You are on page 1of 26

Recursos para el docente

Biología 3
El intercambio de información en los sistemas
biólógicos: relación, integración y control

ES año

Biología 3
El intercambio de información en los sistemas biológicos:
relación, integración y control

Biología 3. Recursos para el docente

es una obra colectiva, creada, diseñada y realizada en el Departamento
Editorial de Ediciones Santillana, bajo la dirección de Mónica Pavicich,
por el siguiente equipo:

Adela V. Castro, Celia E. Iudica, Natalia Molinari Leto, Paula Smulevich

Ana Prawda y Gustavo F. Stefanelli (Construyendo espacios de convivencia)

Editoras: Nora B. Bombara, Paula Smulevich y Cristina Viturro

Jefa de edición: Edith Morales
Gerencia de gestión editorial: Patricia S. Granieri

Recursos para la planificación, pág. 2 • Construyendo espacios de convivencia, pág. 6
• Clave de respuestas, pág. 12.

Jefa de arte: Silvina Gretel Espil. © 2015, EDICIONES SANTILLANA S.A.

Av. L. N. Alem 720 (C1001AAP), Ciudad Autónoma de Biología 3 : el intercambio de información en los sistemas
Diagramación: Exemplarr y Adrián C. Shirao. Buenos Aires, Argentina. biológicos: relación, intergración y control ; recursos
Corrección: Paulina Sigaloff y ISBN: 978-950-46-4155-1 para el docente / Adela V. Castro ... []. - 1a ed. - Ciudad
Queda hecho el depósito que dispone la Ley 11.723
Julia Taboada. Autonóma de Buenos Aires : Santillana, 2015.
Impreso en Argentina. Printed in Argentina. 24 p.; 28x22 cm. - (Santillana en línea)
Primera edición: febrero de 2015.

Este libro no puede ser reproducido total ni parcialmente ISBN 978-950-46-4155-1

en ninguna forma, ni por ningún medio o procedimiento,
sea reprográfico, fotocopia, microfilmación, mimeógrafo o 1. Biología. 2. Educación Secundaria. 3. Recursos
cualquier otro sistema mecánico, fotoquímico, electrónico, Este libro se terminó de imprimir en el mes de Educacionales. I. Castro, Adela V.
informático, magnético, electroóptico, etcétera. Cualquier febrero de 2015, en Grafisur S. A., Cortejarena 2943, CDD 371.1
reproducción sin permiso de la editorial viola derechos Ciudad de Buenos Aires, República Argentina.
reservados, es ilegal y constituye un delito.
Recursos para la planificación
SECCIón ⁄ Capítulo Expectativas de logro Contenidos Estrategias didácticas
Reconocer a los seres vivos como sistemas Los seres vivos como sistemas Clasificación de sistemas en aislados, cerrados y abiertos.
La respuesta al abiertos capaces de procesar y transmitir abiertos. La relación de los Identificación de las características de los seres vivos como
medio información. Analizar la relación de los seres seres vivos con el ambiente. Las sistemas abiertos. Identificación de estímulos y respuestas
vivos con el ambiente y los distintos tipos de respuestas de los animales en ejemplos de relaciones de seres vivos con el ambiente.
respuestas en animales y plantas. Establecer qué y de las plantas. La Comparación entre los tipos de respuestas en animales
1 es la homeostasis y en qué consiste la función homeostasis. El control de las y plantas. Reconocimiento de ejemplos de homeostasis.
de control. Comprender el modelo estímulo- actividades en los animales y Análisis de la termorregulación, la osmorregulación y
Los seres vivos y procesamiento-respuesta. Propiciar una mirada las plantas. El modelo estímulo- la defensa en animales y plantas. Análisis del modelo
su relación con crítica del mito que indica que hablarle a las procesamiento-respuesta. estímulo-procesamiento-respuesta. Explicación de
el medio plantas favorece su desarrollo. Analizar las comportamientos de los animales y las actividades de las
ventajas de aprovechar la interacción de las plantas aplicando el modelo estímulo-procesamiento-
plantas con el ambiente. Apreciar la labor de respuesta. Análisis del mito que indica que es necesario
científicos argentinos en el estudio del ambiente hablarle a las plantas para favorecer su desarrollo. Lectura
de las tortugas marinas para comprender los sobre la implementación y las ventajas de los jardines
beneficios que nos provee el intercambio que verticales. Lectura sobre el trabajo que se realiza con las
ellas hacen como sistemas abiertos. tortugas marinas en el Mar Argentino.

Identificar y caracterizar la variedad de estímulos Los estímulos y el ambiente. Caracterización general de las estructuras encargadas de
2 que captan los seres vivos. Comprender la Estructuras que captan la captación de los estímulos. Clasificación de receptores
especificidad de la interacción estímulo-receptor estímulos. Percepción de según diferentes criterios. Identificación del espectro de
y la existencia de variedad de receptores para estímulos lumínicos. Distintos luz visible en un gráfico del espectro electromagnético.
La percepción de
un mismo estímulo. Propiciar una mirada tipos de ojos y otras estructuras Análisis comparativo de diferentes fotorreceptores:
estímulos crítica sobre el mito que indica que perros y que captan la luz. La visión manchas oculares, ocelos y ojos simples. Análisis de
gatos solo ven en blanco y negro. Analizar las de los colores. La visión en el ubicación y funcionamiento de los ojos en animales
posibilidades que abre la aplicación de la ciencia medio acuático y en el terrestre. con visión monocular y binocular. Comparación de ojos
a la gastronomía. Apreciar el desarrollo de una Percepción de profundidad. con lente: compuesto y en cámara. Comparación entre
aplicación para hipoacúsicos elaborada por Percepción de estímulos fonorreceptores de invertebrados y el oído de vertebrados.
estudiantes argentinos. Leer críticamente un texto químicos. El gusto y el olfato. Análisis de un gráfico de captación de sonidos en diferentes
científico explicativo. Percepción de estímulos animales. Análisis comparativo de los estatocistos de los
mecánicos. Receptores de invertebrados y el aparato vestibular de los vertebrados en la
vibraciones y de contacto. captación del estímulo de la gravedad. Análisis de otros tipos
Percepción de estímulos de estímulos. Debate sobre el mito que indica que gatos y
sonoros. Captación del estímulo perros ven en blanco y negro. Lectura sobre la aplicación de
gravitatorio. Captación de otros la ciencia a la gastronomía y la percepción de los alimentos.
tipos de estímulos. Lectura sobre el desarrollo argentino de una aplicación
para celulares que los convierte en audífonos digitales para

Distinguir los tipos de respuestas en plantas El movimiento como respuesta. Clasificación de las respuestas en los seres vivos: nastias,
3 y animales. Diferenciar el comportamiento Nastias, tropismos y taxismos. tropismos y taxismos. Ejemplificación de tipos de respuestas
instintivo del aprendido. Debatir acerca de Las respuestas en las bacterias. en diferentes grupos de seres vivos. Análisis de las respuestas
las características innatas o aprendidas de Las respuestas de movimiento de las plantas en relación con la calidad, la intensidad y la
Las respuestas a
diferentes comportamientos en los seres de las plantas. Fototropismo y duración de la luz. Comparación entre las plantas de día
los estímulos humanos y otros animales. Interpretar los heliotropismo. Tigmotropismo. corto y las de día largo. Análisis de un esquema que exhibe el
sistemas biológicos y su diversidad como geotropismo positivo de raíces y el geotropismo negativo de

© Santillana S.A. Prohibida su fotocopia. Ley 11.723

© Santillana S.A. Prohibida su fotocopia. Ley 11.723

SECCIón ⁄ Capítulo Expectativas de logro Contenidos Estrategias didácticas

producto de su historia evolutiva. Explicar Las respuestas de las plantas tallos. Identificación de los comportamientos de los
y describir fenómenos biológicos utilizando a los estímulos mecánicos y a animales. Comparación entre comportamientos innatos y
un lenguaje adecuado y variado. Propiciar un la gravedad. Hidrotropismo. adquiridos. Identificación de diferentes comportamientos
análisis crítico sobre el mito de la alimentación Otros tipos de respuestas en en animales: huida, comunicación. Establecimiento de
de las plantas carnívoras. Analizar una película plantas. Las respuestas de los las bases genéticas del comportamiento. Análisis del
a partir de la ciencia. Apreciar los avances animales: el comportamiento. El comportamiento adquirido y de la orientación de algunos
argentinos sobre sueros antiofídicos. Diseñar un comportamiento de huida. Bases animales. Acercamiento a los comportamientos innatos
experimento que permita averiguar el efecto de genéticas del comportamiento. y adquiridos en los seres humanos. Comparación de la
la gravedad en el crecimiento de la raíz. El aprendizaje. La orientación. comunicación entre animales y la comunicacion química
El comportamiento humano. La de las plantas. Análisis sobre el mito de las repuestas a
comunicación entre animales. estímulos y la alimentación de las plantas carnívoras.
Feromonas e insectos sociales. Crítica de una película vinculada con el comportamiento
Diversidad de señales y de animal desde una mirada científica. Lectura sobre los
comportamientos. Comunicación avances argentinos en la elaboración de sueros antiofídicos.
química en las plantas, Análisis de un experimento histórico vinculado con las
aplicaciones biotecnológicas. respuestas a estímulos de las plantas.

Identificar los mecanismos celulares de ajuste Los seres vivos, las células Revisión de las características de las células. Interpretación
4 al ambiente a través de la percepción de y los estímulos. Características del modelo de mosaico fluido de la membrana plasmática.
señales. Establecer semejanzas y diferencias de la célula. La membrana Caracterización de las funciones de la membrana.
entre los distintos mecanismos de transporte plasmática: funciones, Esquemas y descripción de los mecanismos de transporte
La percepción y
de membrana. Valorar la importancia de las permeabilidad selectiva. El a través de la membrana plasmática. Identificación de
la respuesta a observaciones biológicas. Explicar el papel de las transporte pasivo y el activo. señales locales y a distancia que actúan sobre las células.
nivel celular proteínas de la membrana celular en los procesos La captación celular de las Descripción del modelo señal-receptor y su especificidad
de captación de señales y comunicación celular. señales. El complejo señal- para desencadenar una respuesta celular. Interpretación de
Comprender que una misma señal puede producir receptor. Tipos de receptores. la transformación de la señal y la producción de respuesta
distintas respuestas celulares. Propender a una La transducción de la señal y la a partir del ejemplo de acción de la acetilcolina sobre una
mirada crítica sobre el mito que indica que beber respuesta. Tipos de respuesta. fibra muscular, una fibra cardíaca y una célula glandular.
café genera acidez. Analizar “el efecto Mozart” La comunicación intercelular Análisis del mito que indica que consumir café produce
desde el punto de vista científico. Valorar los directa. La comunicación en las acidez. Análisis de la música de Mozart y del efecto que
avances argentinos en la lucha contra el cáncer. células animales y vegetales. produce desde una mirada científica. Lectura sobre avances
argentinos en la lucha contra el cáncer.

Establecer relaciones entre la estructura de la El sistema nervioso. Las células Identificación de las partes de una neurona y de sus
Regulación e célula nerviosa y su función en tanto percepción, nerviosas. La comunicación funciones. Clasificación funcional de las neuronas.
integración de procesamiento y producción de respuestas neuronal. El impulso nervioso. Descripción de los mecanismos de generación y conducción
frente a una señal. Construir representaciones La bomba de sodio-potasio. del impulso nervioso. Interpretación de un gráfico de
de las generalizaciones de los mecanismos de Generación y propagación la variación del potencial de membrana a lo largo del
conducción de impulsos nerviosos. Identificar del impulso nervioso. La tiempo. Interpretación de esquemas sobre el mecanismo
5 las partes principales del sistema nervioso vaina de mielina. La sinapsis. de sinapsis. Descripción del encéfalo y de sus funciones.
distinguiendo entre el carácter estructural y Los neurotransmisores. La Identificación de las estructuras cerebrales que participan
El control el funcional de sus divisiones. Propender a un organización del sistema en los procesos de memoria. Descripción de la participación
nervioso en el análisis crítico sobre el mito que asegura que nervioso humano: central y del sistema nervioso autónomo en ejemplos concretos.
ser humano las neuronas no pueden regenerarse. Analizar periférico. Funcionamiento del Lectura crítica del mito que indica que las neuronas no
una serie en la que el protagonista tiene un sistema nervioso autónomo. El pueden regenerarse. Análisis de una serie a partir de una
alto coeficiente intelectual desde una mirada encéfalo. La corteza cerebral. mirada científica. Lectura sobre el desarrollo argentino de la
científica. Apreciar el desarrollo argentino de Aprendizaje y memoria. La primera silla de ruedas que se mueve con el pensamiento.
la primera silla de ruedas que se mueve con el médula espinal.
pensamiento. Analizar gráficos y esquemas.

SECCIón ⁄ Capítulo Expectativas de logro Contenidos Estrategias didácticas
Identificar los principales modelos que El control nervioso en los Identificación de las estructuras nerviosas en diferentes
6 representan la organización del sistema nervioso invertebrados. El plexo invertebrados y vertebrados. Descripción de los principales
en diferentes grupos de invertebrados y de nervioso. Ganglios y cordones modelos de organización nerviosa en invertebrados.
vertebrados. Comparar las distintas estructuras nerviosos. La complejidad Reconocimiento del proceso de cefalización y
El control
nerviosas: ganglios, cordones, sistemas nerviosa: cefalización. Las diferenciación con el de encefalización a partir de ejemplos.
nervioso en los ganglionares bilaterales y cerebros. Propiciar áreas cerebrales. El control Comparación de los encéfalos de distintos vertebrados.
animales una mirada crítica sobre el mito que rodea la nervioso en los vertebrados. El Análisis del sistema nervioso periférico de los vertebrados.
inteligencia de los pulpos. Analizar la conducta cerebelo. El cerebro y la corteza Lectura crítica del mito acerca de la inteligencia de los
de una mona que se tomó una autofotografía. cerebral. Los sistemas nerviosos pulpos. Análisis de la conducta de una mona que se tomó
Analizar la investigación argentina sobre la periférico, somático una autofotografía. Debate a partir de una investigación
influencia de los herbicidas en el sistema y autónomo. argentina sobre la influencia de los herbicidas en el sistema
nervioso. Comunicar de forma escrita los nervioso.
conceptos aprendidos mediante el uso de diversos
registros, como esquemas y dibujos.

Reconocer los mecanismos de acción a Los mensajeros químicos. Análisis histórico de la construcción del concepto
7 distancia de las hormonas y los efectos de su El concepto de “hormona”. de hormona. Descripción del sistema endocrino.
hipofunción e hiperfunción. Explicar la regulación Las hormonas en la historia. Caracterización de las glándulas endocrinas y de
de la glucemia utilizando los conceptos de Las investigaciones en los las hormonas que producen. Reconocimiento de los
El control
producción de señales químicas, su transporte, siglos xix y xx. Las glándulas mecanismos de regulación hormonal. Análisis de ejemplos
endocrino en el órganos blanco, especificidad entre la señal y el endocrinas. Los receptores de control hormonal de la homeostasis (glucemia).
ser humano receptor, desencadenamiento de la respuesta y hormonales. Las hormonas y Interpretación del control endocrino a partir de la
acción antagónica de la insulina y el glucagón. la homeostasis: el control de la regulación de la glucemia. Análisis del control hormonal
Interpretar la regulación hormonal del desarrollo glucemia. La retroalimentación del desarrollo. Interpretación de la regulación del ciclo
sexual en general y del ciclo menstrual en o feedback. Otras hormonas menstrual. Lectura crítica sobre el mito que indica que
particular. Relacionar los mecanismos de glucemiantes. La diabetes. El consumir pollo puede afectar la reproducción. Análisis
estrés con el control hormonal. Comprender eje hipotálamo-hipofisario. crítico sobre el verdadero papel de las feromonas en los
la importancia de la acción coordinada de los Las hormonas tiroideas. Las perfumes. Lectura sobre la campaña nacional gratuita para
sistemas nervioso y endocrino. Propender a hormonas y el desarrollo. El prevenir la ceguera por diabetes.
un análisis crítico sobre el mito que dice que ciclo menstrual. Las hormonas
consumir pollo puede afectar la reproducción. y el comportamiento: la
Analizar el verdadero papel de las feromonas en respuesta al estrés. El control
los perfumes. Compartir la campaña nacional neuroendocrino.
gratuita para prevenir la ceguera por diabetes.

Identificar los mecanismos de regulación y Las respuestas hormonales Identificación de la acción hormonal en algunos
8 control hormonal en diferentes grupos de de los seres vivos. La acción invertebrados y vertebrados. Análisis de un esquema de
animales. Identificar los mecanismos vegetales hormonal en los invertebrados. variación de hormonas en el proceso de metamorfosis de
de ajuste al ambiente a través de las hormonas. Muda y metamorfosis en un insecto. Diferenciación entre ciclo menstrual y ciclo
La respuesta
Propiciar un abordaje crítico sobre la toxicidad los insectos. Hormonas que estral en vertebrados. Descripción del control hormonal
hormonal en los de los insecticidas. Analizar el proceso de intervienen en la reproducción. de algunas respuestas de las plantas: fototropismo,
animales y las obtención de la seda. Abordar los pormenores Feromonas. La acción hormonal gravitropismo. Relación entre las hormonas y el ciclo de
plantas de la inseminación artificial de un guepardo en los vertebrados. Las vida de una planta. Revisión de algunos experimentos
hembra en el Zoológico de Buenos Aires. Analizar hormonas vegetales: auxinas, históricos que permitieron identificar las primeras
gráficos vinculados con el efecto de una hormona citocininas y giberelinas. hormonas vegetales. Lectura crítica sobre la toxicidad de
sobre la osmorregulación. Leer críticamente una los insecticidas. Análisis del proceso de obtención de la
nota de divulgación científica. seda. Acercamiento a los pormenores de la inseminación
artificial de un guepardo hembra en el Zoológico de
Buenos Aires.

© Santillana S.A. Prohibida su fotocopia. Ley 11.723

© Santillana S.A. Prohibida su fotocopia. Ley 11.723

SECCIón ⁄ Capítulo Expectativas de logro Contenidos Estrategias didácticas

Reconocer que las proteínas son unas de las Las proteínas en los seres Identificación de la participación de las proteínas en
Del ADN al moléculas fundamentales para la estructura y vivos. Las funciones de las diferentes funciones de los seres vivos. Clasificación de las
organismo el funcionamiento de un organismo. Relacionar proteínas. Los aminoácidos. La proteínas de acuerdo con sus funciones. Caracterización de
la diversidad de estructuras de las proteínas con estructura de los aminoácidos. la estructura básica de las proteínas a partir de la unión
la diversidad de funciones que cumplen en el Estructura y clasificación de de aminoácidos. Análisis e interpretación de esquemas de
9 organismo y dar ejemplos. Explicar la acción de las proteínas. Las enzimas y los distintos niveles de organización de las proteínas.
las enzimas utilizando la analogía señal-receptor, su acción. Propiedades de las Clasificación de las proteínas de acuerdo con su estructura y
Las proteínas para dar cuenta de su especificidad. Propiciar un proteínas. Las proteínas como ejemplificación de cada grupo. Reconocimiento de la relación
análisis crítico sobre el mito que indica que cortar resultado de la expresión entre las propiedades de una proteína y el mantenimiento
el pelo lo fortalece. Apreciar esculturas basadas en genética. de su estructura. Descripción del mecanismo de acción de
la estructura de las proteínas. Apreciar el trabajo de las enzimas. Lectura crítica del mito que asegura que
alumnos de escuelas técnicas para encarar diferentes cortar el pelo lo fortalece. Abordaje de esculturas basadas
desarrollos alimenticios con soja. Experimentar en la estructura de la proteínas. Apreciación del trabajo
para comprobar la acción enzimática. Analizar de alumnos de escuelas técnicas sobre el desarrollo de
modelos de mecanismos de acción enzimática. productos alimenticios con soja.

Conocer las características del material hereditario. El material genético. La Análisis de experimentos históricos que permitieron
10 Comprender procesos biológicos, como la composición de los ácidos identificar el ADN como portador de la información
replicación del ADN. Relacionar la estructura de las nucleicos. La estructura del hereditaria. Descripción del material hereditario:
proteínas con la información genética, apelando ADN. Su replicación. Los cromosomas, genes, ADN. Interpretación de esquemas
al concepto de código genético y traducción. genes y el genoma. El Proyecto del modelo de estructura del ADN y de su replicación.
Interpretar el proceso de síntesis de proteínas a Genoma Humano. La expresión Descripción del Proyecto Genoma Humano y de los
partir de un ácido nucleico. Formular una primera de la información genética. principales conocimientos que aporta. Descripción de las
interpretación del concepto de mutación. Vincular El código genético universal. etapas en la síntesis de proteínas. Análisis de ejemplos
las mutaciones con los procesos de evolución. Genotipo, fenotipo y ambiente. para identificar la relación entre genotipo y ambiente en
Propiciar una mirada crítica sobre el mito que Alteraciones de la información la determinación del fenotipo de un individuo. Lectura
indica que existen diferentes razas en la especie genética: mutaciones. crítica sobre el mito que asegura que hay diferentes razas
humana. Analizar una historieta desde el punto de Variabilidad y evolución. en la especie humana. Análisis de una historieta desde
vista científico. Apreciar los beneficios que implicó una mirada científica. Lectura acerca del papel del índice
la posibilidad de establecer el índice de abuelidad de abuelidad para la recuperación de la identidad de hijos
para la recuperación de la identidad de hijos de de desaparecidos durante la última dictadura militar.
desaparecidos durante la última dictadura militar Resolución de problemas vinculados con la replicación, la
argentina. transcripción y la traducción del ADN.

Reconocer los procesos biotecnológicos como parte La biotecnología tradicional Revisión histórica del concepto de biotecnología.
11 de la vida cotidiana a lo largo de la historia de la y la moderna. Las técnicas Diferenciación entre la biología tradicional y la moderna.
humanidad. Diferenciar entre la biotecnología de ingeniería genética. Los Descripción de las herramientas básicas involucradas
tradicional y la moderna. Describir algunas microorganismos transgénicos. en las técnicas de ingeniería genética. Identificación
La biotecnología
técnicas de obtención de organismos transgénicos. Sus aplicaciones. Las plantas de los principales pasos en la obtención de organismos
Identificar las principales aplicaciones de los transgénicas. Aplicaciones transgénicos: bacterias, plantas y animales. Elaboración
organismos transgénicos. Generar debates en biotecnológicas. La clonación de esquemas para producir diferentes organismos
cuanto a la inocuidad de los productos transgénicos. animal. Biotecnología y salud. transgénicos. Ejemplificación de aplicaciones de organismos
Reflexionar acerca de las ventajas y las desventajas Las controversias en torno a transgénicos en diferentes ámbitos: agricultura, medicina.
que implica la manipulación de genes. Promover los OGM. La regulación de la Lectura crítica sobre la posibilidad de que los alimentos
un análisis crítico sobre la posibilidad de que los biotecnología. transgénicos afecten la salud. Análisis de una caricatura
alimentos transgénicos afecten la salud. Analizar televisiva desde una mirada científica. Lectura sobre el papel
una caricatura televisiva desde una mirada de vanguardia de la Argentina en materia de clonación
científica. Apreciar el papel de vanguardia de la animal. Resolución de un problema relacionado con el maíz
Argentina en materia de clonación animal. transgénico. Lectura analítica de un texto científico.

Construyendo espacios de convivencia

Querido/a profesor/a:

La iniciativa de Santillana “Desde la escuela. Programa para convivir mejor” pone a tu

disposición recursos, que se incluyen en el marco de la construcción de espacios de convi-
vencia, para prevenir las conductas que generan conflictos violentos y que podés utilizar con
los estudiantes que tenés a cargo.

¿Cómo se hace para prevenir y/o transformar situaciones conflictivas en soluciones


Comencemos mencionando algunas características de los conflictos:

• Los conflictos son el choque, la pugna entre dos o más partes, como consecuencia de desa-
• Pueden ser de diferente naturaleza, intensidad y magnitud. Desde un niño que arroja una
tiza en el aula o un grupo de estudiantes que acosa permanentemente a un compañero,
hasta un país que invade a otro.
• Se originan, generalmente, en intereses que no coinciden y se enfrentan. Como resulta-
do de esa pugna se produce una alteración del orden establecido –es decir, la ruptura del
equilibrio– que perjudica a uno, a muchos o a todos los que conviven en un ámbito de-
terminado. Muchos de estos conflictos se resuelven, pero otros se agrandan cada vez más
en intensidad y cantidad de diferencias. Cuando esto sucede, hablamos de conflicto que
escala o de escalada del conflicto (Prawda, 2008).2

Más allá de las distintas definiciones que encontremos, es importante destacar que el
conflicto es inherente a la vida misma y que es construido por cada una de las personas invo-
lucradas en él, quienes lo revisten de un alto grado de subjetividad.
Para iniciar el camino de resolución es necesario transformar una dinámica de confron-
tación en una de colaboración y lograr que las partes trabajen juntas en la solución del pro-
blema, acercándose entre ellas para lograr un acuerdo. Es decir, que de ser enemigos pasen a
ser socios.
En este punto podemos decir que todo conflicto:
P Es inevitable: ya que siempre hay situaciones donde las personas tienen diferencias.
© Santillana S.A. Prohibida su fotocopia. Ley 11.723
P Es necesario: pues aparece cuando algo debe cambiar, ocupando nuestra atención y
preocupándonos. Es un aviso de que se tienen que pensar variables para tener en cuenta
en una situación determinada.
P Puede mejorar o empeorar las relaciones: dependerá de los aportes que cada uno de los
involucrados hace durante el intercambio.

El conflicto posee aspectos positivos y negativos, es decir que no es ni malo ni bueno per se.

6 1

Prawda, Ana. Plataforma UNSAM Virtual. En: Redorta, J. Entender el conflicto. Barcelona, Paidós Ibérica, 2007.
Prawda, Ana. “Hablemos del conflicto”. En: Mediación escolar sin mediadores. Buenos Aires, Editorial Bonum, 2009.
Aspectos positivos Aspectos negativos

Promueve el cambio en las re- Promueve, como indicador importante, solo los aspectos
laciones. que connotan desvalorizaciones, enojos y otros relatos ne-
Ofrece un espacio para plan- gativos. En consecuencia, produce efectos desgastantes en
tear reclamos. las personas y en las relaciones.
Favorece la reflexión acerca Ofrece una escalada de malentendidos y enojos que aumen-
del hecho y, consecuentemen- tan, de ese modo, el perjuicio y culminan en una situación
te, posibilita la identificación de violencia que afecta a las relaciones y a las personas in-
de los intereses y las necesi- volucradas.
dades en juego de cada parte. Imposibilita que las personas logren satisfacer sus intereses
Posibilita el crecimiento per- en juego.
sonal, grupal, institucional y/o De no abordarse correctamente su solución, puede crecer
social. en intensidad y cantidad, ya sea que se profundicen las di-
ferencias y/o den lugar al surgimiento de nuevos conflictos.

Con frecuencia, el conflicto está asociado con la violencia. Sin embargo, la violencia es
la máxima expresión de un conflicto que escala y que, en ocasiones, comienza como una
diferencia de opiniones hasta que se convierte en una comunicación basada en profundas
agresiones físicas y/o psicológicas. Una vez que se desencadena la violencia, los aspectos po-
sitivos del conflicto desaparecen.
Identificar estos aspectos positivos permite avanzar hacia la solución. Cuando, en cambio,
solo se tienen en cuenta los aspectos negativos, la situación se agrava hasta que, algunas ve-
ces, se convierte en violenta.
Los aspectos positivos del conflicto son aquellos que ofrecen y promueven un espacio para
pensar ese cambio. La vida de los seres humanos implica la permanente toma de decisiones,
algo que, muchas veces, se expresa por medio de conflictos. Por ejemplo: ¿avanzo o retrocedo
en mi posición?, ¿me quedo o me voy?, ¿le respondo o permanezco callado?, ¿le propongo una
solución o acepto la suya?, ¿o pensamos una que nos favorezca a ambos?
Desde la perspectiva que nos brinda esta percepción del conflicto, la meta del docente no
sería necesariamente eliminarlo, sino prevenirlo, reducirlo y abordarlo identificando sus as-
pectos positivos y los intereses encubiertos que muchas veces tiene, con el fin de analizarlo,
y según sea su característica, prevenir que escale hasta convertirse en violento.
En este cuadernillo te ofrecemos algunas actividades que te permitirán poner en práctica
diferentes recursos junto a tus alumnos, con el objetivo de que, entre todos, puedan identi-
ficar aquellas situaciones cotidianas que pueden derivar en posibles conflictos, y también
© Santillana S.A. Prohibida su fotocopia. Ley 11.723

técnicas, estrategias y habilidades que harán posible analizar estas situaciones, generar una
toma de conciencia y aprendizaje colectivo y, finalmente, prevenir la violencia en el aula.

Ana Prawda y Gustavo Stefanelli.

DINÁMICA 1: Todos discriminados

VALORES: integración, respeto, diversidad.

• Encontrar un rasgo personal que diferencia a un individuo del resto
de las personas.
• Identificar los beneficios de integrar grupos con personas de diferen-
tes características: físicas, sociales, económicas, etcétera.
• Practicar la empatía con respecto a las particularidades de los otros.

Síntesis de objetivos y • Organismo: Ministerio de Sanidad, Servicios

contenidos Sociales e Igualdad. Gobierno de España
• Origen: España, 2011
Aceptar la diversidad nos permite enriquecer • Duración: 1 minuto y 41 segundos
el mundo donde vivimos. Es el punto de partida de • Link del video:
diferentes procesos, entre ellos, el del aprendizaje. [Consultado el 2/12/2014]
Una realidad sin diferencias, vista a través de Canal de la Asociación Civil Convivencia Social
lentes que solo permiten apreciar un color, no y Asistencial
existe: justamente, lo que hace que las cuestiones
de la vida sean reales es que son distintas, se ven Consideraciones previas
diferentes y cada uno las interpreta a su modo. Son • Materiales: TV y reproductor de DVD
las diferencias las que nos permiten pensar si lo • Tiempo estimado de la actividad: 1 h 30 min
que afirmamos, vemos o entendemos es así como
creemos. Ellas nos hacen salir de nuestras propias A. Introducción
ideas y nos posibilitan la inclusión de otras o favo-
recen la creación de un pensamiento más abarca- El video completo forma parte de una campaña
dor, producto del aporte de todos. de publicidad del Ministerio de Sanidad, Servicios
Es decir, la diversidad favorece el crecimiento Sociales e Igualdad del Gobierno de España.
personal, que se va dando entre los conflictos que Las breves historias que presenta este fragmen-
se suscitan al tratar de aunar criterios para convi- to permiten reconocer, en cada uno de sus protago-
vir con las diferencias y/o de acordar intereses y nistas, una característica que los diferencia de los
necesidades comunes. Dentro de este marco, en- otros y por la cual son excluidos o discriminados,
tendemos el conflicto como una oportunidad de ya sea la edad, la nacionalidad, las c
­ apacidades físi-
cambio, de crecimiento, de mejora. Pero… cas, etc. De esta manera, el video propone un espa-
• ¿Qué sucedería si las diferencias fueran utili- cio de reflexión acerca de los diferentes prejuicios

© Santillana S.A. Prohibida su fotocopia. Ley 11.723

zadas para lastimar, para agredir, para excluir? con que los individuos consideran a los demás.
• ¿Cómo nos sentiríamos en el supuesto caso
de que esto nos sucediera? B. Desarrollo y consignas
Si todos tomáramos las diferencias como un
motivo para excluir, entonces todos seríamos po- 1. Observar atentamente el video.
tenciales víctimas de discriminación. 2. Etapa de trabajo individual. El docente les en-
tregará a los alumnos una hoja en la que tie-
Video a analizar nen que responder las siguientes consignas:
• Nombre del video: “Anuncio contra la discrimi- a) Escribir una oración que sintetice lo que
nación” cada uno cree que comunica el video.
• Descripción: Campaña contra la discriminación b) Identificar las diferentes razones o motivos
por los cuales se discrimina a cada uno de los
protagonistas de las historias del video.

c) Elegir uno de los personajes del video y po- c) Por último, hacer un listado de conductas
nerse en su lugar, en su situación y tratar de que posibiliten sentirse bien y reconocido
pensar como él. Luego, responder según sea por el resto de los compañeros sin necesi-
el caso: dad de discriminar al otro.
• ¿Qué acción y/o comentarios realizó
para discriminar al otro? ¿Qué sintió al C. Cierre
realizar dicha acción o comentario?
• ¿Qué acción y/o comentarios recibió que 1. Los integrantes de los grupos comparten las
lo hizo sentir discriminado? ¿Qué emo- respuestas entre sí.
ciones experimentó en ese momento? 2. El docente puede acompañar este momento
d) A la lista elaborada en la consigna b), agre- resumiendo las respuestas en el pizarrón.
gar motivos de discriminación que cada
alumno/a haya observado en el colegio. Sugerimos anotar las emociones identificadas
e) ¿Por qué razón los alumnos creen que la tanto en el rol de los que son discriminados como
gente discrimina a los otros? Cada uno de- en el de los que discriminan, ya que esto les per-
berá enumerar, al menos, una razón. mitirá a los alumnos reflexionar junto al docente
3. Etapa de trabajo grupal. Organizados en grupos sobre una habilidad social denominada empatía,
de hasta cinco integrantes, los alumnos inter- que les permite a los seres humanos ponerse en
cambian y comparten las respuestas. Luego rea- el lugar del otro, tratando de sentir y pensar desde
lizan las siguientes consignas: ese nuevo rol. De este modo se podrá plantear el
a) Conversar sobre las respuestas que ha dado siguiente análisis:
cada uno y luego elegir entre todos: • ¿Cuántas veces observamos una situación de
- Una palabra que sintetice lo que trans- burla o agresión verbal que deriva en discri-
mite el video. minación y de manera inconsciente la vali-
- Tres emociones que reconocieron en los damos, al no darnos cuenta del impacto que
personajes del video al ser discriminados. genera en el otro esa acción?
- Tres motivos que llevan a una persona La actividad también permite reflexionar sobre
a realizar comentarios o acciones que el hecho de mostrarse tal cual uno es, sin temor a
discriminan a otro. ser marginado o discriminado, a partir de plantear:
Luego, responder: ¿para qué consideran • ¿Cuántas veces decidimos no hacer ciertas co-
que lo hacen?, ¿cuánto y qué gana o sas, o decir lo que pensamos, porque creemos
pierde una persona cuando discrimina? que si lo hacemos no seremos aceptados?
b) Realizar una lista de motivos o razones por • ¿Qué decidimos perder para ser aceptados?
las cuales en el colegio unos estudiantes ¿Esto tiene algún valor para nosotros?
discriminan o excluyen a otros.
© Santillana S.A. Prohibida su fotocopia. Ley 11.723

DINÁMICA 2: ¿Cómo es mi “baile”?

VALORES: integración, respeto y diversidad.

• Encontrar un rasgo personal que nos diferencie del resto de las personas.
• Identificar los beneficios de integrar grupos con personas de diferentes
características: físicas, sociales, económicas, etcétera.
• Practicar la empatía con respecto a las particularidades de los otros.

Síntesis de objetivos y centes vestidos de manera similar, que se burlan

contenidos del diferente. Los chicos y las chicas del primer
plano van, uno por uno, integrando este segundo
El respeto por las diferencias es una de las cla- grupo de iguales, y desde esta igualdad, discrimi-
ves para comunicarse eficazmente y convivir sin nan con sus pares al considerado diferente.
violencia. Las conductas que permiten la diversi- En un segundo momento, todos los adoles-
dad y posibilitan la integración requieren recono- centes, ya sea vestidos con sus características di-
cer al otro como un semejante, aceptarlo con sus ferenciadoras o vestidos igual, terminan bailando
diferencias y buscar juntos espacios donde se en- ­juntos la misma coreografía.
cuentren intereses y necesidades comunes. La propuesta de “Bailemos juntos contra la
discriminación social” nos permite comprender el
Video a analizar hecho de que cada uno puede tener un lugar, man-
• Nombre del video: “Bailemos juntos contra la teniendo su identidad.
discriminación social”
• Descripción: Campaña contra la discriminación B. Desarrollo y consignas
• Organismo: Ministerio de Sanidad, Servicios
Sociales e Igualdad. Gobierno de España Si bien en el video aparecen dos grupos, la cla-
• Origen: España se se dividirá en tres, cada uno de ellos con el si-
• Duración: 1 minuto y 31 segundos guiente rol:
• Link del video: Grupo A: representa a los adolescentes que están
[Consultado el 2/12/2014] en primer plano y se visten, peinan y mueven
Canal de la Asociación Civil Convivencia como lo desean.
Social y Asistencial
Grupo B: representa a los adolescentes que en el
Consideraciones previas video aparecen en segundo plano y están vestidos
todos con remera blanca.
© Santillana S.A. Prohibida su fotocopia. Ley 11.723
• Materiales: TV y reproductor de DVD
• Tiempo estimado de la actividad: 1 h 30 min
Grupo C: representa a los adolescentes que, en
A. Introducción principio, formaban parte del Grupo A, pero des-
pués integran uno nuevo que, a su vez, discrimina.
El video forma parte de una campaña de publi-
cidad del Ministerio de Sanidad, Servicios Sociales Luego, cada grupo deberá responder las siguientes
e Igualdad del Gobierno de España. consignas que se le entregan por escrito:
Nos muestra escenas en dos planos:
- En primer plano aparecen, de a uno, distintos Grupo A
adolescentes, cada uno de ellos con una diferen- 1. ¿Cuáles son las ventajas de integrar un grupo
te forma de vestir, peinarse, moverse, etcétera. de personas diferentes?
- En segundo plano aparece un grupo de adoles- 2. ¿Qué creen que sienten por ser discriminados
por el resto?
3. ¿Qué significa para ustedes la frase “bailemos
C. Cierre
juntos contra la discriminación”?
4. ¿Cuáles creen que son las emociones que
1. Los integrantes de los grupos comparten las
sentirían si formaran parte del baile en el que
respuestas entre sí.
participan todos?
2. El docente puede acompañar este momento
5. Escriban, por lo menos, dos situaciones que
resumiendo las respuestas en el pizarrón o en
hayan experimentado en la escuela, en la que
diferentes cartulinas para cada grupo. En una
algunos alumnos se hayan reído, burlado y
cartulina única se escriben las respuestas 3 y
discriminado a otro. Luego identifiquen:
4, previamente debatidas entre todos.
• ¿Cuáles eran los motivos por los que se
discriminaba a un/a compañero/a?
Como en la dinámica precedente, y a fin de fo-
• Poniéndose en el lugar del chico o la chica
calizar y reforzar las conductas propuestas, suge-
discriminado/a, traten de identificar, por
rimos anotar las emociones identificadas tanto en
lo menos, tres emociones que crean que
el rol de los que son discriminados como en el de
sentirían en su lugar.
los que discriminan, ya sean las tomadas del video
• Poniéndose en el lugar de los integrantes
como las correspondientes a las experiencias del
del grupo que discrimina, identifiquen, por
colegio. Esto les posibilitará a los alumnos reflexio-
lo menos, dos emociones que crean que
nar junto al docente sobre una habilidad social
sentirían al realizar estas acciones.
denominada empatía, que les permite a los seres
humanos ponerse en lugar del otro, tratando de
Grupo B
sentir y pensar desde ese nuevo rol. De este modo
1. ¿Qué beneficios encuentran al actuar así
se podrá plantear el siguiente análisis:
como grupo?
• ¿Cuántas veces observamos una situación de
2. ¿Cuáles son las desventajas de formar parte
burla o agresión verbal que deriva en discri-
de ese grupo de iguales?
minación y de manera inconsciente la vali-
3. ¿Qué representa, para ustedes, la frase “baile-
damos, al no darnos cuenta del impacto que
mos juntos contra la discriminación”?
generaba en el otro esa acción?
4. ¿Cuáles son las emociones que sentirían si
La actividad también permite reflexionar sobre
formaran parte del baile en el que participan
el hecho de mostrarse tal cual uno es, sin temor a
ser marginado o discriminado, a partir de plantear:
5. La consigna 5 es la misma que en el caso del
• ¿Cuántas veces decidimos no hacer ciertas co-
Grupo A.
sas, o decir lo que pensamos, porque creemos
que si lo hacemos no seremos aceptados?
Grupo C
• ¿Qué decidimos perder para ser aceptados?
1. ¿Para qué creen que cada uno de los adoles-
¿Esto tiene algún valor para nosotros?
centes que se presenta en primer plano cam-
Por último, la idea sería poder aplicar la me-
bia de look y de actitud cuando forma parte
táfora del baile a la convivencia diaria, resumien-
del grupo que se encuentra detrás?
do lo que para cada uno de los grupos representa
2. ¿Qué creen que pierde cada uno de ellos al
y reforzando la idea de participar en un contexto
formar parte de ese grupo?
donde se respete la diversidad.
© Santillana S.A. Prohibida su fotocopia. Ley 11.723

3. ¿Qué representa para ustedes la frase “baile-

¿Cómo sería el baile de este curso?
mos juntos contra la discriminación”?
Si el docente lo considera viable, se puede articular
4. ¿Cuáles son las emociones que sentirían si
esta actividad con los docentes de Educación artísti-
formaran parte del baile en el que participan
ca para realizar una propuesta práctica.
5. La consigna 5 es la misma que en el caso del
Grupo A.

Clave de respuestas
Las respuestas que no figuran quedan a cargo de los a
­ lumnos.

1. Los seres vivos y su relación e) Falso. El encargado de percibir los estímulos es el siste-
ma nervioso periférico.
con el medio
2. a) Por ejemplo, la planta incorpora energía solar como
Página 17 energía lumínica que usa en la fotosíntesis y la trans-
Respuesta posible: forma en energía química, en forma de azúcares. Libera
energía en forma de calor, mediante la transpiración
Control de las actividades y la respiración. Intercambia materia, como los gases
de la atmósfera durante la fotosíntesis y la respiración,
absorbe nutrientes minerales del suelo, intercambia va-
por de agua a través de los estomas, etcétera.
b) Consiste en la recepción de un estímulo ambiental me-
Animales Plantas diante los órganos receptores, el procesamiento de la
información y la ejecución de una respuesta a través de
órganos efectores.
c) Los mecanismos implicados en el crecimiento de las
plantas involucran la acción de las hormonas vegetales,
como las auxinas. Por ejemplo, las raíces necesitan pe-
Control Control Hormonas
queñas cantidades de auxinas para crecer; un aumento
endocrino nervioso vegetales
en la concentración de estas hormonas inhibe su desa-
d) El mecanismo de control es el nervioso, de acción rápi-
da. La persona recibió el estímulo del calor del metal a
Auxinas través de receptores en la piel. Este estímulo fue trans-
mitido por los nervios del sistema nervioso periférico
hasta el sistema nervioso central. Allí se procesa la in-
formación y se emite la orden, nuevamente transmi-
Exocrinas Endocrinas tida, mediante los nervios, hacia la mano para que se
aleje de la olla.
Hormonas nervioso 3. a)
Respuesta secretora; b) respuesta motora; c) respuesta
secretora; d) respuesta inmune.

Resolver problemas
4. Ejemplo del canto de los grillos:
Central Periférico Estímulo: sonido producido por el frote de las alas del
grillo macho.
Receptores: “oído” en el cuerpo de los grillos hembra.
Páginas 22 y 23 Centro de procesamiento: sistema nervioso.
Actividades finales Efectores: músculos del cuerpo de las hembras.
Recuperar conceptos Respuesta: movimiento de las hembras hacia los ma-
chos que emiten el sonido.
© Santillana S.A. Prohibida su fotocopia. Ley 11.723
1. a) Falso. El planeta Tierra puede considerarse un ejemplo
de sistema abierto, porque intercambia energía (calor y Ejemplo del vuelo de los mosquitos:
radiaciones) y materia (moléculas de la atmósfera, me- Estímulo: dióxido de carbono exhalado por el ser hu-
teoritos o partículas) con el exterior. mano durante la respiración.
b) Verdadero. La regulación del volumen de agua se cono- Receptores: estructuras sensoriales olfativas en el cuer-
ce como osmorregulación. Cuando la cantidad de agua po del mosquito.
es baja en nuestro organismo, los riñones retienen el Centro de procesamiento: sistema nervioso.
agua y producen menor cantidad de orina, y viceversa. Efectores: músculos del cuerpo del mosquito.
c) Falso. Las hormonas forman parte de la respuesta se- Respuesta: vuelo del mosquito hacia el ser humano.
cretora, al ser producidas por las glándulas endocrinas
frente a un estímulo. Los glóbulos blancos y anticuer- 5. a) Cuando la temperatura del ambiente es igual o mayor
pos intervienen en la respuesta inmune. a 37 °C, la acción de bostezar estaría incorporando aire
d) Verdadero. El sistema nervioso periférico solo transmi- caliente al cuerpo. El bostezo entonces deja de ser un
te la información desde los distintos órganos y tejidos mecanismo útil para refrigerar el cerebro. Por eso la fre-
hasta el sistema nervioso central. cuencia detectada de bostezos es más baja.

b) La temperatura óptima es aquella en la que se detecta c) Si abandonamos el ejercicio en cuanto se comienza a
mayor cantidad de bostezos, a los 20 °C. sentir el dolor, no lograremos avanzar en el estiramien-
c) El bostezo puede considerarse un proceso de termorre- to de los músculos. Si el ejercicio se continuara de ma-
gulación, al funcionar como un mecanismo de refrigera- nera controlada, se le envía información al cerebro de
ción a temperaturas templadas. Cuando la temperatura que la actividad no es dañina, el dolor puede cesar con
ambiente es muy baja, el mecanismo de bostezo no es la práctica y se puede mejorar el estiramiento muscular.
tan necesario para producir la refrigeración, y cuando es
demasiado alta, no cumpliría con esta función.
d) Puede discutirse la influencia de otras variables, como 2. La percepción de estímulos
la cantidad de horas que durmió una persona la noche
anterior, si tiene sueño o no, la hora del día a la que se Página 25
realizó el estudio, la edad de los participantes, etcétera. Los organismos necesitan captar los cambios que se producen
en el ambiente, responder a ellos y así mantenerse adaptados
6. a un medio cambiante. Para los ciervos, por ejemplo, tener los
Estímulo Receptor CP Efector Respuesta ojos a los costados de su cabeza les permite ver mejor su alre-
a) Canto de los Oídos de las SN Ovarios Madurez dedor, y estar alertas, ya que son presa fácil de los felinos. Otro
machos hembras sexual ejemplo es la detección del gusto de los alimentos, que evita la
b) Gritos de los Oídos de la SN Músculos Huida del ingestión de sustancias tóxicas.
teros comadreja del cuerpo territorio
c) Olor de la Nariz del SN Glándulas Producción Página 29
carne perro salivales de saliva La quimiorrecepción fue el primer tipo de captación de estí-
d) Aumento de Receptores PF Estomas Apertura de mulos porque resulta una manera de detectar la fuente de nu-
la humedad especializados los estomas
trientes. En los primeros organismos, que fueron unicelulares,
del ambiente en las hojas
este tipo de captación de estímulos, junto con el desarrollo de
  CP = Centro de procesamiento. medios de locomoción, les permitió dirigirse hacia la fuente
  PF = Procesos fisiológicos. de alimento, lo que constituye una ventaja adaptativa frente a
  SN = Sistema nervioso otros organismos inmóviles.

Experimentar Página 33
7. a) Porque son variables que pueden dar indicios de cómo El agua es un buen conductor eléctrico, no así el aire.
se modifican los procesos internos de nuestro cuerpo, Son fundamentales para mantener el equilibrio y tener no-
por ejemplo, el trabajo del corazón, el calor que se emi- ción del estado en que se encuentra el propio cuerpo, si se
te mediante la contracción de los músculos y la respi- halla en reposo o en movimiento.
ración, y la presión sanguínea.
b) Una hipótesis puede ser que se espera que los valores Páginas 36 y 37
de esas variables aumenten en este sentido: grupo A < Actividades finales
grupo B < grupo C, ya que es factible que con una mayor Recuperar conceptos
intensidad de actividad física se incremente el consu- 1. a) V.
mo de energía de las células, por lo que la respiración y b) F. El ojo en cámara regula la entrada de luz mediante
la circulación de oxígeno y nutrientes en la sangre debe el iris, que puede aumentar o disminuir el tamaño del
ser mayor. orificio ubicado en su centro, la pupila.
e) Se podría: extender el tiempo de a ­ ctividad física, me- c) F. Las aves y los reptiles tienen una visión tetracromá-
dir en cada alumno las variables antes y después de tica, mientras que los seres humanos tenemos visión
realizar la actividad, tomar en cuenta otras v ­ ariables, tricromática.
hacer otros ejercicios; evaluar si todos los estudiantes d) F. En la visión monocular hay superposición de campos
están en las mismas condiciones iniciales (por ejem- visuales, aunque esta es menor que en la binocular.
plo, algún alumno que estuviese más ­abrigado, o que e) V.
© Santillana S.A. Prohibida su fotocopia. Ley 11.723

hubiera hecho el mismo ejercicio con distinta intensi- f) V.

dad, etcétera). g) F. En una parte del oído, el oído interno, se encuentran
los fonorreceptores.
Investigar h) V.
9. El reloj biológico regula los distintos procesos del organis-
mo, estableciendo cierta regularidad. Por ejemplo, en los 2. A: ampollas de Lorenzini: electrorreceptores, estímulos
seres humanos, es el responsable de regular el ciclo de vi- eléctricos; B: sistema de línea lateral: mecanorreceptores,
gilia y sueño. Su alteración perjudica el equilibrio interno. estímulos mecánicos; C: foseta loreal: termorreceptores,
estímulos térmicos; D: ojo compuesto: fotorreceptores, es-
Opinar tímulos lumínicos.
10. a) El estiramiento del músculo. a) El ojo compuesto comparte la modalidad sensorial con
b) El dolor es una forma que tiene el cuerpo de alertarnos el ojo en cámara de los seres humanos. Ambos recepto-
de que algo puede dañarnos y de esa manera proteger- res captan estímulos lumínicos.
nos y alejarnos de la fuente de dolor. b) Las sensilias de invertebrados pueden captar estímulos
químicos y mecánicos.

3. Están involucrados los ojos y los oídos. El estímulo es v
­ isual b) Puede tener un origen cognitivo como resultado de in-
y gravitatorio. Participan fotorreceptores, ubicados en la ferencias inconscientes o debido a una estimulación
­retina de los ojos, y mecanorreceptores, que detectan cam- excesiva de un tipo específico, como el movimiento, el
bios en la posición relativa a la fuerza de gravedad (gravi- brillo, el tamaño, la inclinación, el color o la posición.
rreceptores), ubicados en el aparato vestibular del oído. c) Se espera que los alumnos se den cuenta de que la vi-
sión es un proceso susceptible de fallas que puede ha-
Resolver problemas cernos incurrir en errores en cuanto a la forma en que
4. Como se vio en el capítulo, las medusas tienen ocelos percibimos los estímulos visuales.
­(fotorreceptores) y estatocistos (gravirreceptores). De ma-
nera que de día suben a la superficie guiadas por sus ocelos
y de noche bajan orientándose con sus estatocistos.
3. Las respuestas a los estímulos
5. El tímpano es una membrana que vibra por el choque de
las ondas sonoras contra su superficie. De esta manera Página 39

convierte las vibraciones del aire en vibraciones mecáni- Tropismos Nastias Taxismos
cas, lo que se transmite, finalmente, a los fonorreceptores.
Involucran Sí Sí Sí
Este proceso hace posible la captación del estímulo sonoro.
Si esta membrana se perfora, no se pueden convertir las vi-
braciones sonoras en mecánicas y, por tanto, no se genera Tipo de Plantas Plantas Bacterias,
el proceso de audición. organismos protistas
y animales
6. La presencia de los ojos frontales es un posible indicio Direccionales Sí No Sí
de que se trata de un ave cazadora, ya que esta disposi-
Perceptibles No Sí Sí
ción de los ojos aporta una visión binocular esencial para
esta actividad. Por otro lado, el gran número de bastones La locomoción permite que los organismos tengan respues-
indicaría que tiene hábitos nocturnos, pues estos son muy tas más rápidas y eficientes a los estímulos ambientales,
sensibles a la luz y permiten ver aun cuando esta es escasa. por ejemplo, el desplazamiento hacia las fuentes de  nu-
trientes, así como la huida del peligro y la ­búsqueda  de
Leer y escribir en ciencias condiciones más favorables de luz, humedad, etc., que es
7. a) Porque intenta hacer entender un hecho o un proceso, lo que se observa efectivamente en los taxismos.
incorporando terminología precisa de la disciplina.
b) Hace referencia a los órganos sensoriales en hendidu- Página 43
ra, que se encuentran típicamente en arañas tejedoras. En algunas plantas, la detección del alargamiento de los pe-
Tienen una función importante en la comunicación en- ríodos de oscuridad desencadena como respuesta la floración,
tre diferentes miembros de la especie y en la captación mientras que en otras la inhibe. A su vez, un mismo estímu-
de información sobre sus presas. lo, como la gravedad, puede generar dos respuestas opuestas
c) Las señales vibrátiles a través de la generación de ten- dentro de la misma planta, según el órgano que lo detecte. En
siones diferentes en los hilos de la tela de araña. la raíz produce como respuesta un gravitropismo positivo, y en
d) Constituye una forma de adaptación al medio por- el tallo, uno negativo.
que de este modo las arañas perciben la presencia de
miembros de su misma especie con quienes pueden Página 45
entablar comunicación que les permitirá ayudar a la Los comportamientos innatos permiten que los animales pue-
supervivencia de la cría, encontrar pareja para repro- dan afrontar situaciones indispensables para su supervivencia
ducirse, así como reconocer la presencia de organismos de manera exitosa. El comportamiento posee una base genéti-
de otras especies de los que se alimenta. ca que se hereda y es un fenotipo más del animal. Está sujeto
a la selección natural, o sea que evoluciona a medida que se
Investigar produce su optimización, de manera que los individuos cuyos
8. En general, las personas que perdieron la función de algún comportamientos les confieren una ventaja sobrevivirán y de-
órgano de los sentidos agudizan el funcionamiento de otro jarán más descendientes. © Santillana S.A. Prohibida su fotocopia. Ley 11.723
sentido que compense esa falta. Por ejemplo, en las personas
ciegas se suele agudizar el sentido del oído, el olfato y el tac- Páginas 54 y 55
to. En realidad, esto se relaciona con la plasticidad neuronal. Actividades finales
El cerebro utiliza zonas originariamente destinadas a pro- Recuperar conceptos
cesar la información proveniente del sentido faltante para 1. a) F. Tanto las plantas como las bacterias se mueven y
procesar información proveniente de otros órganos senso- presentan respuestas que involucran movimientos,
riales. Los órganos de los sentidos obtienen la información como las nastias, los tropismos y los taxismos. En el
del ambiente, de modo que la pérdida de algunos de estos caso de las plantas, algunos de estos movimientos son
órganos puede implicar una seria desventaja adaptativa que muy lentos y por eso nos resultan imperceptibles, como
ponga en peligro la supervivencia. muchos tropismos. Otros son más evidentes, como las
nastias, ya que suelen ser más rápidas y las podemos
9. a) Es la percepción visual de una imagen que no coincide percibir. En el caso de las bacterias, algunas de ellas
con la realidad objetiva. presentan estructuras especializadas en la ­locomoción

y se mueven de forma activa, por ello pueden ­responder la raíz va a crecer siempre a favor de la fuerza de grave-
acercándose o alejándose de determinados estímulos, dad y el tallo en sentido opuesto a esta fuerza.
lo que se conoce como taxismo positivo y negativo, res- b) Procedimiento:
pectivamente. Paso 1. Se colocaron dos semillas de poroto pinchadas
b) F. Algunos tropismos son reversibles, como el heliotro- sobre una plancha de corcho humedecida. Una en posi-
pismo. ción vertical (A) y la otra en posición horizontal (B).
c) V. Paso 2. La plancha se ubicó en un lugar iluminado y se
d) F. Las conductas animales tienen una base innata y esperó a que germinaran las semillas.
pueden modificarse mediante el aprendizaje. Paso 3. Se mantuvo humedecida la plancha durante
e) V. todo el transcurso de la experiencia.
f) V. c) Observaciones (el alumno anotará sus observaciones
g) V. cada día, o día por medio. Acá se sintetizan los resul-
tados esperados): al cabo de “x” tiempo germinaron las
2. A: señales químicas (feromonas), que en este caso tienen por semillas y aparecieron la raíz y el tallo en ambas. En
finalidad la identificación individual. B: señales visuales; la la planta A el tallo y la raíz crecieron “derechos”, el hi-
exhibición de la cola por parte del pavo real es una forma de pocótilo (tallo primario) hacia arriba y la raíz hacia aba-
atraer a las hembras. C: señales auditivas; el canto del gallo jo. En la planta B la raíz y el hipocótilo se encuentran en
tiene como propósito demarcar su territorio y posesiones. posición horizontal respecto del suelo.
Después de un tiempo se observa que en la semilla A
3. Aprendizaje por asociación. el hipocótilo y la raíz continúan elongándose sin variar
su dirección. En la semilla B se observa una desviación
Resolver problemas en la dirección del crecimiento de la raíz, que comien-
4. Los animales migran hacia aquellos lugares que les ofrecen za a dirigirse hacia abajo, es decir, a favor de la fuerza
las condiciones favorables para la obtención de alimento y gravitatoria. En el hipocótilo se observa que comienza a
la reproducción, ya que perciben las señales del ambiente dirigirse hacia arriba, es decir, en sentido contrario a la
que les permiten orientarse. fuerza gravitatoria.
d) Conclusiones: se confirma la hipótesis. Independiente-
5. a) Se completa de arriba hacia abajo así: 3, 1 y 2. mente de la posición en que se colocaron las semillas,
b) La luz proviene del lado izquierdo porque las plantas la raíz crece a favor de la fuerza de gravedad, y el hi-
crecen inclinadas hacia allí. pocótilo, en sentido opuesto a esta fuerza. Es decir que
c) Esta respuesta corresponde al fototropismo positivo. las raíces presentan gravitropismo positivo, y los tallos,
d) Los receptores para el estímulo luminoso se encuen- gravitropismo negativo.
tran en el ápice, dado que la planta que tiene su ápice
cubierto es la única que no responde al estímulo. Investigar
e) En respuesta a la captación del estímulo luminoso, me- 10. a) La técnica llamada “confusión sexual” es una forma de
diante receptores ubicados en el ápice, la planta crece control de plagas en la que se esparce feromona sinté-
inclinándose hacia la luz. Si bien el estímulo se capta tica a lo largo de todo el cultivo, de manera que, al llegar
en el ápice, la respuesta se produce más abajo, lo que la época reproductiva, el macho no consiga encontrar a
se evidencia porque la planta que tiene el tallo cubierto su hembra.
presenta menos inclinación que aquella sin cubrir. b) Afecta la comunicación a través de señales químicas.
f) En este tipo de respuesta están involucrados los recep- c) La ventaja de esta técnica es que es más específica y
tores llamados fototropinas y las hormonas auxinas. afecta solamente a la especie que se quiere combatir
g) Se espera que los alumnos reconozcan el gravitropismo en oposición a la fumigación, que resulta nociva para
positivo de las raíces y el gravitropismo negativo de los especies inocuas e incluso beneficiosas para los seres
tallos. También pueden llegar a reconocer que la germi- humanos, como las abejas, además de ser nocivas para
nación de la semilla se debe a una respuesta fotomor- los propios hombres.
11. a) A Pavlov le había llamado la atención de que los perros
© Santillana S.A. Prohibida su fotocopia. Ley 11.723

6. a) Se denominan patrón fijo de acción o FAP. produjeran saliva aun cuando todavía no tenían comida
b) Es innata. Se evidencia porque aun si se las cría en cau- en su boca. Y esto ocurría tanto si olían como si obser-
tiverio la presentan. vaban la comida. Claramente se trataba de la recepción
c) Esto se explica porque las conductas innatas están suje- de un estímulo externo y una respuesta. Pero había algo
tas a variaciones producto del aprendizaje que surge de más: Pavlov observó que los perros también salivaban
la experiencia individual en interacción con el ambiente. si se acercaba a ellos la persona que habitualmente se
ocupaba de alimentarlos. Se preguntaba si se trataba de
Experimentar un comportamiento adquirido o era simple casualidad.
7. Esta respuesta es de elaboración personal, pero se espera b) Para dilucidar este enigma llevó adelante una serie de
que el alumno realice un informe que puede ser semejante experimentos. Se propuso medir la cantidad de saliva
al siguiente: producida cuando se sometía a los perros a diferentes
a) Hipótesis: si coloco dos semillas en diferentes po- estímulos, unos que tuvieran que ver con el instinto, y
siciones en el dispositivo, se podrá observar que, otros, con la experiencia. Entonces, investigó lo que ocu-
­independientemente de la posición que estas tengan, rría cuando se le acercaba alimento al hocico y lo que
sucedía si, antes de esto, se hacía sonar una campana.
La secuencia que empleaba era la siguiente: primero re- ciertas moléculas o iones pueden atravesar la membrana
gistró lo que ocurría cuando a un perro hambriento se le mientras que otros no.
acercaba alimento al hocico. b) El glucocálix, es decir, el conjunto de carbohidratos que
1. Midió la cantidad de saliva que producía el animal y se encuentran casi siempre en su parte externa, unidos
obtuvo valores muy altos. a las proteínas o a los lípidos.
2. Hizo sonar una campana. Esto no parecía conducir c) Se espera que los alumnos indiquen que la bicapa li-
a ninguna respuesta de salivación. pídica es la doble capa de lípidos, mayormente fosfo-
3. Durante un tiempo, siguió alimentando a los perros lípidos y en menor medida colesterol, que forman las
cuando estaban hambrientos pero, antes de hacer- membranas celulares.
lo, hacía sonar la campana. d) Se dice que la membrana plasmática responde a este
4. Después de varias semanas, Pavlov descubrió que, modelo porque los lípidos y las proteínas integrales es-
si hacía sonar la campana pero no mostraba el ali- tán dispuestos en una especie de organización en mo-
mento, los perros igualmente salivaban. saico, y las membranas celulares son estructuras casi
c) Pavlov concluyó que era posible condicionar al animal fluidas, en las que tanto los lípidos como las proteínas
para que asociara el sonido de la campana con la ali- integrales pueden trasladarse dentro de la bicapa.
mentación y forzar así una respuesta de salivación. De e) Se reconocen porque los carbohidratos se encuentran
esta manera, una respuesta que originariamente era principalmente unidos a las proteínas y lípidos que lin-
innata ahora se tornaba aprendida. dan con el exterior de la célula.
d) Las respuestas innatas o instintivas en esta experiencia f) La composición del espacio extracelular difiere del
son salivar, oler u observar el alimento. medio interno de la célula, y esto se relaciona con la
e) La respuesta aprendida es salivar ante el sonido de la función primordial de las membranas plasmáticas de
campana. Se relaciona con un aprendizaje por asociación. mantener la homeostasis celular.
f) Este tipo de conductas no es permanente, y si se deja
de exponer al animal al estímulo (campanada antes de 2. a) Locales. b) Yuxtacrinas. c) Paracrina. d) Autocrina. e) Se-
comer), este termina por perderlo. ñales. f) Endocrinas. g) Diana. h) Inducción. i) Distantes.

3. a) Fagocitosis.
4. La percepción y la respuesta b) Difusión.
c) Difusión facilitada.
a nivel celular d) Endocitosis.

Página 57 4. Hay que señalar: a) bomba de sodio-potasio; b) durabilidad;

Significa que este patrón apareció muy tempranamente en c) endocrina; d) glucocálix; e) desmotúbulo.
el camino evolutivo. Esta universalidad evidencia que este
Resolver problemas
patrón resulta sumamente efectivo para la adaptabilidad
5. a) Cambio de posición.
de las especies.
b) Contracción.
Los organismos unicelulares en la mayoría de los casos
c) Secreción de sustancias.
tienen como medio externo el ambiente en el que viven:
d) Propagación de señales.
como la superficie de la piel, el agua, el suelo, etc. Mientras
e) Síntesis de materiales.
que las células individuales de un organismo pluricelular,
por lo general, tienen como medio externo los líquidos ex-
Leer y escribir en ciencias
tracelulares que las bañan, y las células vecinas.
7. b) Se espera que los alumnos indiquen que la señaliza-
ción es fundamental en la respuesta inmune, ya que
Página 67
involucra diferentes tipos celulares que son reclutados
Ambas uniones se asemejan en que proporcionan canales
mediante este proceso que se inicia con el ingreso del
entre los citoplasmas de células adyacentes y en que son
microorganismo al cuerpo.
c) Se espera que los alumnos subrayen: “fagocitan”; “pro-
Es probable que se trate de estructuras análogas en lugar

© Santillana S.A. Prohibida su fotocopia. Ley 11.723

ducen nuevas señales”; “estimulan la diferenciación”;
de homólogas, dado que si bien tienen semejanzas funcio-
“sintetizan y liberan”.
nales, presentan estructuras extremadamente distintas.
Las interacciones entre células son críticas para el desarro- 8. Muchas células del organismo tienen en su membrana recep-
llo y la función de los organismos pluricelulares. Esta comu- tores que se activan cuando son infectadas, y posibilitan así
nicación permite que los tejidos funcionen de manera coor- ser reconocidas y destruidas por células del sistema inmune.
dinada, facilita la nutrición celular y permite la regulación Este mecanismo se conoce como muerte celular o apoptosis.
del funcionamiento celular, por ejemplo, la regulación de
los ciclos celulares. La proliferación o la muerte celulares, de
esta manera, están sujetas a las necesidades del organismo. 5. El control nervioso
Páginas 70 y 71 en el ser humano
Actividades finales
Recuperar conceptos Página 79
1. a) La permeabilidad selectiva es una propiedad muy impor- a) Las neuronas son las principales células del sistema ner-
tante de las membranas plasmáticas mediante la cual vioso, capaces de transmitir información sobre la base de

su capacidad de excitabilidad. Las células gliales también b) V.
forman parte del sistema nervioso, pero su función es cola- c) V.
borar en la actividad neuronal, para ayudar en la nutrición, d) F. La médula espinal forma parte del sistema nervioso
el sostén y el funcionamiento de las neuronas. central.
b) Tanto las dendritas como el axón son prolongaciones del e) F. El principal efector del sistema nervioso periférico so-
soma neuronal. No obstante, las primeras son más cortas mático es el músculo voluntario.
y abundantes, y la segunda casi siempre es única y más f) V.
larga. Las dendritas captan información aferente, y el axón
la conduce de forma eferente. 4. a) En las sinapsis eléctricas las membranas celulares de
c) El potencial de membrana en reposo consiste en la polaridad ambas neuronas están estrechamente unidas y los io-
que se establece en las cercanías de la membrana de una cé- nes pasan de una a otra a través de poros específicos,
lula, basada en la permeabilidad diferencial de esta a distin- mientras que en las sinapsis químicas la comunicación
tos iones, en especial el Na+ y el K+. El potencial de acción es se establece sobre la base de neurotransmisores que se
la inversión de esa polaridad que se observa ante la llegada vuelcan al espacio sináptico.
de un estímulo a una célula excitable como la neurona. b) En la corteza cerebral hay áreas sensoriales, motoras y
d) La membrana está polarizada en el reposo, mientras que se de asociación.
despolariza por apertura de canales iónicos, ante la llegada c) El período refractario sucede porque, una vez que los
de un estímulo. canales del sodio de una zona estimulada se cierran,
e) Los axones mielinizados poseen una vaina de mielina con- quedan inactivos y no responden a un nuevo estímulo
sistente en las células de Schwann enrolladas sobre el axón, durante unos milisegundos.
cualidad que aumenta la velocidad del impulso nervioso,
mientras que aquellos sin mielina son axones desnudos ca- Resolver problemas
rentes de vaina donde la conducción del impulso nervioso 5. a) El tiempo 0 representa el momento en el que se produ-
es lenta. ce el estímulo.
b) El eje del gráfico que se relaciona con la actividad de
Página 82 canales iónicos en la membrana es el y (Concentración
a) Los tres elementos que proporcionan protección al sistema de iones).
nervioso central son los huesos del cráneo y la columna c) No. La permeabilidad al ion Na+ aumenta temporaria-
vertebral, las meninges y el líquido cefalorraquídeo. mente antes que la permeabilidad al ion K+ y es de ma-
b) Los efectos postsinápticos dependen del tipo de neuro- yor magnitud. Puede deberse a que los canales para uno
transmisor que libere la neurona presináptica, ya sea de y otro ion tienen propiedades diferentes que hace que
tipo inhibitorio o excitatorio. respondan de modo distinto a la llegada del estímulo.
c) La sustancia gris contiene fundamentalmente somas neu- Unos canales, por ejemplo, son más lentos que otros
ronales, y la sustancia blanca está compuesta por axones. para abrirse o cerrarse.
d) El aumento de la permeabilidad al Na+ permite el in-
Página 90 greso de iones Na+ desde el compartimiento extrace-
Actividades finales lular hacia el interior de la neurona, despolarizando la
Recuperar conceptos membrana que se hallaba en reposo; un aumento pos-
1. Partes principales de una neurona: terior en el tiempo de la permeabilidad al K+ permite
Cuerpo celular o soma: interviene en la producción de que estos iones escapen de la neurona, lo que facilita
sustancias y en la coordinación de funciones vitales. El el descenso del potencial de membrana hasta nueva-
retículo endoplasmático rugoso forma los cuerpos de mente los valores del reposo, y repolariza la membrana
Nissl. plasmática de la célula excitable.
Dendritas: son prolongaciones ramificadas del cuerpo
celular, por lo general cortas, a través de las cuales las Página 91
neuronas reciben información de otras neuronas. Leer y escribir en ciencias
Axón: es una ramificación por lo general mucho más 6. Los estudiantes deberán redactar un texto que abarque
delgada y larga que las dendritas, a través de la cual se los siguientes conceptos: las neurociencias son áreas de
© Santillana S.A. Prohibida su fotocopia. Ley 11.723

transmite información de una neurona a la siguiente, o las ciencias biológicas que se abocan a explicar la estruc-
hacia los músculos o las glándulas. tura y la función del sistema nervioso, sobre la base del
Vaina de mielina, formada por las células de Schwann, estudio de los aspectos moleculares y celulares hasta las
que agiliza la transmisión del impulso nervioso. Los interacciones que se establecen entre sus diferentes com-
nódulos de Ranvier son interrupciones de la vaina de ponentes. Se usa por ejemplo para explicar los fenómenos
mielina. complejos que ofrece la conducta, en especial la humana.
Hay que marcar a), c) y d).
7. Subrayado doble: ideas principales; subrayado simple:
2. El esquema se completa, de izquierda a derecha y de arriba ideas secundarias.
hacia abajo, así: encéfalo / médula / sensoriales / nervioso Una familia de drogas muy interesante afecta en forma relativa-
somático / nervioso autónomo. mente exclusiva el funcionamiento del cerebro, los psicofármacos.
Estas drogas afectan la “psique”, es decir, los estados de la mente.
3. a) F. Los cuerpos de Nissl consisten en retículo endoplas- Las Investigaciones científicas que se desarrollaron durante los
mático rugoso, muy abundante en las neuronas. últimos 30 a 40 años permitieron conocer que la gran mayoría

de los psicofármacos actúa a nivel de la sinapsis. Uno de los me- ejecuta funciones complejas, como la memoria, el aprendi-
canismos por el cual estos fármacos actúan es la interacción con zaje y la comunicación.
los receptores de los neurotransmisores: por su similitud química
con estos, son reconocidos por los receptores de las membranas Páginas 104 y 105
postsinápticas para actuar a este nivel. Actividades finales
Un ejemplo muy estudiado del primero de estos mecanismos de Recuperar conceptos
acción es el de la nicotina. Esta sustancia química, producto na- 1. Primate (de arriba hacia abajo): encéfalo; ganglios; médula
tural de la planta Nicotiana tabacum, imita la acción de la ace- espinal; nervios.
tilcolina en sus receptores del sistema nervioso central, lo que se Insecto: a la izquierda, cerebro; a la derecha, cordón nervio-
traduce en cambios conductuales al aumentar la actividad de las so; abajo, ganglios.
neuronas de ciertas zonas del cerebro. Similar mecanismo utiliza
la morfina, que se extrae de Papaver somniferum. Este poderoso 2. a) V.
analgésico es reconocido por los receptores del sistema nervioso b) V.
central que actúan en la modulación del dolor. Ambos son ejem- c) F. En los invertebrados, el sistema nervioso se ubica en
plos de psicofármacos que remedan la acción de los neurotrans- la región ventral, y en los vertebrados, tiene localiza-
misores, activando sus receptores. Existen otros psicofármacos ción dorsal.
que inhiben la acción de los neurotransmisores. Un ejemplo es d) F. Los plexos nerviosos están presentes en animales
la estricnina, que inhibe la acción del neurotransmisor GABA y simples y también en algunas regiones del sistema ner-
provoca una excitación que se observa como convulsiones. vioso de animales complejos.
3. a) Las esponjas no poseen un sistema nervioso definido,
pero tienen células capaces de reaccionar ante los estí-
8. Para el tratamiento de la enfermedad de Parkinson, que es
una enfermedad neurodegenerativa donde se lesionan las
b) El cerebelo es una estructura del encéfalo de los verte-
neuronas de algunas regiones del encéfalo, se experimentó
brados que permite que el animal se oriente en el espa-
con trasplantes de neuronas embrionarias. Un trozo de te-
cio, por eso está más desarrollado en los animales que
jido del encéfalo embrionario o una suspensión de células
nerviosas embrionarias se introduce en la zona del encéfalo
c) El desarrollo del encéfalo está muy vinculado a la evolu-
del receptor. Las células trasplantadas reemplazan las des-
ción de los organismos, ya que por ser un órgano que in-
truidas y emiten axones hacia las zonas blanco de las neu-
tegra información sensorial y elabora respuestas, tendrá
ronas que reemplazan, estableciendo sinapsis funcionales.
mucha vinculación con el equilibrio entre el animal y el
medio, y la capacidad que desarrolle para responder a
9. El actor de Superman sufrió una lesión medular alta que lo
los cambios, lo que le permitirá su adaptación al medio.
llevó a presentar una parálisis total desde el cuello hasta
d) Las áreas cerebrales se especializan según funciones,
la parte inferior del cuerpo, por la que incluso necesitó un
para realizar diversas tareas en un cerebro complejo.
respirador artificial, debido a la inmovilidad del diafragma.
Las hay sensoriales, motoras y de integración.

6. El control nervioso en los 4. a) Porque estos animales se defienden de sus predadores
y se alimentan casi exclusivamente en función del re-
animales gistro de sustancias químicas a su alrededor en un me-
dio acuoso bastante homogéneo.
Página 97 b) A medida que otros grupos de animales conquistan
a) Los cefalópodos presentan un ganglio cerebral o cerebro medios más diversos –por ejemplo, los reptiles, el am-
protegido por una cubierta cartilaginosa. biente terrestre–, estarán expuestos a más estímulos.
b) La cefalización constituyó una ventaja adaptativa para los Por lo tanto, necesitarán aumentar el procesamiento de
animales, ya que posibilitó una mejor detección de las presas estos.
para alimentarse, por concentrar los órganos sensoriales prin- c) El cuerpo estriado de las aves y la corteza cerebral de
cipales, el centro integrador y la boca en espacios cercanos. los mamíferos son similares, en tanto son los órganos

© Santillana S.A. Prohibida su fotocopia. Ley 11.723

c) En los animales con cerebro complejo, como moluscos, que concentran las funciones más complejas de estos
artrópodos y vertebrados, hay áreas específicas que se grupos de organismos.
ocupan de llevar a cabo determinadas funciones, como el d) Esperaríamos encontrar un número mayor de neuronas
disparo de patrones de conducta específicos o el procesa- en los animales más complejos, porque el sistema ner-
miento de estímulos de diferentes modalidades sensoria- vioso se complejiza en estos grupos.
les, o áreas motoras determinadas. e) El texto y el gráfico tienen un contenido similar, ya que
ambos muestran los cambios que el encéfalo de los
Página 99 animales va experimentando conforme se avanza en la
a) La cefalización consiste en la concentración de cuerpos escala evolutiva, con adaptaciones a las funciones prin-
neuronales en la región anterior del cuerpo de un animal, cipales que desarrolla cada tipo de animal.
mientras que la encefalización se refiere al desarrollo de un
­sistema nervioso complejo con la adquisición de un encéfalo
Resolver problemas
con diferentes porciones encargadas de funciones distintas.
5. Se completa de arriba hacia abajo con: redes de neuronas;
b) Mientras que el cerebelo es la parte del encéfalo con fun-
ganglios; anélidos; cerebro; moluscos; vertebrados.
ciones en el equilibrio y la postura del cuerpo, el cerebro

Leer y escribir en ciencias Página 114
6. Se espera que los alumnos indiquen que en la cabeza de Las secreciones de la hipófisis están controladas por el hipo-
los santa teresa hay células que se especializan en un com- tálamo, centro de control de la homeostasis del sistema ner-
portamiento de apareamiento, lo que ha servido para la vioso central, que recibe señales del interior y el exterior del
supervivencia de la especie, aunque va en detrimento del organismo, las integra y responde con la secreción de neu-
individuo. Es probable que las células del ganglio cerebral rohormonas, que influyen en la producción de hormonas de
de este insecto sean inhibitorias de este comportamiento, la hipófisis anterior, o bien son almacenadas en la hipófisis
que se expresa a partir de la decapitación. posterior. Por medio de ellas el hipotálamo regula la acción
de la hipófisis, que, mediante sus secreciones, actúa sobre
Investigar diversos órganos blanco.
8. Los estudiantes podrán buscar información como la de
esta tabla, y quizás se sorprendan por el valor de EQ para Páginas 122 y 123
los delfines. Recuperarán los conceptos de relatividad del Actividades finales
tamaño cerebral y la dimensión corporal. Recuperar conceptos
Especies EQ 1. Timo ‡ produce hormonas relacionadas con la defensa
del organismo; suprarrenal ‡ secreta hormonas en situa-
Ser humano 7,4-7,8
ciones de estrés; páncreas ‡ produce y libera hormonas
Delfín mular 4,14 que regulan la glucemia; paratiroides ‡ secreta hormonas
Mono capuchino 2,8-3,1 relacionadas con el metabolismo del calcio; tiroides ‡ pro-
Orca 2,57-3,3 duce hormonas que estimulan el crecimiento de los tejidos
y el desarrollo del sistema nervioso; hipófisis ‡ glándula
Chimpancé 2,2-2,5
maestra con funciones diversas; gónadas ‡ libera hormo-
Macaco Rhesus 2,1 nas que intervienen en la función reproductiva.
Perro 1,2
2. El esquema debe presentar los siguientes ítems: Nivel bajo
Elefante 1,13-2,36
de glucosa en la sangre. ‡ Detección pancreática y libera-
Gato 1 ción de glucagón. ‡ Incremento de glucosa en la sangre. ‡
Caballo 0,9 Detección pancreática y liberación de insulina.
Oveja 0,8
3. a) V.
Ratón 0,5
b) F. Sin insulina, la glucosa no puede ingresar en las célu-
Rata 0,4 las.
Conejo 0,4 c) V.
d) F. La neurohipófisis almacena las secreciones hormo-
Cachalote 0,28
nales que se producen en el hipotálamo.

4. a) Glándulas endocrinas: tiroides - paratiroides - supra-

rrenales - páncreas - hígado - timo.
7. E
 l control endocrino b) Características de la unión hormona-receptor: encaje
inducido - saturabilidad - segundos mensajeros - rever-
en el ser humano sibilidad.
c) Acciones en las que están involucradas las hormonas
Página 109 tiroideas: temperatura - hipoglucemia - crecimiento -
La línea de tiempo debe contener: antiguos egipcios: cuer- desarrollo - cretinismo.
po coordinado; siglo v a.C.: Hipócrates / humores; siglo ii d) Hormonas involucradas en la reproducción: hormona
d.C.: Sorano de Efeso / reproducción; siglo iii d.C.: Galeno / luteinizante - progesterona - glucagón - estrógeno -
medicina y humores; 1849: Berthold / sustancias mensaje- hormona foliculoestimulante.
ras; 1850: Addison / corteza suprarrenal; 1901: Takamine /
© Santillana S.A. Prohibida su fotocopia. Ley 11.723

adrenalina; 1902: concepto de hormona. 5. a) La función del sistema reproductor femenino está regu-
lada por las hormonas hipofisarias FSH y LH en coordi-
Página 111 nación con las hormonas ováricas estrógeno y proges-
a) Las glándulas exocrinas no producen mensajeros quími- terona.
cos, vuelcan sus secreciones al exterior. b) Existen varias hormonas para el control de la glucemia:
b) Las hormonas hidrófilas no pueden atravesar la membrana la insulina, el glucagón, la somatostatina de forma indi-
y tendrán receptores en la superficie celular, mientras que recta y al menos otras cuatro más no mencionadas en
las lipídicas o hidrófobas podrán interactuar con recepto- el texto, como la adrenalina, el cortisol, la hormona de
res intracelulares en el citoplasma o el núcleo. crecimiento y el lactógeno placentario en el embarazo.
c) Cuando una hormona se une a un receptor específico, se c) El sistema nervioso y el endocrino están interrelaciona-
inicia una cascada de eventos en la que intervienen mo- dos, ya que las secreciones de las glándulas endocrinas
léculas mensajeras intracelulares denominadas segundos están controladas por la acción directa o indirecta del
mensajeros, que activan una serie de reacciones químicas sistema nervioso, y de esta manera regulan los proce-
que conducen al efecto final en la célula blanco. sos internos y mantienen la homeostasis.

6. a) Retroalimentación o feedback. comiencen sus actividades sin un aporte apropiado de nu-
b) La retroalimentación negativa es el caso más difundido, trientes y energía. La ocasión permite proponer un cambio
y se produce cuando, al aumentar los niveles de una de actitud hacia conductas alimenticias más saludables.
hormona por encima de un valor determinado, la pro-
pia hormona inhibe su secreción por parte de la glán-
dula que la genera.
c) La TSH es una hormona hipofisaria que estimula la se- 8. La respuesta hormonal en los
creción de tiroxina por la glándula tiroides. Cuando los animales y las plantas
niveles de tiroxina en sangre son altos, se inhibe la pro-
ducción de TSH por la hipófisis. Página 129
La aplicación de la hormona juvenil evitará que los insec-
Resolver problemas tos se desarrollen a la etapa adulta y, por lo tanto, alcancen
7. Los receptores de la insulina y el glucagón estarán en la su faz reproductiva; esto disminuirá su número y controla-
membrana de sus células blanco, porque son hormonas pro- rá las plagas.
teicas, por lo que no atraviesan la membrana plasmática. Si una feromona interviene en la reproducción, podría uti-
lizarse para regular la tasa reproductiva de una especie.
8. Al comienzo de la maratón el deportista tiene glucosa en
su sangre, por lo que la hormona A podría ser la insulina. Página 130
Cuando la glucosa disponible comienza a agotarse, dismi- a) Las hormonas tiroideas promueven la metamorfosis en los
nuye la insulina y comienza a secretarse la hormona B, que anfibios.
puede ser el glucagón, para que se encuentre disponible b) El camuflaje que se observa en algunos animales para la
más glucosa para el gasto. defensa contra los predadores está controlado por la hor-
mona estimulante de melanocitos, que modifica la distri-
Investigar bución del pigmento melanina en las células de la piel.
11. La manera de diagnosticar la diabetes es la realización c) La vasotocina es una hormona que se ha demostrado que
­periódica de un análisis de sangre donde se evalúe la glu- está involucrada en la osmorregulación de todos los verte-
cemia en ayunas. Existe un valor estimativo normal en brados no mamíferos.
ayunas, que es de 70 a 110 mg de glucosa por cada 100
ml de sangre. Si este valor supera los 140 mg % en por lo Páginas 136 y 137
menos tres oportunidades, se considera que la persona Actividades finales
es diabética. Si los valores se encuentran entre 110 y 140 Recuperar conceptos
mg %, es posible realizar un segundo tipo de diagnóstico, 1. a) Las hormonas son mensajeros químicos intracelula-
la curva de tolerancia a la glucosa, que consiste en medir res que ejercen sus efectos en tejidos o células blanco
los valores de glucosa en sangre a través del tiempo (dos del mismo individuo, mientras que las feromonas son
horas), luego de ingerir una mezcla de agua con abun- mensajeros químicos entre individuos.
dante glucosa. Si la persona es diabética, hay una demora b) Las neurohormonas son secretadas por células nervio-
importante en restablecer los valores de glucemia origi- sas, mientras que las hormonas son producidas por cé-
nales. lulas endocrinas.
c) La ecdisona es la hormona de la muda que favorece
12. Están compuestos por hormonas, de la familia de los es- el crecimiento y la aparición de las características del
trógenos y de la progesterona. El principal mecanismo de adulto, mientras que la hormona juvenil mantiene los
acción de los anticonceptivos orales es la inhibición de la estadios típicos de las formas juveniles.
ovulación (suprimen la liberación de las gonatrofinas).
2. Los cambios necesarios están resaltados en negrita:
Opinar La metamorfosis de los invertebrados es el proceso por
13. La actividad propone un debate de opiniones acerca de la el cual el individuo atraviesa una secuencia de estadios
­juveniles que se suceden desde el estado larval hasta el
© Santillana S.A. Prohibida su fotocopia. Ley 11.723
importancia de mantener conductas alimenticias saluda-
bles que permitan que los sistemas de control del cuerpo organismo adulto. En algunos casos, estos cambios son
puedan funcionar de manera apropiada. El examen sorpre- graduales, y en otros hay un estadio intermedio entre la
sa como situación de estrés propició la secreción de hor- larva y el adulto, llamado pupa. Hay dos hormonas que
monas como la adrenalina, que favorece el consumo de ­posibilitan la metamorfosis: la hormona juvenil, que man-
glucosa como fuente de energía, lo que demandó de ma- tiene al individuo en la forma inmadura, y la ecdisona,
nera adicional al organismo de la joven. En este caso, el que favorece el crecimiento.
sistema de control de la glucemia falló, y permitió que los La hormona protoracicotrofina (PTTH) se produce en una
valores de glucosa en sangre cayeran por debajo de los ne- región del cerebro y ejerce su acción en la glándula pro-
cesarios para mantener el sistema nervioso activo; debido torácica, que secreta ecdisona. La ecdisona activa la pro-
a ello la estudiante se sintió obnubilada. Seguramente, si ducción de una nueva cutícula, mientras la vieja se digiere.
hubiera desayunado de forma adecuada, no habría tenido El paso del individuo del estadio juvenil al estadio adulto
esos síntomas. La reflexión debe conducir a detectar que es depende de la ausencia de la hormona juvenil que se pro-
muy habitual que los adolescentes descuiden el desayuno y duce en células nerviosas.

3. 7. Se espera que los alumnos indiquen que las auxinas se sin-
Auxinas Intervienen en el crecimiento de raíces y tetizan en el extremo del tallo y se distribuyen alejándose
tallos. del extremo, inhibiendo el desarrollo de las yemas axilares.
Median la respuesta del fototropismo y el Cuando el extremo del tallo se corta, se suprime la inhibi-
geotropismo. ción de las auxinas y las yemas axilares se desarrollan.
Participan en el desarrollo de los frutos y
en la diferenciación de los tejidos de con-
8. La neotenia es un estadio de metamorfosis incompleta que
permite que los individuos se reproduzcan sin perder carac-
Citocininas Retrasan el envejecimiento y la caída de teres juveniles. El ejemplo clásico de la neotenia es el axolo-
las hojas. te (reptil) causado por un déficit de hormonas tiroideas.
Promueven el crecimiento de las yemas
laterales y estimulan el desarrollo de los
frutos. 9. Las proteínas
Giberelinas Promueven el alargamiento del tallo.
Ponen en disponibilidad las reservas ali- Página 146
menticias de las semillas para el creci- Cada nivel estructural le confiere una característica a la pro-
miento embrionario. teína relacionada con la función. La estructura primaria le
confiere la identidad a la proteína y determina la estructura
Resolver problemas tridimensional que adoptará la proteína y, en consecuencia, su
4. a) En ausencia de la hormona no se reabsorbe agua; en función. Las estructuras secundarias y terciarias son niveles
presencia de la hormona solo los anfibios reabsorben de plegamiento cada vez más complejos que se relacionan di-
agua. rectamente con la función que cumplirán en el organismo. La
b) La hormona estudiada tiene efecto en la osmorregula- estructura cuaternaria es mucho más compleja y está presente
ción en anfibios pero no en peces. solo en algunas proteínas con funciones muy especiales.
c) Es posible que la osmorregulación en peces esté bajo
control hormonal, pero que la responsable sea otra hor-
Páginas 154 y 155
Actividades finales
Recuperar conceptos
5. a) Los valores del eje de las y se pueden haber determina- Proteínas Clasificación funcional
do pesando las plántulas de tabaco. Albúmina Nutritiva o reserva
b) Se puede concluir que la combinación de hormonas au-
Hemoglobina Transporte
xinas y cinetina determina el crecimiento de las plán-
tulas de tabaco. Mioglobina Estructural
c) Puede deberse a una interacción de ambas hormonas. Colágeno Estructural
Pepsina Enzimática
Leer y escribir en ciencias
6. Ideas principales, subrayado doble; secundarias, subrayado Miosina Estructural
simple. Insulina Hormonal
Tanto para la economía como para la producción de alimentos, los Lipoproteína Transporte
peces son importantes. De allí que se haya desarrollado la acui-
Caseína Nutritiva o reserva
cultura, dedicada a la cría y el manejo de los recursos acuáticos
vivientes en un medio ambiente restringido, como un estanque o Glucagón Hormonal
una porción controlada de un cuerpo de agua natural. La mayoría Fibrina Inmunitaria o defensa
de las especies de peces no madura sexualmente de forma normal
en cautiverio, en especial cuando las variables ambientales que 2. Porque las proteínas son compuestos formados por la repe-
determinan el desarrollo de gónadas y la maduración de gametos tición de unidades similares (monómeros), unidos entre sí
están alteradas. Por eso, en la acuicultura resulta necesario acele-
© Santillana S.A. Prohibida su fotocopia. Ley 11.723

como una cadena. Sus monómeros son los aminoácidos.

rar o retrasar la maduración, a fin de sincronizar la producción de
gametos de machos y hembras, adelantar o desfasar el desarrollo 3.
embrionario y la producción de individuos juveniles, o facilitar Átomo de
Átomo de hidrógeno
cruzamientos entre individuos de especies distintas que difieren
en tiempos de maduración.
Para inducir la maduración sexual se utilizan en acuicultura va- H O
rias técnicas, desde el uso de preparaciones con gonadotrofinas de
otros animales, el empleo de compuestos que estimulan la síntesis
y la liberación de las gonadotrofinas propias, hasta la aplicación H N C C O H
de compuestos bioactivos sintéticos, análogos a hormonas de pe-
ces. A medida que avance el conocimiento de los aspectos endocri- H Grupo ácido
Grupo R
nológicos que regulan la reproducción de organismos acuáticos, o carboxilo
se perfeccionarán los métodos para promover la maduración de El grupo R es variable en
especies en cautiverio, incluyendo peces, moluscos y crustáceos. cada tipo de aminoácido

4. a) V. Estos aminoácidos no pueden ser sintetizados por el ­ ompletar esta investigación con las leyes y las normas re-
organismo. lacionadas. La celiaquía es una enfermedad hereditaria y
b) V. El grupo radical es el que cambia entre un aminoáci- autoinmune en la que el intestino delgado resulta dañado
do y otro. El R define la identidad y las propiedades de debido a la intolerancia al gluten, proteína que se encuen-
ese aminoácido. tra en el trigo, la avena, la cebada y el centeno, cuyo princi-
c) F. El enlace peptídico se forma por la unión del grupo car- pal componente es la gliadina. Esto afecta la capacidad del
boxilo de un aminoácido con el grupo amino del otro. intestino para absorber los nutrientes de forma adecuada.
d) F. Cuando un polipéptido contiene más de cincuenta Una de las causas es la falta de enzimas digestivas capaces
unidades de aminoácidos, se denomina proteína. de degradar las proteínas del gluten.
e) V. Un oligopéptido es un péptido que contiene hasta 20
unidades de aminoácidos. Opinar
15. La idea es que los alumnos investiguen sobre los alimen-
5. b) < c) < d) < a) tos (de origen animal y vegetal) que aportan proteínas, que
analicen su dieta, que reconozcan los trastornos produci-
6. La reacción que se observa en el esquema es la unión de dos por la falta de proteínas en el organismo y cómo deben
dos sustancias para producir otra nueva mediante la ac- complementar aquellos alimentos de origen animal con
ción de una enzima. En A se observa cómo los dos sustra- los de origen vegetal si desean realizar una alimentación
tos se unen al sitio activo de la enzima. En B se aprecia la ­vegetariana.
manera en que se ha producido una sustancia nueva por
combinación de los sustratos (producto).

Resolver problemas 10. El ADN

7. Presentan distintas propiedades y funciones porque su se-
cuencia de aminoácidos (estructura primaria) es diferente. Página 160
No solo influye el tipo de aminoácidos que forma a la pro- No podría mantener constante la información genética que se
teína sino también el orden en que están dispuestos, ya traspasa a cada célula hija.
que esto determinará sus estructuras secundarias y tercia-
rias, y en consecuencia su función. Página 167
La idea es que los alumnos vinculen en un párrafo los tres tér-
8. a) Especificidad de especie. minos, de modo que expliquen que las mutaciones son una de
b) Especificidad de función. las causas de la evolución, ya que aportan los cambios nece-
c) Desnaturalización. sarios en los genes para que exista variabilidad genética y la
existencia de distintas especies.
9. a) Peróxido de hidrógeno (o agua oxigenada).
b) Agua y oxígeno. Páginas 170 y 171
Actividades finales
Experimentar Recuperar conceptos
10. Lo que observarán es la desnaturalización de la proteína 1. a) gen; b) nucleótidos; c) transcripción; d) ribosoma; e) cro-
del huevo (ovoalbúmina) por la acción de un medio ácido. mosoma; f) traducción.
La clara del huevo se irá “cocinando” y se pondrá blanca
y sólida. Esta experiencia puede completarse proponiendo 2. a) i. ADN: núcleo (ADN nuclear) o mitocondria (ADN mi-
que los alumnos diseñen otras experiencias que comprue- tocondrial).
ben la acción de otros agentes sobre las proteínas, como la   ii. ARN mensajero: se produce en el núcleo pero sale
agitación, el calor, el frío, el medio alcalino, etcétera. al citoplasma para la traducción.
 iii. ARN de transferencia: se encuentra en el citoplas-
11. La catalasa de la papa actuará sobre su sustrato (agua oxi- ma, ya que es allí donde se realiza el proceso de
genada), que producirá oxígeno gaseoso que se evidencia- traducción de ARN a proteínas.
rá por el desprendimiento de burbujas. Sería interesante b) i. Replicación: núcleo.

© Santillana S.A. Prohibida su fotocopia. Ley 11.723

plantear que los alumnos tomen el tiempo y diseñen algún   ii. Transcripción: núcleo.
ensayo para ver cómo la temperatura, el pH, la luz, la can-  iii. Traducción: citoplasma.
tidad de enzima o sustrato, o ambos, etc., influyen en esta
reacción enzimática. 3.
Estructura Cadena doble Cadena simple
13. a) y b) La pepsina actúa en el estómago. Es más activa con Azúcar Desoxirribosa Ribosa
un pH de entre 2 y 3, y se desactiva con un pH superior Base nitroge- Citosina, guanina, Citosina, guanina,
a 5. La tripsina actúa en el duodeno (intestino delgado) nada adenina y timina adenina y uracilo
y su pH óptimo es 8.

14. Se espera que los alumnos realicen un trabajo de inves- 4. Porque el lenguaje en nucleótidos es el mismo para todos los
tigación, no solo del trastorno en sí, sino también de la seres vivos. Así, por ejemplo, el codón que codifica para un
incidencia y la prevalencia en nuestro país. Es interesante determinado aminoácido lo hace en cualquier organismo.

5. El ADN mitocondrial, a diferencia del ADN nuclear, no pre- aminoácidos en un codón stop que indique la finaliza-
senta regiones inactivas (intergénicas). El ADN nuclear se ción de la traducción y produzca una proteína más corta.
encuentra en los cromosomas (núcleo), mientras que el
mitocondrial está en la matriz de las mitocondrias (cito- Leer y escribir en ciencias
plasma). Por otro lado, el ADN mitocondrial, a diferencia 11. La idea es que los alumnos vean esta investigación con ojos
del nuclear, solo se transmite por vía materna, ya que es el de científico y puedan analizar las variables utilizadas, el
óvulo el que aporta las mitocondrias. material de experimentación y las conclusiones abordadas
La importancia del ADN mitocondrial es que, como codifica por los científicos. Además, se aporta un nuevo concepto:
una cantidad limitada de proteínas, permite hacer estudios epigenética, que se relaciona con el tema dado y es de gran
de mayor precisión. De este modo, es posible utilizarlo para actualidad científica.
realizar pruebas de identidad muy eficientes cuando falta
ADN nuclear o para establecer la identidad de hijos cuyos Investigar
padres han fallecido. 12. El ozono de la atmósfera se comporta como un filtro de
los rayos ultravioletas (UV). El adelgazamiento de la capa
Resolver problemas de ozono provoca que la superficie terrestre se encuentre
6. paso: las hebras de ADN se separan por acción de las expuesta a niveles cada vez mayores de rayos UV-B (que
enzimas helicasa y topoisomerasa. son los de más alta energía). Estos rayos tienen efectos be-
AT TCGCATGA ACGCTAGGA ATCATGA néficos (promover la síntesis de vitamina D), pero también
TA AGCGTACT TGCGATCCT TAGTACT nocivos, como generar mutaciones no deseadas vinculadas
2.o  paso: cada hebra sirve de molde para la síntesis de una con enfermedades como el cáncer de piel, etcétera.
cadena complementaria por medio de la ADN polimerasa.
AAGCGTACTTGCGATCCTTAGTAC 13. El docente debe porpiciar que cada alumno pueda elaborar
AAGCGTACTTGCGATCCTTAGTAC una opinión crítica y reflexiva sobre los temas y comparta
TTCGCATGAACGCTAGGAATCATG esa opinión con sus compañeros. paso: quedan formadas las dos nuevas cadenas de ADN.
b) La función de las helicasas es romper los puentes de
11. La biotecnología
hidrógeno que existen entre las bases nitrogenadas, y
Página 179
las topoisomerasas van rotando la molécula. La ADN
Para que se pueda producir la transgénesis, es decir, la trans-
polimerasa reconoce la hebra de ADN y va uniendo
ferencia de ADN de una especie a otra, es necesario que exista
los nucleótidos complementarios a cada una de las
un mismo código de transcripción y de traducción, y esto es
cadenas de ADN molde.
posible gracias a la universalidad del código genético.
c) Es semiconservativa porque cada una de las nue-
vas cadenas de doble hélice contiene una hebra del
Páginas 184 y 185
ADN original y otra hebra nueva.
Actividades finales
Recuperar conceptos
7. La idea es que elijan cualquiera de las hebras molde y
1. a) Fermentación: tradicional.
transcriban el ARNm que corresponda colocando los nu-
b) Plásmidos: moderna.
cleótidos complementarios.
c) Ingeniería genética: moderna.
Luego deberán dividir la hebra formada en grupos de tres
d) Yogur: tradicional.
nucleótidos (tripletes o codones) y buscar en la tabla del có-
e) Cultivo celular: moderna.
digo genético a qué aminoácidos corresponde cada triplete
f) Penicilina: tradicional.
para traducir el ARNm a proteína. Por ejemplo:
TTCGCATGAACGCTAGGAATCATG (ADN) 2. El importante hallazgo que determinó un cambio en la bio-
AAGCGUACUUGCGAUCCUUAGUAC (ARNm) tecnología fue el descubrimiento de la estructura del ADN.
© Santillana S.A. Prohibida su fotocopia. Ley 11.723

Lis  -  Arg  -  Treo  -  Cis  -  Ác. asp  -  Pro  -  Stop  -  Tir 4. a) Plásmidos: transportan (vectores) los fragmentos de
ADN insertados (gen de interés) para incorporarlos
8. La idea es que los alumnos expliquen cómo se complemen- dentro de las células.
tan estos tres ARN para lograr la síntesis proteica. b) Enzimas de restricción: cortan el ADN en lugares espe-
cíficos para insertar un fragmento de otro ADN.
9. a) Se espera que los alumnos cambien algún nucleótido c) Enzima ligasa: une nuevamente dos fragmentos de ADN.
pero que esta alteración no modifique el aminoácido,
es decir, que se forme un codón que codifique para el Resolver problemas
mismo aminoácido. 5. a) El factor esencial para que sea posible utilizar insuli-
b) La idea es que se cambie algún nucleótido que modifi- nas de vacas y cerdos en seres humanos es que estas
que el aminoácido, es decir, que se forme un codón que proteínas son muy similares en su estructura y tienen
codifique para otro aminoácido. idéntica función.
c) Se espera que los alumnos cambien un nucleótido que b) Las ventajas son que la insulina obtenida es huma-
transforme alguno de los codones que codifican para na y no de otra especie (que a veces podía provocar

r­ eacciones alérgicas), que es más segura y menos cos- 5.° Finalmente los plantines se cultivan en la tierra y
tosa, y se puede producir en grandes cantidades y con se obtiene una planta transgénica con la resistencia
gran pureza. adquirida al insecto.
b) La obtención es más compleja porque, además de in-
6. a) La idea es que confeccionen un diagrama o esquema sertar el gen de interés, es necesario asegurar que esté
que incluya los siguientes pasos: presente en todas sus células. Además, los organismos
1.° Se extraen los plásmidos y se les inserta el gen de la pluricelulares ocupan más espacio y su desarrollo es
somatotrofina. más lento.
2.° Se introducen estos plásmidos dentro de las bacte- c) Es inmune a la acción dañina de las larvas del insec-
rias, para que el ADN recombinante se transcriba a to que perjudica un gran porcentaje de cultivos en la
un ARNm, que se traducirá en la proteína de interés. ­Argentina.
3.° Se incuban las bacterias. d) Podría ocurrir un desequilibrio en la diversidad, ya que
4.° Al multiplicarse se generan copias del gen insertado competiría con otras plantas que son atacadas por
y se obtienen de este modo grandes cantidades de la el insecto y que podrían desaparecer; además podría
proteína de interés. ­afectar a aquellos animales que se alimentan de estas
5.° Posteriormente se extraen todas las proteínas for- plantas o de esos insectos. También puede ponerse en
madas de las células bacterianas, entre ellas la so- duda si se afecta o no la calidad nutricional, las carac-
matotrofina humana recombinante. terísticas y el sabor del alimento.
Finalmente se purifica la hormona sintetizada en las
bacterias, que es idéntica a la producida por el páncreas 8. a) Para darle importancia al aspecto ético-social de la técnica
humano. del ADN recombinante se espera que los alumnos elijan
b) Porque la resistencia a los antibióticos permite seleccio- la definición: “El ADN recombinante es muy i­mportante
nar solo aquellas que tienen el plásmido insertado. Las porque permite hacer individuos transgénicos”, ya que
que no tienen el plásmido con la proteína de interés no esta definición no incluye aspectos ­metodológicos como
sobrevivirán en un medio con antibiótico. las otras opciones, sino los resultados de estas técnicas
c) Ventajas: se reproducen con rapidez, son fáciles de que pueden tener impacto en la sociedad.
cultivar y de modificar genéticamente, poseen un alto La menos propicia es: “El ADN recombinante es muy
rendimiento de producción a un bajo costo, se almace- importante porque es diferente del ARN”, ya que no tie-
nan en grandes cantidades. Desventajas: solo pueden ne ninguna importancia social y es simplemente una
utilizarse para proteínas pequeñas que no requieran explicación teórica de su estructura.
modificaciones luego de su síntesis.
9. a) La idea es que los alumnos sean capaces de explicar
7. a) 1.° Se inserta el gen de interés en la bacteria. que la transgénesis es muy útil cuando se requiere la
2.° La bacteria se pone en contacto con las células de la generación de especies animales con características es-
planta y, en condiciones reguladas, se transfiere el peciales de gran importancia productiva.
gen de la bacteria a la célula vegetal. b) El objetivo es que la modificación introducida en un
3.° Se obtienen las células vegetales transformadas (con individuo animal se transmita a su descendencia y, de
el gen de interés insertado en su genoma). este modo, se logre una nueva línea con esas caracterís-
4.° Las células vegetales transformadas se colocan en un ticas especiales.
medio de cultivo adecuado. En él se regeneran y se
desarrollan hasta obtener los plantines transgénicos.

© Santillana S.A. Prohibida su fotocopia. Ley 11.723

Recursos para el docente

Biología 3
El intercambio de información en los sistemas
biólógicos: relación, integración y control

ES año