chapter? L@ [aby © i Seon BBL] Nesente 3. Amine acids, monosaccharides, nucleotides, and lipids ae the four ‘yper of biologie small molecules. Amino acids, monosaccharides, anda leoides can fom polymers of poets, polysaccharides and nuclei acids respectively 5. (@) Mainly C and Hf plus some © OC Hando (CHL 0. andN plos small amounts ofS 7. (a You should mesure che nvogen content sine this would indice the presene of protein (nce lipids nor earbahydees contain icoge) (@) You could ad the compousid that contains the most niuogen can pound B, which ic melamine. (Melamine i a esbmance that hasbeen fdded co mn es foods and el prc from China so that they would ppeato contain more protein, Melamine ie tox t pets and cde ) (@ Compound C is a8 amine acid, so would already be present in prorein-onesning food. 9. All amino ais have exons groups: All have primary amino groups xcept for palin, which has asecondaty amino group. 11, Aan has an amido group and Cys hat a sully group, 13. casbom— oi FE ssa oY cy a 15, Unc has» eabonyl funetional group, whereas eyosine ha an amino functional group 222 SOLUTIONS 17. Ae deeb inthe text, palmitate and cholestrol ate highly nonpolar and are therefore insoluble in wate: Both ate highly aliphatic. Alanine is water seluble beau its amino group and carboxylate group ate ioited, which eae ‘er the molecule “stike" Glee i also water soluble Beeaze aye {oup and many bydroryl groupe ae able to form hydrogen bonds with water 19, DNA forms a more regular sructare because DNA consis of only fut Aifrencaueoides, whereas proteins are made up ofa many as 20 dif tntamine aids. In addition, the 20 asin aids bree much more individual ‘arition in thei sructres than do the four nucleotides. Both ofthese fc- (ors rerult in amore regular suucture for DNA. The cellular cole of DNA relic on the sapuenc ofthe nucleotides that make up the DNA, not on the veal shape of the DNA moleeule itself Proteins, on the ther hand, fold dno unigue shapes, as llusacd by endocheln in Figoe 1-4, The ably of proteins to fold into a wide vaticy of shapes means that proteins can dso Serve a wide variety of biochem oles in the ell. According to Table 1-2, ‘he rajr sles of poten in the el acto cay cut metabolic eactions and sosupport ella sete, 21. The pancreacic amyl is unable to digs the ghycoidic bonds ha bik the ghicos residues together in alle. Figure 16 shows the struct i ferences Becween sath and cellulose, Pancetic amsate binds to sarc pot te catalyzing the hydeai ofthe gyeosiic bond thus the enayme nd the starch mast have shapes that are complementary. The enzyme would be unable te bind tothe celulore, whose structure is much diffrent fom that of sarc, 23. A positive entropy change indiats that che system has became mote disordered, « negative camopy change indcaee chat the syste hae become spore ordered (a) negative (& posive (0 postive (@ postive {e) negative 25. The polymeric moleesl is mote ordered and thus has lees entopy A mitute of constivuent monomers has a lage number of dtferene aangement ike she balls seeered on spool table) and thus ar greet catcpy. 27. The dissolution of ammonium nitrate in water ies highly endothermic process, a indicated by the postive value of AH. This means that when Ammonium nittate dissolves in wate, the sytem absorbs heat fom the su toundings and the wrounding become cold The plastic bag containing ‘he ammonium nitrate Becomes cold and can be ed 6a cold pak ro est ab injury 29, Firs, alate AH and AS, described in Sample Caeulsion 1-1 AH= Hy ~ th, GOL} + mol"! ~ 544) > mol 6) mol S~ 5, BYR camol" 227K ol“! AW= 21] K ol (9) AG~ (6000 J mal“) ~ + 273 KYAT KT mo) AG= 180}- mo “The eseton sno favonble a 4°C, (8) AG = (6000 J+ mel!) — (37 + 273 KE} KF“) AG = =510}+ mol The ation is avorable a 37°C. B10 —14.3 kf mol” ~ 273 + 25 KAS) 13 KJ mel! > (273 + 25 VAS) M48} moi! > as AS cauld be any poshive value, or it could havea negative value sealer (an =48 J mol 629630 Ch2 Solutions 33, Proces (dis never spontaneous. 435. The disoluton of uses in water ivan endathezie proces and has 2 posive A/f value. In order co be spontaneous, the proces mus also have 2 positive AS value inorder forthe fee energy change of the proces to be negniveSolucions havea higher order of entropy thas the solvent and slate aloe 137, (a) The conversion of glucose to glucose--phosphate is no favorable because the AG value forthe teaction is posite, indiating an ender onic proces (b) 1 the evo reactions are coupled, the ove reaction would be the sam of the two individual rescaons. The AU value would be te am of the AG values for the ewo individual reactions ATP + glucose = ADP + glacote6-phosphate AG ~ ~167 i) mol Coupling the conversion af ghicore ro glicose-6-phowphate with the Inydalsis of ATP has converted an unfavorable seaction oa favorable reaction. The AG vale ofthe coupled reaction i negative, which ind ‘ate that che eatin a wit favorable 39. C (most oxidized, A, B (mor reduced) 41. (a) oxidned () oxidized (© oxidized (@) reduced 45, (a) Palmitate carbon atoms, which ave the formula —CH,—, are ‘more reduced than CO, 20 their reoxidaion to CO; can slate fee cnciy. (b) Bocas the CH, — groups of palmitate are mor educed han thos fucose (COL), hei convesion tothe fly exidaed CO; would bbeesen more chemedyamicllyfvoabe (havea ager nepsive ale of AG} chan the convesion of gluceseazbons to CO. Theeote, palmate ‘ebons eould provide more ee energy than gucoe azbons 45. ‘Te experiment was sigiicant because it demmonstated that was por "ibe to ayntheie the bung blocks of bilogiesl macromaeeser (ane acids cabohydrates, and nudlic aid) using only inorganic gases a ating raters and lightning aan energy sours, that the conditions that most kely existed in the prebotc wld 47. Morphologie difeences, which ase uefal for casing lange ‘oxganisns, ate not wef for bactetia which often look alike. Further, mroeeopc orgies donot leave an eal incerpeted imprint inthe foe tecotd, at vertebrate do, Thus, molecu information is often the only means for tracing the evoasionay biory of acters 49. (a) HIS and 17 ae closely ated, ate H4 and HUA (6) Hi and H14 are mos losely related to HE, chapter? 1. The water moleale isnot perfelytetraedtal because the ecteons in the nonbonding ovbisle repel the electrons inthe bonding orbitals more than the bonding elctons repel each other. The angle beween the bonding cotta i therefore lightly ess than 103°, 3 Ammonia pole becae it ha one wshated eleeon pate shape i uigoal pyramidal andthe molecule not symmetical. Niogen i ote lc ‘ronegative han hydrogen so pata negative charges resid on the nitrogen and pata posve charges onthe hydrogens « N 4S at fH 8 st 5. The arrows point roward hydrogen accepots and away from hydrogen doners: \ I 9 HO 4 rorad snsaty tt 0-H, pH Ane boo- 1 N oO N. Usieasid 7. (van der Wials ores (dipole-dipole interacions) (©) Hydiogen bonding (@ wan der Wale ores (London dipetsion fore) (@) lonicinceractions 9. From the highest mecking point to dhe lowes ming pont , BE, A, D. Compound C (ues, making point 133°C) har the Fanetonal groupe at cn sere as hydiogen dans andlor accepts. Compound B (acetamide, melting point 80 16) hat one lee NH group thin Compound C and shercore fous fewer hydtoges bonds Compound F (propionaldehyde, sing point 80°C) hae one faneional group tht can serv a ydrogen bond aceptoe, but i as no donors, so dipole-dipole forces are the ange intermolecular forces n a sample of th compound. Compound A meth ey ether, mele ing point 113°C) ao has one functional group that ean seve a a ydogen bond acer (tas no denon), but it as hyreecbon porons that inert wi one another via London dpesen forces, Cmpound D (pentane, ling Point ~139.67°0) is nonpolar and experiences eniy London cipeson forex. {0 cha the lowest ening poi in the group. 11, Aquatic organisms tht lve inthe pond ate able co survive the wine. Sine he water at che borom ofthe pond remains inthe liquid form instead of ficesing, the ganas ate able to move around, The eon top of the pond also serves as an insulating layer fom the cold winter ait 13. The possvely charged ammonisim ion i eurounded by 3 shel oF water molecules tha ate evieted so that thet partly negatively charged oxygen sxomsincerat with the postive charge onthe ammenim ion. Similey, the reqaively charged slate ion is hydeated with water molecles eviemted 40 thatthe patialy positively charged hydrogen asoms interes with the nega tive chage om the slate anion. (Not show in the diagram isthe fact that the ammonia ions ournamber she aliens by a2: t ato Algo noe that the exact number of water moleeles shown is unimportant)15, (a) Surice censon i defined as the force thas mast be applied to eurfice snoleeules ina Liquid so hat they may experince these Frcs atthe toleeles inthe iver ofthe liquid. Wates suri enson ie geer than ethanol because the atength and numberof wate itermaleeat forces (hydrogen bonds ae both greater, Ethanol —OH group also forms hydrogen bonds, bat che hydrocarbon portion ofthe molecule cannot interact favorably with water and weaker London dispecsion fares For trad () The kinetic energy of the water molecules increases when tem petaure inctetes. Intermolecular foters are weaker in strength as 4 Consequence ofthe increased moleclat motion. Because rrice te son increas when the strength of intermolecular fores increas, a described in par (a, surface tension decreases whea temperature 17, Methanol, which asthe highest delete constane. would be the best solvent lor the ationie NH; The polarity f the alcohol, which ll eonesin 4 primary OH group, vais with the sizeof the hydrocarbon porto. 1-Butanol. with the laigest hydsophbic group, isthe lest polar and there fore has che highest dileewe conseanc. 19, (2) Fis, elelate the suber of moles of protein wing Avopadeos umber 1 mole Taam maces V6 1" moles 1000 molecules x [New allt che volume of che ell expressing rin centimeters a 3 4a(5 x 107m)! volume 5.2% 107Y em! Since 1 cm! = 1 mL the volume ie 5.2107" mL, or 5.2107 ‘Thetefor, che concencation ofthe protein is 5X 10°? moles 6.02 x 10" moles T ‘mole 52% 107. » 1.6 X 10" mleeuer 21. Compound A is amphiphilic and has 2 pola head and nonpolar tail indicated and can form + micelle Ge Hig. 2-10). Compound 8 is nonpolar and cannot form + micelle ofa bilayer Compound C ie polit (onic) and eannot form a mieclle ora bilayer. Compound D is amphiphilic and has a polar head and ewo nonpolar tails indiated and ean form a bilayer ee Fig. 2-11). Compound E is polar and lovms neither a micelle nor bilayer. we [ete 7 ci o-t aaa] sp wore einem onde JN noua ch 2 Solutions 631 28. (2) Nonpobe sail 16“ {The hydrophobic grese can move nto the hydkophobic cove of the vwarecoluble soap micelle, The “dislved”greae can then be washed aay wit che miele 25. (a) The nonpolar core of the lip bilayer help preven the passage of vue ine the pole wer molecules cannot easly penetrate te hyro- phobic ete of the blaye= {b) Most human cells ate suounded by 4 Mid conaining about 150M Na~ andlighely lee CI” (ee Fig 2.13). A oltion containing 150 mM NaCl mimic she exalllar ud and cherefoe help mine tain the olted ells in nest normal conditions Te she ells were placed i pute wate, water would rend ro enter he cell by oso his ight ce the ells to burt. 27. (a) CO, i nonpolar and woul be able to cos bilayer {) Glucose is polar and would not beable to pas dough a bilayer be- ‘ae the presence ofthe yd groups means ghar irhighly bydated tnd would not be able opus ough the nonpolar tale of the molecule forming the bilayer {(@ DNP is nonpolar and would be able co cross bilayer (4) Calcium ions are charged and ae ike pisos, highly hydrated and would no be able ro cto aiid biayes 29, Substance preseatathigh concession mave to anaes oflow concen- tration spontaneatsiy. or downs» eaneentaton gradient in proce hat inceae their entropy. The expots of Na” ions out of the cll equie hat ‘he sodium ine be transported fom anaes of low concentration to an ates of high concentation. The sume ite for possum anspor, Tas, these process ate not spontancou, and an inpt of ella energy i requized co ‘ccompls the transport 31. Inahigh-solute medium. he eyoplasm loses watt theseor is volume decreases na lowsolate medium, the roplasm puns water and certore fn volume increase, 33, Since the molecular mass of HO is 18.0 g mo, a given volume (or example, 11 1000 g) har a molar concentration of 1000 g I~" =18.0g 58.5 M. By definition iter of water at pH. 7.0 ha a hydrogen Jan concentration of 1.0 X 107” M, Therefore, the tatia of [HO] to [Et] 1955.5 MI(.0% 10" M) = 5.55 % 10 138. The HClia song acid and disocates completely. This means thc the ‘oneeneration of hydrogen ins contbuted by the HCI ie 1.0% 10°” M. ‘Buc che concentation ofthe hydrogen ins contnbuted by the dissociation632 Ch2 Solutions of waters L0Old gente than thi: 1.0 X 107" M. The conentation of the byiogen ions ontbuedby the HCl segigle in cmparion Thee ote the pf ofthe ion equal 70 37. Tn aqueous lation, whee iu albicheie resco place, an extemely tong acid wich ar IC Basoces comple so tha ll protons ar donated to water HCI ~ HO» H,0" + Gln Ths lees LO" ache only acide species remaining 39, Sine pit = —log(H),'] = 107" Fors BE") = 107M = 25 x 107M For ring [1] = 10° = 325 10°*M (0.02013(1.0 M) 41 (@) The fina concentration of HNO, is 0.038 M 2 Since HINO, ie a stong acid and dusocaes compel the added [31] Js equal to [HINO,]. (The exiting hydrogen ion concentration in the svater tell, 1.0 107” M, canbe ignored because i is much smaller than the hydtogen ion conceatation canurbuted bythe nti ai) Host | =1ag(0.038) p= 14 (6) The inal concentation of KOH is (0015 110.0M) _ 4 5,4 SEN 0009 M Since KOH disoriates completely, che added [OH] i equal to the KOH], (The exiting hydroxide ion concentation in the water il, 1,0 X 10-7 M canbe ignored because itis much smaller than the by- 107) pH= 125 43. The stomach contents have low pH due the contribution of gastric juice (GEE 1523.0). When che parialy digested material enters the small intestine, che addition of pancreatic juice (GH 7.8-8.0) neutalines the acid ad increases the PHL 45. @) GO; WSO” (HPO; @ CO; (Aol PO" (HOI a7. 1, -COOIt a N i 4 pene es bi, d i te nowy Tyne ati ai i cr, ai—|-or é 4¢Merphine chanelle aid (MES) 4. i “HN—cH—C—0- Ge, Ga, ce, i de, Ny 51, The pKof the fluorinated compound would be Tower (is 9.0) hac is the compound becomes les baie and mote aide, This cece because the F arom, which is highly eleewonegative, pulls on che nitrogen’ eleewons loosening ts held an the proton, 53, (a) 10 mM glyeinamide busier because its pis closer co the desied pH. (6) 20 mM Ts buter because the higher the concentration of the bles ing species, dhe more acid or bse an newtaie (@ Neither; each solution wil contain an equlibtium mictre of the Dori acid and ies conjugate base borate) 55. Becawe itis small and nonpolar (ee Solution 2), CO, can quickly di fuse acon ell membranes text the tres and enter red blood eel 57, (a) The thee ionizable protons of phosphoric aid have pK’ values of 215, 682, and 12.58 (Table 2-4), The pX values ae the midpoint of the dation cure we : “prec [H:Poz) olf Tos 19 18 20 28 80 (H.Pou Hi ons aissosiatod (@) The disociion ofthe second proton has ap of 82, whic is lose tothe pH of blood Therefore, the wee acid preset in blood ie H,207 and the weak acid is HPO (€ The dssciacion af the third proton has apf 12.38. Therefore, abut FEraolion ac pH 1 would consis of the weak acd HPO} andi cot juga base, PO} (upped asthe sodium ss Na}HPO, and NasPO), 59. Calculate she ral concentration of he wel sci (H,POT) and con- jugae base (HPO!™). Note that Kia spectator on, (0.025 1)22.0M) (t20; — 3M 2) _ (9.0501).20M) proj] = PODEOM 9 55 4¢ Tero G20 * Next substitute these values into the Henderson Haselbalch equation ‘sing the pX values in Table 2-4 tog PES pA lg ct pH = 682 + log(0.50 M)(0.25 M) pH = 682 - 0.50 pH 732(61, Tis, decermine the ratio of JT] co [HA Hi = pk log AD PH p+ logy tary lo Hpk Sinay PP LAT _ sgitere ina Substicute che values fr the desired pH (5.0) andthe pX(476) IA] = ygyse-a70 = 90 ee wo = 174 CCalealate dhe number of mole of acetate (A")aleay preset: (0.501) (0.20 mol +L") = 0.10 moles acetate (Caeulate the moles of acetic acid needed, based on the ealeulted eat: wl 4 inar~ '” 0.10 males trig = Oot [HA] = 0.057 moles nally, cleulate the volume of glacial asic aid needed 0.057 mole Ta mol I> 00981. 93.3 mt “The addltion of 3.3 ml. to SO0-ml solusion dilute the solution by les ‘han 196, which doen inttnduce igaicant err. 63. @) HO=W.O. Ni Nic, s07 +140 LO 805 +H Weak sed (14) HomLG.—N — X—icH),-s05 +150" Conjugate base (8) () The pYor HEPES i755; therefore, effective blering range is 655-855, 260.3¢ @10Lx t= 6 ‘Weigh 26 g of the HEPES sale and add 10a beakec.Dissohe in slighty less than 1.0 Iter of water (leave “room” for dhe HCI sluion that wl beaded in the nxt stp) () Ae the Binal 9 wo THAI For each mole of HCL added, x one mele of HEPES salt ($7) will be convered to a mole of HEPES acid (HA). The starting amount af A~ is (.0 1300.10 mol L~') ~ 0.10 mole. Afer the HCL is added, he amount of A" will be 0.10 mle ~ x ad the amount of HA wil be Consequenty 0.10 mole 1 oPlt-ah = 92-798 = 49h 2 tary 2.10 mole TAC Lg) — 240 mole = = ina) > 22x = 0.10 mel ~ 382+ = 0.10 mol = 010 mol/382 = 0.0262 mol CCaleslate how much 6.0 MHC ro add 0.0262 mol PERSE = 0.0064 Lor 44 mL Ch Solutions 633 “To make the bulls, disolve 26 g of HEPES ale [sce pare (1 in less than LOL. Add 44 ral of 6.0 MFICL then add wate to bring the final volume to 1.0. 65. (a) Fist, ealeulte the ratio of (A"] to (HA). Resranging the Hlenderaon-Hassebalch equation gives aL ina ‘Viera ll ofthe ein the wea acd form. Therefor, the concen uation of che weak acid, TIA i 0.10 M and the concentration ofthe conjugate base, AW is 5.0 % 10™* M. {) The aided HCl dissociates completly so the amount of H” added (00015 1)(8.0 mol “1~) ~ 0.0045 mal. In an elec baller, the acid would convert some of che conjugate is base wo weak acid. But ‘he concentration of conjugate bates alesdy negligible. Therefore. the ‘moles of additional HI" should be added roche conceneaion of hydro- en ions already present (1,0 % 107? M), fora total concentration of bows M, PHO A 1g) 19-4 5 10°? pH = ~log[#t"] = log (0.0145 M) = 1.84 The bul has not functioned effectively. Thee wat not enough conja- gare base ro react with the additonal hydrogen ions added, The resus 2 decreat in pH frm 2.0 to 184, {@) When NaOH is added, an equivalence amount of Tis acid (HA) is converted to Tie base (A™), etx moles of OH" added = (0.0015 1) {G.0 mol 1") ~ 0.0045 moles ~ 45 mmol The inal amount of AW is 5.0 X 10°? mol + 45 mmel = 4.5 mal The nal amovine of HA ie 100 mmol ~ 4.5 mmol ~ 95.8 mmol, “The new pH is determined by substituting the new concentrations of Hand HA into the Henderon-Hatebalch equation (a = pi bo Pee ee OTA (45 mmol) Simmel) pH = 83+ (-13)=70 pH = 83 + log Tiss aot an efecive butler at pH = 2.0, pH more than 6 units lower ‘han ste pKvale, Virsllyall of the Ts in she weak seid form a thie pH Ifacid added, there sno enough bate to absocb the ee added hydrogen ions and the pH decrease, i ase sade, some of the weak seid i converted tothe conjugate base and the pH approaches the value ofthe pK (67, Arssonia and ammonium ions atin equilibrium, as represented by the following equation NET SH NH, (Carbonic acid and bicarbonate ions ar in equim, a presented by the fellowing equation: 14,00, =H" + HCO; Phouphat ions are in equilibrium, according to the following equation: 1007 =H’ + HPO} In metabolic acidosis, the concentaton of protons increases, othe equi rim shiftrto form H,PO%, eizonic acd snd smmonism ions. In oer co bing the pet back co nora, the kidney wil excrete HyPO7 and anume- rim ions and bicibonate ins wil be resbeobed. Te rel ina decrease the concentration of protons and an incase in blood pH. Chapter3 1. The hea eestmentdetoys che polvacharde explo she wild ype Preumacocn, but the DNA survives the heat westment, The DNA then “invader the mutant Preumococar and rupplie the genes encoding the es aymes needed forthe capsule synthetic pathnay tha the mutant aks, The634 Ch3 Solutions mutant is now able co symthesie a capsule and has the capacity wo cause cae, which tele in the death ofthe mice and the appesrance of enesp- ulated Preumeenca inthe mouse tsi 3. Some ofthe labeled “patent” DNA appeats in the progeny, but none of ‘the labeled proce appeas inthe progeny. Ths indeaes that the baceto- phage DNA is invelved inthe production of progeny bacteriophages, but bacteriophage protein i not requiced 5 ya, He. " S-Meigleoine 7. The bat, Schlorouracl ea batt for dhymine (-methyursel) 9, ‘Thymine (-methylucai) contains a methyl group arached co C5 of the pytimiine sng of ural an. oH OH the dinadeorde were DNA, it would lack OH groupe teach ribose C2 positon, 15, The total amount of pines (A+ G) in DNA must equal the total amount of pyrimidines (C +T) because each base pain he double-stranded [DNA molecule consi ofa purine anda pyrimidine, This ir noc ue for RNA, which is single-stranded, 15, (a) Using Chargalf’s rules (ce Solution 14), the number of C resi dacs mac aio be 24182. Subteseting 2X 24.182) om 97.004 yede 48,640 (A + T) residues. Dividing this number by 2 yields 24.320 tsi ues each of A and (b) GenBank reports only the sequence of single stand of DNA. since the sequence ofthe complementary stand can cay be dedced using ‘Charest cules. 17, Weiss GC be pai 19, The satemen ie filsebecaue she gesteraabity of GC-rich DNA ie due to che stronger stacking seasons involving GiC bate pais and doce not depend on the number of hydragen bonds inthe baz pit 21, The sugar-phosphatebackboae i found onthe ouside ofthe molecule The polar sgat molecules can fot hydrogen bonds with the surrounding water molecules, The negatively charged phoephate grospr interact favorbly swith positively charged ions. The nonpolar niogen bases ae lound oa the inside ofthe molec and interact fivorably a aking interactions, foie ‘way contact with the aqueous slution it miniaied, as described by the Inydeophobic eet. 23. Relative absoroance at 260 nm 10 25. The DNA fiom the ongensms that thrive in hor environments would ‘entan mote G and C than DNA fiom species living in a mote temperate “avsronment. The higher GC consent neteares the ably of ONA at high temperature, 27, You should incrate the tempeatue to mele ous imperfect entches besween she probe and the DNA, 29, (a) An inherited characeiic could be determined by anor chan one pte (0) Some sequences of DNA encode RNA molecules that ae oc tans Inted inte protein (for example, ¢RNA and tRNA). (© Some genes are noe uasscribed during a els ifetime. This en o¢- ctf the gene is expresed only under certain environmental conitions ‘rin cercain specialized celina mulielllar organism, 31, (a) TGTGGTACCACGTAGACTGA @ ACACCAUGGUGCAUCUGACU 33, (a) A poly(Phe) polypeptide was produced (6) PattA) produces poly: pely(C) yields polyPea): and poly(G) veld poly(Gl. 56. Pst reading fame: AGG TCT TCA GGG AAT GCC TGG CGA GAG G&G AGC AG Ser-Ser-Ser-Gly-Arn-Ala-Trp-Arg-Glw-Gly-Ser TG TAY CGC TGG GEC CAA AGG C ‘Trp-Tyr-Arg-Trp-Ala-Gln-Arg Second riding Fame! AGGT CTT CAG GGA ATG CCT GGC GAG AGG GGA GCA Gly-Leu-Gln-Gly-Met-Pro-Gly-Glu-Arg-Gly -Ala- GCT GGT ATC GCT GGG ccc AAA Gac Ala-Gly-Ie-Ala-Gly-Pro-Lys-Gly “Thind reading fame: AG GTC TTC AGG GAA TGC CTG GCG AGA GGG GAG CAG Val-Phe-Acg-Glu-Cys-Leu-Ala-Atg-Gly-Glu-Gla. (TG GTA TeG CTG GGC CCA AAG GC Leu-Val-Ser-Lew-Gly-Pro-Lys 37. Asparagine has «wo codons, AAU and AAC (ie Table 33). An A> 1G mutation athe second position could generat a codon far serine (AGU e° AGC, 39, The genetic code (shows in ‘Table 3) i redundant, Since there ate 4 Aierne posites for 3 bate codons and oly 20 amino acids, ome amino acide have mote than one codon, If «mutation just happens co occur in che third postion (3 end) the mutation might not ater te protein sequence. Foretample, GUU, GUC. GUA and GUG all eode fr valine. A metation in the third pasion of valine codon would sil rest inthe election of valine and would have ne elect onthe arsine acid sequence ofthe protein, A. Fins, ieniy she ransation star sit, the Met reside whee codon ie AUG in the mRNA (ee Table $-3) or ATG in the DNA. Teanslation stopsa the DNA sequence TAA, which coresponds tothe stp codon UAA in (he mRNA, Ue Table 33 to decode the intervening codons, substituting Vier CICAGAGITCACC ATG GGC TEC ATC GGT GCA GOA AGC ATG GAA, ‘Met Gly Ser lle Gly Ala alo Ser Met Glo Tod bp... UUCUUU GEC AGA UGU GUU UCC CCU UAA AAAGAA Phe Phe Gh arg cys Val Ser Pro * 43. Crud wih such a sal genome and only 182 gees, must be some sore of parasite rather than afeeliving Bacterium. (fac. C. rudd i an insect symbione) 45. The 35 milion dilrences ou of 3.2 billion otal nucleotides present sppromimatey 86, 7 eee han the orignal esi, (Thie number tects lease difrences and docs not accu for inserions and deletions of rmukiple bases) 47. (a) The fs seading frame isthe longest ORE Fit reading fame: TAT GGG ATG GCT GAG TAC AGC ACG'TTG AAT GAG GcG. ‘Tyr-Gly-Met-Ala-Glu-Tyt-See-Ser-Leu-Tyr-Glu-Ala- ATG GCC Ger GGT Gar G Met-Ala-Ala-Gly -Asp Second reading fame! ATG GGA TGG CTG AGTACA GCA CGT TGA ATG AGG Met-Gly-Trp-Lew-Ser-Thr-Ala-Arg-ssop-Mec-Arg aa 1G cre Gre are Arg Trp-Pro-Lew-Val- Met ‘Third reading fame (A UGG GAT GGC TGA GIA CAG CAC GIT GAA TGA GGC “Tyr Aep-Gly-aeap-Lew-Gla-Hie- Val-Gli-stop-Gly- GAT GGC CGE TGG TGA TG Gly-Arg-Tep-ssap- (@) Assuming the reading fame har been conecly ented, she most lly sare ste is the ise Mec residue nthe fist ORF 49. Ifa SNP occurs every 300 nucleoids oso, and if there ate about 4 million ki inthe human genome ne Table 34) then a SNP occurs every (8X 10°7300) ~ 10,000 kb oro. Source: hrpllghrnlm ah gowhandbok! (enomicresearc ang) 51. (a) The tzongest socations ae located besween postions 67,400,000 and 67.450.000. (@) Gene 8 contains SNPs aocsted withthe dear whereas genes Aand B do not. [ftom Duets, RH, ea, Sen 314, 1461-1463 (2006) ] 55. Polymerizacion occurs in the 5'—>3" direction and a3" OF group must bearable so the primer mist be complementary tothe sequence as shown. 5" AGTCGATCCCTGATCGTACGCTACGGTAACGT" S-IGCCATTGCA'S' 55. A resution endonuedease i often wsed to prepare fagmentsof DNA for insertion into 3 laning vector Since the cloned DNA contains the 06 tin ste whose sequence is know), sis sequence cas be wed a asst point sequence the unknown DNA segment 57. You can we a DNA polymerase that ir not hestetabe, You would have to coal the reaction mixture ta temperatute a which the polymerase wotke bert, and you would have to add the enzyme at each rescion jee beeniee it would be destoyed everytime the temperature was ated to inl the double-stranded DNA, 59. Mop, Asl, EcoRI, Prt, Saul, and Not! generat icy ende, Alt and EcoRV generate blunt ends, G1, The teatiction enayme with the longer recognition sequence would be rave eter beens i ly to eneouner tir aquence les offen and ‘hetelore will cave che DNA ls Gequenly than a esction enayte with a shore eecognition sequence. 63. Ifyou were co use plasmids, you would need at least 150,000 clones accommodate the 4 X 10°-Kb genome in fragments of 20 Kb each Gee ch4 Solutions 635 “Table 3.6). This an almost unmanageable sumbee However, you wete {use yeas atiliialchromesomes. you would need only 2 minimum of 3000 clones to accommodate the 3 X 10‘-Kb geneme in fagments of 1000 kb, 65. Atop codon would need to fllow the Leu cesidue (instead ofthe Ser that is presen in the wildtype protein). A mismatched primer could sab- suture sUCA (Set) codon fora UGA stop codon. Tete at several correct awets du so che redundaney ofthe genetic cade. One ponible sequence ISGTTTTCGCIGTTCTTICAUGA. [Tom Yur, Ly J Vio 83, 11588 11598 (2009) 1. (@) The chiral carbon is marked with an asterisk. o-Alanine, the mittor itmage isms, i shown gor | G0" vance | eon oy fy Aline | Aline (6) Since the majority of protine contain t-amino acids the presence of -amino acid inthe bacrevl ell wall renders the cll wal Tee cepble co digestion by proteases (nuymes produced by certain otgan- isms co destroy bacteria 3. (2) His, Phe, Pro I Tip (6) Hl Phe. ip (@) His, Cy, Ser Ths, Tye (@ Gy fe) Aug Lye (8) As. Glu ig) Cys Mee 5. From leas soluble co most solubleTip, Val The, Sey Arg. You ean we “Tble 4-3 ar guide, bot you should alo be able todo this type of problem withour using the table 7. Tris combination cannot occur in sgnifcane amount at any pH. An \unprotonated amine group cannot exit with protonated eboeyat roip because the amino groups pis much greater than th carboxy! groups pK (therefore the eebosy grou inizes at lower pH than the amino group) 9. Ina fee amino acd, che chaged amino and carbonate groups, which are spirated only by the alpha carbon, sleeronclly nflence each aber ‘When the amino acid fms a peptide bond, one ofthese groupe is newtal- saed herby altering the electronic properties ofthe remaining gro, 11, Ar plH 60, che Neccrminus is protonated (+1 charge), and the C- ‘erininus ie unprotonated(~1 charge). Te four Hie side cine (pX= 6.0) ate hal protonated (Se Fig. 2-17) so that each has a barge of +0.5. The tetrapeptide therefore har a net chatge of +2. 13, (9) The thee amino acide ae Sez, Tye. and Gly. {) Cyeliation of he polypeptide backbone aceursberween the ebony ‘aubon of Ser and the amide nitrogen of Gly {@) Oxidation rests ins double bond in the Ty side chain berween Cat and CB (the second carbon ofthe side chai) on636 Ch 4 Solutions Auparame (Ap-Phe-OMe) rn 9 srNcgito- Giione » os, on i a, 21, There ae st posible sequence: HPR, HR@, PHR, PRH, RHP, RPE, 23, (9 tetany (b) quaternary (© primary (a secondary 27. Both the DNA helt and the a helix varn in the rghthanded dice tuon. Both helices have tightly packed ineros: In DNA, the intevior of the helt is occupied by aitzogenous base: in the a belie, the atoms of the polypeptide backbone contact one another. Inthe a helix, the side chains extend outward fom the hel DNA bel, 29, The amino group of Pro ilinked ots ide chain (ae Fig, 4-2) which limite the conformational Beibilty of a peptide bond involving the amino troup. The geometry of this pepride bond i incompatible with the bond ngs requited fora polypeptide to form an abel ie such structure exist in the ‘The polar amine acid residues ate shown in ted; che nonpolar residues are shown in blue. The polar residues are mainly on one side of the helix ‘while the nonpolar reside are on she other vide. Quite afew ofthe polit ‘ide Chane are positively charged. [This isan example of an amphipathic helix From Marcoglio. 8, Graf, R, and Dobbestein, B, EMO J. 16, 6536-6645 (1997).) 35. Those phosphate uomerae ian ceample of lB protein. 35. 1 ponibe that che ligand har a posve charge and farms anion pit withthe negatively charged Gla on the receptor. When the Gl is mutated tan Ala, che negative chuge om the seeptr islet and the ion pat between the receptor and the ligand ean no Tonge foc 37, Thete are many posible answers for this question. An example i shown foreach below). eo Bk # oat @ Heal @ 8 fh ba, L Vander Wak 1 be pkogen fever Sereen £5 Atyciu Toning bereen Teeadva dy ioopar FE Tyeandser hog Ly cod- " i f 4 ph he cH ree i yb ant39. A polypeptide synthesized in a living ell has a sequence cat has been optimized by natal selection s0 chat i ald properly (with bydzophobie residues on the inside and polar residues on the outside). The random = ‘quence ofthe ayathetie pepeide cannot dret « caberen folding proces, fo hydcophobie side chsne on diferent molecules aggregate, causing the polypeptide to precipitate frm elution 41, Anfcars iboruleae experiment demonstnted that a protest primary sructute dice ts tee-dimensional sere. although some Proteins, ike ribonueleze, cn zenatre spontaneously in etre, most pro tein equie che asitanceof molecular chaperones to fold propel in se, 43. When the semperstzeincese, the wbrationl and roationsl energy ofthe ators making up the protein alee alte inerese, which increases ‘he chance tha the preci wll denaure, Increasing the synthesis of chap- tone under thee conditions allows the ev renatue r fel, proteins ‘har ave ben denatured by hes. 45, Proline doesnot ft well nto the structure ofthe o helix, because of both ie geometry (ace Problem 29) andthe absence ofa peptide —NH to conaribute wo hydrogen bonding (ce Problem 37). Tis amino acd substi tion would produce a protein with decreased abil, which woud affet the abiliyof ted blood els o deform chet shape inorder co squeeze through capillaries. The elle would become damaged and would be removed fom fedlation, using anemia. (From Johnson, C.P, Gaetan, M.. Orca. V, Bhasin, N, Harpe. 5. Gallagher, PG, Speicher D.W, and Dreher. DE, ‘Blood 109, 3558-3543 2007) | 47. If che proreins were homodimers, chey would be mote Hkely co have two iene sites o interact with thei palindromic recognition tes inthe DNA. Heterodimesic proeine would likey lack the ncesaryeymmetey, (Unfit, these ensymes are homedimerie) 49. The sfnine residues, with their positively charged sidechains and the auparcate rides, ith thet negatively charged side chains, ate likely to be found on the sulace of the monomer These rider ely form ion pais ‘hac eile the dimetic form, When these esiduer were mated to neutal tino acid side chains, the fon pir could not form, the dimer could not fore, and the equlibium shifted in favor ofthe monomers. [Pom Huang, Y, Misquits S. Blond, SY, Adame F, and Colman, RE, J Bil. Chee 2283, 52800-52888 (2008), 51. The only ionnable groups in che dipepride ae the C-erminss (p= 3.5) aud the Nterminus (p= 90). pl = 14 (35 9.0) = 625. 53. The protein must contain groupe that undergo protonation!deproton- ation at pH values near 4.3. The only amino acide with side chain pK valet tn this range are Ap and Cle (Table 1), 20 the protein likly camtains an sbundanes ofthese residue. 15. At pt 7.0, the peptide likly ha nt postive chagge since Aag(R) and ye (K) outnumber Arp (D) and Gli (). Therefore, the pepide i likely to bind to CM groups but norco DEAE groups. 57. The amin terminal reside is Ala, The carboxyl rcminal residue muse be Mee since the dodeespepide wat not cleaved when CNBr war added. CChymourypsin cleaves ate Phe. Pagment I contains the Asp. sit appears tm the sequence fr, and Phe mst be the elesvage site Type leave afer ys, Since fagmeat il contains Asp, Lys must be the deavage site Elasase cleaves ater iy, Val and Ser Vil mir oceupy the second position followed bya Po, and this Vl was nor deaved, Typin Chymetrpein Asp-Val-Pro-Lys-Ser—Asp-Gln-Phe-Val-Gly-Leu-Met | \/ Ela Elatate [Based on Anastari, A, Montecucchi,P, Exspamer,V. and Vint J. Espen: ent 38, 857-888 (1977) 59. Edman degradation of «polypeptide with «dillidecroslink would rot wock propery when the frst Cys became exposed atthe N-terminus of the polypeptide (the Cys would not be tleased in the nex eatin sac it ch Solutions 637 ‘would sll be cavalently inked to a Cys residue farther along the palypeptide ) end becsute GT? hydzolprie occu following sb- “unit incorporation into the micotubule, [n'a dowly growing microtubule, the (+) ead wll contin telatvly more GTP hat har already been hyo. lyzed to GDP-A protein tha preferentially biads to (+) ends that contain GTP rather than GDP could thereby diinguish fat and lowe growing sicrocubuls, 41, Polymers composed of f-cubulin molecules allowed so polymeize in the presence of « nonhydrolyzable analog of GTP ate more stale. When {he tubulin subunics ate exposed to GP in solution the GTP binds to ‘he B-tubelin and then ic hydrolyaed to GDP which remain bound roche Brtubulin. Additional a heterodimers are then added. The microtubule nds with GDP bound to the tubulin are les able than shore bond o GTP becaute protoflanents with GDP bound ae curved tater than resight and tend to fray: If « nonhydroyzable analog is bound, i wll fesemble GIP and the protoflamene willbe steaight racer than curved. Tes les likely to fray and the teulting protoflmment i more able a4 resale 43. Microcubules fotm the mitotic spindle dung cll division, Because cancer els ate rapidly dividing ells. and hence ndenge mitosis a rte smote rapid than in most other body eis drugs chat target tubulin and thus tncerfere with the formation ofthe mito epndle in some way wl slow the (rom of eancerous ramet. 45. Colchicine. which promotes miciocubule depolymerization, inhibits ‘he mobili ofthe nestropble because ell mobility rvs from polymer iaation and depolymerization of microtubules 47. As shown in Figure 522, microtubules link eeplicated envomosomes to ‘ov point st opposite ses ofthe ell. Vinblatine abil to sabize the smiciotubules a the (+) end whale desabizing the (=) end disrupts this Ch Solutions 639 linkage: Micoss slows down or completely halts asa esl. [From Panda, 1D, Jordan, MA Chu, KC, and Wilbon, LJ Biol Chem, 271, 29807-29812 (1996)] 49. (a) The ist and fourth side chains te buried ince coiled eo but the remaining side chains ae exposed co the solvent and therefore cend co bepolar or charged. () Aihough the residues at positions 1 and 4 in both sequences ate bydtophabie, Tip and Tyr are much lage than Ile and Val and would ‘herefore nor Bs well nthe aes of contex Between the wo polypep- sides in ciled eal ce Fig. 525) 51. The reducing agent breaks the dsulide bonds (—S—S—) berween betatin molecules Seng the hae brings the sedced Cys cesiducs (vith ‘heir —SH group) closer to new parses on other keratin chains. When the hairs then exposed to an oxidising agent. new daufde bonds orm between ‘the Cys esidues and the hates the shape ofthe rollers, 53. (a) Acti primary ssuctue ist amine acd sequene. Is secondary srucure includes ie @ helice, 8 sheets, ard other conformations af ‘he polypepside backbone, Ie eriatysrctue ithe arrangement of te backbone and allie sdechsinsin a globular sructare Monemeric sein by definition has no quaternaty suture. However, when acin mone- sets suacate to form + mierolarent, the aerangemene of sbunite becomes the fiamene quaternary structuce. Thus, actin is an example fs protein that har quaternary retire under certain condition {) Gallager primary sructte amino aid sequence Ie second- say srscere ie the lefe handed helical conformation characte of {he Gh-Pro-Hyp repeating Sequence fs etary sructute is esencialy fhe same ar tr sceandaty arate, ince moet ofthe poten conte af fone ype of secondary suueture. Collages quaternary suuctue isthe iscangement oie three chine ina teple el Tei alo posible view ‘he tiple lca form of trary strut, with quaternary srutute referring tothe seoction of eollagen molec, 155. The bacterial enzymes degrade colagen, she major prossn in connective tie, Teatment of the Gas with thee enymes degrades the collagen in ‘he exrcllar matic without harming the elle emslver an the faci tates the prepatation of ell fr culturing (Source: Worthington Biochemical Corporation] 457. (a) Collagen B ifm rt, and collagen A ie fom che ses urchin () The stability ofeach ofthese eolagens is corelted with thei hy Aroxyproline concent. The highe: che percentage of hydroryprolin, the more regular che strustue and the mare dificl i ita melt eultng tn more sabe collagen, The eat has a mote sable cllagen, and the sca ‘rch, which ves cold water, has aes stable collagen, Is impor- ‘ant to note that che melting emperaures ofeach collagen molecule ate higher than the temperature at which exch organism ler Ths, ‘ach organism has stable collagen a the vermperature ofits environment [From Mayne, J. and Robinson J], J Cell Bischere 84, 567-574 (2001) 59. (a) Pro-Pro-Gly)y has a meting temperature of 41°C, while (Po Hyp-Gly)ip bara ming tempesstate of 60°C. (Peo-Hyp-Gly)n and (ro-ProWGiy)y, both have an imino acid content of 67%, but (Pro Hyp-Gly)p contains hydroxyproline, whereas Peo-PronGlyye does not Hydtorypoline herfore has a tabling effec slave vo polne. () PrerPro-Gly)g and (Gly-Pro-Tha( Gal) y have the same mel tng point indicating tat they ave equal abies. This is iteesing because (Pro-Pro-Gly)y hasan imine acid content of 67%, whereas (Giy-Pro-TheGab) sas an min acid content of oly 33%. The gy- seoyatedthiconine rust have an fle simiar to that f proline es posnble tha the galictose, which contains many hydroxy groups, pro- des additional sive for hydrogen banding and would thus contibute to che ably ofthe erp helo. {@) The inclusion of (Gly-PrenTh yi impostan because the results show tha his molecale doesn form a tiple helix. Tis molecule is in- tdaded ara contel vo show thatthe inceated ability of the (Gly-Pre ‘Tar(GaD)s is duet the galactose, not to the threonine residue tele {From Bana, ).G., Peyton, HL, and Bichinger, H. , FERS Let. 475, 237-240 (2000)640 Ch6 Solutions 41 RoR R AAA Hook ere 663, Because collagen ha such an unusual amino acid composition (almost ‘o-thids consists of Gly and Pro or Pro dervztives).it contains elaively ewer of the other amino acide and is therefore not a good a source of amino acids ae proteins contuning a grater vaiey of amino acids In parcicla, gelatin Icks eryprophan and contains only small amounts of toethionine 165. (@) The paciens al sufer from scurvy disease resin fom the lack of vitamin C, ot ascorbate inthe et. (b) Ascorbic acid is necessary forthe formation of hydeoxypoline rei- dues in newly synthesized cllgen chine. Undethydsonylated collagen {sles sable, 0 ssses containing the defecive collagen ae less sound, Trading to brivng joint swelling fatigue, and gum diese (© Pasience with a grtointessnal disease may actually be consuming foods with vitamin ©, but the diene impairs absorption, Patients sf feng from poor densiton and sleoholiam may have overall iiclie ‘with fod intake, Patient fellowing vatious food lade might consume iets chat are s anal or resscivethas hei iva of viamin Ce ‘asulient to support hed collagen sys. (From Olmedo, JM. Yiannis. A, Windgaeen, EB, and Gornet, MK. dnt. Dermal. 45, 9094918 2006), o. i NES 69. (@) Minos ibis the yy! hyonylse nays. fa the presence of ‘mioxi ever ys eis ae hydromiate, as demonstrated by the decease of PH}yine incorporated ito colagen. (&) Since minoxidil inhib lyk hydrxpase, procollagen chains sould be todethydrnyated.Uysines lacking hydro groupe de "ccs the sub ofthe callge an ince he ikelbood hat che Cellagen wil be degraded once scsted fm the Seo ell “This would be efectve in eceing collages concetcations inpatients wth Eri {© A simlar explanation indicts that lngscem minosidl ein sient with roi at he poi ocempeosite alge oy {hess Bbroblacs ofthe dn. Theunderyéonlted olsen sete aed in the presence of rion be lee able tl sce right be ated rarer The medi neat eport only sal ination, dryness cling, hing, and rednen o sde ct ome ten who recived copied minal weaamens fr nly wo Jeu, weve [from Mud, Waller Tj, . a Pinel Se ‘Arch, Bachem Biophys 308, 2-47 (1994) and Pee V. HN. Eng ‘ed 341, 964-975 (199911 7. Myosin rbot Sbrous and globular Is owe beads ae lbular with evr layers of secondary eu. ta however, cms ofa wnge brow eed eo 75. (9 Difsions random proces tends tobe dow specially forge ‘bancs and ove lng diane). Breas random. hopes tire dimensions (nt lineal) and has no diectionaliy (8) As nelly tenapre te ms ave some sr of tac lor Tncar movemen of eg) and an eagne dat moves ego along the stack by converting chemical energy to mechanical energy. The engine tat operate ireretsbly to promee rapid movement in one diction. Fhnaly some soz of addressing system is needed co diet cargo from its soutee wa cesta deination, 75. Wen muscles contact. myosin heads bind and tleae atin in a pro ess that requires ATP forthe physial movement of myosin along the atin lament. At the time of death, cellular process tha genetate ATP cease ‘Myosin heads remain bound to atin, but in he absence of ATE the confor- tmational change that cute myosin to eleate che atin doce not eect, and sifened muscles ae the consequence, 77. Normal bone development involves the formation of bone tse in response to stenes placed onthe bone, When muscle activity is impsted, ain muscular éscopy the forces th shape bone development ar ls abnoxma leading to aber bone growth, Chapters 1A globular protein can bind rubzate in a selteed active ste and ean support an artangement of funcional groups that fctaes the reaction and seablie the eansion state. Mow bras proteinase rgd and extended and therfore cannoc surround dhe abe co sequen itor promee ts chemi! ‘tanfrnation 3. The rate enhancement i clelated a the sti ofthe extalyed eat to the uncaeljzed ete 47x 108 [From Bryant, R.A. R., and Hansen, D. E., fi Am. Chem. Soc, 118, soos sa (1996) 5, Foradenosne deaminase aaah Tae Fort peptone 4300" . te = 0x0 Tews The tate ofthe uncatayaed teaction is slower the adenosine demise reaction than forthe erate phosphate iomerace rection. But adenosine deaminase is able to catalyze its reaction 50 that it oceuts more quickly than the reaction catalyze by tise phosphate isomerase, Therefore, the rate eahancemnent fr the adenosine deaminase reaction i greatet N oO oO iH oO 9. (a) Pyrvate deasbonye is ase. During the elimination of he boryate group (COO) of pyruvate a double bond is Formed in C0, (0-C—9). (6) Alanine aminotrnefrae a taneferae, The amino gro i tant fesed from alanine to a-keoglutaate (@ Alcohol dehydrogenaze ean oxidordctte, Acetalshyde ie reduced to thane or ethanol ended to acalchyde @ Hewkinase isa tansferase, The phosphate group i tansfecred from ATP to gluco to fora gicoe-& phosphate (6) Chymotrypsin ea hydrolase. Chymotrypsin etalyes the yey peptide bende, 11, Succinate dehydrogenase isan oxidoreductase. 00" 00" HOGA _wsinwedebydogomie GH wt tu 00" boo suscinte Ronasse13, A kinase wasters a phosphate group fim ATP co a substrate N20 cH, Noon, bx,.c00- Cresinephorpte 15. (a) Reseion 4b) Reaction I: €) Reaction 5: (d) Resetion 2 17, 21,0, —* 0; + 21,0 19, Frey tenfold inczeate in ate cortpond to a decease af about 5. KI mol" in AG". Tor te nucleus, with a rate enhancement on the order of 10°, AG*ilowered about 14% 5.7 kf lo about 80K] * mal 2 @ Fast Slow i v » One-stop Twosstes t 8 © Endergonic Exergonic S % (Initia stow stop Inia fat step - x 23, Yes. An enzyme decreases the activation energy batter for both the fr sratd andthe severe dictions ofa peaction. 25. (a) Gig. Ala and Val have side chain that lack the Fanctiona groups required for acid-base or covalent esas, () Macating one of thee residues may aker the conformation a the active ste enough to drupe the atrangement of other groupe that are involved in etl 27, (In ord for any molecule o ac tan enays, it mus beable to re gts and bind a subarate special it must have the appropriate Fine ‘onal groups ofc chemia tection, and it must be able posion thos groupe fo ection, (@) Functional groups on che nitcogen bases cn paccipate in chemi cal reactions in much the sime way at amina seid cde chaine on proteins. For example, the amino groups on adenine, guanine, and ‘ycosine bases could act as nucleophiles and could seo aet ax proton dono (DNA, aa double-stranded molecule, has limited conformations ficedom. RNA, which i snglestanded, is able to assume a grater Ch 6 Solutions 641 range of conformations. This feb allows i co bind to substrates and eatey out chemi traneformations 29. Hie 57 abaaczea proton from Ser 198, hus rendering the serine oxygen ‘a bester nucleophile, When Ser 195 is modified by formation of «covalent bbond with DIP the proton i no longer avlable and Ser 195 is unable co function ata nucleophile 31. Aceyleolineease cH0H 433. His residues ate oeninvlved in proton tanser A earboxymethlated ic would be unable o donate or aceptprovons. IL 1 i AE [+ actcoo> 2. wy < x WwW ‘cH,coo- [feom Shapizo, R., Wetemowir 5. Riordan J. and Valles. 3. Prac Nat Acad Se 4, 978-8787 (1987) ~ee cH HE : ° 35. @) ~e CH F a cr + on No; NO; (0) Since benzoate tesembler the substrate, i is Hikely that benzo- ate binds to the active ste of che enzyine. Under these conditions, FDNP does not have acces to the active site and wil be unable to reac with the (yrosine (wich is abo assumed to be part of the en- yme' active site beeauze of it wnusval resetvity). [From Nishino, T, Massey. Vand Willams, C. IL, J. Bil. Chem, 258, 3610-3616 1999) 137. Ac very low pH vals Hie would be protonated and unable ro form a Ibydrogen bond wid Set Arp would also be protonated and unable vo form ‘hydrogen bond with His. A very high pH vals, His would be unproron- ‘ed and unable to form «hydrogen bond with Asp 39. (a) Ghe 35 har s pol 59 and Aep 52 hava pKoF 4S. {) Lysonyme is active a pH 2.0 becaute both the Gl and the Aap tie protonated. The Apis longer negatively charged and cannot ‘deeply actack the carbocation intermediate. Lysoryme ie inactive NO»642 Ch6 Solutions acpH 8.0 bees both the Glu and the Asp are unprotonated The Glo ‘would be unable ce danate a hydrogen to eave the bond between the sugar tesidues © pee pasion gus Tee spe or 451. (@) In the fist par of che ration, the ester bond isceaved and the chymouypain is acetylated, The penitophenolate ion is quickly 4- Tease, which accounts for the rapid inerease in absorbance seen at 410 nen. The enzyme enust be tegeneated before a second round of crayae an begin, which requires 4 deacetylation ste, Thie sep ie ‘muh slower than the frst sep. Once the acetate it released, the ene zyme is regenerated and another molecule ofsubstace ean bind and tact. Thas a steady sat it reached and uhe abvosbance increases ata ‘eiform este until she substrate se depleted, i + Hc-f—o. No; p-Nivophenyesate ach v0. ve p-Nitophenalate ‘alow Giymecgpin GOH Chymoysin sof RO hymouyia + eHc00- +H cH.0H (b) The seaction coordinate diagram willlooklike the ane in Figure 67. since this ra ostep reason Fach sep hae character ection coeigy. The acetylated chymotypein i the intermediate (© Yer, chymotrypsin and eypin we she sme extalyte mechanism, <0 yp ean act at an estrae ay wel a protest. 45. This isan exarnpleof convergent evlution, in which unrelated proteins ‘velve sms character, 45. Cys 778 is highly exposed and unusually reacive compared to other ‘eyscines in exeatine kinase. Cys 278, because of i high eset. is peob- bly one ofthe etal eiduer inthe cnryme, The other oyreine cede se not at reactive bees they ate not ditety involved in eatalysis and! for because they ae shielded in some way that prevents chem from reacting swith NEM, a. gu BN ry —lol SF Gem be Be HV‘ (Wom LiL. Bina. 'T, Niemann, Hand 5 2599-2405 (2000) 1 BR, Biochemistry 39, 49. (a) The deamidation reseion for asparagine i shown. The deamidation reaction fr glutamine is simi i i mre 6 140 — oatimet—d— + xn fn 0 i é Apanace (© Ser and The reside could sabi the wansition ae. They could also serve as bases if unprotonted) and aeept a proton fiom wate: to form s hydroxide ion that would at ae the stacking nucleophile. Ser and The (inthe unprotonated form) could abo act as ataching nudeo- hiles themes,(4) ‘The mechanism forthe deaidaton of an amino terminal Gla rs dhe is shown, Arsine terminal Ach residues ae nt deamidated because ‘fourmemberd ring, which s unveble, would cule 4 NH, + HA (@) Wate isa subsuate in the reaction. The Aso and Gla eesidues on the srfieeof the protein have mich greter aces to water molecules than icerios Ass and Glo sides. [Bom Weight, HE, Cri, Re Bie chem Ml Biol 26, 1-52 (191,) 51. The ability ofan enzyme to aceleate a reaction depends on the Fee nergy difference beween the enzyme-bound substate and the zyme bound transition state. As long at tis fice energy difference i lee than the free energy difference beeween the unbound substate and che ‘ancatlyed transition state, the eotymemediated tection proceeds sore quickly. 53. In a srne protease there is no need o exclude water from the ative tie, since it ira fesrant for the hydrolyse reaction catalyze bythe enzyme 55. The sin on paricipste in catalyiy polarising the water molecle so ‘hac ite proton i more cay abstracted by Glu 226, The postive charged tineion sabes the negatively charged cgen inthe transition ste 57. The tasiion state suru is likely teahedel at position 6 on the tine ring since adenosine is planar wheres I.6-kydeopurine ie wetrahe- ‘rl ac this postion, Enzyme bind the wantin state mich mote tightly than the subetate 59. A mutation can increase or decteze an enayme’ estalyic aetviny, depending on how it alles the sruetute and aciviy of groupe in the 61, (a) Typsin eaves pepeide bonds on the carboxyl side of Lys and Arg rede, which re postively charged a physiological pH. These esider, feinto che specificity pockes and interac lectosatcly with Aap 189 () A mutant teypsin with 3 porvly charged Lys sede in ee pec fciy pockec would no longer prefer basic sde chine becaute the ike shargs would repel one anethet: The mutant trypsin might instead pre- fer co deave peptide bonds on the caboryl side of negatively charged retduer such ¢ Gland Aap, whoze sidechains could interaetelecr0- stall with he positively charged Lys tesidue (I the submrate speiicsy pocket doesnot include 2 positively charged Lys tesidv, then cere would be no reaton to expect the natant nay ta proce aubstaer with aide side chang. Inatead the mata aayme is move key co prefer subsuates with aonpolar ide chains such lew ole [From Graf 1. Ck, C5. Paty. A. Roeanik Fle Cele RJ and Rue, W], Bichemisry26, 2616-2623 (1987) 63. During chymotypin acuiation, chymotypuin cleaves other ehyno ‘oypsin molecules a2 Leu, Tye, and an Asn residue Only one of thes (7) fits che standard description of chymotrypsin speci. Cen, chyie Loypsn has wider subsuate spec. probably decermined in pact by the ents of verdes nea the vile bond, 65. No, the compound shown in Problem 8 would not be ydrolyed by chymouypsin. The side chain on the eaboxy side of the amide bond is an ssgisine ride chain which would not fe into the ehymotypsins speciciy poder, 67. (a) Pesinent scsivaion af uypsinogen to teypin also cess in the ciation of ciymouypsinogen to chymotypsin {se Problem 6) and ‘ues protecytic destin ofthe pancreatic tive Ch7 Solutions 643, (6) Since trypsin isa the “op of the cascade.” ic makes sense co inat- vate it by wtng a ypeininkibitr [From Hirota, M., Obmnuraya, M. and Baba, HE, Pond Med J. 82, 775-778 (2006) 69. Aprocese with exuemely ast subsuate specificity (hati, protese sth a single ergs) would pose no threat to nearby proteins Seca these preceins would not be tecogaized a subsite for hydelyis chapter? 1. The hypeiblic shape ofthe veloiy vers substrate curve sugges that ‘he enzyme and substrate physially combine otha the enzyme becomes a= tated at high concentrations of eubstate. The lok atey model describes ‘he interaction becwec an enzyme and ite sbsae in rere ofa igh pe ie physica sedation benwen the enzyme (lack) andthe subrate hey) fe 400" Ku Taw _ fe) 25x 10M ah 30am Bhs day" x 36008 28x 1088 ease M (Prom Bryant, RAR, and Hansen, D. Ef. Am Chem Soc, 118, 549825499 (1996). 7. (58 107 M5447 X10") = 27 Me pean Mt nL Reaction Molecalatty Rate equation ALBOC Bimoleular Race = ANB] 2AoB Bimoleular Rae = BAN? 2ASB+e Bimolecular Rate= &(Al? Reaction velocity Unite of & propectional Order = Al Ti Mts! (Al and (8) Second Mt {Al squared Second Mw [Al aguared Second 13, tae = k[sucose) rate = (5.0 X 107" 7}(0.050 94) te = 2.5. 107 Mos 15. (@) The eacton isa second-order eacion Because the nis ofthe ate constant bate Moe {) Convert he patil presure of CO, into nits of molar concentae tion by wing the Hea gu aw PV nRT eof ve Lam 40 om X Feo vot Doe em SRE 5 510K Kemal 0021 Me SIs