Sie sind auf Seite 1von 2

Table S1.

Sequences of oligoes and primers used in this study

NEK1 sgRNA GGAAAGAATAAATAGGGCCAGGG

RAG1-FW GAGATGTGAAGTCCGTGTGC

RAG1-RV CGTTCCAGGTTCTCAGCATG

NEK1-FW AGGCAAGAAAAGGAAAGGGT

NEK1-RV TGTGGTAGGGAATGGATGGT

G6PD-FW GCAAGACACTCTCTCCCTCA

G6PD-RV AGCTGAGGAATGTAGCTGGG

HBB-FW GCTGGGCATAAAAGTCAGGG

HBB-RV TCCTGAGACTTCCACACTGA

SRY-FW CGAACTCTGGCACCTTTCAA

SRY-RV GTTACCCGATTGTCCTACAGCT

TACGCCAGGCCTCACGGAGCTCGTCGCTGAGGGGACATAGTATGA
ssODN1
AGCTTGGGAGGCCGGTGGCACACAGGGAGGGAGGGCAAAGGCC
(G6PD)
AC

GGCCATCACTAAAGGCACCGAGCACTTTCTTGCCATGAGCCTTCA
CCTTAGGGTTGCCCATAACAGCATCAGGAGTGGACAGATCCCCAA
ssODN2
AGCTTTCAAAGAACCTCTGGGTCCAAGGGTAGACCACCAGCAGC
(HBB)
CTAAGGGTGGGAAAATAGACCAATAGGCAGAGAGAGTCAGTGCC
TATCAGAAACCCAAGAGTCTTC

ssODN3 CCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGA
(HBB) AAGCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCC

ssODN4 CCTCCCAAGCCATACTATGTCCCCTCAGCGACGAACTACGCGAAG
(G6PD) CTTGGCGTATTTTCACCCCACTGCTGCACCAGATTGAGCTGGAGA
Figure S1: Off-target analysis in G6PD editing embryo #2. a. Sequence of selected top 13
potential off-target sites. b. T7E1 digestion of PCR amplified off-target site region. * indicates T7E1
assay positive samples. c. Sequencing results of OT10OT11 and OT12 PCR samples.