Sie sind auf Seite 1von 40

Capítulo 1

As Bases Moleculares
da Hereditariedade

1.1 Generalidades 8 1.7 Funções do DNA 23


1.7.1 O DNA tem função autoduplicadora 23
1.2 O genoma, o DNA e os genes 9 1.7.2 DNA comanda a síntese de proteínas 27
1.7.2.1 Síntese proteica 28
1.3 Ácidos nucleicos 9
1.7.2.2 Tradução: mRNA → cadeia
1.3.1 Estrutura química 9
polipeptídica 32
1.3.2 Estrutura molecular 12
1.8 Regulação gênica 35
1.4 O código genético 15
1.8.1 Regulação gênica em procariotos 35
1.5 DNA: nuclear e mitocondrial 16 1.8.2 Regulação gênica em eucariotos 36
1.5.1 DNA nuclear 16 1.8.2.1 Regulação do remodelamento da
cromatina 38
1.5.1.1 Tipos de sequências 17
1.8.2.2 Regulação da transcrição 38
1.5.2 DNA mitocondrial (mtDNA) 19
1.8.2.3 Regulação pós-transcricional 39
1.6 RNA: tipos 21 1.8.2.4 Regulação da tradução 41
1.6.1 RNA heterogêneo nuclear, pré-RNA 1.8.2.5 Regulação pós-traducional 42
mensageiro, RNA primário ou transcrito
primário 21
1.6.2 RNA mensageiro 21
1.6.3 RNA transportador ou RNA de
transferência 23
1.6.4 RNA ribossômico 23
1.6.5 Outros RNAs 23

Borges-Osorio_01.indd 7 29/01/13 13:35


Genética Humana 8

Caso clínico
Francisco, 22 anos, era um eletricista que gostava muito particularidades, e o impacto no organismo exercido pe-
de sair com seus amigos para beber cerveja nos fins de las mutações mitocondriais que porventura ocorram. A
semana. Sempre teve boa visão, mas há algumas sema- disfunção mitocondrial parece estar envolvida na maioria
nas percebeu que ela se tornou embaçada, e as cores dos das principais doenças conhecidas, como diabetes tipo
fios elétricos com que trabalhava pareciam mais esmaeci- II, aterosclerose, câncer e doenças neurodegenerativas
das do que de costume. Como o problema não melhorou, (doenças de Alzheimer, Huntington e Parkinson) e psi-
Francisco consultou um oftalmologista, que, durante o quiátricas (esquizofrenia e transtornos bipolares), além
exame, percebeu alterações na retina do jovem: tumefação de suscitar até uma hipótese para o envelhecimento, com
de disco (pseudoedema da camada de fibras nervosas da base no acúmulo progressivo de mutações no mtDNA e
retina) e aumento da tortuosidade dos vasos sanguíneos perda associada da função mitocondrial.
retinianos. Gradualmente, sua visão central foi piorando,
As doenças mitocondriais humanas mostram grande
e o eletricista teve de abandonar seu emprego. Sua mãe,
variabilidade nos seus quadros clínicos devido à grande
Terezinha, era uma mulher sadia de 49 anos, com dois ir-
quantidade de mutações no DNA mitocondrial. Os ór-
mãos: Antônio, 54 anos, que tinha cegueira decorrente de
gãos com alta demanda energética são, em geral, os mais
atrofia óptica, diagnosticada desde os 28 anos, e Dora, 50
afetados: cérebro, coração, músculos esqueléticos, olhos,
anos, que até sua quarta década de vida não apresentara
orelhas, pâncreas e rins. Além disso, a interação entre os
problemas visuais, mas vinha perdendo lentamente sua vi-
genes mitocondriais e os nucleares pode sofrer distúrbios
são central. Além disso, em um recente exame minucioso,
variados. A LHON (OMIM 535000) resulta do funciona-
Dora descobriu que tem um ritmo cardíaco raro que talvez
mento inadequado das mitocôndrias, já tendo sido asso-
pudesse estar relacionado a seus problemas oculares. O
ciadas a essa doença 18 mutações pontuais, entre as quais
oftalmologista aconselhou Francisco a procurar uma clí-
cinco têm um efeito suficientemente grave para causá-la.
nica de genética, para obtenção de diagnóstico e prognós-
A maioria dos casos, pelo menos em pessoas de origem
tico exatos, uma vez que o jovem deseja saber também se
europeia, é causada pelas mutações G11778A (substi-
seus filhos terão risco de ser afetados como ele. Na história
tuição de G por A no nucleotídeo 11778 do gene ND4),
familiar do probando, consta que seus avós maternos já
G3460A (troca de G por A no gene ND1) e T14484C (tro-
faleceram; o avô aos 68 anos, por doença cardíaca corona-
ca de T por C no gene ND6), que causam problemas no
riana, e a avó aos 77 anos, por câncer de mama. O pai e a
complexo I (NADH-desidrogenase) do sistema de fosfori-
irmã de Francisco, bem como o casal de filhos de Antônio e
lação oxidativa, a via final da respiração celular. Em geral,
a filha de Dora, não apresentam problemas visuais.
são testadas essas três mutações específicas, mas, se ne-
A natureza dos problemas oculares, o avanço rápido nhuma estiver presente, é necessária uma pesquisa mais
dos sintomas nos homens afetados, o início mais tardio e ampla, inclusive sequenciamento parcial do mtDNA. Os
doença mais moderada em Dora, que também apresenta indivíduos podem ser homoplásmicos (moléculas idênti-
problemas de ritmo cardíaco, levaram o geneticista con- cas de mtDNA) ou heteroplásmicos (moléculas diferentes
sultado por Francisco a sugerir que sua condição poderia de mtDNA) para as mutações mitocondriais, por isso a
ser a neuropatia óptica hereditária de Leber (LHON), que testagem completa de mutações inclui a verificação das
apresenta amplo espectro de sintomas e início variável. quantidades relativas de mitocôndrias normais e mutan-
Essa doença é causada por uma mutação no DNA mito- tes, pois a proporção de células heteroplásmicas aumenta
condrial (mtDNA). Se esse tipo de herança for confirma- com a idade. O resultado mostrou que Francisco era ho-
do, Francisco e sua namorada poderão tranquilizar-se moplásmico para a mutação G3460A, confirmando assim
quanto a sua prole, uma vez que o homem não transmite o diagnóstico de LHON. Nesse caso, sua prole não será
seu DNA mitocondrial aos filhos. afetada, uma vez que a transmissão das mitocôndrias é
realizada somente por intermédio do gameta feminino.
Por outro lado, toda a prole de uma mulher afetada (p.
Comentário ex., Dora, tia de Francisco) poderá ser também afetada,
A escolha desse caso clínico ressalta a necessidade de se ainda que as condições mitocondriais sejam muito variá-
conhecer a existência do genoma mitocondrial, com suas veis em uma mesma família.

pluricelulares, essas células podem apresentar-se nos


1.1 Generalidades mais variados tipos.
Todo ser vivo é constituído de células, nas quais está De acordo com sua organização celular, os seres vi-
situado o material hereditário. O número de células de vos são geralmente classificados em dois grupos: proca-
um organismo pode variar de uma (como nas bactérias) riotos e eucariotos, cujas características constam na
a muitos milhões (como nos humanos). Nos organismos Tabela 1.1.

Borges-Osorio_01.indd 8 29/01/13 13:35


9 As Bases Moleculares da Hereditariedade
Tabela 1.1 Caracterização de procariotos e eucariotos
Características Procariotos Eucariotos

Núcleo Não Sim


Membrana nuclear Não Sim
“Corpo nucleoide” Sim Não
Material genético DNA, RNA DNA
Cromossomos visíveis na divisão celular Não Sim
Ribossomos Sim Sim
Outras organelas Não Sim
Parede celular rígida Sim Não
Exemplos Bactérias, cianobactérias Fungos, protozoários, algas superiores,
vegetais e animais superiores

Na década de 1970, pesquisadores descobriram um rias, sendo essas indicações estendidas posteriormente
tipo de microrganismo até então desconhecido, ao qual aos organismos mais complexos.
denominaram Archaea pelo fato de pensarem que tal-
Os genes são sequências de DNA que contêm a in-
vez pudesse ser o mais antigo tipo de célula existente,
formação para codificar as cadeias polipeptídicas de uma
combinando características dos procariotos e eucario-
proteína, sendo os responsáveis pela transmissão here-
tos, mas exibindo também características próprias. Os
ditária das características de uma geração para outra.
Archaea, inicialmente denominados Archaebactérias,
Tais sequências nem sempre são contínuas, podendo ser
são considerados uma subdivisão dos procariotos, mas
interrompidas por segmentos de DNA não relacionados
colocados em um grupo separado das demais bactérias
com a codificação de uma cadeia polipeptídica específica.
por conta de suas características distintivas: os compo-
nentes de suas membranas e paredes celulares e as dife- Os genes estão organizados em um número relativa-
renças em bases raras encontradas em seus RNAs trans- mente pequeno de cromossomos. O material genético de
portadores e em estruturas diferentes nas subunidades cada cromossomo consiste em uma fita muito longa de
da RNA-polimerase. Devido às diferenças moleculares DNA, contendo muitos genes em uma ordem linear, em-
que esses microrganismos apresentam em relação às bora nem sempre contínua.
demais bactérias, alguns cientistas tendem a chamá-los
O conceito de gene modificou-se ao longo do tem-
preferencialmente de Archaea, colocando-os em um
po; atualmente, o gene é definido como o segmento
subgrupo à parte dos procariotos.
de DNA que codifica uma cadeia polipeptídica
e inclui regiões flanqueadoras que antecedem
(sequência-líder) e que seguem (cauda) a região
codificadora, bem como sequências que não são
1.2 O genoma, o DNA e traduzidas (íntrons) e que se intercalam com as
os genes sequências codificadoras individuais (éxons).

O genoma contém o conjunto completo de informações


hereditárias de qualquer organismo, consistindo em uma
longa sequência de um ácido nucleico, denominado ácido
desoxirribonucleico, ou DNA, composto de nucleotídeos
1.3 Ácidos nucleicos
formados por bases nitrogenadas, açúcar e fosfato. O
grande desenvolvimento dos estudos dos genomas de vá-
1.3.1 Estrutura química
rios organismos levou à criação de um termo específico: a A estrutura química dos ácidos nucleicos é simples e não
genômica, que será tratada no Capítulo 18. varia entre os diversos organismos.
O DNA constitui a sequência de subunidades indi- Esses ácidos nucleicos são constituídos de sequên-
viduais, denominadas genes pelo biólogo dinamarquês cias de nucleotídeos. Cada nucleotídeo é formado por:
Wilhelm Johannsen, em 1909. A função dos genes é ar-
ƒ uma base nitrogenada, que pode ser uma purina
mazenar e codificar as informações genéticas que serão
(adenina ou guanina) ou uma pirimidina (timina
utilizadas para a produção das cadeias polipeptídicas das
ou citosina, no DNA; uracil ou citosina, no RNA);
proteínas que compõem as células, tecidos e órgãos dos
organismos. ƒ um açúcar (pentose: desoxirribose, no DNA; ribose,
no RNA);
Os primeiros indícios de que o DNA é o material he-
reditário surgiram de experiências realizadas com bacté- ƒ um grupo fosfato (PO4).

Borges-Osorio_01.indd 9 29/01/13 13:35


Genética Humana 10

O conjunto de base + açúcar denomina-se nucleo- riável, tanto no DNA quanto no RNA. O DNA encontra-se
sídeo, chamando-se nucleotídeo ao conjunto de base principalmente nos cromossomos; o RNA é encontrado
+ açúcar + fosfato. no nucléolo (estrutura nuclear) e no citoplasma, havendo
muito pouco nos cromossomos.
De acordo com a pentose que apresentam, os ácidos
nucleicos são de dois tipos: DNA (ácido desoxirribonu- Na Figura 1.1 estão representadas as estruturas quí-
cleico), que contém desoxirribose, e RNA (ácido ri- micas dos componentes dos nucleotídeos (bases nitrogena-
bonucleico), que contém ribose. Neste último não há das, açúcares e grupo fosfato); a Figura 1.2 apresenta as
timina, e sim uracil. O grupo fosfato apresenta-se inva- estruturas química e molecular de uma sequência de DNA.

A NH2 O O
Figura 1.1
N H3C C C
Representação esquemá- C NH HC NH
C C
tica das estruturas quí- N
micas dos componentes HC C
CH HC C HC
dos nucleotídeos, bem C N O N O
adenina N N timina H H uracil
como de um nucleotídeo, H
mostrando as ligações
entre esses componen-
tes. A – Bases nitroge- NH2
O
nadas (purinas: adenina
N C C
e guanina; pirimidinas: C HC N
NH
timina, citosina e uracil).
HC C
B – Grupo fosfato (mo- C C HC
NH2 O
nofosfato, difosfato e guanina N N citosina N
H
trifosfato). C – Açúcares H
(desoxirribose e ribose). PURINAS PIRIMIDINAS
D – Nucleotídeo.
Fonte: Azevedo e Astolfi B
Filho.1
O
D NUCLEOTÍDEO BASE
O P O R MONOFOSFATO
NH2
O
FOSFATO
N
O O
O

O P O P O R DIFOSFATO N O
O P O CH2
O
O O O H H
H H
O O O
OH H
O P O P O P O R TRIFOSFATO

O O O AÇÚCAR

O O
CH2OH OH CH2OH OH

H H

OH H OH OH

DESOXIRRIBOSE RIBOSE

Borges-Osorio_01.indd 10 29/01/13 13:35


11 As Bases Moleculares da Hereditariedade
A CH
3 H
O O H
H O N
P N
T
O O N N H H
N A
O
CH2 N
O N
5’ H 3’
H2C
O
H O O
O O H
H N H O P
P N
C O O
O O N N H N G H
O
CH2 N
H N N
O
H
H2C
O
O O
O O CH
H 3
P
P H N N H O H
T O O
O O
O N A N H N N
CH2
N
O
H H2C
O
O O
O O H
H P
P H N O H N H
O O
C
O O
O N G N H N N
CH2
N
3’ N H O H2C 5’
H O
OH O O
P
O O

HO C H OH
5’ O

C H H C
4’ 1’

H C C H
3’ 2’

OH H

Figura 1.2
Representação esquemática das estruturas química e molecular do DNA e de seus nucleotídeos. A – Seg-
mento de uma fita dupla de DNA, mostrando alguns pares de nucleotídeos adjacentes e considerando a lo-
calização dos carbonos 5' e 3' no açúcar (desoxirribose); pode ser notada a orientação oposta das fitas, por
isso denominadas antiparalelas. A fita da esquerda corre da direção 5' (acima) para a direção 3' (abaixo), a
fita da direita corre em direção oposta: de 5' (abaixo) para 3' (acima). Pode-se observar também a estrutura
química dos componentes da molécula de DNA, bem como o pareamento entre as bases nitrogenadas ade-
nina (A) e timina (T), ligadas por duas pontes de hidrogênio, e entre as bases nitrogenadas guanina (G) e
citosina (C), ligadas por três pontes de hidrogênio. B – Numeração dos carbonos do açúcar (desoxirribose)
na estrutura açúcar-fosfato da molécula de DNA.
2
Fonte: Lewis.

Borges-Osorio_01.indd 11 29/01/13 13:35


Genética Humana 12

1.3.2 Estrutura molecular 5'-ATGCGTCAG-3'

Além das diferenças em sua composição química, o DNA 3'-TACGCAGTC-5'


e o RNA mostram diversidade quanto à sua estrutura mo- A relação G+C/A+T é igual em todos os indivíduos
lecular. da mesma espécie, mas varia de uma espécie para outra.
É necessário que o DNA tenha uma estrutura sufi- A estrutura molecular do DNA apresenta uma série
cientemente versátil para explicar a grande variedade de de vantagens: (a) possibilita o armazenamento e a codi-
genes e, ao mesmo tempo, ser capaz de reproduzir-se de ficação de imensa quantidade de informação, tendo em
tal maneira que se forme uma cópia idêntica em cada cé- vista as bases nela contidas; assim, para uma molécula
lula com capacidade de se dividir. N
com N bases, há 4 sequências possíveis; (b) sugere um
Em 1953, J. D. Watson e F. C. Crick, com base em mecanismo para sua replicação, já que cada fita contém
estudos de difração aos raios X, propuseram um modelo a informação completa da molécula de DNA, podendo
para a estrutura molecular do DNA que atendia a esses servir como molde para a síntese de uma nova fita com-
requisitos: (a) a molécula de DNA é uma longa fita ou fita plementar; (c) fornece um mecanismo de defesa contra
de nucleotídeos, formando uma configuração semelhante a perda de informação genética causada por um dano ao
à de uma escada de corda, enrolada de forma helicoidal; DNA (p. ex., se uma base de uma das fitas for danificada
(b) nessa escada, o açúcar e o fosfato são os componen- ou perdida, poderá ser substituída, já que sua fita com-
tes verticais (corrimãos) e as bases nitrogenadas são os plementar orienta essa substituição); (d) permite que as
degraus: para que estes se formem, as ligações entre as fitas de DNA, com a sua complementaridade, se identifi-
bases são feitas por pontes de hidrogênio, sendo duplas quem e se juntem em uma mistura complexa de molécu-
entre as bases adenina e timina, e triplas entre guanina e las, configurando o que se denomina hibridização, pro-
citosina; (c) tal modelo também requer que as duas fitas cesso utilizado em algumas situações pelos mecanismos
polinucleotídicas sejam antiparalelas, isto é, corram em nucleares de regulação da expressão gênica.
direções opostas: uma na direção 5'→3' e a outra na di- A forma original da dupla-hélice do DNA, proposta
reção 3'→5'. Na Figura 1.3 está representado o modelo no modelo de Watson e Crick, é denominada B-DNA,
original da molécula de DNA. Por seu trabalho, Watson e mas ainda existem outras formas. A conformação que o
Crick receberam o Prêmio Nobel de Medicina e Fisiolo- DNA adota depende de vários fatores: nível de hidrata-
gia, em 1962. ção, sequência de DNA, direção e grau do superenrola-
Desse modo, o DNA é formado por duas fitas po- mento, modificações químicas das bases, tipo e concen-
linucleotídicas que se dispõem em espiral em torno de tração de íons metálicos e presença de poliaminas em
um mesmo eixo imaginário, mas com polaridades opos- solução. Em condições fisiológicas, a maior parte do DNA
tas. Cada fita de DNA tem sua polaridade determina- de procariotos e eucariotos aparece com a forma desse
da pela orientação dos componentes açúcar e fosfato. modelo: uma hélice com giro para a direita (dextrógira) e
Quando uma fita termina no átomo de carbono 5' da entre 10 e 10,5 bases por giro, formando dois sulcos, um
molécula de desoxirribose, que constitui sua extremi- grande e profundo (sulco maior), outro pequeno, estreito
dade 5', a fita oposta termina no carbono 3' do açúcar, ou raso (sulco menor). Essa estrutura pode transformar-
denominando-se extremidade 3. Assim, a extremidade -se no A-DNA, forma rara já conhecida quando surgiu o
5' de uma fita tem orientação oposta à extremidade 3' modelo de Watson e Crick, também dextrógira, que existe
somente em condições salinas altas ou de desidratação,
da outra, daí a denominação de fitas antiparalelas. A es-
contendo 11 pares de bases por giro e diferindo do B-DNA
tabilização da dupla-hélice é dada pela interação entre
por uma rotação de 20º em relação ao eixo perpendicular
as bases complementares oponentes e as bases que vão
da hélice, o que causa mudança na aparência dos sulcos
se superpondo. O espaço ocupado por duas bases opos-
maior e menor. Existe ainda o Z-DNA, que apresenta
tas é pequeno, o que obriga a associação, por meio de
instabilidade termodinâmica e contém 12 pares de ba-
pontes de hidrogênio, entre uma base grande (púrica)
ses por giro. Sua orientação para a esquerda (levógira)
e outra pequena (pirimídica); duas bases grandes não
resulta em maior distância entre seus pares de bases do
caberiam nesse espaço e duas pequenas não se aproxi-
que no B-DNA e em uma molécula de DNA em forma de
mariam o suficiente para interagir. Essas associações
zigue-zague, daí sua denominação. Um giro de 180º pode
complementares ocorrem entre adenina e timina
converter o B-DNA em Z-DNA com função biológica, mas
e entre guanina e citosina, por serem combinações
ainda não se sabe exatamente se o Z-DNA ocorre in vivo.
mais estáveis. Assim, as quantidades de bases púricas
Segmentos de B-DNA cujas bases foram modificadas qui-
e pirimídicas são iguais, de tal forma que A+G ⫽ C+T.
micamente por metilação podem sofrer grande mudança
Verifica-se, igualmente, que as quantidades de adeni-
em sua conformação e adotar a forma Z. Essas estruturas
na e timina são equivalentes e o mesmo ocorre com a
raras podem ser reconhecidas por proteínas específicas
guanina e a citosina, tendo-se, assim: A⫽T e G⫽C.
de ligação ao Z-DNA e podem estar envolvidas na regula-
Considerando-se uma fita hipotética, com a seguinte
ção da transcrição.
composição: 5'-ATGCGTCAG-3', sua fita complemen-
tar deverá ser 3'-TACGCAGTC-5', com a estrutura em A Figura 1.4 mostra essas três formas da dupla-hé-
dupla-hélice completa sendo assim representada: lice do DNA. Foram descobertas outras formas de DNA

Borges-Osorio_01.indd 12 29/01/13 13:35


13 As Bases Moleculares da Hereditariedade
sulco maior

sulco menor

A B

fosfato
fosfato

açúcar
açúcar
sulco maior
fosfato
fosfato

açúcar
açúcar

fosfato
fosfato
sulco menor
açúcar
açúcar
Legenda:
hidrogênio fosfato
fosfato

oxigênio
açúcar
açúcar
carbono na cadeia de
açúcar+fosfato
carbono e nitrogênio
nas bases

fosfato
C D

Figura 1.3
Modelo de Watson e Crick para a estrutura da molécula do DNA, em diferentes modos de representação. A
– A dupla-hélice está desenrolada para mostrar os pares de bases (internamente, em laranja) e o esqueleto
de açúcar-fosfato (externamente, em preto). Sua largura mantém-se constante porque as purinas pareiam
sempre com as pirimidinas: A com T, unidas por duas pontes de hidrogênio, G com C, unidas por três pon-
tes de hidrogênio. B – A dupla-hélice assemelha-se a uma escada, na qual os degraus são os pares de bases,
situados perpendicularmente aos corrimãos formados pela estrutura de açúcar e fosfato. As setas indicam
a orientação oposta das fitas. O enrolamento helicoidal das duas fitas faz surgir um sulco menor (~12Å de
diâmetro) e um sulco maior (~22Å de diâmetro), assinalados na figura. C – Esta representação mostra as
relações entre os átomos da molécula de DNA. D – O esquema de um segmento desenrolado da dupla-hélice
mostra a relação entre as bases complementares, que representam o conteúdo informativo variável do DNA,
e o esqueleto de açúcar-fosfato, que é idêntico em todo o DNA.
Fonte: Lewis.3

Borges-Osorio_01.indd 13 29/01/13 13:35


Genética Humana 14

de hélices dextrógiras, quando investigadas em condições O interesse em formas alternativas de DNA, tal como
laboratoriais variadas. Essas formas são denominadas a forma Z e outras formas raras, decorre da possibilidade
C-DNA, D-DNA, E-DNA e P-DNA. O C-DNA é encon- de que o DNA possa assumir uma estrutura diferente da
trado em condições de maior desidratação do que as ob- existente na forma B para facilitar algumas de suas fun-
servadas durante o isolamento do A-DNA e do B-DNA. ções genéticas.
Apresenta somente 9,3 pares de bases por giro, por isso é
Como já foi mencionado, o RNA difere do DNA em
menos compacto. Do mesmo modo que no A-DNA, os pa-
sua composição química quanto a dois aspectos: o RNA
res de bases do C-DNA não são planos, inclinando-se em
possui ribose, no lugar da desoxirribose, e uracil, em vez
relação ao eixo da hélice. O D-DNA e o E-DNA ocorrem
de timina.
em hélices que não contêm guanina em sua composição
de bases e apresentam 8 e 7 pares de bases por giro, res- Quanto à estrutura molecular, o RNA apresenta ape-
pectivamente. O P-DNA (denominação em homenagem nas uma fita de nucleotídeos, cuja composição de bases
a Linus Pauling) é mais longo e mais estreito do que a não está restrita às igualdades G⫽C e A⫽U. Em circuns-
forma B, e seus grupos fosfato e bases nitrogenadas têm tâncias especiais, uma molécula de RNA pode formar
localização inversa à encontrada no B-DNA, pois os pri- uma fita dupla com outra parte de sua própria estrutura,
meiros se encontram no interior da molécula e as últimas, como ocorre no RNA transportador, que será abordado
na sua superfície externa. Há aproximadamente 2,6 bases mais adiante neste capítulo. Além disso, o DNA contém
por giro, em contraste ao maior número de bases por giro a informação que codifica uma cadeia polipeptídica, en-
encontrado no B-DNA. quanto o RNA utiliza essa informação.

Figura 1.4
Principais formas do DNA.
A – Modelos tridimensio-
nais computadorizados de
B-DNA, A-DNA e Z-DNA.
B – Representação es-
quemática de B-DNA e de
A-DNA, exemplificando a
orientação dos seus pares
de bases: no B-DNA, são
perpendiculares à hélice,
enquanto no A-DNA são
inclinados e afastados da
hélice.

B-DNA A-DNA Z-DNA

B-DNA A-DNA

Borges-Osorio_01.indd 14 29/01/13 13:35


15 As Bases Moleculares da Hereditariedade
mas das trincas especificam aminoácidos ou que al-
1.4 O código genético guns deles devem ser especificados por mais de um
O código para a produção dos diferentes tipos de proteí- tipo de trinca ou por mais de um códon. Por exem-
nas que o organismo deve formar ao longo de sua vida plo, o aminoácido fenilalanina pode ser codificado
está contido no zigoto de cada indivíduo. por dois códons diferentes: UUU e UUC. Os códons
que representam os mesmos aminoácidos são de-
Todas as células de um determinado organismo, nominados códons sinônimos, relacionando-se, em
em um dado momento de sua vida, contêm o mesmo geral, por uma alteração de sua terceira base; a de-
código ou informação genética do zigoto que as origi- generação da terceira base minimiza os efeitos de
nou, porém nem todos os genes estão funcionando em possíveis mutações.
todas as células ao mesmo tempo e com a mesma inten-
sidade. Isso varia com o tipo de célula e com a idade do c. É considerado não ambíguo, isto é, uma trinca só
indivíduo. pode codificar um aminoácido. As trincas acima re-
feridas só codificam a fenilalanina, e nenhum outro
O código genético descreve a relação entre a sequên- aminoácido.
cia de bases nitrogenadas do DNA e a sequência de ami-
noácidos na cadeia polipeptídica correspondente. Foi d. É um código sem superposição, ou seja, uma
elucidado em 1966, graças à descoberta de que o RNA dada base pertence a uma só trinca ou códon. Ex-
mensageiro transmite a informação entre genes e pro- ceções: bacteriófago ␾ X174 e outros vírus, em que
teínas. A palavra-chave do código para um aminoácido há pontos de iniciação múltiplos, criando genes su-
consiste em uma sequência de três bases nitrogenadas perpostos.
adjacentes, que formam a unidade de informação e. É, também, contínuo, não existindo espaçamento
genética ou códon. O código genético apresenta as se- entre os códons.
guintes características:
f. É semiuniversal, ou seja, os mesmos aminoácidos
a. Sua leitura é feita em trincas de bases ou de nu- são codificados pelos mesmos códons em quase to-
cleotídeos. dos os organismos, permitindo que um RNA mensa-
b. É degenerado ou redundante. A sequência de geiro seja traduzido em uma célula de outra espécie,
nucleotídeos deve conter o número suficiente de o que possibilitou a técnica do DNA recombinante
unidades codificadoras para representar 20 ami- (ver Cap. 17). Aparentemente, uma vez evoluído,
noácidos. Como o DNA possui apenas quatro bases o código genético vem mantendo-se quase intacto
distintas, são necessárias diversas combinações ao longo da história evolutiva da vida na Terra. No
dessas bases para codificar os diferentes tipos de entanto, existem algumas exceções (certos genes
aminoácidos. Se a combinação das bases fosse 2 a da mitocôndria humana e de levedura, da bactéria
2 (42), haveria 16 arranjos; como são 20 os aminoá- Mycoplasma capricolum e dos protozoários ciliados
cidos, essa combinação é, portanto, inadequada. Paramecium, Tetrahymena e Stylonychia), como
Agrupando-se as bases 3 a 3 (43), resultam 64 ar- mostra a Tabela 1.2. Em genomas mitocondriais,
ranjos, número maior do que o necessário. Desde essas alterações são mais comuns; em genomas nu-
que há 64 combinações possíveis e apenas 20 ami- cleares, são esporádicas e afetam geralmente os có-
noácidos diferentes, deduz-se que somente algu- dons de finalização ou terminação.

Tabela 1.2 Algumas exceções ao código genético universal


Códon No código normal No código alterado Fonte

UGA finalização trp Mitocôndria humana e de levedura


Mycoplasma (bactéria)
cys Euplotes (protozoário ciliado)
sel Procariotos e eucariotos
UAA finalização gln Paramecium, Tetrahymena,
Stylonychia (protozoários ciliados)
UAG finalização gln Tetrahymena
pyr Archaea; bactéria
AUA ile met Mitocôndria humana
AGA arg finalização Mitocôndria humana
AGG arg finalização Mitocôndria humana
CUA leu thr Mitocôndria de levedura
CUG leu ser Candida (levedura)

Fonte: Klug e colaboradores4 e Lewin.5

Borges-Osorio_01.indd 15 29/01/13 13:35


Genética Humana 16

g. Há códons de iniciação e de finalização ou ter- de facilitar a decodificação de sequências situadas depois


minação. O início da síntese de um polipeptídeo, do códon finalizador.
em procariotos, é assinalado pela presença de um
códon iniciador específico, que é AUG no RNA men-
sageiro, correspondendo ao aminoácido metionina.
Há, também, códons finalizadores ou terminado- 1.5 DNA: nuclear e mitocondrial
res, que indicam o término da síntese polipeptídica,
como UAA, UAG e UGA, e em geral não correspon- O conteúdo de DNA das células humanas constitui o que
dem a aminoácidos em eucariotos. se denomina de genoma humano. Esse genoma subdivi-
de-se em duas partes: o genoma nuclear, que correspon-
A Figura 1.5 mostra o código genético completo, de à maior parte da informação genética total, e o geno-
que geralmente é representado pelas bases contidas no ma mitocondrial, que corresponde à informação genética
RNA mensageiro, com uracil (U) em lugar de timina (T). restante (ver seção 1.5.2).
Os aminoácidos selenocisteína (sel) e pirroli-
sina (pyr), codificados respectivamente pelas trincas
1.5.1 DNA nuclear
UGA e UAG, que correspondem a códons finalizadores
na maioria dos organismos, são considerados os 21º e O genoma humano nuclear apresenta em torno de 33%
22º aminoácidos, embora o primeiro ocorra em proca- do conteúdo de DNA na forma de genes estruturais e se-
riotos e eucariotos e o último apenas em bactérias e em quências a eles relacionadas, enquanto sua maior parte
Archaea. Esses casos são interpretados como um meio (67%) é encontrada como DNA extragênico, isto é, o con-

Figura 1.5 Base nucleotídica


Primeira Segunda Terceira
O código genético. Além do código
Uracil (U) Citosina (C) Adenina (A) Guanina (G)
genético tradicional, representado
pelas três primeiras letras de cada F Fenilalanina (Phe) S Serina (Ser) Y Tirosina (Tyr ou tyr) C Cisteína (Cys ou cys) U
F Fenilalanina (Phe) S Serina (Ser) Y Tirosina (Tyr ou tyr) C Cisteína (Cys ou cys) C
aminoácido, também é usado o có- Uracil L Leucina (Leu) S Serina (Ser) Códon finalizador Códon finalizador A
digo alfabético abreviado, em que os (U)
L Leucina (Leu) S Serina (Ser) Códon finalizador W Triptofano (Trp) G
aminoácidos são representados ape-
L Leucina (Leu) P Prolina (Pro) H Histidina (His) R Arginina (Arg) U
nas por uma letra do alfabeto. L Leucina (Leu) P Prolina (Pro) H Histidina (His) R Arginina (Arg) C
6 Citosina
Fonte: Passarge. (C) L Leucina (Leu) P Prolina (Pro) Q Glutamina (Gln) R Arginina (Arg) A
L Leucina (Leu) P Prolina (Pro) Q Glutamina (Gln) R Arginina (Arg) G

I Isoleucina (Ile) T Treonina (Thr) N Asparagina (Asn) S Serina (Ser) U


Adenina I Isoleucina (Ile) T Treonina (Thr) N Asparagina (Asn) S Serina (Ser) C
(A) I Isoleucina (Ile) T Treonina (Thr) K Lisina (Lys ou lys) R Arginina (Arg) A
Início (Metionina) T Treonina (Thr) K Lisina (Lys ou lys) R Arginina (Arg) G

V Valina (Val) A Alanina (Ala) D Ácido aspártico (Asp) G Glicina (Gly) U


Guanina V Valina (Val) A Alanina (Ala) D Ácido aspártico (Asp) G Glicina (Gly) C
(G) V Valina (Val) A Alanina (Ala) E Ácido glutâmico (Glu) G Glicina (Gly) A
V Valina (Val) A Alanina (Ala) E Ácido glutâmico (Glu) G Glicina (Gly) G

Código genético no mRNA para todos os aminoácidos


Início AUG F (Phe) UUU L (Leu) CUU R (Arg) CGU V (Val) GUU
Fim UAA UUC CUC CGC GUC
UAG CUG CGG GUG
UGA G (Gly) GGU CUA CAA GUA
GGC UUG AGG
A (Ala) GCU GGG UUA AGA W (Trp) UGG
GCC GGA
GCG M (Met) AUG S (Ser) UCU Y (Tyr) UAU
GCA UCC UAC
H (His) CAU N (Asn) AAU UCG
CAC AAC
C (Cys) UGU UCA B (Asx) Asn
UGC P (Pro) CCU AGU
I (Ile) AUU ou
CCC AGC Asp
D (Asp) GAU AUC
AUA CCG T (Thr) ACU
GAC
CCA ACC Z (Glx) Gln
E (Glu) GAG K (Lis) AAG Q (Gln) CAG ACG ou
GAA AAA CAA ACA Glu

Código alfabético abreviado

Borges-Osorio_01.indd 16 29/01/13 13:35


17 As Bases Moleculares da Hereditariedade
teúdo de DNA que não faz parte dos genes nem das se- função codificadora. Os genomas maiores, em um mesmo
quências a eles relacionadas. filo, não contêm mais genes, mas maiores quantidades de
DNA repetitivo.
A quantidade do DNA de uma célula diploide hu-
mana é de aproximadamente 6.000 Mb (megabases). Se 1.5.1.1 Tipos de sequências
esse DNA consistisse apenas em genes estruturais, isto é,
genes que codificam cadeias polipeptídicas, existiria cer- A Figura 1.6 apresenta os principais tipos de sequên-
ca de 6 a 7 milhões de genes no genoma humano, número cias de DNA e alguns tipos de sequências repetitivas do
demasiadamente alto, uma vez que a análise de genomas genoma humano nuclear. O DNA nuclear dos eucariotos
eucarióticos tem revelado que a relação entre o tamanho apresenta os seguintes tipos de sequências: DNA não
do genoma e o número de genes não é linear. Segundo repetitivo, que consiste em sequências individuais pre-
Lewin,5 estima-se que existam entre 20 e 25 mil genes sentes em apenas uma cópia no genoma haploide; e DNA
estruturais, codificados por sequências de DNA não repe- repetitivo, que abrange sequências presentes em mais
titivo, sendo o restante do genoma constituído de outros de uma cópia por genoma.
tipos de DNA. De acordo com Passarge,6 essa estimativa
DNA não repetitivo – Esse tipo de DNA consiste em
é de aproximadamente 22 mil genes, portanto dentro do
sequências individuais presentes em apenas uma cópia
intervalo citado.
por genoma, contendo os genes estruturais (55 Mb)
A maior parte do DNA do genoma de organismos su- e sequências relacionadas (945 Mb). A distribuição
periores consiste em sequências de DNA repetitivo, sem desses genes varia muito entre os diferentes cromos-

A
Figura 1.6
Genoma humano
3.000 Mb A – Principais tipos de sequên-
Genes e sequências
DNA extragênico
cias do DNA. B – Alguns tipos
relacionadas
2.000 Mb de sequências repetitivas do
1.000 Mb
DNA.

55 Mb Sequências Repetições Outras regiões


~22.000 genes relacionadas dispersas 600 Mb
ao gene 945 Mb 1.400 Mb

Microssatélites
90 Mb
LINE 640 Mb
SINE 420 Mb
Íntrons ~20.000 LTR 250 Mb
pseudogenes Outras 510 Mb
UTRs Transposons 90 Mb

1 - Elementos nucleares P ORF 1 ORF 2 LINE-1 ~600.000 cópias


intercalares longos (A)n LINE-2 ~370.000 cópias
(LINEs) (autônomos) LINE-3 ~44.000 cópias
6–8 kb

2 - Elementos nucleares Família Alu ~1.200.000 cópias


intercalares curtos (A)n MIR ~450.000 cópias
(SINEs) (não autônomos) MIR3 ~85.000 cópias
100–300 pb

Sequências
3 - Elementos similares LTR gag pol (env) LTR retrovirais humanas
ao retrovírus endógenas (HERV)
~240.000 cópias
(transposons LTR) (várias classes;
P autônomas e
6–11 kb
não autônomas)

Transposase Várias classes ~300.000 cópias


4 - Transposons
(autônomas e
de DNA
2–3 kb não autônomas)

Borges-Osorio_01.indd 17 29/01/13 13:35


Genética Humana 18

a
somos e em certas regiões cromossômicas, dado que 2 – DNA altamente repetitivo, que consiste em se-
as regiões centroméricas e heterocromáticas contêm quências muito curtas (geralmente com menos de 100
poucos genes estruturais, estando a maioria deles lo- pares de bases [pb]) presentes em milhares de vezes no
calizada em regiões subteloméricas (regiões cromossô- genoma e não transcritas. O DNA altamente repetitivo
micas situadas entre o centrômero e as extremidades consiste sobremaneira em sequências de DNA dispersas
dos cromossomos; para mais detalhes, ver Cap. 4). Os por todo o genoma (cerca de 1.400 Mb) e outras, como
genes estruturais codificam polipeptídeos que integram o DNA-satélite. Entre as repetições dispersas (não
enzimas, hormônios, receptores e proteínas estruturais em tandem), muitas são elementos de transposição,
e reguladoras. que são móveis, podendo movimentar-se para diferentes
regiões do genoma. A seguir, são descritos quatro tipos
Entre as sequências relacionadas aos genes, encon-
dessas repetições dispersas:
tram-se os íntrons e aproximadamente 20 mil pseudo-
genes. Os íntrons (“int” de interveniente) são sequências 1. Longos elementos nucleares dispersos ou ele-
internas de DNA presentes entre as regiões codificadoras mentos intercalares longos (LINEs, do inglês
da maioria dos genes e no pré-mRNA, mas são removidos long interspread nuclear elements) – abrangendo
antes da tradução do mRNA maduro. Esses segmentos cerca de 640 Mb do genoma humano, consistem, em
nucleotídicos são também chamados sequências interve- sua forma mais comum (LINE-1 ou elemento L1), em
nientes, e os genes que as contêm são denominados genes sequências repetitivas de aproximadamente 6.500 pb,
interrompidos. presentes em até 100 mil cópias. Um módulo de 6 a
Os pseudogenes são genes não funcionais, com se- 8 kb de comprimento apresenta duas fases de leitura
quências homólogas às de genes estruturais funcionais, aberta, um promotor (P) na extremidade 5' e segmen-
mas diferindo desses por apresentarem inserções, dele- tos ricos em adenina na extremidade 3'. Há três tipos
ções e sequências flanqueadoras de repetição direta com de LINEs (L1, L2 e L3) que se encontram dispersos
10 a 20 nucleotídeos, que impedem a sua expressão. Apa- em grande quantidade no genoma, do qual perfaz 15 a
rentemente, os pseudogenes surgiram por duplicação e 20%. Uma pequena porção pode apresentar transpo-
aquisição de muitas mutações nos elementos codificado- sição autônoma, cujo mecanismo já se conhece. A se-
res e reguladores, ou pela inserção de sequências de DNA quência L1 é transcrita em uma molécula de RNA, que
complementares, às quais faltam as sequências promoto- serve de molde para a síntese do DNA complementar,
ras necessárias para sua expressão. usando a enzima transcriptase reversa (enzima que
transcreve inversamente o RNA em DNA, codificada
DNA repetitivo – Esse tipo de sequência constitui o por uma parte da sequência L1). A seguir, a nova có-
DNA extragênico, que abrange 2.000 Mb sem informação pia de L1 é integrada ao DNA do cromossomo em um
genética conhecida. Alguns autores costumam classificar novo sítio. Devido à semelhança desse mecanismo de
o DNA repetitivo em duas classes: transposição ao utilizado pelos retrovírus, os LINEs
a
1 – DNA moderadamente repetitivo, que consiste são referidos também como retrotransposons.
em sequências relativamente pequenas que se repetem de 2. Pequenos elementos nucleares dispersos ou
10 a mil vezes e estão dispersas por todo o genoma; esse elementos intercalares curtos (SINEs, do inglês
subtipo inclui as famílias multigênicas, formadas por short interspread nuclear elements) – abrangem
genes funcionais em múltiplas cópias, com funções simi- cerca de 420 Mb, têm menos de 500 pb de extensão e
lares, tendo surgido por duplicação, com consequente di- consistem em mais de 500 mil cópias dispersas pelo
vergência evolutiva. Alguns fazem parte de grupamentos, genoma. Um dos tipos mais importantes de SINE é a
enquanto outros estão espalhados pelo genoma, consti- família Alu ou repetições Alu, cuja denominação
tuindo as referidas famílias multigênicas, que podem ser se deve ao fato de que essas repetições, com cerca de
de dois tipos: (a) famílias gênicas clássicas, que apresen- 300 pb de tamanho, contêm uma sequência de DNA
tam alto grau de homologia em suas sequências, tendo que pode ser cortada pela enzima de restrição Alu I
se originado por duplicação. Exemplos: (1) os numerosos (ver Cap. 17). Uma característica importante das se-
genes que codificam os diversos RNAs ribossômicos e quências Alu é sua capacidade de autoduplicação,
agrupam-se nas regiões organizadoras de nucléolos, nos podendo inserir-se em outras regiões do genoma,
braços curtos dos cinco cromossomos autossômicos acro- interrompendo, às vezes, um gene que codifica uma
cêntricos (cromossomos 13, 14, 15, 21 e 22; ver Cap. 4); dada proteína e acarretando, assim, uma doença ge-
(2) as famílias gênicas que codificam os diferentes RNAs
nética. Seu mecanismo de transposição é semelhante
transportadores, localizadas em numerosos conjuntos
ao dos LINEs.
dispersos por todo o genoma; (b) superfamílias gênicas,
compostas por genes com funções muito semelhantes que As funções do DNA disperso ainda não são total-
se originaram por duplicação a partir de um gene precur- mente conhecidas. Os membros da família Alu são flan-
sor e posterior divergência. Os exemplos mais conhecidos queados por pequenas sequências de repetição direta e,
são: (1) superfamília do sistema HLA, localizada no braço portanto, se assemelham a sequências de DNA instáveis,
curto do cromossomo 6; (2) superfamília dos receptores denominadas elementos de transposição, elemen-
das células T, que têm homologia estrutural com os genes tos transponíveis ou transposons. Tais elementos,
para as imunoglobulinas. identificados primeiramente no milho, movem-se espon-

Borges-Osorio_01.indd 18 29/01/13 13:35


19 As Bases Moleculares da Hereditariedade
taneamente ao longo de todo o genoma, de um cromos- variable number tandem repeats), que consiste em
somo para outro, tanto em plantas quanto em animais. repetições curtas (15 a 100 pares de bases) encontra-
Postula-se que tanto as repetições Alu como os elementos das no interior dos genes e entre eles. É altamente
L1 acarretariam mutações patogênicas, encontradas em polimórfico, variando de um indivíduo para outro e
várias doenças humanas hereditárias, como, por exem- criando regiões localizadas de 1 a 20 kb de extensão.
plo, a hipercolesterolemia familiar. Muitos grupamentos desse tipo estão dispersos ao
longo do genoma, sendo referidos também como mi-
3. Repetições terminais longas (LTRs, do inglês
nissatélites. A variação em comprimento dessas re-
long terminal repeats) – abrangem cerca de 250
giões entre os humanos serviu de base para a técnica
Mb do genoma e dispõem de repetições diretas em
denominada impressões digitais de DNA (finger-
ambas as extremidades. Como os retrovírus, as LTRs
printing), que se aplica à identificação de indivíduos
dos retrotransposons têm promotores para iniciar a
e à medicina forense (ver Cap. 17).
transcrição da RNA-polimerase II e sinais de polia-
denilação para processamento do mRNA. 3. Microssatélites – consistem em repetições cur-
tas em tandem (< de 10 nucleotídeos, geralmente
4. Transposons de DNA – abrangem cerca de 90 Mb
1 a 5 nucleotídeos), dispersas no genoma e com alto
do genoma e apresentam várias classes (autônomas e
grau de polimorfismo. São conhecidas também como
não autônomas). Os transposons de DNA movem-se
STRs (do inglês short tandem repeats), utilizadas
de uma parte a outra do genoma por meio de um me-
como marcadores moleculares na análise genômi-
canismo de corte-e-colagem, mediado pela enzima
ca. Raramente ocorrem no interior das sequências
transposase. Ao contrário das LTRs, esses elemen-
codificadoras, mas repetições de três nucleotídeos
tos contêm repetições terminais com extremidades
próximos aos genes estão associadas a certas doen-
invertidas.
ças hereditárias, como a doença de Huntington,
As repetições em tandem (nas quais o início de a deficiência mental ligada ao X frágil e a distrofia
uma repetição ocorre imediatamente adjacente ao final miotônica (ver Cap. 5). Além dessas sequências,
de outra) consistem em muitas repetições de sequências existem sequências de DNA com 1 a 4 pares de ba-
de DNA não codificadoras, que podem estar concentra- ses, altamente polimórficas e de ampla distribuição
das em locais restritos ou muito dispersas no genoma. no genoma, chamadas repetições de sequências
Podem dividir-se em três subgrupos: simples e utilizadas como marcadores moleculares
em diversos métodos.
1. DNA-satélite – abrange uma proporção variável do
DNA total dos eucariotos (inexistindo em procariotos) Essa terminologia, entretanto, não é precisamente
e consiste em repetições curtas em tandem, situadas definida. Por exemplo, a classificação em DNA modera-
nas regiões flanqueadoras dos centrômeros, conhe- damente repetitivo e altamente repetitivo é variável na
cidas como regiões heterocromáticas, de alguns cro- literatura específica, e alguns autores usam uma classi-
mossomos (p. ex., 1, 9, 16, Y). Não deve ser confun- ficação híbrida para o DNA repetitivo (DNA moderada-
dido com o satélite dos cromossomos acrocêntricos mente a altamente repetitivo). Certos autores utilizam a
(ver Cap. 4); sua denominação origina-se do fato de, denominação microssatélite quando o tamanho da unida-
na centrifugação em gradiente de densidade de cloreto de repetitiva é inferior a 10 pb, chamando-a minissatélite
de césio, separar-se como um “satélite” do restante do quando esse tamanho está entre 10 e 100 pb.
genoma. Em humanos, uma das sequências de DNA-
Até o presente momento, não há uma explicação in-
-satélite mais conhecidas é a família alfoide, com
teiramente satisfatória para a vasta quantidade de DNA
171 pb, que é encontrada em arranjos de repetições em
repetitivo no genoma humano, parecendo ter pouca ou
tandem do início ao fim e chega a totalizar 1 milhão
nenhuma função e contribuindo pouco para o fenótipo.
de pares de bases. Não se conhece o papel exato desse
Daí sua denominação de “DNA egoísta”, que se preser-
tipo de DNA altamente repetitivo na função centromé-
va a si próprio, com a autoperpetuação no genoma como
rica, mas se sabe que ele não é transcrito.
sua única função, e contra o qual não agem as forças se-
2. Minissatélites – consistem em duas famílias de re- letivas. Outro termo utilizado para designar o aparente
petições curtas em tandem: (a) DNA telomérico, excesso de DNA é “DNA lixo”, que se refere a sequências
situado na porção terminal das extremidades cro- genômicas sem qualquer função aparente. É provável que
mossômicas (telômeros), consistindo em 10 a 15 kb exista um equilíbrio no genoma entre a criação de novas
de repetições em tandem de uma sequência de DNA sequências e a eliminação de sequências indesejadas, e
de 6 pb (TTAGGG); esse DNA é necessário para a in- que alguma proporção do DNA sem função aparente es-
tegridade cromossômica na replicação e é adicionado teja em processo de eliminação.
ao cromossomo por uma enzima específica denomi-
nada telomerase; (b) DNA minissatélite hiper-
variável, que ocorre nas proximidades dos telôme-
1.5.2 DNA mitocondrial (mtDNA)
ros e em outros locais dos cromossomos. Um de seus O DNA mitocondrial é uma molécula circular de fita
exemplos é o DNA descrito como número variá- dupla, com 16.569 pares de bases, existente no interior
vel de repetições em tandem (VNTR, do inglês das mitocôndrias, organelas oriundas de bactérias e pro-

Borges-Osorio_01.indd 19 29/01/13 13:35


Genética Humana 20

dutoras de energia localizadas no citoplasma de pratica- proteínas, 22 genes de tRNA e 2 genes de rRNA. Os genes
mente todas as células eucarióticas. Esse DNA não apre- codificadores de proteínas encontram-se no complexo
senta íntrons (exceção: leveduras, que contêm grandes citocromo-c-oxidase (subunidades 1, 2 e 3) e nas regiões
íntrons), nem crossing-over, arcabouço de histonas e do citocromo b e das subunidades 6 e 8 do complexo da
sistema de reparo eficiente; existe em muitas cópias por ATPase. Por meio de densidade, pode ser diferenciada
mitocôndria e por célula, é de herança materna e sofre uma fita simples leve (L) de uma pesada (H), na qual se
alta exposição aos radicais livres de oxigênio. encontra a maioria dos genes (Fig. 1.7B). Os genes mi-
As células eucarióticas contêm um número variável tocondriais utilizam um código genético diferente do usa-
de mitocôndrias, dependendo da energia necessária para do pelos genes nucleares; em mamíferos, UGA para trp,
a realização de suas funções: quanto maior essa neces- AUA para met e AGA/AGG como códon de finalização.
sidade, como nos músculos e no cérebro, por exemplo, A taxa de mutação do mtDNA é quase 20 vezes mais
maior a quantidade de mitocôndrias existente no cito- alta do que a do DNA nuclear, provavelmente devido à
plasma celular. grande produção de radicais livres de oxigênio (mutagê-
As mitocôndrias apresentam, via de regra, forma ci- nicos) nas mitocôndrias e à sua limitada capacidade de
líndrica alongada, com diâmetro de 0,5 a 1,0 m␮, mas são reparo.
organelas dotadas de grande mobilidade e plasticidade, O mtDNA atraiu a atenção de muitos pesquisado-
mudando constantemente de forma e podendo fundir-se res, quando foi publicado um artigo por Cann e colabo-
umas às outras e separar-se posteriormente. 8
radores, em 1987, no qual era sugerido que a espécie
Cada mitocôndria é formada por uma matriz limi- humana descenderia de uma única mulher africana que
tada por duas membranas, uma externa e outra in- teria vivido há 200 mil anos. Tal hipótese baseava-se no
terna. Esta última apresenta dobramentos para dentro, fato de que as mitocôndrias são exclusivamente herança
formando cristas que aumentam internamente sua super- materna e o acúmulo de mutações no mtDNA pode ser
fície total (Fig. 1.7A). O genoma mitocondrial humano e utilizado como um relógio evolutivo. Hoje, são conheci-
de outros mamíferos apresenta 13 genes codificadores de das muitas variantes do mtDNA, atribuídas a diferentes

Phe-tRNA
A B
Alça D Val-tRNA
Thr-tRNA 12S-rRNA
Matriz ori
16S-rRNA
b
o
om
cr
to

Pro-tRNA
Ci

Membrana
Glu-tRNA
interna Leu-tRNA
ND 5 ND 6
ND 1
Fita H Fita L
Ile-tRNA
16.569 Gln-tRNA
pares de bases f-Met-tRNA
Membrana Leu-tRNA Ala-tRNA ND 2
Asn-tRNA
externa Ser-tRNA Trp-tRNA
Cys-tRNA
His-tRNA
e1

Tyr-tRNA
ori
idas

ND 4 Ser-tRNA
-ox
o-c

Espaço ND 4L
om
Ci

intermembranar
cr
to

to

m Arg-tRNA Asp-tRNA
cr

Ci
o

o- ND 3
c- 2
ox Gly-tRNA Lys-tRNA se
ida ida
se
3 -c-ox
o
rom
ATP-sintetase Citoc
subunidade 6 ATP-sintetase
subunidade 8

Figura 1.7
Representação esquemática de uma mitocôndria e do DNA mitocondrial (mtDNA). A – Mitocôndria e seus principais
componentes: matriz, membrana interna, membrana externa e espaço intermembranar. (Fonte: Alberts e colaborado-
res.7) B – DNA mitocondrial (mtDNA) humano, mostrando os genes mitocondriais em seres humanos: 22 genes para
tRNA, 2 para rRNA (12S rRNA e 16S rRNA) e 13 regiões codificadoras de proteínas relacionadas com a respiração (ND
1, ND2, CO 1, CO2, ATPase 8, ATPase 6, CO3, ND3, ND4L, ND4, ND5, ND6 e Cyt b). Alça D ⫽ região do mtDNA na
qual um curto segmento de RNA pareia com uma das fitas de DNA; ND ⫽ NADH desidrogenase.

Borges-Osorio_01.indd 20 29/01/13 13:35


21 As Bases Moleculares da Hereditariedade
haplogrupos, de acordo com sua distribuição geográfica. 1.6.1 RNA heterogêneo nuclear, pré-RNA
Os principais grupos são denominados L1, L2 e L3 (na
África), M e N (na Ásia) e R (na Europa), cada uma com
mensageiro, RNA primário ou
diversos subgrupos, propiciando a reconstrução de sua transcrito primário
árvore evolutiva. Esse tipo de RNA é encontrado apenas em eucario-
O mtDNA também é importante sob outros aspec- tos e seu tamanho é variável, sendo sempre mais longo
tos, como, por exemplo, o da sua relação com algumas do que o RNA que é traduzido (mRNA) e praticamente
doenças. Os bilhões de moléculas do mtDNA de qualquer correspondente à sequência do gene que é transcrito. É
indivíduo são geralmente idênticos e de herança materna, o primeiro passo da transcrição (por isso também é de-
pois o espermatozoide contém escasso citoplasma, com nominado de transcrito primário), forma-se a partir do
poucas mitocôndrias; portanto, uma doença causada por DNA e grande parte dele nunca sai do núcleo. Fisicamen-
mutação no mtDNA é herdada exclusivamente da mãe. te, mantém-se ligado a proteínas, formando partículas
Apenas as mulheres podem transmitir as doenças mito- de ribonucleoproteínas heterogêneas nucleares
condriais, passando as mutações para toda a sua prole de (hnRNPs); in vitro, essas partículas tomam a forma de
ambos os sexos. No entanto, essa transmissão não parece pequeninas contas ou glóbulos.
ser tão simples, pois a expressão de alguns genes mito- O hnRNA é formado por regiões codificadoras que
condriais depende da interação com genes nucleares. O são transcritas e traduzidas (éxons) e regiões não codifi-
genoma mitocondrial contém em torno de 1.500 genes, cadoras que são transcritas, mas que não são traduzidas
cuja maioria está distribuída no genoma nuclear. Muitas (íntrons), por isso ele é muito mais longo do que a infor-
proteínas mitocondriais são agregadas de produtos gêni- mação que codifica. Os íntrons são segmentos de hnRNA
cos nucleares e mitocondriais; esses produtos são trans- eliminados ainda no núcleo, como parte do processa-
portados para as mitocôndrias após a transcrição nuclear mento do RNA mensageiro. Essa eliminação é realizada
e a tradução citoplasmática, formando proteínas funcio- por pequenas moléculas de RNA que funcionam como
nais com subunidades de produtos gênicos nucleares e enzimas, denominadas ribozimas. Após a excisão dos
mitocondriais. Portanto, algumas doenças genéticas de íntrons, os segmentos remanescentes (os éxons) reúnem-
origem mitocondrial seguem as leis de Mendel, enquan- -se para formar o RNA mensageiro. A excisão dos íntrons
to as doenças puramente mitocondriais seguem somen- e a reunião dos éxons fazem parte desse processamento,
te a herança materna. Dado que o mtDNA se replica de conforme mostrado na Figura 1.8.
forma independente do DNA nuclear e as mitocôndrias
segregam-se nas células-filhas também de forma inde- Entre 10 e 25% das moléculas de hnRNA são con-
pendente dos cromossomos nucleares, a proporção de vertidos em RNA mensageiro, pois a maior parte do
mitocôndrias que porta uma mutação no mtDNA pode transcrito primário, constituída de íntrons, é degrada-
diferir entre as células somáticas. Essa heterogeneidade é da durante esse evento. Ainda são ignoradas as funções
denominada heteroplasmia e tem importante papel no dos íntrons e as razões pelas quais os genes não são
fenótipo variável das doenças mitocondriais. contínuos. Uma hipótese é a de que os íntrons sirvam
como espaçadores para facilitar a recombinação entre os
Além disso, os tecidos diferem em sua dependência éxons. Sabe-se que somente mutações nos éxons podem
da fosforilação oxidativa, sendo mais dependentes o co- afetar a sequência proteica; no entanto, mutações em ín-
ração, os músculos esqueléticos e o sistema nervoso cen- trons podem afetar o processamento do RNA mensagei-
tral. Portanto, as doenças mitocondriais caracterizam- ro, impedindo, assim, a síntese da cadeia polipeptídica.
-se com mais frequência por miopatias e encefalopatias, A maioria dos genes que codificam proteínas provavel-
problemas dos músculos e do encéfalo, respectivamente. mente surgiu como sequências interrompidas e, certa-
Por fim, a fosforilação oxidativa declina com a idade, tal- mente, a organização de éxons e íntrons foi importante
vez devido ao acúmulo de mutações no mtDNA. Assim, nos primórdios evolutivos dos genes, supondo-se que as
o fenótipo clínico, nas doenças mitocondriais (como sequências de íntrons tenham propiciado o surgimento
LHON), cardiomiopatia hipertrófica com miopatia e de novas e úteis proteínas. O número de íntrons é alta-
diabetes com surdez de herança materna; ver Cap. 5), mente variável, mas nem todos os genes os possuem,
não está direta ou simplesmente relacionado ao genó- como, por exemplo, os genes que codificam as histonas
tipo do mtDNA, mas reflete vários fatores, como os já (proteínas básicas que, juntamente com o DNA e outros
mencionados. componentes, constituem os cromossomos).

1.6.2 RNA mensageiro


1.6 RNA: tipos O RNA mensageiro transfere a informação contida nos
genes estruturais para as sequências de aminoácidos que
Existem quatro tipos principais de RNA, todos trans-
formam os polipeptídeos. É responsável por aproximada-
critos de moldes de DNA por RNA-polimerases e com a
mente 5% do RNA total de uma célula.
mesma estrutura química básica. Esses RNAs têm tama-
nhos diferentes e possuem sequências de bases desiguais O mRNA, após ser processado a partir do pré-mRNA,
que determinam funções específicas. constitui-se apenas de éxons, é relativamente estável e

Borges-Osorio_01.indd 21 29/01/13 13:35


Genética Humana 22

Citoplasma
transporte do mRNA do núcleo
membrana ao citoplasma, para a tradução
nuclear

mRNA cap 5’ 3’ – AAAA... (cauda poli-A)

Núcleo
splicing, emenda ou recomposição

mRNA cap 5’ 3’ – AAAA...


(cauda poli-A)

modificação do mRNA

pré-mRNA
ou hnRNA

transcrição

DNA

5’ sequência 3’ sequência
não codificadora não codificadora

Figura 1.8
Transcrição do DNA em RNA heterogêneo nuclear (hnRNA) e processamento do RNA mensageiro
(mRNA).
Fonte: Lewis.3

possui número variável de nucleotídeos. Esse número extremidade 5' do mRNA, no núcleo. Esse evento parece
pode variar de 100 a 10 mil, considerando-se em conjunto ter grande efeito na tradução do mRNA, pois confere van-
procariotos e eucariotos. tagem ao seu transporte para o citoplasma e à sua ligação
aos ribossomos, além de protegê-lo da degradação pelas
Durante seu processamento, pode ocorrer o cap-
exonucleases celulares endógenas.
ping, isto é, a adição de um nucleotídeo específico mo-
dificado (uma guanina metilada), denominado de 7-me- Outra modificação pós-transcricional do mRNA é a
tilguanosina, trifosfato de guanosina ou cap (capuz), à adição de aproximadamente 200 nucleotídeos de adeni-

Borges-Osorio_01.indd 22 29/01/13 13:35


23 As Bases Moleculares da Hereditariedade
na à sua extremidade 3' (poliadenilação), após a trans- Os ribossomos dos procariotos consistem em partí-
crição, constituindo a chamada sequência poli-A ou culas de 30 S e 50 S que, quando juntas, comportam-se
cauda poli-A. Tal adição ocorre na região flanqueadora como uma partícula de 70 S. Os ribossomos dos euca-
não traduzida, cerca de 15 a 20 pb a jusante de uma se- riotos são um pouco maiores, a subunidade maior apre-
quência de seis nucleotídeos, denominada sinal AAUA- sentando 60 S e a menor, 40 S; quando unidas, compor-
AA. Existe uma hipótese de que essa sequência também tam-se como uma partícula de 80 S (Fig. 1.10). Cerca
esteja associada à maior facilidade de transporte do da metade do conteúdo ribossômico é constituído pelo
mRNA para o citoplasma e sua estabilidade no momento rRNA, que contém de 100 a 5 mil nucleotídeos, seu con-
em que chega ao citoplasma, dando-lhe mais resistência teúdo restante sendo proteínas ribossômicas específicas.
à digestão por exonucleases celulares endógenas, pois a
O rRNA desempenha um papel ativo na função ri-
perda da sequência poli-A pode desencadear a desestabi-
bossômica, pois interage com o tRNA e o mRNA em cada
lização desse mRNA. Esses eventos estão representados
etapa da tradução, facilitando o reconhecimento entre
na Figura 1.8.
códons e anticódons e auxiliando na ligação desses RNAs
aos ribossomos.
1.6.3 RNA transportador ou RNA de
transferência 1.6.5 Outros RNAs
Esse RNA é responsável por até 15% do RNA total de Existem outros tipos de RNAs, principalmente nos eu-
uma célula, sendo relativamente pequeno, com 70 a 90 cariotos, que não participam diretamente da tradução,
nucleotídeos. É estável, sendo uma molécula altamente mas têm papéis definidos. Por exemplo, o RNA da te-
especializada e importante para a síntese de proteínas; lomerase é envolvido na replicação do DNA nas extre-
durante a tradução, sua configuração torna-o apto a re- midades dos cromossomos, o RNA nuclear pequeno
conhecer e ligar-se a aminoácidos por uma de suas extre- (snRNA) participa do processamento de mRNAs, e o
midades, transportando-os para o ribossomo, e a códons RNA antissenso, o microRNA (miRNA), e o pe-
determinados no mRNA, pela outra extremidade. Algu- queno RNA interferente (siRNA) estão envolvidos
mas das bases do tRNA estabelecem ligações fracas entre na regulação gênica de eucariotos. Os miRNAs são for-
si, fazendo com que esse tRNA forme alças, que lhe confe- mados por longas moléculas de fita simples de RNA,
rem um aspecto de folha de trevo. Cada aminoácido pos- codificados por mais de 200 genes e podem suprimir a
sui um ou mais tRNAs que lhe são específicos. Tal espe- tradução; o siRNA resulta da clivagem de longas molécu-
cificidade depende de uma série de enzimas complexas, las de RNA de fita dupla em fragmentos menores que po-
as aminoacil-tRNA-sintetases, havendo uma dessas dem induzir a degradação de um mRNA complementar.
para cada aminoácido. Em uma das alças do tRNA exis- Mais informações podem ser obtidas em Lewin5 e Klug e
te uma sequência de três bases que são complementares colaboradores.4
a um conjunto de igual número de bases no mRNA. As
bases do mRNA denominam-se códon, enquanto as do
tRNA, anticódon. Este último é o responsável pelo re-
conhecimento do códon correto. O tRNA carregando um
aminoácido é denominado aminoacil-tRNA (Fig. 1.9).
1.7 Funções do DNA
1.7.1 O DNA tem função autoduplicadora
1.6.4 RNA ribossômico É de fundamental importância que o material genético
Esse tipo de RNA, que pode constituir cerca de 80% do seja capaz de autoduplicação ou autorreplicação, e
RNA total da célula, é sintetizado nos nucléolos, asso- que esta se dê corretamente a cada divisão celular.
ciando-se a certas proteínas ribossômicas sintetizadas no
Como as fitas polinucleotídicas são unidas apenas
citoplasma e transportadas para os nucléolos, para for-
por pontes de hidrogênio, elas são facilmente separáveis.
mar os ribossomos, nos quais se dá a tradução genética,
No momento da replicação, essas ligações se rompem e
ou seja, a síntese proteica. Essas organelas celulares são
a dupla-hélice abre-se, com o auxílio de enzimas deno-
compostas de mais de 50 proteínas diferentes e de diver-
minadas DNA-helicases, liberando seus terminais para
sas moléculas de rRNA, existindo milhões delas em uma
ligarem-se a novos nucleotídeos específicos. Cada fita
célula viva típica.
dirige e serve de molde para a síntese de uma nova fita,
Os ribossomos são constituídos de duas subunidades por complementaridade do pareamento de bases, a partir
de tamanhos diferentes, produzidas no nucléolo, que es- de nucleotídeos presentes no núcleo da célula. O prin-
tão comumente separadas no citoplasma, juntando-se no cípio do pareamento complementar de bases estabelece
local da síntese proteica. Os tamanhos dessas subunida- que uma base não pareada atraia um nucleotídeo livre
des são determinados pelo coeficiente de sedimentação, somente se ele lhe for complementar. Os nucleotídeos
que é a medida da velocidade com que uma partícula so- são unidos por ação da enzima DNA-polimerase, sen-
fre sedimentação, quando ultracentrifugada, expressa em do ligados à fita-molde por novas pontes de hidrogênio,
unidades Svedberg (S). Quanto maior o valor de S, maior com o auxílio de outra enzima, a DNA-ligase. A DNA-
será a molécula. -polimerase também faz um procedimento de revisão

Borges-Osorio_01.indd 23 29/01/13 13:35


Genética Humana 24

Figura 1.9 AMINOÁCIDO


Representação esquemática do RNA transportador. As
bases identificadas na figura são praticamente inva-
riantes. As denominações dos braços D e T referem-se A
às bases ␺ (pseudouridina) e D (di-hidrouridina), deri- C extremidade 3’
vadas do uracil. C
Fonte: Modificada de Lewin.9 extremidade 5’ G

braço aceitador

braço D braço T ou T C

Py
U* A*
C
A Pu
Py G
G* C
Pu Py T
G A

braço do anticódon
Py*
U Pu*
braço adicional

A A A anticódon

G G A U U U U A G códons
mRNA

Figura 1.10 Procariotos Eucariotos


30S 40S
Representação esquemática dos Ribossomo Ribossomo
ribossomos de procariotos e
70S 80S
eucariotos.

50S 30S 60S 40S

rRNA rRNA

5S 23S 16S 5S 28S 5,8S 18S

e cerca de e cerca de
e 34 proteínas e 21 proteínas
50 proteínas 33 proteínas

Borges-Osorio_01.indd 24 29/01/13 13:35


25 As Bases Moleculares da Hereditariedade
de leitura, no qual um nucleotídeo recém-adicionado é bidirecional, formam-se duas forquilhas de replicação e
conferido para que haja certeza de sua complementarida- elas partem da origem, uma em direção à outra, até se en-
de à base da fita-molde. Caso negativo, esse nucleotídeo contrarem (Figs. 1.11 e 1.12A). As forquilhas de repli-
é removido e substituído pelo nucleotídeo complementar cação mais próximas entre si estão separadas por cerca de
correto. Tal procedimento reforça a precisão da replica- 30 a 300 kb e ocorrem em unidades de replicação ou
ção do DNA. No caso de não haver esse reparo, caracteri- replicons que contêm entre 20 e 80 origens de replica-
za-se uma mutação. ção (ou forquilhas de replicação). Assim, a replicação do
DNA realiza-se descontinuamente, com posterior união
A duplicação do DNA é passível de se iniciar, ao
pela DNA-ligase entre os pequenos segmentos recém-
mesmo tempo, em vários pontos da fita, podendo ser uni
-formados. Os menores segmentos, com no máximo 150
ou bidirecional. O ponto no qual ela se origina é denomi-
nucleotídeos, são os denominados fragmentos de Okazaki
nado forquilha de replicação, origem de replica-
(Fig. 1.12B).
ção ou ponto de crescimento. O primeiro passo na
replicação do DNA ocorre quando uma helicase rompe Vista ao microscópio eletrônico, a região replicada
as pontes de hidrogênio, mantendo junto um par de ba- aparece como um olho ou uma bolha dentro do DNA
ses, em um sítio de iniciação. Outra enzima, conheci- não duplicado. À medida que a replicação prossegue, uma
da como primase, atrai nucleotídeos de RNA comple- determinada bolha expande-se até encontrar outras bo-
mentares para formar uma pequena sequência de RNA lhas, às quais se funde.
denominada iniciador de RNA, desencadeador ou
Completadas as novas ligações, cada uma das molé-
primer, no início de cada segmento de DNA a ser du-
culas recém-formadas de DNA tem uma das fitas origi-
plicado. Esse iniciador de RNA é necessário, pois o DNA
nais e outra proveniente dos novos nucleotídeos. Por essa
não pode iniciar uma nova fita de ácido nucleico por si
razão, a duplicação do DNA é chamada de semiconser-
próprio. O iniciador de RNA atrai a DNA-polimerase,
vativa (Fig. 1.13).
que então reúne os nucleotídeos complementares às ba-
ses da fita-molde de DNA. A nova fita de DNA começa a
crescer, à medida que se formam as ligações de hidrogê-
nio entre as bases complementares. O iniciador de RNA
é removido enzimaticamente, sendo substituído pelas Olhos de replicação podem ser uni- ou bidirecionais
bases corretas do DNA. As ligações necessárias entre os REPLICAÇÃO UNIDIRECIONAL
nucleotídeos da nova fita de DNA são realizadas cataliti-
camente pelas ligases. ORIGEM
Na forquilha de replicação, cada uma das fitas de Forquilha de replicação
DNA serve como molde para a síntese do novo DNA.
Antes, nessa região, a dupla-hélice é desenrolada por
um sistema enzimático. Como as fitas parentais não são
paralelas, a replicação do DNA só pode prosseguir con- DNA replicado
tinuamente em uma das fitas, na direção 5'-3', denomi- DNA
nada fita de replicação contínua. Ao longo da fita 3'- parental
5', chamada fita de replicação descontínua, o novo
DNA se forma por meio de pequenos segmentos de mil a
2 mil bases em procariotos e de 200 bases em eucariotos, REPLICAÇÃO BIDIRECIONAL
chamados fragmentos de Okazaki, em homenagem ao
seu descobridor. Na fita de replicação descontínua, é ne- ORIGEM
cessário um pequeno segmento de RNA como iniciador.
Esse iniciador é produzido por uma RNA-polimerase, de- Forquilha de replicação Forquilha de replicação
nominada primase. A seguir, uma exonuclease remove
o iniciador de RNA, o DNA é inserido nessa lacuna pela
DNA-polimerase I e, finalmente, os segmentos de DNA
são unidos pela DNA-ligase. A enzima responsável pela
síntese de DNA (DNA-polimerase III) é complexa, com-
preendendo diversas subunidades.
Nos eucariotos, há diferentes enzimas para as fitas
de replicação contínua e descontínua. Durante a replica- Figura 1.11
ção, os erros são eliminados por um complexo mecanis-
mo de reparo: a revisão de leitura, em que as bases in- Replicação do DNA. A – Forquilha de replicação
corporadas erroneamente são removidas e substituídas ou ponto crescente: ponto de origem da repli-
cação do DNA. B – A replicação pode ser uni ou
pelas corretas.
bidirecional, segundo se formem, na origem, uma
Na replicação unidirecional, a forquilha de replica- ou duas forquilhas de replicação.
ção parte da origem e prossegue ao longo do DNA. Na Fonte: Lewin.5

Borges-Osorio_01.indd 25 29/01/13 13:35


Genética Humana 26

A
3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’

DNA-
primer de -helicase
RNA

DNA DNA-
-polimerase

DNA-ligase

olho ou

bolha
de
replicação

5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’
molde desenrolamento o DNA duas moléculas-filhas
do DNA inicial do DNA em substitui os de DNA
extensão
parental vários pontos de primers
dos primers
origem e síntese de RNA
dos primers de
RNA
B

3’5’

3’5’

3’5’
unidos pela
DNA-ligase
fragmentos
de Okazaki

5’ 3’ 5’ 3’ 5’ 3’

Figura 1.12
A – Etapas da replicação do DNA. As fitas parentais são mostradas em laranja-escuro para
distingui-las do novo DNA replicado, apresentado em laranja-claro. A replicação começa com
o desenrolamento da dupla-hélice, em vários pontos de origem, e a síntese dos iniciadores de
RNA. A DNA-polimerase estende esses iniciadores, que são substituídos depois pelo DNA e as
pequenas sequências replicadas são unidas pela DNA-ligase. B – Replicação do DNA mostrando
os fragmentos de Okazaki, que posteriormente são unidos pela DNA-ligase.
3
Fonte: Lewis.

Borges-Osorio_01.indd 26 29/01/13 13:35


27 As Bases Moleculares da Hereditariedade
Figura 1.13
Replicação semiconservativa do
DNA. Cada uma das fitas de DNA é
usada como molde para a formação
de uma nova fita complementar; as-
molécula original sim, cada molécula recém-formada
de DNA conserva uma das fitas ori-
ginais, unida a outra proveniente dos
novos nucleotídeos.

moléculas-filhas da
primeira geração

moléculas-filhas da
segunda geração

Em geral, a replicação inicia-se em diferentes mo- do toda a fisiologia do organismo), anticorpos (proteínas
mentos da fase S da interfase do ciclo celular, até que responsáveis pela defesa do organismo, eliminando es-
todo o DNA se duplique, formando duas moléculas-filhas truturas proteicas estranhas e desempenhando um papel
completas. Ao fim dessa replicação é que tem início a importante nas infecções e nos transplantes) e hormô-
divisão celular. É a autoduplicação que garante a trans- nios (proteínas formadas em órgãos específicos e trans-
missão do material genético de uma célula para as suas portadas pelo sangue para outras regiões do organismo,
descendentes. com a finalidade de regular o seu funcionamento nor-
mal). Os aminoácidos possuem a composição química
1.7.2 DNA comanda a síntese de proteínas básica mostrada na Figura 1.14, em que –COOH é um
grupo ácido carboxílico e –NH2 é o grupo amino, básico.
O DNA também é responsável pela síntese das proteínas A diferença entre um aminoácido e outro está no radical
necessárias ao funcionamento celular. Essas proteínas (R) que se liga a esses grupos. Dois aminoácidos unem-
são formadas por sequências de aminoácidos, e suas -se pelas ligações peptídicas, formadas pela reação de um
características funcionais variam de acordo com o nú- grupo amino de um aminoácido com o grupo carboxila
mero e a posição desses aminoácidos em sua molécula. do aminoácido seguinte.
Existem proteínas estruturais (que conferem a forma ao
organismo, pois constroem as paredes celulares, mem- As sequências da proteína são convencionalmente
branas nucleares, conteúdo citoplasmático e organelas), escritas na ordem do aminoácido com o grupo NH2 livre
enzimas (proteínas especializadas na catálise de reações (N terminal), correspondendo à extremidade 5' da fita do
biológicas, com extraordinária especificidade; estão en- mRNA, para o aminoácido com o grupo COOH livre (C
volvidas nas atividades metabólicas celulares, controlan- terminal), correspondendo à extremidade 3' do mRNA.

Borges-Osorio_01.indd 27 29/01/13 13:35


Genética Humana 28

A Aminoácido livre
H H H H
Comuns a todos os Estrutura
␣-aminoácidos das proteínas
N C C N C C1 primária
H O CH3

H
N C
+ H O
H3N C ␣ COOH C
O N C

Grupo R Grupo CH C R
amino carboxila O C N
H
C
N 2 Estrutura
O secundária
R C H
O
A cadeia O carbono ␣ N C
lateral é distinta encontra-se H
C
para cada entre os grupos O
aminoácido. carboxila e amino NC
C H C R
N
B Aminoácidos combinados R C H
em ligações peptídicas

NH-CH-CO-NH-CH-CO
Estrutura
3
R R terciária

As cadeias laterais
determinam as propriedades
das proteínas

Figura 1.14
Características estruturais dos ami- 4 Estrutura
quaternária
noácidos. A – Aminoácido livre.
B – Aminoácidos combinados em
ligações peptídicas.
Fonte: Champe e colaboradores.10

A Figura 1.15 mostra os quatro níveis estruturais Figura 1.15


de uma proteína. A sequência de aminoácidos que forma Os quatro níveis estruturais de uma
uma cadeia polipeptídica constitui a estrutura primária da proteína.
proteína. A estrutura secundária é produzida por dobra- Fonte: Champe e colaboradores.10
mentos da sequência primária, devido a ligações químicas
entre aminoácidos muito próximos entre si, criando sítios
ativos ou aspecto estrutural. Essa estrutura secundária
A hemoglobina, por exemplo, uma proteína carrea-
confere organização espacial ao esqueleto polipeptídico,
dora de oxigênio situada nas hemácias, apresenta quatro
dando funcionalidade à molécula. A estrutura terciária
cadeias polipeptídicas; a ferritina, uma proteína do fíga-
é a organização completa em três dimensões de todos os
do, tem 20 polipeptídeos idênticos, com 200 aminoácidos
átomos na cadeia polipeptídica, em decorrência da intera-
cada um; em compensação, a mioglobina, uma proteína
ção entre os aminoácidos e a água circulante, incluindo os
muscular, apresenta uma única cadeia polipeptídica.
grupos laterais, bem como o esqueleto polipeptídico. Um
grau mais alto de organização é encontrado nas proteínas
1.7.2.1 Síntese proteica
multiméricas, formadas por agregados de mais de uma ca-
deia polipeptídica. A conformação assumida pela proteína A síntese proteica se dá em duas fases: transcrição e
multimérica é sua estrutura quaternária. tradução.

Borges-Osorio_01.indd 28 29/01/13 13:35


29 As Bases Moleculares da Hereditariedade
Transcrição direta: DNA → RNA – A transcrição é que se denomina fita codificadora, fita-sentido ou
o processo pelo qual a informação genética é transmitida fita com sentido, e é complementar à outra fita do
do DNA para o RNA. DNA, a fita-molde ou fita antissentido, que fornece o
molde para sua síntese. A Figura 1.16 mostra a relação
Para formar uma fita simples de RNA, a fita dupla de
entre o DNA de fita dupla e o RNA de fita simples.
DNA abre-se no sentido longitudinal pela quebra das pon-
tes de hidrogênio, deixando livres os terminais das bases. Em procariotos, existe uma só RNA-polimerase
Os nucleotídeos do RNA pareiam-se com os do DNA, obe- (enzima que catalisa a síntese do RNA), mas em eucario-
decendo à mesma especificidade no pareamento das bases: tos existem pelo menos três tipos: (a) RNA-polimerase
I, que transcreve os RNAs ribossômicos; (b) RNA-po-
Bases do DNA Bases do RNA limerase II, que transcreve o RNA mensageiro e parte
dos pequenos RNAs nucleares; e (c) RNA-polimerase
G (guanina) C (citosina)
III, que transcreve o RNA transportador e alguns RNAs
C (citosina) G (guanina) ribossômicos e outros pequenos RNAs nucleares.
T (timina) A (adenina) A estrutura de um gene humano hipotético é mostra-
da na Figura 1.17, na qual são vistos seus componentes
A (adenina) U (uracil)
típicos que interessam à transcrição.
Essa nova fita que se forma usando uma das fitas do A transcrição inicia-se quando a enzima RNA-po-
DNA como molde é o RNA, idêntico em sequência (exceto limerase II se liga ao promotor, sítio promotor ou
por ter uracil no lugar de timina) a uma das fitas do DNA, região promotora, que pode se situar a várias cente-

Uma fita do DNA é transcrita em RNA Figura 1.16


Fita codificadora Relação entre o DNA de
= 5⬘ TACGCGGTACGGTCAATGCATCTACCT fita dupla e o RNA de fita
3⬘ ATGCGCCATGCCAGTTACGTAGATGGA simples. A função da RNA-
Fita molde
-polimerase é copiar uma
fita dupla de DNA em RNA.
A sequência de RNA é
TRANSCRIÇÃO Fonte: Lewin.5
complementar à fita molde
e idêntica à fita codificadora

Transcrito de RNA
= 5⬘ UACGCGGUACGGUCAAUGCAUCUACCU

Códon iniciador da transcrição Códon finalizador da transcrição

boxe boxe
GC CAT TATA box

éxon 1 éxon 2 éxon 3


5’ região
flanquea- 3’
dora região
região íntron 1 íntron 2 flanquea-
promotora
dora
início da finalização da sinal para a
tradução tradução poliadenilação
do mRNA

Figura 1.17
Representação esquemática de um gene estrutural humano típico, mostrando a região flanqueadora an-
tecedente – que constitui o sítio ou a região promotora da transcrição do gene –, o códon de iniciação ou
iniciador da transcrição, os éxons e os íntrons, o códon de finalização ou finalizador, e a região flanquea-
dora subsequente, com o sinal para a poliadenilação do RNA mensageiro (mRNA).

Borges-Osorio_01.indd 29 29/01/13 13:35


Genética Humana 30

nas de pares de bases do local de início da transcrição. las é o encadeamento (splicing) ou recomposição
Já foram identificadas diversas sequências específicas do do mRNA, que consiste na remoção de todos os íntrons
promotor (denominadas boxes), sendo as seguintes as do pré-mRNA e junção dos éxons não contíguos, forman-
mais comuns: GC, TATA e CAAT. O promotor circunda o do, ao fim dessa etapa, uma molécula de mRNA muito
primeiro par de bases que é transcrito em RNA, o códon menor, funcional, com uma sequência codificadora inin-
iniciador, e a RNA-polimerase II move-se ao longo da terrupta composta só de éxons, que sai do núcleo pelos
fita-molde até atingir um códon finalizador. O produto poros da membrana nuclear e se localiza junto aos ribos-
imediato da transcrição é denominado transcrito pri- somos, no citoplasma.
mário, RNA primário, RNA heterogêneo nuclear
ou pré-mRNA, consistindo em um RNA que se estende Os íntrons podem ser classificados em diversos gru-
do códon iniciador ao códon finalizador, na direção 5'- pos, de acordo com os mecanismos de encadeamento. Os
3'. Entretanto, esse transcrito primário é quase sempre íntrons do grupo I, que fazem parte do transcrito primá-
instável: em procariotos, é rapidamente modificado em rio dos RNAs ribossômicos, não precisam de componentes
mRNA ou clivado em produtos maduros (rRNA e tRNA); adicionais para sua excisão, pois são dotados de autoexci-
em eucariotos, sofre várias modificações em suas extre- são. Os íntrons do grupo II, que fazem parte dos transcritos
midades, dando origem ao mRNA. primários dos mRNA e tRNA produzidos nas mitocôndrias,
também são dotados de autoexcisão. Os íntrons do grupo
A transcrição é o primeiro estágio na expressão gêni- III, que fazem parte do transcrito primário do mRNA pro-
ca, sendo controlada por proteínas reguladoras que de- veniente do núcleo, são maiores dos que os dos grupos an-
terminam se um gene específico está disponível para ser teriores e são mais abundantes; sua remoção necessita de
transcrito pela RNA-polimerase. O primeiro passo na re- um mecanismo muito mais complexo, a seguir descrito.
gulação é o da decisão sobre transcrever ou não um gene.
Como a célula reconhece os íntrons que devem ser
Durante a transcrição, distinguem-se as seguintes removidos? Ainda que nos diferentes organismos existam
etapas: vários tipos de encadeamento ou splicing, nos eucariotos
superiores os íntrons apresentam pequenas sequências de
1. Reconhecimento do molde: começa com a liga- nucleotídeos iguais ou muito semelhantes, situadas nas
ção da RNA-polimerase II ao sítio promotor do gene. suas extremidades ou próximas a elas, denominadas pe-
Nesse local, a dupla-hélice do DNA se desenrola e se quenas sequências de consenso (assim chamadas por-
separa para constituir o molde, criando-se a bolha de que são comuns a todos os genes eucariotos), que atuam
transcrição. como sinal para a sua remoção. As extremidades dos ín-
2. Início: nessa etapa, são sintetizadas e liberadas as trons consistem em um sítio de splicing 5' (ou sequên-
primeiras sequências, com dois a nove nucleotídeos, cia doadora), formado pelo dinucleotídeo GU (também
terminando quando a enzima se libera do promotor e representado por GT, no DNA) e um sítio de splicing
a fita ultrapassa o comprimento mencionado; o pro- 3' (ou sequência aceptora), formado pelo dinucleotídeo
motor é caracterizado por uma sequência de DNA AG. A presença constante desses nucleotídeos nas duas
necessária para que a RNA-polimerase II se ligue ao primeiras posições (GU no RNA, GT no DNA) e nas duas
molde e realize a reação de início. Essa fase também últimas (AG em ambos) dos íntrons dos genes nucleares
é conhecida como iniciação. é denominada regra GU-AG (originalmente chamada
regra GT-AG). Essas e outras sequências de consenso dos
3. Alongamento: à medida que se move ao longo do íntrons atraem moléculas específicas, que formam um
DNA, a RNA-polimerase II alonga a fita de RNA; complexo molecular essencial, denominado encadeosso-
essa enzima desenrola a dupla-hélice de DNA, ex- mo (ou spliceossomo). O encadeossomo contém cinco
pondo um novo segmento da fita-molde, com o qual pequenas ribonucleoproteínas nucleares (snRNPs, do in-
pareiam os nucleotídeos da fita de RNA em cresci- glês small nuclear ribonucleoproteins, snurps), 70 fatores
mento e, atrás dessa região desenrolada, a fita-molde de encadeamento necessários à montagem do complexo e
de DNA pareia com sua fita complementar, para res- cerca de 70 proteínas associadas, parte delas com ativida-
tabelecer a dupla-hélice. Finalmente, o RNA emerge des em outros estágios da expressão gênica.
como uma fita simples livre.
A função dos snRNPs é aproximar as duas extre-
4. Finalização ou terminação: consiste no reco-
midades de um íntron, para removê-lo. Essa remoção é
nhecimento do ponto a partir do qual nenhuma
mostrada na Figura 1.19 e ocorre da seguinte maneira:
base mais é adicionada à fita de RNA. Quando a úl-
(a) em cada íntron, um grupo de snurps liga-se ao RNA e
tima base lhe é adicionada, tanto a RNA-polimerase
corta o íntron na sua extremidade 5' (sequência doadora
II quanto a fita de RNA são liberadas, esta última
5'), separando o éxon da esquerda (éxon 1) e o conjun-
passando a se chamar RNA heterogêneo nuclear ou
to íntron-éxon da direita (íntron-éxon 2); (b) o éxon 1
pré-mRNA. A Figura 1.18 mostra a transcrição do
mostra-se como uma molécula linear e o conjunto íntron-
RNA a partir do DNA.
-éxon 2 toma a forma de um laço ou alça; para tanto, uma
Antes de sair do núcleo como mRNA, o pré-mRNA base específica (adenina) situada no interior do íntron,
sofre várias modificações, conjuntamente denominadas na sequência denominada sítio ou ponto de ramifica-
processamento pós-transcricional. A primeira de- ção, une-se à extremidade 5' gerada pelo corte no íntron,

Borges-Osorio_01.indd 30 29/01/13 13:35


31 As Bases Moleculares da Hereditariedade
RNA- Códon iniciador
-polimerase (start of the gene)

Sítio Sequência- Sequência gênica Códon finalizador


promotor -líder (em
alguns genes) A. Início
RNA Nucleotídeos
do RNA

RNA-polimerase
G
Fita-molde de DNA
B. Alongamento T C G A C T GG G
RNA

U C G A C U
A G C T G A C C

3'
Sentido da
transcrição
C. Finalização ou terminação

Figura 1.18
Etapas da transcrição do RNA a partir do DNA. A – A RNA-polimerase liga-se à sequência de DNA em um
sítio promotor. B – A RNA-polimerase adiciona nucleotídeos à fita de RNA em crescimento, à medida que
o DNA se desenrola. C – A transcrição cessa e a nova molécula de RNA é separada de seu molde.
Fonte: Lewis.2

dando a este último a forma de laço ou alça; (c) a extre- mina) em um códon UAA (de finalização) e terminando o
midade 3 do éxon 1 reage com a extremidade 5' do éxon polipeptídeo com aproximadamente a metade do compri-
2, cortando o íntron em sua extremidade 3' e liberando mento codificado no genoma.
esse íntron em forma de laço ou alça, ao mesmo tempo
As outras modificações que ocorrem no mRNA antes
ligando ambos os éxons; o laço é desfeito, dando origem a
de sair do núcleo são o capping, na sua extremidade 5',
um íntron linear excisado, que é rapidamente degradado.
e a poliadenilação na sua extremidade 3', já descritas.
O encadeamento assim descrito representa uma A Figura 1.18 mostra esquematicamente o processamento
das formas de regulação potencial da expressão gênica pós-transcricional do mRNA. A molécula desse ácido nu-
em eucariotos. Por exemplo, há outros casos em que os cleico leva o código do DNA (a mensagem) até os ribosso-
éxons derivados do mesmo gene são encadeados de ma- mos, no citoplasma.
neiras diferentes, resultando em mRNAs com diferentes
Transcrição reversa: RNA → DNA – Inicialmente,
éxons. Esse tipo de encadeamento alternativo pro-
acreditava-se que a informação genética era transcrita
duz mRNAs semelhantes, mas não idênticos, que após
apenas do DNA para o RNA e, então, traduzida em pro-
a tradução resultam em proteínas relacionadas, chama-
teína. Entretanto, a partir do estudo de certos vírus cujo
das isoformas. O encadeamento alternativo é abordado
material genético é o RNA, denominados retrovírus,
também na seção 1.8.2.3.
existem evidências de que estes últimos são capazes de
Outra forma de processamento pós-transcricional do reverter o fluxo no processo normal de informação do
RNA é a chamada edição do RNA, em que a sequência DNA para o RNA. Tal processo é feito graças à enzima
nucleotídica de um pré-mRNA é mudada antes da tra- transcriptase reversa, que é capaz de sintetizar uma
dução, resultando um mRNA maduro com sequências fita dupla de DNA, copiando o RNA do cromossomo vi-
diferentes das sequências codificadas nos éxons do DNA ral. O DNA é chamado de provírus e incorporado ao
do qual esse RNA foi transcrito. A edição pode dar-se por DNA do hospedeiro, durante o ciclo vital do vírus. Esse
substituição ou por deleção/inserção de nucleotídeos, a processo é referido como transcrição reversa ou
primeira sendo mais encontrada entre os eucariotos. Um síntese de DNA dirigida pelo RNA. A homologia
exemplo observado em humanos é o da apolipoproteína entre sequências de oncogenes humanos e retrovirais
B (apo B), que existe em uma forma longa e outra cur- (ver Cap. 12) poderia representar uma evidência desse
ta, codificadas pelo mesmo gene. Em células intestinais mecanismo e constituir uma importante abordagem te-
humanas, o mRNA da apo B é editado com uma simples rapêutica no tratamento das doenças hereditárias em
troca de C para U, convertendo um códon CAA (de gluta- humanos (ver Cap. 17).

Borges-Osorio_01.indd 31 29/01/13 13:35


Genética Humana 32

sítio de ramificação
Figura 1.19
sítio 5’ doador da emenda U2 snRNP sítio 3’ aceptor da emenda
Encadeamento, recom- U1 snRNP
posição ou splicing do
éxon 1 íntron éxon 2
mRNA, que consiste na re- parte do transcrito
moção de todos os íntrons 5’ GU A AG 3’ primário
do pré-mRNA e junção dos
éxons não contíguos. GU e U4/U6 snRNP
AG, sequências de consen- U5 snRNP
so; snRNP, pequena ribo-
U4/U6 snRNP
nucleoproteína nuclear; A,
adenina.
Fonte: Modificada de Alberts e
7
colaboradores.
A
5’ 3’

U5 snRNP
Formação de laço e
clivagem do sítio 5’
doador da emenda

laço

OH A
3’
5’ 3’

Clivagem do sítio 3’ aceptor da


emenda e união das duas
sequências de éxon

sequência do íntron cortada


na forma do laço
A
(será degradada no núcleo)
3’
OH

éxon 1 éxon 2
parte do
5’ 3’ mRNA

A Figura 1.20 mostra a concepção atual dos papéis de energia (ATP) e vários fatores proteicos. As etapas da
da replicação, transcrição e tradução do DNA no dogma tradução podem ser resumidas do seguinte modo:
da genética molecular.
1. Início: O mRNA leva a mensagem copiada do DNA
até os ribossomos, organelas citoplasmáticas situa-
1.7.2.2 Tradução: mRNA → cadeia polipeptídica das nas paredes do retículo endoplasmático e local
A tradução é o segundo evento na síntese proteica, con- da síntese proteica. Uma curta sequência de bases
sistindo na transmissão da informação genética do mRNA no início de cada mRNA, denominada sequência-
para um polipeptídeo. A Figura 1.21 ilustra esquemati- -líder, habilita-o a ligar-se às pequenas subunidades
camente esse processo, do qual participam muitos com- dos ribossomos por meio de pontes de hidrogênio. O
ponentes celulares: mRNA, tRNA, ribossomos (rRNA + primeiro códon do mRNA a especificar um aminoáci-
proteínas), aminoácidos, moléculas de armazenamento do é AUG, que atrai um tRNA iniciador, o qual trans-

Borges-Osorio_01.indd 32 29/01/13 13:35


33 As Bases Moleculares da Hereditariedade
ticódon e o segundo códon do mRNA. A seguir, os dois
primeiros aminoácidos estabelecem ligações peptídicas
entre eles, com o auxílio de uma ribozima. A parte do
DNA ribossomo que mantém juntos o mRNA e o tRNA tem
dois sítios: o sítio P (de peptidil) mantém a cadeia poli-
Replicação peptídica crescente e o sítio A (de aminoacil) mantém o
Transcrição Transcrição
reversa próximo aminoácido a ser adicionado à cadeia. Na Figura
1.21, met ocupa o sítio P e gly, o sítio A. Os ribossomos,
RNA por intermédio do rRNA, mantêm o controle da sínte-
se, de tal forma que os aminoácidos sejam reunidos na
Replicação mesma ordem dos códons do RNA, transcritos do DNA.
Tradução Assim, a pequena subunidade ribossômica está associada
ao mRNA, e a grande subunidade, à cadeia polipeptídica
recém-iniciada. Nesse momento, o primeiro tRNA é libe-
Proteína
rado para buscar outra metionina, que poderá ser utili-
zada ou não na cadeia polipeptídica. Durante a formação
da cadeia polipeptídica, os ribossomos, com o auxílio de
fatores de alongamento, movem-se ao longo do mRNA,
traduzindo cada um dos códons. À medida que vão sendo
Figura 1.20 liberados pelos ribossomos, os tRNAs podem ser reutili-
Concepção atual dos papéis da replicação, trans-
zados no transporte de outros aminoácidos que lhes são
crição e tradução do DNA, no dogma central da específicos. E assim se processam os demais passos do
genética molecular. A replicação é responsável alongamento da tradução.
pela herança da informação genética; a trans-
A tradução continua até que a mensagem seja lida
crição e a tradução são responsáveis pela sua
por inteiro, e o término da síntese se dá quando é encon-
conversão em proteína. A transcrição do DNA em
RNA pode ser reversível, mas a tradução do RNA trado um dos códons finalizadores (UAG, UAA ou UGA)
em proteína é irreversível. no mRNA.
Fonte: Lewin.5 3. Finalização ou terminação: Assim que um có-
don de finalização é alcançado, há fatores de libe-
ração dependentes de GTP que auxiliam a cadeia
polipeptídica recém-formada a se desligar do ribos-
somo, que se dissocia em suas subunidades. A cadeia
porta o aminoácido metionina (met). Esse aminoáci-
polipeptídica é utilizada na célula ou secretada. Se
do, portanto, é o início da cadeia polipeptídica, sendo
um códon de finalização surgir no meio de uma mo-
geralmente removido antes do término de sua sínte-
lécula de mRNA em virtude de uma mutação, ocor-
se. A pequena subunidade do ribossomo, o mRNA
rerá o mesmo processo, e a cadeia polipeptídica será
a ela ligado e o tRNA iniciador com seu aminoácido
terminada prematuramente.
(nos procariotos, N-formilmetionina, f-met; nos eu-
cariotos, metionina ou met), auxiliados por fatores Durante a tradução, depois que um ribossomo per-
proteicos de iniciação que reforçam a ligação desses correu certo trecho ao longo do mRNA, um segundo ri-
elementos, formam o complexo de iniciação. bossomo pode se ligar ao primeiro, o que é possível ocor-
rer em um espaço de cerca de 70 a 90 nucleotídeos entre
Para que se incorporem à cadeia polipeptídica em
os ribossomos. Assim, uma molécula de mRNA de 450
formação, os aminoácidos devem ser primeiramente ati-
nucleotídeos, como, por exemplo, um polipeptídeo da he-
vados, reagindo com moléculas de ATP. Cada aminoácido
moglobina, pode ter cinco ou seis ribossomos unidos si-
assim ativado liga-se, então, a uma extremidade do tRNA
multaneamente durante a tradução, cada um sintetizando
específico, que é identificado pelo seu anticódon. Este
um polipeptídeo separado. Esses grupos de ribossomos
último faz um pareamento complementar de bases com
são denominados de polirribossomos ou polissomos.
um códon adequado do mRNA. Assim, o mRNA especi-
fica a sequência de aminoácidos, atuando por intermédio Nos eucariotos, a tradução é mais complexa: ocor-
do tRNA. re em ribossomos maiores, com rRNA e proteínas mais
complexas, e no citoplasma, separadamente da trans-
2. Alongamento: Resumidamente, essa etapa pode-
crição, que ocorre no núcleo. Essa separação proporcio-
ria ser descrita em três passos: reconhecimento do
na múltiplas ocasiões de regulação da expressão gênica
códon, ligação peptídica ao aminoácido adjacente e
nas células eucarióticas. Por ter cap na extremidade 5',
movimentação do ribossomo na direção 3' do mRNA.
o mRNA é traduzido de maneira eficiente. Além disso, a
Os tRNAs transportam os aminoácidos ativados até maioria dos mRNAs eucarióticos contém uma sequência
o complexo de iniciação (ao qual se liga a grande subu- curta de reconhecimento em torno do códon de início
nidade do ribossomo). O tRNA que transporta o segundo AUG, diferente da que se encontra na tradução em pro-
aminoácido forma pontes de hidrogênio entre seu an- cariotos (AGGAGG, antecedente ao códon iniciador AUG

Borges-Osorio_01.indd 33 29/01/13 13:35


Genética Humana 34

Início Alongamento
1 2
• O mRNA liga-se a uma pequena • Ligação da grande subunidade ribossômica.
subunidade ribossômica. • O tRNA que transporta o segundo aminoácido
• O tRNA que traz a metionina (met) (gly) liga-se ao segundo códon do mRNA no
liga-se ao mRNA. sítio A.
• Formação de ligação peptídica entre met e
gly.
Ribossomo
(pequena e grande subunidades)

Pequena
AU subunidade P A
G mRNA
ribossômica
G
G

A U G G G A U G U A A G C G A A
A
U

G U A C C C U
U
AA
G
CG mRNA tRNA
A
AC A Alongamento
U
3
met gly
GTP e • O primeiro tRNA separa-se.
t
me fatores proteicos Cadeia de Ligação peptídica • O ribossomo move-se por um códon
aminoácidos do mRNA na direção 3'. O antigo sítio
tRNA
A torna-se o novo sítio P.
• O terceiro tRNA traz o aminoácido
cisteína (cys), que forma ligação
P A peptídica com gly.

mRNA Direção do movimento


A U G G G A U G U A A G C G A A
ribossômico
C C U A C A
C
A
U

met gly cys Alongamento


4
• O segundo tRNA separa-se.
• O ribossomo movimenta-se, e o sítio
A passa a ser o sítio P.
• O quarto tRNA traz lisina (lys), que
forma ligação peptídica com cys.
P A
mRNA
A U G G G A U G U A A G C G A A

A C A U U C U
G Códon de finalização
U

A
C
C

gly cys lys


met

Finalização met
5 gly
• O códon de finalização cy
(UGA) é alcançado. s
• Os componentes se lys
U A UGG
dissociam; mRNA, tRNAs e C G
A
A
subunidades ribossômicas U
G U A AGCGA A
são reciclados.
• O peptídeo é usado na
célula ou secretado.

Figura 1.21
Etapas da tradução. O início da tradução reúne a pequena subunidade ribossômica, o mRNA e um tRNA iniciador que
transporta o aminoácido metionina (etapa 1). No alongamento, a grande subunidade ribossômica liga-se ao complexo
de iniciação, e um tRNA, transportando um segundo aminoácido (neste exemplo, glicina), forma pontes de hidrogênio
entre seu anticódon e o segundo códon do mRNA. A metionina trazida pelo primeiro tRNA forma uma ligação peptídi-
ca com o aminoácido trazido pelo segundo tRNA (etapa 2). O primeiro tRNA desliga-se, o ribossomo move-se ao longo
do mRNA na direção 3', e um terceiro tRNA chega, carregando o aminoácido cisteína, neste exemplo (etapa 3). Um
quarto aminoácido é ligado à cadeia polipeptídica crescente (etapa 4), e o processo continua até a finalização, quando
um códon finalizador é alcançado (etapa 5).

Borges-Osorio_01.indd 34 29/01/13 13:35


35 As Bases Moleculares da Hereditariedade
do mRNA e chamada sequência de Shine-Dalgarno). Em em musculares, etc., devido a um controle coordenado e
eucariotos, a sequência é 5' ACCAUGG, denominada se- diferencial da expressão de genes estruturais, o qual
quência de Kozak, em homenagem à sua descobridora, pode ocorrer em diferentes estágios e em diferentes célu-
Marilyn Kozak. Se estiver ausente, o tRNA iniciador não las. Esse controle, em geral, é exercido por um gene, de-
seleciona o códon AUG e continua percorrendo o mRNA nominado gene regulador, que produz uma proteína,
até encontrar outro AUG que esteja acompanhado pela diferente das que são codificadas pelos estruturais e cuja
sequência de Kozak. única função é controlar a expressão destes últimos ge-
nes, por meio de sua ligação a sítios particulares do DNA,
Em eucariotos, os fatores proteicos que orientam a
agindo sobretudo na transcrição.
tradução também são mais numerosos, e alguns mais
complexos. A associação entre os ribossomos e as mem- O conhecimento do controle da expressão gênica é,
branas que compõem o retículo endoplasmático rugoso portanto, fundamental para serem compreendidos todos
facilita a secreção das proteínas recém-sintetizadas dire- os aspectos do desenvolvimento e do ciclo vital humano.
tamente dos ribossomos para os canais desse retículo, ao
contrário dos procariotos, cujos polipeptídeos são libera-
dos pelo ribossomo diretamente no citoplasma.
1.8.1 Regulação gênica em procariotos
Um elemento essencial da regulação gênica em procario-
A síntese proteica é econômica. Uma célula pode pro-
tos é a rapidez com que os genes se ligam ou desligam,
duzir grandes quantidades de uma determinada proteína
em resposta a mudanças ambientais repentinas (fatores
apenas com uma ou duas cópias de um gene. Uma célula
como temperatura, pH e outros organismos no ambiente
plasmática do sistema imunológico humano, por exem-
podem mudar com rapidez). O microrganismo deve estar
plo, pode produzir 2 mil moléculas de anticorpo idênti-
pronto a se adaptar imediatamente a tais alterações. Esse
cas por segundo. Para essa produção em massa, RNAs,
tipo de regulação de curto prazo é exemplificado pelo sis-
ribossomos, enzimas e outros componentes celulares
tema óperon lac, em bactérias. A Escherichia coli pode
devem ser reciclados. Muitos mRNAs podem ser trans-
crescer em vários tipos de açúcares, mas seu substrato
critos de um único gene, assim como um mRNA pode ser
preferido é a glicose, de modo que, mesmo que a lactose
traduzido por vários ribossomos simultaneamente, cada
esteja presente, o sistema necessário para o uso desta úl-
um em um ponto diferente ao longo da mensagem, resul-
tima não será ativado. Na ausência da glicose, a bactéria é
tando em polipeptídeos de diferentes comprimentos. O forçada a usar a lactose, sendo, então, ativado um sistema
número de vezes que qualquer mRNA pode ser traduzido de genes conhecido como óperon lac.
é uma função da afinidade de seu sítio de iniciação pelos
ribossomos e de sua estabilidade (o mRNA de bactérias O modelo desse tipo de indução foi proposto por
tem meia-vida de alguns minutos; o mRNA de eucariotos François Jacob e Jacques Monod, em 1961, que recebe-
geralmente é estável por várias horas e até dias). ram o Prêmio Nobel por esse trabalho. Os referidos pes-
quisadores cunharam o termo óperon para a unidade
Muitas cadeias polipeptídicas, antes de atingirem de ação gênica que consiste em um gene operador e
sua estrutura normal ou sua atividade funcional, sofrem os genes estruturais que lhe são adjacentes e cuja
o processamento pós-traducional, que pode envol- ação o gene operador controla. Este último, por sua vez,
ver várias modificações: a adição de carboidratos, a cliva- é controlado por um gene regulador, que não está ne-
gem em unidades polipeptídicas menores ou a combina- cessariamente próximo. O gene regulador sintetiza um
ção com outros polipeptídeos para formar uma proteína repressor ou proteína repressora que inibe o gene
maior. Tais modificações são necessárias, por exemplo, operador. Assim, quando o gene regulador está funcio-
para realizar os dobramentos das cadeias polipeptídicas nando, as proteínas não são sintetizadas pelos respecti-
visando à estrutura secundária da proteína ou para esta- vos genes estruturais, que somente funcionam quando o
bilizar a estrutura desta última. regulador é “desligado” pela inativação do repressor por
um metabólito específico denominado indutor.
O controle básico do óperon lac, como ele é entendi-
do atualmente, está ilustrado na Figura 1.22. Quando
1.8 Regulação gênica o óperon lac é induzido, são sintetizadas três enzimas:
Com algumas exceções, pode-se dizer que todas as células permease, ␤-galactosidase e transacetilase, que
de um organismo contêm os mesmos genes. No entanto, metabolizam a lactose, facilitam sua entrada na bactéria
em um determinado tecido ou órgão, apenas um grupo e degradam os produtos tóxicos da digestão da lactose.
desses genes é expresso. Em nossa espécie, por exemplo, Os genes estruturais para as três enzimas estão reciproca-
muitos processos celulares e os genes que os determinam mente próximos, no cromossomo da E. coli, na seguinte
são comuns a todas as células do nosso corpo, como os ordem: lac Z (␤-galactosidase), lac Y (permease) e lac A
genes das proteínas ribossômicas, cromossômicas e do (transacetilase). Junto a esse grupo de genes estruturais,
citoesqueleto, constituindo os chamados genes de ma- encontram-se o gene operador (O), o promotor (P) e, a al-
nutenção (housekeeping genes). Entretanto, embora guma distância, o gene repressor (l). Esse gene transcreve
teoricamente todas as células tenham os mesmos genes, um mRNA que é traduzido em uma proteína repressora.
algumas se diferenciam em células da epiderme, outras No estado repressor ou não induzido, essa proteína

Borges-Osorio_01.indd 35 29/01/13 13:35


Genética Humana 36

regulador ou Sem a presença de lactose,


promotor (P) operador (O) lac Z lac Y lac A
repressor (I) os produtos dos genes Z, Y
DNA e A não são necessários.
(genes) As proteínas repressoras
bloqueiam o operador,
portanto, esses genes não
são transcritos.
mRNA

permease
proteínas
proteínas repressoras
repressoras ligam-se ao ␤-galactosidase acetilase
operador

mRNA
regulador ou
repressor (l) promotor (P) operador (O) lac Z lac Y lac A Com a presença da lactose,
DNA os produtos dos genes Z, Y
(genes) e A são sintetizados e
metabolizam a lactose.
a lactose inativa
as proteínas
mRNA repressoras

indutor
(lactose)

proteínas
proteínas repressoras
repressoras ligam-se ao
operador

Figura 1.22
O sistema óperon lac em E. coli proposto por Jacob e Monod: estados não induzido (acima) e induzido (abaixo).
Fonte: Lewis.3

liga-se a um sítio específico do gene O, impedindo tam- sítio de ligação ao indutor; mas o repressor funcional é, real-
bém a conexão da RNA-polimerase ao promotor e, con- mente, um homotetrâmero, isto é, contém quatro cópias do
sequentemente, a transcrição dos genes estruturais do monômero referido. A ligação desse repressor em dois sítios
óperon lac. do operador distorce a conformação do DNA, fazendo com
que este se dobre e afaste do repressor, além de impedir o
No estado indutor, a lactose, funcionando como
acesso da polimerase durante o estado de repressão.
indutor, liga-se à proteína repressora, impedindo-a de
unir-se ao gene O. Na ausência dessa ligação, a RNA-po-
limerase junta-se ao promotor (P) e ocorre a transcrição 1.8.2 Regulação gênica em eucariotos
dos genes estruturais lac Z, lac Y e lac A, com a subse-
Nos eucariotos, ainda não foi detectado um mecanismo
quente tradução do mRNA nas três enzimas.
de regulação semelhante ao sistema óperon lac. Nesses
A regulação, seja indutiva ou repressiva, pode estar organismos, a regulação gênica apresenta um problema
sob controle negativo ou positivo. No controle negativo, a de coordenação muito maior do que em procariotos,
expressão gênica sempre ocorre, a menos que seja impedi- devido, provavelmente, à maior complexidade de suas
da por alguma molécula reguladora. No controle positivo, atividades e funções, e às situações ambientais mais
ao contrário, a transcrição somente ocorre se uma molécu- complicadas que eles enfrentam, sendo necessário sis-
la reguladora estimular diretamente a produção de RNA. temas de controle da expressão gênica também muito
mais complexos.
Atualmente, entre outros aspectos, sabe-se que o re-
pressor codificado pelo gene I é um monômero composto Nos eucariotos, os genes que controlam as enzimas
de 360 aminoácidos, em cuja região central se encontra o de vias metabólicas não parecem estar ligados ou agrupa-

Borges-Osorio_01.indd 36 29/01/13 13:35


37 As Bases Moleculares da Hereditariedade
dos nos cromossomos; a transcrição ocorre no núcleo e a
tradução, no citoplasma (nos procariotos, ambas ocorrem Cromatina
em grande proximidade física); o mRNA dos eucariotos
varia muito em sua estabilidade, alguns sendo bastante
estáveis, o que permite pontos múltiplos de controle.
As necessidades regulatórias dos organismos supe- 1 - Regulação do
riores podem ser divididas em dois tipos: (a) regulação remodelamento
com efeitos de longo prazo, que envolve a diferenciação da cromatina
morfológica e funcional permanente; (b) regulação com DNA
efeitos de curto prazo, que resulta em respostas imedia-
tas, porém transitórias, a um dado estímulo.
Transcrição 2 - Regulação
A diferenciação celular, durante o desenvolvimento da transcrição
ontogenético, depende da regulação da expressão dos ge-
nes que as células contêm. No início do desenvolvimento Pré-mRNA (transcrito primário)
embrionário de muitas espécies, a diferenciação está con-
trolada por fatores de origem materna encontrados no ci- 3 - Regulação do
toplasma do ovo. Depois de algum tempo, entretanto, os encadeamento e
próprios genes do embrião começam a se tornar ativos. do processamento
Em mamíferos, por exemplo, a síntese do mRNA inicia-
-se no estágio de quatro células, embora os embriões mRNA
continuem a usar o mRNA de origem materna por bom Cap AAA
período de tempo. Normalmente, os genes estão cuidado- 4 - Regulação do
Núcleo transporte
samente regulados para se tornarem ativos no momento
específico em que um dado produto gênico é necessário.
Os genes reguladores podem ser distinguidos dos
estruturais pelos efeitos das mutações. Uma mutação em
Membrana Poro
um gene estrutural modifica uma proteína específica co-
nuclear nuclear
dificada por esse gene. Já uma mutação em um gene re-
gulador influi na expressão de todos os genes estruturais
que ele regula. A natureza dessa influência revela o tipo Ribossomo
de regulação: negativa ou positiva. Citoplasma 5 - Degradação
Na regulação dita negativa, os genes são transcritos, do mRNA
a menos que sejam desativados pela proteína reguladora. Tradução 6 - Regulação
Assim, uma mutação que inative o regulador faz com que traducional
os genes estruturais permaneçam se expressando. Visto
que a função do regulador, nesse caso, é impedir a expres-
Produto 7 - Modificações
são dos genes estruturais, ele é denominado repressor.
proteico na proteína
Por outro lado, na regulação positiva, os genes estru-
turais só são transcritos se os genes reguladores os ativa-
rem. Na ausência do regulador, os genes não se expressam. Figura 1.23
Os mecanismos e as moléculas que executam os vá- Modos de regulação que podem ocorrer em qual-
rios tipos de controle ainda não são totalmente conheci- quer etapa da expressão do material genético.
dos, mas alguns deles já foram descritos.
A regulação da expressão gênica nos eucariotos pode
ocorrer em qualquer uma das etapas que vão do DNA aos
produtos proteicos. A Figura 1.23 mostra os principais e poliadenilados, e cada um desses processos pode ser
modos de regulação e os momentos em que podem ocor-
regulado de modo a influir na quantidade e nos tipos de
rer, todos afetando o grau da expressão dos genes.
mRNAs disponíveis para a tradução; (c) depois da trans-
Certas características das células eucarióticas possi- crição, o transporte dos mRNAs para o citoplasma tam-
bilitam-lhes a utilização de vários modos de regulação: bém pode ser regulado para modular a disponibilidade
(a) o alto conteúdo de DNA associado com as histonas e desses RNAs à tradução; (d) os mRNAs têm meias-vidas
outras proteínas, formando estruturas compactas de cro- variáveis, podendo ser regulados para retardar sua de-
matina, que são modificadas durante a expressão gênica, gradação; (e) as taxas de tradução podem ser moduladas,
no interior do núcleo; (b) antes de serem transportados bem como o processamento, as modificações e a degrada-
para o citoplasma, os mRNAs são encadeados, capeados ção das proteínas.

Borges-Osorio_01.indd 37 29/01/13 13:35


Genética Humana 38

1.8.2.1 Regulação do remodelamento da crição; (b) CAAT ou CCAAT box, sequência-consenso


cromatina localizada aproximadamente 70 a 80 pb 5' acima ou à
esquerda do sítio de início da transcrição, sendo menos
O DNA eucariótico combina-se com histonas e outras pro- presente do que o TATA box; quando presente, contribui
teínas, formando a cromatina, que integra e forma os cro- para uma transcrição quantitativamente mais eficiente;
mossomos (ver Cap. 4). O maior grau de compactação da (c) GC box ou GGGCGGG, sequência-consenso parti-
cromatina pode inibir o reparo, a replicação e a transcri- cularmente presente na região promotora dos genes de
ção do DNA. A capacidade de ser alterada a associação en- manutenção, alguns dos quais não possuem os TATA e
tre o DNA e outros componentes da cromatina é essencial CAT boxes, mas são extremamente ricos em GC na re-
para permitir o acesso das proteínas reguladoras ao DNA; gião promotora. Os elementos CAAT e GC ligam-se aos
por isso o remodelamento (ou remodelagem) da cromati- fatores de transcrição e funcionam aproximadamente
na é importante na regulação gênica. Esse remodelamento como reforçadores também.
pode ocorrer de várias maneiras, por exemplo: alteração
da composição ou do posicionamento dos nucleossomos As sequências reguladoras localizadas no promotor
(unidades básicas da cromatina), facilitando a transcrição são consideradas de atuação cis, quando afetam apenas
gênica; modificações das histonas, relaxando sua asso- a expressão do gene adjacente, e de atuação trans, quan-
ciação com o DNA; metilação do DNA, isto é, adição de do atuam sobre genes distantes, geralmente sobre ambas
grupamentos metila às suas bases (com mais frequência à as cópias de um gene em cada cromossomo. Em alguns
citosina), reprimindo a transcrição mediante inibição da genes humanos, como o da distrofia muscular Duchenne,
ligação dos fatores de transcrição ao DNA. Há uma rela- existem vários promotores, situados em diferentes regiões
ção inversa entre o grau de metilação e o grau de expres- do gene. Dessa forma, a transcrição gênica pode começar
são gênica, ou seja, os genes que são transcritos ativamen- em pontos distintos, produzindo proteínas também dife-
te estão desmetilados ou com baixo nível de metilação. rentes. Isso permite que a mesma sequência gênica codi-
fique variantes de uma proteína em tecidos diferentes (p.
1.8.2.2 Regulação da transcrição ex., no tecido muscular versus tecido cerebral).

A regulação da transcrição do DNA em uma molécula de Os reforçadores (também chamados acentuado-


mRNA envolve vários tipos diferentes de sequências de res ou enhancers) são sequências de DNA situadas a uma
DNA, a interação de muitas proteínas, o remodelamen- distância variável dos genes estruturais, que aumentam
to da cromatina e a formação de alças e dobramentos de o nível da transcrição de genes que lhes estão próximos
sequências de DNA. Os genes eucarióticos têm diversos ou distantes, e interagem com os promotores. Uma vez
tipos de sequências reguladoras, como os promotores, si- que os reforçadores se situam a distâncias variáveis dos
lenciadores e reforçadores (Fig. 1.24). promotores, existe um mecanismo de dobramento ou
inversão do DNA, que permite a interação simultânea
Os promotores são sequências de DNA que fun- de vários elementos reguladores, pela formação de uma
cionam como sítios de reconhecimento para a maquina-
ou mais alças ou laços complexos do DNA. A interação
ria da transcrição, com localização adjacente aos genes
reforçador-promotor também pode ocorrer quando uma
por eles regulados. Geralmente têm centenas de nucleo-
proteína reguladora se liga primeiramente ao reforçador
tídeos e especificam o início e a direção da transcrição ao
e depois desliza no DNA até se ligar a um promotor. Os
longo do DNA.
primeiros reforçadores descobertos foram os de certos ví-
As sequências mais conhecidas (chamadas boxes) rus de DNA, como o SV40, capazes de aumentar a trans-
incluem: (a) TATA box, também denominado boxe crição de um grande número de genes em praticamente
Hogness, que frequentemente contém 7 a 8 pb na se- todos os tecidos testados. Mais recentemente, foram des-
quência-consenso TATAAAA, localizando-se cerca de 25 cobertos reforçadores específicos para alguns tecidos ou
a 30 pb 5' acima ou à esquerda do sítio de início da trans- células, como, por exemplo, o reforçador localizado no
crição; mutações nessas sequências reduzem a transcri- gene da imunoglobulina, o qual é funcional nas células B,
ção e deleções podem alterar o sítio de início da trans- mas não em outros tipos de células.

Promotor Promotor
Silenciador Reforçador Gene 1 Silenciador Gene 2
...

Figura 1.24
Algumas sequências reguladoras dos genes eucarióticos. A transcrição é regulada por elementos
reguladores imediatamente adjacentes ao gene (os promotores) e por outros localizados a certa
distância (os reforçadores e os silenciadores).
Fonte: Klug e colaboradores.4

Borges-Osorio_01.indd 38 29/01/13 13:35


39 As Bases Moleculares da Hereditariedade
Os silenciadores são sequências curtas de DNA, ção. Distintos dos domínios de ligação ao DNA, esses do-
também de atuação cis, que reprimem o nível da trans- mínios podem conter de 30 a 100 aminoácidos. Outros
crição. Frequentemente agem de modo tecido-específico fatores de transcrição contêm domínios que se ligam às
ou cromossomo-específico para controlar a expressão gê- proteínas remodeladoras da cromatina ou a coativadores,
nica. Um exemplo de silenciador é o do gene da tireotro- que são pequenas moléculas, como hormônios ou meta-
pina ␤ humana, que codifica uma subunidade do hormô- bólitos, que regulam a atividade do fator de transcrição.
nio tireotropina e só se expressa nas células produtoras
de tireotropina (os tireotrofos) da glândula hipófise. Sua 1.8.2.3 Regulação pós-transcricional
transcrição restringe-se aos tireotrofos, por efeito do si-
A regulação pós-transcricional se dá durante o processa-
lenciador, situado a 140 pb a montante do sítio de início
mento do hnRNA ou pré-mRNA em mRNA, que inclui a
da transcrição. Esse silenciador liga-se ao fator celular
remoção dos íntrons, o encadeamento dos éxons e a adi-
Oct-1 que, no âmbito do promotor do gene da tireotro-
ção de cap à extremidade 5' do mRNA e da cauda poli-
pina ␤, reprime a transcrição em todos os tipos celulares,
-A à sua extremidade 3'. Depois, o mRNA é enviado ao
exceto os tireotrofos. Nestes, a ação do silenciador é su-
citoplasma, onde é traduzido e degradado. Cada passo
plantada pela ação do reforçador localizado a mais de 1,2
desse processamento pode ser regulado para controlar a
kb acima do promotor.
quantidade de mRNA funcional disponível para sintetizar
Resumindo, os promotores, reforçadores e silencia- o produto proteico, com consequências para a velocidade
dores influem no início da transcrição, por consistirem de tradução e a estabilidade e atividade desse produto.
em sítios de ligação para proteínas conhecidas como fa-
Os principais mecanismos de regulação pós-transcri-
tores de transcrição, que se ligam ao DNA e podem
cional são o encadeamento alternativo, o controle da esta-
ter efeitos variados sobre a transcrição, aumentando,
bilidade do mRNA e o silenciamento mediado pelo RNA.
diminuindo ou modulando o nível da expressão gênica.
Esses fatores de transcrição são produzidos por genes que O encadeamento alternativo produz diferen-
controlam a transcrição do DNA para o RNA e, ativados tes moléculas de mRNA a partir do mesmo pré-mRNA,
por sinais extracelulares, ligam-se ao promotor, forman- gerando maior número de produtos proteicos por gene,
do complexos que iniciam a transcrição, com o auxílio da com funções similares ou diferentes. Esse tipo de enca-
RNA-polimerase. A Figura 1.25 apresenta de forma es- deamento é bastante comum em vertebrados, inclusive os
quemática o complexo de iniciação da transcrição, mos- humanos. As modificações no encadeamento podem alte-
trando os principais elementos reguladores. rar a atividade enzimática, a capacidade de ligação com o
receptor ou a localização de uma proteína na célula. Por
Vários tipos de fatores de transcrição são necessários
isso, constituem eventos reguladores importantes que
para a transcrição de um gene eucariótico, já sendo co-
ajudam a controlar diversos aspectos como, por exemplo,
nhecida mais de uma centena deles. Muitos apresentam
o desenvolvimento pluricelular, a apoptose e a conexão
sequências em comum, que os dobram em conformações
entre os neurônios.
tridimensionais características (motivos), das quais
surgem suas denominações. Por exemplo, nas proteínas O controle da estabilidade do mRNA relaciona-se
“dedo de zinco” (Fig. 1.26), existem segmentos repe- com a quantidade de um mRNA na célula, que é determina-
tidos que projetam uma alça em forma de dedo, aos quais da pela combinação entre a taxa de transcrição do gene e a
se ligam átomos de zinco (Zn). Esse motivo é constituído taxa de degradação desse mRNA. A duração de um mRNA,
por quatro aminoácidos que formam um complexo com definida em termos de meia-vida, pode variar bastante e
um íon zinco, dobrando-se sobre si próprio para formar pode ser regulada em resposta às necessidades da célula.
uma projeção digital. Cada dedo tem aproximadamente Por exemplo, a grande quantidade de algumas proteínas
23 aminoácidos, com uma alça de 12 a 14 aminoácidos envolvidas na regulação da transcrição gênica, no cresci-
entre as cisteínas e as histidinas, e a ligação entre as alças mento e na diferenciação celulares é determinada mais pelo
consistem em 7 a 8 aminoácidos. Os aminoácidos da alça controle da taxa de degradação dos mRNAs dessas proteí-
interagem com sequências específicas do DNA, às quais nas do que pela regulação da taxa de transcrição gênica.
se ligam, estimulando a transcrição. Consequentemente,
A degradação do mRNA pode dar-se por três vias
os genes que possuem esse motivo são candidatos a cau-
gerais, cada uma sujeita à regulação: (a) enzimas que
sarem distúrbios do desenvolvimento (ver Cap. 7). Outro
encurtam a cauda de poli-A; em mRNAs recém-sinteti-
exemplo relacionado é o do raquitismo resistente à vita-
zados, essa cauda tem cerca de 200 nucleotídeos e se liga
mina D, no qual há uma anormalidade da proteína recep-
a uma proteína de ligação à poli-A, que ajuda a estabili-
tora da vitamina D exatamente nesse motivo, que impede
zar o mRNA, mas se a cauda for encurtada para menos
a proteína de ligar-se ao DNA. Os dedos são formados
de 30 nucleotídeos, esse mRNA se torna instável e é logo
de quatro cisteínas estrategicamente localizadas, que se
degradado pelas exonucleases; (b) enzimas que removem
atraem por conterem enxofre e atraem também o zinco,
o cap, tornando instável o mRNA; (c) clivagem interna
estabilizando a formação dos dedos (Fig. 1.27).
do mRNA por uma endonuclease, expondo extremida-
Os fatores de transcrição também contêm domí- des desprotegidas, por meio das quais a degradação pode
nios que interagem com proteínas no complexo basal de continuar. Como um mRNA normal pode tornar-se alvo
transcrição e controlam o nível de iniciação da transcri- de degradação? Um modo de alterar sua meia-vida é por

Borges-Osorio_01.indd 39 29/01/13 13:35


Genética Humana 40

proteína de ligação TATA


Figura 1.25
Representação esquemática
da formação do complexo DNA região
codificadora
de iniciação da transcri-
ção. A – Uma proteína de
ligação TATA liga-se ao TATA box
TATA box no promotor
coativadores promotor
de um determinado gene.
A
B – Proteínas coativadoras
reúnem-se em torno da
proteína referida no item
A. C – Proteínas ativadoras
e repressoras ligam-se ao DNA proteína de região
ligação TATA codificadora
conjunto assim formado,
para controlar o ritmo da
transcrição, e sua presença TATA box
é transmitida ao gene que
B promotor
deverá ser expresso, pelas
proteínas coativadoras re-
repressor
feridas no item B e unidas
à proteína de ligação TATA. reforçador reforçador
D – Finalmente, proteínas (enhancer) silenciador (enhancer)
han or
)
cer

denominadas fatores basais


(en rçad

ou gerais de transcrição ativador


o

ativador
ref

unem-se à proteína de
ligação TATA, de modo
dobramento ou
inversão do DNA

a fazerem espaço para a


RNA-polimerase ligar-se ao
promotor. ativador proteína de região
3 ligação TATA codificadora
Fonte: Lewis.

TATA box
promotor
C

repressor
reforçador reforçador
(enhancer) (enhancer)
silenciador
han or
)
cer
(en rçad

ativador
o

ativador
ref

fatores
basais
dobramento ou
inversão do DNA

ativador H
E região
A B F codificadora
RNA-
-polimerase
TATA box
proteína de
D ligação TATA promotor

intermédio do elemento rico em adenosina-uracil (ARE, Em células com baixos níveis de expressão gênica, as se-
de adenosine-uracil rich element), uma sequência de ri- quências ARE do mRNA se ligam a complexos específi-
bonucleotídeos A e U, localizada geralmente nas regiões cos que realizam o encurtamento da cauda de poli-A e a
3' não traduzidas dos mRNAs que têm meias-vidas curtas rápida degradação do mRNA. As doenças autoimunes,
e reguladas. Esses mRNAs codificam proteínas envolvi- algumas condições inflamatórias e certos tipos de câncer
das no crescimento celular ou no controle da transcrição, parecem estar associados a defeitos no controle da estabi-
que precisam ser moduladas rápida e abundantemente. lidade do mRNA por meio das sequências ARE.

Borges-Osorio_01.indd 40 29/01/13 13:35


41 As Bases Moleculares da Hereditariedade
Figura 1.26
Proteínas em “dedo de zinco”: possuem segmentos re-
C C
petidos que projetam uma alça em forma de dedo, aos
quais se ligam átomos de zinco (Zn). Detalhadamente,
cada segmento (motivo) é constituído por quatro ami-
Zn noácidos (duas cisteínas e duas histidinas) que formam
um complexo com um íon zinco, dobrando-se sobre si
próprio para formar uma projeção digital. O “motivo”
H H “dedo de zinco” capacita as proteínas a ligar-se à molé-
cula de DNA, onde regulam a transcrição.
Fonte: King e Stansfield.11

O silenciamento mediado pelo RNA, também 1.8.2.4 Regulação da tradução


conhecido como interferência por RNA (RNAi), é
A tradução pode ser regulada por intermédio dos níveis
a regulação da expressão gênica exercida por pequenas
intracelulares de proteínas, o que é conhecido como au-
moléculas de RNA de fita dupla (com pouco mais de 20
torregulação, também conhecida como regulação
nucleotídeos) no citoplasma, por meio de repressão da
autógena. Um de seus exemplos mais conhecidos é o
tradução e indução da degradação do mRNA, quando
das tubulinas ␣ e ␤, componentes das subunidades dos
esse tem uma sequência complementar a uma das fitas
microtúbulos em eucariotos (ver Cap. 3), que inibem a
do RNA de fita dupla. Bastam poucas moléculas de fita tradução do mRNA da tubulina. O tratamento de uma
dupla para realizar a degradação de grandes quantida- célula com colchicina causa rápida desagregação de seus
des de mRNA. Recentemente, foi demonstrado que esses microtúbulos e aumento da concentração de subunidades
pequenos RNAs (pequeno RNA interferente [siRNA], ␣ e ␤ livres; nessas condições, a síntese de tubulinas ␣ e ␤
microRNA [miRNA] e o RNA associado à proteína Piwi diminui consideravelmente. No entanto, quando a célula
[piRNA]) agem também no núcleo, alterando a estrutura é tratada com vimblastina, uma substância que também
da cromatina e reprimindo a transcrição. Aparentemen- causa desagregação dos microtúbulos, e a síntese de tu-
te, os mecanismos de RNAi se conservaram em todos os bulinas aumenta. Apesar de ambas as substâncias causa-
eucariotos, inclusive os humanos, nos quais constituem rem desagregação dos microtúbulos, a vimblastina preci-
um mecanismo de defesa natural contra infecções virais. pita as subunidades que não estão em solução, reduzindo
Mais informações a respeito da RNAi e de suas contri- as concentrações das subunidades e ␤ livres. A síntese das
buições para a terapia gênica podem ser encontradas em tubulinas é estimulada nas baixas concentrações de subu-
4 5 6
Klug e colaboradores, Lewin e Passarge. nidades livres e inibida nas altas concentrações.

“dedo de zinco” “dedo de zinco”


Figura 1.27
O raquitismo resis-
Cys Cys Cys Cys tente à vitamina D
pode ser devido a uma
Zn++
mutação no gene que
Zn++ Cys Cys codifica o motivo de
“dedo de zinco”.
Cys Cys Fonte: Lewis.3

regiões de ligação
ao DNA
sítio da mutação GGC GAC
relacionada com o
CGA CAA raquitismo resistente à
vitamina D

Borges-Osorio_01.indd 41 29/01/13 13:35


Genética Humana 42

1.8.2.5 Regulação pós-traducional garantir a quantidade necessária de átomos de ferro li-


vres para o metabolismo celular. Igualmente, os níveis de
O ponto final da expressão gênica é a presença ou a ati-
receptores de transferrina precisam estar regulados para
vidade do produto proteico do gene. Em alguns casos, a
fornecer ferro intracelular suficiente. Essa dupla regula-
tradução de um mRNA pode ser regulada pelo grau de
ção é atingida pela modulação da capacidade de tradução
demanda da proteína pela célula. Um bom exemplo desse
dos mRNAs dos receptores de transferrina e de ferritina.
tipo de regulação pós-traducional é o controle da tradu-
A Figura 1.28 ilustra esse exemplo de regulação da ex-
ção do mRNA dos receptores de ferritina e de transfer-
rina. Para o funcionamento de muitas enzimas celulares pressão gênica. Na região 5' não traduzida do mRNA da
são necessários átomos de ferro solúvel, mas o excesso ferritina há uma sequência de 30 nucleotídeos conhecida
de ferro é tóxico para as células. No interior do corpo, o como elemento de resposta ao ferro (IRE, de iron
ferro está ligado a uma proteína chamada transferrina. response element). Esse elemento dobra-se em uma es-
As moléculas receptoras de transferrina situam-se na su- trutura de alça-haste que se liga à proteína reguladora
perfície celular e interagem com o complexo transferrina/ de ferro. Quando não há excesso de ferro na célula, essa
ferro, transportando-o para o citoplasma, onde o ferro é proteína reguladora se liga ao IRE do mRNA da ferritina,
liberado. Para se protegerem dos altos níveis de ferro in- bloqueando o início da tradução do mRNA da ferritina.
tracelular, as células sintetizam a proteína ferritina, que Havendo excesso de ferro, suas moléculas se ligam à pro-
se liga aos átomos de ferro, inativando-os no citoplasma. teína reguladora de ferro, o que faz com que essa se dis-
Por esse motivo, os níveis de ferritina precisam estar bem socie do IRE. Assim, o mRNA da ferritina fica disponível
sintonizados para responder aos níveis de ferro e para para a tradução.

A
Figura 1.28
Proteína reguladora de ferro
Regulação da expressão gênica de (A) (ligada a ferro)
ferritina e (B) receptor de transferrina. Proteína reguladora de ferro
A proteína reguladora de ferro liga-se (em ausência de ferro)
à estrutura em alça-haste dos mRNAs
da ferritina e do receptor da transfer-
rina. A – Em ausência de ferro livre,
a proteína reguladora de ferro inibe a AUG AUG
tradução do mRNA da ferritina, mas An An
IRE mRNA de ferritina IRE mRNA de ferritina
estabiliza o mRNA do receptor de trans-
ferrina. B – Em presença de ferro livre Sem tradução Com tradução
(representado por círculos vermelhos),
a proteína reguladora de ferro se disso-
cia do IRE, resultando em aumento da
Proteína ferritina
tradução da ferritina e desestabilização
do mRNA do receptor da transferrina.
B
Proteína reguladora de ferro
Proteína reguladora de ferro (ligada a ferro)
(em ausência de ferro)

AUG AUG
An An
mRNA do receptor IRE mRNA do receptor da IRE
da transferrina transferrina
mRNA estável mRNA estável
Com tradução Sem tradução

Proteína receptora
de transferrina

Borges-Osorio_01.indd 42 29/01/13 13:35


43 As Bases Moleculares da Hereditariedade
O IRE também está presente na região 3 não tradu- ção e a localização correta das proteínas no interior da
zida do mRNA do receptor de transferrina. Quando não célula. Além disso, a regulação da função proteica, como
há excesso de ferro, o IRE se liga à proteína reguladora a da atividade enzimática, exerce um papel-chave no con-
de ferro. Essa ligação não afeta diretamente a tradução, trole do comportamento celular
como ocorria com o mRNA da ferritina; ao contrário,
a presença da proteína reguladora de ferro aumenta a Em geral, o nível das proteínas reguladoras pode
estabilidade do mRNA do receptor de transferrina, re- ser modificado por diferentes fatores: (a) velocidade da
sultando em aumento dos níveis de mRNA, que se tra- transcrição do gene em RNA; (b) processamento desse
duz em aumento dos níveis desse receptor. A presença RNA; (c) transporte do mRNA do núcleo para o citoplas-
de mais receptores acelera o transporte de ferro para a ma; (d) velocidade da tradução do mRNA em cadeia po-
célula. Quando há excesso de ferro, suas moléculas se lipeptídica; (e) velocidade de degradação do mRNA; (f)
ligam à proteína reguladora de ferro, dissociando-a do processamento pós-traducional do polipeptídeo; e (g) ve-
mRNA do receptor de transferrina e tornando instáveis locidade de degradação da proteína.
esse mRNA. Nesse caso, é transportado menos ferro Todos esses mecanismos de controle correspondem
para a célula.
a situações específicas. Entretanto, talvez o método de
Em outros casos, ocorrem modificações posteriores controle mais econômico e mais difundido nos eucario-
nas proteínas, incluindo clivagem e ligação covalente a tos seja o de controlar a produção da proteína no nível da
carboidratos e lipídeos, que são importantes para a fun- transcrição do gene.

Resumo
Todo ser vivo é constituído de células, nas quais está + açúcar denomina-se nucleosídeo, chamando-se nu-
situado o material hereditário. De acordo com sua cleotídeo ao conjunto de base + açúcar + fosfato.
organização celular, os seres vivos são geralmente
O DNA é encontrado principalmente nos cromos-
classificados em dois grupos: procariotos e euca-
somos; o RNA é encontrado principalmente no nu-
riotos. Os Archaea são considerados uma subdivisão
cléolo (estrutura nuclear) e no citoplasma, havendo
dos procariotos, mas colocados em um grupo sepa-
muito pouco nos cromossomos.
rado das demais bactérias, pelas suas características
distintivas. Além das diferenças em sua composição química,
o DNA e o RNA mostram diversidade quanto à sua es-
O genoma contém o conjunto completo de infor-
trutura molecular. O modelo proposto por Watson e
mações hereditárias de qualquer organismo, consis-
Crick (1953) para a estrutura molecular do DNA é o
tindo em uma longa sequência de DNA, composto de
seguinte: (a) a molécula de DNA é uma longa fita de
nucleotídeos formados por bases nitrogenadas, açúcar
nucleotídeos, formando uma configuração semelhante
e fosfato.
à de uma escada de corda, enrolada de forma helicoi-
O DNA constitui a sequência de subunidades indi- dal; (b) nessa escada, o açúcar e o fosfato são os com-
viduais, denominadas genes, cuja função é armazenar ponentes verticais (corrimãos) e as bases nitrogenadas
e codificar as informações genéticas que serão utili- são os degraus: para que esses se formem, as ligações
zadas para a produção das cadeias polipeptídicas das entre as bases são feitas por pontes de hidrogênio;
proteínas que compõem as células, tecidos e órgãos (c) tal modelo também requer que as duas fitas poli-
dos organismos. Esses genes estão organizados em um nucleotídicas sejam antiparalelas, isto é, corram em
número relativamente pequeno de cromossomos. direções opostas: uma na direção 5'→3' e a outra na
direção 3'→5'.
Atualmente, o gene é definido como o segmento
de DNA que codifica uma cadeia polipeptídica e inclui O RNA difere do DNA em sua composição quími-
regiões flanqueadoras que antecedem (sequência-lí- ca quanto a dois aspectos: o RNA possui ribose, no lu-
der) e que seguem (cauda) a região codificadora, bem gar da desoxirribose, e uracil, em vez de timina. Quan-
como sequências que não são traduzidas (íntrons) e to à estrutura molecular, o RNA apresenta, em geral,
que se intercalam com as sequências codificadoras in- apenas uma fita de nucleotídeos. Em algumas circuns-
dividuais (éxons). tâncias, uma molécula de RNA pode formar uma fita
dupla com outra parte de sua própria estrutura, como
A estrutura química dos ácidos nucleicos é simples
ocorre no RNA transportador.
e não varia entre os diversos organismos. Os ácidos
nucleicos são constituídos de sequências de nucleotí- A forma original da dupla-hélice do DNA é deno-
deos, que são formados por uma base nitrogenada, um minada B-DNA, mas ainda existem outras formas. Por
açúcar e um grupo fosfato (PO4). O conjunto de base exemplo, A-DNA, Z-DNA e outras mais raras.

Borges-Osorio_01.indd 43 29/01/13 13:35


Genética Humana 44

O código genético descreve a relação entre a se- O DNA tem função autoduplicadora e, comple-
quência de bases nitrogenadas do DNA e a sequência tada sua replicação, cada uma das moléculas de DNA
de aminoácidos na cadeia polipeptídica correspon- recém-formadas tem uma das fitas originais e outra
dente. proveniente dos novos nucleotídeos. Por essa razão, a
duplicação do DNA é chamada de semiconservativa. É
A palavra-chave do código para um aminoácido
a autoduplicação que garante a transmissão do mate-
consiste em uma sequência de três bases nitrogena-
rial genético de uma célula para as suas descendentes.
das adjacentes, que formam a unidade de informação
genética ou códon. O código genético apresenta várias O DNA também tem a função de comandar a sín-
características descritas no texto deste capítulo. tese das proteínas necessárias ao funcionamento celu-
lar. A síntese proteica se dá em duas fases: transcrição
Os aminoácidos selenocisteína (sel) e pirrolisina
e tradução. A transcrição é o processo pelo qual a in-
(pyr), codificados respectivamente pelas trincas UGA
e UAG, são considerados os 21º e 22º aminoácidos, formação genética é transmitida do DNA para o RNA.
embora não ocorram em todos os procariotos e euca- O produto imediato da transcrição é denominado
riotos. RNA heterogêneo nuclear ou pré-mRNA, sendo quase
sempre instável: em procariotos, é rapidamente mo-
O genoma humano subdivide-se em duas partes: dificado em mRNA ou clivado em produtos maduros
o genoma nuclear e o genoma mitocondrial. O genoma (rRNA e tRNA); em eucariotos, sofre várias modifica-
humano nuclear apresenta cerca de 33% do conteúdo ções em suas extremidades, dando origem ao mRNA.
de DNA na forma de genes estruturais e sequências a A tradução consiste na transmissão da informação
eles relacionadas, enquanto sua maior parte (67%) é genética do mRNA para um polipeptídeo, sendo mais
encontrada como DNA extragênico. É estimada a exis- complexa nos eucariotos.
tência de 20 a 25 mil genes estruturais, codificados
por sequências de DNA não repetitivo, sendo o restan- A regulação gênica em procariotos é de curto
te do genoma constituído de outros tipos de DNA. prazo, exemplificada pelo sistema óperon lac, em
bactérias. O termo óperon refere-se à unidade de
Os principais tipos de sequências do DNA nuclear ação gênica que consiste em um gene operador e os
dos eucariotos são: DNA não repetitivo e DNA repeti- genes estruturais que lhe são adjacentes e cuja ação
tivo, descritos no texto. Entre as sequências relacio- o gene operador controla. Este último, por sua vez, é
nadas aos genes, encontram-se os íntrons e os pseu- controlado por um gene regulador, que não está ne-
dogenes. cessariamente próximo. O gene regulador sintetiza
O DNA mitocondrial é uma molécula circular um repressor ou proteína repressora que inibe o gene
de fita dupla, com 16.569 pares de bases, existen- operador. Assim, quando o gene regulador está fun-
te no interior das mitocôndrias, organelas oriundas cionando, as proteínas não são sintetizadas pelos res-
de bactérias e produtoras de energia localizadas no pectivos genes estruturais, que somente funcionam
citoplasma de praticamente todas as células eucari- quando o regulador é “desligado” pela inativação do
óticas. Esse DNA geralmente não apresenta íntrons, repressor por um metabólito específico denominado
nem crossing-over, arcabouço de histonas e sistema indutor.
de reparo; existe em muitas cópias por mitocôndria e A regulação gênica em eucariotos apresenta
por célula, é de herança materna e sofre alta exposi- um problema de coordenação muito maior do que
ção aos radicais livres de oxigênio. O genoma mito- em procariotos, devido, provavelmente, à maior
condrial humano e de outros mamíferos apresenta 13 complexidade de suas atividades e funções, e às si-
genes codificadores de proteínas, 22 genes de tRNA e tuações ambientais mais complicadas que eles en-
2 genes de rRNA. frentam, sendo necessário sistemas de controle da
Existem quatro tipos principais de RNA, todos expressão gênica também muito mais complexos. A
transcritos de moldes de DNA por RNA-polimerases regulação da expressão gênica nos eucariotos pode
e com a mesma estrutura química básica. Esses RNAs ocorrer em qualquer uma das etapas que vão do
têm tamanhos diferentes e possuem sequências de ba- DNA aos produtos proteicos. Os genes eucarióticos
ses desiguais que determinam funções específicas. São têm diversos tipos de sequências reguladoras, como
eles: RNA heterogêneo nuclear (hnRNA), RNA men- os promotores, silenciadores e reforçadores, que
sageiro (mRNA), RNA transportador (tRNA) e RNA consistem em sítios de ligação para proteínas conhe-
ribossômico (rRNA). Existem ainda outros RNAs, cidas como fatores de transcrição, que se ligam ao
como o RNA da telomerase, o RNA nuclear pequeno DNA e podem ter efeitos variados sobre a transcri-
(snRNA), o RNA antissenso, o microRNA (miRNA) e o ção, aumentando, diminuindo ou modulando o nível
pequeno RNA interferente (siRNA). da expressão gênica.

Borges-Osorio_01.indd 44 29/01/13 13:35


45 As Bases Moleculares da Hereditariedade
Teste seu conhecimento

1. De acordo com a sua organização celular, como se 6. Quais são as funções do DNA e do RNA?
classificam os seres vivos e quais as suas características?
7. O que é código genético e como ele se caracteriza?
2. Conceitue gene.
8. Descreva sucintamente a síntese proteica.
3. Descreva, brevemente, as estruturas química e
molecular dos ácidos nucleicos. 9. Como se dá a regulação gênica em procariotos?

4. Quais são os tipos de DNA? 10. Como se dá a regulação gênica em eucariotos?

5. Quais são os tipos de RNA?

Exercícios
1. Observe as sequências abaixo de DNA, RNA e cadeia 8. Coloque as seguintes enzimas na ordem direta em que
polipeptídica, respectivamente, de um segmento começam a funcionar na replicação do DNA:
normal. Utilizando esses dados, explique a replicação ligase – DNA-polimerase – primase – helicase –
do DNA, a transcrição e a tradução que fazem parte da exonuclease
síntese proteica.
DNA: (fita codificadora) A T G C A G G T G A C C T 9. Escreva a sequência da fita replicada de cada uma das
CAACT fitas de DNA a seguir:
(fita-molde) T A C G T C C A C T G G A G T T G A a. T C G A G A A T C T C G A T T
RNA: A U G C A G G U G A C C U C A U G A b. C C G T A T A G C C G G T A C
Cadeia polipeptídica: MET – GLN – VAL – TER c. A T C G G A T C G C T A C T G
– SER – FIM
10. Faça uma lista das diferenças entre o DNA e o RNA.
2. Numere a primeira coluna de acordo com a segunda.
11. Quais são as alterações que ocorrem no processamento
( ) Tradução (1) Resulta da tradução sofrido pelo hnRNA?
( ) Códon (2) Transmissão da
informação para o RNA 12. Liste três sequências de mRNA que poderiam codificar
( ) Transcrição a seguinte sequência de aminoácidos:
(3) Códon iniciador
( ) Cadeia polipeptídica metionina – histidina – alanina – arginina – serina
(4) Local da síntese proteica
( ) MET – leucina – valina – cisteína
(5) Transmissão da
( ) Ribossomos para um informação genética 13. Dê as diferenças entre (a) síntese unidirecional
polipeptídeo (6) Unidade de informação e bidirecional e (b) síntese de DNA contínua e
( ) Códon AUG genética descontínua.

3. Indique as principais polimerases e suas atuações: (a) 14. Quando foram determinadas as sequências de
na replicação do DNA e (b) na síntese dos diferentes aminoácidos de insulinas de diferentes organismos,
tipos de RNAs. foram observadas algumas diferenças: a alanina foi
substituída por treonina, a serina por glicina e a valina
4. Onde atuam as enzimas denominadas ribozimas? por isoleucina, nas mesmas posições dessa proteína.
Liste as trocas de bases que poderiam ocorrer nos
5. No contexto da genética molecular, conceitue e dê as
códons do código genético para produzir essas
diferenças entre transcrição e tradução.
mudanças de aminoácidos.
6. Onde ocorrem, na célula de procariotos e eucariotos, a
15. Liste e descreva de forma esquemática os modos de
replicação, a transcrição e a tradução?
regulação que podem ocorrer durante a expressão do
7. Escreva uma sequência de DNA que poderia codificar material genético.
a seguinte sequência de aminoácidos:
valina – triptofano – lisina – prolina – fenilalanina
– treonina – fim

Borges-Osorio_01.indd 45 29/01/13 13:35


Genética Humana 46

Referências
1. Azevedo MG, Astolfi Filho S. A estrutura do DNA. 7. Alberts B, Bray D, Johnson A, Lewis J, Raff M,
In: Costa SOP, coordenador. Genética molecular e Roberts, K, et al. Fundamentos da biologia celular:
de microrganismos: os fundamentos da engenharia uma introdução à biologia molecular da célula. Porto
genética. São Paulo: Manole; 1987. p. 19-38. Alegre: Artmed, 1999.
2. Lewis R. Human genetics: concepts and applications. 8. Cann RL, Stoneking M, Wilson AC. Mitochondrial DNA
4th ed. Boston: McGraw-Hill; 2001. and human evolution. Nature. 1987;325(6099):31-6.
3. Lewis R. Human genetics: concepts and applications. 9. Lewin B. Genes VII. 7. ed. Porto Alegre: Artmed; 2001.
2nd ed. Dubuque IR: Wm. C. Brown; 1997.
10. Champe PC, Harvey RA, Ferrier DR. Bioquímica
4. Klug WS, Cummings MR, Spencer CA, Palladino MA. ilustrada. 4. ed. Porto Alegre: Artmed; 2009.
Conceitos de genética. 9. ed. Porto Alegre: Artmed; 2010.
11. King R, Stansfield WD. A dictionary of genetics. 5th ed.
5. Lewin B. Genes IX. 9. ed. Porto Alegre: Artmed; 2009. New York: Oxford University; 1997.
6. Passarge E. Genética: texto e atlas. 3. ed. Porto Alegre:
Artmed; 2011.

Leituras recomendadas
Alberts B, Bray D, Hopkin K, Johnson A, Lewis J, Raff M, Robinson WM, Borges-Osório MR. Genética para
et al. Fundamentos da biologia celular. 3. ed. Porto Alegre: odontologia. Porto Alegre: Artmed; 2006.
Artmed; 2011.
Turnpenny P, Ellard S. Emery genética médica. 13. ed. Rio
Cooper GM, Hausman RE. A célula: uma abordagem de Janeiro: Elsevier; 2009.
molecular. 3. ed. Porto Alegre: Artmed; 2007.
Nussbaum RL, McInnes RR, Willard HF. Thompson e
Thompson: genética médica. 7. ed. Rio de Janeiro: Elsevier;
2008.

Borges-Osorio_01.indd 46 29/01/13 13:35