occurrence of autism. Neurosci. Lett. 422, 2429.
Anagnou, N. P., OBrien, S. J., Shimada, T., Nash, W. G., Chen, M. J., and
Nienhuis, A. W. (1984). Chromosomal organization of the human dihydrofolate reduc-
tase genes: Dispersion, selective amplification, and a novel form of polymorphism. Proc.
Natl. Acad. Sci. USA 81(16), 51705174.
Anagnou, N. P., Antonarakis, S. E., OBrien, S. J., Modi, W. S., and Nienhuis, A. W.
(1988). Chromosomal localization and racial distribution of the polymorphic human
dihydrofolate reductase pseudogene (DHFRP1). Am. J. Hum. Genet. 42, 345352.
Appleman, J. R., Prendergast, N., Delcamp, T. J., Freisheim, J. H., and Blakley, R. L.
(1988). Kinetics of the formation and isomerization of methotrexate complexes of
recombinant human dihydrofolate reductase. J. Biol. Chem. 263, 1030410313.
Azizkhan, J. C., Vaughn, J. P., Christy, R. J., and Hamlin, J. L. (1986). Nucleotide sequence
and nuclease hypersensitivity of the Chinese hamster dihydrofolate reductase gene
promoter region. Biochemistry 25, 62286236.
Azizkhan, J. C., Jensen, D. E., Pierce, A. J., and Wade, M. (1993). Transcription from
TATA-less promoters: Dihydrofolate reductase as a model. Crit. Rev. Eukaryot. Gene
Expr. 3, 229254.
Banerjee, D., Schnieders, B., Fu, J. Z., Adhikari, D., Zhao, S. C., and Bertino, J. R. (1998).
Role of E2F-1 in chemosensitivity. Cancer Res. 58, 42924296.
Banerjee, D., Gorlick, R., Liefshitz, A., Danenberg, K., Danenberg, P. C., Danenberg, P. V.,
Klimstra, D., Jhanwar, S., Cordon-Cardo, C., Fong, Y., Kemeny, N., and Bertino, J. R.
(2000). Levels of E2F-1 expression are higher in lung metastasis of colon cancer as
compared with hepatic metastasis and correlate with levels of thymidylate synthase. Cancer
Res. 60, 23652367.
Banerjee, D., Mayer-Kuckuk, P., Capiaux, G., Budak-Alpdogan, T., Gorlick, R., and
Bertino, J. R. (2002). Novel aspects of resistance to drugs targeted to dihydrofolate
reductase and thymidylate synthase. Biochim. Biophys. Acta 1587, 164173.
Bastow, K. F., Prabhu, R., and Cheng, Y. C. (1984). The intracellular content of dihy-
drofolate reductase: Possibilities for control and implications for chemotherapy. Adv.
Enzyme Regul. 22, 1526.
288 Emine Ercikan Abali et al.
Cody, V., Luft, J. R., Ciszak, E., Kalman, T. I., and Freisheim, J. H. (1992). Crystal structure
determination at 2.3 A of recombinant human dihydrofolate reductase ternary complex
with NADPH and methotrexate-gamma-tetrazole. Anticancer Drug Des. 7, 483491.
Cody, V., Galitsky, N., Luft, J. R., Pangborn, W., Blakley, R. L., and Gangjee, A. (1998).
Comparison of ternary crystal complexes of F31 variants of human dihydrofolate reductase
with NADPH and a classical antitumor furopyrimidine. Anticancer Drug Des. 13, 307315.
Cowan, K. H., Goldsmith, M. E., Ricciardone, M. D., Levine, R., Rubalcaba, E., and
Jolivet, J. (1986). Regulation of dihydrofolate reductase in human breast cancer cells and
in mutant hamster cells transfected with a human dihydrofolate reductase minigene. Mol.
Pharmacol. 30, 6976.
Czeizel, A. E., and Dudas, I. (1992). Prevention of the first occurrence of neural-tube defects
by periconceptional vitamin supplementation. N. Engl. J. Med. 327, 18321835.
Davies, J. F., 2nd, Delcamp, T. J., Prendergast, N. J., Ashford, V. A., Freisheim, J. H., and
Kraut, J. (1990). Crystal structures of recombinant human dihydrofolate reductase
complexed with folate and 5-deazafolate. Biochemistry 29, 94679479.
Doetzlhofer, A., Rotheneder, H., Lagger, G., Koranda, M., Kurtev, V., Brosch, G.,
Wintersberger, E., and Seiser, C. (1999). Histone deacetylase 1 can repress transcription
by binding to Sp1. Mol. Cell. Biol. 19, 55045511.
Domin, B. A., Grill, S. P., Bastow, K. F., and Cheng, Y. C. (1982). Effect of methotrexate
on dihydrofolate reductase activity in methotrexate-resistant human KB cells. Mol.
Pharmacol. 21, 478482.
Ercikan, E., Banerjee, D., Waltham, M., Schnieders, B., Scotto, K. W., and Bertino, J. R.
(1993a). Translational regulation of the synthesis of dihydrofolate reductase. Adv. Exp.
Med. Biol. 338, 537540.
Ercikan, E., Waltham, M., Dicker, A., Schweitzer, B., and Bertino, J. R. (1993b). Effect of
codon 22 mutations on substrate and inhibitor binding for human dihydrofolate reduc-
tase. Adv. Exp. Med. Biol. 338, 515519.
Ercikan-Abali, E. A., Banerjee, D., Waltham, M. C., Skacel, N., Scotto, K. W., and
Bertino, J. R. (1997). Dihydrofolate reductase protein inhibits its own translation by
binding to dihydrofolate reductase mRNA sequences within the coding region. Biochem-
istry 36, 1231712322.
Farnham, P. J., and Means, A. L. (1990). Sequences downstream of the transcription
initiation site modulate the activity of the murine dihydrofolate reductase promoter.
Mol. Cell. Biol. 10, 13901398.
Fry, C. J., Pearson, A., Malinowski, E., Bartley, S. M., Greenblatt, J., and Farnham, P. J.
(1999). Activation of the murine dihydrofolate reductase promoter by E2F1. A require-
ment for CBP recruitment. J. Biol. Chem. 274, 1588315891.
Fujii, H., and Shimada, T. (1989). Isolation and characterization of cDNA clones derived
from the divergently transcribed gene in the region upstream from the human dihydro-
folate reductase gene. J. Biol. Chem. 264, 1005710064.
Futterman, S. (1957). Enzymatic reduction of folic acid and dihydrofolic acid to tetrahy-
drofolic acid. J. Biol. Chem. 228, 10311038.
Gee, J. E., Blume, S., Snyder, R. C., Ray, R., and Miller, D. M. (1992). Triplex formation
prevents Sp1 binding to the dihydrofolate reductase promoter. J. Biol. Chem. 267,
1116311167.
Gellekink, H., Blom, H. J., van der Linden, I. J., and den Heijer, M. (2007). Molecular
genetic analysis of the human dihydrofolate reductase gene: Relation with plasma total
homocysteine, serum and red blood cell folate levels. Eur. J. Hum. Genet. 15, 103109.
Goto, Y., Yue, L., Yokoi, A., Nishimura, R., Uehara, T., Koizumi, S., and Saikawa, Y. (2001). A
novel single-nucleotide polymorphism in the 30 -untranslated region of the human dihydro-
folate reductase gene with enhanced expression. Clin. Cancer Res. 7, 19521956.
290 Emine Ercikan Abali et al.
Hammes-Schiffer, S., and Benkovic, S. J. (2006). Relating protein motion to catalysis. Annu.
Rev. Biochem. 75, 519541.
Hillcoat, B. L., Swett, V., and Bertino, J. R. (1967). Increase of dihydrofolate reductase
activity in cultured mammalian cells after exposure to methotrexate. Proc. Natl. Acad. Sci.
USA 58, 16321637.
Hurford, R. K., Jr., Cobrinik, D., Lee, M. H., and Dyson, N. (1997). pRB and p107/p130
are required for the regulated expression of different sets of E2F responsive genes. Genes
Dev. 11, 14471463.
Johnson, W. G., Stenroos, E. S., Spychala, J. R., Chatkupt, S., Ming, S. X., and Buyske, S.
(2004). New 19 bp deletion polymorphism in intron-1 of dihydrofolate reductase
(DHFR): A risk factor for spina bifida acting in mothers during pregnancy? Am. J.
Med. Genet. A 124, 339345.
Johnson, W. G., Scholl, T. O., Spychala, J. R., Buyske, S., Stenroos, E. S., and Chen, X.
(2005). Common dihydrofolate reductase 19-base pair deletion allele: A novel risk factor
for preterm delivery. Am. J. Clin. Nutr. 81, 664668.
Lin, S. Y., Black, A. R., Kostic, D., Pajovic, S., Hoover, C. N., and Azizkhan, J. C. (1996).
Cell cycle-regulated association of E2F1 and Sp1 is related to their functional interaction.
Mol. Cell. Biol. 16, 16681675.
Martianov, I., Ramadass, A., Serra Barros, A., Chow, N., and Akoulitchev, A. (2007).
Repression of the human dihydrofolate reductase gene by a non-coding interfering
transcript. Nature 445, 666670.
Masters, J. N., and Attardi, G. (1983). The nucleotide sequence of the cDNA coding for the
human dihydrofolic acid reductase. Gene 21, 5963.
Masters, J. N., and Attardi, G. (1985). Discrete human dihydrofolate reductase gene tran-
scripts present in polysomal RNA map with their 50 ends several hundred nucleotides
upstream of the main mRNA start site. Mol. Cell. Biol. 5, 493500.
Masters, J. N., Yang, J. K., Cellini, A., and Attardi, G. (1983). A human dihydrofolate
reductase pseudogene and its relationship to the multiple forms of specific messenger
RNA. J. Mol. Biol. 167, 2336.
Maurer, B. J., Barker, P. E., Masters, J. N., Ruddle, F. H., and Attardi, G. (1984). Human
dihydrofolate reductase gene is located in chromosome 5 and is unlinked to the related
pseudogenes. Proc. Natl. Acad. Sci. USA 81, 14841488.
Maurer, B. J., Carlock, L., Wasmuth, J., and Attardi, G. (1985). Assignment of human
dihydrofolate reductase gene to band q23 of chromosome 5 and of related pseudogene psi
HD1 to chromosome 3. Somat. Cell Mol. Genet. 11, 7985.
Mayer-Kuckuk, P., Banerjee, D., Malhotra, S., Doubrovin, M., Iwamoto, M., Akhurst, T.,
Balatoni, J., Bornmann, W., Finn, R., Larson, S., Fong, Y., Gelovani Tjuvajev, J., et al.
(2002). Cells exposed to antifolates show increased cellular levels of proteins fused to
dihydrofolate reductase: A method to modulate gene expression. Proc. Natl. Acad. Sci.
USA 99, 34003405.
McPherson, J. P., Saurbrey, A., Meehl, M., Russo, A., Skacel, N., and Bertino, J. R. (1999).
Characterization of RNA binding by mutant variants of human dihydrofolate reductase.
Proc. Am. Assoc. Cancer Res. 40, 676a.
Mishra, P. J., Longo, G. S. A., Menon, L. G., Abali, E. E., Humeniuk, R., Cole, P. D.,
Kamen, B. A., Banerjee, D., and Bertino, J. R. (2006). The 829C!T single nucleotide
polymorphism in the 30 UTR of the dihydrofolate reductase gene results in methotrexate
resistance and is rare among non-Japanese American patients. In AACR Meeting
Abstracts, Vol. 301.
Mishra, P. J., Humeniuk, R., Longo-Sorbello, G. S., Banerjee, D., and Bertino, J. R.
(2007). A miR-24 microRNA binding-site polymorphism in dihydrofolate reductase
gene leads to methotrexate resistance. Proc. Natl. Acad. Sci. USA 104, 1351313518.
Mitchell, P. J., Carothers, A. M., Han, J. H., Harding, J. D., Kas, E., Venolia, L., and
Chasin, L. A. (1986). Multiple transcription start sites, DNase I-hypersensitive sites, and
Human Dihydrofolate Reductase 291
an opposite-strand exon in the 50 region of the CHO dhfr gene. Mol. Cell. Biol. 6,
425440.
Murchison, E. P., and Hannon, G. J. (2004). miRNAs on the move: miRNA biogenesis and
the RNAi machinery. Curr. Opin. Cell Biol. 16, 223229.
Nevins, J. R. (2001). The Rb/E2F pathway and cancer. Hum. Mol. Genet. 10, 699703.
Noe, V., Alemany, C., Chasin, L. A., and Ciudad, C. J. (1998). Retinoblastoma protein
associates with SP1 and activates the hamster dihydrofolate reductase promoter. Oncogene
16, 19311938.
Noe, V., MacKenzie, S., and Ciudad, C. J. (2003). An intron is required for dihydrofolate
reductase protein stability. J. Biol. Chem. 278, 3829238300.
Olney, J. W., Fuller, T. A., and de Gubareff, T. (1981). Kainate-like neurotoxicity of folates.
Nature 292, 165167.
Osborn, M. J., and Huennekens, F. M. (1958). Enzymatic reduction of dihydrofolic acid.
J. Biol. Chem. 233, 969974.
Padmanabhan, R., and Shafiullah, M. M. (2003). Amelioration of sodium valproate-induced
neural tube defects in mouse fetuses by maternal folic acid supplementation during
gestation. Congenit. Anom. (Kyoto) 43, 2940.
Park, K. K., Rue, S. W., Lee, I. S., Kim, H. C., Lee, I. K., Ahn, J. D., Kim, H. S., Yu, T. S.,
Kwak, J. Y., Heintz, N. H., Magae, J., and Chang, Y. C. (2003). Modulation of Sp1-
dependent transcription by a cis-acting E2F element in dhfr promoter. Biochem. Biophys.
Res. Commun. 306, 239243.
Parle-McDermott, A., Pangilinan, F., Mills, J. L., Kirke, P. N., Gibney, E. R., Troendle, J.,
OLeary, V. B., Molloy, A. M., Conley, M., Scott, J. M., and Brody, L. C. (2007). The
19-bp deletion polymorphism in intron-1 of dihydrofolate reductase (DHFR) may
decrease rather than increase risk for spina bifida in the Irish population. Am. J. Med.
Genet. A 143, 11741180.
Pemov, A., Bavykin, S., and Hamlin, J. L. (1995). Proximal and long-range alterations in
chromatin structure surrounding the Chinese hamster dihydrofolate reductase promoter.
Biochemistry 34, 23812392.
Perez-Lezaun, A., Calafell, F., Mateu, E., Comas, D., and Bertranpetit, J. (1996). Identifi-
cation of a base pair substitution at the tetranucleotide tandem repeat locus DHFRP2
(AAAC)n in a worldwide survey. Int. J. Legal Med. 109, 159160.
Polymeropoulos, M. H., Xiao, H., Rath, D. S., and Merril, C. R. (1991). Tetranucleotide
repeat polymorphism at the human dihydrofolate reductase psi-2 pseudogene
(DHFRP2). Nucleic Acids Res. 19, 4792.
Rhoads, G. G., and Mills, J. L. (1986). Can vitamin supplements prevent neural tube defects?
Current evidence and ongoing investigations. Clin. Obstet. Gynecol. 29, 569579.
Roberts, C. W., and Orkin, S. H. (2004). The SWI/SNF complexChromatin and cancer.
Nat. Rev. Cancer 4, 133142.
Rossmann, M. G., Moras, D., and Olsen, K. W. (1974). Chemical and biological evolution
of nucleotide-binding protein. Nature 250, 194199.
Sawaya, M. R., and Kraut, J. (1997). Loop and subdomain movements in the mechanism of
Escherichia coli dihydrofolate reductase: Crystallographic evidence. Biochemistry 36,
586603.
Schilling, L. J., and Farnham, P. J. (1994). Transcriptional regulation of the dihydrofolate
reductase/rep-3 locus. Crit. Rev. Eukaryot. Gene Expr. 4, 1953.
Schnell, J. R., Dyson, H. J., and Wright, P. E. (2004). Structure, dynamics, and catalytic
function of dihydrofolate reductase. Annu. Rev. Biophys. Biomol. Struct. 33, 119140.
Shimada, T., Chen, M. J., and Nienhuis, A. W. (1984). A human dihydrofolate reductase
intronless pseudogene with an Alu repetitive sequence: Multiple DNA insertions at a
single chromosomal site. Gene 31, 18.
292 Emine Ercikan Abali et al.
Shimada, T., Inokuchi, K., and Nienhuis, A. W. (1986). Chromatin structure of the human
dihydrofolate reductase gene promoter. Multiple protein-binding sites. J. Biol. Chem.
261, 14451452.
Shimada, T., Inokuchi, K., and Nienhuis, A. W. (1987). Site-specific demethylation and
normal chromatin structure of the human dihydrofolate reductase gene promoter after
transfection into CHO cells. Mol. Cell. Biol. 7, 28302837.
Shinya, E., and Shimada, T. (1994). Identification of two initiator elements in the bidirec-
tional promoter of the human dihydrofolate reductase and mismatch repair protein 1
genes. Nucleic Acids Res. 22, 21432149.
Shrimpton, P., Mullaney, A., and Allemann, R. K. (2003). Functional role for Tyr 31 in the
catalytic cycle of chicken dihydrofolate reductase. Proteins 51, 216223.
Skacel, N., Menon, L. G., Mishra, P. J., Peters, R., Banerjee, D., Bertino, J. R., and
Abali, E. E. (2005). Identification of amino acids required for the functional up-
regulation of human dihydrofolate reductase protein in response to antifolate Treatment.
J. Biol. Chem. 280, 2272122731.
Slansky, J. E., and Farnham, P. J. (1996). Transcriptional regulation of the dihydrofolate
reductase gene. Bioessays 18, 5562.
Slansky, J. E., Li, Y., Kaelin, W. G., and Farnham, P. J. (1993). A protein synthesis-
dependent increase in E2F1 mRNA correlates with growth regulation of the dihydro-
folate reductase promoter. Mol. Cell. Biol. 13, 16101618.
Sowers, R., Toguchida, J., Qin, J., Meyers, P. A., Healey, J. H., Huvos, A., Banerjee, D.,
Bertino, J. R., and Gorlick, R. (2003). mRNA expression levels of E2F transcription
factors correlate with dihydrofolate reductase, reduced folate carrier, and thymidylate
synthase mRNA expression in osteosarcoma. Mol. Cancer Ther. 2, 535541.
Tai, N., Ding, Y., Schmitz, J. C., and Chu, E. (2002). Identification of critical amino acid
residues on human dihydrofolate reductase protein that mediate RNA recognition.
Nucleic Acids Res. 30, 44814488.
Tai, N., Schmitz, J. C., Chen, T. M., and Chu, E. (2004). Characterization of a cis-acting
regulatory element in the protein-coding region of human dihydrofolate reductase
mRNA. Biochem J. 378, 9991006.
Tsay, J. T., Appleman, J. R., Beard, W. A., Prendergast, N. J., Delcamp, T. J.,
Freisheim, J. H., and Blakley, R. L. (1990). Kinetic investigation of the functional role
of phenylalanine-31 of recombinant human dihydrofolate reductase. Biochemistry 29,
64286436.
Tunnicliff, G., and Ngo, T. T. (1977). Folic acid and the inhibition of brain L-glutamic
decarboxylase. Experientia 33, 6768.
van der Linden, I. J., Nguyen, U., Heil, S. G., Franke, B., Vloet, S., Gellekink, H.,
Heijer, M., and Blom, H. J. (2007). Variation and expression of dihydrofolate reductase
(DHFR) in relation to spina bifida. Mol. Genet. Metab. 91, 98103.
Wald, D. S., Law, M., and Morris, J. K. (2002). Homocysteine and cardiovascular disease:
Evidence on causality from a meta-analysis. BMJ 325, 1202.
Watanabe, A., Ikejima, M., Suzuki, N., and Shimada, T. (1996). Genomic organization and
expression of the human MSH3 gene. Genomics 31, 311318.
Wright, A. J., Dainty, J. R., and Finglas, P. M. (2007). Folic acid metabolism in human
subjects revisited: Potential implications for proposed mandatory folic acid fortification in
the UK. Br. J. Nutr. 98, 667675.
Xu, X., Gammon, M. D., Wetmur, J. G., Rao, M., Gaudet, M. M., Teitelbaum, S. L.,
Britton, J. A., Neugut, A. I., Santella, R. M., and Chen, J. (2007). A functional 19-base
pair deletion polymorphism of dihydrofolate reductase (DHFR) and risk of breast cancer
in multivitamin users. Am. J. Clin. Nutr. 85, 10981102.
Zhang, K., and Rathod, P. K. (2002). Divergent regulation of dihydrofolate reductase
between malaria parasite and human host. Science 296, 545547.
C H A P T E R T E N
Contents
I. Introduction to Methyltransferases and Their Cofactors 294
II. Three Component Systems Required for B12/THF-Dependent
Methyltransferases 296
III. Biological Systems Impacted by B12 and Folate-Dependent
Methyltransferases 297
A. Methionine biosynthesis 297
B. Methanogenesis 297
C. Methanogenic methyltransferases and the 22nd amino acid 299
D. Acetogenesis 299
E. Other metabolic systems in which B12- and folate-dependent
methyltransferases play a key role 300
IV. Structure and Function of B12 in Methyltransferases 301
A. Binding of B12 to the enzymes 301
B. Generation and maintenance of the active Co(I) state of B12 304
C. The importance of the dmb-off /dmb-on equilibrium 305
V. Activation of the Methyl Group Donors 307
A. Binding of the methyl group donor to the MtxB
(MTII) component 307
B. General acid catalysis, Lewis acid catalysis, and covalent
catalysis to accomplish electrophilic activation of the methyl
group donor 310
VI. Activation of the Methyl Group Acceptors: Zn Thiolates and
NiFeS Clusters 314
A. Methylation of thiol acceptors 315
B. Methylation of the NiFeS cluster of ACS 316
Acknowledgments 317
References 317
293
294 Stephen W. Ragsdale
Abstract
This review focuses on the reaction mechanism of enzymes that use B12 and
tetrahydrofolate (THF) to catalyze methyl group transfers. It also covers the
related reactions that use B12 and tetrahydromethanopterin (THMPT), which is
a THF analog used by archaea. In the past decade, our understanding of the
mechanisms of these enzymes has increased greatly because the crystal struc-
tures for three classes of B12-dependent methyltransferases have become avail-
able and because biophysical and kinetic studies have elucidated the
intermediates involved in catalysis. These steps include binding of the cofactors
and substrates, activation of the methyl donors and acceptors, the methyl
transfer reaction itself, and product dissociation. Activation of the methyl
donor in one class of methyltransferases is achieved by an unexpected proton
transfer mechanism. The cobalt (Co) ion within the B12 macrocycle must be in the
Co(I) oxidation state to serve as a nucleophile in the methyl transfer reaction.
Recent studies have uncovered important principles that control how this highly
reducing active state of B12 is generated and maintained. 2008 Elsevier Inc.
I. Introduction to Methyltransferases
and Their Cofactors
An organic chemist wishing to insert a methyl group into a compound
might use methyltriflate or diazomethane. In biology, the methyl donors are
much less explosive. Figure 10.1 shows some of the simple methyl donors
H
H2N H
H O
N NH2
N H
NH2
N H2N O
N N
Co
O O N
N
N NH2 O
NH2
H CH3 O
N N
H
O
O NH O
MTHF
N NH2
HO
H
N CH3-OH O O
O
H COOH P
CH3-B12
COOH
CH3-OAryl
O
O
OH
NH2
CH3-Cl
N CH3-NH2
N
CH3-SR
N N
HO CH3-SCoM (methyl-SCoM)
O
SAM CH3-H4folate (MTHF)
HO CH3-H4MPT
O COO CH3-+SR (SAM)
SH
HO P NH2 CH3-Co (CH3-B12)
O CH3
CH3-Ni
Methyltransferases
CH3-H4folate Co(I) CH3-RS (Methionine)
MTHF
H4folate CH3-Co(III) RS (Homocysteine)
Intermediates
[ CH3+ + X ] Heterolysis
CH3-X [ CH3 + X ] Homolysis
[ CH3 + X+ ] Heterolysis
CoI
CH3-X CH3-Y
X= Y=
MtxB, MtxC, MtxA, HCys, CoM,
OH, OR,
CmuB, MT1 CmuA, MT2 CmuA, CODH/ACS,
OAr, NR2,
MetH, or MetH, or MetH, ACDS
SH, Cl,
AcsE, B AcsCD, A AcsAB,
THF,
MtrH CdhDE CdhABC
THMPT
X CH3
Y
CoIII
B. Methanogenesis
As shown in Fig. 10.5, growth of methanogens requires the conversion of
substrates (CO2, methylamines, methylthiols, and acetate) to methyl-
SCoM. The nickel containing enzyme methyl-SCoM reductase then
catalyzes the conversion of methyl-SCoM to methane. Table 10.1 lists six
B12-dependent methyltransferases that are important in growth of metha-
nogenic archaea. Most of these methyltransferases catalyze the transfer of
a methyl group from the methyl donor (Methyl-X) to CoM, thus providing
methyl-SCoM needed for methane formation. These methanogenic
methyltransferases use B12 (or an analog with a slight modification in the
Table 10.1 B12-dependent methyltransferases
Methyl-Coenzyme M Reductase
MCR O
N
A B
N
Nl(l)
N CH4
N N
D
C
MeTr CH3-SCoM
MeTr
CO2 MeTr CH3-NR2 (R = H, CH3)
CH3-SH
CH3COOH CH3-OH
C. Methanogenic methyltransferases
and the 22nd amino acid
Study of the methanogenic methyltransferases has uncovered the 22nd
amino acid, pyrrolysine, which is encoded by a UAG stop codon. This
system is reminiscent of selenocysteine, encoded by the UGA codon. For
pyrrolysine synthesis, there is an enzymatic system, encoded by the pylBCD
genes to synthesize pyrrolysine, a dedicated pyrrolysyl-tRNA synthetase
(encoded by pylS ), which aminoacylates a specific amber-decoding tRNA
(encoded by the pylT gene) with pyrrolysine (Blight et al., 2004; Longstaff
et al., 2007). Thus, like the other 20 natural amino acids, pyrrolysine is
co-translationally placed into the nascent polypeptide chain. The role of
pyrrolysine in the methyltransferase reaction is discussed below.
D. Acetogenesis
A role for B12 in anaerobic CO2 fixation was described in 1965 (Ljungdahl
et al., 1966; Poston et al., 1964). There are two B12-dependent methyl-
transferases involved in the Wood-Ljungdahl pathway of CO2 fixation
(Fig. 10.6). The first, MTHF: corrinoid iron-sulfur protein (CFeSP)
methyltransferase is encoded by the acsE gene and catalyzes transfer of the
methyl group from MTHF to the Co(I)-B12 site in the CFeSP, which is
encoded by the acsCD genes. In the subsequent reaction, the methylated
300 Stephen W. Ragsdale
CO2
H2
CO2
HCOOH
THF H2 CODH
CH3-Co(III) CO
CoA
H2 MeTr ACS
H2 O
CH3-THF Co(I) C
H3C SCoA
CFeSP
MtvABC or
THF
MtaABC
CH3-OAr or
CH3-OH
triplets at each of the eight resonant positions, as was observed in the EPR
spectrum of the CFeSP (Ragsdale et al., 1987). The his-on mode is
clearly indicated by adding 15N-His to the growth medium, which replaces
the natural abundance histidine (mostly 14N) in enzymes. Since 15N has a
nuclear spin of , doublet instead of triplet superhyperfine lines are
observed at each of the eight resonant positions in the EPR spectrum.
Observation of the triplet spectrum in B12 proteins labeled with 15N-His
suggests a dmb-on binding mode.
Crystallographic studies of methyltransferases have revealed the elegant
molecular details of how proteins bind B12. The crystal structures of the
cobalamin-binding component of several methyltransferases are available,
including the B12-binding domain of methionine synthase in several states
(Bandarian et al., 2002, 2003; Drennan et al., 1994), MtaC (Das et al., 2007)
(Fig. 10.8) and the CFeSP (AcsCD) from M. thermoacetica (Svetlitchnaia
et al., 2006) (Fig. 10.9), and the MtaBC complex from Methanosarcina barkeri
(Hagemeier et al., 2006). In all of these methyltransferase structures, cobala-
min is bound within a Rossman a/b fold (Fig. 10.10). The C compo-
nents that have a dmb-off/his-on mode of B12 binding share a sequence
motif DXHXXGX41SXLX2628GG in which the His is the lower axial
ligand. The Asp, His, and Ser residues in this sequence are referred to as
the catalytic triad and facilitate formation of the base-off conformation
by protonating the His ligand, (Ludwig and Matthews, 1997). In the
M. thermoacetica MtaC, the Asp and His are present in the catalytic triad
(Fig. 10.6); however, it appears that a Thr residue replaces Ser. The dmb
Figure 10.8 B12-binding site in M. thermoacetica MtaC (Das et al., 2007). The region
containing the conserved DXH motif (see text) is shown in cornflower blue. Generated
from PDB ID# 1Y80 using Chimera.
Tetrahydrofolate and B12 in Methyltransferases 303
Figure 10.9 B12-binding site in the M. thermoacetica CFeSP (Svetlitchnaia et al., 2006).
The region containing the hydrophobic helix (see text) is shown in cornflower blue.
Generated using Chimera from PDB ID code 2H9A.
Figure 10.10 B12-binding site in M. barkeri MtaC focusing on the Rossman domain
involved in ligating the Dmb moiety, generated from PDB ID code 2I2X, using
Chimera.
side chain is deeply embedded and is responsible for much of the binding
energy that tethers the cobalamin to the protein. A dmb-on structure is
not available in the methyltransferase class, which is somewhat surprising since
several AdoCbl-dependent isomerases share the dmb-on binding mode,
304 Stephen W. Ragsdale
including diol dehydratase (Abend et al., 1998; Shibata et al., 1999; Yamanishi
et al., 1998), ribonucleotide reductase (Lawrence et al., 1999; Sintchak et al.,
2002), and ethanolamine ammonia lyase (Abend et al., 1999; Ke et al., 1999).
Most of the methyltransferases share the dmb-off/his-on binding
mode, while the CFeSP involved in transferring the methyl group to the
ACS component in the Wood-Ljungdahl pathway is in the base-off
state, as revealed by spectroscopic studies (Ragsdale et al., 1987) and con-
firmed by crystallographic studies (Svetlitchnaia et al., 2006) of the CFeSP
(Fig. 10.9). A related protein in the methanogenic acetyl-CoA decarbony-
lase synthase complex also is in the base-off state ( Jablonski et al., 1993).
Proteins that bind B12 in the base-off state lack the DXH . . . signature
sequence. Instead, they contain a relatively hydrophobic helix below the
plane of the cobalamin (SVLTAWAA) (Fig. 10.9). A coordinating water
molecule in the upper axial position is replaced by a methyl group during
catalysis. The EPR spectrum of the CFeSP in H217O exhibits 17O-induced
hyperfine broadening, providing conclusive demonstration that H2O
coordinates to the metal center in one of the open axial positions (Stich
et al., 2006).
reaction is necessary for reactivation of the Co(II) state because the quinone/
hydroquinone and hydroquinone/semiquinone couples of the E. coli flavo-
doxin have a significantly more positive redox potential ( 250 mV and
450 mV, respectively (Vetter and Knappe, 1971)), than the Co(II)/(I)
couple of methionine synthase (526 mV) (Banerjee et al., 1990c) (Olteanu,
2004, #6302). Before reductive activation, the His ligand dissociates from
the Co center to generate the base-off conformation. The rationale for
generating the base-off state is that the nitrogen ligand would donate
electron density to the Co center, making the reduction more difficult.
In methionine synthase, binding of flavodoxin, the redox partner responsible
for reductive activation, leads to dissociation of the His ligand (Hoover et al.,
1997). Removal of the dmb ligand also is an intermediate step in the
electrochemical reduction of Co(II) to the Co(I) state of B12 in solution
(Lexa and Saveant, 1976). Thus, methyltransferases appears to have evolved a
mechanism to facilitate the reductive activation that can be understood based
on the principles of inorganic chemistry and electrochemistry.
While SAM-dependent reductive methylation is used to return Co to
the catalytic cycle in methionine synthase, in the methanol- (Daas et al.,
1996b) and dimethylamine- (Wassenaar et al., 1998) methyltransferases, an
ATP-dependent activating protein is involved. ATP-dependent activation
also appears to be required for the aromatic O-demethylase from some
acetogens (Kaufmann et al., 1998).
In the M. thermoaceticum MTHF:CFeSP methyltransferase involved in
the Wood-Ljungdahl pathway, the inactive Co(II) state of the CFeSP is
already base-off in the resting enzyme, which represents a ready state
for electron transfer to form a four-coordinate Co(I) state (Harder et al.,
1989; Ragsdale et al., 1987; Stich et al., 2006; Wirt et al., 1993, 1995). The
direct electron donor is the [4Fe-4S] cluster of the AcsC subunit of the
CFeSP (Menon and Ragsdale, 1999). This cluster has a reduction potential of
523 mV (Harder et al., 1989), which is nearly isopotential with the Co(II)/
Co(I) couple of the CFeSP-bound B12 and can accept electrons from a
low-potential ferredoxin or directly from enzymatic systems that couple
to ferredoxin, including CO/CODH, H2/hydrogenase, or pyruvate/pyruvate
ferredoxin oxidoreductase (Menon and Ragsdale, 1999). These low poten-
tial electron donors have a reduction potential similar to that of the Co(II)/(I)
couple, which probably explains why this system does not require coupling
to ATP or reductive methylation as in the systems described above.
Arg516
Asn508
WAT
Glu320
Asp473
WAT
Asn323
Asp390 Asn411
Figure 10.13 Proposed methanol-binding site between the Co and Zn ions (pinpoint)
in MtaBC. Modified from Hagemeier et al. (2006). Generated from PDB ID code 2I2X
using Chimera.
310 Stephen W. Ragsdale
Figure 10.14 Pyrrolysine (stick diagram) in the channel formed by the triosephosphate
isomerase (TIM) barrel of MtmB. Generated from 1NTH (Hao et al., 2002) using
Chimera.
Figure 10.16 Proton transfer networks without an obvious proton donor. From
Doukov et al. (2007).
312 Stephen W. Ragsdale
Figure 10.17 Left: Asn199 in the apo and MeTr-bound states. Right: Proposed transi-
tion state for proton transfer. Modified from Doukov et al. (2007).
314 Stephen W. Ragsdale
carbonic anhydrase, both of which use Zn-based Lewis acid catalysis for
substrate activation. There are other charged residues in the second coordi-
nation sphere that may also provide H-bonds and a suitable electrostatic
environment for the electrophilic activation of the methyl group, facilitat-
ing attack on the methyl group by the Co center.
Figure 10.15 summarizes the proposed mechanism of covalent catalysis
by pyrrolysine in activation of the methyl group of mono-, di-, and
trimethylamines (Hao et al., 2002). Recent structures of MtmB in the
presence of hydroxylamine and N-methyl-hydroxylamine demonstrate
the adduct between the amine and C-2 of pyrrolysine (Hao et al., 2004).
Thus, as shown in Fig. 10.15, nucleophilic attack of the methylamine substrate
on the imino group of pyrrolysine generates a substituted methyl ammonium
adduct at C-2. The positive charge on nitrogen is expected to lead to electro-
philic activation of the methyl group, facilitating attack by Co(I), which would
generate methyl-Co(III) and leave a covalent amine adduct on pyrrolysine.
Proton transfer associated with elimination of the amine as ammonia would
regenerate pyrrolysine for the next round of catalysis.
Thus, there are at least three ways that enzymes activate the methyl
donor in methyltransferases: general acid catalyzed protonation of the N5 of
pterins in MTHF (and probably in MTHMPT) through a H-bonding
network, Lewis acid catalysis using a Zn active site near the cobalamin,
and covalent catalysis using a novel amino acid.
ACKNOWLEDGMENTS
I thank NIH (GM39451) for supporting the work in my laboratory on methyltransferases.
I thank Ruma Banerjee, Joe Krzycki, Vadim Gladyshev, and Rick Finke for their comments
on parts of the manuscript.
REFERENCES
Abe, T., Masai, E., Miyauchi, K., Katayama, Y., and Fukuda, M. (2005). A tetrahydrofolate-
dependent O-demethylase, LigM, is crucial for catabolism of vanillate and syringate in
Sphingomonas paucimobilis SYK-6. J. Bacteriol. 187, 20302037.
Abend, A., Bandarian, V., Nitsche, R., Stupperich, E., Retey, J., and Reed, G. H. (1999).
Ethanolamine ammonia-lyase has a base-on binding mode for coenzyme B-12. Arch.
Biochem. Biophys. 370, 138141.
Abend, A., Nitsche, R., Bandarian, V., Stupperich, E., and Retey, J. (1998). Dioldehydrase
Binds Coenzyme B12 in the "Base-On" Mode: ESR Investigations on Cob(II)alamin.
Angew. Chem. Int. Ed. 37, 625627.
Achari, A., Somers, D. O., Champness, J. N., Bryant, P. K., Rosemond, J., and
Stammers, D. K. (1997). Crystal structure of the anti-bacterial sulfonamide drug target
dihydropteroate synthase. Nat. Struct. Biol. 4, 490497.
318 Stephen W. Ragsdale
Allen, J. R., Clark, D. D., Krum, J. G., and Ensign, S. A. (1999). A role for coenzyme M
(2-mercaptoethanesulfonic acid) in a bacterial pathway of aliphatic epoxide carboxylation.
Proc. Natl. Acad. Sci. USA 96, 84328437.
Angier, R. B., et al. (1946). The Structure and Synthesis of the Liver L. casei Factor. Science
103, 667669.
Bandarian, V., Ludwig, M. L., and Matthews, R. G. (2003). Factors modulating conforma-
tional equilibria in large modular proteins: a case study with cobalamin-dependent
methionine synthase. Proc. Natl. Acad. Sci. USA 100, 81568163.
Bandarian, V., Pattridge, K. A., Lennon, B. W., Huddler, D. P., Matthews, R. G., and
Ludwig, M. L. (2002). Domain alternation switches B(12)-dependent methionine
synthase to the activation conformation. Nat. Struct. Biol. 9, 5356.
Banerjee, R., Frasca, V., Ballou, D. P., and Matthews, R. G. (1990a). Participation of Cob(I)
alamin in the Reaction Catalyzed by Methionine Synthase from Escherichia coli: A Steady-
State and Rapid Reaction Kinetic Analysis. Biochem. 29, 1110111109.
Banerjee, R. V., Frasca, V., Ballou, D. P., and Matthews, R. G. (1990b). Participation of
cob(I) alamin in the reaction catalyzed by methionine synthase from Escherichia coli: A
steady-state and rapid reaction kinetic analysis. Biochemistry 29, 1110111109.
Banerjee, R. V., Harder, S. R., Ragsdale, S. W., and Matthews, R. G. (1990c). Mechanism
of reductive activation of cobalamin-dependent methionine synthase: an electron para-
magnetic resonance spectroelectrochemical study. Biochem. 29, 11291135.
Barker, H. A., Weissbach, H., and Smyth, R. D. (1958). A coenzyme containing pseudo-
vitamin B12. Proceedings of the National Academy of Sciences, USA 44, 10931097.
Blight, S. K., Larue, R. C., Mahapatra, A., Longstaff, D. G., Chang, E., Zhao, G.,
Kang, P. T., Green-Church, K. B., Chan, M. K., and Krzycki, J. A. (2004). Direct
charging of tRNA(CUA) with pyrrolysine in vitro and in vivo. Nature 431, 333335.
Brunold, T. C. (2004). Spectroscopic and Computational Insights into the Geometric and
Electronic Properties of the A Cluster of Acetyl-Coenzyme A Synthase. J. Biol. Inorg.
Chem. 9, 533541.
Catalan, J., Elguero, J., Flammang, R., and Maquestiau, A. (1983). On the relative basicities
of imidazole and benzimidazole. Angew. Chem. Suppl. 4, 411418.
Col, B., Oltean, S., and Banerjee, R. (2007). Translational regulation of human methionine
synthase by upstream open reading frames. Biochim. Biophys. Acta. 1769, 532540.
Costi, M. P., and Ferrari, S. (2001). Update on antifolate drugs targets. Curr Drug Targets 2,
135166.
Daas, P. J. H., Hagen, W. R., Keltjens, J. T., Vanderdrift, C., and Vogels, G. D. (1996a).
Activation mechanism of Methanol:5- hydroxybenzimidazolylcobamide methyltransfer-
ase from Methanosarcina barkeri. J. Biol. Chem. 271, 2234622351.
Daas, P. J. H., Wassenaar, R. W., Willemsen, P., Theunissen, R. J., Keltjens, J. T.,
Vanderdrift, C., and Vogels, G. D. (1996b). Purification and properties of an enzyme
involved in the ATP-dependent activation of the methanol:2- mercaptoethanesulfonic acid
methyltransferase reaction in Methanosarcina barkeri. J. Biol. Chem. 271, 2233922345.
Darnault, C., Volbeda, A., Kim, E. J., Legrand, P., Vernede, X., Lindahl, P. A., and
Fontecilla-Camps, J. C. (2003). Ni-Zn-[Fe(4)-S(4)] and Ni-Ni-[Fe(4)-S(4)] clusters in
closed and open alpha subunits of acetyl-CoA synthase/carbon monoxide dehydroge-
nase. Nat. Struct. Biol. 10, 271279.
Das, A., et al. (2007). Characterization of a corrinoid protein involved in the C1 metabolism
of strict anaerobic bacterium Moorella thermoacetica. Proteins 67, 167176.
Datta, S. P., and Grzybowski, A. K. (1966). The acid dissociation constant of the imidazo-
lium ion. J. Chem. Soc. (B) 136140.
Dorweiler, J. S., Finke, R. G., and Matthews, R. G. (2003). Cobalamin-dependent methi-
onine synthase: probing the role of the axial base in catalysis of methyl transfer between
methyltetrahydrofolate and exogenous cob(I)alamin or cob(I)inamide. Biochemistry 42,
1465314662.
Tetrahydrofolate and B12 in Methyltransferases 319
Doukov, T., Seravalli, J., Stezowski, J., and Ragsdale, S. W. (2000). Crystal structure of a
methyltetrahydrofolate and corrinoid dependent methyltransferase. Structure 8, 817830.
Doukov, T. I., Blasiak, L. C., Seravalli, J., Ragsdale, S. W., and Drennan, C. L. (2008).
Xenon in and at the end of the tunnel of bifunctional carbon monoxide dehydrogenase/
acetyl-CoA synthase. Biochemistry 47, 34743483.
Doukov, T. I., Hemmi, H., Drennan, C. L., and Ragsdale, S. W. (2007). Structural And
Kinetic Evidence For An Extended Hydrogen Bonding Network In Catalysis Of
Methyl Group Transfer: Role Of An Active Site Asparagine Residue In Activation
Of Methyl Transfer By Methyltransferases. Journal of Biological Chemistry 282,
66096618.
Doukov, T. I., Iverson, T., Seravalli, J., Ragsdale, S. W., and Drennan, C. L. (2002). A Ni-
Fe-Cu center in a bifunctional carbon monoxide dehydrogenase/acetyl-CoA synthase.
Science 298, 567572.
Drennan, C. L., Doukov, T. I., and Ragsdale, S. W. (2004). The Metalloclusters of Carbon
Monoxide Dehydrogenase/Acetyl-CoA Synthase: A Story in Pictures. J. Biol. Inorg.
Chem. 9, 511515.
Drennan, C. L., Huang, S., Drummond, J. T., Matthews, R. G., and Ludwig, M. L. (1994).
How a protein binds B12: A 3.0 A X-ray structure of B12-binding domains of methionine
synthase. Science 266, 16691674.
Drummond, J. T., Huang, S., Blumenthal, R. M., and Matthews, R. G. (1993). Assignment
of enzymatic function to specific protein regions of cobalamin-dependent methionine
synthase from Escherichia coli. Biochem. 32, 92909295.
Engelmann, T., Kaufmann, F., and Diekert, G. (2001). Isolation and characterization of a
veratrol:corrinoid protein methyl transferase from Acetobacterium dehalogenans. Arch.
Microbiol. 175, 376383.
Ensign, S. A., and Allen, J. R. (2003). Aliphatic epoxide carboxylation. Annu. Rev. Biochem.
72, 5576.
Evans, J. C., Huddler, D. P., Hilgers, M. T., Romanchuk, G., Matthews, R. G., and
Ludwig, M. L. (2004). Structures of the N-terminal modules imply large domain motions
during catalysis by methionine synthase. Proc. Natl. Acad. Sci. USA 101, 37293736.
Evans, J. C., Huddler, D. P., Jiracek, J., Castro, C., Millian, N. S., Garrow, T. A., and
Ludwig, M. L. (2002). Betaine-homocysteine methyltransferase: zinc in a distorted
barrel. Structure 10, 11591171.
Fasching, M., Schmidt, W., Krautler, B., Stupperich, E., Schmidt, A., and Kratky, C.
(2000). Co alpha-(1H-imidazolyl)-Co beta-methylcob(III)amide: Model for protein-
bound corrinoid cofactors. Helv. Chim. Acta. 83, 22952316.
Fedorov, A., Shi, W., Kicska, G., Fedorov, E., Tyler, P. C., Furneaux, R. H., Hanson, J. C.,
Gainsford, G. J., Larese, J. Z., Schramm, V. L., and Almo, S. C. (2001). Transition
state structure of purine nucleoside phosphorylase and principles of atomic motion in
enzymatic catalysis. Biochemistry 40, 853860.
Fujii, K., Galivan, J. H., and Huennekens, F. M. (1977). Activation of methionine synthase:
further characterization of flavoprotein system. Arch. Biochem. Biophys. 178, 662670.
Gencic, S., LeClerc, G. M., Gorlatova, N., Peariso, K., Penner-Hahn, J. E., and
Grahame, D. A. (2001). Zinc-thiolate intermediate in catalysis of methyl group transfer
in Methanosarcina barkeri. Biochemistry 40, 1306813078.
Gottschalk, G., and Thauer, R. K. (2001). The Na()-translocating methyltransferase
complex from methanogenic archaea. Biochim. Biophys. Acta. 1505, 2836.
Goulding, C. W., and Matthews, R. G. (1997). Cobalamin-dependent methionine synthase
from Escherichia coli: involvement of zinc in homocysteine activation. Biochemistry 36,
1574915757.
Guest, J. R., Friedman, S., Woods, D. D., and Smith, E. L. (1962). A methyl analog of
cobamide coenzyme in relation to methionine synthesis by bacteria. Nature 195, 340342.
320 Stephen W. Ragsdale
Hagemeier, C. H., Krer, M., Thauer, R. K., Warkentin, E., and Ermler, U. (2006). Insight
into the mechanism of biological methanol activation based on the crystal structure of the
methanol-cobalamin methyltransferase complex. Proc. Natl. Acad. Sci. USA 103,
1891718922.
Hampele, I. C., DArcy, A., Dale, G. E., Kostrewa, D., Nielsen, J., Oefner, C., Page, M. G.,
Schonfeld, H. J., Stuber, D., and Then, R. L. (1997). Structure and function of the
dihydropteroate synthase from Staphylococcus aureus. J. Mol. Biol. 268, 2130.
Hao, B., Gong, W., Ferguson, T. K., James, C. M., Krzycki, J. A., and Chan, M. K. (2002).
A new UAG-encoded residue in the structure of a methanogen methyltransferase. Science
296, 14621466.
Hao, B., Zhao, G., Kang, P. T., Soares, J. A., Ferguson, T. K., Gallucci, J., Krzycki, J. A.,
and Chan, M. K. (2004). Reactivity and chemical synthesis of L-pyrrolysine- the 22(nd)
genetically encoded amino acid. Chem. Biol. 11, 13171324.
Harder, S. A., Lu, W.-P., Feinberg, B. F., and Ragsdale, S. W. (1989). Spectroelectrochem-
ical studies of the corrinoid/iron-sulfur protein from Clostridium thermoaceticum.
Biochemistry 28, 90809087.
Hilhorst, E., Iskander, A. S., Chen, T. B. R. A., and Pandit, U. (1994). Alkyl transfer from
quaternary ammonium salts to cobalt(I): model for the cobalamin-dependent methionine
synthase reaction. Tetrahedron 50, 88638870.
Hodgkin, D. C., Kamper, J., Mackay, M., Pickworth, J., Trueblood, K. N., and White, J. G.
(1956). Structure of vitamin B12. Nature 178, 6466.
Hogenkamp, H. P., Rush, J. E., and Swenson, C. A. (1965). Observations on the organo-
metallic bond of the corrinoid coenzymes. J. Biol. Chem. 240, 36413644.
Hoover, D. M., Jarrett, J. T., Sands, R. H., Dunham, W. R., Ludwig, M. L., and
Matthews, R. G. (1997). Interaction of Escherichia coli cobalamin-dependent methio-
nine synthase and its physiological partner flavodoxin: Binding of flavodoxin leads to axial
ligand dissociation from the cobalamin cofactor. Biochemistry 36, 127138.
Huang, C. C., Casey, P. J., and Fierke, C. A. (1997). Evidence for a catalytic role of zinc in
protein farnesyltransferase. Spectroscopy of Co2-farnesyltransferase indicates metal
coordination of the substrate thiolate. J. Biol. Chem. 272, 2023.
Jablonski, P. E., Lu, W. P., Ragsdale, S. W., and Ferry, J. G. (1993). Characterization of the
metal centers of the corrinoid/iron-sulfur component of the CO dehydrogenase enzyme
complex from Methanosarcina thermophila by EPR spectroscopy and spectroelectro-
chemistry. J. Biol. Chem. 268, 325329.
Kaufmann, F., Wohlfarth, G., and Diekert, G. (1998). O-demethylase from Acetobacterium
dehalogenans--substrate specificity and function of the participating proteins. Eur. J.
Biochem. 253, 706711.
Ke, S. C., Torrent, M., Museav, D. G., Morokuma, K., and Warncke, K. (1999). Identifi-
cation of dimethylbenzimidazole axial coordination and characterization of (14)N super-
hyperfine and nuclear quadrupole coupling in Cob(II)alamin bound to ethanolamine
deaminase in a catalytically-engaged substrate radical-Cobalt(II) biradical state. Biochemistry
38, 1268112689.
Kicska, G. A., Tyler, P. C., Evans, G. B., Furneaux, R. H., Shi, W., Fedorov, A.,
Lewandowicz, A., Cahill, S. M., Almo, S. C., and Schramm, V. L. (2002). Atomic
dissection of the hydrogen bond network for transition-state analogue binding to purine
nucleoside phosphorylase. Biochemistry 41, 1448914498.
Krautler, B. (1987). Thermodynamic trans-effects of the nucleotide base in the B12
coenzymes. Helvetica Chimica Acta. 70, 12681278.
Kruer, M., Haumann, M., Meyer-Klaucke, W., Thauer, R. K., and Dau, H. (2002). The
role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M
methyltransferase from Methanosarcina barkeri. Eur. J. Biochem. 269, 21172123.
Tetrahydrofolate and B12 in Methyltransferases 321
Olteanu, H., and Banerjee, R. (2001). Human methionine synthase reductase, a soluble
P-450 reductase-like dual flavoprotein, is sufficient for NADPH-dependent methionine
synthase activation. J. Biol. Chem. 276, 3555835563.
Olteanu, H., Wolthers, K. R., Munro, A. W., Scrutton, N. S., and Banerjee, R. (2004).
Kinetic and thermodynamic characterization of the common polymorphic variants of
human methionine synthase reductase. Biochemistry 43, 19881997.
Peariso, K., Goulding, C. W., Huang, S., Matthews, R. G., and Penner-Hahn, J. E. (1998).
Characterization of the zinc binding site in methionine synthase enzymes of Escherichia
coli: The role of zinc in the methylation of homocysteine. J. Am. Chem. Soc. 120,
84108416.
Peariso, K., Zhou, Z. S., Smith, A. E., Matthews, R. G., and Penner-Hahn, J. E. (2001).
Characterization of the zinc sites in cobalamin-independent and cobalamin-dependent
methionine synthase using zinc and selenium X-ray absorption spectroscopy. Biochemistry
40, 987993.
Pejchal, R., and Ludwig, M. L. (2005). Cobalamin-independent methionine synthase
(MetE): a face-to-face double barrel that evolved by gene duplication. PLoS Biol. 3, e31.
Pfiffner, J. J., Calkins, D. G., ODell, B. L., Bloom, E. S., Brown, R. A., Campbell, C. J.,
and Bird, O. D. (1945). Isolation of an antianemia factor (vitamin Bc conjugate) in
crystalline form from yeast. Science 102, 228230.
Poston, J. M., Kuratomi, K., and Stadtman, E. R. (1964). Methyl-vitamin B12 as a source of
methyl groups for the synthesis of acetate by cell-free extracts of Clostridium thermoaceti-
cum. Ann. N.Y. Acad. Sci. 112, 804806.
Pratt, J. M. (1999). The roles of Co, corrin, and protein: I. Co-ligand bonding and the trans
ligand effect. In Chemistry and biochemistry of B12, (R. Banerjee, ed.), Vol. 1,
pp. 73112. John Wiley and Sons, New York.
Pratt, J. M., Norris, P. R., Hamza, S. A., and Bolton, R. (1994). Methyl Transfer from
Nitrogen to Cobalt: Model for the B12-Dependent Methyl Transfer Enzymes. J. Chem.
Soc., Chem. Commun. 13331334.
Ragsdale, S. W. (2006). Metals and their scaffolds to promote difficult enzymatic reactions.
Chem. Rev. 106, 33173337.
Ragsdale, S. W., Lindahl, P. A., and Munck, E. (1987). Mossbauer, EPR, and optical studies
of the corrinoid/Fe-S protein involved in the synthesis of acetyl-CoA by Clostridium
thermoaceticum. J. Biol. Chem. 262, 1428914297.
Ragsdale, S. W., and Wood, H. G. (1985). Acetate biosynthesis by acetogenic bacteria:
Evidence that carbon monoxide dehydrogenase is the condensing enzyme that catalyzes
the final steps of the synthesis. J. Biol. Chem. 260, 39703977.
Ragsdale, S. W., Wood, H. G., and Antholine, W. E. (1985). Evidence that an iron-nickel-
carbon complex is formed by reaction of CO with the CO dehydrogenase from
Clostridium thermoaceticum. Proc. Natl. Acad. Sci. USA 82, 68116814.
Ram, M. S., and Riordan, C. G. (1995). Methyl transfer from a cobalt complex to Ni(tmc)
() yielding Ni(tmc)Me(): A model for methylcobalamin alkylation of CO dehydro-
genase. J. Am. Chem. Soc. 117, 23652366.
Ram, M. S., Riordan, C. G., Yap, G. P. A., Liable-Sands, L., Rheingold, A. L., Marchaj, A.,
and Norton, J. R. (1997). Kinetics and mechanism of alkyl transfer from organocobalt
(III) to nickel(I): Implications for the synthesis of acetyl coenzyme A by CO dehydroge-
nase. J. Am. Chem. Soc. 119, 16481655.
Rickes, E. L., Brink, N. G., Koniuszy, F. R., Wood, T. R., and Folkers, K. (1948).
Crystalline Vitamin B12. Science 107, 396397.
Riordan, C. (2004). Synthetic Chemistry and Chemical Precedents for Understanding the
Structure and Function of Acetyl Coenzyme A Synthase. J. Biol. Inorg. Chem. 9, 542549.
Rod, T. H., and Brooks, C. L., 3rd. (2003). How dihydrofolate reductase facilitates
protonation of dihydrofolate. J. Am. Chem. Soc. 125, 87188719.
Tetrahydrofolate and B12 in Methyltransferases 323
Svetlitchnyi, V., Dobbek, H., Meyer-Klaucke, W., Meins, T., Thiele, B., Romer, P.,
Huber, R., and Meyer, O. (2004). A functional Ni-Ni-[4Fe-4S] cluster in the mono-
meric acetyl-CoA synthase from carboxydothermus hydrogenoformans. Proc. Natl. Acad.
Sci. USA 101, 446451.
Tackett, S. L., Collat, J. W., and Abbott, J. C. (1963). The formation of hydridocobalamin
and its stability in aqueous solution. Biochemistry 2, 919923.
Tallant, T. C., Paul, L., and Krzycki, J. A. (2001). The MtsA subunit of the methylthiol:
coenzyme M methyltransferase of Methanosarcina barkeri catalyses both half-reactions of
corrinoid-dependent dimethylsulfide: coenzyme M methyl transfer. J. Biol. Chem. 276,
44854493.
Tan, X., Loke, H. K., Fitch, S., and Lindahl, P. A. (2005). The tunnel of acetyl-coenzyme a
synthase/carbon monoxide dehydrogenase regulates delivery of CO to the active site.
J. Am. Chem. Soc. 127, 58335839.
Tan, X., Sewell, C., Yang, Q., and Lindahl, P. A. (2003). Reduction and Methyl Transfer
Kinetics of the alpha Subunit from Acetyl Coenzyme A Synthase. J. Am. Chem. Soc. 125,
318319.
Thanbichler, M., Neuhierl, B., and Bock, A. (1999). S-methylmethionine metabolism in
Escherichia coli. J. Bacteriol 181, 662665.
Vetter, H., Jr, and Knappe, J. (1971). Flavodoxin and ferredoxin of Escherichia coli. Hoppe.
Seylers. Z. Physiol. Chem. 352, 433446.
Wassenaar, R. W., Keltjens, J. T., and van der Drift, C. (1998). Activation and reaction
kinetics of the dimethylamine/coenzyme M methyltransfer in Methanosarcina barkeri
strain Fusaro. Eur. J. Biochem. 258, 597602.
Wedemeyer-Exl, C., Darbre, T., and Keese, R. (1999). A model for the cobalamin-
dependent methionine synthase. Helvetica Chimica Acta. 82, 11731184.
Whipple, G. H., and Robscheit-Robbins, F. S. (1925). Blood regeneration in severe anemia.
II. Favorable influence of liver, heart and skeletal muscle in diet. Am. J. Physiol. 72,
408418.
Wilker, J. J., and Lippard, S. J. (1997). Alkyl transfer to metal thiolates: Kinetics, active
species identification, and relevance to the DNA methyl phosphotriester repair center of
Escherichia coli ada. Inorg. Chem. 36, 969978.
Wirt, M. D., Kumar, M., Ragsdale, S. W., and Chance, M. R. (1993). X-ray absorption
spectroscopy of the corrinoid/iron sulfur protein involved in acetyl-CoA synthesis by
Clostridium thermoaceticum. J. Am. Chem. Soc. 115, 21462150.
Wirt, M. D., Wu, J.-J., Scheuring, E. M., Kumar, M., Ragsdale, S. W., and Chance, M. R.
(1995). Structural and electronic factors in heterolytic cleavage: Formation of the Co(I)
intermediate in the corrinoid/iron-sulfur protein from Clostridium thermoaceticum.
Biochemistry 34, 52695273.
Yamanishi, M., Yamada, S., Muguruma, H., Murakami, Y., Tobimatsu, T., Ishida, A.,
Yamauchi, J., and Toraya, T. (1998). Evidence for axial coordination of 5,6-dimethyl-
benzimidazole to the cobalt atom of adenosylcobalamin bound to diol dehydratase.
Biochemistry 37, 47994803.
Zhao, S., Roberts, D. L., and Ragsdale, S. W. (1995). Mechanistic studies of the methyl-
transferase from clostridium thermoaceticum: origin of the pH dependence of the methyl
group transfer from methyltetrahydrofolate to the corrinoid/iron-sulfur protein. Biochem-
istry 34, 1507515083.
Zheng, D., Darbre, T., and Keese, R. (1999). Methanol and dimethylaniline as methylating
agents of Co(I) corrinoids under acidic conditions. J. Inorg. Biochem. 73, 273275.
Zhou, Z. H. S., Peariso, K., PennerHahn, J. E., and Matthews, R. G. (1999). Identification
of the zinc ligands in cobalamin- independent methionine synthase (MetE) from Escher-
ichia coli. Biochemistry Usa. 38, 1591515926.
C H A P T E R E L E V E N
Methyltetrahydrofolate in
Folate-Binding Protein Glycine
N-Methyltransferase
Zigmund Luka*
Contents
I. Introduction 326
II. 5-Methyltetrahydrofolate in Folate Metabolism 326
A. Folate uptake, metabolism, and catabolism 326
B. 5-Methyltetrahydrofolate, methyl trap 328
III. Folate-Binding Enzymes 330
IV. Glycine N-Methyltransferase 331
A. GNMT genes and proteins 331
B. Enzyme kinetics and activity regulation 333
V. GNMT as Methyltetrahydrofolate-Binding Protein 335
A. Inhibition of GNMT by folate 336
B. Role of GNMT in folate and one-carbon metabolism 336
C. GNMT mutations in human patients and
GNMT knockout mouse model 337
D. Crystal structure of GNMTfolate complex
and mechanism of inhibition 339
VI. Conclusions 340
Acknowledgments 341
References 341
Abstract
In mammals, folate is used as a carrier of one-carbon units (C1) in nucleic acids
metabolism and biological methylation. Among all forms of folate the most
abundant is 5-methyltetrahydrofolate (5-CH3-THF), which is of exceptional
importance. Its distinctive role among other forms of folate is in its dual
function. As a C1 carrier it is used for synthesis of methionine by remethylation
of homocysteine. In addition, 5-CH3-THF is bound to and inhibits glycine-N-
methyltransferase (GNMT). GNMT is one of the key enzymes in methionine and
S-adenosylmethionine (AdoMet) metabolism. It removes excess AdoMet by
325
326 Zigmund Luka
using it for methylation of glycine. The interaction of 5-CH3-THF and GNMT was
proposed as an important regulatory mechanism in AdoMet metabolism and
biological methylation. The recent discovery of human individuals with mutant
GNMT and the study of a mouse model with the GNMT gene knocked out
showed that inactivation of that enzyme, indeed, has a significant impact on
AdoMet levels in the liver and plasma. The crystal structure of GNMT complexed
with 5-CH3-THF revealed that there are two folate molecules bound to one
tetrameric form of GNMT, which is a basis for establishing of mechanism of
inhibition of GNMT. The role of GNMT as a folate-binding protein and how it
affects one-carbon folate metabolism is discussed. 2008 Elsevier Inc.
I. Introduction
Living organisms need folate as enzyme cofactors to carry C1 from a
number of sources for biosynthesis of nucleic acids and methylation. After
absorption from the diet in the intestine, transferring to circulation and
transport into the cells, the folates are bound by folate-binding enzymes so
there is almost no free folate in the cells (Wagner, 1995). In the liver, the most
abundant form of folate is methyltetrahydrofolate and changes in its amount
are associated with several metabolic conditions. Only one enzyme, methio-
nine synthase (MS), uses methyltetrahydrofolate as a substrate but this is not a
major methyltetrahydrofolate-binding protein. In the liver and several other
tissues, the major methyltetrahydrofolate-binding protein is the enzyme,
glycine N-methyltransferase (GNMT). This enzyme, in addition to its
important biological role of removing excess S-adenosylmethionine by
methylation of glycine, also binds methyltetrahydrofolate without using it
for any enzymatic reaction. Moreover, methyltetrahydrofolate is a potent
inhibitor of GNMT. The high level of GNMT in the liver controls the
availability of the folate for other enzymes and use of AdoMet for methylation
reactions since all forms of folate are interconvertible. For these reasons more
attention should be paid to the biological role of this particular
methyltetrahydrofolate-binding protein/enzyme. In this chapter, the latest
data on the role of GNMT as folate-binding regulatory protein are presented.
Mammals get folate from the diet as a mixture of different forms (Cook,
2001; McKillop et al., 2006; Seyoum and Selhub, 1998). The major form of
folate in the diet is 5-CH3-THF, which is, for example, 85% in egg yolk,
43% in spinach, 46% in yeast (McKillop et al., 2006), 36% in cows liver, and
58% in orange juice (Seyoum and Selhub, 1998). The structure of 5-CH3-
THF is shown in Fig. 11.1. Other folate forms differ in substitutions at C5
and C10 carbon atoms on the pterin and in the number of glutamate
residues linked to p-aminobenzoate (PABA). The number of glutamate
residues varies from 1 to 8 depending on the food (Cook, 2001; McKillop
et al., 2006; Seyoum and Selhub, 1998).
Folate uptake is a complex process, which is discussed in published
reviews (Halsted, 1979; Matherly and Goldman, 2003; Pacha, 2000; Said,
2004; Said and Mohammed, 2006; Sirotnak and Tolner, 1999). There are
two main steps of folate transport. The first step begins with folate absorption
by the small intestine epithelium and transfer of folate into mucosa cells.
In the brash border of mucosal cells, all polyglutamate forms are converted
to monoglutamates by action of a specific enzyme, folylpoly-g-glutamate
carboxypeptidase (Shane, 1995). The monoglutamate forms of folates are
transported through intestine epithelium cells into the circulation by a passive
mechanism at high concentration of folate and by the reduced folate carrier
(RFC) at lower folate levels. In the second step folate monoglutamates are
transported from circulation into the cells by the RFC and by folate receptors.
Folate is used in C1 metabolism in all tissues but most folate is metabolized
in the liver (Clifford et al., 1990; Cook, 2001). In the liver cells the folate pool
is almost equally divided between cytosol and mitochondria. In both compart-
ments the first step of metabolism is the addition of glutamate residues to folate
monoglutamates by folylpoly-g-glutamate synthase (Shane, 1995). In the rat
the predominant form is pentaglutamate (Shin et al., 1972), while in human it
is hexa- and heptaglutamates (Foo et al., 1982).
Folates in the cell serve as carriers of C1 groups. In the very simplified
scheme in Fig. 11.1 the main sources of C1 groups and their use in the cell is
presented. The C1 groups are added to tetrahydrofolate (THF) from serine,
formate, choline, glycine, sarcosine, and from histidine metabolites by different
cytosolic and mitochondrial enzymes.
Loading of THF with different C1 groups results in synthesis of different
forms of folate, which are using for synthesis of purines, deoxythymidine
50 -phosphate (dTMP), and methylation as shown in Fig. 11.1. In the cell the
distribution of the folate forms is maintained relatively constant. In the rat
liver cytosolic folate pool there are four major forms: THF, 27% of total
folate; 5-CH3-THF, 45%; 10-formylTHF, 19.3%; 5-formylTHF, 8.7%,
and small amounts of other forms: 5-formiminoTHF, 5,10-methenylTHF,
5,10-methyleneTHF, and dihydrofolate (Cook, 2001). Detailed folate
metabolism is discussed in another chapter of this issue (Chapter 1 by
Stover)) and in other reviews (Appling, 1991; Cook, 2001; Wagner, 1995).
Catabolism of folates includes three main pathways. Free folate monoglu-
tamates are passively excreted from the cells into the circulation. Free folate
polyglutamates are hydrolyzed to monoglutamates by action of g-glutamyl
hydrolase (GGH) and subsequently excreted as monoglutamates. Free folates
also undergo oxidative degradation releasing different products depending on
the degradation scheme (Suh et al., 2001).
AdoMet
6
inhibition
THF 5-CH3-THF
5
Methionine
AdoMet
Glycine
Methylation 5-CH3-THF
2 3
reactions inhibition
Sarcosine
AdoHcy
4
Adenosine Homocysteine
Cystathionine
Figure 11.3 Glycine-N-methyltransferase (GNMT) gene and protein. At the top the
scheme of the mouse GNMT gene (GeneBank accession number AF 325352) is shown.
Numbers from 1 to 6345 indicate the numbers of nucleotides. Below are aligned amino
acid sequences of mouse and human GNMT (GeneBank codes D89664 and
NM018960). Different amino acid residues are in boxes.
sequencing of GNMT cDNA (Ogawa et al., 1984, 1987). Native and recom-
binant GNMTs were compared by kinetics, limited proteolysis and AdoMet
binding (Konishi and Fujioka, 1988). Ogawas research group reported the
first crystal structure of GNMT, which will be discussed below. GNMT from
pancreas was also purified to homogeneity and its kinetic properties were
studied (Yeo and Wagner, 1992). Recombinant human and mouse GNMTs
were expressed in Escherichia coli and their kinetic properties, stability, and
crystal structures were studied (Luka and Wagner, 2003a; Luka and Wagner,
2003b; Pakhomova et al., 2004).
It was found that GNMT is a tetrameric protein consisting of four
identical subunits of about 32.5 kDa, which depends on the protein origin.
The cDNAs for GNMT from human, rabbit, pig, and mouse were cloned
and sequenced (Aida et al., 1997; Chen et al., 1998; Ogawa et al., 1993) from
which amino acid sequences were derived. It appeared that GNMTs are
very similar with amino acid sequence similarity of about 90%. As an
example, in Fig. 11.3 sequences of GNMTs from mouse and human are
aligned. All sequenced proteins contain 292294 amino acid residues with
no signs of any unusual features. The theoretical isoelectric points are about
7.17.5, but experimentally, the pI value for native rat enzyme was found to
be 6.4 (Ogawa and Fujioka, 1982a).
Rat liver GNMT is phosphorylated in vivo and could be phosphorylated
in vitro by cAMP-dependent protein kinase (Wagner et al., 1989). This was
confirmed by hepatocyte studies (Moller et al., 2003). The studies on rat liver
and recombinant GNMTs showed that there are several phosphorylated
serine residues, but the total level of phosphorylation is very low (Luka
et al., 2006a). It was found that the only residues undergoing phosphorylation
are serines and in rat GNMT those serine residues are Ser9, Ser71, Ser139,
Ser182, and Ser241. The Ser9 was phosphorylated in vitro when cAMP-
dependent protein kinase was used (Luka et al., 2006a; Wagner et al., 1989).
The GNMT crystal structure was solved for rat, mouse, and human
recombinant proteins either as an apoprotein on in complex with AdoHcy,
AdoMet, AdoMet and acetate, or as a complex with 5-CH3-THF (Fu et al.,
1996; Huang et al., 2000; Luka et al., 2007; Pakhomova et al., 2004;
Pattanayek et al., 1998; Takata et al., 2003). It appeared that in the crystal,
GNMT is organized as flat-shaped tetramer with numerous interactions
between subunits. Each subunit consists of an active center for reaction of
AdoMet and glycine inside of the globular part.
V. GNMT as Methyltetrahydrofolate-
Binding Protein
The fact that GNMT is somehow participating in regulation of the ratio
of AdoMet/AdoHcy and level of methylation in the cells was implied since
discovery of GNMT (Heady and Kerr, 1973); however, the mechanism of
336 Zigmund Luka
are shown as reaction 2, but for GNMT it is shown as reaction 3. One of the
products of methylation reactions is AdoHcy which undergoes further
metabolism via transsulfuration reactions. AdoHcy is hydrolyzed to adenosine
and homocysteine by S-adenosylhomocysteine hydrolase (reaction 4).
Homocysteine can be converted back to methionine by transferring a methyl
group from 5-CH3-THF by MS (reaction 5). In turn, 5-CH3-THF is
synthesized from 5,10-methylene-THF by MTHFR (reaction 6) and that
reaction is inhibited by AdoMet.
The levels of methionine and AdoMet are determined by diet and by the
availability of methyl groups from 5-CH3-THF, which may vary signifi-
cantly. Since the level of AdoMet can affect biological methylation, it must
be thoroughly regulated. The proposed regulation mechanism explains how
it is achieved, at least in the liver, where most of the AdoMet and folate are
metabolized. In the first scenario, when methionine level in the diet and in
the cell is higher than normal, the level of AdoMet is also abnormally high
because there is no feedback between level of AdoMet and MAT activity.
A high level of AdoMet results in increase in inhibition of MTHFR (reaction
6) and less 5-CH3-THF is synthesized. This, in turn, leads to activation of
GNMT because of less inhibition by 5-CH3-THF (reaction 3). That results
in increased use of AdoMet for glycine methylation and funneling of excess
AdoMet through the transsulfuration pathway (homocysteine-cystathionine-
cysteine and pyruvate) shown in Fig. 11.3.
When the methionine level becomes lower than normal the level of
AdoMet is also decreased below normal and this must be prevented. Again,
this is achieved by activation/inhibition of MTHFR and GNMT. The
MTHFR is activated because concentration of its inhibitor, AdoMet,
decreased. Therefore, more 5-CH3-THF is synthesized, more homocyste-
ine is remethylated to methionine, and more AdoMet synthesized. At the
same time increased concentration of 5-CH3-THF inhibits GNMT, less
AdoMet is used for glycine methylation and becomes available for other
methylation reactions (reaction 2).
Two of these patients were children from one Italian family and a third
patient was a child from Greece. All of them have very high level of AdoMet
in the plasma (2.22.7 mM with normal level about 100 nM) and methionine
(4001000 mM with normal level 1545 mM), but normal level of AdoHcy.
All patients were characterized with mild liver disease.
GNMT genes of all three patients were sequenced. In the case of the
Italian family DNA from parents and both children was also analyzed.
Indeed, as was expected, GNMT genes from all patients carried missense
mutations in the exons. The brother and sister from the Italian family carry
the two mutations: one (C/T in CTT codon for Leu49) in exon 1 and
another (C/A in codon CAT for His176) in exon 4. The GNMT gene of
the third patient carries an A/G mutation in codon AAT for Asn140. These
mutations cause change of Leu49 to proline, Asn140 to serine, and His176
to asparagines, respectively.
Activity of all mutant GNMTs were assayed in vitro after cDNAs with
corresponding mutations were cloned and expressed in an E. coli expression
vector (Augoustides-Savvopoulou et al., 2003; Luka and Wagner, 2003c).
It was shown that all mutations inactivate GNMT to different extents: the
N140S mutant possess only traces of WT GNMT activity, L49P is inacti-
vated by 90%, but the H176N mutant activity decreased only 25% regard-
ing Vmax (Luka and Wagner, 2003c). The Km values for AdoMet and
glycine also were changed compared to WT GNMT. These data are in
excellent agreement with proposed scheme of regulation of the levels of
methionine and AdoMet by GNMT.
The second strategy to show the role of GNMT in vivo also was explored
by developing the mouse model with GNMT knocked out by using
gene targeting (Luka et al., 2006b). In that mouse model exon 1 and the 50 -
regulatory sequence of GNMT gene, which carries at least part of putative
promoter in targeted allele, was replaced via homologous recombination with
NEO (neomycin phosphotransferase) gene.
Transgenic mice showed no difference in appearance and growth rate at
least for 36 months. GNMT activity assay and Western blotting showed
that transgenic animals, indeed, possessed no GNMT activity and no
GNMT protein. The levels of main metabolites were exactly as was
expected for inactivated GNMT and as was found in human patients: the
concentration of methionine increased from 100 nmol/g liver in WT
animals to about 700 nmol/g, the concentration of AdoMet increased
from 37 nmol/g in WT animals to about 1334 nmol/g in knockout
mice, while the level of AdoHcy slightly decreased from 1215 nmol/g to
35 nmol/g liver (Luka et al., 2006b). These changes in concentrations of
AdoMet and AdoHcy resulted in an increase in the AdoMet/AdoHcy ratio
from about 3300, that is, 100-fold. These changes mean that concentration
of the substrate for almost all methylases, AdoMet, increased enormously.
At the same time, the concentration of AdoHcy, which is an inhibitor for
GNMT-methyltetrahydrofolate 339
into solvent (Takata et al., 2003). Thus, binding AdoMet requires disruption
of the interaction of all N-terminal fragments of GNMT subunits.
That mechanism implies that any modification of the interaction of
N-terminal fragments will result in activation/inhibition of the enzymatic
reaction. Bound folate molecules strongly interact with the first 7 N-terminal
residues of each subunit. As a result, their flexibility significantly decreased
and much higher concentration of AdoMet is needed to enter the active
centers, that is, the enzymatic reaction is inhibited by folate.
VI. Conclusions
Cell and organism homeostasis requires strict regulation of all bio-
chemical processes in response to changes of environment. GNMT is one of
the most important parts of that regulation machinery. Therefore, exact
GNMT-methyltetrahydrofolate 341
knowledge of how that part is built and how it operates is needed for a
correct explanation of any abnormality in the cell and correct prediction of
how that affects the cells and organism.
The data discussed in this chapter show that knowledge of the role of
GNMT as methylating enzyme and folate-binding protein allows us to
predict the major effect of inactivation of that enzyme: increase in the
level of methionine and AdoMet, folate binding and physiological conse-
quences for liver. Our knowledge of GNMT function, however, is still not
sufficient to answer other questions. We still do not know why GNMT is
abundant in pancreas, kidney, and prostate but is not expressed in other
tissues. Is that related to secretion by pancreas and prostate? If so, what is the
mechanism of GNMT participation in that process? Another question is
how different forms of folate are distributed among all folate-binding
protein in the cell and how it is related to any abnormality, including
diseases? This is also a practical problem since folate derivatives are widely
used in medicine. Another unanswered question is, what is the primary
reason for the GNMT gene being completely repressed in tumor cells. Is it
just a trivial consequence of a shift of the total pattern of gene expression or
is repression of GNMT, a part of a tumor growth triggering mechanism?
The hope is that recent development in GNMT studies will bring the
answers to most of these questions.
ACKNOWLEDGMENTS
This work was supported by Grant DK15289 from the National Institutes of Health. The
author thanks Prof. Conrad Wagner for his critical reading of the manuscript.
REFERENCES
Aida, K., Tawata, M., Negishi, M., and Onaya, T. (1997). Mouse glycine N-methyltransferase
is sexually dimorphic and regulated by growth hormone. Horm. Metab. Res. 29, 646649.
Augoustides-Savvopoulou, P., Luka, Z., Karyda, S., Stabler, S. P., Allen, R. H.,
Patsiaoura, K., Wagner, C., and Mudd, S. H. (2003). Glycine N methyltransferase
deficiency, a new patient with a novel mutation. J. Inherit. Metab. Dis. 26, 745759.
Appling, D. R. (1991). Compartmentation of folate-mediated one-carbon metabolism in
eukaryotes. FASEB J. 5, 26452651.
Balaghi, M., Horne, D. W., and Wagner, C. (1993). Hepatic one-carbon metabolism in
early folate deficiency in rats. Biochem. J. 291, 145149.
Blumenstein, J., and Williams, G. R. (1960). The enzymatic N-methylation of glycine.
Biochem. Biophys. Res. Comm. 3, 259263.
Brown-Borg, H. M., Rakoczy, S. G., and Uthus, E. O. (2005). Growth hormone alters
methionine and glutathione metabolism in Ames dwarf mice. Mech. Ageing Dev. 126,
389398.
342 Zigmund Luka
Chen, Y. M., Shiu, J. Y., Tzeng, S. J., Shih, L. S., Chen, Y. J., Lui, W. Y., and Chen, P. H.
(1998). Characterization of glycine-N-methyltransferase-gene expression in human
hepatocellular carcinoma. Int. J. Cancer 75, 787793.
Chen, Y. M., Chen, L. Y., Wong, F. H., Lee, C. M., Chang, T. J., and Yang-Feng, T. L.
(2000). Genomic structure, expression, and chromosomal localization of the human
glycine N-methyltransferase gene. Genomics 66, 4347.
Chen, Z., Karaplis, A. C., Ackerman, S. L., Pogribny, I. P., Melnyk, S., Lussier-Cacan, S.,
Chen, M. F., Pai, A., John, S. W., Smith, R. S., Bottiglieri, T., Bagley, P., et al. (2001).
Mice deficient in methylenetetrahydrofolate reductase exhibit hyperhomocysteinemia
and decreased methylation capacity, with neuropathology and aortic lipid deposition.
Hum. Mol. Genet. 10, 433443.
Clarke, S., and Banfild, K. (2001). S-adenosylmethionine dependent methyltransferase.
In Homocysteine in Health and Disease (R. Carmel and D. W. Jacobsen, eds.),
pp. 6378. Cambridge University Press, Cambridge.
Clifford, A. J., Heid, M. K., Muller, H. G., and Bills, N. D. (1990). Tissue distribution and
prediction of total body folate of rats. J. Nutr. 120, 16331639.
Cook, R. J. (2001). Folate metabolism. In Homocysteine in Health and Disease (R. Carmel
and D. W. Jacobsen, eds.), pp. 113134. Cambridge University Press, Cambridge.
Cook, R. J., and Wagner, C. (1981). Measurement of a folate binding protein from rat liver
cytosol by radioimmunoassay. Arch. Biochem. Biophys. 208, 358364.
Cook, R. J., and Wagner, C. (1984). Glycine N-methyltransferase is a folate binding protein
of rat liver cytosol. Proc. Natl. Acad. Sci. USA 84, 36313634.
Foo, S. K., McSloy, R. M., Rousseau, C., and Shane, B. (1982). Folate derivatives in human
cells: Studies on normal and 5,10-methylenetetrahydrofolate reductase-deficient fibroblasts.
J. Nutr. 112, 16001608.
Fu, Z., Hu, Y., Konishi, K., Takata, Y., Ogawa, H., Gomi, T., Fujioka, M., and
Takusagawa, F. (1996). Crystal structure of glycine N-methyltransferase from rat liver.
Biochemistry 35, 1198511993.
Fujioka, M., Takata, Y., Konishi, K., and Ogawa, H. (1987). Function and reactivity of
sulfhydryl groups of rat liver glycine methyltransferase. Biochemistry 26, 696702.
Halsted, C. H. (1979). The intestinal absorption of folates. Am. J. Clin. Nutr. 32, 846855.
Heady, J. E., and Kerr, S. J. (1973). Purification and characterization of glycine
N-methyltransferase. J. Biol. Chem. 248, 6972.
Heady, J. E., and Kerr, S. J. (1975). Alteration of glycine N-methyltransferase activity in
fetal, adult, and tumor tissues. Cancer Res. 35, 640643.
Henderson, G. B. (1990). Folate-binding proteins. Annu. Rev. Nutr. 10, 319335.
Herbert, V., and Zalusky, R. (1962). Interrelations of vitamin B12 and folic acid metabolism:
Folic acid clearance studies. J. Clin. Invest. 41, 12631276.
Huang, Y., Komoto, J., Konishi, K., Takata, Y., Ogawa, H., Gomi, T., Fujioka, M., and
Takusagawa, F. (2000). Mechanisms for auto-inhibition and forced product release in
glycine N-methyltransferase, crystal structures of wild-type, mutant R175K and
S-adenosylhomocysteine-bound R175K enzymes. J. Mol. Biol. 298, 149162.
Jacobs, R. L., Stead, L. M., Brosnan, M. E., and Brosnan, J. T. (2001). Hyperglucagonemia
in rats results in decreased plasma homocysteine and increased flux through the transsul-
furation pathway in liver. J. Biol. Chem. 276, 4374043747.
Kim, D. W., Huang, T., Schirch, D., and Schirch, V. (1996). Properties of tetrahydropter-
oylpentaglutamate bound to 10-formyltetrahydrofolate dehydrogenase. Biochemistry 35,
1577215783.
Kloor, D., Karnahl, K., and Kompf, J. (2004). Characterization of glycine
N-methyltransferase from rabbit liver. Biochem. Cell Biol. 82, 369374.
Konishi, K., and Fujioka, M. (1987). Chemical modification of a functional arginine residue
of rat liver glycine methyltransferase. Biochemistry 26, 84968502.
GNMT-methyltetrahydrofolate 343
Konishi, K., and Fujioka, M. (1988). Rat liver glycine methyltransferase. Cooperative
binding of S-adenosylmethionine and loss of cooperativity by removal of a short
NH2-terminal segment. J. Biol. Chem. 263, 1338113385.
Liang, C. R., Leow, C. K., Neo, J. C., Tan, G. S., Lo, S. L., Lim, J. W., Seow, T. K.,
Lai, P. B., and Chung, M. C. (2005). Proteome analysis of human hepatocellular carcinoma
tissues by two-dimensional difference gel electrophoresis and mass spectrometry. Proteomics
5, 22582271.
Liu, H. H., Chen, K. H., Shih, Y. P., Lui, W. Y., Wong, F. H., and Chen, Y. M. (2003).
Characterization of reduced expression of glycine N-methyltransferase in cancerous hepatic
tissues using two newly developed monoclonal antibodies. J. Biomed. Sci. 10, 8797.
Luka, Z., and Wagner, C. (2003a). Expression and purification of glycine
N-methyltransferases in Escherichia coli. Protein Expr. Purif. 28, 280286.
Luka, Z., and Wagner, C. (2003b). Human glycine N-methyltransferase is unfolded by urea
through a compact monomer state. Arch. Biochem. Biophys. 420, 153160.
Luka, Z., and Wagner, C. (2003c). Effect of naturally occurring mutations in human glycine
N-methyltransferase on activity and conformation. Biochem. Biophys. Res. Commun. 312,
10671072.
Luka, Z., Cerone, R., Phillips, J. A., 3rd., Mudd, H. S., and Wagner, C. (2002). Mutations
in human glycine N-methyltransferase give insights into its role in methionine metabo-
lism. Hum. Genet. 110, 6874.
Luka, Z., Ham, A.-J., Norris, J. L., Yeo, E.-J., Yermalitsky, V., Glenn, B., Caprioli, R. M.,
Liebler, D. C., and Wagner, C. (2006a). Identification of phosphorylation sites in glycine
N-methyltransferase from rat liver. Protein Sci. 15, 785789.
Luka, Z., Capdevila, A., Mato, J. M., and Wagner, C. (2006b). A glycine
N-methyltransferase knockout mouse model for humans with deficiency of this enzyme.
Transgenic Res. 15, 393397.
Luka, Z., Pakhomova, S., Loukachevitch, L. V., Egli, M., Newcomer, M. E., and
Wagner, C. (2007). 5-methyltetrahydrofolate is bound in intersubunit areas of rat liver
folate-binding protein glycine N-methyltransferase. J. Biol. Chem. 282, 40694075.
Matherly, L. H., and Goldman, D. (2003). Membrane transport of folates. In Vitamines and
Hormones (G. Litwack, ed.), Vol. 66, pp. 405456. Academic Press, California.
Mays, L. L., Borek, E., and Finch, C. E. (1973). Glycine N-methyltransferase is a regulatory
enzyme which increases in ageing animals. Nature 243, 411413.
McKillop, D. J., McNulty, H., Scott, J. M., McPartlin, J. M., Strain, J. J., Bradbury, I.,
Girvan, J., Hoey, L., McCreedy, R., Alexander, J., Patterson, B. K., Hannon-
Fletcher, M., et al. (2006). The rate of intestinal absorption of natural food folates is not
related to the extent of folate conjugation. Am. J. Clin. Nutr. 84, 167173.
McMullen, M. H., Rowling, M. J., Ozias, M. K., and Schalinske, K. L. (2002). Activation
and induction of glycine N-methyltransferase by retinoids are tissue- and gender-specific.
Arch. Biochem. Biophys. 401, 7380.
Min, H., Shane, B., and Stokstad, E. L. (1988). Identification of 10-formyltetrahydrofolate
dehydrogenase-hydrolase as a major folate binding protein in liver cytosol. Biochim.
Biophys. Acta 967, 348353.
Moller, M. T., Samari, H. R., Fengsrud, M., Stromhaug, P. E., oStvold, A. C., and
Seglen, P. O. (2003). Okadaic acid-induced, naringin-sensitive phosphorylation of
glycine N-methyltransferase in isolated rat hepatocytes. Biochem. J. 373, 505513.
Mudd, S. H., Cerone, R., Schiaffino, M. C., Fantasia, A. R., Minniti, G., Caruso, U.,
Lorini, R., Watkins, D., Matiaszuk, N., Rosenblatt, D. S., Schwahn, B., Rozen, R., et al.
(2001). Glycine N-methyltransferase deficiency, a novel inborn error causing persistent
isolated hypermethioninaemia. J. Inherit. Metab. Dis. 24, 448464.
Nieman, K. M., Hartz, C. S., Szegedi, S. S., Garrow, T. A., Sparks, J. D., and
Schalinske, K. L. (2006). Folate status modulates the induction of hepatic glycine
344 Zigmund Luka
Suh, J. R., Herbig, A. K., and Stover, P. J. (2001). New perspectives on folate catabolism.
Annu. Rev. Nutr. 21, 255282.
Suzuki, N., and Wagner, C. (1980). Purification and characterization of a folate binding
protein from rat liver cytosol. Arch. Biochem. Biophys. 199, 236248.
Swanson, D. A., Liu, M. L., Baker, P. J., Garrett, L., Stitzel, M., Wu, J., Harris, M.,
Banerjee, R., Shane, B., and Brody, L. C. (2001). Targeted disruption of the methionine
synthase gene in mice. Mol. Cell. Biol. 21, 10581065.
Takata, Y., Huang, Y., Komoto, J., Yamada, T., Konishi, K., Ogawa, H., Gomi, T.,
Fujioka, M., and Takusagawa, F. (2003). Catalytic mechanism of glycine
N-methyltransferase. Biochemistry 42, 83948402.
Tseng, T. L., Shih, Y. P., Huang, Y. C., Wang, C. K., Chen, P. H., Chang, J. G.,
Yeh, K. T., Chen, Y. M., and Buetow, K. H. (2003). Genotypic and phenotypic
characterization of a putative tumor susceptibility gene, GNMT, in liver cancer. Cancer
Res. 63, 647654.
Uthus, E. O., and Brown-Borg, H. M. (2003). Altered methionine metabolism in long
living Ames dwarf mice. Exp. Gerontol. 38, 491498.
Velichkova, P., and Himo, F. (2005). Methyl transfer in glycine N-methyltransferase.
A theoretical study. J. Phys. Chem. B. 109, 82168219.
Villanueva, J. A., and Halsted, C. H. (2004). Hepatic transmethylation reactions in micropigs
with alcoholic liver disease. Hepatology 39, 13031310.
Waditee, R., Tanaka, Y., Aoki, K., Hibino, T., Jikuya, H., Takano, J., Takabe, T., and
Takabe, T. (2003). Isolation and functional characterization of N-methyltransferases
that catalyze betaine synthesis from glycine in a halotolerant photosynthetic organism
Aphanothece halophytica. J. Biol. Chem. 278, 49324942.
Wagner, C. (1982). Cellular folate bindng proteins; function and significance. Ann. Rev.
Nutr. 2, 229248.
Wagner, C. (1995). Biochemical role of folate in cellular metabolism. In Folate in Health
and Disease (L. B. Bayley, ed.), pp. 2342. Marcel Dekker Inc., New York.
Wagner, C., Briggs, W. T., and Cook, R. J. (1985). Inhibition of glycine
N-methyltransferase activity by folate derivatives, implications for regulation of methyl
group metabolism. Biochem. Biophys. Res. Commun. 127, 746752.
Wagner, C., Decha-Umphai, W., and Corbin, J. (1989). Phosphorylation modulates the
activity of glycine N-methyltransferase, a folate binding protein. In vitro phosphorylation
is inhibited by the natural folate ligand. J. Biol. Chem. 264, 96389642.
Williams, K. T., and Schalinske, K. L. (2007). New insights into the regulation of methyl
group and homocysteine metabolism. J. Nutr. 137, 311314.
Wittwer, A. J., and Wagner, C. (1980). Identification of folate binding protein of mitochon-
dria as dimethylglycine dehydrogenase. Proc. Natl. Acad. Sci. USA 77, 44844488.
Xu, G. P., and Snoswell, A. M. (1985). Disturbance of methyl group metabolism in alloxan-
diabetic sheep. Biochem. Int. 10, 897905.
Yeo, E. J., and Wagner, C. (1992). Purification and properties of pancreatic glycine
N-methyltransferase. J. Biol. Chem. 267, 2466924674.
Yeo, E. J., and Wagner, C. (1994). Tissue distribution of glycine N-methyltransferase,
a major folate-binding protein of liver. Proc. Natl. Acad. Sci. USA 91, 210214.
Yeo, E. J., Briggs, W. T., and Wagner, C. (1999). Inhibition of glycine N-methyltransferase
by 5-methyltetrahydrofolate pentaglutamate. J. Biol. Chem. 274, 3755937564.
Zamierowski, M. M., and Wagner, C. (1977). Identification of folate binding proteins in rat
liver. J. Biol. Chem. 252, 933938.
C H A P T E R T W E LV E
Mechanism-Based Inhibitors of
Folylpoly-g-Glutamate Synthetase and
g-Glutamyl Hydrolase: Control of
Folylpoly-g-Glutamate Homeostasis
as a Drug Target
James K. Coward* and John J. McGuire
Contents
I. Introduction 348
II. Folylpoly-g-Glutamate Homeostasis as a Drug Target 350
A. FPGS and GH: Biochemistry 350
B. FPGS and GH: Structure 352
III. Design of Fluoroglutamate-Containing Folates and Antifolates as
FPGS or GH Alternate Substrates and/or Inhibitors 354
A. Replacement of hydrogen by fluorine: Electronics
versus sterics 354
B. Predicted effect of fluorine substitution in free amino acids and
in fluoroglutamate-containing oligo-g-glutamates 356
IV. Synthesis of Fluorine-Containing Folates and Antifolates from the
Corresponding Fluoroglutamates and Related Fluoroamino Acids 356
A. 4-Fluoroglutamic acid 356
B. 4,4-Difluoroglutamic acid and derivatives 357
C. 3,3-Difluoroglutamic acid 358
D. Folates and antifolates derived from 4-FGlu 358
E. Folates and antifolates derived from 4,4-F2Glu and 4,4-F2Orn 359
F. Folates and antifolates derived from 3,3-F2Glu 360
G. Fluoroglutamate derivatives: Summary and conclusions 361
V. Design of Phosphorus-Containing Pseudopeptides as
FPGS Inhibitors 361
A. Introduction 361
* Departments of Medicinal Chemistry and Chemistry, University of Michigan, 3813 Chemistry, 930 N.
University, Ann Arbor, Michigan 48109
{
Grace Cancer Drug Center, Roswell Park Cancer Institute, Buffalo, New York 14263
347
348 James K. Coward and John J. McGuire
Abstract
Intracellular folate pools consist primarily of g-glutamyl isopeptide conjugates of
reduced forms of the vitamin, folic acid. Biosynthesis of these oligomeric isopep-
tides is catalyzed by the enzyme folylpoly-g-glutamate synthetase (FPGS).
The highly anionic character of the oligomers renders them unable to cross
the cell membrane and, therefore, these forms of reduced folates (and certain
antifolates) accumulate in cells to high concentration. g-Glutamyl hydrolase
(GH) catalyzes the hydrolysis of the oligo-g-glutamates derivatives to monoglu-
tamyl forms, which are substrates for the reduced folate carrier and able to
exit the cell. This chapter describes research, primarily from our laboratories,
on the design, synthesis, and biochemical evaluation of several novel
analogues of glutamic acid, g-glutamyl peptides, and derivatives of folic
acid as well as of antifolate drugs. These include a series of fluoroglutamic
acids, fluoroglutamate-containing isopeptides, phosphorus-containing pseudo-
peptides, and epoxide-containing peptidomimetics. The fluoroglutamic acids and
fluoroglutamate-containing folates and antifolates exhibit position-dependent
effects on the reactions catalyzed by FPGS and GH, thus providing insight into
the catalytic mechanism and control of these enzymes. The phosphinic acid-
containing pseudopeptides are the most potent inhibitors of FPGS identified to
date, and were designed based on mechanistic enzymology data from our
laboratories and others, prior to the publication of any structural information
about the targeted enzymes. 2008 Elsevier Inc.
I. Introduction
Naturally occurring folate conjugates are composed of a series of
oligo-g-glutamate isopeptides attached to pteroic acid via an amide bond
(Fig. 12.1). Although the structures of these compounds have been known
for many years (Stokstad and Koch, 1967), details on their biosynthesis,
FPGS and GH Inhibitors 349
O H
N
O CO2
HN N N
H H
H2N N
H
CO2
O H
N
O CO2
HN N N
H H
H2N N
H
CO2
g GH FPGS
O H O CO2
N
HN N N
H H
H2N N CO2
H
N
O H
CO2
N
O H
n
CO2
degradation, and utilization have been elucidated only more recently (Galivan
et al., 2000; McGuire and Coward, 1984; Schirch and Strong, 1989; Shane,
1989). In this chapter, we describe research, primarily from our own labora-
tories, that has sought to exploit our understanding of the reactions catalyzed
by folylpoly-g-glutamate synthetase (FPGS, EC 6.3.2.17) and g-glutamyl
hydrolase (GH, EC 3.4.19.9). These enzymes act in concert to maintain
levels of intracellular folylpoly-g-glutamates sufficient for cell growth, as well
as adequate levels of antifolate chemotherapeutic agents to inhibit the growth
of cells targeted in the treatment of cancer and other pathological conditions
such as rheumatoid arthritis. Early work demonstrated an absolute require-
ment for folylpoly-g-glutamate synthesis for cell viability in Chinese hamster
ovary cells. A mutant cell line, AUXB1, that is auxotrophic for glycine,
adenosine, and thymidine (McBurney and Whitmore, 1974), or glycine
and methionine (Taylor and Hanna, 1977), contains primarily low levels of
monoglutamate derivatives of reduced folates, and it was concluded that the
defect in this cell line as well as a temperature-sensitive variant, tsAUXB1, is
the enzyme responsible for linking glutamate residues onto intracellular folate
derivatives. Taylor and Hanna (1977) subsequently identified FPGS as the
single enzyme responsible for the multiple auxotrophy. Two consequences
350 James K. Coward and John J. McGuire
CO2-
O
Het C N CO2- Donor substrate
H
Y
ATP
FPGS
ADP
CO2-
O
O
Het C N C PO3=
H
Y O
Z
H2N CO2-
CO2-
Acceptor substrate
CO2-
O
X CO2-
CO2- Z C N P
H2 H
O
N O O CO2-
C N + CO2-
H -O O CO -
Y X = NH, O, CH2
=O P 2 Mechanism-Based
3 FPGS inhibitors
ATP
FPGS
Pi (X = CH2)
ADP
CO2- CO2-
O H Z O
N CO2- CO2-
Het C N C N P
H -
H Y O O CO -
O CO2- =O P
2
3
O NH2 O
N N
HN N N N HN C
Het = H Me H2
H2N N N H2N N N H2N N N
H
Folate-based Methotrexate-based Lometrexol-based
CO2 Z CO2
O H O
N CO2 CO2
C N
RNH H Mechanism-Based
Y O CO2
CO2 GH Inhibitor
GH-Cys110-SH GH-Cys110-SH
CO2 Z
O H
N CO2 CO2 OH
C N CO2
RNH H
Y S O
CO2 CO2
Cys110 S
GH
Cys110
GH
Z
H2N CO2 Postulatead GH inactivation by an
CO2 epoxide-containing pseudopeptide
CO2
O
S
C N Cys110
RNH H Y O
GH
H2O
GH-Cys110-SH
CO2
O
O
C N
RNH H Y O
activities, has been reported (Mathieu et al., 2005). Both the N-terminal and
C-terminal domains of FolC are superimposable with those of the L. casei
enzyme. Most interestingly, the structural data indicate that dihydropteroate
can bind to the C-terminal domain (1.9 A) of FolC, which is distinct from
the site in the N-terminal domain (1.6 A). Crystallization of FolC in the
presence of 7,8-dihydrofolate (H2PteGlu) and ATP provides a ternary
complex consisting of 7,8-dihydropteroylphosphate and ADP bound to
the C-terminal domain. This complex apparently is formed by hydrolysis
of H2PteGlu to give pteroic acid and release of glutamate, followed by
ATP-mediated formation of the acyl phosphate. Comparison of the
C-terminal domains of FolC and L. casei FPGS does not reveal a common
folate-binding site (Mathieu et al., 2005). This suggests the possibility of
designing inhibitors that target specifically each domain. No crystal struc-
ture for human or other eukaryotic FPGS has been reported to date. The
crystal structure reported for human GH at 1.6 A (Li et al., 2002) indicates
that this enzyme is a dimer, since confirmed in solution by ultracentrifuga-
tion (Eisele et al., 2006), and is a class I glutamine amidotransferase based on
sequence alignment with members of this superfamily (Chave et al., 2000).
This is not surprising if one considers the reaction catalyzed by GH, that is,
reaction of a nucleophile (H2O) and a g-substituted glutamine, -NHGlu-g-
(Glu)n-g-Glu-OH.
Considering the reactions catalyzed by FPGS and GH, it is tempting
to consider the use of ATP analogues, such as AMPPNP and AMPPCP
(Yount, 1975), or glutamate analogues as inhibitors of the formation or
hydrolysis of folate polyglutamates. However, nucleotide analogues are not
readily transported across cell membranes and are generally not effective in
cell culture experiments or in vivo (Debart et al., 2007). In contrast, analogues
of glutamic acid or glutamine readily cross the cell membrane. However, the
fact that glutamate and glutamine are involved in a wide array of biochemical
reactions makes the use of analogues of these amino acids somewhat prob-
lematic. Such analogues are toxic, for example, acivicin and 6-diazo-5-oxo-
norleucine (Ahluwalia et al., 1990) as are the free fluoroglutamic acids
described below [e.g., 4-fluoroglutamic acid (4-FGlu); Galivan et al.,
1985a]. Therefore, our focus has been to design analogues of glutamic acid
and glutamyl-g-glutamate, based on our understanding of the catalytic mech-
anism of the two target enzymes, FPGS and GH, that can be incorporated
into folate and antifolate platforms (Schemes 12.1 and 12.2). As is described
354 James K. Coward and John J. McGuire
1
In previous publications from our laboratories, the terms acceptor and incoming were used to describe
two of the substrates involved in the reaction catalyzed by FPGS. The folate or antifolate that reacts with ATP
to form the g-glutamyl phosphate intermediate (Banerjee et al., 1988) was considered the acceptor
substrate, whereas the free glutamic acid or an analogue was considered the incoming substrate. In this
chapter, we have used a more general nomenclature, one used for glycosyltransferases (cf. Qasba et al., 2005)
and ATP-dependent synthetases (cf. Watanabe et al., 2007), in which the electrophilic acyl donor derived
from a folate or an antifolate is defined as the donor substrate and the nucleophilic glutamic acid or analogue is
defined as the acceptor substrate.
FPGS and GH Inhibitors 355
Sterics
Atomic radius (A)
a
H 0.790
F 0.570
van der Waals radius (A)
b
H 1.20
F 1.47
Bond length (A, R3CX)
b
H 1.099
F 1.428
OH 1.440
3
van der Waals volume (A /substituent)
c
CH3 21.6
CF3 39.8
CH3CH2 38.9
(CH3)2CH 56.2
Electronegativity (w)b
H 2.20
F 3.98
a
http://environmentalchemistry.com/yogi/periodic/atomicradius.html
b
Timperley and White (2003).
c
Leroux (2004).
CO2H
H3N CO2H
X
of FPGS and GH have been published (Coward et al., 1991; Tsukamoto et al.,
1996a) and serve as a foundation for the material reviewed in this chapter.
2
A decrease in pKa of the a-NH3 moiety, due to the presence of a neighboring electron-withdrawing group
such as fluorine, results in an amino acid in which the nucleophilicity is decreased as indicated. However, it
should also be noted that, in accord with the HendersonHasselbach equation, the mole fraction of the
nucleophilic free amine present in solution is dependent on the pH. Thus, depending on the assay pH or
intracellular pH, the concentration of the nucleophilic a-amino group may be increased sufficiently to offset
the decreased inherent nucleophilicity of the amino acid analogue due to the presence of an electron-
withdrawing group nearby.
FPGS and GH Inhibitors 357
C. 3,3-Difluoroglutamic acid
Although placement of one or two fluorine substituents adjacent to the
g-CO2H, as in 4-FGlu or 4,4-F2Glu, was of interest in terms of the impact
on FPGS-catalyzed ligation or GH-catalyzed hydrolysis, the distal position-
ing of fluorine substituents at C-3 would permit investigation of the impact
of a decreased pKa at the a-amino group (Table 12.2). The synthesis of both
diastereomers (2R, 3S; 2R, 3R) of L-3-fluoroglutamic acid via chemoenzy-
matic methods has been reported (Vidal-Cros et al., 1985, 1989). However,
neither synthesis nor biochemical studies of the corresponding folyl or
antifolyl derivatives have been described. A racemic synthesis of DL-3, 3-
difluoroglutamic acid (DL-3,3-F2Glu) was first achieved at Merrill-Dow
Research Institute and was made available for our research in limited
quantities (McGuire et al., 1990). Most interestingly, FPGS-catalyzed liga-
tion of 3,3-F2Glu resulted in an enhanced ligation rate, apparently resulting
from a higher concentration of the nucleophilic substrate, the unprotonated
a-amino moiety of the glutamate acceptor substrate present at the assay pH
of 8.4, due to the decreased pKa of the a-amino group. Extension of our
nucleophilic fluorination methodology allowed us to obtain larger quanti-
ties of this fluorinated amino acid from the internal carbamate derived from
3-hydroxy DL-prolinol (Hart and Coward, 1993) for use in the synthesis of
folates and antifolates containing this interesting fluorinated glutamate.
More recently, a stereoselective synthesis of N-Cbz and N-Boc L-3,
3-F2Glu dibenzyl ester has been reported (Suzuki et al., 2004) although
the corresponding free amino acid has not yet been described.
V. Design of Phosphorus-Containing
Pseudopeptides as FPGS Inhibitors
A. Introduction
The reactions catalyzed by FPGS and GH proceed via intermediates that
involve unstable tetrahedral intermediates (Schemes 12.1 and 12.2). Our
design of mechanism-based inhibitors of these enzymes has focused on either
mimicking (FPGS) or intercepting (GH) formation of these intermediates.
Much as the research described above has focused on organofluorine chemis-
try, the research described below involves organophosphorus chemistry.
Initially, our efforts were aimed at synthesizing b-ketophosphonate analogue,
1b (R CO 2 ), of the unstable g-glutamyl phosphate intermediate, 1a
(Structure 1). Unfortunately, only the a-descarboxy analogue, 1b (R H),
was amenable to synthesis (Tang and Coward, 1983) and, not surprisingly, no
inhibition of FPGS activity by this compound was observed. Subsequently,
362 James K. Coward and John J. McGuire
R
O
X Y
Het C N C PO3 =
H O
1
peptidase (Chave et al., 1999) indicate that a different approach to the design of
GH-specific inhibitors is required (vide infra).
Examination of the phosphonate- and phosphinate-containing pseudo-
peptides as FPGS inhibitors was more gratifying. The MTX-based phos-
phonate analogue (MTX-phosphonate) is a very potent competitive
inhibitor (Ki 46 nM) of human FPGS and retains the potent inhibitory
activity of MTX against DHFR with a value of IC50 0.9 nM (Tsukamoto
et al., 1998). The related phosphinate-containing pseudopeptide (MTX-
phosphinate), a mixture of two racemic diastereomers, is an even more
potent competitive inhibitor (Ki 3.1 nM) and also retains inhibitory
activity against DHFR (IC50 2.1 nM) (McGuire et al., 2003). Evaluation
of the single isomer phosphinates coupled to three heterocyclic platforms
(Scheme 12.1, Het) has demonstrated that one diastereomer, presumably
20 S, 200 S, exhibits values of IC50 ca. 10- to 30-fold lower than the other
diastereomer, presumably 20 S, 200 R. The more potent diastereomers are
competitive inhibitors with values of Ki 15 nM ( J. J. McGuire et al.,
in preparation). The surprisingly small difference in inhibitory activity
between the two diastereomers suggests that the D-configuration at the
C-terminal glutamate is tolerated in these inhibitors, a conclusion consistent
with the conformational flexibility of distal glutamate residues, that is, n > 0
in Het-pAB-Glu-g-[Glu]n-g-OH, as discussed above in the context of the
position-dependent effects of 3,3-F2Glu.
VII. Conclusions
This chapter summarizes research, primarily from our laboratories,
on the design, synthesis, and biochemical evaluation of several novel ana-
logues of glutamic acid, g-glutamyl peptides, and derivatives of folic acid and
also of antifolate drugs. These include a series of fluoroglutamic acids,
fluoroglutamate-containing isopeptides, phosphorus-containing pseudopep-
tides, and epoxide-containing peptidomimetics. The enzyme targets of these
FPGS and GH Inhibitors 367
compounds are enzymes that catalyze the biosynthesis (FPGS, Scheme 12.1)
and hydrolysis (GH, Scheme 12.2) of poly-g-glutamate conjugates of folates
and antifolates. The fluoroglutamic acids and fluoroglutamate-containing
folates and antifolates exhibit position-dependent effects on the reactions
catalyzed by FPGS and GH, thus providing insight into the catalytic mecha-
nism and control of these enzymes. The phosphinic acid-containing pseudo-
peptides are the most potent inhibitors of FPGS identified to date, and were
designed based on mechanistic enzymology data from our laboratories and
others, prior to the publication of any structural information about the targeted
enzymes.
ACKNOWLEDGMENT
Research in our laboratories has been supported by grants from the National Cancer Institute
[CA 28097 ( JKC), CA 43500 ( JJM), CA 16056 (RPCI CCSG)]. We thank our students,
postdoctoral associates, and other colleagues whose names are given in the references for
their enthusiastic pursuit of the research described herein.
REFERENCES
Abell, L. M., and Villafranca, J. J. (1991). Investigation of the mechanism of phosphinothricin
inactivation of Escherichia coli glutamine synthetase using rapid quench kinetic techniques.
Biochemistry 30, 61356141.
Ahluwalia, G. S., Grem, J. L., Hao, Z., and Cooney, D. A. (1990). Metabolism and action of
amino acid analog anticancer agents. Pharmacol. Therapeut. 46, 243271.
Alexander, J. P., Ryan, T. J., Ballou, D. P., and Coward, J. K. (2008). g-Glutamyl hydrolase:
Kinetic characterization of isopeptide hydrolysis using fluorogenic substrates. Biochemistry
47, 12281239.
Alexander, M. D. (2004). The synthesis and characterization of g-glutamyl aldehydes and
epoxides designed as inhibitors of the cysteine protease g-glutamyl hydrolase. Ph.D.
Dissertation. University of Michigan, Ann Arbor, MI.
Banerjee, R. V., Shane, B., McGuire, J. J., and Coward, J. K. (1988). Dihydrofolate synthetase
and folylpolyglutamate synthetase: Direct evidence for intervention of acyl phosphate
intermediates. Biochemistry 27, 90629070.
Bartlett, P. A., and Marlowe, C. K. (1983). Phosphonamidates as transition-state analogue
inhibitors of thermolysin. Biochemistry 22, 46184624.
Bartley, D. M., and Coward, J. K. (2005). A stereoselective synthesis of phosphinic acid
phosphapeptides corresponding to glutamyl-g-glutamate and incorporation into potent
inhibitors of folylpoly-g-glutamyl synthetase. J. Org. Chem. 70, 67576774.
Beaumont, K., Webster, R., Gardner, I., and Dack, K. (2003). Design of ester prodrugs to
enhance oral absorption of poorly permeable compounds: Challenges to the discovery
scientist. Curr. Drug Metab. 4, 461485.
Bohm, H. J., Banner, D., Bendels, S., Kansy, M., Kuhn, B., Muller, K., Obst-Sander, U.,
and Stahl, M. (2004). Fluorine in medicinal chemistry. Chem. Biochem. 5, 637643.
Chave, K. J., Galivan, J., and Ryan, T. J. (1999). Site-directed mutagenesis establishes
cysteine-110 as essential for enzyme activity in human g-glutamyl hydrolase. Biochem J.
343, 551555.
368 James K. Coward and John J. McGuire
Chave, K. J., Auger, I. E., Galivan, J., and Ryan, T. J. (2000). Molecular modeling and site-
directed mutagenesis define the catalytic motif in human g-glutamyl hydrolase. J. Biol.
Chem. 275, 4036540370.
Chave, K. J., Ryan, T. J., Chmura, S. E., and Galivan, J. (2003). Identification of single
nucleotide polymorphisms in the human g-glutamyl hydrolase gene and characterization
of promoter polymorphisms. Gene 319, 167175.
Chen, S., Lin, C.-H., Kwon, D. S., Walsh, C. T., and Coward, J. K. (1997). Design,
synthesis, and biochemical evaluation of phosphonate and phosphonamidate analogs of
glutathionylspermidine as inhibitors of glutathionylspermidine synthetase/amidase from
Escherichia coli. J. Med. Chem. 40, 38423850.
Clarke, S. J., Beale, P. J., and Rivory, L. P. (2000). Clinical and preclinical pharmacokinetics
of raltitrexed. Clin. Pharmacokin. 39, 429443.
Cook, J. D., Cichowicz, D. J., George, S., Lawler, A., and Shane, B. (1987). Mammalian
folyl-g-glutamate synthetase: In vitro and in vivo metabolism of folates and analogues and
regulation of folate homeostasis. Biochemistry 26, 530539.
Coward, J. K., McGuire, J. J., and Galivan, J. (1991). The influence of fluoro substituents on
the reactivity of carboxylic acids, amides, and peptides in enzyme-catalyzed reactions.
In Selective Fluorination in Organic and Bioorganic Chemistry ( J. T. Welch, ed.),
pp. 196204. American Chemical Society, Washington, DC.
Debart, F., Abes, S., Deglane, G., Moulton, H. M., Clair, P., Gait, M. J., Vasseur, J. J., and
Lebleu, B. (2007). Chemical modifications to improve the cellular uptake of oligonu-
cleotides. Curr. Topics Med. Chem. 7, 727737.
Deprele, S., and Montchamp, J.-L. (2001). Triethylborane-initiated room temperature
radical addition of hypophosphites to olefins: Synthesis of monosubstituted phosphinic
acids and esters. J. Org. Chem. 66, 67456755.
Eisele, L. E., Chave, K. J., Lehning, A. C., and Ryan, T. J. (2006). Characterization of human
g-glutamyl hydrolase in solution demonstrates that the enzyme is a non-dissociating
homodimer. Biochim. Biophys. Acta. 1764, 14791486.
Feng, Y., and Coward, J. K. (2006). Prodrug forms of N-[(4-deoxy-4-amino-10-methyl)
pteroyl]-glutamate-g-[cP(O)(OH)]-glutarate, a potent inhibitor for folylpoly-g-gluta-
mate synthetase: Synthesis and hydrolytic stability. J. Med. Chem. 49, 770788.
Forsch, R., Bader, H., and Rosowsky, A. (1999). Synthesis of L-2-(N-pteroylamino)-3-(N-
phosphonoacetyl)amino-propanoic acid as an analogue of the putative phosphorylated
intermediate in the g-glutamation of folic acid by folylpolyglutamate synthetase. Pteridines
10, 3946.
Galivan, J., Coward, J. K., and McGuire, J. J. (1985a). The effects of D,L-4-fluoroglutamic
acid on the glutamylation of methotrexate by hepatic cells in vitro. Biochem. Pharmacol. 34,
29952997.
Galivan, J., Inglese, J., McGuire, J. J., Nimec, Z., and Coward, J. K. (1985b). g-Fluoro-
methotrexate: Synthesis and biological activity of a potent inhibitor of dihydrofolate
reductase with greatly diminished ability to form poly-g-glutamates. Proc. Natl. Acad. Sci.
USA 82, 25982602.
Galivan, J., Ryan, T. J., Chave, K., Rhee, M., Yao, R., and Yin, D. (2000). Glutamyl
hydrolase: Pharmacological role and enzymatic characterization. Pharmacol. Ther. 85,
207215.
Gelb, M. H., Svaren, J. P., and Abeles, R. H. (1985). Fluoro ketone inhibitors of hydrolytic
enzymes. Biochemistry 24, 18131817.
George, S., Cichowicz, D. J., and Shane, B. (1987). Mammalian folylpoly-g-glutamate
synthetase. 3. Specificity for folate analogues. Biochemistry 26, 522529.
Hart, B. P. (1995). The synthesis and biological evaluation of fluorinated glutamates, folates,
and antifolates. Ph.D. Dissertation. The University of Michigan, Ann Arbor, MI.
FPGS and GH Inhibitors 369
Hart, B. P., and Coward, J. K. (1993). The synthesis of DL-3,3-difluoroglutamic acid from a
3-oxoprolinol derivative. Tetrahedron Lett. 34, 49174920.
Hart, B. P., Haile, W. H., Licato, N. J., Bolanowska, W. E., McGuire, J. J., and
Coward, J. K. (1996). Synthesis and biological activity of folic acid and methotrexate
analogues containing L-threo(2S,4S )-4-fluoroglutamic acid and DL-3,3-difluoroglutamic
Acid. J. Med. Chem. 39, 5665.
Hudlicky, M. (1993). Stereospecific syntheses of all four stereoisomers of 4-fluoroglutamic
acid. J. Fluorine Chem. 60, 193210.
Jencks, W. P., and Regenstein, J. (1976). In CRC Handbook of Biochemistry & Molecular
Biology (G. D. Fasman, ed.), pp. 305351. CRC Press, Inc, Cleveland, OH.
Kokuryo, Y., Kawata, K., Nakatani, T., Kugimiya, A., Tamura, Y., Kawada, K.,
Matsumoto, M., Suzuki, R., Kuwabara, K., Hori, Y., and Ohtani, M. (1997). Synthesis
and evaluation of novel fluorinated methotrexate derivatives for application to rheuma-
toid arthritis treatment. J. Med. Chem. 40, 32803291.
Konas, D. W., and Coward, J. K. (1999). Synthesis of L-4,4-difluoroglutamic acid via
electrophilic difluorination of a lactam. Org. Lett. 1, 21052107.
Konas, D. W., and Coward, J. K. (2001). Electrophilic fluorination of pyroglutamic acid
derivatives: Application of substrate-dependent reactivity and diastereoselectivity to the
synthesis of optically active 4-fluoroglutamic acids. J. Org. Chem. 66, 88318842.
Konas, D. W., Pankuch, J. J., and Coward, J. K. (2002). The synthesis of (2S)-4,4-
difluoroglutamyl g-peptides based on Garners aldehyde and fluoro-Reformatsky chem-
istry. Synthesis-Stuttgart 26162626.
Leroux, F. (2004). Atropisomerism, biphenyls, and fluorine: A comparison of rotational
barriers and twist angles. ChemBioChem. 5, 644649.
Li, H., Ryan, T. J., Chave, K. J., and Van Roey, P. (2002). Three-dimensional structure of
human g-glutamyl hydrolase: A class I glutamine amidohydrolase adapted for a complex
substrate. J. Biol. Chem. 277, 2452224529.
Licato, N. J., Coward, J. K., Nimec, Z., Galivan, J., Bolanowska, W. E., and McGuire, J. J.
(1990). Synthesis of N-[N-(4-deoxy-4-amino-10-methylpteroyl)-4-fluoroglutamyl]-g-
glutamate, an unusual substrate for folylpoly-g-glutamate synthetase and g-glutamyl
hydrolase. J. Med. Chem. 33, 10221027.
Liederer, B. M., and Borchardt, R. T. (2006). Enzymes involved in the bioconversion of
ester-based prodrugs. J. Pharm. Sci. 95, 11771195.
Lienhard, G. E., and Secemski, I. I. (1973). P1, P5, Di(adenosine-50 )pentaphosphate,
a potent multisubstrate inhibitor of adenylate kinase. J. Biol. Chem. 248, 11211123.
Liu, X., Hu, E., Tian, X., Mazur, A., and Ebetino, F. H. (2002). Enantioselective synthesis
of phosphinyl peptidomimetics via an asymmetric Michael reaction of phosphinic acids
with acrylate derivatives. J. Organomet. Chem. 646, 212222.
Longo, G. S. A., Gorlick, R., Tong, W. P., Lin, S. L., Steinherz, P., and Bertino, J. R.
(1997). g-Glutamyl hydrolase and folylpolyglutamate synthetase activities predict poly-
glutamylation of methotrexate in acute leukemias. Oncol. Res. 9, 259263.
Malachowski, W. P., and Coward, J. K. (1994a). The chemistry of phosphapeptides:
Investigations on the synthesis of phosphonamidate, phosphonate, and phosphinate
analogues of glutamyl-g-glutamate. J. Org. Chem. 59, 76257634.
Malachowski, W. P., and Coward, J. K. (1994b). The chemistry of phosphapeptides:
Formation of functionalized phosphonochloridates under mild conditions and their
reaction with alcohols and amines. J. Org. Chem. 59, 76167624.
Manne, V., Yan, N., Carboni, J. M., Tuomari, A. V., Ricca, C. S., Brown, J. G.,
Andahazy, M. L., Schmidt, R. J., Patel, D., Zahler, R., Weinmann, R., Der, C. J.,
et al. (1995). Bisubstrate inhibitors of farnesyltransferase: A novel class of specific inhibi-
tors of ras transformed cells. Oncogene 10, 17631779.
370 James K. Coward and John J. McGuire
Matherly, L. H., and Goldman, D. (2003). Membrane transport of folates. Vitam. Horm. 66,
403456.
Mathieu, M., Debousker, G., Vincent, S., Viviani, F., Bamas-Jacques, N., and Mikol, V.
(2005). Escherichia coli FolC structure reveals an unexpected dihydrofolate binding site
providing an attractive target for anti-microbial therapy. J. Biol. Chem. 280, 1891618922.
McBurney, M. W., and Whitmore, G. F. (1974). Isolation and biochemical characterization
of folate deficient mutants of Chinese hamster cells. Cell 2, 173182.
McClure, W. R., and Chow, Y. (1980). The kinetics and processivity of nucleic acid
polymerases. Methods Enzymol. 64, 277.
McDermott, A. E., Creuzet, F., Griffin, R. G., Zawadzke, L. E., Ye, Q. Z., and
Walsh, C. T. (1990). Rotational resonance determination of the structure of an
enzyme-inhibitor complex: Phosphorylation of an (aminoalkyl)phosphinate inhibitor
of D-alanyl-D-alanine ligase by ATP. Biochemistry 29, 57675775.
McGuire, J. J., and Coward, J. K. (1984). Pteroylpolyglutamates: Biosynthesis, degradation,
and function. In Folates and Pterins (R. L. Blakley and S. J. Benkovic, eds.), Vol. 1,
pp. 135190. John Wiley & Sons, New York.
McGuire, J. J., and Coward, J. K. (1985). DL-threo-4-Fluoroglutamic acid: A chain terminat-
ing inhibitor of folylpolyglutamate synthetase. J. Biol. Chem. 260, 67476754.
McGuire, J. J., and Coward, J. K. (2003). Folylpolyglutamate synthetase as a target for
therapeutic intervention. Drugs Future 28, 967974.
McGuire, J. J., Hsieh, P., Coward, J. K., and Bertino, J. R. (1980). Enzymatic synthesis of
folylpolyglutamates. Characterization of the reaction and its products. J. Biol. Chem. 255,
57765788.
McGuire, J. J., Hsieh, P., Coward, J. K., and Bertino, J. R. (1983). In vitro methotrexate
polyglutamate synthesis by rat liver folylpolyglutamate synthetase and its inhibition by
bromosulfophthalein. In Folyl and Antifolyl Polyglutamates (I. D. Goldman,
B. A. Chabner, and J. R. Bertino, eds.), Vol. 163, pp. 199214. Plenum Press, New York.
McGuire, J. J., Hsieh, P., Franco, C. T., and Piper, J. R. (1986). Folylpolyglutamate
synthetase inhibition and cytotoxic effects of methotrexate analogs containing 2,o-
diaminoalkanoic acids. Biochem. Pharmacol. 35, 26072613.
McGuire, J. J., Graber, M., Licato, N., Vincenz, C., Coward, J. K., Nimec, Z., and
Galivan, J. (1989). Biochemical and growth inhibitory effects of the erythro and threo
isomers of g-fluoromethotrexate, a methotrexate analogue defective in polyglutamyla-
tion. Cancer Res. 49, 45174525.
McGuire, J. J., Haile, W. H., Bey, P., and Coward, J. K. (1990). DL-3,3-Difluoroglutamate:
An enhancer of folylpolyglutamate elongation. J. Biol. Chem. 265, 1407314079.
McGuire, J. J., Bolanowska, W. E., Coward, J. K., Sherwood, R. F., Russell, C. A., and
Felschow, D. M. (1991). Biochemical and biological properties of methotrexate analogs
containing D-glutamic acid or D-erythro,threo-4-fluoroglutamic acid. Biochem. Pharmacol.
42, 24002403.
McGuire, J. J., Hart, B. P., Haile, W. H., Rhee, M., Galivan, J., and Coward, J. K. (1995).
DL-b,b-difluoroglutamic acid mediates position-dependent enhancement or termination
of pteroylpoly (g-glutamate) synthesis catalyzed by folylpolyglutamate synthetase. Arch.
Biochem. Biophys. 321, 319328.
McGuire, J. J., Hart, B. P., Haile, W. H., Magee, K. J., Rhee, M., Bolanowska, W. E.,
Russell, C., Galivan, J., Paul, B., and Coward, J. K. (1996a). Biological properties of
fluoroglutamate-containing analogs of folates and methotrexate with altered capacities to
form poly (g-glutamate) metabolites. Biochem. Pharmacol. 52, 12951303.
McGuire, J. J., Tsukamoto, T., Hart, B. P., Coward, J. K., Kalman, T. I., and Galivan, J.
(1996b). Exploitation of folate and antifolate polyglutamylation to achieve selective
anticancer chemotherapy. Invest. New Drugs 14, 317323.
FPGS and GH Inhibitors 371
McGuire, J. J., Haile, W. H., Valiaeva, N., Bartley, D., Guo, J., and Coward, J. K. (2003).
Potent inhibition of human folylpolyglutamate synthetase by a phosphinic acid mimic of
the tetrahedral reaction intermediate. Biochem. Pharmacol. 65, 315318.
Nair, S. A., Lee, B., and Hangauer, D. (1995). Synthesis of orthogonally protected
L-homocysteine and L-2-amino-4-phosphonobutanoic acid from L-homoserine.
Synthesis 7, 810814.
Pankuch, J. J. (2004). New fluorogenic peptide substrates for studying the mechanism of
g-glutamyl hydrolase. Ph.D. Dissertation. University of Michigan, Ann Arbor, MI.
Patel, D. V., Gordon, E. R., Schmidt, R. J., Weller, H. N., Young, M. G., Zahler, R.,
Barbacid, M., Carboni, J. M., Gullo-Brown, J. L., Hunihan, L., Ricca, C., Robinson, S.,
et al. (1995). Phosphinyl acid-based bisubstrate analog inhibitors of ras farnesyl protein
transferase. J. Med. Chem. 38, 435442.
Pizzorno, G., Mini, E., Coronnello, M., McGuire, J. J., Moroson, B. A., Cashmore, A. R.,
Dreyer, R. N., Lin, J. T., Mazei, T., Periti, P., and Bertino, J. R. (1988). Impaired
polyglutamylation of methotrexate as a cause of resistance in CCRF-CEM cells after
short-term, high-dose treatment with this drug. Cancer Res. 48, 21492155.
Qasba, P. K., Ramakrishnan, B., and Boeggeman, E. (2005). Substrate-induced conforma-
tional changes in glycosyltransferases. Trends Biochem. Sci. 30, 5362.
Rosowsky, A. (1999). PT523 and other aminopterin analogs with a hemiphthaloyl-L-
ornithine side chain: Exceptionally tight-binding inhibitors of dihydrofolate reductase
which are transported by the reduced folate carrier but cannot form polyglutamates. Curr.
Med. Chem. 6, 329352.
Rosowsky, A., Freisheim, J. H., Moran, R. G., Solan, V. C., Bader, H., Wright, J. E., and
Radike-Smith, M. (1986). Methotrexate analogues. 26. Inhibition of dihydrofolate
reductase and folylpolyglutamate synthetase activity and in vitro tumor cell growth by
methotrexate and aminopterin analogues containing a basic amino acid side chain. J. Med.
Chem. 29, 655660.
Rots, M. G., Pieters, R., Peters, G. J., Noordhuis, P., van Zantwijk, C. H., Kaspers, G. J. L.,
Hahlen, K., Creutzig, U., Veerman, A. J. P., and Jansen, G. (1999). Role of folylpo-
lyglutamate synthetase and folylpolyglutamate hydrolase in methotrexate accumulation
and polyglutamylation in childhood leukemia. Blood 93, 16771683.
Salcedo, E., Cortese, J. F., Plowe, C. V., Sims, P. F. G., and Hyde, J. E. (2001).
A bifunctional dihydrofolate synthetase-folylpolyglutamate synthetase in Plasmodium
falciparum identified by functional complementation in yeast and bacteria. Mol. Biochem.
Parasitol. 112, 239252.
Schirch, V., and Strong, W. B. (1989). Interaction of folylpolyglutamates with enzymes in
one-carbon metabolism. Arch. Biochem. Biophys. 269, 371380.
Schlosser, M. (1998). Parametrization of substituents: Effects of fluorine and other heteroa-
toms on OH, NH, and CH acidities. Angew. Chem. Int. Ed. 110, 14961513.
Schneider, E., and Ryan, T. J. (2006). g-Glutamyl hydrolase and drug resistance. Clinica
Chimica Acta 374, 2532.
Shane, B. (1989). Folylpolyglutamate synthesis and role in the regulation of one-carbon
metabolism. Vitam. Horm. 45, 263335.
Stokstad, E. L. R., and Koch, J. (1967). Folic acid metabolism. Physiol. Rev. 47, 83116.
Sun, X., Bognar, A. L., Baker, E. N., and Smith, C. A. (1998). Structural homologies with
ATP- and folate-binding enzymes in the crystal structure of folylpolyglutamate synthe-
tase. Proc. Natl. Acad. Sci. USA 95, 66476652.
Sun, X., Cross, J. A., Bognar, A. L., Baker, E. N., and Smith, C. A. (2001). Folate-binding
triggers the activation of folylpolyglutamate synthetase. J. Mol. Biol. 310, 10671078.
Suzuki, A., Mae, M., Amii, H., and Uneyama, K. (2004). Catalytic route to the synthesis of
optically active b,b-difluoroglutamic acid and b,b-difluoroproline derivatives. J. Org.
Chem. 69, 51325134.
372 James K. Coward and John J. McGuire
Watanabe, K., Toh, Y., Suto, K., Shimizu, Y., Oka, N., Wada, T., and Tomita, K. (2007).
Protein-based peptide bond formation by aminoacyl-tRNA protein transferases. Nature
449, 867.
Wolfenden, R. (1972). Analog approaches to the structure of the transition-state in enzyme
reactions. Acct. Chem. Res. 5, 1018.
Wolfenden, R. (2003). Thermodynamic and extrathermodynamic requirements of enzyme
catalysis. Biophys. Chem. 105, 559572.
Yang, Y., and Coward, J. K. (2007). Synthesis of p-aminophenyl aryl H-phosphinic acids
and esters via cross-coupling reactions: Elaboration to phosphinic acid pseudopeptide
analogs of pteroyl glutamic acid and related antifolates. J. Org. Chem. 72, 57485758.
Yount, R. G. (1975). ATP analogs. Adv. Enzymol. Relat. Areas Mol. Biol. 43, 156.
C H A P T E R T H I R T E E N
Methylenetetrahydrofolate
Reductase, Common Polymorphisms,
and Relation to Disease
Philip Thomas* and Michael Fenech*
Contents
I. Introduction 376
A. Methylenetetrahydrofolate reductase 377
B. MTHFR and disease 381
C. MTHFR and pregnancy outcomes 383
D. MTHFRenvironment interactions 384
E. MTHFRother gene interactions 385
II. Conclusions 386
References 386
Abstract
Folate plays a key role in maintaining genomic stability and providing methyl
groups for the formation of dTMP from dUMP which is required for DNA
synthesis and repair and for the maintenance of methylation patterns involving
cytosine or specific sites such as CpG islands. Under conditions of low folate,
dUMP accumulates producing DNA strand breaks and micronucleus formation
as a result of excessive uracil incorporation into DNA in place of thymine.
Methylenetetrahydrofolate reductase (MTHFR) is an important folate metabo-
lizing enzyme that catalyzes the irreversible conversion of 5,10-methylenetre-
trahydrofolate, which is the methyl donor for the conversion of dUMP to dTMP,
into 5-methyltetrahydrofolate, which is the methyl donor for remethylation of
homocysteine to methionine. Certain common polymorphisms within the
MTHFR gene (C677T, A1298C) result in reduced enzymatic activity and have
been associated with reduced risk for a variety of cancers such as acute
lymphocytic leukemia, lung and colorectal cancer. These common polymorph-
isms are also associated with hyperhomocysteinemia that has been reported to
be an increased risk factor for neural tube defects and cardiovascular disease.
375
376 Philip Thomas and Michael Fenech
In this chapter, we consider the role that MTHFR plays in relation to folate
metabolism and the possible contribution made in relation to certain important
clinical outcomes. 2008 Elsevier Inc.
I. Introduction
Folate (vitamin B9) is an essential B vitamin that is crucial to the
prevention of genomic instability and hypomethylation of DNA (Choi
and Mason, 2000, 2002). Folate is required for the synthesis of deoxythy-
midine monophosphate (dTMP) from deoxyuridine monophosphate
(dUMP), which is essential for DNA synthesis and repair (Fig. 13.1).
Under conditions of folate deficiency, dUMP accumulates resulting in
excessive uracil incorporation into DNA leading to single- and double-
strand DNA breaks, chromosome breakage, and ultimately micronucleus
(MN) formation (Blount and Ames, 1995; Blount et al., 1997; Fenech,
2001). Folate and vitamin B12 are required in the synthesis of methionine
through the remethylation of homocysteine (Hcy) that ultimately leads to
the synthesis of S-adenosylmethionine (SAM). SAM plays an important role
as a methyl donor required for the maintenance of genomic methylation
patterns that determine gene expression, DNA conformation, and is
required for the synthesis of myelin, neurotransmitters, and membrane
phospholipids (Calvaresi and Bryan, 2001; Zingg and Jones, 1997). Folate
deficiency reduces SAM levels resulting in lower DNA cytosine methyla-
tion and elevated levels of Hcy. Additionally, folate deficiency may lead to
demethylation of centromeric DNA repeat sequences and centromere
dysfunction leading to abnormal chromosome distribution during nuclear
Folic acid
Cell proliferation and
protein synthesis
DHF
B12 THF
Methionine Cob (III) B6
MTRR 5,10-methyl
SAM THF
MTR 5,10-methylene
B12
Cob (II) THF
CH3 dUMP
Homocysteine MTHFR dTMP
B12
5-methyl THF (B2)
Cob (I)
DNA B6
methylation DNA synthesis
Cystathione and repair
Dietary folate
Gene expression
Figure 13.1 Metabolism of folic acid. Adapted from Wagner (1995). SAM: S-adenosyl
methionine, MTRR: methionine synthase reductase, MTR, methionine synthase;
THF, tetrahyrdofolate; DHF, dihydrofolate; MTHFR, methylene tetrahydrofolate
reductase; dUMP, deoxyuridine monophosphate; dTMP, deoxythymidine monopho-
sphate; Cob(I), reduced form of vitamin B12; Cob(III), oxidized form of vitamin B12 .
MTHFR, Common Polymorphisms, and Relation to Disease 377
A. Methylenetetrahydrofolate reductase
One of the intriguing aspects of the relationship between folate status
and cancer risk is the potential modifying effect of polymorphisms in key
folate metabolizing enzymes. Methylenetetrahydrofolate reductase (MTHFR)
is a pivitol enzyme within the folate methionine pathway which can influ-
ence both the bioavailability of folate for dTMP synthesis and maintain
methylation patterns at CpG islands known to regulate gene expression.
MTHFR catalyzes the reduction of 5,10-methylenetretrahydrofolate into
5-methyltetrahydrofolate, which is the major circulating form of folate, and
acts as a methyl donor in the remethylation of Hcy to methionine (Crott et al.,
2001; Goyette et al., 1998, 1994; Rozen, 1997; Sibani et al., 2003). The
MTHFR gene was cloned in 1998 and found to be 20.3 kb long, consisting
of 11 exons ranging in size from 102 to 432 bp (Frosst et al., 1995; Goyette
et al., 1998). The major gene product is a catalytically active 77 kDa protein
consisting of 656 amino acids, which has been shown to map to the short
arm of chromosome 1 at 1p36.3 (Goyette et al., 1994).
MTHFR enzymatic activity can be affected in a number of ways. First,
polymorphisms within the gene sequence could alter the affinity of the
enzyme for either substrate or its cofactor flavin adenine dinucleotide (FAD
or vitamin B2). Second, high concentrations of methionine or SAM are
inhibitory to MTHFR activity, and finally, insufficient levels of FAD cofactor
may lead to reduced enzymatic activity (Hustad et al., 2000; Kimura et al.,
2004; Rivlin, 1996). Under conditions of reduced MTHFR activity, 5,10-
methylenetetrahydrofolate concentration increases with a resultant subsequent
lowering of 5-methyltetrahydrofolate concentration. This shift in balance
favors dTTP synthesis over CpG island methylation, a reduction in the
number of chromosome breaks by minimizing uracil incorporation, an
increase in DNA hypomethylation that could favor chromosome loss, and a
resultant increase in the concentration of plasma Hcy (Blount and Ames, 1995;
Blount et al., 1997; Castro et al., 2004; Kimura et al., 2004; Stern et al., 2000).
Many polymorphisms within the MTHFR gene have been reported
within the literature; however, very few have been conclusively studied in
relation to disease and population dynamics. The two most widely studied
of these are the common C677T and A1298C polymorphisms.
enzyme activity, higher plasma Hcy, and lower plasma folate concentrations
(Botto et al., 2003; Friedman et al., 1999; Weisberg et al., 1998b).
The combined association of these two alleles produces a similar biochemi-
cal profile to those individuals who are homozygote for the T allele of
C677T. The population frequency for A1298C homozygosity is not as well
documented as for the C677T allele and is thought to have a prevalence of
about 10% (van der Put et al., 1998; Weisberg et al., 1998a). To date, over
30 other mutations have been identified as being associated with severe
MTHFR deficiency (Sibani et al., 2000, 2003). The relationship between
these rare polymorphisms and population dynamics and disease outcomes
has yet to be fully determined.
Low R Low F
High MNi (Chromosome INCREASED
Loss/Gain) frequency CANCER
increased RISK?
ANEUPLOIDY
Low Low CpG
MTHFR methylation *
activity
G Low MNi (Chromosome breaks)
E Low uracil in DNA
Low NPB (Chromosome
N rearrangement)
O Low NBUDs (Gene REDUCED
T amplification) CANCER
High
Y RISK?
P
Low MNi (Chromosome
E
High CpG loss/gain) frequency
High decreased
methylation *
MTHFR ANEUPLOIDY
activity
High uracil in DNA
High MNi (Chromosome breaks)
High NPB (Chromosome INCREASED
rearrangement) CANCER
High R Low F High NBUDs (Gene RISK?
amplification)
2. Cardiovascular disease
Homozygosity for the C677T allele leads to a relative deficiency in the
remethylation process of Hcy into methionine resulting in mild-to-moder-
ate hyperhomocysteinemia, a condition recognized as an independent risk
factor for atherosclerosis (Clarke et al., 1991; Danesh and Lewington, 1998).
A number of studies have investigated whether an association between
MTHFR polymorphisms and cardiovascular disease exists. A meta-analysis
was performed in 1996 combining all studies where MTHFR genotyping
data was available for patients with coronary heart disease. It was shown that
individuals who were 677T homozygotes had a significant 19% higher risk
for coronary heart disease compared with the other MTHFR genotypes
(Blom, 1998). A more recent meta-analysis of over 72 studies in which
MTHFR genotypes were available in patients that had been diagnosed with
ischemic heart disease, deep vein thrombosis, or pulmonary embolism
showed a significantly higher risk in people with the MTHFR mutation
(Wald et al., 2002). Further meta-analysis investigation involving over 80
studies examining increased risk for coronary disease showed an odds ratio
of 1.14 (95% confidence intervals (CI): 1.051.24) for TT versus CC
genotype (Lewis et al., 2005). Although there is not a strong allelic associa-
tion in most studies, it may be that the resulting elevated Hcy may also
interact with other risk factors that may induce vascular events in those
individuals who have underlying conditions such as thrombophilia that may
predispose to cardiovascular disease (Refsum and Ueland, 1998; Ueland
et al., 2001).
3. Alzheimers disease
Alzheimers disease (AD) is a neurodegenerative disorder that is character-
ized clinically by cognitive decline, memory loss, visuospatial and language
impairment, and is the commonest form of dementia (Burns et al., 2002;
Kawas, 2003; Mattson, 2004; St George-Hyslop, 2000). Regions of the
brain that are involved in short-term memory and learning such as the
temporal and frontal lobes are impaired as a result of neuronal loss and
the breakdown of the neuronal synaptic connections (Mattson et al., 1998).
Many case control studies have shown that Alzheimers patients have
been found to be deficient in certain micronutrients such as folate, vitamin
B12, and have elevated levels of the sulfur-based amino acid Hcy (Aisen
et al., 2003; Shea and Rogers, 2002). These factors are associated with
increased MN formation and the alteration of methylation patterns that
could modify gene expression (Fenech and Crott, 2002; Scarpa et al., 2003;
Suzuki et al., 2002). It has been shown that adequate folate intake improves
global cognitive function (de Lau et al., 2007) and that increased Hcy levels
have a significant effect in the reduction of effective cognitive function
(Kim et al., 2007).
MTHFR, Common Polymorphisms, and Relation to Disease 383
2. Preeclampsia
Hyperhomocysteinemia in conjunction with a TT genotype has been
associated with an increased risk for spontaneous abortion, placental abrup-
tion, and preeclampsia (Ray and Laskin, 1999). It is thought that the
elevated levels of Hcy produce placental endovascular damage as a result
of oxidative stress. It has been shown that 17% of women suffering with
severe preeclampsia were found to have hyperhomocysteinemia compared
with a 2% prevalence found in the general population (Dekker et al., 1995;
Leeda et al., 1998). Recent studies have not been able to associate a clear
relationship between MTHFR polymorphisms and placenta-mediated dis-
eases such as preeclampsia (Els et al., 2000; Laivuori et al., 2000; Thomas
Kaiser and Moses, 2000). However, an increased incidence of the TT allele
has been reported in women who have experienced abruption placentae,
interuterine fetal growth retardation, and still births compared to women
who have had normal pregnancies (Kupferminc et al., 1999). These pregnancy
outcomes are associated with elevated Hcy and emphasizes the importance of
maintaining adequate folate levels periconceptionally, especially in individuals
who possess MTHFR polymorphisms that may contribute to increased risk
for abnormal pregnancies.
D. MTHFRenvironment interactions
A number of studies have examined the interaction between nutritional
status and the C677T polymorphism in relation to clinical outcomes. Two
studies suggest that neural tube risk associated with C677T, TT, homozy-
gosity may be dependent on nutritional status. The first study showed a
13-fold increased risk for spina bifida in C677T, TT, homozygotes with a
red blood cell folate value in the lowest study quartile (Christensen et al.,
1999). The second found that maternal multivitamin use (containing folic
acid) reduced the risk for spina bifida in individuals with wild-type or
heterozygous alleles (OR 0.3) and in those with the homozygous TT
MTHFR, Common Polymorphisms, and Relation to Disease 385
II. Conclusions
The MTHFR C677T polymorphism has been implicated in a number
of clinical diseases. Under conditions of low folate, the MTHFR C677T,
TT genotype is associated with increased risk for NTDs. Conversely when
folate levels are adequate, the TT genotype may reflect a selective advantage
for the reduction in risk for both lung and colorectal cancer. Individuals who
are TT homozygotes or compound heterozygotes for both the A1298C and
C677T alleles may have to pay more attention to adjusting their folate and
riboflavin intake in order to reduce genomic instability and the effect of
potential clinical outcomes associated with hyperhomocysteinemia.
REFERENCES
Aisen, P. S., Egelko, S., Andrews, H., Diaz-Arrastia, R., Weiner, M., DeCarli, C.,
Jagust, W., Miller, J. W., Green, R., Bell, K., and Sano, M. (2003). A pilot study of
vitamins to lower plasma homocysteine levels in Alzheimer disease. Am. J. Geriatr.
Psychiatry 11, 246249.
Andreassi, M. G., Botto, N., Cocci, F., Battaglia, D., Antonioli, E., Masetti, S., Manfredi, S.,
Colombo, M. G., Biagini, A., and Clerico, A. (2003). Methylenetetrahydrofolate reduc-
tase gene C677T polymorphism, homocysteine, vitamin B12, and DNA damage in
coronary artery disease. Hum. Genet. 112, 171177.
Arinami, T., Yamada, N., Yamakawa-Kobayashi, K., Hamaguchi, H., and Toru, M. (1997).
Methylenetetrahydrofolate reductase variant and schizophrenia/depression. Am. J. Med.
Genet. 74, 526528.
Aubard, Y., Darodes, N., and Cantaloube, M. (2000). Hyperhomocysteinemia and preg-
nancyreview of our present understanding and therapeutic implications. Eur. J. Obstet.
Gynecol. Reprod. Biol. 93, 157165.
Beetstra, S., Thomas, P., Salisbury, C., Turner, J., and Fenech, M. (2005). Folic acid
deficiency increases chromosomal instability, chromosome 21 aneuploidy and sensitivity
to radiation-induced micronuclei. Mutat. Res. 578, 317326.
Blom, H. J. (1998). Mutated 510 methylenetetrahydrofolate reductase and moderate
hyperhomocysteinemia. Eur. J. Pediatr. 157, S131S134.
Blount, B. C., and Ames, B. N. (1995). DNA damage in folate deficiency. Baillieres Clin.
Haematol. 8, 461478.
Blount, B. C., Mack, M. M., Wehr, C. M., MacGregor, J. T., Hiatt, R. A., Wang, G.,
Wickramasinghe, S. N., Everson, R. B., and Ames, B. N. (1997). Folate deficiency causes
uracil misincorporation into human DNA and chromosome breakage: Implications for
cancer and neuronal damage. Proc. Natl. Acad. Sci. USA 94, 32903295.
Botto, L. D., and Yanq, Q. (2000). 5,10-Methylenetetrahydrofolate reductase gene variants
and congenital anomalies: AHuGE review. Am. J. Epidemiol. 151, 862877.
Botto, N., Andreassi, M. G., Manfredi, S., Masetti, S., Cocci, F., Colombo, M. G.,
Storti, S., Rizza, A., and Biagini, A. (2003). Genetic polymorphisms in folate and
homocysteine metabolism as risk factors for DNA damage. Eur. J. Hum. Genet. 11,
671678.
MTHFR, Common Polymorphisms, and Relation to Disease 387
Brunelli, T., Bagnoli, S., Giusti, B., Nacmias, B., Pepe, G., Sorbi, S., and Abbate, R. (2001).
The C677T methylenetetrahydrofolate reductase mutation is not associated with Alzhei-
mers disease. Neurosci. Lett. 315, 103105.
Burns, A., Byrne, E. J., and Maurer, K. (2002). Alzheimers disease. Lancet 360, 163165.
Calvaresi, E., and Bryan, J. (2001). B vitamins, cognition, and aging: A review. J. Gerontol. B
Psychol. Sci. Soc. Sci. 56, P327P339.
Castro, R., Rivera, I., Ravasco, P., Camilo, M. E., Jakobs, C., Blom, H. J., and de
Almeida, I. T. (2004). 5,10-methylenetetrahydrofolate reductase (MTHFR) 677C!T
and 1298A!C mutations are associated with DNA hypomethylation. J. Med. Genet. 41,
454458.
Cattaneo, M., Tsai, M. Y., Bucciarelli, P., Taioli, E., Zighetti, M. L., Bignell, M., and
Mannucci, P. M. (1997). A common mutation in the methylenetetrahydrofolate reduc-
tase gene (C677T) increases the risk for deep-vein thrombosis in patients with mutant
factor V (factor V:Q506). Arterioscler. Thromb. Vasc. Biol. 17, 16621666.
Chen, J., Giovannucci, E., Kelsey, K., Rimm, E. B., Stampfer, M. J., Colditz, G. A.,
Spiegelman, D., Willett, W. C., and Hunter, D. J. (1996). A methylenetetrahydrofolate
reductase polymorphism and the risk of colorectal cancer. Cancer Res. 56, 48624864.
Chen, J., Ma, J., Stampfer, M. J., Palomeque, C., Selhub, J., and Hunter, D. J. (2002).
Linkage disequilibrium between the 677C > T and 1298A > C polymorphisms in
human methylenetetrahydrofolate reductase gene and their contributions to risk of
colorectal cancer. Pharmacogenetics 12, 339342.
Choi, S. W., and Mason, J. B. (2000). Folate and carcinogenesis: An integrated scheme.
J. Nutr. 130, 129132.
Choi, S. W., and Mason, J. B. (2002). Folate status: Effects on pathways of colorectal
carcinogenesis. J. Nutr. 132, 2413S2418S.
Christensen, B., Arbour, L., Tran, P., Leclerc, D., Sabbaghian, N., Platt, R., Gilfix, B. M.,
Rosenblatt, D. S., Gravel, R. A., Forbes, P., and Rozen, R. (1999). Genetic polymorph-
isms in methylenetetrahydrofolate reductase and methionine synthase, folate levels in red
blood cells, and risk of neural tube defects. Am. J. Med. Genet. 84, 151157.
Clarke, R., Daly, L., Robinson, K., Naughten, E., Cahalane, S., Fowler, B., and Graham, I.
(1991). Hyperhomocysteinemia: An independent risk factor for vascular disease. N. Engl.
J. Med. 324, 11491155.
Clarke, R., Smith, A. D., Jobst, K. A., Refsum, H., Sutton, L., and Ueland, P. M. (1998).
Folate, vitamin B12, and serum total homocysteine levels in confirmed Alzheimer
disease. Arch. Neurol. 55, 14491455.
Crott, J. W., Mashiyama, S. T., Ames, B. N., and Fenech, M. F. (2001). Methylenetetrahy-
drofolate reductase C677T polymorphism does not alter folic acid deficiency-induced
uracil incorporation into primary human lymphocyte DNA in vitro. Carcinogenesis 22,
10191025.
Danesh, J., and Lewington, S. (1998). Plasma homocysteine and coronary heart disease:
Systematic review of published epidemiological studies. J. Cardiovasc. Risk 5, 229232.
de Lau, L. M. L., Refsum, H., Smith, A. D., Johnston, C., and Breteler, M. M. B. (2007).
Plasma folate concentration and cognitive performance: Rotterdam Scan Study. Am. J.
Clin. Nutr. 86, 728734.
Dekker, G. A., de Vries, J. I., Doelitzsch, P. M., Huijgens, P. C., von Blomberg, B. M.,
Jakobs, C., and van Geijn, H. P. (1995). Underlying disorders associated with severe
early-onset preeclampsia. Am. J. Obstet. Gynecol. 173, 10421048.
den Heijer, T., Vermeer, S. E., and Clarke, R. (2003). Homocysteine and brain atrophy on
MRI of non-demented elderly. Brain 126, 170175.
Duesberg, P., Rasnick, D., Li, R., Winters, L., Rausch, C., and Hehlmann, R. (1999). How
aneuploidy may cause cancer and genetic instability. Anticancer Res. 19, 48874906.
388 Philip Thomas and Michael Fenech
Dwyer, B. E., Raina, A. K., Perry, G., and Smith, M. A. (2004). Homocysteine and
Alzheimers disease: A modifiable risk? Free Radic. Biol. Med. 36, 14711475.
Elkins, J. S., Johnston, S. C., Ziv, E., Kado, D., Cauley, J. A., and Yaffe, K. (2007).
Methylenetetrahydrofolate reductase C677T polymorphism and cognitive function in
older women. Am. J. Epidemiol. 166, 672678.
Els, F.v.d.M., Guus, E. A., Willianne, L. D. M. N., Nathalie, J. M. v. d. P., Sandra, G. H.,
Tom, K. A. B. E., and Henk, J. B. (2000). A common mutation in the 5,10-methyle-
netetrahydrofolate reductase gene as a new risk factor for placental vasculopathy. Am. J.
Obstet. Gynecol. 182, 12581263.
Esteller, M., Garcia, A., Martinez-Palones, J. M., Xercavins, J., and Reventos, J. (1997).
Germ line polymorphisms in cytochrome-P450 1A1 (C4887 CYP1A1) and methylene-
tetrahydrofolate reductase (MTHFR) genes and endometrial cancer susceptibility.
Carcinogenesis 18, 23072311.
Fenech, M. (2001). The role of folic acid and Vitamin B12 in genomic stability of human
cells. Mutat. Res. 475, 5767.
Fenech, M., and Crott, J. W. (2002). Micronuclei, nucleoplasmic bridges and nuclear buds
induced in folic acid deficient human lymphocytes-evidence for breakage-fusion-bridge
cycles in the cytokinesis-block micronucleus assay. Mutat. Res. 504, 131136.
Finnell, R. H., Greer, K. A., Barber, R. C., and Piedrahita, J. A. (1998). Neural tube and
craniofacial defects with special emphasis on folate pathway genes. Crit. Rev. Oral Biol.
Med. 9, 3853.
Friedman, G., Goldschmidt, N., Friedlander, Y., Ben-Yehuda, A., Selhub, J., Babaey, S.,
Mendel, M., Kidron, M., and Bar-On, H. (1999). A common mutation A1298C in
human methylenetetrahydrofolate reductase gene: Association with plasma total homo-
cysteine and folate concentrations. J. Nutr. 129, 16561661.
Friso, S., Choi, S. W., Girelli, D., Mason, J. B., Dolnikowski, G. G., Bagley, P. J.,
Olivieri, O., Jacques, P. F., Rosenberg, I. H., Corrocher, R., and Selhub, J. (2002).
A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects
genomic DNA methylation through an interaction with folate status. Proc. Natl. Acad.
Sci. USA 99, 56065611.
Frosst, P., Blom, H. J., Milos, R., Goyette, P., Sheppard, C. A., Matthews, R. G.,
Boers, G. J., den Heijer, M., Kluijtmans, L. A., van den Heuvel, L. P., and Rozen, R.
(1995). A candidate genetic risk factor for vascular disease: A common mutation in
methylenetetrahydrofolate reductase. Nat. Genet. 10, 111113.
Giovannucci, E., Rimm, E. B., Ascherio, A., Stampfer, M. J., Colditz, G. A., and
Willett, W. C. (1995). Alcohol, low-methionine-low-folate diets, and risk of colon
cancer in men. J. Natl. Cancer Inst. 87, 265273.
Giovannucci, E., Stampfer, M. J., Colditz, G. A., Rimm, E. B., Trichopoulos, D.,
Rosner, B. A., Speizer, F. E., and Willett, W. C. (1993). Folate, methionine, and alcohol
intake and risk of colorectal adenoma. J. Natl. Cancer Inst. 85, 875883.
Goyette, P., Pai, A., Milos, R., Frosst, P., Tran, P., Chen, Z., Chan, M., and Rozen, R.
(1998). Gene structure of human and mouse methylenetetrahydrofolate reductase
(MTHFR). Mamm. Genome 9, 652656.
Goyette, P., Sumner, J. S., Milos, R., Duncan, A. M., Rosenblatt, D. S., Matthews, R. G.,
and Rozen, R. (1994). Human methylenetetrahydrofolate reductase: Isolation of cDNA,
mapping and mutation identification. Nat. Genet. 7, 195200.
Gregorio Lorenzo Acacio, R. B., Bertuzzo, C. S., Couto, E. C., Annichino-
Bizzacchi, J. M., and Pinto, W., Jr. (2005). Methylenetetrahydrofolate reductase gene
polymorphisms and their association with trisomy 21. Prenat. Diagn. 25, 11961199.
Hustad, S., Ueland, P. M., Vollset, S. E., Zhang, Y., Bjorke-Monsen, A. L., and Schneede, J.
(2000). Riboflavin as a determinant of plasma total homocysteine: Effect modification by
MTHFR, Common Polymorphisms, and Relation to Disease 389
Lievers, K. J., Boers, G. H., Verhoef, P., den Heijer, M., Kluijtmans, L. A., van der
Put, N. M., Trijbels, F. J., and Blom, H. J. (2001). A second common variant in the
methylenetetrahydrofolate reductase (MTHFR) gene and its relationship to MTHFR
enzyme activity, homocysteine, and cardiovascular disease risk. J. Mol. Med. 79,
522528.
Lucock, M., Yates, Z., Glanville, T., Leeming, R., Simpson, N., and Daskalakis, I. (2003).
A critical role for B-vitamin nutrition in human developmental and evolutionary
biology. Nutr. Res. 23, 14631475.
Ma, J., Stampfer, M. J., Giovannucci, E., Artigas, C., Hunter, D. J., Fuchs, C.,
Willett, W. C., Selhub, J., Hennekens, C. H., and Rozen, R. (1997). Methylenetetra-
hydrofolate reductase polymorphism, dietary interactions, and risk of colorectal cancer.
Cancer Res. 57, 10981102.
Mattson, M. P. (2004). Pathways towards and away from Alzheimers disease. Nature 430,
631639.
Mattson, M. P., Keller, J. N., and Begley, J. G. (1998). Evidence for synaptic apoptosis. Exp.
Neurol. 153, 3548.
McCaddon, A., Davies, G., Hudson, P., Tandy, S., and Cattell, H. (1998). Total serum
homocysteine in senile dementia of Alzheimer type. Int. J. Geriatr. Psychiatry 13,
235239.
Morita, H., Kurihara, H., Tsubaki, S., Sugiyama, T., Hamada, C., Kurihara, Y., Shindo, T.,
Oh-hashi, Y., Kitamura, K., and Yazaki, Y. (1998). Methylenetetrahydrofolate reductase
gene polymorphism and ischemic stroke in Japanese. Arterioscler Thromb. Vasc. Biol. 18,
14651469.
Morris, M. S. (2003). Homocysteine and Alzheimers disease. Lancet Neurol. 2, 425428.
Morrison, K., Papapetrou, C., Hol, F. A., Mariman, E. C., Lynch, S. A., Burn, J., and
Edwards, Y. H. (1998). Susceptibility to spina bifida: An association study of five
candidate genes. Ann. Hum. Genet. 62, 379396.
Munoz-Moran, E., Dieguez-Lucena, J. L., Fernandez-Arcas, N., Peran-Mesa, S., and
Reyes-Engel, A. (1998). Genetic selection and folate intake during pregnancy. Lancet
352, 11201121.
Ramsbottom, D., Scott, J. M., Molloy, A., Weir, D. G., Kirke, P. N., Mills, J. L.,
Gallagher, P. M., and Whitehead, A. S. (1997). Are common mutations of cystathionine
beta-synthase involved in the aetiology of neural tube defects? Clin. Genet. 51, 3942.
Rasnick, D., and Duesberg, P. H. (1999). How aneuploidy affects metabolic control and
causes cancer. Biochem. J. 340(Pt 3), 621630.
Ray, J. G., and Laskin, C. A. (1999). Folic acid and homocyst(e)ine metabolic defects and the
risk of placental abruption, pre-eclampsia and spontaneous pregnancy loss: A systematic
review. Placenta 20, 519529.
Refsum, H., and Ueland, P. M. (1998). Recent data are not in conflict with homocysteine as
a cardiovascular risk factor. Curr. Opin. Lipidol. 9, 533539.
Rivlin, R. S. (1996). In Present Knowledge in Nutrition 7th. ed., pp. 206219.
Rozen, R. (1997). Genetic predisposition to hyperhomocysteinemia: Deficiency of methy-
lenetetrahydrofolate reductase (MTHFR). Thromb. Haemost. 78, 523526.
Scarpa, S., Fuso, A., DAnselmi, F., and Cavallaro, R. A. (2003). Presenilin 1 gene silencing
by S-adenosylmethionine: A treatment for Alzheimer disease? FEBS Lett. 541, 145148.
Schneider, J. A., Rees, D. C., Liu, Y. T., and Clegg, J. B. (1998). Worldwide distribution of
a common methylenetetrahydrofolate reductase mutation. Am. J. Hum. Genet. 62,
12581260.
Sellers, T. A., Kushi, L. H., Cerhan, J. R., Vierkant, R. A., Gapstur, S. M., Vachon, C. M.,
Olson, J. E., Therneau, T. M., and Folsom, A. R. (2001). Dietary folate intake, alcohol,
and risk of breast cancer in a prospective study of postmenopausal women. Epidemiology
12, 420428.
MTHFR, Common Polymorphisms, and Relation to Disease 391
Seshadri, S., Beiser, A., Selhub, J., Jacques, P. F., Rosenberg, I. H., DAgostino, R. B.,
Wilson, P. W., and Wolf, P. A. (2002). Plasma homocysteine as a risk factor for dementia
and Alzheimers disease. N. Engl. J. Med. 346, 476483.
Shaw, G. M., Rozen, R., Finnell, R. H., Wasserman, C. R., and Lammer, E. J. (1998).
Maternal vitamin use, genetic variation of infant methylenetetrahydrofolate reducatase,
and risk for spina bifida. Am. J. Epidemiol. 148, 3037.
Shea, T. B., and Rogers, E. (2002). Homocysteine and dementia. N. Engl. J. Med. 346,
2007; author reply 2008..
Sibani, S., Christensen, B., OFerrall, E., Saadi, I., Hiou-Tim, F., Rosenblatt, D. S., and
Rozen, R. (2000). Characterization of six novel mutations in the methylenetetrahydro-
folate reductase (MTHFR) gene in patients with homocystinuria. Hum. Mutat. 15,
280287.
Sibani, S., Leclerc, D., Weisberg, I. S., OFerrall, E., Watkins, D., Artigas, C.,
Rosenblatt, D. S., and Rozen, R. (2003). Characterization of mutations in severe
methylenetetrahydrofolate reductase deficiency reveals an FAD-responsive mutation.
Hum. Mutat. 21, 509520.
Skibola, C. F., Smith, M. T., Kane, E., Roman, E., Rollinson, S., Cartwright, R. A., and
Morgan, G. (1999). Polymorphisms in the methylenetetrahydrofolate reductase gene are
associated with susceptibility to acute leukemia in adults. Proc. Natl. Acad. Sci. 96,
1281012815.
St George-Hyslop, P. H. (2000). Piecing together Alzheimers. Sci. Am. 283, 7683.
Steegers-Theunissen, R. P., Boers, G. H., Trijbels, F. J., Finkelstein, J. D., Blom, H. J.,
Thomas, C. M., Borm, G. F., Wouters, M. G., and Eskes, T. K. (1994). Maternal
hyperhomocysteinemia: A risk factor for neural-tube defects? Metabolism 43, 14751480.
Steegers-Theunissen, R. P., Boers, G. H., Blom, H. J., Nijhuis, J. G., Thomas, C. M.,
Borm, G. F., and Eskes, T. K. (1995). Neural tube defects and elevated homocysteine
levels in amniotic fluid. Am. J. Obstet. Gynecol. 172, 14361441.
Stern, L. L., Mason, J. B., Selhub, J., and Choi, S. W. (2000). Genomic DNA hypomethyla-
tion, a characteristic of most cancers, is present in peripheral leukocytes of individuals
who are homozygous for the C677T polymorphism in the methylenetetrahydrofolate
reductase gene. Cancer Epidemiol. Biomarkers Prev. 9, 849853.
Suzuki, T., Fujii, M., and Ayusawa, D. (2002). Demethylation of classical satellite 2 and 3
DNA with chromosomal instability in senescent human fibroblasts. Exp. Gerontol. 37,
10051014.
Thomas Kaiser, S. P. B., and Moses, E. K. (2000). Methylenetetrahydrofolate reductase
polymorphisms are not a risk factor for pre-eclampsia/eclampsia in Australian women.
Gynecol. Obstet. Invest. 50, 100102.
Trembath, D., Sherbondy, A. L., Vandyke, D. C., Shaw, G. M., Todoroff, K.,
Lammer, E. J., Finnell, R. H., Marker, S., Lerner, G., and Murray, J. C. (1999). Analysis
of select folate pathway genes, PAX3, and human T in a midwestern neural tube defect
population. Teratology 59, 331341.
Ueland, P. M., Hustad, S., Schneede, J., Refsum, H., and Vollset, S. E. (2001). Biological
and clinical implications of the MTHFR C677T polymorphism. Trends Pharmacol. Sci.
22, 195201.
van der Put, N. M., Gabreels, F., Stevens, E. M., Smeitink, J. A., Trijbels, F. J., Eskes, T. K.,
van den Heuvel, L. P., and Blom, H. J. (1998). A second common mutation in the
methylenetetrahydrofolate reductase gene: An additional risk factor for neural-tube
defects? Am. J. Hum. Genet. 62, 10441051.
Viel, A., DallAgnese, L., Simone, F., Canzonieri, V., Capozzi, E., Visentin, M. C.,
Valle, R., and Boiocchi, M. (1997). Loss of heterozygosity at the 5,10-methylenetetra-
hydrofolate reductase locus in human ovarian carcinomas. Br. J. Cancer 75, 11051110.
392 Philip Thomas and Michael Fenech
Mitochondrial
Methylenetetrahydrofolate
Dehydrogenase,
Methenyltetrahydrofolate
Cyclohydrolase, and
Formyltetrahydrofolate Synthetases
Karen E. Christensen* and Robert E. MacKenzie
Contents
I. Introduction 394
II. Yeast Mitochondria Contain a Trifunctional
DehydrogenaseCyclohydrolaseSynthetase 395
III. Mammalian Mitochondrial
Methylenetetrahydrofolate Dehydrogenase 395
A. Discovery and characterization of NAD-dependent
methylenetetrahydrofolate dehydrogenasecyclohydrolase
(MTHFD2) 395
B. Differences between the NAD- and NADP-dependent
dehydrogenasecyclohydrolases 396
C. Distribution and expression of methylenetetrahydrofolate
dehydrogenasecyclohydrolases 401
IV. Mitochondrial Formyltetrahydrofolate Synthetase 403
A. Discovery 403
B. Characterization of the monofunctional synthetase 404
C. Expression and distribution 404
V. Conclusion 405
A. Metabolic compartmentation of the folate enzymes 405
B. Functions of mitochondria in folate-mediated metabolism 406
C. Mathematical models 407
References 408
* Montreal Childrens Hospital Research Institute, Montreal, QC, Canada H3Z 2Z3
{
Department of Biochemistry, McGill University, Montreal, QC, Canada H3G 1Y6
393
394 Karen E. Christensen and Robert E. MacKenzie
Abstract
Folate-mediated metabolism involves enzyme-catalyzed reactions that occur in
the cytoplasmic, mitochondrial, and nuclear compartments in mammalian cells.
Which of the folate-dependent enzymes are expressed in these compartments
depends on the stage of development, cell type, cell cycle, and whether or not
the cell is transformed. Mitochondria become formate-generating organelles in
cells and tissues expressing the MTHFD2 and MTHFD1L genes. The products of
these nuclear genes were derived from trifunctional precursor proteins, expres-
sing methylenetetrahydrofolate dehydrogenasemethenyltetrahydrofolate
cyclohydrolase, and formyltetrahydrofolate synthetase activities. The MTHFD2
protein is a bifunctional protein with dehydrogenase and cyclohydrolase activ-
ities that arose from a trifunctional precursor through the loss of the synthetase
domain and a novel adaptation to NAD rather than NADP specificity for the
dehydrogenase. The MTHFD1L protein retains the size of its trifunctional precur-
sor, but through the mutation of critical residues, both the dehydrogenase and
cyclohydrolase activities have been silenced. MTHFD1L is thus a monofunctional
formyltetrahydrofolate synthetase. This review discusses the properties and
functions of these mitochondrial proteins and their role in supporting cytosolic
purine synthesis during embryonic development and in cells undergoing rapid
growth. 2008 Elsevier Inc.
I. Introduction
Folate-mediated metabolism is a complex series of pathways that
involve several amino acids, the synthesis of purines and thymidylate, the
support of cellular methylation reactions via recycling of homocysteine to
methionine, and the synthesis of S-adenosylmethionine. Serine, glycine,
and formate are the main sources of the one-carbon folates used in these
biosynthetic pathways. Folate-dependent enzymes are found in different
subcellular compartments, often with the same activity appearing in more
than one compartment. In this regard, there are significant differences seen
between species (Christensen and MacKenzie, 2006). The object of this
review is to concentrate on the enzyme activities found in mammalian
mitochondria, and to discuss possible advantages of this compartmentation.
The cytoplasm and mitochondria of mammalian cells contain isoforms of
serine hydroxymethyl transferase (SHMT1 and SHMT2, respectively) that
generate glycine and methylenetetrahydrofolate from serine, in a reversible
reaction. In essence, it is the fate of this methylenetetrahydrofolate that is the
key to understanding the contribution of the mitochondria to overall folate-
mediated metabolism. The genetics and biochemical characterization of
these enzymes in yeast mitochondria provide an informative introduction
to the situation in mammals.
DehydrogenaseCyclohydrolaseSynthetase 395
does not. This clearly showed that the dehydrogenase and cyclohydrolase
catalyzed reactions cannot be considered as a single complex reaction. It also
demonstrated that the rate of the overall reverse reaction of formyl- to
methylene conversion is the same as that for the first step, catalyzed by the
cyclohydrolase. This showed that the channeling of the intermediate methe-
nyltetrahydrofolate in the reverse direction is 100% efficient. Moreover, it
was found that the presence of 20 ,50 -ADP, an analog of NADP, stimulated the
reverse cyclohydrolase activity of the human MTHFD1 DC domain by more
than twofold. The cyclohydrolase activity of MTHFD2 could not be stimu-
lated by 20 ,50 -ADP or by 50 -ADP. This suggests that the NADP-dependent
DC domains are optimized to catalyze the reverse direction by efficiently
retaining the labile methenyl intermediate and converting it to methylenete-
trahydrofolate. In contrast, the properties of the NAD-dependent DC suggest
that it is not optimized for catalysis of the reverse reaction.
The X-ray structure of the NADP-dependent DC domain of MTHFD1
(Allaire et al., 1998) as well as structures with bound inhibitors (Schmidt
et al., 2000 and Fig. 14.1) set the stage for site-directed mutagenesis
Figure 14.2 The ion-binding site of MTHFD2. Arg166 (assisted by Asp190) and
Arg198 bind the inorganic phosphate. Asp133, inorganic phosphate, and NAD form
the binding site for the magnesium ion. This binding site positions the phosphate and
magnesium ions so that they form ionic and hydrogen bonds with NAD, facilitating
cofactor binding. Figure generated using PyMol version 0.96 (DeLano, 2004). Adapted
from Christensen et al. (2005a, Fig. 4, p. 34321).
C C
ADP + Pi ADP + Pi
S S
THF ATP THF ATP
Formate Formate
Cytoplasm Mitochondria
Figure 14.4 The cytoplasmic and mitochondrial folate pathways of embryonic and
transformed cells. In the cytoplasm, the methylenetetrahydrofolate dehydrogenase (D),
methenyltetrahydrofolate cyclohydrolase (C), and formyltetrahydrofolate synthetase
(S) activities are found in the trifunctional protein MTHFD1. In the mitochondria of
embryonic and transformed cells, the dehydrogenase and cyclohydrolase activities are
found in MTHFD2 whereas the synthetase activity is found in MTHFD1L. From
Christensen et al. (2005b, Fig. 8, p. 7601).
402 Karen E. Christensen and Robert E. MacKenzie
methylenetetrahydrofolate NADP
, formyltetrahydrofolate NADPH
not clear from these studies how the formyltetrahydrofolate yielded formate
for use in the cytoplasm.
V. Conclusion
A. Metabolic compartmentation of the folate enzymes
In yeast, the presence of cytoplasmic and mitochondrial isoforms of a
trifunctional dehydrogenasecyclohydrolasesynthetase support a model
wherein the mitochondria can produce formate which can be used by the
cytoplasmic enzymes for the synthesis of purines and for methylation reac-
tions. However, it is not yet clear what advantage the compartmentation of
folate metabolism provides for yeast, since deletion of the MIS1 gene has
little effect. Perhaps the mitochondrial pathway provides a useful redun-
dancy or plays a role under specific growth conditions.
In mammals, it is clear that the duplication of isoforms of the same
folate-dependent enzyme activity in both the cytoplasm and mitochondria
does support different metabolic functions. For example, the fact that
Chinese hamster ovary cells lacking mitochondrial serine hydroxymethyl-
transferase are glycine auxotrophs despite the presence of a cytosolic isoform
of the same enzyme, clearly illustrated a specific metabolic role for mito-
chondria (Chasin et al., 1974; Stover et al., 1997). The utilization of
methylenetetrahydrofolate and its interconversion with formyltetrahydro-
folate within the mitochondria enable specific roles in cellular one-carbon
metabolism. Of critical importance is the nature and distribution of the
dehydrogenase, cyclohydrolase, and synthetase activities. MTHFD2
evolved from a trifunctional dehydrogenasecyclohydrolasesynthetase
precursor with the loss of the synthetase domain (Patel et al., 2002).
Moreover, a trifunctional dehydrogenasecyclohydrolasesynthetase pre-
cursor gave rise to a monofunctional synthetase (MTHFD1L) by mutagen-
esis of critical amino acid residues essential for dehydrogenase and
cyclohydrolase activities. While all three activities are present in at least
406 Karen E. Christensen and Robert E. MacKenzie
C. Mathematical models
Folate-mediated metabolism is a complex, nonlinear pathway, with several
sources of one-carbon units, and potential competition for these units
between methylation pathways and formyl transfer reactions. It is comfort-
able to draw these folate pathways in general diagrams (such as Fig. 14.4) but
it is becoming clearer all the time that we must be more specific with respect
to which cell, tissue, or organism or stage of development is being studied.
In recent years, the pathways have been addressed by mathematical
modeling that helps to provide insight into function, and to test hypotheses.
Reed et al. (2006) built a mathematical model for folate metabolism where
predictions matched experimental data. The model, for example, predicts
that the inverse relationship between folate and homocysteine is strongest at
very low folate concentrations, and that the DNA methylation rate is
relatively insensitive to changes in folate pool size. The model was also
used to address the conditions of vitamin B12 deficiency and polymorphisms
in methylenetetrahydrofolate reductase and the effects on purine and thy-
midine synthesis. More recently, the model has been refined to address the
compartmentalization of folate-mediated metabolism (Nijhout et al., 2006).
It predicts the critical role of MTHFD2 that enables mitochondria to
produce formate to support purine synthesis in transformed cells and
embryonic tissues, while in adult hepatic cells the mitochondria produce
serine from glycine that can be used for gluconeogenesis. The development
of models like this one will assist in the understanding of folate metabolism
when comparing different types of cells and tissues, and help predict the
effects of genetic or chemical alterations of these pathways. They hold
promise as useful tools in predicting the effects of inhibitors of various
targets in the pathway, specific for cell type, including tumor cells.
408 Karen E. Christensen and Robert E. MacKenzie
REFERENCES
Allaire, M., Li, Y., MacKenzie, R. E., and Cygler, M. (1998). The 3-D structure of a folate-
dependent dehydrogenase/cyclohydrolase bifunctional enzyme at 1.5 A resolution.
Structure 6, 173182.
Appling, D. R. (1991). Compartmentation of folate-mediated one-carbon metabolism in
eukaryotes. FASEB J. 5, 26452651.
Barlowe, C. K., and Appling, D. R. (1988). In vitro evidence for the involvement of
mitochondrial folate metabolism in the supply of cytoplasmic one-carbon units. Biofactors
1, 171176.
Belanger, C., and MacKenzie, R. E. (1989). Isolation and characterization of cDNA clones
encoding the murine NAD-dependent methylenetetrahydrofolate dehydrogenase-
methenyltetrahydrofolate cyclohydrolase. J. Biol. Chem. 264, 48374843.
Chasin, L. A., Feldman, A., Konstam, M., and Urlaub, G. (1974). Reversion of a Chinese
hamster cell auxotrophic mutant. Proc. Natl. Acad. Sci. USA 71, 718722.
Christensen, K. E., and MacKenzie, R. E. (2006). Mitochondrial one-carbon metabolism is
adapted to the specific needs of yeast, plants and animals. BioEssays 28, 595605.
Christensen, K. E., Mirza, I. A., Berghuis, A. M., and MacKenzie, R. E. (2005a). Magnesium
and phosphate ions enable NAD binding to methylenetetrahydrofolate dehydrogenase-
methenyltetrahydrofolate cyclohydrolase. J. Biol. Chem. 280, 3431634323.
Christensen, K. E., Patel, H., Kuzmanov, U., Mejia, N. R., and MacKenzie, R. E. (2005b).
Disruption of the Mthfd1 gene reveals a monofunctional 10-formyltetrahydrofolate
synthetase in mammalian mitochondria. J. Biol. Chem. 280, 75977602.
Cohen, L., and MacKenzie, R. E. (1978). Methylenetetrahydrofolate dehydrogenase-
methenyltetrahydrofolate cyclohydrolase-formyltetrahydrofolate synthetase from porcine
liver. Interaction between the dehydrogenase and cyclohydrolase activities of the
multifunctional enzyme. Biochim. Biophys. Acta 522, 311317.
DeLano, W. L. (2004). The PyMOL Molecular Graphics System. DeLano Scientific
LLC, San Carlos, CA, USA. http://www.pymol.org.
Di Pietro, E., Sirois, J., Tremblay, M. L., and MacKenzie, R. E. (2002). Mitochondrial
NAD-dependent methylenetetrahydrofolate dehydrogenase-methenyltetrahydrofolate
cyclohydrolase is essential for embryonic development. Mol. Cell. Biol. 22, 41584166.
Di Pietro, E., Wang, X. L., and MacKenzie, R. E. (2004). The expression of mitochondrial
methylenetetrahydrofolate dehydrogenase-cyclohydrolase supports a role in rapid cell
growth. Biochim. Biophys. Acta 1674, 7884.
Hum, D. W., and MacKenzie, R. E. (1991). Expression of the active domains of the human
folate-dependent trifunctional enzyme in E. coli. Protein Eng. 4, 493500.
Jones, E. W. (1977). Bipartite structure of the ade3 locus of Saccharomyces cerevisiae. Genetics
85, 209223.
MacKenzie, R. E. (1984). Interconversion of substituted tetrahydrofolates. In Folates and
Pterins: Chemistry and Biochemistry of Folates (R. Blakely and S. Benkovic, eds.), Vol. 1,
pp. 255306. John Wiley and Sons, New York.
Mejia, N. R., and MacKenzie, R. E. (1985). NAD-dependent methylenetetrahydrofolate
dehydrogenase is expressed by immortal cells. J. Biol. Chem. 260, 1461614620.
Mejia, N. R., and MacKenzie, R. E. (1988). NAD-dependent methylenetetrahydrofolate
dehydrogenase-methenyltetrahydrofolate cyclohydrolase in transformed cells is a mito-
chondrial enzyme. Biochem. Biophys. Res. Commun. 155, 16.
Mejia, N. R., Rios-Orlandi, E. M., and MacKenzie, R. E. (1986). NAD-dependent
methylenetetrahydrofolate dehydrogenase-methenyltetrahydrofolate cyclohydrolase
from ascites tumor cells. Purification and properties. J. Biol. Chem. 261, 95099513.
DehydrogenaseCyclohydrolaseSynthetase 409
Nijhout, H. F., Reed, M. C., Lam, S. L., Shane, B., Gregory, J. F., III, and Ulrich, C. M.
(2006). In silico experimentation with a model of hepatic mitochondrial folate metabo-
lism. Theor. Biol. Med. Model. 3, 40; doi: 10.1186/1742-4682-3-40.
Patel, H., Christensen, K. E., Mejia, N., and MacKenzie, R. E. (2002). Mammalian
mitochondrial methylenetetrahydrofolate dehydrogenase-cyclohydrolase derived from
a trifunctional methylenetetrahydrofolate dehydrogenase-cyclohydrolase-synthetase.
Arch. Biochem. Biophys. 403, 145148.
Patel, H., Di Pietro, E., and MacKenzie, R. E. (2003). Mammalian fibroblasts lacking mito-
chondrial NAD-dependent methylenetetrahydrofolate dehydrogenase-cyclohydrolase are
glycine auxotrophs. J. Biol. Chem. 278, 1943619441.
Paukert, J. L., DAri-Straus, L., and Rabinowitz, J. C. (1976). Formyl-methenyl-methyle-
netetrahydrofolate synthetase-(combined). An ovine protein with multiple catalytic
activities. J. Biol. Chem. 251, 51045111.
Paukert, J. L., Williams, G. R., and Rabinowitz, J. C. (1977). Formyl-methenyl-methyle-
netetrahydrofolate synthetase (combined): Correlation of enzymic activities with limited
proteolytic degradation of the protein from yeast. Biochem. Biophys. Res. Commun. 77,
147154.
Pawelek, P. D., and MacKenzie, R. E. (1998). Methenyltetrahydrofolate cyclohydrolase is
rate-limiting for the enzymatic conversion of 10-formyltetrahydrofolate to 5,10-methy-
lenetetrahydrofolate in bifunctional dehydrogenase-cyclohydrolase enzymes. Biochemistry
37, 11091115.
Pawelek, P. D., Allaire, M., Cygler, M., and MacKenzie, R. E. (2000). Channeling
efficiency in the bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase
domain: The effects of site-directed mutagenesis of NADP binding residues. Biochim.
Biophys. Acta 1479, 5968.
Pelletier, J. N., and MacKenzie, R. E. (1995). Binding and interconversion of tetrahydro-
folates at a single site in the bifunctional methylenetetrahydrofolate dehydrogenase-
cyclohydrolase. Biochemistry 34, 1267312680.
Peri, K. G., and MacKenzie, R. E. (1991). Transcriptional regulation of murine NADP
dependent methylenetetrahydrofolate dehydrogenase-cyclohydrolase-synthetase. FEBS
Lett. 294, 113115.
Peri, K. G., and MacKenzie, R. E. (1993). NAD-dependent methylenetetrahydrofolate
dehydrogenase-cyclohydrolase: Detection of the mRNA in normal murine tissues and
transcriptional regulation of the gene in cell lines. Biochim. Biophys. Acta 1171, 281287.
Prasannan, P., Pike, S., Peng, K., Shane, B., and Appling, D. R. (2003). Human mitochon-
drial C1-tetrahydrofolate synthase: Gene structure, tissue distribution of the mRNA, and
immunolocalization in Chinese hamster ovary cells. J. Biol. Chem. 278, 4317843187.
Reed, M. C., Nijhout, H. F., Neuhouser, M. L., Gregory, J. F., III, Shane, B., James, S. J.,
Boynton, A., and Ulrich, C. M. (2006). A mathematical model gives insights into
nutritional and genetic aspects of folate-mediated one-carbon metabolism. J. Nutr. 136,
26532662.
Rios-Orlandi, E. M., and MacKenzie, R. E. (1988). The activities of the NAD-dependent
methylenetetrahydrofolate dehydrogenase-cyclohydrolase from ascites tumor cells are
kinetically independent. J. Biol. Chem. 263, 46624667.
Schmidt, A., Wu, H., MacKenzie, R. E., Chen, V. J., Bewly, J. R., Ray, J. E., Toth, J. E.,
and Cygler, M. (2000). Structures of three inhibitor complexes provide insight into the
reaction mechanism of the human methylenetetrahydrofolate dehydrogenase/cyclohy-
drolase. Biochemistry 39, 63256335.
Scrimgeour, K. G., and Huennekens, F. M. (1960). Occurrence of a DPN-linked N5, N10-
methylenetetrahydrofolate dehydrogenase in Ehrlich ascites tumor cells. Biochem.
Biophys. Res. Commun. 2, 230233.
410 Karen E. Christensen and Robert E. MacKenzie
Contents
I. Introduction 412
II. Structural and Mechanistic Studies on EcoHPPK 413
A. Identification of the HPPK fold and substrate binding 413
B. Mechanism of catalysis 419
C. Inhibitors 420
III. Structures of HPPKs from Other Organisms 421
IV. Kinetics 424
V. Relationship of HPPK to Other Pyrophosphoryl Transfer Enzymes 426
VI. Concluding Remarks 429
References 430
Abstract
6-Hydroxymethyl-7,8-dihydropterin pyrophosphokinase (HPPK) catalyses the
transfer of pyrophosphate from ATP to 6-hydroxymethyl-7,8-dihydropterin (HMDP),
and is an essential enzyme in the biosynthesis of folic acid. It is also a potential
target for antimicrobial drugs. HPPK from Escherichia coli, which has been the
most intensively investigated, is a monomeric protein with a molecular mass of
about 18,000. Structures of the enzyme, determined by X-ray crystallography
and NMR, have shown that it adopts an a/b fold with a substrate-binding cleft on
the surface. Three loop regions surround the enzyme active site and form
intimate contacts with the substrates. The enzyme has a fixed order of substrate
binding, with ATP binding first, followed by HMDP. Binding of ATP causes a shift
in the conformations of the loop regions, which completes formation of the
HMDP-binding site. Two magnesium ions bind within the active site, bridging
between the phosphate groups in ATP and the enzyme. Both ions appear to play
an integral role in ATP recognition and stabilization of the transition state of the
reaction. Ligand binding and kinetic studies have shown that the overall rate of
411
412 Jeremy P. Derrick
the reaction is not limited by the rate of substrate transformation into products
on the enzyme, which is relatively fast, but is more likely caused by a slow step
associated with product release. These fundamental studies open up the potential
for exploitation through the design of specific HPPK inhibitors. 2008 Elsevier Inc.
I. Introduction
6-Hydroxymethyl-7,8-dihydropterin pyrophosphokinase (HPPK; EC
2.7.6.3) catalyses an essential step in the biosynthesis of folic acid. The
enzyme was first identified in 1969 (Richey and Brown, 1969) but it is in
the last 8 years that most of our current knowledge of its structure and
mechanism has been acquired. Folic acid is a dietary requirement for man,
but bacteria, plants, and parasites have the ability to synthesize folic acid
de novo. As a result, HPPK, along with several of the enzymes from the folate
pathway, are not found in man, rendering them attractive potential targets
for the development of antimicrobial agents. Indeed, the enzyme in the
folate pathway after HPPK, dihydropteroate synthase (DHPS), has been
known for many years to be the target for sulfonamide drugs (Bermingham
and Derrick, 2002). The possibility that knowledge of the structure and
mechanism of HPPK could be deployed to direct the development of novel
antimicrobials is a strong justification for research into the enzyme.
The section of the folic acid biosynthesis pathway to which HPPK
belongs is shown in Fig. 15.1. Although it is not shown in Fig. 15.1, the
pathway begins with formation of the pterin ring from GTP, via a complex
O OH O
N CH2OH DHNA N CH2OH
HN HN
H2N N N HO H2N N N
H H 6-hydroxymethyl- (HMDP)
7,8-dihydroneopterin Glycoladehyde 7,8-dihydropterin
ATP
HPPK
AMP
O
N CH2O P P
HN
6-hydroxymethyl-
H2N N N 7,8-dihydropterin
H pyrophoshate
DHPS (DHPPP)
NH2 CO2
O
N CH2NH CO2 P P pABA
HN
H2N N N
H 7,8-dihydropteroate
Figure 15.1 Three steps from the folic acid biosynthesis pathway.
Structure and Mechanism of HPPK 413
Figure 15.2 Structures of E. coli HPPK (EcoHPPK) alone and in complex with sub-
strates and substrate analogs (A) ribbon diagram to illustrate the fold of a
6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase (HPPK) monomer, with heli-
ces in red and b-strands in yellow (from PDB 1Q0N). The locations of the three loop
regions (L1, L2, L3) are indicated. (B) Surface filling model of the apoenzyme (PDB
code 1HKA) with stick models of a,b-methyleneadenosine triphosphate (AMPCPP) and
6-hydroxymethyl-7,8-dihydropterin (HMDP) superimposed from the structure of the
tertiary complex (PDB code 1Q0N). Note that the binding sites for the adenine and
ribose moieties in AMPCPP are well formed in the apoenzyme. (C) Surface filling model
of the protein component from the EcoHPPKAMPCPPHMDP ternary complex with
stick models of AMPCPP and HMDP superimposed (PDB code 1Q0N). Note that the
HMDP is almost completely buried in the ternary complex. (D) Structural alignment of
the apoenzyme in red (PDB code 1HKA) with the ternary complex in green (PDB code
1Q0N), with stick models of AMPCPP and HMDP superimposed. The largest structural
changes occur within loops L2 and L3, as indicated.
ATP and help to form the binding site for HMDP (Fig. 15.2D). Blaszczyk
et al. (2000) have noted the roles of two highly conserved residues, N10 and
Q50, in promoting a hydrogen bonding network, which has a role in
stabilizing the conformations of loops L1, L2, and L3.
Table 15.1 Summary of selected HPPK structures determined by X-ray crystallography or NMR
PDB Resolution
Organism code Method (A) Ligands References
Escherichia coli 1HKA XRD 1.50 None Xiao et al., 1999
Escherichia coli 2F65 NMR AMPCPP Li et al., 2006
Escherichia coli 2F63 NMR AMPCPP and Li et al., 2006
6-hydroxymethyl-7,7-
dimethylpterin
Escherichia coli 1EQM XRD 1.50 ADP Xiao et al., 2001
Escherichia coli 1RB0 XRD 1.35 DHPPP Blaszczyk et al., 2004b
Escherichia coli 1Q0N XRD 1.25 AMPCPP and HMDP Blaszczyk et al., 2000
Escherichia coli 1RAO XRD 1.56 AMP and DHPPP Blaszczyk et al., 2004b
Escherichia coli 1DY3 XRD 2.0 ATP and 6-hydroxymethyl-7- Stammers et al., 1999
methyl-7-phenethyl-7,8-
dihydropterin
Escherichia coli 1EX8 XRD 1.85 6-(Adenosine tetraphosphate- Shi et al., 2001
methyl)-7,8-dihydropterin
Haemophilus 1CBK XRD 2.1 6-Hydroxymethyl-7,7- Hennig et al., 1999
influenzae dimethyl-7,8-dihydropterin
Saccharomyces 2BMB XRD 2.3 6-Hydroxymethylpterin Lawrence et al., 2005
cerevisiae monophosphate
Streptococcus 2CG8 XRD 2.9 None Garcon et al., 2006
pneumoniae
Structure and Mechanism of HPPK 417
within the binding site. Furthermore, the pterin ring is effectively sand-
wiched on both sides by two aromatic residues, Y53 and F123. An illustra-
tion of the principal interacting residues is shown in Fig. 15.3B. The highly
specific nature of the recognition of the pterin ring explains the high affinity
of the enzymeAMPCPP binary complex for HMDP (Bermingham et al.,
2000; Li et al., 2002). It also has important ramifications for the design of
inhibitors against the enzyme (see following section).
Two product complex structures with EcoHPPK have been reported,
with DHPPP alone and AMPDHPPP (Blaszczyk et al., 2004b). The
authors used these to complete the series of enzyme-substrate and enzyme-
product crystal structures that describe the HPPK reaction pathway. They
observed that there is a significant degree of disorder in the phosphate groups
in AMP and DHPPP, requiring the modeling of two alternate conforma-
tions. They also reported that the AMPDHPPP ternary complex had an
almost identical conformation to an NMR structure for the EcoHPPK
AMPCPP binary complex, with loop L3 displaced far from the active
site. By contrast, loop L3 is closed over the active site in the EcoHPPK
AMPCPPHMDP ternary complex. The authors interpreted this series of
structures as indicative of extensive movement of loop L3 during substrate
binding, catalysis, and product release. The loop is displaced outwards on
ATP binding, inwards after formation of the AMPCPPHMDP ternary
complex and back outwards again after formation of the EcoHPPK
AMPDHPPP product complex.
The conclusions discussed above concerning structural transitions in
HPPK during the reaction cycle were based solely on crystal structures of
the various intermediate structural states. It is well established that the
constraints of packing within a crystalline lattice can fix loop regions in
particular conformational states, which may not be accurately representative
of the situation in solution. In the case of HPPK, more recent work by
NMR (Li et al., 2006) and computational studies (Keskin et al., 2002; Yang
et al., 2005) has indicated that the loop regions in the enzyme are accessible
to a wider range of conformational states than is apparent from the crystal
structure, particularly of the apoenzyme form.
As a consequence of the small size and monomeric state of EcoHPPK,
solution state NMR has made a valuable contribution to structural studies
on the enzyme (Garcon et al., 2004; Li et al., 2006; Xiao et al., 2001). The
3-D structure of EcoHPPK in complex with the ATP analog b,g-
methyleneadenosine triphosphate (AMPPCP) provided a verification,
independent from crystallography, of structural transitions which occur on
the binding of ATP (Xiao et al., 2001). More recently, two further struc-
tures of a binary complex with AMPCPP and a ternary complex with
AMPCPP and 6-hydroxy-7,7-dimethyl-pterin, have provided novel
insights into the nature of the conformational changes between different
ligand-bound states of the enzyme (Li et al., 2006). Both the apoenzyme and
Structure and Mechanism of HPPK 419
the binary complexes with ATP analogs exhibit a higher degree of confor-
mational flexibility, particularly within loop regions L1L3, than the ternary
complex. This is manifest in weak or absent NH cross peaks for residues
within loops L1 and L3 for the AMPCPP binary complex. Most signals
from residues in the ternary complex, by contrast, are well defined, includ-
ing all those originating from loops L1 to L3. These observations suggest a
tightening-up of the structure on binding of the HMDP analog. The
results provide evidence for multiple structural conformations in the apo-
enzyme and binary complexes in solution, requiring a revision of the
classical induced fit model of substrate binding, as applied to EcoHPPK,
to a more complex population-based model (Li et al., 2006).
The conclusions from NMR work have been bourne out by computa-
tional studies of the dynamics of the EcoHPPK structure: Keskin et al.
(2002) concluded that the core regions of secondary structure within
HPPK, which comprise most of the residues conserved in sequence, were
rigid but that the L2 and L3 loops exhibited a much greater degree of
motion. They also provided independent evidence of the relative restriction
in mobility of the structure on binding of substrates. Yang et al. (2005)
applying a different methodology (essential dynamics analysis) reached
similar conclusions and suggested that the open conformation of L3,
which had been identified in the crystal structure complex with ADP
(Xiao et al., 2001), was also accessible to the loop in solution in the apoen-
zyme form. The current consensus is that a selected fit model pertains to
the initial binding events in the HPPK reaction cycle: the apoenzyme adopts a
wide range of conformational states, principally driven by diverse structures
of L2 and L3. Following binding of ATP, a reorganization of the L3
structure promotes formation of the HMDP-binding site. It would be
interesting to pursue the study of other structural states of the EcoHPPK
reaction cycle, particularly the product complexes, given that the steps
associated with product departure are apparently responsible for limiting
the overall rate of catalysis (discussed further in Section IV, below).
B. Mechanism of catalysis
The current model for the mechanism of the pyrophosphoryl transfer
reaction is based primarily on crystallographic data, particularly the struc-
ture of the nonproductive ternary complex EcoHPPKAMPCPPHMDP
(Blaszczyk et al., 2000). The authors proposed an in-line single displacement
mechanism for nucleophilic attack of the b-phosphorus in ATP by the
hydroxyl oxygen in HMDP. It was suggested that the reaction has some
associative character (shown schematically in Fig. 15.4): an associative
mechanism would require that the transition state contains a pentacoordi-
nate geometry at the b-phosphorus atom in the transition state (SN2-like).
By contrast, a dissociative transition state would have a trigonal planar
420 Jeremy P. Derrick
Figure 15.4 Schematic diagram of the transition state for the 6-hydroxymethyl-7,8-
dihydropterin pyrophosphokinase (HPPK) reaction. Adapted from Blaszczyk et al.
(2000).
geometry at this atom (SN1-like) (Matte et al., 1998). In the case of HPPK,
the value of the EcoHPPKAMPCPPHMDP structure in distinguishing
between these possibilities lies in its degree of similarity with the real
EcoHPPKATPHMDP transition state.
A number of roles in substrate binding and catalysis have been proposed
by Blaszczyk et al. (2000) for the two Mg2 ions that are bound within the
HPPK active site. It seems likely that the Mg2 ions play a role in ATP
binding and the associated conformational change which promotes the
binding of HMDP. The ions could play an important part in orientating
the hydroxyl oxygen of HMDP relative to the b-phosphorus and the
bridging oxygen atom between the a- and b-phosphates to ensure optimal
geometry for the reaction. The Mg2 ions could also activate the b-phos-
phorus for nucleophilic attack, and contribute to stabilization of the negative
charge on the transition state. Again, these proposals are largely based on the
crystal structure and require further investigation by other techniques.
C. Inhibitors
Relatively few specific inhibitors of HPPK have been reported in the
literature. Wood and colleagues described the synthesis of disubstituted
pterin analogs with two substituents at the 7-position on the ring, which
were shown to inhibit HPPK activity (Wood, 1975). The use of these
inhibitors in structural studies on E. coli (Li et al., 2006; Stammers et al.,
1999) and HiHPPK (Hennig et al., 1999) has already been discussed.
A comparison of the structures of the EcoHPPKATP6-hydroxymethyl-
7-methyl-7-phenethyl-7,8-dihydropterin (PDB 1DY3) and EcoHPPK
AMPCPPHMDP (PDB 1Q0N) ternary complexes shows that W89 in
the latter structure would cause a steric clash with the phenethyl substituent.
The side chains of R82 and R92, known to be essential for catalysis (Li et al.,
2003), adopt different rotamers in the two structures. Furthermore, the
conformation of L3 differs between the two structures. These slight changes
Structure and Mechanism of HPPK 421
this can occur in enzymes from some biosynthetic pathways (Huang et al.,
2001). However, there is currently no evidence for channeling of substrates to,
or products from HPPK.
In the yeast Saccharomyces cerevisiae, HPPK is found as part of a trifunc-
tional DHNAHPPKDHPS polypeptide; in order to investigate the
assembly of this complex, Lawrence et al. (2005) determined the crystal
structure of the HPPKDHPS fragment to 2.3 A resolution. A structural
alignment of the S. cerevisiae HPPK (ScHPPK) component with EcoHPPK
shows good agreement with the location of most secondary structures,
although electron density for the equivalent of loop 3 (L3) is missing from
the Saccharomyces structure (Fig. 15.5B). Interestingly, L2 adopts a confor-
mation in the ScHPPK structure which is similar to its equivalent in the
EcoHPPKAMPCPPHMDP ternary complex. The main point of diver-
gence between the two HPPK structures lies in an additional five residues in
ScHPPK, between b4 and a3. Crystal structures of DHPS show that the
enzyme adopts a TIM barrel-type fold and is dimeric (Achari et al., 1997;
Babaoglu et al., 2004; Baca et al., 2000; Hampele et al., 1997). The associa-
tion of the two DHPS monomers in the ScHPPKDHPS complex is the
dominant feature of the structure (Fig. 15.5C). The two HPPK domains are
kept apart, and do not make contact. The structure was determined with the
inhibitor 6-hydroxymethylpterin monophosphate (PMM) bound in both
the HPPK and the DHPS active sites; the two active sites are well separated
in space, with a distance of about 34 A between PMM molecules bound to
the same polypeptide chain. Lawrence et al. (2005) went on to propose a
structural arrangement for the DHNAHPPKDHPS trifunctional com-
plex, based on 222 point group symmetry, which would incorporate the
DHNA tetramer. This could serve as a model for other DHNAHPPK
DHPS trifunctional complexes in fungal pathogens.
As mentioned above, HPPK in S. pneumoniae is fused to the preceding
enzyme in the pathway, the aldolase DHNA (Lopez and Lacks, 1993).
DHNA from bacterial sources adopts a barrel-shaped octameric structure
with 422 point group symmetry (Goulding et al., 2005; Hennig et al., 1998).
The determination of the crystal structure of the S. pneumoniae DHNA
HPPK bifunctional enzyme showed how this arrangement of quaternary
structure could be adapted to accommodate the eight HPPK domains
(Garcon et al., 2006). It was apparent that there was no linker region
between the two domains, reducing their relative conformational flexibility.
The molecular mass of a single S. pneumoniae DHNAHPPK polypeptide is
about 29 kDa, so the octamer has an overall mass of about 230 kDa, making
this the largest enzyme from this section of the folate biosynthesis pathway
(DHNA, HPPK, DHPS) whose crystal structure has been determined to
date. The structure has an elongated barrel shape, with the DHNA domains
forming the central parts of the barrel, and the HPPK domains capping the
ends (Fig. 15.5D). The active sites of the HPPK and DHNA domains point
424 Jeremy P. Derrick
outwards and, as was the case for ScHPPKDHPS, they are well separated
in space with no obvious structural link between them. One major differ-
ence from the ScHPPKDHPS structure is that the HPPK domains form
extensive monomermonomer contacts; presumably this feature helps to
prevent the octamer from dissociating into monomers.
Doubtless the structures of HPPKs from other organisms will be deter-
mined in due course. A key question is likely to be, whether the structural
changes which occur on substrate binding to EcoHPPK are also found in
other HPPKs. A similar question could also be posed concerning the studies
of ligand binding and kinetics of the reaction, where measurements have
largely been carried out on EcoHPPK: this work is reviewed in the next
section.
IV. Kinetics
The question of the binding order of the substrates for HPPK was first
addressed by Bermingham et al. (2000). Using EcoHPPK, they showed that
a fluorescent ATP analogue, 20 (30 )-O-(N-methylanthraniloyl) adenosine
50 -triphosphate (MANT-ATP), bound to the apoenzyme with a Kd of
10 mM. An equilibrium displacement titration of MANT-ATP by ATP also
permitted the determination of the Kd for ATP (4.5 mM). The apoenzyme,
however, failed to show any measurable affinity for the second substrate,
HMDP. In a parallel investigation into the nucleotide-binding specificity
of EcoHPPK, Shi et al. (2000) demonstrated that nucleotide recognition by
the enzyme was highly specific for ATP, with the equilibrium-binding con-
stant for GTP, for example, being 260-fold higher. These researchers also
showed that Mg2 played an important part in ATP binding, and that the
binding constant for AMP was much weaker than for ATP.
The use of a non-hydrolyzable analog of ATP, AMPCPP, has been
extremely valuable for the formation of nonproductive ternary complexes
of the enzyme, as a way of studying substrate-binding order and modeling
the transition state of the reaction (Blaszczyk et al., 2000). Bermingham et al.
showed HMDP bound to the enzymeAMPCPP binary complex,
providing evidence for a compulsory substrate-binding order:
E $ E:AMPCPP $ E:AMPCPP:HMDP
been characterized. One reason may be the greater electron density at the
b-phosphorus than the g-phosphorus atom, which would militate against
nucleophilic substitution at this site. Are all pyrophosphoryl transfer enzymes
related structurally or mechanistically? Although other pyrophosphoryl trans-
fer enzymes have not been studied in as much detail as HPPK, there is
sufficient information available now to suggest that this is not the case. At
a structural level at least, it would appear that there is no common theme
underlying different pyrophosphoryl transfer enzymes. An examination of
three separate pyrophosphoryl transfer enzymes, where crystal structures
have been determined, will serve to illustrate the point.
Thiamin pyrophosphokinase (EC 2.7.6.2) catalyses the pyrophosphor-
ylation of thiamin by ATP to form thiamin pyrophophate, which is subse-
quently used by a range of enzymes in carbohydrate metabolism. The
human enzyme has been shown to have a ping-pong type mechanism
and, in common with HPPK, a relatively slow turnover value of about
0.07 s1 (Onozuka and Nosaka, 2003). The crystal structures of thiamin
pyrophosphokinase have been determined from yeast (Baker et al., 2001)
and mouse (Timm et al., 2001): the active site of the enzyme lies between
two lobes, formed from an a/b Rossman fold and a b-sandwich-type
domain. Although complexes with thiamin bound were determined, no
structure has been reported in complex with ATP, or an ATP analog.
A groove between the subunits was identified which could accommodate
ATP, including several conserved aspartate residues which could coordinate
Mg2 ions (Baker et al., 2001). The mode of binding of thiamin to thiamin
pyrophosphokinase, against the edges of b-strands, is rather different from
HMDP recognition by HPPK, where the substrate binds against one face of
the central b-sheet in the protein. Consequently, there appear to be few
points of similarity between the two enzymes.
Phosphoribosylpyrophosphate synthetase (EC 2.7.6.1) is another pyro-
phosphoryl transfer enzyme which has been studied in some detail. The
enzyme catalyzes the transfer of pyrophosphate from ATP to D-ribose
5-phosphate, to form 5-phospho-alpha-D-ribose 1-diphosphate. The struc-
ture consists of two consecutive a/b domains, each of which resembles the
fold of a type I phosphoribosyltransferase (Eriksen et al., 2000). Quaternary
structures vary: the Bacillus subtilis and human enzymes form hexamers
(Eriksen et al., 2000; Li et al., 2007) but the enzyme from Methanocaldococcus
jannaschii is a tetramer (Kadziola et al., 2005). A product complex, formed by
soaking crystals of the M. jannaschii enzyme with AMP and 5-phospho-
alpha-D-ribose 1-diphosphate, showed the positions of the two products
between the domains (Kadziola et al., 2005). The inferred recognition of the
substrates indicated no evident similarity with binding of ATP and HMDP
to HPPK. Human phosphoribosylpyrophosphate synthetase has been shown
to have a fixed order of substrate binding, with ribose-5-phosphate binding
first and 5-phosphoribose diphosphate being released last (Fox and Kelley,
428 Jeremy P. Derrick
Figure 15.6 Structural alignment of the GTP pyrophosphokinase domain from Strep-
tococcus dysgalactiae RelA/SpoT with E. coli HPPK (EcoHPPK). (A) Ribbon plots of the
RelA/SpoT homolog (PDB 1VJ7, green) and E. coli HPPK (EcoHPPK) (PDB 1Q0N,
blue) are shown. Note how the two a-helices at the top of the diagram and the b-sheet
superimpose well. (B) Alternate view of the alignment in A, but with a,b-methylenea-
denosine triphosphate (AMPCPP) and 6-hydroxymethyl-7,8-dihydropterin (HMDP)
from the 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase (HPPK) structure
included in the superposition. The loop regions from HPPK, which are responsible
for substrate recognition, are not part of the conserved core structure with the RelA/
SpoT ppGpp synthetase domain.
REFERENCES
Achari, A., Somers, D. O., Champness, J. N., Bryant, P. K., Rosemond, J., and
Stammers, D. K. (1997). Crystal structure of the anti-bacterial sulfonamide drug target
dihydropteroate synthase. Nat. Struct. Biol. 4, 490497.
Auerbach, G., Herrmann, A., Bracher, A., Bader, G., Gutlich, M., Fischer, M.,
Neukamm, M., Garrido-Franco, M., Richardson, J., Nar, H., Huber, R., and
Bacher, A. (2000). Zinc plays a key role in human and bacterial GTP cyclohydrolase I.
Proc. Natl. Acad. Sci. USA 97, 1356772.
Babaoglu, K., Qi, J. J., Lee, R. E., and White, S. W. (2004). Crystal structure of 7,8-
dihydropteroate synthase from Bacillus anthracis: Mechanism and novel inhibitor design.
Structure 12, 17051717.
Baca, A. M., Sirawaraporn, R., Turley, S., Sirawaraporn, W., and Hol, W. G. (2000).
Crystal structure of Mycobacterium tuberculosis 7,8-dihydropteroate synthase in complex
with pterin monophosphate: New insight into the enzymatic mechanism and sulfa-drug
action. J. Mol. Biol. 302, 11931212.
Baker, L. J., Dorocke, J. A., Harris, R. A., and Timm, D. E. (2001). The crystal structure of
yeast thiamin pyrophosphokinase. Structure 9, 539546.
Bateman, A., Coin, L., Durbin, R., Finn, R. D., Hollich, V., Griffiths-Jones, S., Ajay
Khanna, Marshall, M., Moxon, S., Sonnhammer, E. L. L., Studholme, D. J., Yeats, C.,
and Eddy, S. R. (2004). The Pfam protein families database. Nucleic Acids Res. 32,
D138D141.
Bermingham, A., and Derrick, J. P. (2002). The folic acid biosynthesis pathway in bacteria:
Evaluation of potential for antibacterial drug discovery. Bioessays 24, 637648.
Bermingham, A., Bottomley, J. R., Primrose, W. U., and Derrick, J. P. (2000). Equilibrium
and kinetic studies of substrate binding to 6-hydroxymethyl-7,8-dihydropterin pyro-
phosphokinase from Escherichia coli. J. Biol. Chem. 275, 1796217967.
Structure and Mechanism of HPPK 431
Blaszczyk, J., Shi, G., Yan, H., and Ji, X. (2000). Catalytic center assembly of HPPK as
revealed by the crystal structure of a ternary complex at 1.25 angstrom resolution.
Structure 8, 10491058.
Blaszczyk, J., Li, Y., Shi, G. B., Yan, H. G., and Ji, X. H. (2003). Dynamic roles of arginine
residues 82 and 92 of Escherichia coli 6-hydroxymethyl-7,8-dihydropterin pyrophospho-
kinase: Crystallographic studies. Biochemistry 42, 15731580.
Blaszczyk, J., Li, Y., Wu, Y., Shi, G. B., Ji, X. H., and Yan, H. G. (2004a). Essential roles of a
dynamic loop in the catalysis of 6-hydroxymethyl-7,8-dihydropterin pyrophosphoki-
nase. Biochemistry 43, 14691477.
Blaszczyk, J., Shi, G. B., Li, Y., Yan, H. G., and Ji, X. H. (2004b). Reaction trajectory of
pyrophosphoryl transfer catalyzed by 6-hydroxymethyl-7,8-dihydropterin pyropho-
sphokinase. Structure 12, 467475.
Bracher, A., Schramek, N., and Bacher, A. (2001). Biosynthesis of Pteridines. Stopped-flow
kinetic analysis of GTP Cyclohydrolase I. Biochemistry.
Brooks, D. R., Wang, P., Read, M., Watkins, W. M., Sims, P. F. G., and Hyde, J. E. (1994).
Sequence Variation of the Hydroxymethyldihydropterin Pyrophosphokinase -
Dihydropteroate Synthase Gene in lines of the Human Malaria Parasite, Plasmodium
falciparum, with Differing Resistance to Sulfadoxine. Eur. J. Biochem. 224, 397405.
Brown, G. M., Weisman, R. A., and Molnar, D. A. (1961). Biosynthesis of Folic Acid.
1. Substrate and Cofactor Requirements for Enzymatic Synthesis by Cell-Free Extracts of
Escherichia Coli. J. Biol. Chem. 236, 25342543.
Chatterji, D., and Ojha, A. K. (2001). Revisiting the stringent response, ppGpp and
starvation signaling. Curr. Opin. Microbiol. 4, 160165.
Dosselaere, F., and Vanderleyden, J. (2001). A metabolic node in action: chorismate-
utilizing enzymes in microorganisms. Crit. Rev. Microbiol. 27, 75131.
Eriksen, T. A., Kadziola, A., Bentsen, A. K., Harlow, K. W., and Larsen, S. (2000).
Structural basis for the function of Bacillus subtilis phosphoribosylpyrophosphate synthe-
tase. Nat. Struct. Biol. 7, 303308.
Fox, I. H., and Kelley, W. N. (1972). Human Phosphoribosylpyrophosphate Synthetase -
Kinetic Mechanism and End Product Inhibition. J. Biol. Chem. 247, 21262131.
Garcon, A., Bermingham, A., Lian, L. Y., and Derrick, J. P. (2004). Kinetic and structural
characterization of a product complex of 6-hydroxymethyl-7,8-dihydropterin pyropho-
sphokinase from Escherichia coli. Biochem. J. 380, 867873.
Garcon, A., Levy, C., and Derrick, J. P. (2006). Crystal structure of the bifunctional
dihydroneopterin aldolase/6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase from
Streptococcus pneumoniae. J. Mol. Biol. 360, 644653.
Goulding, C. W., Apostol, M. I., Sawaya, M. R., Phillips, M., Parseghian, A., and
Eisenberg, D. (2005). Regulation by oligomerization in a mycobacterial folate biosyn-
thetic enzyme. J. Mol. Biol. 349, 6172.
Hampele, I. C., DArcy, A., Dale, G. E., Kostrewa, D., Nielsen, J., Oefner, C., Page, M. G.,
Schonfeld, H. J., Stuber, D., and Then, R. L. (1997). Structure and function of the
dihydropteroate synthase from Staphylococcus aureus. J. Mol. Biol. 268, 2130.
Hennig, M., DArcy, A., Hampele, I. C., Page, M. G. P., Oefner, C., and Dale, G. E.
(1998). Crystal structure and reaction mechanism of 7,8-dihydroneopterin aldolase from
Staphylococcus aureus. Nat. Struct. Biol. 5, 357362.
Hennig, M., Dale, G. E., DArcy, A., Danel, F., Fischer, S., Gray, C. P., Jolidon, S.,
Muller, F., Page, M. G. P., Pattison, P., and Oefner, C. (1999). The structure and
function of the 6-hydroxymethyl-7,8- dihydropterin pyrophosphokinase from Haemo-
philus influenzae. J. Mol. Biol. 287, 211219.
Hogg, T., Mechold, U., Malke, H., Cashel, M., and Hilgenfeld, R. (2004). Conformational
antagonism between opposing active sites in a bifunctional Re1A/SpoT homolog
432 Jeremy P. Derrick
modulates (p)ppGpp metabolism during the stringent response. Cell (Cambridge, Mass.)
117, 5768.
Huang, X., Holden, H. M., and Raushel, F. M. (2001). Channeling of substrates and
intermediates in enzyme-catalysed reactions. Annu. Rev. Biochem. 70, 149180.
Kadziola, A., Jepsen, C. H., Johansson, E., McGuire, J., Larsen, S., and Hove-Jensen, L.
(2005). Novel class III phosphoribosyl diphosphate synthase: Structure and properties of
the tetrameric, phosphate-activated, non-allosterically inhibited enzyme from Methano-
caldococcus jannaschii. J. Mol. Biol. 354, 815828.
Keskin, O., Ji, X., Blaszcyk, J., and Covell, D. G. (2002). Molecular motions and confor-
mational changes of HPPK. Proteins: Struct. Funct. Genet. 49, 191205.
Lawrence, M. C., Iliades, P., Fernley, R. T., Berglez, J., Pilling, P. A., and Macreadie, I. G.
(2005). The three-dimensional structure of the bifunctional 6-hydroxymethyl-7,8-dihy-
dropterin pyrophosphokinase/dihydropteroate synthase of Saccharomyces cerevisiae.
J. Mol. Biol. 348, 655670.
Li, G. Y., Felczak, K., Shi, G. B., and Yan, H. G. (2006). Mechanism of the conformational
transitions in 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase as revealed by
NMR spectroscopy. Biochemistry 45, 1257312581.
Li, S., Lu, Y. C., Peng, B. Z., and Ding, J. P. (2007). Crystal structure of human phosphor-
ibosylpyrophosphate synthetase 1 reveals a novel allosteric site. Biochem. J. 401, 3947.
Li, Y., Gong, Y. C., Shi, G. B., Blaszczyk, J., Ji, X. H., and Yan, H. G. (2002). Chemical
transformation is not rate-limiting in the reaction catalyzed by Escherichia coli 6-hydro-
xymethyl-7,8-dihydropterin pyrophosphokinase. Biochemistry 41, 87778783.
Li, Y., Wu, Y., Blaszczyk, J., Ji, X. H., and Yan, H. G. (2003). Catalytic roles of arginine
residues 82 and 92 of Escherichia coli 6-hydroxymethyl-7,8-dihydropterin pyrophospho-
kinase: Site- directed mutagenesis and biochemical studies. Biochemistry 42, 15811588.
Li, Y., Blaszczyk, J., Wu, Y., Shi, G. B., Ji, X. H., and Yan, H. G. (2005). Is the critical role
of loop 3 of Escherichia coli 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase in
catalysis due to loop-3 residues arginine-84 and tryptophan-89? Site-directed mutagene-
sis, biochemical, and crystallographic studies. Biochemistry 44, 85908599.
Lopez, P., and Lacks, S. A. (1993). A Bifunctional Protein in the Folate Biosynthetic-
Pathway of Streptococcus pneumoniae with Dihydroneopterin Aldolase and Hydroxy-
methyldihydropterin Pyrophosphokinase Activities. J. Bacteriol. 175, 22142220.
Lopez, P., Greenberg, B., and Lacks, S. A. (1990). DNA-Sequence of Folate Biosynthesis
Gene-SulD, Encoding Hydroxymethyldihydropterin Pyrophosphokinase in Streptococcus
pneumoniae, and Characterization of the Enzyme. J. Bacteriol. 172, 47664774.
Matte, A., Tari, L. W., and Delbaere, L. T. J. (1998). How do kinases transfer phosphoryl
groups? Structure Fold Des. 6, 413419.
Nar, H., Huber, R., Auerbach, G., Fischer, M., Hosl, C., Ritz, H., Bracher, A.,
Meining, W., Eberhardt, S., and Bacher, A. (1995). Active site topology and reaction
mechanism of GTP cyclohydrolase I. Proc. Natl. Acad. Sci. USA 92, 1212012125.
Nar, H., Huber, R., Meining, W., Bracher, A., Fischer, M., Hosl, C., Ritz, H., Schmid, C.,
Weinkauf, S., and Bacher, A. (1996). Structure and mechanism of GTP cyclohydrolase I
of Escherichia coli. Biochem. Soc. Trans. 24, 37S.
Onozuka, M., and Nosaka, K. (2003). Steady-state kinetics and mutational studies of
recombinant human thiamin pyrophosphokinase. J. Nutr. Sci. Vitaminol. (Tokyo). 49,
156162.
Rebeille, F., Macherel, D., Mouillon, J. M., Garin, J., and Douce, R. (1997). Folate
biosynthesis in higher plants: Purification and molecular cloning of a bifunctional
6-hydroxymethyl-7,8- dihydropterin pyrophosphokinase/7,8-dihydropteroate synthase
localized in mitochondria. EMBO J. 16, 947957.
Structure and Mechanism of HPPK 433
Richey, D. P., and Brown, G. M. (1969). Biosynthesis of Folic Acid .9. Purification and
Properties of Enzymes Required for Formationof Dihydropteroic Acid. J. Biol. Chem.
244, 15821592.
Shi, G. B., Gong, Y. C., Savchenko, A., Zeikus, J. G., Xiao, B., Ji, X. H., and Yan, H. G.
(2000). Dissecting the nucleotide binding properties of Escherichia coli 6-hydroxymethyl-
7,8-dihydropterin pyrophosphokinase with fluorescent 3 0 (2)0 -O-anthraniloyladenosine
5 0 -triphosphate. Biochim. Biophys. Acta 1478, 289299.
Shi, G. B., Blaszczyk, J., Ji, X. H., and Yan, H. G. (2001). Bisubstrate analogue inhibitors of
6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase: Synthesis and biochemical and
crystallographic studies. J. Med. Chem. 44, 13641371.
Stammers, D. K., Achari, A., Somers, D. O., Bryant, P. K., Rosemond, J., Scott, D. L., and
Champness, J. N. (1999). 2.0 angstrom X-ray structure of the ternary complex of 7,8-
dihydro-6-hydroxymethylpterinpyrophosphokinase from Escherichia coli with ATP and a
substrate analogue. FEBS Lett. 456, 4953.
Storozhenko, S., Navarrete, O., Ravanel, S., De Brouwer, V., Chaerle, P., Zhang, G. F.,
Bastien, O., Lambert, W., Rebeille, F., and Van Der Straeten, D. (2007). Cytosolic
hydroxymethyldihydropterin pyrophosphokinase/dihydropteroate synthase from Arabi-
dopsis thaliana - A specific role in early development and stress response. J. Biol. Chem.
282, 1074910761.
Stroppolo, M. E., Falconi, M., Caccuri, A. M., and Desideri, A. (2001). Superefficient
enzymes. Cell. Mol. Life Sci. 58, 14511460.
Talarico, T. L., Dev, I. K., Dallas, W. S., Ferone, R., and Ray, P. H. (1991). Purification and
Partial Characterization of 7,8-Dihydro-6- Hydroxymethylpterin-Pyrophosphokinase
and 7,8-Dihydropteroate Synthase from Escherichia coli MC4100. J. Bacteriol. 173,
70297032.
Talarico, T. L., Ray, P. H., Dev, I. K., Merrill, B. M., and Dallas, W. S. (1992). Cloning,
Sequence-Analysis, and Overexpression of Escherichia coli FolK, the Gene Coding for 7,8-
Dihydro-6-Hydroxymethylpterin pyrophosphokinase. J. Bacteriol. 174, 59715977.
Timm, D. E., Liu, J. Y., Baker, L. J., and Harris, R. A. (2001). Crystal structure of thiamin
pyrophosphokinase. J. Mol. Biol. 310, 195204.
Volpe, F., Ballantine, S. P., and Delves, C. J. (1993). The Multifunctional Folic-Acid
Synthesis Fas Gene of Pneumocystis carinii Encodes Dihydroneopterin Aldolase, Hydro-
xymethyldihydropterin Pyrophosphokinase and Dihydropteroate Synthase. Eur. J.
Biochem. 216, 449458.
Weisman, R. A., and Brown, G. M. (1964). Biosynthesis of Folic Acid .V. Characteristics of
Enzyme System That Catalyzes Synthesis of Dihydropteroic Acid. J. Biol. Chem. 239,
326331.
Wood, H. C. S. (1975). Specific inhibition of dihydrofolate biosynthesis- a new approach to
chemotherapy. In Chemistry and Biology of Pteridines, (W Pfleiderer, Ed.),. Walter de
Gruyter, Berlin-New York.
Xiao, B., Shi, G. B., Chen, X., Yan, H. G., and Ji, X. H. (1999). Crystal structure of
6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase, a potential target for the devel-
opment of novel antimicrobial agents. Structure 7, 489496.
Xiao, B., Shi, G. B., Gao, J. H., Blaszczyk, J., Liu, Q., Ji, X. H., and Yan, H. G. (2001).
Unusual conformational changes in 6-hydroxymethyl-7,8- dihydropterin pyrophospho-
kinase as revealed by X-ray crystallography and NMR. J. Biol. Chem. 276, 4027440281.
Yang, R., Lee, M. C., Yan, H. G., and Duan, Y. (2005). Loop conformation and dynamics
of the Escherichia coli HPPK apo-enzyme and its binary complex with MgATP. Biophys.
J. 89, 95106.
Index
435
436 Index
HiHPPK. See H. influenzae HPPK Imidazole ring, 11, 1920, 104, 306
H. influenzae HPPK, 414 Immunohistochemistry (IHC), 208209
Histidase, 12 vs. FolateScan, 210
Histone acetyl transferase, 277 Immunotoxin, 224
Histone deacetylase inhibitors, 225 IMP. see Inosine monophosphate
Histone deacetylases, 277 Initiation factor 2 (IF-2), 28
HMDP. See 6-Hydroxymethyl-7, Inosine monophosphate, 18, 104
8-dihydropterin Intracellular folate metabolism, in mammalian
HMMDP. See 6-Hydroxymethyl-7,7-dimethyl-7, cells, 103
8-dihydropterin
HNE. See 4-Hydroxynonenal L
Homocysteine, 282, 376
Lactose/proton symporter, 149
B vitamin and, 84
CBS reaction with, 50 LacY. See Lactose/proton symporter
characteristics of, 107108 ligM gene, 300
elimination, 86, 9093 liver cytosolic folate pool, of rats, 328
folate status and, 62, 104, 407 Low folate (LF) conditions, 17, 62, 68, 108, 188,
214, 379380, 383, 407
level and pathological states of, 297
L-protein, in human brain, 26
levels and multiple cognitive dysfunctions, 84
polymorphism and, 282 M
remethylation cycle, 15, 89, 330, 376
role of, 85 Major facilitator superfamily, 113114
to thiolactone, 108 of transporters, 147150
TS expression and, 20 MCI. See Mild cognitive impairment
Homocysteinemia, 106108, 383 MDR. See Multidrug resistance
Homozygosity, for C677T allele, 382 MeCbl. See Methylcobalamin
HPPK. See 6-Hydroxymethyl-7,8-dihydropterin MEFS. See Mouse embryo fibroblasts
pyrophosphokinase Membrane-spanning domains, 125
Human brain Methanethiosulfonate, 169, 173
homocysteine elimination and glutathione Methanocaldococcus jannaschii, 427
metabolism in, 86 Methanogenesis, 297299
L-protein in, 26 Methanol, 2, 295, 305, 308, 311, 313
MTHFS in, 15 Methenyltetrahydrofolate cyclohydrolase, 395,
SHMT1 in, 8 397
Human DHFR intron-1, 19-bp deletion in, 281 5,10-MethenylTHF cyclohydrolase, 9, 13, 27
Human RFC (hRFC), 147 5,10-MethenylTHF synthetase, 1516
topological model for, 160 Methionine, 2, 10, 23, 50, 5657, 329, 335337,
6-Hydroxymethyl-7,8-dihydropterin, 413 339, 376377
6-Hydroxymethyl-7,8-dihydropterin Methionine adenosyltransferase, 88, 329
pyrophosphate, 413 Methionine biosynthesis, 16, 104, 297
6-Hydroxymethyl-7,8-dihydropterin Methionine cycle, 4950, 52, 58, 6061, 65,
pyrophosphokinase, 412 72, 109
comparison in structure, 421424 Methionine synthase, 2224, 87, 385
pyrophosphoryl transfer enzymes, relationship and SHMT activity interaction, effects of, 69
with, 426429 Methionine synthase reductase, 282
structures, determined by X-ray Methionine synthethase, 282
crystallography/NMR, 416 Methionyl-tRNAf Met formyltransferase, 28
transition state, 420 Methotrexate, 52, 73, 105, 152153, 189, 212,
6-Hydroxymethyl-7,7-dimethyl-7, 268269, 283286, 350
8-dihydropterin, 414 Methylamine methyltransferase, 308
4-Hydroxynonenal, 93 Methylamines, 295, 297, 310, 314
Hyperhomocysteinemia, 84, 107, 382383 Methylcobalamin, 295
Hypopituitarism, 236237 5,10-Methylene tetrahydrofolate, 86, 212
Methylene tetrahydrofolate
dehydrogenase, 397, 401
I Methylene tetrahydrofolate reductase, 5, 87,
IGROV-1 tumor xenografts, 217 109, 377
IHC. See Immunohistochemistry and disease, 381383
Index 441