J. Plant Biochem. Biotechnol.

(JanJune 2013) 22(1):5261

DOI 10.1007/s13562-012-0110-9

ORIGINAL ARTICLE

Conserved microRNAs and their targets in rubber tree

and the related Euphorbiaceous species
Manassawe Lertpanyasampatha &
Porawee Pramoolkit & Panida Kongsawadworakul &
Unchera Viboonjun & Herv Chrestin &
Jarunya Narangajavana

Received: 9 September 2011 / Accepted: 13 February 2012 / Published online: 3 March 2012
# Society for Plant Biochemistry and Biotechnology 2012

Abstract Plant microRNAs (miRNAs) have been demonstrat- consists of regulatory genes predicted to encode transcription
ed to play an important regulatory role in a variety of biological factors, while non-regulatory genes involving in various func-
processes ranging from plant growth and development, defen- tions. Some miRNAs contain different targets, suggesting the
sive pathways, as well as biotic and abiotic stress responses. diverse functions of miRNAs depending on plant species and
MiRNAs have been extensively studied in plant models with environmental conditions. The 6 expressed Hbr-miRNAs
available genome sequence data. The Euphorbiaceae family is were verified in rubber tree. Gaining insight into the miRNA
a large flowering plant family, which is of considerable eco- targets will help us to understand the range of miRNA expres-
nomic importance, but relatively limited genome sequence sion regulation and to more coherently describe the functional
data. The four Euphorbiaceous species; rubber tree, cassava, importance of miRNAs. These findings considerably facilitate
castor bean and leafy spurge; were selected for this study. the basis for broaden future investigation on the role of these
Using conserved plant miRNAs sequences aligned to the miRNAs in the economic important Euphorbiaceous species.
GenBank expressed sequenced tag database of each target
plants, and further potential precursor miRNA-secondary Keywords MicroRNAs . Euphorbiaceae . Rubber tree .
structure analysis, the 526 potential miRNAs belonging to Cassava . Castor bean . Leafy spurge
17 miRNA families and their targets were identified. The
majority of miRNA families was able to be identified in Abbreviations
cassava. The minimal folding free energy index of precursor AGO1 ARGONAUTE 1
miRNAs was significantly higher than other non-coding or Ath Arabidopsis thaliana
coding RNAs. The largest group of miRNA target genes DEPC Diethylpyrocarbonate
EST Expressed sequenced tag
Electronic supplementary material The online version of this article Hbr Hevea brasiliensis
(doi:10.1007/s13562-012-0110-9) contains supplementary material, MFE Negative folding free energy (G)
which is available to authorized users.
MFEI Minimal folding free energy index
M. Lertpanyasampatha : P. Pramoolkit : J. Narangajavana (*) MIR gene microRNA encoding gene
Department of Biotechnology, Faculty of Science,
miRNAs microRNAs
Mahidol University,
Rama VI Road, RT-PCR Reverse transcription polymerase chain reaction
Bangkok 10400, Thailand Ptc Populus trichocarpa
e-mail: scjnr@mahidol.ac.th

P. Kongsawadworakul : U. Viboonjun
Department of Plant Science, Faculty of Science,
Mahidol University, Introduction
Bangkok, Thailand
MicroRNAs (miRNAs) are a class of small single-stranded,
H. Chrestin
Institut de Recherche pour le Dveloppement (IRD), non-coding RNAs in plants and animals that are derived
Montpellier, France from primary miRNAs transcribed from specific MIR genes.
J. Plant Biochem. Biotechnol. (JanJune 2013) 22(1):5261
In plants, primary miRNAs (pri-miRNAs) are processed by
Dicer-like 1 (DCL1) proteins, the RNase III enzyme, to
generate precursor miRNAs (pre-miRNAs) contains a 2-nt
overhang at 3end. The conversion processing of pri-to-pre-
miRNAs also requires two other proteins, HYPONASTY
LEAVES 1 (HYL1) and C2H2-zinc finger protein SER-
RATE (SE), which interact with DCL1 in nuclear processing
centers called D-bodies to produce a 60 to 300 nucleotide
hairpin structure known as the miRNA precursor (Jones-
Rhoades et al. 2006; Voinnet 2009; Jung et al. 2009). A
miRNA:miRNA duplex is methylated on its 3 nucleotide by
HEN, which has been discovered as an accessory factor
involving in RNA decay and miRNA degradation in plants.
(Jones-Rhoades et al. 2006; Li et al. 2005; Mullen and
Marzluff 2008; Jung et al. 2009). After this processing,
miRNA:miRNA duplex is transported into cytoplasm by
HASTY (HST), a homolog of exportin 5 in animals. The
hasty mutants have reduced accumulation of most miRNAs,
suggesting that HASTY is important for miRNA export
(Jung et al. 2009). In cytoplasm, the mature miRNAs are
incorporated of mature miRNAs are incorporated into the
RNA-induced silencing complex including ARGONAUTE
1 (AGO1), guiding the complex to identify target messages
for posttranscriptional gene silencing. Moreover AGO pro-
teins cleave target mRNAs of the complimentary site to
miRNA, several studies reports that the mutations of
AGO1 gene contribute to abnormally miRNA target gene
expressions (Kidner and Martienssen 2005). In plants, these
regulatory small RNAs direct cleavage their targets through
perfect or near-perfect binding complementary at the target
site and leading to the gene regulation at many levels such
as mRNA cleavage and translational inhibition (Jones-
Rhoades et al. 2006).
Plant tolerance to biotic and abiotic stresses is a complex
trait and one of the extensively studied research topics. To
improve such complex traits, a thorough understanding of the
transcriptional, post-transcriptional and post-translational
changes during stress is essential, because each of these reg-
ulations individually and together plays an important role in
adaptation to stress. Post-transcriptional gene regulation me-
diated by miRNAs is particularly interesting, because they
have the ability to regulate several protein coding genes be-
longing to related gene families or genes potentially implicat-
ed in the same pathway. Identification of stress-regulated
miRNAs will help in the design of new strategies for improv-
ing stress tolerance. It has been demonstrated through post-
transcriptional gene silencing that plant miRNAs are involved
in plant developmental processes, such as organ boundary
formation, organ polarity/radial patterning, and in the
development of root, stem, leaf, and flower organs
(Mallory and Vaucheret 2006). The identification of
regulatory miRNAs by cloning approach led to discover
that environmental factors can regulate miRNA levels,
53
coupled with the discovery of abiotic/biotic stress-responsive
genes as miRNA targets provided clues about the role of
miRNAs in stress responses (Jones-Rhoades and Bartel
2004; Sunkar et al. 2007; Phillips et al. 2007).
Although the founding members of miRNAs could be
discovered by genetic screening approaches, these approaches
were limited by their low efficiency, time consuming, and
high cost (Zhang et al. 2006a, b). miRNAs are small in size,
have a low expression level for many previously known
miRNAs, and have significant variation in their expression
levels in different tissues and/or under different environmental
conditions. These characteristics make it difficult to identify
miRNAs using genetic approaches.
Considering to the extraordinary characteristic of miR-
NAs that evolutionarily conserved in the plant species, a
powerful strategy, bioinformatics approaches combine to the
publicly available of expressed sequenced tag (EST) data-
bases have been developed to complement genetic screening
efforts for identifying miRNA genes. The principles of this
approach are based on the major features of miRNAs:
hairpin-shaped stem loop secondary structure, high conser-
vation from species to species, and high minimal folding
free energy index (MFEI). In plants, a number of miRNAs
and their targets have been identified by bioinformatics
approach in plant model systems for example; Arabidopsis
(Griffiths-Jones 2006), maize (Zhang et al. 2006a, b), rape-
seed (Xie et al. 2007), oil palm (Nasaruddin et al. 2007),
tomato (Yin et al. 2008), soybean (Zhang et al. 2008), poplar
(Lu et al. 2008), potato (Zhang et al. 2009), rice (Jian et al.
2010), and castor bean (Zeng et al. 2010).
Although plant miRNAs have been extensively studied in
diverse plant systems, less is known in other plants with
limited genome sequence data, especially the plants in the
family Euphorbiaceae. Euphorbiaceous family consists of
more than 300 genera and around 7,500 species, including
monoecious herbs, perennial shrubs and trees. These plants
are characterized with high photosynthesis and high bio-
mass, carry distinct physiologies, and have complex traits
adapting to dynamic environmental conditions. The agri-
economically important species in Euphorbiaceae are the
Castor bean (Ricinus communis), the Cassava (Manihot
esculenta), the Rubber tree (Hevea brasiliensis) and the
Jatropha (Jatropha curcas). Castor bean is the source of
oil which has been widely used in many applications. Cas-
sava is a woody shrub that is extensively cultivated as
annual crops in tropical and subtropical regions for its edible
starchy root, a major source of carbohydrates. Rubber tree is
of major economic importance because its latex can be
collected and is the primary source of natural rubber. Jatro-
pha is a perennial shrub producing a high-quality biodiesel
fuel. Leafy spurge is an herbaceous perennial plant which
has been identified as a serious weed and is being developed
as a model of weed biology.
54
A large number of miRNAs have been identified in
various plant species in recent year but there is limited
information of miRNAs in Euphorbiaceous species. There-
fore, we introduce the computational approach for analyzing
and compiling of the information including miRNAs
sequences, their precursor-secondary structures, and their
target mRNAs from plants in the family Euphorbiaceae.
Very little have been reported about the direct cloning of
miRNA from rubber tree, therefore the 6 miRNAs from the
computational approach were verified by the end-point re-
verse transcription polymerase chain reaction (RT-PCR) in
this study.
Materials and methods
miRNA reference set
A total of 526 potential mature miRNA sequences and their
precursor sequences of four plants of the family Euphorbia-
ceae: Cassava (178), Castor bean (47), Rubber tree (24) and
Leafy spurge (277) were obtained from microPC, A Com-
prehensive Resource for Predicting and Comparing Plant
MicroRNAs (Last updated 17 May 2009) (Mhuantong and
Wichadakul 2009).
The precursor miRNA sequences were analyzed for Min-
imal Folding Free Energy Index (MFEI), an index for de-
termination of the thermodynamic stability of each miRNA
sequence. The MFEI was calculated using the following
equation (where MFE denotes the negative folding free
energy (G))
MFEI MFE=length of the RNA sequence  100=G C% using NCode miRNA First-strand cDNA synthesis and
Availability of software
The secondary structures and stability of precursor miRNAs
were predicted to find out the localization of mature miRNAs
which generated using Mfold 3.2, a web server for nucleic
acid folding and hybridization prediction by Zuker (publicly
available at http://frontend.bioinfo.rpi.edu/applications/
mfold/cgi-bin/rna-form1.cgi) (Zuker 2003). The microPC
(http://www3a.biotec.or.th/micropc/) was used for predicting
target genes of miRNAs.
Prediction of potential miRNA target genes
The previous researches demonstrated that a majority of
plant miRNAs have highly complementary site(s) at their
targeted mRNAs (Jones-Rhoades and Bartel 2004). This
characteristic mentioned allowed the prediction of miRNA
targets by computational approaches based on the fact that
J. Plant Biochem. Biotechnol. (JanJune 2013) 22(1):5261
miRNAs are perfect or nearly perfect complementary to
the coding region of their mRNAs with no bubbles or
gaps at the complementary site (Reinhart et al. 2002;
Zhang et al. 2006a, b). The total mature miRNA sequen-
ces were scanned for their complementary target protein-
coding EST sequences of the same four Euphorbiaceous
plants from plantGDB. The potential miRNA targeted
genes were predicted using the following criteria: (1)
no more than 4 mismatches at complementary sites
between miRNA sequences and mRNA targets (2) no
bubbles or no gaps (3) no more than 1 G:U basepair
(Zhang et al. 2006a, b).
Plant material and small RNA extraction
The 8-years old mature virgin rubber trees (Hevea brasilien-
sis) of the PB217 clone were obtained from the Bongo/
Socit Africaine de Plantations Hvas plantaion in south-
eastern Ivory Coast (West Africa). The trees were selected and
sampled on the same week in April, during the transition
between the dry and wet seasons (Tungngoen et al. 2009).
The inner soft bark was transferred into liquid nitrogen and
ground into a fine powder, then small RNA ( 200 nt) was
extracted using the mirVana miRNA I solation kit (Ambion,
USA). The concentration and purity of RNA were determined
spectrophotometrically at 260 and 230 nM. The integrity of
isolated RNA was validated by analysis 15% (w/v) Polyacryl-
amide gel electrophoresis (PAGE).
miRNA first-stranded cDNA synthesis
The first stranded cDNA of small RNAs were generated
qRT-PCR kits (Invitrogen, USA) according to the manufac-
turers instructions. The small RNAs were polyadenylated
in 25 l reaction volume (100 ng of small RNA, 5X miRNA
Reaction Buffer, 25 mM MgCl2, 200 l ATP, Poly A Poly-
merase, and DEPC- treated water). The polyadenylated
RNA was further used for first-stranded cDNA synthesis
according to the reaction, 4 l of polyadenylated RNA,
1 l of annealing buffer and 3 l of 25 mM Universal RT
Primer. The mixture was further incubated at 65C for
15 min then placed on ice for 1 min. The 10 l of 2X
First-Strand Reaction Mix and SuperScript Enzyme Mix
was added and preheated at 50C for 50 min. To inactivate
reverse transcriptase, the mixture was incubated at 85C for
5 min to stop the reaction and aliquots were stored at 20C.
Identification of miRNAs in rubber tree using end-point
RT-PCR
The PCR amplification was carried out for 25 cycles with
60C annealing temperature, using 5 miRNA-specific
J. Plant Biochem. Biotechnol. (JanJune 2013) 22(1):5261 55

primers which were designed based on mature miRNA
sequences in Table 1 and 3 the Universal qPCR primer
(Invitrogen, USA) in a 25 l reaction volume which com-
posed of 10X of primers. The PCR products were analyzed
on a 1.8% agarose gel in 1X TAE buffer. The desired
product size was ranged ~85100 bp. Subsequently, the
cDNA fragments were directly cloned into pGEM -T Easy
Vector System (Promega, USA) and sequenced. The nucle-
otide sequencs were compared against mature miRNA
sequences of 2 model plants which are Arabidopsis thaliana
and Populus trichocarpa from miRBase.
Results and discussion
Identification of 526 potential miRNAs in four
Euphorbiaceous species
While molecular cloning is the most direct way of discov-
ering miRNAs, bioinformatic approaches have provided a
useful complement to cloning experiments. A total of 526
potential mature miRNA sequences of plants in Euphorbia-
ceae family were predicted using microPC, and were further
classified into 17 miRNA families (Table 2); 11 of leafy
spurge (Euphorbia esula), 1 of rubber tree (Hevea bra-
siliensis), 13 of cassava (Manihot esculenta), and 3 of
castor bean (Ricinus communis). To confirm the second-
ary structure of the potential precursor miRNAs, EST
sequences of Euphorbiaceous plants were computation-
ally folded. After performing the secondary structure
analysis using Mfold 3.2, it was found that mature
miRNAs were located at the 3-arm or 5-arm of pre-
miRNAs (Supplementary Figure S1). In this study, we
found that miRNAs have negative folding free energy
(G) ranging from 28.2 to 82.6 kcal/mol. Recently,
the minimal folding free energy index was developed as
the new criteria of miRNAs (Meyers et al. 2008). Pre-
vious published studies suggested that pre-miRNAs
sequences should have significantly higher MFEI than
other non-coding or coding RNAs, and the candidate
RNA sequences are more likely to be miRNAs when
the MFEI is greater than 0.85. In this study, the MFEIs of
precursor miRNAs were ranged from 0.71 to 1.44 kcal/mol
which satisfied the criteria defined for plant miRNA annota-
tion (Table 1).
The majority of miRNA families were able to be identi-
fied in cassava might result from the higher number of
cassava EST sequences that has been published in NCBI
database. Using ESTs database, only 3 potential conserved
miRNAs family in castor bean were identified in this study.
In contrast,, it should be noted that using recent castor bean
genome database, the 85 conserved miRNAs in 23 families
had been predicted in the castor bean (Zeng et al. 2010).
However, the only 58 of the 85 miRNAs were experimen-
tally verified that they expressed in one of four Euphorbia-
ceous species, the Castor bean, the Cassava, the Rubber tree
and the Jatropha (Jatropha curcas L.), during normal seed-
ling development (Zeng et al. 2010). Thus, a fewer potential
mature miRNAs which were identified in this study might
result from the limited number of EST sequences and un-
completed genome sequencing of individual Euphorbia-
ceous plant species. The secondary structure of the
potential precursor miRNAs was computationally predicted.
In this study, the MFEIs of precursor miRNAs were ranged
from 0.71 to 1.44 kcal/mol. The MFEI value is significantly
higher than those of other types of RNA (tRNAs (0.64),
rRNAs (0.59), and mRNAs (0.620.66)) (Zhang et al.
2006c).
Prediction of potential miRNA targets in four
Euphorbiaceous species biaceae
Using the target scanner from microPC, we found 16 poten-
tial conserved miRNA families and predicted mRNA targets
against EST sequences of selected plants from PlantGDB
database (Table 3). The functions of mRNA targets function
could be divided in to several groups (Fig. 1), including the
molecular function (45%), the transcription factors (23%),
biological process (14%), the transcriptional initiators (2%)
and the other (unknown) (4%). The target genes of each
miRNA members were shown in Supplementary Table S1.
The prediction of potential miRNA targets was done
against EST sequences of selected plants from PlantGDB
database. The target genes of each miRNA members were

Table 1 miRNA primers used

in this study miRNAs miRNA-specific primer (5-3)a Annealing temperature (C) Length (nt)

miR156 GAGGTGAGGCTGACAGAAGAGAG 60 23
miR159 CCGGAGTTCGTTTGGATTGAAGGGA 60 25
miR160 CGTAAACTGCCTGGCTCCCTG 60 21
miR166 GTTTCTCCTCGGACCAGGCTTC 60 22
miR167 GCATCTGATGAAGCTGCCAGCA 60 22
a
the 15 nucleotide sequences miR172 CCGGCGTTGAGAATCTTGATGAT 60 23
specific to each miRNA were miR393 CAGAGGATCCAAAGGGATCGCA 60 22
underlined
56 J. Plant Biochem. Biotechnol. (JanJune 2013) 22(1):5261

Table 2 List of potential miRNAs in Euphorbiaceous plants

miRNA Mature sequence Accession Gene Location LMa/nt LPa/nt G C MFEs MFEIs
number source content content

Euphorbia esula
miR156 ugacagaagagagugagcac DV157451.1 EST 5 20 86 17 20 47.8 1.29
miR157a uugacagaagauagagagcac DV123826.1 EST 5 21 85 17 14 40.3 1.3
miR159 uuuggauugaagggagcucua DV144273.1 EST 3 20 168 40 30 72.9 1.04
miR160 ugccuggcuccuuguaugcca DV141695.1 EST 5 21 81 20 17 48.2 1.3
miR162 ucgauaaaccucugcauccag DV153694.1 EST 3 21 92 19 22 33.8 0.82
miR166j cggaccaggcuucauuccc DV141066.1 EST 3 19 99 25 23 41.9 0.87
miR169a agccaaggaugacuugcc DV142312.1 EST 5 18 83 18 18 44.2 1.23
miR170 ugauugagccgugccaauauc DV136695.1 EST 3 21 78 21 12 47.4 1.44
miR171 ugauugagccgugccaauauc DV136695.1 EST 3 21 78 21 12 47.4 1.44
miR319 uuggauugaagggagcucc DV144273.1 EST 3 19 167 40 30 71 1.01
miR408 augcacugccucuucccuggc DV143909.1 EST 3 21 83 20 23 45 1.05
Hevea Brasiliensis
miR166 ucggaccaggcuucauucc EC601181.1 EST 3 19 88 18 19 28.2 0.76
Manihot esculenta
miR159 uuuggauugaagggagcucua DB935460.1 EST 3 21 194 46 36 80.3 0.98
miR162 ucgauaaaccucugcauccag FF380876.1 EST 3 21 92 21 21 35.3 0.84
miR166j cggaccaggcuucauuccc DV449619.1 EST 3 19 145 32 29 51.4 0.84
miR168 ucgcuuggugcaggucgggaa DB925940.1 EST 5 21 138 36 27 51 0.81
miR169b gccaaggaugacuugccug DV452747.1 EST 5 19 112 26 23 38.5 0.79
miR170 ugauugagccgcgucaauauc DV454131.1 EST 3 21 79 15 14 33.1 1.14
miR171a gauugagccgcgucaauauc DV454131.1 EST 3 20 79 15 14 33.1 1.14
miR172 gaaucuugaugaugcugcau CK645041.1 EST 3 20 128 33 27 42.8 0.71
miR319 uuggauugaagggagcuc DB935460.1 EST 3 18 177 43 37 82.6 1.03
miR394 uuggcauucuguccaccucc CK652213.1 EST 5 20 76 16 23 30.8 0.79
miR399 ugccaaaggagauuugccc DB932374.1 EST 3 19 93 19 26 39.7 0.88
miR535 ugacgacgagagagagcac DB928603.1 EST 5 19 79 23 18 46 1.12
miR1533 auaauaaaaauaauaau DV442277.1 EST 3 17 196 35 35 50.6 0.72
Ricinus communis
miR159 uuuggauugaagggagcucua EG662925.1 EST 3 21 172 45 30 78.4 1.05
miR160a ugccuggcucccuguaugcca EG668418.1 EST 5 21 80 25 24 47 0.96
miR319 uuggauugaagggagcuc EG662925.1 EST 3 18 168 44 30 75.8 1.02

different in functions. The largest group of miRNA target
genes consists of 12 regulatory genes predicted to encode
transcription factors, which control various plant develop-
mental processes. In this study, SQUAMOSA promoter
binding protein (SPL) genes were predicted as the target of
miR156 and miR157 which are closely related in sequences
and their target genes. SPL genes are a family of plant-
specific transcription factors that contain a highly conserved
DNA-binding domain (SQUA promoter-binding protein
[SBP] domain). The regulation of miR156 and its target
genes was believed to be involved in the switch from veg-
etative to reproductive development of flowers, increasing
in the number of leaves, delayed flowering, the transition
from the juvenile to the adult phase of shoot development,
and decreasing in apical dominance. Recently the
correlation between miR156 and miR172 has been reported
in plants (Xie et al. 2006). miR156 regulates the expression
of miR172 via SPL9 which, redundantly with SPL10, di-
rectly promotes the transcription of miR172b (Wu et al.
2009).
Auxins are a class of phytohormone having an essential
role in coordination of many growth and behavioral pro-
cesses in the plant life cycle for example; induction of the
cell differentiation and regeneration of the vascular tissues
in wounding response and promoting the root growth and
shoot apical dominance. Moreover, at the high concentra-
tions, auxin can induce the synthesis of ethylene. Auxin can
stimulate or inhibit the expression of specific genes through
the action of auxin response factor (ARF) (Gutierrez et al.
2009). In this study, miR160 was predicted to target ARF 10
J. Plant Biochem. Biotechnol. (JanJune 2013) 22(1):5261 57

Table 3 The predicted targets of Euphobiaceous miRNAs

miRNA Target protein Hevea Manihot Ricinus Euphorbia Target

brasiliensis esculenta communis esula Function

miR156 Lactoylglutathione lyase Molecular Function

Tubulin folding cofactor A Biological process
Squamosa promoter-binding protein Transcription factors
Root phototropism protein 2 Biological process
Ion channel CASTOR, chloroplast precursor Molecular Function
miR157 Squamosa promoter-binding protein Transcription factors
miR159 Diphenol oxidase, Laccase Molecular Function
Carbonic anhydrase, chloroplast precursor Molecular Function
RING-H2 finger protein ATL1M Biological process
Gag-pol polyprotein unknown
YABBY-like transcription factor Transcription factors
Thiohydroximate S-glucosyltransferase Molecular Function
Teosinte branched1 - like protein Transcription factors
Protein kinase Molecular Function
miR160 Auxin response factor 10 Transcription factors
Prolyl-tRNA synthetase Molecular Function
miR162 Ankyrin-repeat-containing protein Transcriptional initiators
Chlorophyll a-b binding protein CP293, Cellular Component
chloroplast precursor
miR166 Ferredoxin, chloroplast precursor (PFLP) Molecular Function
Class III HD-Zip protein5, 6, 8 Transcription factors
Nascent polypeptide-associated complex subunit Cellular Component
alpha-like protein 1 (NAC-alpha-like protein 1)
Beta-1,3-glucanase Molecular Function
60S ribosomal protein L6 (YL16-like) Cellular Component
Cytochrome P450 76 C1 Molecular Function
miR169 Nuclear transcription factor Y subunit A-3 (AtNF-YA-3) Transcription factors
4,5-DOPA dioxygenase extradiol-like protein Molecular Function
Cytochrome P450 71A1 Molecular Function
CDPK-related protein kinase Molecular Function
miR168 Protein argonaute Cellular Component
miR170 Scarecrow-like 6 (SCL6) Transcription factors
miR171 Synaptobrevin-related protein Molecular Function
Scarecrow-like 6 (SCL6) Transcription factors
Endo-beta-1,4-glucanase precursor Biological process
miR172 Rubber elongation factor Transcription factors
Protein kinase-like Molecular Function
Mutant cincinnata unknown
Putative receptor like kinase (RLK) Molecular Function
Receptor-like serine-threonine protein kinase Biological process
miR319 Diphenol oxidase, Laccase Molecular Function
Carbonic anhydrase, chloroplast precursor Molecular Function
RING-H2 finger protein ATL1M Biological process
Gag-pol polyprotein unknown
GTPase Molecular Function
Teosinte branched1 - like protein Transcription factors
YABBY-like transcription factor GRAMINIFOLIA Transcription factors
Thiohydroximate S-glucosyltransferase Molecular Function
miR394 Quinone oxidoreductase Molecular Function
58
Table 3 (continued)
miRNA Target protein
miR399 Ubiquinolcytochrome-c reductase
Rhodanese like protein
Phenylalanine ammonia lyase
Cell cycle switch protein CCS52A
Delta-aminolevulinic acid dehydratase, chloroplast precursor
miR408 Proteasome subunit alpha type-4
Basic blue protein (Cusacyanin) (Plantacyanin) (CBP)
Proteasome subunit alpha type-4
miR535 Elongation factor 1-gamma (EF-1-gamma)
Transcription factor BIM1 (BES1-interacting
Myc-like protein 1)
and 16 that have been reported in regulating the expression of
auxin response genes in apical root formation, embryo devel-
opment, fruit development, vascular tissue formation, hormone
response, flowering, leaf senescence, and floral abscission.
The miR166, only one miRNA family predicting in rub-
ber tree, target the transcripts of HD-Zip class III transcrip-
tion factors describing as developmental regulators of the
apical meristem, the vascular bundles, auxin transport and
the adaxial domains of lateral organs (Ko et al. 2006;
Hawker and Bowman 2004). miR169 targets nuclear tran-
scription factor Y subunit A-3. which is a ubiquitous tran-
scription factor composed of three distinct subunits (NF-YA,
NF-YB, and NF-YC). It is shown that NFYA5 is down-
regulated by miR169 by drought stress through an ABA-
dependent pathway. Moreover miR169 can restricted the
expression of MtHAP2-1, a new transcription factor of the
Fig. 1 Functional categorization of miRNA targets in four Euphorbia-
ceous plants
J. Plant Biochem. Biotechnol. (JanJune 2013) 22(1):5261
Hevea Manihot Ricinus Euphorbia Target
brasiliensis esculenta communis esula Function
Molecular Function
Molecular Function
Molecular Function
Biological process
Molecular Function
Cellular Component
Biological process
Cellular Component
Cellular Component
Transcription factors
CCAAT-binding family, in the nodule meristematic zone
which is essential for the differentiation of nodule cells
(Sunkar and Zhu 2004). In woody plant, it has been shown
that various transcription factors are responsible in the reg-
ulating of secondary growth for example; Auxin response
factor (ARF), Class III homeodomain-leucine Zipper (HD-
ZIP III), Kanadi (KAN), MYB and NAC (Demura and
Fukuda 2007). Moreover, it has been shown that these
transcription factors act as the target of miRNAs. The better
understanding of the regulation of miRNAs and their target
genes will be an alternative way to control plant transcrip-
tion factors concerning as an important component that
might govern the complex networks of transcriptional reg-
ulation involved in wood formation.
Putative SCARECROW gene regulator 6 (SCL6) is a class
of plant-specific transcription factors that control the plant
developmental processes (Llave et al. 2002). In this study
SCL6 is predicted as miR170 and miR171 targeted genes that
predominantly play role in flower development. APETALA 2
(AP2) genes and AP2/ethylene responsive factor (ERF) are
also targeted by miR172 and miR530, respectively (Zhao et al.
2008). AP2 homolog HAP2 play a variety of roles throughout
the plant life cycle: from being key regulators of several
developmental processes, like floral organ identity determina-
tion or control of leaf epidermal cell identity, to forming part of
the mechanisms used by plants to respond to various types of
biotic and environmental stresses while AP2/ERF genes act as
nodes of regulatory network in plant response to many stresses,
which are conserved in many plants (Zhuang et al. 2006).
Other groups of miRNA targets composed of non-regulatory
genes involving in various aspects for example, rubber elonga-
tion factor (REF), cytochrome P450 and putative gag-pol poly-
protein. Rubber elongation factor is predicted to be a target of
miR172. It associated with the large rubber particles in the
latex, and is required for rubber molecule elongation. It is
interesting that this is the first report showing that rubber
J. Plant Biochem. Biotechnol. (JanJune 2013) 22(1):5261
Fig. 2 The end-point RT-PCR
results of miRNA-specific pri-
mers in rubber tree. A negative
control (no template control,
NT) was included for each
primer combination. Amplifi-
cation of ~85100 bp products
will be regarded as expressed
miRNAs where the band
appeared in 1.8% agarose gel.
The sizes in base pairs of stan-
dard DNA molecular weight
marker (M) bands are indicated
elongation factor is possible to be the target of miRNAs.
Further verification of miR172 and their target rubber elonga-
tion factor in rubber is needed to be done. Cytochromes P450
are also predicted as the target genes of miR169 in leafy
spurge which participate in a variety of biochemical pathways
to produce primary and secondary metabolites. The P450
families conserved throughout land plants function in produc-
ing defense chemicals such as phenylpropanoids, alkaloids,
terpenoids, lipids, cyanogenic glycosides, and glucosinolates,
as well as plant hormones (Werck-Reichhart and Feyereisen
2000; Mizutani 2010). Gag-pol polyprotein was found to be a
target of miR319 however the function of this gene is not well
understood in plants. Apart from these target genes, we also
found that miR168 targeted ARGONAUTE 1 (AGO1) gene
which is a core component of RISC involving in miRNA
biogenesis (Voinnet 2009). This evidence shows that there is
the feedback regulation, a mechanism that helps ensure proper
overall levels of miRNAs in plants.
From this investigation, it was interesting that some miR-
NAs contained different targets, which suggests that miRNAs
may have diverse functions depending on plant species and
environmental conditions. Consistent with the results of Lu et
al. (2005) and Lu et al. (2008), they found that some of
miRNA families deeply conserved among various plant spe-
cies might target functionally different genes for cleavage in a
species-dependent manner. Surprisingly, only one candidate
rubber tree miRNA was identified in this study. This finding
might result from 1) the limitation of incomplete rubber tree
EST database; 2) the majority of pre-miRNAs are usually very
short (approximately 100 nt), and thus, processed rapidly in
the cells; 3) the expression of miRNAs is very low leading to a
low probability of detection; and 4) although computational
approaches have allowed for great progress in identifying
miRNA genes, lots of miRNAs, especially species-specific
miRNAs, await discovery.
Verification of the 6 miRNAs in rubber tree
The small RNA extracted with the mirVana miRNA Iso-
lation kit (Ambion, USA) should be longer than 200 nt.
59
After the polyadenylation of miRNA and the first-strand
cDNA synthesis, they should be about 250 nt. According
to the size of mature miRNAs (2024 nt), the PCR products
of mature miRNA plus its polyadenylation should be ranged
between 85100 bp.
miRNA discovery are usually identified by the experi-
mental approach using direct cloning, involve isolation
small RNAs, ligating adaptor oligonucleotides, reverse tran-
scription, amplification, and sequencing. In this study, the
end-point RT-PCR results showed that seven miRNAs spe-
cific primers, miR156, miR159, miR160, miR166, miR167,
miR172 and miR393, were able to amplify PCR products
from cDNA of rubber tree (Fig. 2). To confirm that miRNAs
in rubber tree are conserved with other plants, the cloning
and sequencing of the amplified PCR products were per-
formed. The multiple alignment of Hbr-miRNAs with ma-
ture miRNA sequences from A. thaliana and P. trichocarpa,
considering as plant models, were done. Of these seven
candidates, the six Hbr-miRNAs were found to be homolo-
gous with these plant species as shown in Supplementary
Table S2. The unique nucleotide sequences of each mature
miRNA in rubber tree were shown in Table 4. It should be
noted that although the miR156 specific primer gave an
expected site of PCR product but after cloning and sequenc-
ing, miR156 candidate clones were not homologous with
any mature miR156 sequences of 2 model plants which are
A. thaliana and P. trichocarpa from miRBase.
Table 4 The sequence analysis of miRNAs
Name miRNA sequencesa Length (nt)
Hbr-miR159 TTTGGATTGAAGGGAGCTCT 20
Hbr-miR160 TGCCTGGCTCCCTGTATGAT 18
Hbr-miR166 TCGGACCAGGCTTCATTCCCT 21
Hbr-miR167 TGAAGCTGCCAGCATGATCT 20
Hbr-miR172 AGAATCTTGATGATGCTGC 19
Hbr-miR393 TCCAAAGGGATCGCATTGATCT 22
a
the conserved nucleotide sequences of each miRNA were underlined,
and the additional nucleotide sequences were specific to each rubber
tree miRNA
60
miRNA discovery are usually identified by the experi-
mental approach using direct cloning, involving isolation of
small RNAs, ligating adaptor oligonucleotides, reverse tran-
scription, amplification, and sequencing (Jones-Rhoades et
al. 2006). miRNAs identification of Arabidopsis was the
initial cloning experiment in plant (Park et al. 2002; Reinhart
et al. 2002) and have expanded to O. sativa (Sunkar et al.
2005a, b) and P. trichocarpa (Lu et al. 2005). In contrast,
miRNAs information was insufficient in Euphorbiaceae fam-
ily. In this study, the six miRNAs were verified to be
expressed in rubber tree. In 2009, Zeng et al. reported 85
conserved miRNAs in 23 families in R. communis and char-
acterized 58 miRNAs in four Euphorbiaceous species, R.
communis, M. esculenta, H. brasiliensis and J. curcas (Zeng
et al. 2010). It should be noted that in this present study we
were able to identify miR167 which has never been reported
in rubber tree.
In summary, the 17 potential miRNA families and their
targets were identified in 4 Euphorbiaceous plants based on
the computational approach. The 6 Hbr-miRNAs were ver-
ified using experimental approach in rubber tree, and this is
the first report of Hbr-miR167. This is considered the initial
step towards the identification of miRNAs in rubber tree. To
gain our understanding of miRNAs and their targets, the
expression analysis will be the major step of further exper-
imentally verify. Gaining insight into the miRNA targets
will help us to understand the range of miRNA expression
regulation and to more coherently describe the functional
importance of miRNAs in these economically important
Euphorbiaceous species.
Acknowledgements This research was financially supported by Na-
tional Science and Technology Development Agency, (grant No. BT-
B-01-PG-14-5202) and Mahidol University. Lertpanyasampatha M..
was supported by the Royal Golden Jubilee Ph.D. program (no.
PHD/0216/2550). Pramoolkit P. was partially supported by Biotech
Alumni Scholarship, Department of Biotechnology, Faculty of Sci-
ence, Mahidol University.
References
Demura T, Fukuda H (2007) Transcriptional regulation in wood for-
mation. Trends Plant Sci 12:13601385
Griffiths-Jones S (2006) miRBase: The microRNA sequence database.
Methods Mol Biol 342:129138
Gutierrez L, Bussell JD, Pcurar DI, Schwambach J, Pcurar M, Bellini
C (2009) Phenotypic plasticity of adventitious rooting in Arabi-
dopsis is controlled by complex regulation of AUXIN RE-
SPONSE FACTOR transcripts and microRNA abundance. Plant
Cell 21:31193132
Hawker NP, Bowman JL (2004) Roles for class III HD-Zip and
KANADI genes in Arabidopsis root development. Plant Physiol
135:22612270
Jian X, Zhang L, Li G, Zhang L, Wang X, Cao X, Fang X, Chen F
(2010) Identification of novel stress-regulated microRNAs from
Oryza sativa L. Genomics 95:4755
J. Plant Biochem. Biotechnol. (JanJune 2013) 22(1):5261
Jones-Rhoades MW, Bartel DP (2004) Computational identification of
plant miRNAs and their targets, including a stress-induced
miRNA. Mol Cell 14:787799
Jones-Rhoades MW, Bartel DP, Bartel B (2006) MicroRNAs and their
regulatory roles in plants. Annu Rev Plant Biol 57:1953
Jung JH, Seo PJ, Park CM (2009) MicroRNA biogenesis and function
in higher plants. Plant Biotechnol Rep 3:111126
Kidner CA, Martienssen RA (2005) The role of ARGONAUTE1.
Nature 428:313321
Ko JH, Prassinos C, Han KH (2006) Developmental and seasonal
expression of PtaHB1, a Populus gene encoding a class III HD-
Zip protein, is closely associated with secondary growth and
inversely correlated with the level of microRNA (miR166). New
Phytol 169:469478
Li J, Yang Z, Yu B, Liu J, Chen X (2005) Methylation protects
miRNAs and siRNAs from a 3-end uridylation activity in Arabi-
dopsis. Curr Biol 15:15011507
Llave C, Xie Z, Kasschau KD, Carrington JC (2002) Cleavage of
Scarecrow-like mRNA targets directed by a class of Arabidopsis
miRNA. Science 297:20532056
Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL (2005) Novel and
mechanical stressresponsive microRNAs in Populus trichocarpa
that are absent from Arabidopsis. Plant Cell 17:2186203
Lu S, Sun YH, Chiang VL (2008) Stress-responsive microRNAs in
Populus. Plant J 55:131151
Mallory AC, Vaucheret H (2006) Functions of microRNAs and related
small RNAs in plants. Nat Genet Sup 38:S31S36
Meyers BC, Axtell MJ, Bartel B, Bartel DP, Baulcombe D, Bowman
JL, Cao X, Carrington JC, Chen X, Green PJ, Griffiths-Jones S,
Jacobsen SE, Mallory AC, Martienssen RA, Poethig RS, Qi Y,
Vaucheret H, Voinnet O, Watanabe Y, Weigel D, Zhu JK (2008)
Criteria for annotation of plant MicroRNAs. Plant Cell 20:3186
3190
Mhuantong W, Wichadakul D (2009) MicroPC (PC): A comprehen-
sive resource for predicting and comparing plant microRNAs.
BMC Genomics 10:366374
Mizutani M (2010) Diversification of P450 genes during land plant
evolution. Annu Rev Plant Biol 61
Mullen TE, Marzluff WF (2008) Degradation of histone mRNA
requires oligouridylation followed by decapping and simulta-
neous degradation of the mRNA both 5 to 3 and 3 to 5. Genes
Dev 22:5065
Nasaruddin NM, Harikrishna K, Othman RY, Hoon LS, Harikrishna A
(2007) Computational prediction of microRNAs from pol palm
(Elaeis guineensis Jacq.) expressed sequence tags. Asia Pac J Mol
Biol 15:107113
Park W, Li J, Song R, Messing J, Chen X (2002) CARPEL FACTORY,
a Dicer homolog, and HEN1, a novel protein, act in microRNA
metabolism in Arabidopsis thaliana. Curr Biol 12:148495
Phillips JR, Dalmay T, Bartels D (2007) The role of small RNAs in
abiotic stress. FEBS Lett 581:35923597
Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP (2002)
MicroRNAs in plants. Genes Dev 16:161626
Sunkar R, Zhu JK (2004) Novel and stress-regulated microRNAs
and other small RNAs from Arabidopsis. Plant Cell 2001
2019
Sunkar R, Girke T, Jain PK, Zhu JK (2005a) Cloning and character-
ization of microRNAs from rice. Plant Cell 17:1397411
Sunkar R, Girke T, Zhu JK (2005b) Identification and characterization
of endogenous small interfering RNAs from rice. Nucleic Acids
Res 33:444354
Sunkar R, Chinnusamy V, Zhu J, Zhu JK (2007) Small RNAs as big
players in plant abiotic stress responses and nutrient deprivation.
Trends Plant Sci 12:301309
Tungngoen K, Kongsawadworakul P, Viboonjun U, Katsuhara M,
Brunel N, Sakr S, Narangajavana J, Chrestin H (2009)
J. Plant Biochem. Biotechnol. (JanJune 2013) 22(1):5261
Involvement of HbPIP2;1 and HbTIP1;1 aquaporins in ethylene
stimulation of latex yield, through regulation of water exchanges
between inner liber and latex cells in Hevea brasiliensis. Plant
Physiol 151: 843856
Voinnet O (2009) Origin, biogenesis, and activity of plant microRNAs.
Cell 136:669687
Werck-Reichhart D, Feyereisen R (2000) Cytochromes P450: a success
story. Genome Biol 1:3003.13003.9
Wu G, Park MY, Conway SR, Wang JW, Weigel D, Poethig RS (2009)
The sequential action of miR156 and miR172 regulates develop-
mental timing in Arabidopsis. Cell 138:750759
Xie K, Wu C, Xiong L (2006) Genomic organization, differential
expression, and interaction of SQUAMOSA promoter-binding-
like transcription factors and microRNA156 in rice. Plant Physiol
142:280293
Xie FL, Huang SQ, Guo K, Xiang AL, Zhu YY, Nie L, Yang ZM
(2007) Computational identification of novel microRNAs and
targets in Brassica napus. FEBS Lett 581:14641474
Yin Z, Li C, Han X, Shen F (2008) Identification of conserved micro-
RNAs and their target genes in tomato (Lycopersicon esculen-
tum). Gene 414:6066
Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang-Peng M
(2010) Conservation and divergence of microRNAs and their
61
functions in Euphorbiaceae plants. Nucleic Acids Res 38:981
995
Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA (2006a)
Computational identification of microRNAs and their targets.
Comput Biol Chem 30:395407
Zhang BH, Pan XP, Anderson TA (2006b) Identification of 188 conserved
maize microRNAs and their targets. FEBS Lett 580:37533762
Zhang BH, Pan XP, Cox SB, Cobb GP, Anderson TA (2006c) Evidence
that miRNAs are different from other RNAs. Cell Mol Life Sci
63:246254
Zhang BH, Pan XP, Stellwag EJ (2008) Identification of soybean
microRNAs and their targets. Planta 229:161182
Zhang W, Luo Y, Gong X, Zeng W, Li S (2009) Computational
identification of 48 potato microRNAs and their targets. Comput
Biol Chem 33:8493
Zhao W, Qiao YS, Zhang Z, Xiong AS, Yao QH (2008) Genome-wide
analysis of the AP2/ERF gene family in Populus trichocarpa.
Biochem Bioph Res Co 371:468474
Zhuang J, Cai B, Peng RH, Zhu B, Jin XF, Xue Y, Gao F, Fu XY, Tian YS,
Groover A, Robischon M (2006) Developmental mechanisms regulat-
ing secondary growth in woody plants. Curr Opin Plant Biol 9:5558
Zuker M (2003) Mfold web server for nucleic acid folding and hybrid-
ization prediction. Nucleic Acids Res 31:34063415