Neurobiology of Aging 33 (2012) 837.e7– 836.

e13
www.elsevier.com/locate/neuaging

VCP mutations in familial and sporadic amyotrophic lateral sclerosis

Max Koppersa,b, Marka M. van Blitterswijka, Lotte Vlama, Paulina A. Rowickaa,
Paul W.J. van Vughta, Ewout J.N. Groena,b, Wim G.M. Splietc, JooYeon Engelen-Leec,
Helenius J. Schelhaasd, Marianne de Vissere, Anneke J. van der Kooie, W-Ludo van der Pola,
R. Jeroen Pasterkampb, Jan H. Veldinka,1, Leonard H. van den Berga,1,*
a
Department of Neurology, Rudolf Magnus Institute of Neuroscience, University Medical Center Utrecht, Utrecht, The Netherlands
b
Department of Neuroscience and Pharmacology, Rudolf Magnus Institute of Neuroscience, University Medical Center Utrecht, Utrecht, The
Netherlands
c
Department of Pathology, University Medical Center Utrecht, Utrecht, The Netherlands
d
Department of Neurology/Clinical Neurophysiology, Donders Institute for Brain, Centre for Neuroscience, Radboud University Nijmegen Medical
Center, Nijmegen, The Netherlands
e
Department of Neurology, Amsterdam Medical Center, Amsterdam, The Netherlands
Received 30 August 2011; accepted 4 October 2011

Abstract

Mutations in the valosin-containing protein (VCP) gene were recently reported to be the cause of 1%–2% of familial amyotrophic lateral
sclerosis (ALS) cases. VCP mutations are known to cause inclusion body myopathy (IBM) with Paget’s disease (PDB) and frontotemporal
dementia (FTD). The presence of VCP mutations in patients with sporadic ALS, sporadic ALS-FTD, and progressive muscular atrophy
(PMA), a known clinical mimic of inclusion body myopathy, is not known. To determine the identity and frequency of VCP mutations we
screened a cohort of 93 familial ALS, 754 sporadic ALS, 58 sporadic ALS-FTD, and 264 progressive muscular atrophy patients for
mutations in the VCP gene. Two nonsynonymous mutations were detected; 1 known mutation (p.R159H) in a patient with familial ALS
with several family members suffering from FTD, and 1 mutation (p.I114V) in a patient with sporadic ALS. Conservation analysis and
protein prediction software indicate the p.I114V mutation to be a rare benign polymorphism. VCP mutations are a rare cause of familial
ALS. The role of VCP mutations in sporadic ALS, if present, appears limited.
© 2012 Elsevier Inc. All rights reserved.

Keywords: Amyotrophic lateral sclerosis; Motor neuron disease; Valosin-containing protein; Genetics; Mutations

1. Introduction Mendelian pattern of inheritance while the remaining 95%

Amyotrophic lateral sclerosis (ALS) is a progressive
adult-onset neurodegenerative disease that affects upper and
lower motor neurons. This will eventually cause death
mostly due to respiratory failure within 3 to 5 years after
disease onset. ALS is familial (fALS) in 5% of cases with a
* Corresponding author at: Department of Neurology, Rudolf Magnus
Institute of Neuroscience, University Medical Center Utrecht, Heidelber-
glaan 100, 3584 CX Utrecht, The Netherlands. Tel.: ⫹31 88 7557978; fax:
⫹31 88 7552100.
E-mail address: l.h.vandenberg@umcutrecht.nl (L.H. van den Berg).
1
Shared last authorship.
are considered to be sporadic ALS (sALS) cases. Several
genes have been linked to fALS including superoxide dis-
mutase 1 (SOD1), TAR-DNA binding protein (TARDBP,
also known as TDP-43), fused in sarcoma (FUS), optineurin
(OPTN), and vesicle-associated membrane protein B (VAPB)
with variable frequencies depending on the geographical loca-
tion of the investigated patient samples (Dejesus-Hernandez et
al., 2011; Deng et al., 2011; Groen et al., 2010; Nishimura et
al., 2004; Renton et al., 2011; Sreedharan et al., 2008; van
Blitterswijk et al., 2011; van Es et al., 2010).
There is a recognized clinical and pathological overlap
between ALS and frontotemporal dementia (FTD). Mild

0197-4580/$ – see front matter © 2012 Elsevier Inc. All rights reserved.
doi:10.1016/j.neurobiolaging.2011.10.006
837.e8 M. Koppers et al. / Neurobiology of Aging 33 (2012) 837.e7– 836.e13
cognitive abnormalities indicative of frontal lobe involve-
ment can be found in up to 50% of ALS patients (Elamin et
al., 2011). In addition, in approximately 5% of ALS pa-
tients, FTD is present with marked behavioral changes and
language impairment (Murphy et al., 2007; Phukan et al.,
2007; Ringholz et al., 2005). Finally, several families have
been identified with individuals diagnosed with ALS, FTD,
or both and ALS and FTD are both characterized by TDP-
43-positive, ubiquitinated cytoplasmatic inclusions (Morita
et al., 2006; Neumann et al., 2006; Vance et al., 2006).
In a recent study, mutations in the valosin-containing
protein (VCP) gene were identified in 5 ALS families by
whole exome sequencing (Johnson et al., 2010). VCP mu-
tations are known to cause inclusion body myopathy (IBM)
with Paget’s disease of bone (PDB) and frontotemporal
dementia (IBMPFD) (Watts et al., 2004). IBMPFD is an
autosomal dominant multisystem degenerative disease, pri-
marily affecting muscle, brain, and bone tissue. Interest-
ingly, just as in ALS and FTD, IBMPFD is characterized by
TDP-43-positive, ubiquitinated inclusions in muscle and
frontal cortex neurons (Neumann et al., 2007; Weihl et al.,
2008).
It is not known whether VCP mutations are present in
other populations or large samples of sporadic ALS patients
or families where (sporadic) ALS and FTD co-occur (sALS-
FTD). To determine the frequency of VCP mutations in the
Dutch population, we screened 93 fALS patients and a large
cohort of sALS and sALS-FTD patients for mutations in the
VCP gene. In addition, we included patients with progres-
sive muscular atrophy (PMA), because PMA is a known
clinical mimic of IBM (Dabby et al., 2001).
2. Methods
2.1. Human subjects
DNA samples were collected as part of a population-
based study in The Netherlands (Prospective ALS study in
the Netherlands [PAN]; Huisman et al., 2011). Patients were
diagnosed with possible, probable, or definite ALS accord-
Table 1
Primers used to sequence coding region of the VCP gene
Exon Forward
a
1 GAGAATTCCAATCCGTCGAG
2_3a GCTTTCTGGTCTAGGGACAGC
4 AAGCCATCCTGCCTTTTCTT
5 TGACACCTCTAACTGTGCTTG
6 TATTCTTGCCTTCTCCTTTC
7 AGGTGGGAACCTAATCACAC
8_9 GGCCAAACAAGCAAGATAAC
10a AGGCCTGTCTCTTACCTCTG
11_12 CTATTGTCTCTGAGCCTCCTG
13 ATGTGGAGGTAGCCTTGAAC
14 CACGTTTGCCTAGAGACATC
15 TCGAGAGGAGAGGCTAAATG
16_17 CTTACCTCAGGTTGGATTGG
a
Long-range polymerase chain reaction (PCR) enzyme (Fermentas) was used for the amplification of these amplicons.
ing to the revised El Escorial criteria (Brooks et al., 2000).
A total of 93 fALS patients from 80 unrelated families were
included in this study. In addition, 754 sALS patients, 264
PMA patients, and 58 sALS-FTD patients were included.
Patients with mutations in SOD1, VAPB, TARDBP, FUS,
and ANG were excluded. The control population consisted
of 713 healthy Dutch individuals with negative medical and
family histories for neurological disease; all were of Dutch
descent.
Patient material was obtained with approval of the Insti-
tutional Review Board, and all participants gave informed
consent.
2.2. Genetic analysis
Venous blood samples were drawn using 10 mL ethyl-
enediaminetetraacetic acid (EDTA) tubes and genomic
DNA was extracted from whole blood using standard pro-
cedures. DNA was whole genome amplified using a Qiagen
Repli-g Mini kit (Qiagen, Hilden, Germany) according to
manufacturer’s instructions using 50 ng of input genomic
DNA per reaction.
Polymerase chain reaction (PCR) for the coding se-
quence of VCP was performed using a touchdown thermo-
cycling program (94 °C for 60 seconds; 15 cycles of 94 °C
for 20 seconds, 65 °C for 30 seconds with a decrement of
0.5 °C per cycle, 72 °C for 60 seconds; followed by 30
cycles of 94 °C for 20 seconds, 57 °C for 30 seconds, 72 °C
for 60 seconds; and 72 °C for 180 seconds). PCR reactions
consisted of 5 ␮L amplified DNA (5 ng/␮L), 0.2 ␮M of
each primer, 200 ␮M of each dinucleotide triphosphate
(dNTP), 25 mM Tricine, 7.0% glycerol (wt/vol), 1.6% di-
methyl sulfoxide (DMSO, wt/vol), 2 mM MgCl2, 85 mM
ammonium acetate pH 8.7, and 0.04 U Taq polymerase in a
total volume of 10 ␮L. Primers were designed using Primer
3.0 (frodo.wi.mit.edu/primer3/) and sequences are listed in
Table 1. PCR products were checked on a 1.2% agarose gel
and diluted in 25 ␮L H20; 1 ␮L was directly used as
template for the sequencing reactions. Sequencing reac-
tions, containing 0.1 ␮L BigDye (v3.1; Applied Biosys-
Reverse
TCCTGGTCTCCACCTCTCTG
CAAGAACTTGGTCCTGCCTG
AATAAATACAGGGGAAAAGCATAA
GTTACCACATGATGCCACAC
TTGGCACCACTTTAGACTTG
CAGCTCATAAGCCCAGTTC
GGCTTCAAGAGGATTAGGTG
AGACACTGTAACGCCTGGTC
AAATGTGTTGACACCCTGAG
AAACAGCCTCTATTCCTTGC
ATGCAAGTCTCCCACAGC
CTGGCTCTCCATGATTGG
TGGCAGTAGTGCCTTGGTTC
 M. Koppers et al. / Neurobiology of Aging 33 (2012) 837.e7– 836.e13 837.e9

tems, Foster City, CA, USA), 1.99 ␮L 2.5 ⫻ dilution buffer
and 0.4 ␮M of the same primer used in the PCR reaction
(either forward or reverse) in a total volume of 5 ␮L, were
performed using cycling conditions as follows: 40 cycles of
94 °C for 10 seconds, 50 °C for 5 seconds, and 60 °C for
120 seconds. Sequencing products were purified by ethanol
precipitation in the presence of 40 mM sodium-acetate and
analyzed on a 96-capillary 3730XL DNA analyzer (Applied
Biosystems), using the standard RapidSeq protocol on 36
cm array (van Boxtel et al., 2008). Sequences were analyzed
for the presence of mutations using PolyPhred and in-house
developed software. All mutations were verified by inde-
pendent PCR and sequence reactions on genomic DNA.
2.3. Bioinformatic analysis
The potential consequence of the identified missense
mutations was analyzed using the bioinformatics programs
PMut (mmb2.pcb.ub.es:8080/PMut/) and SNAP (cubic.
bioc.columbia.edu/services/SNAP/). Conservation analysis
of the altered amino acids was carried out using ClustalW
(www.ebi.ac.uk/Tools/msa/clustalw2/).
3. Results
To determine the frequency of VCP mutations in ALS
patients in the Netherlands, we sequenced all coding exons
of the VCP gene in 93 fALS, 377 sALS, 58 sALS-FTD, and
264 PMA patients as well as 695 healthy controls. Exon 4
and exon 5 were sequenced in 377 additional sALS patients.
One previously identified nonsynonymous mutation and 1
novel nonsynonymous variant were identified (Table 2).
We detected a p.R159H mutation in 1 fALS patient
(Patient A) which was not present in any of the 713 control
subjects sequenced. To further investigate the pathogenicity
of this mutation, we also tested the unaffected brother of the
patient and did not find the mutation. DNA of other family
members was not available. We also identified a novel
nonsynonymous variant mutation (p.I114V) in 1 sALS pa-
tient (Patient B) which was absent in 695 control subjects.
Suggestive evidence that this amino acid change is a rare
neutral polymorphism is found when performing conserva-
tion analysis of the amino acid amongst species and in silico
protein prediction (Fig. 1). No nonsynonymous mutations
were detected in PMA and sALS-FTD patients. In addition
to these 2 nonsynonymous mutations, several synonymous
changes were detected. A total of 6 synonymous changes
were detected in 5 sALS, 1 sALS-FTD, 1 fALS, and 1 PMA
patient (Table 2). Interestingly, 5 of these synonymous
mutations were not found in our control samples. Overall,
there was no significant enrichment of nonsynonymous mu-
tations in ALS versus controls (p ⫽ 0.18, Fisher’s exact
test).
3.1. Clinical information
Patient A gradually developed weakness in her hands
(Table 3). Within a year of onset of symptoms, she also
noticed weakness in her left leg. Neurological examination
demonstrated muscle atrophy in her left arm and both hands,
fasciculations in the left arm, and weakness in proximal arm
and leg muscles. Reflexes in arms and legs were brisk. She
was diagnosed with ALS and died approximately 2 years
after the onset of symptoms. Autopsy of brain and spinal
cord were consistent with classical ALS, characterized by
P62-, ubiquitin-, and TDP-43-positive inclusions. In the
granular layer of the hippocampus and in the neocortex of
the frontal and temporal lobe, a few p62- and ubiquitin-
positive inclusions were found; this can been seen more
extensively in ALS-FTD cases.
The family history of Patient A is shown in Fig. 2. Three
of her father’s brothers were diagnosed with FTD (II: 1, II:
2, II: 3), 1 of them was also diagnosed with multiple scle-
rosis (MS) (II: 3). Her father (II: 6) died due to a car
accident at 31 years of age. The grandmother of Patient A
(father’s side) was not formally diagnosed with FTD, but
she exhibited signs of dementia combined with behavioral
changes. There were no other family members with neuro-
degenerative diseases.
Patient B experienced weakness in her legs, resulting in
difficulties with running and stumbling (Table 2). She also
developed weakness in her arms, and noticed twitching in
both her arms and legs. Neurological examination showed
brisk reflexes in arms and legs. She was diagnosed with
sporadic ALS, because her family history did not reveal
other family members with ALS. Her symptoms gradually
progressed and currently, almost 10 years later, she is un-
able to walk, has severe weakness in her arms, and has

Table 2
Nonsynonymous and synonymous variants detected in the VCP gene in this study
Exon Variant PMut prediction SNAP prediction fALS (n ⫽ 93) sALS PMA sALS-FTD Controls
4 p.I114V Neutral Neutral 0/80 1/754 0/264 0/58 0/695
5 p.R159H Pathological Nonneutral 1/80 0/754 0/264 0/58 0/713
9 p.T330T 0/80 0/377 0/264 1/58 0/685
11 p.L414L 0/80 1/377 1/264 0/58 0/674
12 p.I479I 1/80 0/377 0/264 0/58 0/674
13 p.A528A 0/80 2/377 0/264 0/58 5/662
14 p.L661L 0/80 1/377 0/264 0/58 0/594
Key: fALS, familial amyotrophic lateral sclerosis; FTD, frontotemporal dementia; PMA, progressive muscular atrophy; sALS, sporadic amyotrophic lateral
sclerosis; SNAP, screening for non-acceptable polymorphisms.
837.e10 M. Koppers et al. / Neurobiology of Aging 33 (2012) 837.e7– 836.e13

Figure 1. (A) Chromatograms of wild type and mutant alleles found in 1 familial amyotrophic lateral sclerosis (fALS) (p.R159H) and 1 sALS (p.I144V)
patient. (B) Conservation analysis of the mutated amino acids amongst several species using ClustalW (www.ebi.ac.uk/Tools/msa/clustalw2/).

developed difficulties with talking and breathing. Her
mother died at 82 years of age due to cancer; her father died
at 93 years of age (he had developed dementia, without
behavioral changes).
4. Discussion
In the present study, we screened a large cohort of
patients diagnosed with fALS, sALS, sALS-FTD, and PMA
for mutations in the VCP gene. We report a p.R159H mu-
tation in a familial ALS patient from a family in which
members were diagnosed with FTD. In addition we identi-
fied a novel p.I114V variant in 1 sALS patient which was
not present in 695 control subjects. In a previous study, no
mutations in the VCP gene were identified in 73 sALS
patients screened (Johnson et al., 2010). We could not detect
VCP mutations in ALS patients associated with FTD or in
patients with only lower motor neuron signs.
Mutations in the VCP gene, located on chromosome
9p13.3, have been reported in IBMPFD, a multisystem
degenerative disease affecting brain, bone, and muscle tis-

Table 3
Clinical information on sALS and fALS with VCP variants
Patient Variant Year of birth Gender El Escorial criteria Age at onset (y) Site of onset Duration (mo)
fALS A p.R159H 1948 F Possible 59 Cervical 23a
sALS B p.I114V 1948 F Possible 52 Lumbosacral 119b
Patients are either. a deceased, or b alive.
Key: F, female; fALS, familial amyotrophic lateral sclerosis; sALS, sporadic amyotrophic lateral sclerosis.
 M. Koppers et al. / Neurobiology of Aging 33 (2012) 837.e7– 836.e13
Figure 2. Pedigree of familial amyotrophic lateral sclerosis (fALS) patient
with p.R159H mutation.
sue. Recently, a whole exome sequencing study identified
mutations in the VCP gene to be the cause of ALS in an
Italian family. They identified VCP mutations in an addi-
tional 4 ALS families from the USA and Italy (Johnson et
al., 2010). The p.R159H mutation that was identified in 1 of
our fALS cases has previously been identified in 4 unrelated
IBMPFD families (Haubenberger et al., 2005; Stojkovic et
al., 2009; van der Zee et al., 2009). These families show
clinical heterogeneity between and even within families
with a clinical presentation in patients of FTD, IBM, PDB,
or a combination of these diseases. In 1 family from the
USA a mutation at the same amino acid (p.R159G) was
identified in the recent whole exome sequencing study
(Johnson et al., 2010). Members from this family presented
with ALS, ALS-FTD, or ALS with Paget’s disease. Fur-
thermore, a p.R159C mutation has been reported in a patient
with IBM and FTD (Bersano et al., 2009).
In the other ALS families in which VCP mutations were
identified, individuals within the same family presented
with different diseases. The presence of ALS and FTD in
individuals from the family in which a VCP mutation was
identified here is consistent with these findings.
Thus, mutations in VCP seem to lead to a range of
clinical presentations, even within the same family. This
observation supports the idea that ALS, FTD, and PDB have
an overlapping pathological mechanism. This overlap is
already recognized for ALS and FTD as evidenced by
TDP-43-positive, ubiquitinated cytoplasmatic inclusions
found in both patients (Neumann et al., 2006). An overlap
between ALS and PDB is suggested by a recent Genome-
837.e11
Wide Association Study (GWAS) study where association
was found between the OPTN gene, in which mutations
have been identified in ALS, and PDB (Albagha et al., 2010;
Maruyama et al., 2010; van Blitterswijk et al., 2011).
The pathogenicity of the novel p.I114V variant identified
here in a sALS patient is unknown. Conservation analysis
and protein prediction software do not indicate this mutation
to be pathogenic but rather to be a rare benign polymor-
phism. It is interesting, however, to note that a mutation in
the same exon (p.P137L) has previously been found in 1
IBMPFD case (Stojkovic et al., 2009). Functional studies
are needed to determine the pathogenicity of this variant.
An important pathological feature of ALS is the presence
of TDP-43-positive, ubiquitinated cytoplasmic inclusions
(Neumann et al., 2006). It has been shown that mutations in
the VCP gene led to TDP-43-positive, ubiquitinated cyto-
plasmic inclusions in muscle and frontal cortex neurons of
patients (Watts et al., 2004; Weihl et al., 2008). Moreover,
transgenic mice harboring the p.R155H or p.A232E muta-
tion in VCP contain TDP-43-positive inclusions and reca-
pitulate the brain, bone, and muscle pathology of IBMPFD
(Badadani et al., 2010; Custer et al., 2010; Weihl et al.,
2007).
In summary, based on our data, the frequency of VCP
mutations in familial ALS is approximately 1%–2%, the
same frequency found in the whole exome sequencing study
by Johnson et al. (2010). This study indicates that it is
uncertain whether there are VCP mutations in sporadic
ALS, and, if present, they are extremely rare. We could not
identify a higher frequency of mutation in specific subpopu-
lations of patients with ALS associated with FTD or of
patients with only lower motor neuron signs. Additional
cohorts of fALS and sALS patients will have to be screened
to determine the frequency of VCP mutations in other pop-
ulations.
Disclosure statement
The authors disclose no actual or potential conflicts of
interest.
Patient material used in this study was obtained with
approval of the Institutional Review Board.
Acknowledgements
We thank all patients and healthy volunteers who partic-
ipated in this project as well as the study staff, general
practitioners, and pharmacists. This work has received fund-
ing from the European Community’s Health Seventh
Framework Programme (FP7/2007-2013) under grant
agreement 259867, VSB fonds, EURO-MOTOR FP7, The
Netherlands ALS Foundation (JHV, and LHvdB), Neuro-
science and Cognition Utrecht (NCU), the Prinses Beatrix
Fonds (Kersten Foundation), and the Adessium Foundation
(RJP, JHV, and LHvdB). J.H.V. is supported by the Brain
837.e12 M. Koppers et al. / Neurobiology of Aging 33 (2012) 837.e7– 836.e13
Foundation of The Netherlands and J.H.V, R.J.P., and M.K.
are supported by the Thierry Latran Foundation.
References
Albagha, O.M., Visconti, M.R., Alonso, N., Langston, A.L., Cundy, T.,
Dargie, R., Dunlop, M.G., Fraser, W.D., Hooper, M.J., Isaia, G.,
Nicholson, G.C., del Pino Montes, J., Gonzalez-Sarmiento, R., di
Stefano, M., Tenesa, A., Walsh, J.P., Ralston, S.H., 2010. Genome-
wide association study identifies variants at CSF1, OPTN and
TNFRSF11A as genetic risk factors for Paget’s disease of bone. Nat.
Genet. 42, 520 –524.
Badadani, M., Nalbandian, A., Watts, G.D., Vesa, J., Kitazawa, M., Su, H.,
Tanaja, J., Dec, E., Wallace, D.C., Mukherjee, J., Caiozzo, V., War-
man, M., Kimonis, V.E., 2010. VCP associated inclusion body myop-
athy and Paget disease of bone knock-in mouse model exhibits tissue
pathology typical of human disease. PLoS One 5, e13183.
Bersano, A., Del Bo, R., Lamperti, C., Ghezzi, S., Fagiolari, G., Fortunato,
F., Ballabio, E., Moggio, M., Candelise, L., Galimberti, D., Virgilio, R.,
Lanfranconi, S., Torrente, Y., Carpo, M., Bresolin, N., Comi, G.P.,
Corti, S., 2009. Inclusion body Myopathy and frontotemporal dementia
caused by a novel VCP mutation. Neurobiol. Aging 30, 752–758.
Brooks, B.R., Miller, R.G., Swash, M., Munsat, T.L. World Federation of
Neurology Research Group on Motor Neuron Diseases, 2000. El Es-
corial revisited: revised criteria for the diagnosis of amyotrophic lateral
sclerosis. Amyotroph. Lateral Scler. Other Mot. Neuron Disord. 1,
293–299.
Custer, S.K., Neumann, M., Lu, H., Wright, A.C., Taylor, J.P., 2010.
Transgenic mice expressing mutant forms VCP/p97 recapitulate the
full spectrum of IBMPFD including degeneration in muscle, brain and
bone. Hum. Mol. Genet. 19, 1741–1755.
Dabby, R., Lange, D.J., Trojaborg, W., Hays, A.P., Lovelace, R.E., Bran-
nagan, T.H., Rowland, L.P., 2001. Inclusion body myositis mimicking
motor neuron disease. Arch. Neurol. 58, 1253–1256.
Elamin, M., Phukan, J., Bede, P., Jordan, N., Byrne, S., Pender, N.,
Hardiman, O., 2011. Executive dysfunction is a negative prognostic
indicator in patients with ALS without dementia. Neurology 76, 1263–
1269.
Groen, E.J., van Es, M.A., van Vught, P.W., Spliet, W.G., van Engelen-
Lee, J., de Visser, M., Wokke, J.H., Schelhaas, H.J., Ophoff, R.A.,
Fumoto, K., Pasterkamp, R.J., Dooijes, D., Cuppen, E., Veldink, J.H.,
van den Berg, L.H., 2010. FUS mutations in familial amyotrophic
lateral sclerosis in the Netherlands. Arch. Neurol. 67, 224 –230.
Haubenberger, D., Bittner, R.E., Rauch-Shorny, S., Zimprich, F., Mannhal-
ter, C., Wagner, L., Mineva, I., Vass, K., Auff, E., Zimprich, A., 2005.
Inclusion body Myopathy and Paget disease is linked to a novel
mutation in the VCP gene. Neurology 65, 1304 –1305.
Huisman, M.H., de Jong, S.W., van Doormaal, P.T., Weinreich, S.S.,
Schelhaas, H.J., van der Kooi, A.J., de Visser, M., Veldink, J.H., van
den Berg, L.H., 2011. Population based epidemiology of amyotrophic
lateral sclerosis using capture-recapture methodology. J. Neurol. Neu-
rosurg. Psychiatry 82, 1165–1170.
Johnson, J.O., Mandrioli, J., Benatar, M., Abramzon, Y., van Deerlin,
V.M., Trojanowski, J.Q., Gibbs, J.R., Brunetti, M., Gronka, S., Wuu, J.,
Ding, J., McCluskey, L., Martinez-Lage, M., Falcone, D., Hernandez,
D.G., Arepalli, S., Chong, S., Schymick, J.C., Rothstein, J., Landi, F.,
Wang, Y.D., Calvo, A., Mora, G., Sabatelli, M., Monsurrò, M.R.,
Battistini, S., Salvi, F., Spataro, R., Sola, P., Borghero, G., ITALSGEN
Consortium, Galassi, G., Scholz, S.W., Taylor, J.P., Restagno, G.,
Chiò, A., Traynor, B.J., 2010. Exome sequencing reveals VCP muta-
tions as a cause of familial ALS. Neuron 68, 857– 864.
Maruyama, H., Morino, H., Ito, H., Izumi, Y., Kato, H., Watanabe, Y.,
Kinoshita, Y., Kamada, M., Nodera, H., Suzuki, H., Komure, O.,
Matsuura, S., Kobatake, K., Morimoto, N., Abe, K., Suzuki, N., Aoki,
M., Kawata, A., Hirai, T., Kato, T., Ogasawara, K., Hirano, A., Ta-
kumi, T., Kusaka, H., Hagiwara, K., Kaji, R., Kawakami, H., 2010.
Mutations of optineurin in amyotrophic lateral sclerosis. Nature 465,
223–226.
Morita, M., Al-Chalabi, A., Andersen, P.M., Hosler, B., Sapp, P., Englund,
E., Mitchell, J.E., Habgood, J.J., de Belleroche, J., Xi, J., Jongjaroen-
prasert, W., Horvitz, H.R., Gunnarsson, L.G., Brown, R.H., Jr., 2006.
A locus on chromosome 9p confers susceptibility to ALS and fronto-
temporal dementia. Neurology 66, 839 – 844.
Murphy, J.M., Henry, R.G., Langmore, S., Kramer, J.H., Miller, B.L.,
Lomen-Hoerth, C., 2007. Continuum of frontal lobe impairment in
amyotrophic lateral sclerosis. Arch. Neurol. 64, 530 –534.
Neumann, M., Mackenzie, I.R., Cairns, N.J., Boyer, P.J., Markesbery,
W.R., Smith, C.D., Taylor, J.P., Kretzschmar, H.A., Kimonis, V.E.,
Forman, M.S., 2007. TDP-43 in the ubiquitin pathology of frontotem-
poral dementia with VCP gene mutations. J. Neuropathol. Exp. Neurol.
66, 152–157.
Neumann, M., Sampathu, D.M., Kwong, L.K., Truax, A.C., Micsenyi,
M.C., Chou, T.T., Bruce, J., Schuck, T., Grossman, M., Clark, C.M.,
McCluskey, L.F., Miller, B.L., Masliah, E., Mackenzie, I.R., Feldman,
H., Feiden, W., Kretzschmar, H.A., Trojanowski, J.Q., Lee, V.M.,
2006. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and
amyotrophic lateral sclerosis. Science 314, 130 –133.
Nishimura, A.L., Mitne-Neto, M., Silva, H.C., Richieri-Costa, A., Middle-
ton, S., Cascio, D., Kok, F., Oliveira, J.R., Gillingwater, T., Webb, J.,
Skehel, P., Zatz, M., 2004. A mutation in the vesicle-trafficking protein
VAPB causes late-onset spinal muscular atrophy and amyotrophic
lateral sclerosis. Am. J. Hum. Genet. 75, 822– 831.
Phukan, J., Pender, N.P., Hardiman, O., 2007. Cognitive impairment in
amyotrophic lateral sclerosis. Lancet Neurol. 6, 994 –1003.
Ringholz, G.M., Appel, S.H., Bradshaw, M., Cooke, N.A., Mosnik, D.M.,
Schulz, P.E., 2005. Prevalence and patterns of cognitive impairment in
sporadic ALS. Neurology 65, 586 –590.
Sreedharan, J., Blair, I.P., Tripathi, V.B., Hu, X., Vance, C., Rogelj, B.,
Ackerley, S., Durnall, J.C., Williams, K.L., Buratti, E., Baralle, F., de
Belleroche, J., Mitchell, J.D., Leigh, P.N., Al-Chalabi, A., Miller, C.C.,
Nicholson, G., Shaw, C.E., 2008. TDP-43 mutations in familial and
sporadic amyotrophic lateral sclerosis. Science 319, 1668 –1672.
Stojkovic, T., Hammouda, elH., Richard, P., López de Munain, A., Ruiz-
Martinez, J., Camaño, P., Laforêt, P.C., Pénnison-Besnier, I., Ferrer,
X., Lacour, A., Lacomblez, L., Claeys, K.G., Maurage, C.A., Fardeau,
M., Eymard, B., 2009. Clinical outcome in 19 French and Spanish
patients with valosin-containing protein Myopathy associated with
Paget’s disease of bone and frontotemporal dementia. Neuromuscul.
Disord. 19, 316 –323.
van Blitterswijk, M., van Vught, P.W., van Es, M.A., Schelhaas, H.J., van
der Kooi, A.J., de Visser, M., van den Berg, L.H., 2011. Novel op-
tineurin mutations in sporadic amyotrophic lateral sclerosis patients.
Neurobiol. Aging. doi: 10.1016/j.neurobiolaging.2011.05.019.
van Boxtel, R., Toonen, P.W., Verheul, M., van Roekel, H.S., Nijman, I.J.,
Guryev, V., Cuppen, E., 2008. Improved generation of rat gene knock-
outs by target-selected mutagenesis in mismatch repair-deficient ani-
mals. BMC Genomics 9, 460.
van der Zee, J., Pirici, D., van Langenhove, T., Vandenberghe, R., Hoffman,
M., Pusswald, G., van den Broeck, M., Peeters, K., Mattheijssens, M.,
Martin, J.J., de Deyn, P.P., Cruts, M., Haubenberger, D., Kumar-Singh, S.,
Zimprich, A., van Broeckhoven, C., 2009. Clinical heterogeneity in 3
unrelated families linked to VCP p.Arg159His. Neurology 73, 626 – 632.
van Es, M.A., Dahlberg, C., Birve, A., Veldink, J.H., van den Berg, L.H.,
Andersen, P.M., 2010. Large-scale SOD1 mutation screening provides
evidence for genetic heterogeneity in amyotrophic lateral sclerosis.
J. Neurol. Neurosurg. Psychiatry 81, 562–566.
Vance, C., Al-Chalabi, A., Ruddy, D., Smith, B.N., Hu, X., Sreedharan, J.,
Siddique, T., Schelhaas, H.J., Kusters, B., Troost, D., Baas, F., de Jong,
V., Shaw, C.E., 2006. Familial amyotrophic lateral sclerosis with fron-
totemporal dementia is linked to a locus on chromosome 9p13.2-21.3.
Brain 129, 868 – 876.
 M. Koppers et al. / Neurobiology of Aging 33 (2012) 837.e7– 836.e13 837.e13

Watts, G.D., Wymer, J., Kovach, M.J., Mehta, S.G., Mumm, S., Darvish,
D., Pestronk, A., Whyte, M.P., Kimonis, V.E., 2004. Inclusion body
Myopathy associated with Paget disease of bone and frontotemporal
dementia is caused by mutant valosin-containing protein. Nat. Genet.
36, 377–381.
Weihl, C.C., Miller, S.E., Hanson, P.I., Pestronk, A., 2007. Transgenic
expression of inclusion body myopathy associated mutant p97/VCP
causes weakness and ubiquitinated protein inclusions in mice. Hum.
Mol. Genet. 16, 919 –928.
Weihl, C.C., Temiz, P., Miller, S.E., Watts, G., Smith, C., Forman, M.,
Hanson, P.I., Kimonis, V., Pestronk, A., 2008. TDP-43 accumulation in
inclusion body myopathy muscle suggests a common pathogenic mech-
anism with frontotemporal dementia. J. Neurol. Neurosurg., Psychiatry
79, 1186 –1189.