You are on page 1of 9

European Journal of Phycology

ISSN: 0967-0262 (Print) 1469-4433 (Online) Journal homepage: http://www.tandfonline.com/loi/tejp20

Development of SSR primers from EST sequences


and their application in germplasm identification
of Porphyra lines (Rhodophyta)

Jianwei Sun , Tao Liu , Baotai Guo , Demin Jin , Manli Weng , Yanbin Feng , Pu
Xu , Delin Duan & Bin Wang

To cite this article: Jianwei Sun , Tao Liu , Baotai Guo , Demin Jin , Manli Weng , Yanbin Feng ,
Pu Xu , Delin Duan & Bin Wang (2006) Development of SSR primers from EST sequences and
their application in germplasm identification of Porphyra lines (Rhodophyta), European Journal of
Phycology, 41:3, 329-336, DOI: 10.1080/09670260600740906

To link to this article: http://dx.doi.org/10.1080/09670260600740906

Published online: 20 Feb 2007.

Submit your article to this journal

Article views: 473

View related articles

Citing articles: 17 View citing articles

Full Terms & Conditions of access and use can be found at


http://www.tandfonline.com/action/journalInformation?journalCode=tejp20

Download by: [47.29.220.178] Date: 16 November 2017, At: 18:18


Eur. J. Phycol., (2006), 41(3): 329–336

Development of SSR primers from EST sequences and their


application in germplasm identification of Porphyra lines
(Rhodophyta)

JIANWEI SUN1,2, TAO LIU3, BAOTAI GUO2, DEMIN JIN1, MANLI WENG1,
YANBIN FENG1,2, PU XU4, DELIN DUAN5 AND BIN WANG1,2

1
Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, P. R. China
2
Faculty of Life Science, Laiyang Agricultural College, Laiyang 265200, P. R. China
3
The Key Laboratory of Mariculture, Ministry of Education, Ocean University of China, Qingdao 266003, P. R. China
4
Jiangsu Institute of Oceanology and Hydrology, Nantong 226007, P. R. China
5
Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, P. R. China
Downloaded by [47.29.220.178] at 18:18 16 November 2017

(Received 1 November 2005; accepted 21 February 2006)

This paper reports the development of SSR markers from EST data and their utilization in germplasm identification
of Porphyra. The publicly available EST (expressed sequence tag) sequences of Porphyra were searched from the Internet
(www.kazura.or.jp/en/plant/porphyra/EST/). From a total of 20,779 obtained EST sequences, 391 SSRs (simple sequence
repeats) were analysed with SSRIT software (www.gramene.org/db/searches/ssrtool). From those, 48 SSR primer-pairs were
designed and tested by commonly used SSR reaction conditions using 22 Porphyra DNA samples as templates. Results
showed that 41 SSR primer-pairs gave good amplification patterns. These were used to conduct SSR analyses of genetic
diversity and variety identification of the 22 Porphyra lines. A dendrogram and the DNA fingerprints of the Porphyra
lines were developed based on the obtained SSR data.

Key words: cSSR, DNA fingerprint, microsatellite, Porphyra, seaweeds, simple sequence repeats (SSRs)

Introduction strain identification results detected by RAPD


(Donaldson et al., 1998; Jia et al., 2000; Mai et al.,
Porphyra C. Agardh is one of the most
2000; Wang et al., 2001; Weng et al., 2005) and
important seaweeds. It has a global distribution
AFLP analyses (Iitsuka et al., 2002; Yang et al.,
and important economic value. In addition to its
2002, 2003; Niwa et al., 2004; Sun et al., 2005).
roles in protecting aquatic ecosystems and as a
SSR or microsatellites represent the most widely
source of food, biochemicals and pharmaceuticals,
used molecular makers in plant molecular research,
Porphyra is now considered one of the best model
but have not yet been used in Porphyra research.
organisms for molecular biology research
Compared with other molecular markers, SSR are
(Qin et al., 2004) and for genomic research of
more convenient, simple, stable, abundant, highly
seaweeds (Waaland et al., 2004). However, molec- reproducible and polymorphic. One of their
ular biology research in Porphyra is far behind that major drawbacks, however, is the development
in land plants. that must be carried out to obtain working primers
RAPD (randomly amplified polymorphic for each species, when tested for the first time.
DNA), AFLP (amplified fragment length poly- At present, SSRs have been utilized for most model
morphism) and SSR (simple sequence repeat) are plant and major crop species, such as Arabidopsis,
the three major types of molecular markers tobacco, rice, maize, wheat, poplar, pine, apple,
widely used in plant molecular biology research. peach and others; but SSR markers have yet to be
In recent years, RAPD and AFLP markers developed for seaweeds. The objective of this
have been applied in phycology. Several papers research is to develop a set of SSR markers and
have reported Porphyra diversity analyses and to provide an SSR-based analytical system in
Porphyra, in order to enhance molecular and
Correspondence to: Bin Wang. e-mail: bwang@genetics.ac.cn genomic research in seaweeds.
ISSN 0967-0262 print/ISSN 1469-4433 online/06/030329–8 ß 2006 British Phycological Society
DOI: 10.1080/09670260600740906
J. Sun et al. 330

Materials and methods in annealing temperatures between the forward and


the reverse primer did not exceed 2 C. The lengths
A total of 22 widely used Porphyra lines were
of amplified products were between 150 and 350 base
utilized in this study (Table 1). All were purified and
pairs (bp).
identified by mono-cloning. The lines belong to four
SSR amplification was conducted in 20 ml of
species (14 lines of Porphyra yezoensis Ueda, six lines
reaction mixture containing 10  PCR buffer (2.0 ml),
of Porphyra haitanensis Chang & Zheng, one line of
2.0 mmol l1 MgCl2, 0.15 mmol l1 dNTP, 50 ng tem-
Porphyra oligospermatangia Tseng & Zheng and one line
plate DNA, and 1.0 U Taq DNA polymerase. The
of Porphyra katadai Miura). These include Porphyra
lines that are widely used in production, some wild amplification reaction procedure was as follows: after
Porphyra lines and some introduced to China in recent denaturation at 94 C for 4 min, the reaction mixture was
years. subjected to amplification for 41 cycles consisting of 45 s
at 94 C, 45 s at 55–63 C (depending on the different
Total DNA was isolated from filaments of Porphyra
that were cultivated and reproduced at 18 C. primers) and 45 s at 72 C, with a final extension at 72 C
The collected filaments were ground into powder in for 5 min. The amplification products were separated by
liquid nitrogen and DNA was extracted according to electrophoresis in a 3% agarose gel and visualized under
previously reported methods (Sun et al., 2005; Weng UV after staining with ethidium bromide, or electro-
et al., 2005). The publicly available EST sequences phoresis in a 6% polyacrylamide gel visualized by a
of Porphyra were searched and downloaded from the simplified silver staining method (Xu et al., 2002).
Internet (www.kazura.or.jp/en/plant/porphyra/EST/). SSR products were scored manually as binary data
SSRs with a minimum length of 20 nucleotides were using ‘1’ (presence) and ‘0’ (absence) based on the SSR
Downloaded by [47.29.220.178] at 18:18 16 November 2017

sought using SSRIT software (www.gramene.org/db/ pattern that was amplified using each primer-pair.
searches/ssrtool; Temnykh et al., 2001). If several EST Genetic similarity was calculated based on the formula
sequences containing the same SSR fragment were GS(i, j) ¼ 2N(i, j)/[N(i) þ N( j)], where N(i, j) was the
found with DNAMAN (Version 5.2.2 Lynnon number of fragments shared between individuals, while
BioSoft.) only one of them was retained, the others N(i) and N( j) were the number of fragments
were excluded. in individuals i and j, respectively (Nei & Li, 1979).
SSR primers were designed using DNAMAN The corresponding cluster analysis was performed on
(Version 5.2.2, Lynnon BioSoft.) and Primerselect soft- the similarity matrix employing the UPGMA
ware (DNAstar, License to Dr Steve Sheardown). (unweighted pair group method using arithmetic
Primer pairs of 18–24 nucleotides were designed means) algorithm provided in the computer program
according to the sequences flanking the SSR repeats. STATISTICA/w 5.0 (StatSoft Software, Inc., USA).
The primers were synthesized by Invitrogen (Invitrogen DNA fingerprints of Porphyra lines were constructed
Com., Beijing, China). Primer annealing temperatures according to a previously reported method using Visual
varied from 53 to 65 C depending on the base Basic 6.0 software (Weng et al., 2005). DNA fingerprints
composition of the primers. In general, the difference were then converted into computer language with ‘1’

Table 1. Origins and characteristics of the Porphyra lines used in this study.

Serial number Species Porphyra line Characteristics/Origin Provider

1 P. yezoensis Yqd-2 Early maturity A


2 P. yezoensis Yqd-6 Early maturity A
3 P. yezoensis Yqd-8 Typical life cycle A
4 P. haitanensis Hqd-9 Research material A
5 P. haitanensis Hqd-10 Wild germplasm from Zhejiang A
6 P. haitanensis Hqd-1 Wild germplasm from Fujian A
7 P. haitanensis Hqd-3 Cultivar in Fujian, South-Eastern China A
8 P. yezoensis Yqd-32 Wild germplasm from Qingdao A
9 P. yezoensis Yqd-2-1 Wild germplasm from Qingdao A
10 P. yezoensis Y-9101 High-yield, disease and high temperature resistant B
11 P. yezoensis Y-9308 High quality and spore-rich B
12 P. yezoensis Y-9502 Stress and high-temperature tolerant B
13 P. yezoensis Y-9965 High quality and high-yield B
14 P. yezoensis Y-9970 High-yield and stress tolerant B
15 P. yezoensis Y-2059 Wild line with high quality B
16 P. haitanensis H-9220 Wild maintainer line B
17 P. haitanensis H-9301 Purified cultivar B
18 P. yezoensis Y-9001 High-yield material from Japan B
19 P. yezoensis Y-2020 Maintainer B
20 P. yezoensis Y-008 Maintainer B
21 P. oligospermatangia 0-9404 Maintainer B
22 P. katadai K-2001 Maintainer B

Provider key: A: Dr Delin Duan, Institute of Oceanology, Chinese Academy of Sciences, Qingdao; B: Dr Pu Xu, Jiangsu Institute of
Oceanology and Hydrology.
Developing SSR primers for Porphyra 331

and ‘0’ representing the presence or absence, respec- analysis of the Porphyra lines using the UPGMA
tively, of the corresponding band (Jia et al., 2000; Wang method. Cluster analysis produced a dendrogram
et al., 2001; Weng et al., 2005). in which the similarity coefficient ranged from
0.572 to 0.988 (Fig. 3). The Porphyra lines were
Results divided into two major groups at the 0.600
similarity level, one group containing six lines
Search for SSR-ESTs of P. haitanensis the other group containing
A total of 20,779 Porphyra ESTs were 16 lines from P. yezoensis, P. oligospermatangia
searched (www.kazura.or.jp/en/plant/porphyra/ and P. katadai. This result agreed with that based
EST/). From those, 391 SSRs in 201 Porphyra on traditional methods (Ma & Cai, 1996).
ESTs were identified using the SSRIT software.
An EST containing a SSR sequence was called an DNA fingerprinting
SSR-EST. Finally 65 SSR-ESTs were obtained
by discarding duplicates and multiples. Most Based on the SSR analysis, 12 reproducible
SSR-ESTs contained only one SSR; a few polymorphic SSR bands selected from the ampli-
contained two or three SSRs. fication products of four primer-pairs (PC01,
PC11, PC12 and PC28) were used for constructing
DNA fingerprints of the Porphyra lines (Fig. 4).
Designing and testing SSR primers An amplified band was named according to the
Downloaded by [47.29.220.178] at 18:18 16 November 2017

Not all SSRs were suitable for primer design. Some primer pair used and the band size (bp) that was
SSRs were located too close to the end of the amplified. For example, a product named PC01245
flanking region to accommodate primer design, or is a 245-bp band amplified with primer PC01.
the base composition of the flanking sequence was In each Porphyra line, the band pattern was
unsuitable. Finally, 48 primer-pairs were designed recorded as ‘1’ (present) or ‘0’ (absent). Based on
and synthesized according to the sequences of their this procedure DNA fingerprints were generated
flanking regions. The 48 primer-pairs were tested (Fig. 5), in which each line had its unique
individually by carrying out SSR analyses using the fingerprint pattern and could be easily distin-
22 Porphyra DNAs as templates. A primer-pair guished from the others. The DNA fingerprints
that gave good amplification in more than half the were then converted into computer language
Porphyra lines tested was considered as usable. The expressed with ‘1’ and ‘0’, for present or absent,
results indicated that 41 of the 48 designed primer- respectively (Table 3). Based on these data a
pairs gave good amplification results and could be computer can process DNA fingerprinting results
used for SSR analysis in Porphyra. A summary automatically and quickly. DNA fingerprint ana-
of the results of the SSR amplifications is given lysis provides a good method for the identification
in Table 2. Of the 41 primer-pairs, 39 (95%) were of Porphyra lines.
tri-nucleotide repeats, only one was a di-nucleotide
repeat and one was a tetra-nucleotide repeat. The
Discussion
most common tri-nucleotide repeat was (AGC)n
(14/39), followed by (AAC)n (12/39), (GGC)n RAPD, AFLP and SSR are all PCR-based
(9/39), (GCC)n (2/39), (ACC)n (1/39) and molecular techniques. SSR markers have the
(ACG)n (1/39). advantage that they are convenient, simple and
cheap. Like RFLP markers, they are stable, highly
reproducible and show Mendelian inheritance and
SSR analysis co-dominance. In addition, SSR markers have
The Porphyra lines were analysed with the 41 SSR some unique advantages, being abundant, highly
primer-pairs. The amplified products of 10 primer- polymorphic and well distributed throughout the
pairs, PC01–PC10, were detected and separated genome (Varshney et al., 2002; Chen et al., 2005).
on a 3.0% agarose gel (Fig. 1). The amplification As a result, the use of SSR markers has expanded
products of the other 31 primer-pairs, PC11 to so quickly that they have now become the most
PC41, could be separated by 6% PAGE. Figure 2 widely used molecular marker system in plant
shows the SSR patterns of the Porphyra molecular biological research despite a few dis-
lines amplified by primers PC11, PC12, PC24 advantages (Rungis et al., 2004; Chen et al., 2005).
and PC28. After their discovery in humans in 1981 (Miesfeld
et al., 1981), SSR markers have been developed
for many plant species. They are now available
Cluster analysis
for all the major, model plant and crop species.
The amplification products of 21 selected primer- For example, in Arabidopsis, rice, wheat, and
pairs (94 bands in total) were used for cluster maize there are 1,454, 6,655, 5,425 and 1,855 SSR
J. Sun et al. 332
Table 2. Summary of the 41 designed SSR primers.

Repeat Predicted Tm
Name Forward primer (50 –30 ) Reverse primer (50 –30 ) motif size (bp) ( C) A B

PC01 TTCGCTGCGTTTCACCTTACATTT ACAAGGCCAACCCGAACACA (TGCG)6 205 61 16/22 2


PC02 GGCTGCGGCTGAGTCACAGA GTCGCTCCAACTCCTCCTGCT (AGC)8 235 63 15/22 2
PC03 GAAGATGCCGGTGCCAAGATT GTCCATGTCCTCCTTGAGCG (AGC)8 273 60 22/22 1
PC04 TGGTGCTGTCTTCCAACGAGTA CGGCTGTCGCACCTCGTTATA (AGC)13 245 60 19/22 3
PC05 CCCGTGGAGCTCCTTCATCA TCTCCCATGACAGGTTGCCA (AGC)10 221 60 14/22 1
PC06 CCGTGGAGCTCCTTCATCAT CTCCCATGACAGGTTGCCA (AGC)10 240 58 14/22 3
PC07 GCTGCCATGGATGCGGAAA TACCCAGCATTGGCCTTGCT (GGC)7 221 60 15/22 1
PC08 GTGTGGTAATTGGACGAGGAC AGCGACAACGAGGGCAGA (GGC)7 174 59 15/22 1
PC09 CTTCCCTTTTCCCTTGTCTCTT ACTGGCACGTGACGATGA (GGC)10 348 57 20/22 5
PC10 CACACGGAGACGAAGCACAA CGTAGTCACCATCGTAGCAGT (AAC)16 226 59 15/22 3
PC11 CGCTCAACCACTTCGTCAG CATTGTTGGCGTTGTTGTCATA (AAC)10þ1 261 57 15/22 4
PC12 CCGCTCCTCTACTTTTACTGTT AGTACCTTGCCTCAATAACGAC (GGC)7 265 57 12/22 6
PC13 CCGTCGTCAGCAGGAGCA ATGTGAGAAGCCAGTAGGGAAAGT (GGC)7 200 60 22/22 3
PC14 ACTTCCATCGCTGTCTTCGCT CTGAGCTGCGTGTTGTGGTT (AGC)8 196 60 19/22 6
PC15 GCCTCAAATGCTTTCTCCACAG CCTTGTTTCGTGTTCTTGCTGC (AGC)10 277 60 16/22 1
PC16 GCCTCTGACAAGACCTTCAC TCACGGTCACTGTCTTGGT (ACG)7 217 57 15/22 2
PC17 TCAACCATCAGCCATACCGAC GACATGTCCGCCACCTTGTA (ACC)11 192 59 22/22 3
PC18 CGGATGGTGACTTTGGTGGCTA GACGCAAACGCAGCCACTATTAT (TG)13 234 61 16/22 2
PC19 CATTGGTTCCATCTACTCCTTT TCTTTTGATCAGACAGCACCTT (GCC)7 200 55 12/22 1
Downloaded by [47.29.220.178] at 18:18 16 November 2017

PC20 GGACGATGAGAAGGACAAGGT CATTGGCAGCATCAGCATCA (GCC)7 300 58 13/22 2


PC21 TGACTTCCTCATCGACATTGT GCCATAGTACATTTGTTGCTG (AGC)8 319 55 22/22 2
PC22 TACCAGGTCGACCAGGAGCA TCCAACTCTGCAGTGTCCGTT (AGC)11 291 61 14/22 3
PC23 CGGACATGATGTTTAGTGACGA GGCAAGCTGAGACGATGAC (AGC)18 262 58 20/22 4
PC24 GGAAATCCGTTTGACACCCTT TTGGACGTGAAAGACTGAGCA (AGC)8 266 58 22/22 9
PC25 ACCTCCTCGGCTACTTCAGA GGATACAACGCCTGCTCCAT (AGC)7 276 58 22/22 7
PC26 GGCAGCAGCCATGATGTA CCGTCAGGCAGAAGAGAAT (AGC)8þ8 339 55 22/22 4
PC27 GCCAGCAACAAATGTACTATG CCGTCAGGCAGAAGAGAAT (AGC)8 226 56 22/22 2
PC28 GTAGGGGGCGTCGATAGGTA CATGGCACGAGCAAGATGAA (GGC)9 249 58 21/22 5
PC29 CCCTGTTTTACTGTTCATCTCTCT CCACCACAGTCGTCGTCAT (GGC)7 254 58 14/22 1
PC30 TCGCTGCGCTGCTCATCA GCAGCGGCAAATACGACCAT (GGC)7 243 61 16/22 5
PC31 CAAGGGCTACTGCTACTA CAA TACAAAAAGACTCTCGTG GCA (AAC)17 249 56 20/22 6
PC32 GGGGAGGCCAATCGGCAT CCATGGGTGACCATACGACTCT (GGC)9 212 61 15/22 3
PC33 ACACGGAGACGAAGC ACGA GTAGCCGTCCCCGTAC TTCA (AAC)7þ8 211 60 13/22 1
PC34 ACGGGCTTCTACGACTACAAT GACGACTTGTGCAGGTTGTT (AAC)7þ15 272 58 22/22 1
PC35 CCAACCATGGGCTTCTACGACT TCTCGTAGCCAAACGCGTAGC (AAC)9þ11 181 61 21/22 1
PC36 GCTACGCGTTTGGCTACGAG CGGTGGACGTTGTTCTGCTG (AAC)10þ11þ13 277 61 22/22 1
PC37 CGTGCTACTACGGCTACAAGG GATGTTGCTCGCGTTCTCGTA (AAC)10þ12 217 60 22/22 1
PC38 CGTGCTACTACGGCTACAAGGA CTCGCGTTCTCGTAGCCAAAC (AAC)11þ8 210 61 22/22 1
PC39 CGTGCTACTACGGCTACAAGGA GACGACTTGTGCAGGTTGTTCT (AAC)11þ8þ15 297 60 21/22 1
PC40 CCGTGCTACTACGGCTA CAA GTCCGGTGCAGGTTG TTCT (AAC)9þ11 302 59 22/22 1
PC41 GCTACGCGATGGGCTT CTA GACCGGTGCAGGTTGT TCT (AAC)16 274 58 22/22 1

Key: A: Proportion of lanes with amplified product and total lines examined. B: Maximum band number amplified by the SSR primer and
detected on silver stained PAGE gel. Tm: annealing temperature.

markers, respectively (www.iscb.org/ismb Construction of small insert genomic DNA


2003/posters/cyandavaATceres-inc.com_395.html; libraries and sequencing of the huge number
orygenesdb.cines.fr/cgi-bin/gbrowse/orygenesdb? of clones are necessary for developing SSR
help ¼ citations wheat.pw.usda.gov/ITMI/EST- markers by traditional methods. These methods
SSR/LaRota/; www.bio.net/hypermail/MAIZE/ are laborious, costly and time-consuming (Kantety
2001-October/001018.html). et al., 2002; Yu et al., 2004; Chen et al., 2005). With
In contrast to RAPDs and AFLPs, SSRs have the rapid development of molecular biology, more
strong species specificity. Therefore, SSR primers and more EST data have accumulated and are
need to be designed for each species being publicly available. This facilitates the development
examined for the first time (Kantety et al., 2002; of new SSR primers in some plant species (Kantety
Rungis et al., 2004; Chen et al., 2005). For the et al., 2002; Thiel et al., 2003; Rungis et al., 2004;
rapid progress of molecular and genomic research Yu et al., 2004). Fortunately, 20,779 Porphyra
in Porphyra, it is necessary to develop species- ESTs are publicly available on the Internet.
specific SSR markers. We believe that more SSR Although this number is low compared with
markers will become available for Porphyra in the those for commercial crop plants, it is sufficient
near future. for us to start this study.
Developing SSR primers for Porphyra 333

Primers

PC01

PC02

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 M
Fig. 1. SSR patterns of the Porphyra lines amplified by primer-pairs PC01 and PC02. Amplification products were separated
by electrophoresis in 3% agarose gels and visualized under a UV lamp after ethidium bromide staining. Numbers below
the figure identify the Porphyra lines (see Table 1 for details). M is the DNA marker DL2000.
Downloaded by [47.29.220.178] at 18:18 16 November 2017

Primers

PC11

PC12

PC24

PC28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

Fig. 2. SSR patterns of the Porphyra lines amplified by primers PC11, PC12, PC24 and PC28. Amplification products were
separated in 6% PAGE gels and visualized by silver staining. Numbers below the figure identify the Porphyra lines (see Table 1
for details).

Most SSRs are present in genomic DNA and SSR sequences were identified from 20,779
only a small proportion is present in cDNA. Porphyra EST sequences (approximately 1.9%),
Usually SSRs exist in 7–10% of EST sequences which is a much lower percentage than for land
in land plants (Chen et al., 2005). In this work 391 plants. The reason for this is unclear. If the length
J. Sun et al. 334
Porphyra
lines

Yqd-2
Yqd-6
Y-9101
Y-9970
Y-9001
Y-008
Y-9308
Y-9502
O-9404
Y-2059
Y-2020
Yqd-32
Yqd2-1
Y-9965
Yqd-8
K-2001
Hqd-9
Hqd-10
Hqd-1
Hqd-3
H-9220
H-9301
Downloaded by [47.29.220.178] at 18:18 16 November 2017

0.55 0.60 0.65 0.70 0.75 0.80 0.85 0.90 0.95 1.00
Similarity coefficient

Fig. 3. Cluster analysis of the Porphyra lines using UPGMA.

Primers Selected bands


(number & name)

PC01
1 (PC01225)
2 (PC01205)

3 (PC11265)
PC11
4 (PC11255)

5 (PC12280)
PC12 6 (PC12265)
7 (PC12255)
8 (PC12250)
9 (PC12240)

PC28 10 (PC28255)
11 (PC28250)
12 (PC28244)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

Fig. 4. The 12 SSR bands used for constructing the DNA fingerprints of the Porphyra lines. The four primer-pairs used to
construct DNA fingerprints are given on the left of the figure. The 12 numbered bands used for constructing the DNA
fingerprints are indicated on the right of the figure. (See Table 1 for details of Porphyra lines and SSR patterns.)

of the SSR motif is reduced, the number of in land plants are tri-nucleotide repeats, from 30 to
markers generated will increase, but not signifi- 78% (Varshney et al., 2002; Chen et al., 2005). Of
cantly, which is attributed to the large difference in the 41 newly developed Porphyra SSR markers, 39
genomic DNA between land plants and seaweeds. (95%) were tri-nucleotide repeats (mainly
It was reported that the most abundant SSR motifs AAC, GGC and AGC repeats), only one was a
Developing SSR primers for Porphyra 335
Bands
(number & name)
1 (PC01225)
2 (PC01205)
3 (PC11265)
4 (PC11255)
5 (PC12280)
6 (PC12265)
7 (PC12255)
8 (PC12250)
9 (PC12240)
10 (PC28255)
11 (PC28250)
12 (PC28244)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

Fig. 5. Model DNA fingerprints of the Porphyra lines. Numbers below the figure identify the Porphyra lines. Numbers on the
left of the figure are the 12 bands used for constructing the DNA fingerprints.

Table 3. Computerized DNA fingerprints of the Porphyra samples.


Downloaded by [47.29.220.178] at 18:18 16 November 2017

Serial number Porphyra line Computerized DNA fingerprint Serial number Porphyra line Computerized DNA fingerprint

1 Yqd-2 110000001010 12 Y-9502 010110000110


2 Yqd-6 110000000010 13 Y-9965 000100000110
3 Yqd-8 011000000110 14 Y-9970 110000000110
4 Hqd-9 000000000010 15 Y-2059 010101000110
5 Hqd-10 010000000010 16 H-9220 000100000111
6 Hqd-1 000100000010 17 H-9301 000100010011
7 Hqd-3 000000001001 18 Y-9001 110101000010
8 Yqd-32 010001000010 19 Y-2020 010001000110
9 Yqd-2-1 011001000010 20 Y-008 110111000110
10 Y-9101 110100000010 21 O-9404 010100000110
11 Y-9308 010110100110 22 K-2001 010110000111

di-nucleotide repeat and one was a tetra-nucleotide unique fingerprint pattern that can be easily
repeat. Thus, the percentage of tri-nucleotide distinguished, making them very useful for germ-
repeats is extremely high in Porphyra. This plasm identification of Porphyra. The results prove
supports the view that there is a large difference that the SSR markers are usable and that the
in genomic DNA between land plants and method for developing them from EST sequences
seaweeds. has been successful.
The SSR markers were used in diversity analyses 391 SSR sequences were found in the publicly
and identification of the Porphyra lines. Cluster available EST database and 41 SSR markers were
analysis based on the obtained SSR data, divided successfully developed. Because these Porphyra
the lines into two major groups at the 0.600 SSR markers were derived from cDNA, they can
similarity level. The first group contained only also be referred to as cSSRs or EST-SSRs (Tang
P. haitanensis lines while the second contained et al., 2004). They are likely to be associated
P. yezoensis, P. oligospermatangia and P. katadai. with particular genes and therefore are especially
This result is similar to that from more traditional useful for functional gene research in Porphyra
classifications (Ma & Cai, 1996). Porphyra oligo- (Thiel et al., 2003; Rungis et al., 2004; Tang
spermatangia and P. katadai are more closely et al., 2004). Considering the genome size of
related to P yezoensis, possibly because of their Porphyra, which ranges from 270 to 530 Mb,
similar geographical distribution. Porphyra yezoen- more SSR markers should be developed to meet
sis, P. oligospermatangia and P. katadai grow the need for molecular and genomic research into
in the northern part of China, Korea and Japan, Porphyra.
while P. haitanensis only grows in the southern The data in Table 2 show that 14 of the 41
part of China. primer-pairs amplified products in all the tested
DNA fingerprints of the Porphyra lines were Porphyra samples. However, some primer-pairs
successfully constructed. Each Porphyra line has its were more specific, only amplifying products in
J. Sun et al. 336

parts (13–21, 59.1–95.5%) of the examined DNA NIWA, K., KIKUCHI, N., LWABUCHI, M. & ARUGA, Y. (2004).
Morphological and AFLP variation of Porphyra yezoensis Ueda
samples. Some primers amplified five to six bands
form narawaensis miura (Bangiales, Rhodophyta). Phycol. Res.,
in a particular Porphyra DNA sample, nine being 52: 180–190.
an exceptionally high number, found in only one QIN, S., JIANG, P. & TSENG, C.K. (2004). Molecular biotechnology of
case. Most primers only amplified one to two marine algae in China. Hydrobiologia, 512: 21–26.
RUNGIS, D., BERUBE, Y., ZHANG, J., RALPH, S., RITLAND, C.E.,
bands in most of the Porphyra samples. These data
ELLIS, B.E., DOUGLAS, C., BOHLMANN, J. & RITLAND, K. (2004).
indicate high polymorphism in Porphyra. Robust simple sequence repeat markers for spruce (Picea spp)
from expressed sequence tags. Theor. Appl. Genet., 109:
1283–1294.
Acknowledgements SUN, J.W., JIN, D.M., ZHOU, C.J., YANG, Q.K., WENG, M.L.,
DUAN, D.L., XU, P., MA, J.H. & WANG, B. (2005). Identification
This work was partially supported by the Natural
of Porphyra lines (Rhodophyta) by AFLP-DNA fingerprinting
Science Foundation Project of China (043113159), and molecular markers. Plant Mol. Biol. Rep., 23: 251–262.
the Key Laboratory of Mariculture, Ministry of TANG, J.F., CAO, Y.S., GAO, L.F. & JIA, J.Z. (2004). Mining cSSRs
Education, Ocean University of China and Shandong from EST data using bioinformatics approaches. Sci. Agri. Sini.,
Agricultural Seedstock Breeding Project. We thank 37: 328–332, (In Chinese with English abstract).
TEMNYKH, S., DECLERK, G., LUKASHOVA, A., LIPOVICH, L.,
Dr H. Zalkin (Purdue University, USA) for help with
CARTINHOUR, S. & MCCOUCH, S. (2001). Computational and
the manuscript. experimental analysis of microsatellites in rice (Oriza sativa L.):
frequency, length, variation, transposon associations, and genetic
marker potential. Genome Research, 11: 1441–1452.
References THIEL, T., MICHALEK, W., VARSHNEY, R.K. & GRANER, A. (2003).
Downloaded by [47.29.220.178] at 18:18 16 November 2017

CHEN, J.F., REN, Z.L., GAO, L.F. & JIA, J.Z. (2005). Developing Exploiting EST databases for the development and characteriza-
new SSR markers from EST of wheat. Acta Agro. Sini., 31: tion of gene-derived SSR markers in barley (Hordeum
154–158 (In Chinese with English abstract). vulgare L.). Theor. Appl. Genet., 106: 411–422.
DONALDSON, S.L., CHOPIN, T. & SAUNDERS, G.W. (1998). Amplified VARSHNEY, R.K., THIEL, T., STEIN, N., LANGRIDGE, P. &
fragment length polymorphism (AFLP) as a source of genetic GRANER, A. (2002). In silico analysis of frequency and distribu-
markers for red algae. J. Appl. Phycol., 10: 365–370. tion of microsatellites in ESTs of some cereal species. Cell Mol.
IITSUKA, O., NAKAMURA, K., OZAKI, A., OKAMOTO, N. & SAGA, N. Biol. Lett., 7: 537–546.
(2002). Genetics information of three pure lines of Porphyra WAALAND, J.R., STILLER, J.W. & CHENEY, D.P. (2004). Macroalgal
yezoensis (Bangiales, Rhodophyta) obtained by AFLP analysis. candidates for genomics. J. Phycol., 40: 26–33.
Fish. Sci., 68: 1113–1117. WANG, B., JIA, J.H., SHI, J.F., CHEN, Y.H., JIN, D.M., XU, P.,
JIA, J.H., WANG, P., JIN, D.M., QU, X.P., WANG, Q., LI, C.Y., MEI, J.X. & WENG, M.L. (2001). Identification of Porphyra lines
WENG, M.L. & WANG, B. (2000). The application of RAPD using computerized DNA fingerprinting. Acta Oceanol. Sini., 20:
markers in diversity detection and variety identification of 401–407.
Porphyra. Acta Botanica Sinica, 42: 403–407. WENG, M.L., LIU, B., JIN, D.M., YANG, Q.K., ZHAO, G., MA, J.H.,
KANTETY, R.V., ROTA, M.L., MATTHEWS, D.E. & SORRELLS, M.E. XU, P., DUAN, D.L. & WANG, B. (2005). Identification of
(2002). Data mining for simple sequence repeats in expressed 27 Porphyra lines (Rhodophyta) by DNA fingerprinting and
sequence tags from barley, maize, rice, sorghum and wheat. molecular markers. J. Appl. Phycol., 17: 91–97.
Plant Mol. Biol., 48: 501–510. XU, S.B., TAO, Y.F., YANG, Z.Q. & CHU, J.Y. (2002). A simple and
MA, J.H. & CAI, S.Q. (1996). Cultivation and Processing of rapid method used for silver staining and gel preservation.
Porphyra yezoensis, 1–68 (In Chinese with English abstract). Hereditas (Beijing), 24: 335–336 (In Chinese with English
Science Press, Beijing, China. abstract).
MEI, J.X., JIN, D.M., JIA, J.H. & FEI, X.G. (2000). RAPD analysis YANG, R., LIU, B.Q., LUO, Q.J., WANG, Y.J., ZHOU, X.C. &
of some cultivated Porphyra lines. Acta Shandong Univ. DAI, J.X. (2002). Genetic variation of Porphyra haitanensis by
(Science edition), 35: 230–234 (In Chinese with English abstract). applying AFLP. High Technology Letters, 12: 83–86 (In Chinese
MIESFELD, R., KRYSTAL, M. & ARNHEIM, N. (1981). A member with English abstract).
of a new repeated sequence family, which is conserved YANG, R., LIU, B.Q., LUO, Q.J., WANG, Y.J. & BAO, J.M. (2003).
throughout eucaryotic evolution, is found between the Genetic variation of Pophyra yezoensis by using AFLP.
human delta and beta globin genes. Nucleic Acids Res., 9: Acta Oceanol. Sini., 22: 453–457.
5931–5947. YU, J.K., DAKE, T.M., SINGH, S., BENSCHER, D., LI, W., GILL, B. &
NEI, M. & LI, W.H. (1979). Mathematical model for studying SORRELLS, M.E. (2004). Development and mapping of EST-
genetic variation in terms of restriction endonuclease. derived simple sequence repeat markers for hexaploid wheat.
Proc. Natl. Acad. Sci. USA, 76: 5269–5273. Genome, 47: 805–818.