Sie sind auf Seite 1von 5

Appl Microbiol Biotechnol (1995) 43:65-69 © Springer-Verlag 1995

M. Z. A. Bhuiyan • K. Ueda • Y. Inouye


M. Sugiyama

Molecular cloning and expression in Escherichia coli


of bleomycin-resistance gene
from a methicillin-resistant Staphylococcus aureus
and its association with IS431 mec

Received: 18 April 1994/Received last revision: 1 July 1994/Accepted: 26 July 1994

Abstract A gene that confers bleomycin resistance was carries a Neomycin-resistance determinant (Genilloud
cloned from the chromosomal DNA of methicillin-re- et al. 1984; Mazodier et al. 1985). Sugiyama et al. have
sistant Staphylococcus aureus (MRSA) B-26 into the cloned two Neomycin-resistance genes, designated
plasmid pUC18. It is of chromosomal origin rather blmA and blmB, from Neomycin-producing S. verticil-
than plasmid and exists in the chromosome making lus and demonstrated that they encode bleomycin-
a cluster with the kanamycin-resistance gene. We found binding protein and Neomycin acetyltransferase
that the nucleotide sequence of the Neomycin-resist- respectively (Sugiyama et al. 1994). In addition, a strain
ance gene from the chromosome of MRSA B-26 is harbouring the staphylococcal plasmid p U B l l 0
identical to that from a staphylococcal plasmid, (Jalanko et al. 1981) was resistant to bleomycin (Semon
pUBll0. The partial sequence of IS431mec was also et al. 1987). Although the bleomycin-resistance genes
found upstream from the DNA fragment containing encoded in pUB110 and Tn5 have been sequenced, the
the bleomycin- and kanamycin-resistance genes. biochemical mechanism of resistance has not yet been
elucidated (Mazodier et al. 1985; Semon et al. 1987).
Almost all strains of methicillin-resistant Staphyl-
ococcus aureus (MRSA), isolated in Hiroshima Univer-
Introduction sity Hospital from October 1990 to April 1992, were
resistant to Neomycin, which was not used as an anti-
Bleomycin, an aminoglycopeptide, is one of the impor- bacterial agent. From our observation that the
tant antineoplastic antibiotics isolated from Streptomy- Neomycin-resistance properties did not disappear,
ces verticillus (Umezawa 1975). The mode of action of even when the MRSA cells were treated with ethidium
bleomycin has been studied extensively and it was bromide as a plasmid-curing agent (Bouanchaud et al.
proved that the drug causes cell death as a result of 1969), these strains were thought to be resistant to the
multiple strand scissions by direct interaction with the drug as a result of the presence of the gene in the
tumour cell DNA. Detailed studies have elucidated the chromosome rather than in the plasmid.
mechanism of Neomycin-induced double-strand In the present study we cloned a gene that confers
breaks in bacterial and viral DNA (Haidle and Lloyd Neomycin resistance from the chromosomal DNA of
1979). a MRSA strain isolated from Hiroshima University
A transposon Tn5, originally identified as a compon- Hospital, Japan, and the possibility of the bleomycin-
ent of an R factor from Klebsiella (Berg et al. 1975), resistance determinant as a transposable element in
MRSA strains is discussed.

M. Z. A. Bhuiyan • K. Ueda
Materials and methods
Department of Paediatrics,
Hiroshima University School of Medicine,
Kasumi 1-2-3, Minami-ku, Hiroshima 734, Japan Bacterial strains and plasmids

Y. Inouye . M. Sugiyama ( ~ ) Methicillin-resistant Staphylococcus aureus (MRSA) B-26 was used


Institute of Pharmaceutical Sciences, to clone a gene encoding a chromosomal Neomycin-resistance
Hiroshima University School of Medicine, Kasumi 1-2-3, determinant. Escherichia coli TG1 and E. coli DH5c~ were used as
Minami-ku, Hiroshima 734, Japan. hosts for cloning and sequencing experiments. Plasmids pUC18,
Fax: 81-82-257-5284 pUCll8 and pUCll9 were used as vectors. E. coli TB1 was used as
66

a host for expression vector pMALc-2 (Maina et al. 1988) obtained Reagents used
from New England BioLabs Inc. (Beverly, Mass., USA). E. coli
harbouring the pUC-based plasmids and pMALc-2 were cultivated Restriction enzymes were purchased from New England Biolabs Inc.
in LB broth containing 100 gg/ml ampicillin at 37°C overnight. and Toyobo Co. Ltd. (Osaka, Japan). A ligation kit containing T4
MRSA B-26 was cultivated in TSB broth (Difco laboratories, De- DNA ligase was obtained from Gibco BRL (Gaithersburg, Md.,
troit, Mich., USA) containing 100 gg/ml bleomycin A2 sulphate at USA). A PCR-amplification kit containing Taq polymerase and
37°C overnight. dNTP was purchased from Takara Shuzo Co. Ltd. (Kyoto, Japan).

Preparation of chromosomal DNA


Results
The chromosomal DNA from MRSA B-26 was isolated according
to the method of Davis et al. (1980) after cell lysis using lysozyme and Cloning and expression of the Neomycin-resistance
achromopeptidase. gene in E. coli

Preliminary experiments confirmed that no plasmid


Shotgun cloning of the bleomycin-resistance gene
DNA was present in MRSA B-26. To clone a gene for
The chromosomal DNA was partially digested with several different Neomycin resistance from MRSA B-26, we partially
restriction enzymes, either singly or in combination, and ligated to digested the chromosomal DNA with several different
pUC18 digested with the same enzyme. The chimeric plasmid was restriction enzymes, either singly or in combination,
introduced into E. coli cells by electroporation using the Transpor- ligated the fragments to pUC18 cleaved with the same
ator (BTX Electro Cell Manipulator, San Diego, Calif., USA), ac- enzyme, and introduced the products into E. coli TG1.
cording to the manufacturer's instructions. LB agar containing am-
picillin (100 ~tg/ml) and Neomycin A2 sulphate (100 gg/ml) was used Only when the chromosomal DNA was digested with
to screen bleomycin-resistant transformants. HindIII, were three clones resistant to bleomycin
obtained. The plasmids isolated from these clones all
contained the same 5.1 x 103-base (5.1-kb) insert of
Oligonucleotides and polymerase chain reaction Staphylococcus DNA in the same direction. A partial
restriction map of the plasmid, designated pl 8KBA1, is
To amplify the structural gene for bleomycin resistance from MRSA shown in Fig. 1. E. coli harbouring the plasmid was
B-26 by the polymerase chain reaction (PCR), two primers having
EcoRI and BamHI sites at the 5'- and 3'-adjacent regions respect-
resistant even to 1000 gg/ml bleomycin.
ively, designated primer I(5'-ATGCGAATTCATGTTACAG-
TCTATCCCGGC-3') and primer 2 (5'-ATAAGGATCCTTAG-
CTTTTTATTTGTTGAA-3'), were designed on the basis of the
nucleotide sequence of the Neomycin-resistance gene from pUB110 Clustering with the kanamycin-resistance gene
(Semon et al. 1987) and synthesized using a Cyclone Plus DNA
synthesizer (MilliGen Bioresearch, Bedford, Mass., USA) by Bio- E. coli harbouring p18KBA1 was also resistant to
Synthesis Inc. (Lewisville, Tex., USA). A 1.6-kb BamHI-BglI! frag- 100 gg/ml kanamycin. To localize both the Neomycin-
ment containing the bleomycin-resistance gene from MRSA B-26
was used as a template for the PCR. PCR amplification was per- and kanamycin-resistance genes the deletion deriva-
formed according to the method described previously (Innis et al. tives ofpl8KBA1 were constructed; the plasmid, desig-
1990). nated pl8KBA2, was obtained by double digestion of
pl8KBA1 with HindIII and BamHI and subsequent
ligation (Fig. 1). E. coli TG1, harbouring the 2.6-kb
Subcloning of the PCR-amplified gene BamHI-HindIII insert, contained in the p 18KBA2 plas-
mid, was also resistant to both antibiotics.
The structural gene for bleomycin resistance, amplified by the PCR The pl8KBA3 plasmid, which contained the 1.6-kb
method, was inserted into an expression vector pMALc-2 and intro-
duced into E. coli TB1. The structural gene is expected to be BglII-BamHI segment from the cloned 5.1-kb HindIII-
expressed under the control of the tac promoter in pMALc-2 HindIII DNA fragment, was also constructed. E. coli
(Maina et al. 1988). harbouring pl8KBA3 was resistant to bleomycin, but
not to kanamycin. E. coli harbouring plasmid
pl8KBA4, in which the 2.6-kb BamHI-HindIII seg-
DNA sequencing ment was deleted from the 5.1-kb HindIII-HindIII
DNA fragment, no longer expressed both bleomycin
Some DNA fragments were subcloned into pUC118 and pUC119.
The plasmids were isolated by the alkaline extraction procedure of
and kanamycin resistance. Thus the Neomycin-resist-
Birnboim and Doly (1979), and purified by the Magic Minipreps ance gene was cloned together with the kanamycin-
DNA purification system (Promega Corp., Madison, Wis., USA), resistance gene in a clustered fashion.
according to the manufacturer's instructions. DNA was sequenced Ubukata et al. (1989) have also described
by the dideoxy-DNA chain-termination method (Sanger et al. 1977) a kanamycin-resistance gene, located on the chromo-
using the A.L.F. DNA sequencer (Pharmacia LKB Biotechnology,
Uppsala, Sweden). The sequence data were analysed for open-read- some of a MRSA strain. In the present study we dem-
ing frame and amino acid sequence homologies with the GENETYX onstrated that the bleomycin-resistance gene is clus-
programme (Software Development, Tokyo, Japan). tered with the kanamycin-resistance gene and located
67

Fig. 1 Restriction-map
similarity between p 18KBA 1 (a)
Hind III Hind III BamHI Hind III
and p U B l l 0 (b). The thick EcoR I
amH I
black bar indicates insertion
fragment from methicillin- pl 8KBA1
resistant S. aureus B-26 strain,
and the line indicates the
plasmid pUC18. The thick white
bar indicates the deleted Hind III
fragment. The dotted line
indicates the extent of the pl 8KBA2
BamH I
] ~ gl II Bgl II
I
Pvu ][ 8amH I
Ill
BamHI
I
sequence determined, p U B l l 0
(Jalanko et al. 1981) was
linearized at the EcoRI site. In
pl8KBA1, an extra BglII site is Hind III
Bgl II Bgl II Pvu II BamH I BamHI
present, which is within the BamH I
insertion sequence IS431mec, as pl 8KBA3 ] I I I
shown in Fig. 2

1 ;[ 1 ;]

a lkb

kan r ble r

EcoRl Bgl II Pvull BamHI Xbal EcoRI

pUB 110 I I I i I I
I I
b 1 Kb

downstream from the gene for kanamycin resistance as gene. We thus ought to find out why the nucleotide
a p U B l l 0 plasmid (Jalanko et al. 1981; Semon et al. sequence of the bleomycin-resistance gene of MRSA
1987), and there is a major restriction-enzyme site sim- B-26 is identical to that of pUBll0, also having a sim-
ilarity in both (Fig. 1). We amplified the structural gene ilar alignment with the kanamycin-resistance gene; this
(399 base pairs, bp; data not shown) for bleomycin led us to investigate how these two genes from pUB110
resistance from MRSA B-26 by the PCR method, using transferred to the chromosomal DNA of MRSA B-26.
two oligonucleotide primers, which were synthesized As shown in Fig. 2, a region with complete homology
o n the basis of the nucleotide sequence of the to IS431rnec (Barberis-Maino et al. 1990) was found
bleomycin-resistance gene from p U B l l 0 (Semon et al. downstream from the left HindIII site of the cloned
1987). The nucleotide sequence of the bleomycin-resist- 5.1-kb DNA fragment. The sequence ACTTTG-
ance gene from MRSA B-26 was identical to that from CAACAGAACCG is identical to an inverted repeat,
p U B l l 0 (data not shown). In addition, we confirmed designated IR-r in IS431mec, which is a methicillin-
that the structural gene for bleomycin resistance from resistance-associated insertion-sequence-like element.
MRSA was expressed under the control of the tac But another inverted repeat, designated IR-1, in
promoter on expression vector pMALc-2 (Maina et al. IS431mec was not found in our cloned gene: IR-1 is
1988) in E. coll. shown to be located 759 bases upstream from the IR-r
To elucidate the phenomenon of how bleomycin- motif (Barberis-Maino et al. 1990). Upstream from the
and kanamycin-resistance genes have been evolu- right HindlII site of the fragment, however, no signifi-
tionarily integrated into the chromosomal DNA from cant homology with IS431mec was found.
MRSA, we also sequenced about 300 bp from both the
right and left ends of the cloned 5.1-kb HindIII-HindIII
DNA fragment. We compared the nucleotide sequences
of both the regions with those of several insertion Discussion
sequences from Staphylococcus aureus to discover
whether there is any insertion-sequence (IS)-like ele- Insertion sequences can reside on both plasmids and
ment near the Neomycin- and kanamycin-resistance chromosomes and provide regions of DNA sequence
68

Fig. 2 Comparison of the H in dllI


partial nucleotide sequences of
the segment containing the a AAGCTTTTAA
HindIII-BgIII site (a) in the
cloned 5.1-kb DNA fragment of b A A G C T T T T A A 720
Staphylococcus DNA with
those of IS431mec (b). The
nucleotide sequence of ACTTAAACCTGACTGTCATTGTACATCGAAATATCTGAATAACCTCATTGAGCAAGATCA
IS431mec is numbered
according to the system ACTTAAACCTGACTGTCATTGTACATCGAAATATCTGAATAACCTCATTGAGCAAGATCA 780
described by Barberis-Maino et
al. (1990). * Identical
nucleotides in the compared
sequences, - - the IR-r CCGTCATATTAAAGTAAGAAAGACAAGGTATCAAAGTATCAATACAGCAAAGAATACTTT
************************************************************
sequence
CCGTCATATTAAAGTAAGAAAGACAAGGTATCAAAGTATCAATACAGCAAAGAATACTTT 840

Bgln
A~KAGGTATTGAATGTATTTACGCTCTATATAAA/~Gd~CCG~2AGGTCTCCTTCAGATCT
AAAAGGTATTGAATGTATTTACGCTCTATATAAAAAGAACCGCAGGTCT-CTTCAGATCT 099

ACGGATTTTCGCCATGCCACGAAATTAGCATCATGCTAGCAAGTTAAGCGAACACTGACA

ACGGATTTTCGCCATGCCACGAAATTAGCATCATGCTAGCAAGTTAAGCGAACACTGACA 959

TGATAAATTAGTGGTTAGCTATATTTTTTTACTTTGCAACAGAACCG

TGATAAATTAGTGGTTAGCTATATTTTTTTACTTTGCAACAGAACCG 1006

for recombination (Broda 1979; Cohen 1976; Iida et al. bleomycin- and kanamycin-resistance genes from
1983). In addition, plasmids also can act as vectors for p U B l l 0 transferred to the chromosome in MRSA.
transposable DNA elements or transposons (Kleckner
1981). AcknowledgementsWe are grateful to Professor T. Yokoyama,
The frequent presence of I S 4 3 1 on chromosomal and Hiroshima University Hospital for gifts of MRSA strains. We thank
plasmid DNA of staphylococci in various copy num- Mr. H. Yaju, Pharmacia Biotech K.K., Tokyo, for his skilful analysis
of nucleotide sequencing. We thank Nippon Kayaku Co. Ltd. for the
bers and locations points to the mobile character of this
gift of bleomycin A2 sulphate. We wish to thank the Research Centre
element. I S 4 3 1 is also present in the mercury-resistance for Molecular Medicine, Hiroshima University School of Medicine,
determinant, m e r of S. a u r e u s (Barberis-Maino et al. for the use of their facilities.
1987). The methicillin-resistance determinant m e c in S.
a u r e u s is thought to be transposable (Trees and Ian-
dolo 1987) and has a chromosomal location (Kuhl et al. References
1978). There is indirect evidence that both m e t and m e c
determinants transpose (Trees and Iandolo 1987; Barberis-Maino L, Berger-Bachi B, Weber H, Beck WD, Kayser FH
Shalita et al. 1980; Witte et al. 1986; Lyon and Skurray (1987) IS431, a staphylococcal insertion sequence-like element
1987). However, direct evidence for the mobility of related to IS26 from Proteus vulgaris. Gene 59:107-113
Barberis-Maino L, Ryffel C, Kayser FH, Berger-Bachi B (1990)
1S431 is not available yet. Judging from the observation Complete nucleotide sequence of IS431mec in Staphylococcus
of above researchers and our findings in S. a u r e u s B-26, aureus. Nucleic Acids Res 18:5548
we hypothesize that this bleomycin-resistance gene was Berg DE, Davies J, Allet B, Rochaix J-D (1975) Transposition of
originally present in plasmid p U B l l 0 clustered with factor R genes to bacteriophage 2. Proc. Natl Acad Sci USA
72:3628 3632.
a kanamycin-resistance gene, which was later integ- Birnboim HC, Doly J (1979) A rapid alkaline extraction procedure
rated into the chromosome of MRSA, with the medi- for screening recombinant plasmid. Nucleic Acids Res
ation of I S 4 3 1 m e c , like the mercury- and tetracycline- 7:1513 1523
resistance genes (Skinner et al. 1988; Barberis-Maino Bouanchaud HH, Scavizzi MR, Chabbert YA (1969) Elimination by
et al. 1987). Studies are in progress in our laboratory to ethidium bromide of antibiotic resistance in enterobacteria and
staphylococci. J Gen Microbiol 54:417-425
determine the structure and function of a protein Broda P (1979) Plasmids. Freeman, San Francisco, pp 23-51
encoded by the bleomycin-resistance gene in MRSA. Cohen SN (1976) Transposable genetic elements and plasmid evolu-
Further detailed studies are also needed of how the tion. Nature 263:731-738
69

Davis RW, Botstein D, Roth JR (1980) Advanced bacterial genetics. Sanger F, Nivcklen S, Coulson AR (1977) DNA sequencing with
A manual for genetic engineering. Cold Spring Harbor Laborat- chain-terminating inhibitors. Proc Natl Acad Sci USA
ory, Cold Spring Harbor, New York 74:5463-5467
Genilloud O, Garrido MC, Morreno F (1984) The transposon Tn5 Semon D, Movva NR, Smith TF, Alama ME, Davies J (1987)
carries a bleomycin-resistance determinant. Gene 32:225-233 Plasmid-determined bleomycin resistance in Staphylococcus
Haidle CW, Lloyd RS (1979) In: Hahn FE (ed) Bleomycin in anti- aureus. Plasmid 17:46-53
biotics, vol V, part II. Springer, Berlin Heidelberg New York, pp Shalita Z, Murphy E, Novick RP (1980) Penicillinase plasmids of
124-151 Staphylococcus aureus: structural and evolutionary relationships.
Iida S, Meyer J, Arber W (1983) Prokaryotic IS dements. In: Shapiro Plasmid 3:291.-311
JA (ed) Mobile genetic elements. Academic Press, New York, pp Skinner S, Inglis B, Matthews PR, Stewart PR (1988) Mercury and
159-221 tetracycline resistance genes and flanking repeats associated with
Innis MA, Gelfand DH, Sninsky JJ, White TJ (1990) PCR protocols: methicillin resistance on the chromosome of Staphylococcus
a guide to methods and applications. Academic Press, San Diego, aureus. Mol Microbiol 2:289-297
Calif Sugiyama M, Thompson CJ, Kumagai T, Suzuki K, Deblaere R,
Jalanko A, Palva I, Soederlund H (1981) Restriction maps of plas- Villarroel R, Davies J (1994) Characterisation by molecular clon-
mids pUB110 and pBD9. Gene 14:325 328 ing of two genes from Streptomyces verticillus encoding resistance
Kleckner N (1981) Transposable elements in Prokaryotes. Rev Gen- to bleomycin. Gene 151:11-16
et 15:341 404 Trees DL, Iandolo JJ (1987) Isolation of a transposon (Tn4291) that
Kuhl SA, Patee PA, Baldwin JN (1978) Chromosomal map location codes for resistance to methicillin in Staphylococcus aureus. Abstr
of the methicillin resistance determinant in Staphylococcus aure- Annu Meet Am Soc Microbiol 87:56
us. J Bacteriol 135:460-465. Ubukata K, Nonoguchi R, Matsuhashi M, Song MD, Konno
Lyon BR, Skurray R (1987) Antimicrobial resistance of Staphylococ- M (1989) Restriction maps of the regions coding for methicillin
cus aureus: genetic basis. Microbiol Rev 51:88-134 and tobramycin resistances on chromosomal DNA in methicil-
Maina CV, Riggs PD, Grandea III AG, Slatko BE, Moran LS, lin-resistant staphylococci. Antimicrob Agents Chemother
Tagliamonte JA, McReynolds LA, Guan CD (1988) An Es- 33:1624 1626
cherichia coli vector to express and purify foreign proteins by Umezawa H (1975) Bleomycin. In: Corcoran JW and Hahn FE (eds)
fusion to and separation from maltose-binding protein. Gene Antibiotics, vol III. Springer, Berlin Heidelberg New York, pp
74:365-373 21-33
Mazodier P, Cossart P, Giraud E, Gasser F (1985) Completion of Witte W, Green L, Misra TK, Silver S (1986) Resistance to mercury
the nucleotide sequence of the central region of Tn5 confirms the and to cadmium in chromosomally resistant Staphylococcus
presence of three resistance gene. Nucleic Acids Res 13:195-205 aureus. Antimicrob Agents Chemother 29:663-669