Original Article

Assessing the reliability of microscopy and rapid

diagnostic tests in malaria diagnosis in areas
with varying parasite density among older
children and adult patients in Nigeria
Ayogu EE1,2, Ukwe CV1, Nna EO3

1
Department of Clinical
Pharmacy and Pharmacy
Management, Faculty of
Pharmaceutical Sciences,
University of Nigeria,
Nsukka, 2Pharmacy Unit,
District Hospital Nsukka,
Ministry of Health, Nsukka,
3
Safety Moleular Pathology
Laboratory, Faculty of
Health Sciences and
Technology, University of
Nigeria, Enugu Campus,
Enugu State, Nigeria
Address for correspondence:
Dr. Ebere E Ayogu,
E-mail: ebere.ayogu@unn.
edu.ng
ABSTRACT
Background: Current malaria control strategies are based on early diagnosis and appropriate treatment of
malaria cases. The study aimed at comparing the performance of blood film microscopy and rapid diagnostic
test (RDT) in Plasmodium falciparum detection in patients ≥6 years of age. Materials and Methods: A total of
154 consecutive pyretic patients aged 6-62 years were enrolled, sampled, and tested for malaria using RDT (first
response) and microscopy by Giemsa staining. Genomic DNA was extracted after saponin hemolysis and nested
polymerase chain reaction (PCR) was used to detect Plasmodium falciparum. The endpoints were sensitivity,
specificity, positive predictive value (PPV), and negative predictive value (NPV). Results: Of the 154 patients,
80 (51.9%) had fever of ≥37.5°C. 106 (68.8%) were positive by First response®, 132 (85.7%) by microscopy,
and 121 (78.6%) by PCR. The sensitivity, specificity, PPV, and NPV of first response compared to microscopic
method were 82.2%, 100.0%, 100.0%, and 34.3%, respectively, while it was 75.4%, 75.0%, 95.3%, and 31.2%,
respectively, when compared to PCR. The sensitivity, specificity, PPV, and NPV of the microscopic method
compared to PCR were 92.3%, 50.0%, 90.91%, and 54.5%, respectively. There was a significant difference in the
performance of RDT and film microscopy methods (P ≤ 0.05). Conclusion: Microscopy performed better and
is more reliable than first response (RDT) in areas with low parasite density among patients ≥6 years of age.
Rapid diagnostic tests could be useful in aareas with high parasite density as an alternative to smear microscopy

Received : 14-01-2014
Review completed : 13-03-2014 KEY WORDS: Diagnosis, malaria, malaria diagnosis, microscopy, polymerase chain reaction (PCR),
Accepted : 01-03-2016 rapid diagnostic test (RDT)

Background and Rationale ranging from parasite/vector, drug/insecticide resistance to

a counterproductive attitude of the human populace.[3] The
  alaria is presently one of the most common parasitic
M diseases and a major health problem worldwide. In Nigeria,
current malaria control strategies are mainly based on prompt
and early diagnosis and correct treatment of malaria cases.[4]
Clinical diagnosis is the least expensive, most commonly used
malaria is endemic throughout the country and accounts for up
to 60% outpatient visits to the health facility, 30% childhood method of malaria diagnosis and is the basis for self-treatment.
mortalities, and 11% maternal deaths.[1,2] Efforts to achieve However, the overlap of malaria symptoms with other tropical
50% reduction in malaria morbidity and mortality have been
This is an open access article distributed under the terms of the
hampered by several ecological and anthropogenic factors
Creative Commons Attribution-NonCommercial-ShareAlike 3.0
License, which allows others to remix, tweak, and build upon the
Access this article online work non-commercially, as long as the author is credited and the
Quick Response Code: Website: new creations are licensed under the identical terms.
www.jpgmonline.com
For reprints contact: reprints@medknow.com
DOI:
10.4103/0022-3859.183167 How to cite this article: Ayogu EE, Ukwe CV, Nna EO. Assessing the reliability
of microscopy and rapid diagnostic tests in malaria diagnosis in areas with
PubMed ID:
varying parasite density among older children and adult patients in Nigeria. J
27241807 Postgrad Med 2016;62:150-6.

 150 © 2016 Journal of Postgraduate Medicine | Published by Wolters Kluwer - Medknow

 Ayogu, et al.: Assessing the reliability of microscopy and rapid diagnostic test in malaria diagnosis
diseases other tropical diseases and can result in misdiagnosis.
Microscopic examination of stained thick and thin blood films
is currently the standard method for laboratory diagnosis of
malaria. These techniques require considerable expertise and
adequate quality control. On the other hand, its reliability is
questionable, particularly at low levels of parasitemia and in the
interpretation of mixed infection.[5,6] In comparison to expert
microscopy, a wide range of poor specificity of local microscopy
is reported.[7,8] Poor blood film preparation generates artifacts
commonly mistaken for malaria parasites including bacteria,
fungi, stain precipitation, dirt, and cell debris.[9] To improve
the specificity of blood microscopy, fluorescent-based staining
and fluorescent microscopy are now introduced in clinical
laboratories but are expensive.
This facilitates malaria case detection, reporting, and confirmation
of treatment failure.[10] In view of this, rapid diagnostic test
(RDT) has been developed for situations in which reliable
microscopy may not be available, accessible, and/or affordable.
RDT detects malaria antigens in a small amount of blood, usually
5-15 μl using immune chromatographic assay formats in which
monoclonal antibodies directed against specific parasite antigens
are impregnated on a test strip or cassette. The result, usually a
colored test line, is obtained in 5-20 min. The most common
antigens currently targeted in malaria RDTs are histidine-rich
protein 2 (HRP-2), Plasmodium lactate dehydrogenase (PLDH),
and Plasmodium aldolase.[6] Several studies have reported
excellent sensitivity and specificity for RDTs when compared to
conventional microscopy.[11-15] RDTs are cheap, simple to perform,
and easy to interpret. In Nigeria, the National Policy on Malaria
Diagnosis and Treatment states that RDTs should be deployed
in situations where microscopy may not be possible due to lack
of adequate laboratory facilities or as a complement to the use
of microscopy in secondary health facilities.
The most recent method for diagnosis of malaria is by detection of
parasite genetic material through polymerase chain reaction (PCR)
technique. One important use of PCR method is in detecting
mixed infections or differentiating between infecting species
when microscopic examination is inconclusive.[16] In addition,
the PCR technique could be useful for conducting molecular
epidemiological investigation of malaria clusters or epidemics.[17,18]
A number of PCR assays have been developed for the detection of
malaria DNA from whole blood as single, nested, allele-specific, or
multiplex methods.[18] These assays have been used for the initial
diagnosis, follow-up to treatment, and as sensitive standards against
which other nonmolecular methods could be compared. PCR may
not strictly be considered a rapid technique for the initial diagnosis
of malaria as it is more expensive and time-consuming for a single
sample than microscopy and RDT.[19]
A number of studies have been conducted assessing the
performance of diagnostic tool in children, especially those
≤5 years of age; [13,14] hence, we assessed RDT and blood
film microscopic methods compared to PCR in detecting
Plasmodium falciparum malaria in older children (≥6 years
of age) to ascertain the analytical reliability of using RDT as
an alternative to microscopy in malaria holoendemic areas of
Enugu State, Southeastern Nigeria.
Journal of Postgraduate Medicine July 2016 Vol 62 Issue 3 151 
Materials and Methods
Health research ethics approval
Ethical approval was obtained from the University of Nigeria
Teaching Hospital (UNTH) Ituku Ozalla, Enugu, Nigeria
with reference number NHREC/05/01/2008B-FWA00002458-
IRB00002323 and written, informed consent was obtained from
parents and assent from the children.
Study setting
The study was conducted during the rainy season from March to
November in three hospitals: District Hospital Nsukka (DHN),
Bishop Shanahan Hospital Enugu-Ezike (BSHE), and Cottage
Hospital Ugbuawka (CHU), located in three different local
government areas in Enugu State, Nigeria. Enugu State is located
in Southeastern Nigeria where malaria is present throughout the
year with high malaria transmission during the rainy season. Two
of the hospitals, Bishop Shanahan Hospital and Cottage Hospital
Ugbuawka are situated in rural areas while District Hospital
Nsukka is situated in an urban area. District Hospital Nsukka
and Bishop Shanahan Hospital are secondary health facilities.
Their laboratory units have two laboratory assistants headed by
a laboratory scientist with 10 years working experience. Cottage
Hospital Ugbuawka is a primary health facility with two laboratory
technicians with over 4 years working experience.
Participants and eligibility
Outpatients (≥6 years of age) who had a temperature of
≥37.5°C and/or headache were recruited after informed consent
was obtained. Patients who had taken antimalarials in the
past 2 weeks prior to sampling were not enrolled. Descriptive
characteristics of the subjects are shown in Table 1. All the
enrolled patients were tested using RDT, microscopy, and PCR.
Rapid diagnostic testing
RDT kit First Response®, a histidine-rich protein 2 (HRP2)
combo cassette test from Premier Medical Corporation (23 Ziks
Avenue Enugu. First Response® kits were supplied by the study
group to the three study hospitals for uniformity and reliability
of the results. All the laboratory staff was trained on how to use
Table 1: Characteristics of the study patients and prevalence
of malaria based on different diagnostic methods
Number of patients sampled 154
Mean age (years) 28.3±23
Sex male (%)/female (%) 53 (34.4)/101 (65.5)
Mean temperature (°C)±SD 38.5±1.20
No sampled at BSHE 49
No sampled at DHN 50
No sampled at CHU 55
No. Positive by microscopy (%) 132 (85.7)
No positive by RDT (%) 106 (68.8)
No positive by PCR (%) 122 (79.2)
MPD by microscopy±SD 5874.32±8120.55
No = Number, SD = Standard deviation, BSHE = Bishop Shannahan
Hospital Enugu-Ezike, DHN = District Hospital Nsukka, CHU = Cottage
Hospital Ugbuawka, MPD = Mean parasite density
 Ayogu, et al.: Assessing the reliability of microscopy and rapid diagnostic test in malaria diagnosis
the kit in a 1-day workshop. All the patients were tested with
First Response®. Each kit was labeled with the patient’s number.
The patient’s index finger was swabbed and pierced with a sterile
lancet provided with the kit. 5 µl of blood was scooped with a
loop by the laboratory assistant and added to the sample well
in a cassette followed by three drops of sample diluent. Results
were read within 20 min. Faint test lines were considered to be
positive. Each patient was sampled 3 mL of venous blood into
well-labeled ethylenediamine tetraacetic acid (EDTA) tubes
and transferred in a cold chain to Safety Molecular Pathology
Laboratory (SMPL) within 5 h of sampling where blood film
microscopy and PCR testing were performed.
Blood film microscopy
About 20 µl of blood was used in preparing thick smears of
blood in a clean slide, which were dried and stained with 5%
Giemsa stain for 30 min. Dried slides were viewed at x1000 with
oil immersion by the certified Medical Laboratory Scientists.
Parasites were counted against 200 white blood cells (WBCs)
from the thick film. Parasite density was estimated assuming
total WBC count of 10,000/mL.[20] The pictures of the slides
were captured and results were recorded electronically. Slides
were stored in a secure slide box and were reconfirmed by
another scientist. The laboratory personnel were blinded of the
first response results.
Estimation of parasite load by microscopy
We adopted a method that assumed WBC count of 10,000
cells/µl for each subject.[20]
The formula for parasite density per µl of whole blood = no. of
parasites counted/WBCs counted* 10,000 cells/µl.
Polymerase chain reaction assay
DNA extraction
Malaria DNA was extracted by saponin hemolysis method[21]
from each blood sample on arrival to the SMPL. 1 mL of whole
blood was transferred into a 15 mL sterile tube and centrifuged
at 4,000 rpm for 5 min. The plasma was discarded and the cell
pellets washed thrice in 5 mL of physiological saline. The cells
were then resuspended in 2 mL of cold 0.5% saponin solution in
phosphate buffer saline (PBS), mixed thoroughly by vortexing
until all the cells were lysed, and incubated on ice for 20 min.
The sample was centrifuged at 4,000 rpm for 5 min and the
supernatant discarded. The pellet was resuspended in 1 mL
of ice-cold 0.5% saponin and incubated on ice for 15 min.
The tube was further centrifuged at 4,000 rpm for 5 min with
the supernatant discarded but cells resuspended in 0.5 mL of
PBS for another round of washing. The cell pellet was finally
resuspended in 50 μl of Tris-borate-EDTA buffer (AE buffer),
vortexed gently for 15 s, and incubated at 99°C for 10 min. The
lysate was finally centrifuged at 8,000 rpm for 2 min and the
DNA-rich supernatant was transferred to a 1.5 mL tube and
stored frozen until required for PCR testing.
Plasmodium falciparum amplification by nested polymerase
chain reaction
A set of high-performance liquid chromatography (HPLC)
purified primers were used for nested PCR in Applied
 152 Journal of Postgraduate Medicine July 2016 Vol 62 Issue 3
Biosystem 2730 thermal cyclers (Paisley, United Kingdom). A
commercially optimized 2x PCR master mix (Southampton,
United Kingdom) was used in setting up a 25 µl reaction
volume. The first round PCR used rPLU5 forward primer
5′-CCTGTTGTTGCCTTAAACTTC and rPLU6 backward
primer - 5′-TTAAAATTGTTGCAGTTAAAAC primers
at final concentrations of 300 nM to amplify 1,200 bp
genus (Plasmodium)-specific target of 18S ribosomal RNA
gene. The thermal profile for first-round PCR was initial
denaturation at 95°C for 10 min, 35 cycles at 94°C for 45 s,
58°C for 30 s, 72°C for 30 s, and final extension at 72°C for
5 min. Second-round PCR reactions were set up using the
first-round PCR product and primers R2, rFAL 1 forward
primer 5′ TTAAACTGGTTTGGGAAAACC, and rFAL
2 backward primer 5′ACACAATGAACTCAATCATGA
specific to P. falciparum for amplifying 205-bp amplicon
of the same gene at final concentration of 400 nM in 25 µl
reaction volumes. The thermal profile for second round
PCR was initial denaturation at 95°C for 10 min, 35 cycles
at 94°C for 45 s, 58°C for 30 s, 72°C for 30 s, 58°C for 30 s,
and final extension of 72°C for 5 min. For each round, the
reaction mixture of 25 µL contained 2.5 µL of 10 x reaction
buffers, 5 µL of magnesium chloride 0.75 µL of each primer,
0.2 µL of deoxynucleotide triphosphates (dNTPs), 9.05 µL
of water, 0.25 µL of Taq polymerase, and 5 µL of DNA
extract. The second-round PCR products were visualized in
2% agarose gel using SYBR Safe or Web Green (Promega,
UK and WebScientific, UK) after staining with ethidium
bromide. The whole reaction was done in duplicate as a quality
control measure. All samples that were negative with RDT
but positive with microscopy or negative for microscopy but
positive with RDT were reconfirmed with PCR.
Patients’ management
The First response® result was immediately forwarded to
the clinician to guide on the treatment decisions. Patients
who were symptomatic but with negative first response
result and all who tested positive for both first response and
microscopy were all treated with artemether-lumefantrine
(the current first line treatment for uncomplicated malaria)
each patient received a complete regimen of AL treatment
in the following order. First dose at 0 h, second dose after
8 h, then 3rd, 4th, 5th and 6th doses were taken 12 hourly for
the next 48 h. Patients with body weight above 35, 25-35 and
15-25 kg received 4, 3 and 2 tabs per dose. Each AL tablet
contains 20 mg artemether and 120 mg lumefantrine orally
on the same day.
Statistical analysis
The overall performances of diagnostic methods were compared
using Fisher’s exact test (when three methods were compared)
or a chi-square test (when two methods were compared). The
results for the sensitivity, specificity, positive predictive value
(PPV), and negative predictive value (NPV) were obtained using
PCR as a gold standard; a subanalysis was also done comparing
RDT to microscopy. P ≤ 0.05 was considered to be statistically
significant for all differences within all comparisons. The
statistical analyses were made using the Statistical Package for
the Social Sciences (SPSS) Version 16.0.
 Ayogu, et al.: Assessing the reliability of microscopy and rapid diagnostic test in malaria diagnosis
Results
Demographics
A total of 160 patients were recruited; 6 withdrew consent
before sampling and 154 patients were sampled. 53 (34.4%)
were males while 101 (65.5%) were females. Out of the 154
patients sampled, 80 (51.9%) had fever of ≥37°C with a
mean of 38.5°C. The age range was between 6 years and
52 years, the mean age was 28.3 ± 23 years. 31 (20.1%), 45
(29%), 30 (19.4%), and 48 (31.1%) persons were in the age
of 6-12 years, 13-25 years, 26-40 years, and above 40 years,
respectively. The mean parasite density by microscopy was
5,874.32 ± 8120.55 parasites/µL. The patients’ characteristics
and prevalence of malaria based on the diagnostic methods
are contained in Table 1.
Overall result of diagnostic techniques
Comparison of First Response® [rapid diagnostic test] with
microscopy as the “gold standard”
Out of the 154 patients enrolled, 106 (68.8%) tested positive for
both First Response® and microscopy while 25 patients (16.2%)
tested negative for both First Response® and microscopy.
Samples that were First Response®-positive but microscopy-
negative were 0 (0%) while those that were First Response®-
negative but microscopy-positive were 23 (14.9%). The
analytical performance characteristics: Sensitivity, specificity,
PPV, and NPV were 82.17%, 100.00%, 100.00%, and 34.29%,
respectively. Test of significance (chi-square test) showed
statistically significant difference when First Response® was
compared to the microscopy method (P ≤ 0.05). The data are
summarized in Table 2.
Comparison of First Response® with polymerase chain reaction
as the “gold standard”
101 (65.6%) patients tested positive for both First Response®
and PCR while 15(9.7%) patients tested negative for both
First Response® and PCR. Samples that were First Response®-
positive but PCR-negative were 5 (3.2%) while those that were
First Response®-negative but PCR-positive were 33 (21.4%).
Sensitivity, specificity, PPV, and NPV were 75.37%, 75.00%,
95.28%, and 31.25%, respectively. Test of significance
(chi-square test) showed no statistical significant difference
when First Response® was compared to the PCR method
(P ≤ 0.05). The data are summarized in Table 2.
Table 2: Overall sensitivity, specificity, and predictive value of microscopy and RDT using PCR as the standard
and a subanalysis of RDT only using microscopy as the standard
Diagnostic methods TP (N) FP (N) TN (N)
Parameters for assessment
TFM 120 12 12
RDT 101 5 15
Standard (PCR) 122 0 32
Subanalysis of RDT only using microscopy
as the standard
RDT 106 0 25
Standard (TFM) 132 0 22
TP = True positive, FP = False positive, TN = True negative, FN = False negative, PPV = Positive predictive value, NPV = Negative predictive value,
TFM = Thick film microscopy, N = Number of patients
Journal of Postgraduate Medicine July 2016 Vol 62 Issue 3 153 
Comparison of microscopy with polymerase chain reaction as
the “gold standard”
Of the 154 patients, 120 (77.9%) tested positive for P. falciparum
for both the microscopy and PCR methods while 12 (7.8%)
tested negative in both the methods. Samples that tested
positive by microscopy but negative by PCR were 12 (7.8%)
while microscopy-negative, PCR-positive samples were
10 (6.5%). The sensitivity, specificity, PPV, and NPV were
92.31%, 50.00%, 90.91%, and 54.55%, respectively. Test of
significance (chi-square test) showed that there was no
significant difference between microscopy and PCR methods
(P ≤ 0.05). The data are summarized in Table 2.
Stratification of parasite density in thick blood smear and
correlation with rapid diagnostic test, polymerase chain reaction,
and study area
Out of the 20 patients that were negative for microscopy 2 and
6 were positive for RDT and PCR, respectively. The parasite
count range of 101-1,000 had the highest positivity (75) and
out of the 75 patients, 72 and 73 were positive for RDT and
PCR, respectively. With regard to the study area, patients from
District Hospital Nsukka contributed to 73.3%, 25.3%, and 0%
of the patients with parasite count of 1-100, 101-1000, and
>1000 respectively. The contributions of other patients from
BSHE and CHU are shown in Table 3.
With regard to the three different hospitals, there was a
significant difference in the performance of first response
(RDT) and microscopy when compared among the three
different hospitals (P < 0.001). In BSHE, DHN, and CHU,
the sensitivities of first response (RDT) were 95.3%, 40.0%, and
90.7%, respectively, while the sensitivities of microscopy were
97.0%, 90.9%, and 89.1%, respectively. The specificity, PPV, and
NPV of RDT and microscopy are shown in Table 4.
The cost of testing with RDT, microscopy, and PCR were
N = 300, N = 500, and N = 6,000. The costs of each test and
turnaround time in SMPL are summarized in Table 5.
Discussion
The new treatment guidelines for malaria in Nigeria relied on
the 3Ts (test, treat, and track). The policy is geared toward
FN (N) Sensitivity (%) Specificity (%) PPV (%) NPV (%)
13 92.3 50.00 90.91 54.55
33 75.37 75.37 92.25 31.32
0 100 100 100 100
23 82.17 100 100 34.29
0 100 100 100 100
 Ayogu, et al.: Assessing the reliability of microscopy and rapid diagnostic test in malaria diagnosis

Table 3: Stratification by parasite density in thick blood smear and correlation with diagnostic methods and study area
Frequency 0 1-100 101-1,000 >1,000
Parasite count
No. of patients observed 22 30 79 23
Mean parasite count/µL (range) 0 70 (25-100) 560 (130-910) 15,520 (1,000-47,500)
No positive for RDT 2 (9.1%) 8 (26.7%) 73 (92.4%) 23 (100.0%)
No negative for RDT 20 (90.9%) 22 (73.3%) 6 (7.6%) 0 (0%)
No positive for PCR 6 (27.3%) 25 (83.3%) 70 (88.6%) 15 (65.2%)
No negative for PCR 16 (72.7%) 5 (16.7%) 9 (11.4%) 8 (34.8%)
No of patients from BSHE 6 (27.3%) 3 (10.0%) 28 (35.4%) 12 (52.2%)
No of patients from DHN 8 (36.7%) 22 (73.3%) 20 (25.3%) 0 (0%)
No of patients from CHU 8 (36.7%) 5 (16.6%) 31 (39.2%) 11 (47.8%)

Table 4: Stratification of sensitivity, specificity, Table 5: Cost and turnaround time for RDT, film microscopy,
and predictive values, and correlation with study areas and PCR
Diagnostic method Sensitivity Specificity PPV NPV Test Cost (N) Turnaround time (min)
Microscopy RDT 300 20
BSHE 97.0 35.0 55.4 75.6 Film microscopy 500 45
DHN 90.9 44.0 70.6 43.7 PCR 6,000 1,440
CHU 89.1 71.0 47.9 85.5
RDT
BSHE 95.3 79.9 92.7 78.5 When PCR was used as the gold standard, First Response®
DHN 40.0 73.9 85.0 28.6 showed a lower sensitivity (75.37%) and specificity (75.00%)
CHU 90.7 93.7 89.1 80.4 than when compared to microscopy but had a high PPV of
BSHE = Bishop Shannahan Hospita Enugu-Ezikel, DHN = District 95.28% and an unacceptably low NPV of 31.25%, similar to that
Hospital Nsukka, CHU = Cottage Hospital Ugbuawka obtained when compared to microscopy. On the other hand,
microscopy showed a higher sensitivity (92.3%), PPV (90.91%),
and NPV (54.55%) than first response but had a lower specificity
slowing and/or preventing resistance to the recommended drug, of 50.00%. The study also revealed that First Response® had 101
artemisinin-based combination therapy — ACT (artemether- (65.6%), 5 (3.2%), 15 (9.7%), and 33 (21.4%) true positive, false
lumefantrine) for treatment of uncomplicated malaria. Hence, positive, true negative, and false negative samples, respectively,
each patient must be tested before treatment. The key factors that against 120 (77.9%), 12 (7.8%), 12 (7.8%), and 10 (6.5%),
influence testing include analytical reliability of the test method, samples, respectively, by microscopy. First Response® had more
cost of test/affordability, accessibility, and turnaround time. Since false negative samples, i.e., 33 (21.4%) compared to microscopy,
RDTs may not be very sensitive in detecting malaria, especially in i.e., 12 (7.8%) but a lower false positive, i.e., 5 (3.2%) than
areas with varying transmission intensities as suggested by some microscopy, i.e., 12 (7.8%). This suggests that First Response®
studies[22,23] and both RDT and microscopy have their limitations has a high probability of not accurately detecting falciparum
in detecting malaria[22,24,25] infections, there is a need to use a infection in sick patients while microscopy will likely detect
more accurate and sensitive diagnostic method such as PCR in falciparum infection in patients who are free from Plasmodium
assessing the accuracies of these diagnostic methods even though infection. An important implication of this scenario is that it
most evaluations of RDTs have used microscopy as the gold will lead to an erroneous diagnosis of malaria resulting in either
standard.[26-28] Hence, in this study the reliability of first response denying patients of the appropriate treatment or exposing them
and microscopy were assessed using PCR as the gold standard to treatment, which could lead to the development of drug
and for a balanced comparison, a subanalysis using microscopy as resistance. With a true positive of 120 (77.9%), microscopy had a
the gold standard was performed on first response. In this study sensitivity of 92.3% and PPV of 90.91%. On the other hand, RDT
also, Plasmodium falciparum was preferred because this species with a high false negative of 33 (21.4%) and low false positive
causes the most malaria morbidity in Nigeria. of 5 (3.2%) had a low NPV of 31.25% and high PPV of 95.28%.

When microscopy was used as the gold standard, the specificity
and PPV of First Response® were very high. The specificity
(100%) and PPV (100%) was higher than reported elsewhere.[16,22]
Harani et al. in 2006 reported a similar specificity of 98.3% for
P. falciparum using an RDT kit but a lower predictive PPV of
78.0%.[27] The sensitivity and NPV of 82.17% and 34.29% were
lower in our study than reported elsewhere.[16,28]
It was observed that at high parasite count of ranges
101-1,000 parasites/µL and >1,000 parasites/µL, RDT detected
73.3% and 100.0% positive cases, respectively, while in low
parasite count of ranges 1-100 parasites/µL, RDT detected
26.7% positive cases against 83.3% detected by PCR. This
result suggests that there could be a relationship between
parasite density and RDT performance. The study also

 154 Journal of Postgraduate Medicine July 2016 Vol 62 Issue 3

 Ayogu, et al.: Assessing the reliability of microscopy and rapid diagnostic test in malaria diagnosis
revealed varying parasite densities in the study area, as patients
from DHN showed low parasite density. They contributed
to 73.3%, 25.3%, and 0% of the patients with parasite count
range of 1-100 parasites/µL, 101-1,000 parasites/µL, and
>1,000 parasites/µL. RDT performed poorly in this particular
area (DHN) with low parasite density and sensitivity and
specificity of 40.0% and 73.9%, respectively, while its sensitivity
and specificity were higher (95.3% and 79.9%) for BSHE, and
higher (90.7% and 93.7%) for CHU. There was poor performance
of RDT in patients residing within Nsukka, which is an urban
area compared to the patients residing in Ugbuawka and
Enugu-Ezike where the major occupation is mainly farming
and people live on farms. This study has shown a variation in
the performance of RDT with respect to the study area and
parasite density. The possible reason for this poor performance
by RDT in areas with low parasite density may be its inability to
detect Plasmodium at very low densities. It has been shown that
the performance of RDT is affected by suboptimal sensitivity
at low parasite densities[29] and another study revealed that it
has low sensitivity for parasites below 100 parasites/µL and has
insufficient accuracy.[6] When the performance of microscopy
was assessed with regard to the study area, the difference in its
performance was not statistically different.
Both methods showed low specificity and NPV while First
Response® also showed low sensitivity. Several factors in the
manufacturing process as well as environmental conditions
may be responsible for the low performances observed in
the use of RDT and microscopy in the diagnosis of malaria.
First, the choice of PCR method as the “gold standard” for
comparison might influence the outcome of our finding as
previous studies used blood film microscopy as their comparator.
Second, undue exposure of RDTs to >70% humidity and/or
>30°C temperature, especially in the supply chain, may affect
the quality of testing while occasional false negative results
may be caused by deletion or mutation of the HRP-2 gene
in the infecting parasite.[30] Third, it has also been suggested
that natural anti-HRP-2 antibodies in some humans may also
cause false negative results despite significant parasitemia with
RDT.[31] Lastly, the low sensitivity observed in this study may
also result from the use of patients >5 years of age. This is
supported by a study by Batwala et al. in 2010, which revealed
that the sensitivity of RDT was significantly higher than that of
other techniques and was excellent in children <5 years of age,
i.e., 97.7% [95% confidence interval (CI): 88-99.9] compared to
those ≥5 years, i.e., 83.7% (95% CI: 69.3-93.2).[15]
The lower specificity value observed for microscopy could
have been caused by subjectivity in the reporting of blood
films in addition to interobserver differences in blood film
reporting, which are known to influence blood film outcomes.
Most importantly, the existence of low density infections and
inappropriate use of antimalarials resulting into low parasitemia
could affect the performance of microscopy.
The use of Nested PCR as the gold standard instead of microscopy
agrees with studies by Andrade et al. in 2010[32] and Batwala
et al. in 2010.[15] Andrade et al. in 2010 showed that Nested
Journal of Postgraduate Medicine July 2016 Vol 62 Issue 3 155 
PCR was the gold standard for diagnosis of both symptomatic
and asymptomatic malaria in the Brazilian Amazon because it
detected a major number of cases and presented the maximum
specificity while microscopy showed a low performance of
65.1% for correct diagnosis.[32] In another study by Coleman
et al. 2006, it was observed that although PCR performance
appeared poor when compared to microscopy, data indicated
that the discrepancy between the two methods resulted from
poor performance of microscopy at low parasite densities rather
than poor performance of PCR. Hence, the study concluded that
PCR appears to be a useful method for detecting Plasmodium
parasites during active malaria surveillance in Thailand.[7]
Data from this study highlights the problem of using a less-
than-perfect diagnostic test as a reference standard. Microscopic
results were initially considered as the reference standards for
true positive and true negative results, with all subsequent
statistical analyses based on this assumption. Although the
PCR method is ultrasensitive, reliable, and amenable to high
throughput, it requires a bigger capital outlay to establish as
well as a balanced skill mix to operate daily.
The study also revealed a turnaround time of 20 min, 45 min, and
1,440 min for First Response®, microscopy, and PCR, respectively.
Cost of carrying out each test per patient was Naira 300, 500,
and 6,000 for First Response®, microscopy, and PCR, respectively.
For routine malaria diagnosis, PCR method with a turnaround
time of 1,440 min and cost of Naira 6,000 may not be a better
option. In addition, the urgency and importance of obtaining
results quickly for patients with suspected malaria limits the
usefulness of PCR in routine clinical practice.
Author’s Contribution
EE is the principal investigator. EE sponsored this research
financially as part of her Ph. D program. In collaboration with
the hospital staff, she recruited and sampled the patients. She
provided all data for the research work. EE also participated in
molecular testing of the blood samples, data analysis, and wrote
the manuscript. EO is the Chief Executive Officer (CEO) of
Safety Molecular Pathology Laboratory where all the testing was
done. He made a substantial contribution to the conception
and design of the work and is the key data analyst. CV is the
supervisor of the research work. She contributed in the general
coordination of the research work.
Acknowledgment
We wish to thank first, the malaria patients who volunteered to
participate in this study. We are grateful to the hospital administrators
and staff (especially the doctors and laboratory scientists) in the
three hospitals used. We are also grateful to all the staff of the Safety
Molecular Pathology Laboratory where all molecular testing was done.
Financial support and sponsorship
Nil.
Conflicts of interest
The authors would like to state they there are no conflicts of
interest.
 Ayogu, et al.: Assessing the reliability of microscopy and rapid diagnostic test in malaria diagnosis
References
1. Federal Ministry of Health. National Strategic Plan for Rollback
Malaria. Abuja, Nigeria: Federal Ministry of Health; 2001. p. 63.
2. Federal Ministry of Health. Annual Report on National Malaria
Programme in Nigeria. Nigeria: Federal Ministry of Health; 2005. p. 47.
3. Federal Ministry of Health. Malaria Control in Nigeria: A Strategy for
Behavior Change Communication. Abuja, Nigeria: Federal Ministry
of Health; 2004. p. 58.
4. Reyburn H, Mbakilwa H, Mwangi R, Mwerinde O, Olomi R, Drakeley C,
et al. Rapid diagnostic tests compared with malaria microscopy
for guiding outpatient treatment of febrile illness in Tanzania:
Randomized trial. BMJ 2007;334:403.
5. Hamer DH, Ndhlovu M, Zurovac D, Fox M, Yeboah-Antwi K, Chanda P,
et al. Improved diagnostic testing and malaria treatment practices in
Zambia. JAMA 2007;297:2227-31.
6. Murray CK, Gasser RA Jr, Magill AJ, Miller RS. Update on rapid
diagnostic testing for malaria. Clin Microbiol Rev 2008;21:97-110.
7. Coleman RE, Sattabongkot J, Promstaporm S, Maneechai N,
Tippayachai B, Kengluecha A, et al. Comparison of PCR and microscopy
for the detection of asymptomatic malaria in a Plasmodium falciparum/
vivax endemic area in Thailand. Malar J 2006;5:121.
8. Zurovac D, Midia B, Ochola SA, English M, Snow RW. Microscopy
and outpatient malaria case management among older children and
adults in Kenya. Trop Med Int Health 2006;11:432-40.
9. Ohrt C, Purnomo, Sutamihardja MA, Tang D, Kain KC. Impact of
microscopy error on estimates of protective efficacy in malaria-
prevention trials. J Infect Dis 2002;186:540-6.
10. Federal Republic of Nigeria. National Guidelines for Diagnosis and
Treatment of Malaria. Nigeria: Federal Republic of Nigeria; 2011. p. 15-16.
11. World Health Organization. Malaria Rapid Diagnostic Test
Performance - Results of WHO Product Testing of Malaria RDTs:
Round 1-3: World Health Organization; 2008. p. 1-2.
12. Gatti S, Gramegna M, Bisoffi Z, Raglio A, Gulletta M, Klersy C, et al.
A comparison of three diagnostic techniques for malaria: A rapid
diagnostic test (NOW Malaria), PCR and microscopy. Ann Trop Med
Parasitol 2007;101:195-204.
13. Ashley EA, Touabi M, Ahrer M, Hutagalung R, Htun K, Luchavez J,
et al. Evaluation of three parasite lactate dehydrogenase-based rapid
diagnostic tests for the diagnosis of falciparum and vivax malaria.
Malar J 2009;8:241.
14. Abba K, Deeks JJ, Olliaro P, Naing CM, Jackson SM, Takwoingi Y,
et al . Rapid diagnostic tests for diagnosing uncomplicated P.
falciparum malaria in endemic countries. Cochrane Database Syst
Rev 2011;CD008122.
15. Batwala V, Magnussen P, Nuwaha F. Are rapid diagnostic tests more
accurate in diagnosis of Plasmodium falciparum malaria compared
to microscopy at rural health centres? Maler J 2010;9:349.
16. Valéa I, Tinto H, Nikiema M, Yamuah L, Rouamba N, Drabo M, et al.
Performance of OptiMAL-IT compared to microscopy, for malaria
detection in Burkina Faso. Trop Med Int Health 2009;14:338-40.
17. Kattenberg JH, Ochodo EA, Boer KR, Schallig HD, Mens PF,
Leeflang MM. Systematic review and meta-analysis: Rapid diagnostic
tests versus placental histology, microscopy and PCR for malaria in
pregnant women. Malar J 2011;10:321.
 156 Journal of Postgraduate Medicine July 2016 Vol 62 Issue 3
18. Shokoples SE, Ndao M, Kowalewska-Grochowska K, Yanow SK.
Multiplexed real-time PCR assay for discrimination of Plasmodium
species with improved sensitivity for mixed infections. J Clin
Microbiol 2009;47:975-80.
19. Omo-Aghoja LO, Abe E, Feyi-Waboso P, Okonofua FE. The challenges
of diagnosis and treatment of malaria in pregnancy in low resource
settings. Acta Obstet Gynecol Scand 2008;87:693-6.
20. Adu-Gyasi D, Adams M, Amoako S, Mahama E, Nsoh M, Amenga-
Etego S, et al. Estimating malaria parasite density: Assumed white
blood cell count of 10,000/μl of blood is appropriate measure in
Central Ghana. Malar J 2012;11:238.
21. Orjih AU, Cherian P, AlFadhli S. Microscopic detection of mixed
malarial infections: Improvement by saponin heamolysis. Med Princ
Pract 2008;17:458-63.
22. Hopkins H, Bebell L, Kambale W, Dokomajilar C, Rosenthal PJ,
Dorsey G. Rapid diagnostic tests for malaria at sites of varying
transmission intensity in Uganda. J Infect Dis 2008;197: 510-8.
23. Wongsrichanalai C, Barcus MJ, Muth S, Sutamihardja A, Wernsdorfer WH.
A review of malaria diagnostic tools: Microscopy and rapid diagnostic
test (RDT). Am J Trop Med Hyg 2007;77(Suppl): 119-27.
24. Bell DR, Wilson DW, Martin LB. False-positive results of a
plasmodium falciparum histidine-rich protein 2-detecting malaria
rapid diagnostic test due to high sensitivity in a community
with fluctuating low parasite density. Am J Trop Med Hyg
2005;73:199-203.
25. Mens P, Spieker N, Omar S, Heijnen M, Schallig H, Kager PA. Is
molecular biology the best alternative for diagnosis of malaria to
microscopy? A comparison between microscopy, antigen detection
and molecular tests in rural Kenya and urban Tanzania. Trop Med Int
Health 2007;12:238-44.
26. Guthmann JP, Ruiz A, Priotto G, Kiguli J, Bonte L, Legros D. Validity,
reliability and ease of use in the field of five rapid tests for the
diagnosis of Plasmodium falciparum malaria in Uganda. Trans R Soc
Trop Med Hyg 2002;96:254-7.
27. McMorrow ML, Masanja MI, Abdulla SM, Kahigwa E, Kachur SP.
Challenges in routine implementation and quality control of rapid
diagnostic tests for malaria--Rufiji District, Tanzania. Am J Trop Med
Hyg 2008;79:385-90.
28. Harani MS, Beg MA, Khaleeq L, Adil SN, Kakepoto GN, Khurshid M.
Role of ICT malaria immunochromatographic test for rapid diagnosis
of malaria. J Pak Med Assoc 2006;56:167-71.
29. Moody A. Rapid diagnostic tests for malaria parasite. Clin Microbiol
Rev 2002;15:66-78.
30. Bell D, Wongsrichanalai C, Barnwell JW. Ensuring quality and access
for malaria diagnosis: How can it be achieved? Nat Rev Microbiol
2006;4:682-95.
31. Chiodini PL, Bowers K, Jorgensen P, Barnwell JW, Grady KK,
Luchavez J, et al . The heat stability of Plasmodium lactate
dehydrogenase-based and histidine-rich protein 2-based malaria
rapid diagnostic tests. Trans R Soc Trop Med Hyg 2007; 101:331-7.
32. Andrade BB, Reis-Filho A, Barros AM, Souza-Neto SM, Nogueira LL,
Fukutani KF, et al. Towards a precise test for malaria diagnosis in
the Brazilian Amazon: Comparison among field microscopy, a rapid
diagnostic test, nested PCR, and a computational expert system
based on artificial neural networks. Malar J 2010;9:117.
Copyright of Journal of Postgraduate Medicine is the property of Medknow Publications &
Media Pvt. Ltd. and its content may not be copied or emailed to multiple sites or posted to a
listserv without the copyright holder's express written permission. However, users may print,
download, or email articles for individual use.