See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/47567650

High-throughput approach to detection of

knockdown resistance (kdr) mutation in
mosquitoes, Culex quinquefasciatus, based...

Article in Pest Management Science February 2011

DOI: 10.1002/ps.2044 Source: PubMed

CITATIONS READS

6 113

5 authors, including:

Manas Sarkar Indra Baruah

Godrej Industries 96 PUBLICATIONS 613 CITATIONS
30 PUBLICATIONS 107 CITATIONS
SEE PROFILE

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

MRC (UK) Funded CiC Project: Development of Field Diagnostic Kits for Insecticide Resistance View
project

All content following this page was uploaded by Manas Sarkar on 02 January 2017.

The user has requested enhancement of the downloaded file. All in-text references underlined in blue are added to the original document
and are linked to publications on ResearchGate, letting you access and read them immediately.
Research Article
Received: 10 June 2010 Revised: 9 August 2010 Accepted: 24 August 2010 Published online in Wiley Online Library:

(wileyonlinelibrary.com) DOI 10.1002/ps.2044

High-throughput approach to detection

of knockdown resistance (kdr) mutation in
mosquitoes, Culex quinquefasciatus, based on
real-time PCR using single-labelled
hybridisation probe/melting curve analysis
Manas Sarkar,a Indra Baruah,a Ravi B Srivastava,b Aparajita Borkotokic
and Indra Kumar Bhattacharyyad

Abstract
BACKGROUND: Knockdown resistance (kdr) mutation (L1014F) is a well-defined mechanism of resistance to pyrethroids
and DDT in many insect species. Sensitive detection of the mutations associated with resistance is a prerequisite for
resistance management strategies. The authors have developed a new real-time molecular diagnostic assay based on
SimpleProbe /melting curve analysis for large-scale kdr genotyping in the wild population of Culex quinquefasciatus Say, the
principal vector of bancroftian filariasis. Melting curve analysis is based on the thermal stability difference between matched
and mismatched DNA duplexes. The application of SimpleProbe chemistry in insects described here is novel in entomology
research.

RESULTS: The mosquitoes homozygous for knockdown-resistant and knockdown-susceptible allele showed melting peaks at
60.45 C ( 0.25) and 64.09 C ( 0.24) respectively. The heterozygous mosquitoes yielded both peaks at approximately 60.5 C
( 0.2) and 64.20 C ( 0.23). Among the 92 samples genotyped, 16 were found to be homozygous resistant, 44 homozygous
susceptible and 32 heterozygous. Comparative assessments were made of all the reported methods for kdr genotyping.

CONCLUSION: The present method is cheaper, faster, more reliable and versatile than other alternatives proposed in detecting
correct kdr genotypes in mosquitoes. This is the first report using a single-labelled hybridisation probe to detect point mutations
in insect populations.

c 2010 Society of Chemical Industry
Supporting information may be found in the online version of this article.

Keywords: knockdown resistance; genotyping; insecticide resistance; SimpleProbe ; real-time PCR; vector management; India

1 INTRODUCTION This resistance mechanism is termed knockdown resistance (kdr).

Culex quinquefasciatus Say mosquitoes are the main vector of
the nematode parasite Wuchereria bancrofti Cobbold, an agent
of lymphatic filariasis not only in India but also throughout
continental Asia.1 The approach to prevent transmission of
filariasis and other mosquito-borne diseases has extensively relied
on the application of insecticides.2 Intensive exposure to these
insecticides has inevitably resulted in the evolution of insecticide
resistance in the mosquitoes. The emergence of insecticide
resistance represents a major concern for effective management
of vector-borne diseases.3
DDT and pyrethroids alter the normal function of the voltage-
gated sodium channel, resulting in prolonged channel opening
which causes increased nerve impulse transmission, leading to
paralysis and death.4,5 Resistance to DDT and pyrethroids is
often associated with mutations in the sodium channel gene
that cause reduced neuronal sensitivity to these insecticides.6
Extensive research has shown that kdr or kdr-like mechanisms
result from a leucine to phenylalanine (L1014F) replacement in
transmembrane segment 6 of domain II of the sodium channel.7 10
Insecticide resistance management requires rapid high-
throughput assays for detection of resistance-associated mu-
Correspondence to: Manas Sarkar, National Centre for Disease Control, 22-
Sham Nath Marg, Delhi-54, India. E-mail: manas sarkar54491@yahoo.com
a Medical Entomology Division, Defence Research Laboratory (DRDO), Tezpur,
Assam, India
b Directorate of Life Science, Defence Research and Development Organisation,
New Delhi, India
c Department of Zoology, Gauhati University, Assam, India
d Cotton College, Guwahati, Assam, India

Pest Manag Sci (2010) www.soci.org

c 2010 Society of Chemical Industry
 www.soci.org
tations, and there are currently several different methods
available for detecting the genetic changes responsible for
kdr in mosquitoes.6 The most widely used method is allele-
specific PCR (AS-PCR),11 13 but more recently a number of
other assays have been described in insect systems. These
are heated oligonucleotide ligation assay (HOLA),14 sequence-
specific oligonucleotide probe enzyme-linked immunosorbent
assay (SSOP-ELISA),15 PCR-Dot Blot,16 fluorescence resonance en-
ergy transfer (FRET)/melting curve analysis,17 PCR elongation with
fluorescence,18 TaqMan and high-resolution melt (HRM),6 the
amplification refractory mutation system (ARMS) and primer-
introduced restriction analysis PCR (PIRA-PCR).19 However, all
these methods have some relative advantages and disadvantages
(safety, cost, speed, simplicity, sensitivity, etc.). For any genotyping
experiment, specificity, sensitivity, simplicity and high throughput
are very important parameters.
The authors have developed a new real-time molecular
diagnostic assay based on melting curve analysis (MCA) using
a single-labelled special type of simplified hybridisation probe
for detection of kdr mutation in Cx. quinquefasciatus mosquitoes.
This probe format is the so-called SimpleProbe format. Typically,
such a probe is designed to hybridise to a target sequence that
contains the single nucleotide polymorphism (SNP) of interest
(here, kdr), thereby perfectly matching to a distinct allelic variant.
Melting curve analysis is based on the thermal stability difference
between matched and mismatched DNA duplexes.20,21 Thus, a
probe/target duplex containing a destabilising mismatch melts
off at a lower temperature compared with a probe/target duplex
containing a perfect match. The application of SimpleProbe
chemistry in insects has not yet been reported. This is the first
report using a SimpleProbe assay to detect point mutations in
insect populations.
2 MATERIALS AND METHODS
2.1 Mosquito population and insecticide susceptibility
status
Culex quinquefasciatus mosquito samples used in the study
were collected from Assam, India. Details on study sites and
their ecoenvironmental settings were described in a previous
publication.22 Insecticide susceptibility assays were performed
from these areas earlier, where the authors reported a significant
level of resistance to DDT and incipient resistance to pyrethroids.23
After bioassay in the field, dead (susceptible) and alive (resistant)
mosquitoes were collected and stored separately with silica gel,
and were carried to the laboratory for molecular study.
2.2 PCR template preparation
Genomic DNA from 100 individual mosquitoes was extracted using
High Pure PCR Template Preparation
c
kit (Roche Diagnostics,
Mannheim, Germany) with modifications for real-time genotyping
of kdr. The protocol of the commercial DNA preparation kit
was optimised according to the weight of the starting materials
(mosquito tissue). Individual mosquitoes were homogenised in a
mixture of 50 L tissue lysis buffer (kit content) and incubated with
10 L proteinase K. DNA was prepared by mixing the homogenates
with 50 L binding buffer and 150 L inhibitor removal buffer (kit
content). The spin columns were washed with 300 L wash buffer
(kit content). Finally, the DNA was eluted in 75 L elution buffer
(kit content). For all other steps, the user manual of the kit was
followed. All 100 mosquito DNA samples were distinguished by
wileyonlinelibrary.com/journal/ps

c 2010 Society of Chemical Industry
M Sarkar et al.
Figure 1. Principle of SimpleProbe detection. (A) Fluorescence is
quenched by an internal linker non-fluorescent quencher (Q) when the
probe is free in solution. (B) Fluorescence emission from reporter dye
fluorescein (F) when probe is annealed to its complementary target. This
format is the so-called SimpleProbe format.
a unique code, each code corresponding to a number serially
arranged for final interpretation of results.
2.3 Target sequence, primer and probe designing
Two sequences (FJ182226 and FJ970025) of the IIS6 domain
of the voltage-gated sodium channel (vgsc) isolated from
Cx. quinquefasciatus population from this part of the world22 were
used to design the probe and primers in this new genotyping
assay for the detection of this kdr mutation. Previously, the
authors submitted these sequences, which contain a SNP site
(TTA/TTT) known as knockdown resistance (kdr) at position 127,
to the GenBank.22 A single-labelled simplified hybridisation probe
was designed that consists of a single oligonucleotide internally
labelled with a specific, non-fluorescent quencher and fluorescein
through proprietary linker chemistry. Fluorescence signalling is
dependent on the probes hybridisation status: once hybridised to
its target sequence, the probe emits more fluorescence light than
it does when it is free floating in solution (Fig. 1).
The LightCycler Probe Design software 2.0, v.1.0.R.36 (Roche
Applied Science, IN), is used to design real-time PCR primers
and the single-labelled probe. Two primers, vgsc F (gATCgAATC
CATgTgggACTg) and vgsc R (CggTATgAACTgTTTgTTTCCAT),
along with the probe SP [A] (gAATACTCACgACTAAATTTCCTX
IATCACT-PH), were designed for the genotyping assay. The
SimpleProbe for kdr was internally labelled with fluorescein
and blocked with phosphate at the 3 -end. Primers and probes
were synthesised in TIB MOLBIOL (Berlin, Germany). The melting
temperature (Tm ) for the SimpleProbe was determined both
through the software (theoretical) and empirically with the
appropriate control DNA on the LightCycler. The probe was
designed to match the wild-type allele (knockdown susceptible,
TTA) (Fig. 2).
2.4 Simple-probe genotyping: PCR amplification
and melting curve analysis
All SimpleProbe PCR reactions were performed in 96-well
plates using LightCycler 480 Genotyping Master Mix
c
containing
a modified Taq DNA polymerase, reaction buffer, MgCl2 and
dNTPs (Roche Diagnostics, Mannheim, Germany) with a total
volume of 20 L per well. The kdr genotyping was performed
on the LightCycler 480 instrument (Roche Applied Science, IN).
Before starting the PCR run, the microwell plate was sealed and
centrifuged to avoid air bubbles in the liquid phase and/or prevent
liquid from sticking to the wall of the microwell plate tubes.
Asymmetric PCR was used to obtain more copies of the strand
complementary to the probe and reduce competitive binding.24
In the present study, asymmetric PCR was performed with a final
concentration of 2.5 M for the forward primer (vgsc F, excess
primer) and 0.5 M for the reverse primer (vgsc R, limiting primer).
SimpleProbe was used at a final concentration of 0.2 M. The
Pest Manag Sci (2010)
High-throughput real-time genotyping of kdr mutation in Cx. quinquefasciatus
Figure 2. The position of primers and probe in the referral sequence (FJ182226). The mutation site is shown as A > T. Boxes represent the palindrome
sequences in the vgsc-IIS6 gene fragment.
final concentration of MgCl2 was adjusted to 3 mM. Thermal
cycling for the LightCycler was performed as follows: an initial
denaturation (pre-incubation) at 95 C for 10 min (ramp rate:
4.4 C s1 ), followed by 45 cycles of amplification at 95 C for 10 s
(ramp rate: 4.4 C s1 ), 53 C for 20 s (accusation mode: single;
ramp rate: 2.2 C s1 ) and 72 C for 20 s (ramp rate: 4.4 C s1 ). A
final melting curve cycle was performed by raising the temperature
to 95 C for 10 s (ramp rate: 4.4 C s1 ), followed by a two-step
probe annealing, initially at 48 C for 20 s (ramp rate: 1.5 C s1 )
and a final annealing step at 40 C for 4 min (ramp rate: 1.5 C s1 );
after the final annealing step, the temperature was raised to 75 C
(ramp rate: 1.5 C s1 ) with continuous fluorescent acquisition,
followed by a cool down to 40 C for 30 s. A continuous read
was made in the 530 nm detection channel during the entire
fluorescent acquisition period.
The fluorescence signals (F) in real time were plotted against
temperature (T) to produce melting curves for each sample.
Melting curves were then converted into negative derivative
curves of fluorescence (465510) with respect to temperature
(dF/dT) by the LightCycler 480 Data Analysis software, v.1.5.0
(Roche Applied Science, IN). Melting curve analysis was performed
using the Tm calling feature of the software. The software
then grouped similar melting curves and automatically called
genotypes based on melting standards for known genotypes in
the experiment.
2.5 Allele-specific PCR assay
After real-time genotyping assay, from the 100 samples de-
scribed in Section 2.2, 30 mosquito DNA samples were randomly
selected for allele-specific PCR (AS-PCR) assay to cross-check
SimpleProbe genotyping results. Although all the 100 mosquito
DNA samples were numbered serially, for AS-PCR assay the
samples were selected double blindly to avoid bias in result
interpretation. The PCR was performed to detect kdr mutation
in a single mosquito following the protocol described earlier,22
using four primers (Cq1: 5 GTGGAACTTCACCGACGCATTC3 ;
Cq2: 5 GCAAGGCTAAGAAAAGGTTAAG3 ; Cq3: 5 CCACCGTA
GTGATAGGAAATTTA3 ; Cq4: 5 CCACCGTAGTGATAGGAAATTTT3 ).
The DNA fragments were separated by electrophoresis on 2%
agarose gels and were visualised by ethidium bromide staining
under UV light.
2.6 DNA sequencing
DNA sequencing of the 510 bp internal control PCR products
was conducted, amplified by AS-PCR assay, to cross-check the
comparative genotyping efficacy of SimpleProbe and AS-PCR
assay in detecting correct kdr mutation. This 510 bp internal
Pest Manag Sci (2010)

c 2010 Society of Chemical Industry
www.soci.org
control PCR band containing the kdr flanking regions, amplified
using Cq1 and Cq2 primers as reported earlier,22 was extracted
from the agarose gel using MiniEluteTM Gel Extraction kit (Qiagen,
Cat. No. 28 604) and directly sequenced on both strands using an
ABI automated sequencer.
3 RESULTS
3.1 Designing the probe for knockdown resistance (kdr)
detection
One single-labelled probe (SimpleProbe ) has been designed
to detect kdr mutation. The SimpleProbe was designed to
match exactly the wild-type allele (knockdown susceptible, TTA)
(Fig. 2). An in silico analysis of the designed SimpleProbe
was performed using the NCBI-BLAST program; it was found
that the probe used in the present study for detection of
kdr mutation in Cx. quinquefasciatus mosquitoes could also
be used for kdr genotyping in any mosquito species within
the Culex pipiens complex. The SimpleProbe contains a self-
quenching fluorescent dye, creating a brighter signal when
bound to the complementary sequence. Slowly increasing the
temperature of the reaction (melting curve analysis step) causes
a dissociation of the probe from its target, accompanied with
a loss of fluorescence. The dissociation is target specific, where
each mismatch due to kdr mutation (TTA to TTT) lowers the
dissociation temperature. Therefore, a single low-temperature
peak indicates the homozygous mutation (RR) state, double
peaks represent a heterozygous condition (RS) and a single
high-temperature melting peak is indicative of a homozygous
wild (i.e. knockdown susceptible, SS), fully probe-matched target
(supporting information Figure S1).
3.2 SimpleProbe assay for kdr genotyping
After minimal optimisation using DNA templates of known geno-
type obtained from a previous experiment reported elsewhere,22
the kdr SimpleProbe assays showed excellent discrimination of
the two alleles. The mosquitoes homozygous for knockdown-
resistant (TTT/TTT) allele showed a melting peak at 60.45 C
( 0.25), and the mosquitoes homozygous for knockdown-
susceptible (TTA/TTA) allele showed a melting peak at 64.09 C
( 0.24) (Fig. 3). The SimpleProbe formed a perfect match
with the knockdown-susceptible (TTA) sequence, which re-
sulted in higher Tm of the probe by 4.0 C than a mismatch
with the knockdown-resistant (TTT) sequence. The heterozygous
mosquitoes yielded both peaks at approximately 60.5 C ( 0.2)
and 64.20 C ( 0.23) (Fig. 3).
After optimisation of the SimpleProbe -based PCR/MCA assay,
92 out of 100 samples (92.0%) were successfully amplified. It was
wileyonlinelibrary.com/journal/ps
 www.soci.org M Sarkar et al.

Figure 3. kdr genotyping by Tm calling. The mosquitoes homozygous for knockdown-resistant (TTT/TTT) allele showed a melting peak at 60.45 C
( 0.25), and the mosquitoes homozygous for knockdown-susceptible (TTA/TTA) allele showed a melting peak at 64.09 C ( 0.24). The heterozygous
mosquitoes yielded both peaks at approximately 60.5 C ( 0.2) and 64.20 C ( 0.23).

Table 1. Evaluation of SimpleProbe /MCA assay followed by AS-PCR
and DNA sequencing and comparative performance of SimpleProbe
and AS-PCR assay in kdr genotyping
AS-PCR DNA sequencing
SimpleProbe kdsb kdrc kds/kdrd kds kdr kds/kdr
genotypes (na ) (SS) (RR) (SR) Negative (SS) (RR) (SR)
kds (SS) (12) 9 0 2 1 12 0 0
kdr (RR) (10) 1 9 0 0 0 10 0 for L1014F (kdr) allele for nine Cx. quinquefasciatus samples
kds/kdr (SR) (8) 0 1 7 0 0 0 8 (Table 1). The two heterozygous (kds/kdr), one homozygous-
a n: number of samples.
b kds (SS): homozygous knockdown susceptible (TTA/TTA).
c kdr (RR): homozygous knockdown resistant (TTT/TTT).
d
kds/kdr (SR): heterozygous for L1014/wild type (TTA/TTT).
found that the real-time SimpleProbe assay is sensitive, with
only eight failed reactions. All eight non-amplified and ambiguous
samples were re-run once, but repeated attempts to amplify the
region of interest were unsuccessful in spite of over 50 cycles of
PCR. It is likely that this DNA was badly degraded or contained
strong inhibitors of PCR. Among the 92 samples successfully
genotyped, 16 were found to be homozygous resistant (kdr, RR),
44 homozygous susceptible (kds, SS) and 32 heterozygous (kdr/kds,
RS). The observed and expected homozygotes are 44 (obs.) and
39.13 (exp.) for kds (SS) and 16 (obs.) and 11.13 (exp.) for kdr (RR)
genotypes, whereas heterozygote frequencies are 32 (obs.) and
41.74 (exp.), which did not differ significantly (p[ 2 ] = 0.0252)
from HardyWeinberg equilibrium.
3.3 AS-PCR assay and DNA sequencing
After SimpleProbe /MCA, 30 samples were randomly selected
from the 100 samples for AS-PCR assay. The experiments were
done doubly blindly, but the entire mosquito DNA samples were
numbered serially for final interpretation of results. It proved
possible successfully to genotype 29 samples out of the total 30 by
AS-PCR; the remaining one sample yielded a negative score even
after a second run. By AS-PCR assay, ten samples were detected
as homozygous susceptible (kds), ten samples as homozygous
resistant (kdr) and nine samples as heterozygous, and one sample
did not produce any characteristic band (Table 1). Although the
AS-PCR assays were adapted to give readily interpretable results,
little discrepancy was found between the SimpleProbe /MCA and
the AS-PCR results for five Cx. quinquefasciatus samples (Table 1).
By comparing the SimpleProbe /MCA and the AS-PCR results
based on randomly selected 30 Cx. quinquefasciatus samples,
nine mosquitoes showed the same homozygote genotype for
L1014L (kds). Both assays showed the same heterozygous
genotype (kds/kdr) for seven samples and the same homozygote
susceptible (kds) and one homozygous-resistant (kdr) sample in
AS-PCR assay were actually scored as homozygous susceptible
(kds), homozygous resistant (kdr) and heterozygous (kds/kdr)
respectively in SimpleProbe assay (Table 1).
DNA sequencing was performed for the internal control band
of the AS-PCR containing the kdr mutation site and the flanking
region to sort out the discrepancies between SimpleProbe and
AS-PCR genotyping results. Sequence analysis revealed that in
all cases the SimpleProbe /MCA method gave the correct result
(Table 1).
4 DISCUSSION
In this study, a method that allows kdr genotyping in a
single step has been developed and evaluated. The method
relies on differences in melting temperatures between matched
and mismatched DNA duplexes. SimpleProbe labelled with
fluorescein to detect kdr and kds allele in mosquitoes was
designed and evaluated. This real-time PCR assay using a single-
labelled fluorescence probe gave excellent results for the Leu-Phe
substitution characteristic of kdr resistance. This is the first time
that the use of SimpleProbe chemistry has been described in the
entomology literature.
This new kdr genotyping assay with SimpleProbe /MCA
provides a reliable method for detecting the substitution linked
to kdr resistance. Successful genotyping scores were achieved
even with very old, dry and stored samples (data not shown).
As expected, the homozygous susceptible wild-type samples
showed the highest melting temperature. The existence of a
nucleotide mismatch (homozygous resistant, kdr) between the

wileyonlinelibrary.com/journal/ps

c 2010 Society of Chemical Industry Pest Manag Sci (2010)
High-throughput real-time genotyping of kdr mutation in Cx. quinquefasciatus
target DNA and the hybridisation probe produced a lower Tm
than the Tm of the wild-type sequence. A trial was conducted
on randomly selected samples to compare the SimpleProbe
method with the commonly used AS-PCR approach followed by
DNA sequencing. The genotypes were unambiguously determined
by the SimpleProbe technique, whereas the AS-PCR results were
more difficult to interpret and often required a repeat reaction.
The present method offers high-quality outcomes and minimum
interferences between probe signals and is 100% concordant with
the reference DNA sequences.
Many genotyping approaches have been reported for kdr
mutation in insects. Here, the authors present comparative
assessments of all the reported methods for kdr genotyping
based on their own data and on information derived from the
literature (supporting information Table S1). Comparison was
made in terms of simplicity, sensitivity, specificity, speed, cost
and safety of the methodology. The first method is the widely
used AS-PCR assay.11,12 The very low amplification efficiency
of this PCR precludes the analysis of DNA samples of low
concentration or of poor quality. However, a number of recent
reports have described AS-PCR as relatively less sensitive and
questioned the reliability of this technique in detecting kdr
mutation.14,17,18,22,25 The second approach is PCR-SSOP or SSOP-
ELISA,15 which requires approximately 5 h 30 min running (17
steps); an additional hybridisation step is required, along with
two PCR primers and three SSOPs; this may explain why it has
not been used as extensively as the AS-PCR. A third method
based on a hot ligation oligonucleotide assay (HOLA)14 is more
complex (16 steps) and time consuming (6 h 30 min) than the
other methods, but it is high throughput and has the advantage
of requiring no electrophoresis equipment. Another method, PCR-
Dot Blot,16 is very time consuming (approximately 1618 h; 16
steps) and is not much used for kdr genotyping. In contrast, a few
recently developed high-throughput assays for kdr detection, such
as FRET/MCA,17 PCR elongation with fluorescence,18 TaqMan
assay and HRM,6 are more sensitive and take relatively less
time. However, FRET/MCA requires two rounds of PCR; PCR
elongation with fluorescence requires PCR followed by capillary
electrophoresis. HRM uses standard oligonucleotide primers and
has no requirement for fluorescently labelled oligonucleotides,
and the running costs are very low. In addition, HRM is generally
used to identify or categorise the unknown mutations in the region
of DNA encompassed by the PCR primers, as any alternative base
change will alter the melt profile of the amplicon. Sometimes
this additional feature of HRM can cause problems in interpreting
the results of known SNP detection without prior knowledge of
the melting peak for the known mutation. Other methods for kdr
mutation detection, such as the amplification refractory mutation
system (ARMS) and primer-introduced restriction analysis PCR
(PIRA-PCR),19 are relatively more specific than AS-PCR, but both
techniques may have the same limitations as AS-PCR in terms of
safety, sensitivity and low throughput.
The recently developed TaqMan assay for kdr genotyping6 has
been claimed to be the most sensitive and specific among the
assays previously available. However, it needs three fluorescently
labelled probes, which is a costly affair, and the interpretation
of the scatter plot and grouping of genotypes is sometimes
difficult in the TaqMan assay. In contrast, melting peak analysis
is very easy to interpret. Fluorescent melting curve analysis using
SimpleProbe is relatively simpler and a somewhat less expensive
method than the TaqMan assay for SNP genotyping.26 In addition,
it is not necessary to design the probe to have a specific Tm
Pest Manag Sci (2010)

c 2010 Society of Chemical Industry
www.soci.org
because only a notably different Tm on matched and mismatched
targets is required.27 The cost per sample for the reagents and
consumables for melting curve analysis was approximately 60%
less than TaqMan assay in 96- and 384-well plates.28 However,
one potential limitation of the SimpleProbe detection method,
described here, is the lack of ability to multiplex with a single probe,
and multiple probes are required for simultaneous detection of
multiple mutations.
In conclusion, the SimpleProbe assay results in clearly
interpretable melting peaks for the different kdr genotypes.
Moreover, homozygotes and heterozygotes can easily and
accurately be distinguished using this methodology, which
makes the technique suitable for rapid, simple and large-scale
genotyping of kdr in population screening experiments. In the
authors hands, the method is more reliable, specific, speedy
and sensitive compared with other high-throughput methods,
it is less ambiguous and it may be more sensitive for the
detection of heterozygotes. Hence, this new high-throughput
SimpleProbe /MCA assay will improve the screening of the
kdr frequencies in mosquitoes. While this system has been
specifically designed to assay kdr resistance allele frequencies
in Cx. quinquefasciatus, it is broadly applicable where single
nucleotide polymorphisms are an important mechanism of
resistance to insecticides. Finally, this method is cheaper, faster,
more reliable and versatile, and may be a good alternative method
for detection of kdr and/or related SNPs.
ACKNOWLEDGEMENTS
The authors thank Mr Sirsendu Bhowmik and Mr Krishnendu
Chatterjee for their technical assistance during the early stage of
the experiment set-up. They wish also to thank Dr Shibnarayan
Dutta for his comments and suggestions on the manuscript. The
Defence Research and Development Organisation, Government
of India, financially supported the study.
SUPPORTING INFORMATION
Supporting information may be found in the online version of this
article.
REFERENCES
1 Gyapong JO, Kumaraswami V, Biswas G and Ottesen EA, Treatment
strategies underpinning the global programme to eliminate
lymphatic filariasis. Expert Opin Pharmacol 6:179200 (2005).
2 McCarroll L and Hemingway J, Can insecticide resistance status affect
parasite transmission in mosquitoes? Insect Biochem Mol Biol
32:13451351 (2002).
3 Ottesen EA, Duke BO, Karam M and Behbehani K, Strategies and
tools for the control/elimination of lymphatic filariasis. Bull WHO
75:491503 (1997).
4 Soderlund DM and Bloomquist JR, Neurotoxic actions of pyrethroid
insecticides. Annu Rev Entomol 34:7796 (1989).
5 Narahashi T, Nerve membrane Na+ channels as targets of insecticides.
Trends Pharmacol Sci 13:236241 (1992).
6 Bass C, Nikou D, Donnelly MJ, Williamson MS, Ranson H, Ball A, et al,
Detection of knockdown resistance (kdr) mutations in Anopheles
gambiae: a comparison of two new high-throughput assays with
existing methods. Mal J 6:111 (2007).
7 Williamson MS, Martine-Torres D, Hick CA and Devonshire AL,
Identification in mutations in the housefly para-type sodium
channel gene associated with knockdown resistance (kdr) to
pyrethroid insecticides. Mol Gen Genet 252:5160 (1996).
8 Dong K, Voltage-gated sodium channels as insecticide targets, in
Chemistry of Crop Protection: Progress and Prospects in Science and
wileyonlinelibrary.com/journal/ps
 www.soci.org
Regulation, ed. by Voss G and Ramos G. Wiley, Weinheim, Germany,
pp. 167176 (2002).
9 Vais H, Williamson MS, Devonshire AL and Usherwood PNR, The
molecular interactions of pyrethroid insecticides with insect and
mammalian sodium channels. Pest Manag Sci 57:877888 (2001).
10 Soderlund DM and Knipple DC, The molecular biology of knockdown
resistance to pyrethroid insecticides. Insect Biochem Mol Biol
33:563577 (2003).
11 Martine-Torres D, Chandre F, Williamson MS, Darriet F, Berge JB,
Devonshire AL, et al, Molecular characterization of pyrethroid
knockdown resistance (kdr) in the major malaria vector Anopheles
gambiae s.s. Insect Mol Biol 7:179184 (1998).
12 Martine-Torres D, Chevillon C, Brun-Barale A, Berge JB, Pasteur N and
Pauron D, Voltage dependent Na+ channels in pyrethroid resistant
Culex pipiens L. mosquitoes. Pestic Sci 55:10121020 (1999).
13 Ranson H, Jensen B, Vulule JM, Wang X, Hemingway J and Collins FH,
Identification of point mutation in the voltage-gated sodium
channel gene of Kenyan Anopheles gambiae associated with
resistance to DDT and pyrethroids. Insect Mol Biol 9:491497 (2000).
14 Lynd A, Ranson H, McCall PJ, Randle NP, Black WC, Walker ED, et al,
A simplified high-throughput method for pyrethroid knock-down
resistance (kdr) detection in Anopheles gambiae. Mal J 4:16 (2005).
15 Kulkarni MA, Rowland M, Alifrangis M, Mosha FW, Matowo J, Malima R,
et al, Occurrence of the leucine-to-phenylalanine knockdown
resistance (kdr) mutation in Anopheles arabiensis populations in
Tanzania, detected by a simplified high-throughput SSOP-ELISA
method. Mal J 5:56 (2006).
16 Kolaczinski JH, Fanello C, Herve JP, Conway DJ, Carnevale P and
Curtis CF, Experimental and molecular genetic analysis of the impact
of pyrethroid and non-pyrethroid insecticide impregnated bednets
for mosquito control in an area of pyrethroid resistance. BullEntomol
Res 90:125132 (2000).
17 Verhaeghen K, van Bortel W, Roelants P, Backeljau T and
Coosemans M, Detection of the East and West African kdr mutation
in Anopheles gambiae and Anopheles arabiensis from Uganda using
a new assay based on FRET/Melt Curve analysis. Mal J 5:16 (2006).
18 Tripet F, Wright J and Lanzaro G, A new high-performance PCR
diagnostic for the detection of pyrethroid knockdown resistance
kdr in Anopheles gambiae. Am J Trop Med Hyg 74:658662 (2006).
wileyonlinelibrary.com/journal/ps

c 2010 Society of Chemical Industry
M Sarkar et al.
19 Singh OP, Bali P, Hemingway J, Subbarao SK, Dash AP and Adak T,
PCR-based methods for the detection of L1014 kdr mutation in
Anopheles culicifacies sensu lato. Mal J 8:154 (2009).
20 Bennett CD, Campbell MN, Cook CJ, Eyre DJ, Nay LM, Nielsen DR,
et al, The LightTyper (TM): high-throughput genotyping using
fluorescent melting curve analysis. BioTechniques 34:12881295
(2003).
21 Bernard PS, Lay MJ and Wittwer CT, Integrated amplification and
detection of the C677T point mutation in the methyl-
enetetrahydrofolate reductase gene by fluorescence resonance
energy transfer and probe melting curves. Ann Biochem
255:101107 (1998).
22 Sarkar M, Borkotoki A, Baruah I, Bhattacharyya IK and Srivastava RB,
Molecular analysis of knock down resistance (kdr) mutation and
distribution of kdr genotypes in a wild population of Culex
quinquefasciatus from India. Trop Med Int Health 14:10971104
(2009).
23 Sarkar M, Bhattacharyya IK, Borkotoki A, Goswami D, Rabha B,
Baruah I, et al, Insecticide resistance and detoxifying enzyme activity
in the principal bancroftian filariasis vector, Culex quinquefasciatus,
in northeastern India. Med Vet Entomol 23:122131 (2009).
24 Gameau LD, Brown LD, Moore MA, Donnenhoffer JE and Demyan WB,
Optimization of LightTyper genotyping assays. Biochemica 3:46
(2005).
25 Abdalla H, Matambo TS, Koekemoer LL, Hunt RH and Coetzee M,
Insecticide susceptibility and vector status of natural populations
of Anopheles arabiensis from Sudan. Trans Royal Soc Trop Med Hyg
102:263271 (2008).
26 Ha BK and Boerma HR, High-throughput SNP genotyping by melting
curve analysis for resistance to southern root-knot nematode and
frogeye leaf spot in soybean. J Crop Sci Biotech 11:91100 (2008).
27 Gibson NJ, The use of real-time PCR methods in DNA sequence
variation analysis. Clin Chim Acta 363:3247 (2006).
28 Chantarangsu S, Cressey T, Mahasirimongkol S, Tawon Y, Ngo-
Giang-Huong N, Jourdain G, et al, Comparison of the TaqMan
and LightCycler systems in evaluation of CYP2B6 516G>T
polymorphism. Mol Cell Probes 21:408411 (2007).
Pest Manag Sci (2010)
Table S1. Comparison of eight assays for kdr genotyping along with the present method described here. Comparisons were based on the specialist equipment required and its cost and
safety, the simplicity of the protocol and the speed of the method
Hazardous
Specialist chemicals Protocol run time Number of Number of wells/tubes/ Running cost
Assays equipment required involved (approx.) steps Primers, probes required membranes required per sample (approx.) ($) Reference
SimpleProbe Real-time PCR Nil 1 h 35 min 1 Two PCR primers and one 1 0.9 Present study
machine fluorescently labelled
AS-PCR PCR thermocycler, Ethidium 4 h 30 min 2 Four PCR primers 2 0.92 Bass et al. (2007);
gel electrophoresis bromide Sarkar et al. (2009)
and imaging
equipment
HOLA PCR thermocycler, SDS 6 h 30 min 16 Two PCR primers, two 4 1.74 Lynd et al. (2005);
multichannel reporter primers (5 Bass et al. (2007)
pipette, (optional) phosphorylation and 3
ELISA plate reader fluorescein labelled), four
detector primers (biotin
labelled)
SSOP-ELISA PCR thermocycler, TMAC, H2SO4, 5 h 30 min 17 Two PCR primers (one 3 1.00 Kulkarni et al.
shaking incubator, SDS biotin labelled), three (2006);
multichannel SSOPs (digoxigenin Bass et al., (2007)
pipette, labelled)
(optional) ELISA
plate reader
PCR-Dot Blot PCR thermocycler, SDS 1618 h 16 Two PCR primers, three 3 1.6 Kolaczinski et al.
shaking incubator, SSOPs (digoxigenin (2000);
multichannel pipette labelled) Bass et al. (2007)
FRET/MCA PCR thermocycler, Nil 34 h 2 Four PCR primers (one 2 Not Verhaeghen et al.
high-spec real-time ROX-labelled primer), one determined (2006)
PCR machine probe (FAM labelled)
TaqMan Real-time PCR Nil 1 h 45 min 1 Two PCR primers, three 2 1.72 Bass et al. (2007)
machine fluorescently labelled
probes
HRM High-spec real-time Nil 1 h 35 min 1 Two PCR primers 1 0.62 Bass et al. (2007)
PCR machine
Comparative data were either obtained from the original report of the method or based on Bass et al. (2007).
 Chap/Art #: PM-10-0224 Ed.doc F O N T C H E C K E D - O K 9/17/2010 10:48:40 PM
Project:

Supporting information Figure S1. Description of melting peaks. A single low-

temperature peak (green) indicates the homozygous mutation (RR) state, double peaks
(red) represent a heterozygous condition (RS) and a single high-temperature melting
peak (blue) is indicative of a homozygous susceptible (SS) condition.

C:\DOCUME~1\laser\LOCALS~1\Temp\pm-10-0224-20100916173324\doc\PM-10-0224 Ed.doc 1 of 19 (19 pgs)

View publication stats