DNA COMPUTING

INTRODUCTION:
DNA computing is a form of computing which uses DNA and molecular
biology, instead of the traditional silicon-based computer technologies.
Fifty years ago scientists first described the structure of deoxyribonucleic
acid (DNA). Today humans have put DNA to work in a wide variety of applications. This
exhibit explores a few of those applications.
In the following sections, learn more about the basics of where DNA is
found, how similar DNA is between humans and other species and how traits are
inherited from one generation to the next.

HISTORY
This field was initially developed by Leonard Adleman of the University
of Southern California. In 1994, Adleman demonstrated a proof-of-concept use of DNA
as a form of computation which was used to solve the seven-point Hamiltonian path
problem. Since the initial Adleman experiments, advances have been made, and various
Turing machines have been proven to be constructable.There are works over one
dimensional lengths, bidimensional tiles, and even three dimensional DNA graphs
processing.
On April 28, 2004, Ehud Shapiro, Yaakov Benenson, Binyamin Gil, Uri
Ben-Dor, and Rivka Adar at the Weizmann Institute announced in the journal Nature that
they had constructed a DNA computer. This was coupled with an input and output
module and is capable of diagnosing cancerous activity within a cell, and then releasing
an anti-cancer drug upon diagnosis.
DNA computing is fundamentally similar to parallel computing in that it
takes advantage of the many different molecules of DNA to try many different
possibilities at once.
For certain specialized problems, DNA computers are faster and smaller than any other
computer built so far. But DNA computing does not provide any new capabilities from
the standpoint of computational complexity theory, the study of which
computational problems are difficult. For example, problems which grow exponentially
with the size of the problem (EXPSPACE problems) on von Neumann machines still
grow exponentially with the size of the problem on DNA machines. For very large
EXPSPACE problems, the amount of DNA required is too large to be practical.
(Quantum computing, on the other hand, does provide some interesting new capabilities).

Where is DNA Found?

Our bodies are formed from between 50 and 100 trillion cells (a trillion is
a thousand billion, or a thousand, thousand million). These cells are organized into
tissues, such as skin, muscle, and bone. Each cell contains all of the organism's genetic
instructions stored as DNA. However, each cell uses only the instructions from part of the
DNA. For example, a muscle cell uses the DNA that specifies the muscle apparatus,
whereas a nerve cell uses DNA that specifies the nervous system. It is as if each cell
reads only that part of a book of instructions that it needs.

Within the cell - in chromosomes...

Each very long DNA molecule is tightly wound and packaged as a chromosome. Humans
have two sets of 23 chromosomes in every cell, one set inherited from each parent. A
human cell therefore contains 46 of these chromosomal DNA molecules.

Within each chromosome - in genes...

Each DNA molecule that forms a chromosome can be viewed as a set of shorter DNA
sequences. These are the units of DNA function, called genes, each of which guides the
production of one particular component of an organism. A set of human chromosomes
contains one copy of each of the roughly 30,000 genes in the human "genome" - the term
used to refer to the co
 DNA is found
throughout the body.

Each cell contains all of

the organism's genetic
instructions stored as
DNA. Each very long
DNA molecule is tightly
wound and packaged as a
chromosome. Each DNA
molecule that forms a
chromosome can be
viewed as a set of shorter
DNA sequences. These
are the units of DNA
function, called genes,
each of which guides the
production of one
particular component of an
organism.
Tracing Similarities and Differences in Our DNA

What percent of their genes match yours?

Another human? 100% - All humans have the same genes, but some of these genes contain
sequence differences that make each person unique.
A chimpanzee? 98% - Chimpanzees are the closest living species to humans.
A mouse? 92% - All mammals are quite similar genetically.
A fruit fly? 44% - Studies of fruit flies have shown how shared genes govern the
growth and structure of both insects and mammals.
Yeast? 26% - Yeasts are single-celled organisms, but they have many
housekeeping genes that are the same as the genes in humans, such as
those that enable energy to be derived from the breakdown of sugars.
A weed (thale cress)? 18% - Plants have many metabolic differences from humans. For example,
they use sunlight to convert carbon dioxide gas to sugars. But they also
have similarities in their housekeeping genes.

Why Were Genes Used In This Comparison, and How Do They

Relate To DNA?

Genes a re the fundamental units of DNA function. In DNA terms, genes are discrete
sections of the DNA sequence that are part of much longer DNA molecules. They
provide the biochemical instructions for producing all of the components of biological
organisms. Some genes specify visible physical traits, while others govern metabolic
processes. Most traits, such as the shape of your face, require the actions of many genes.
Why Are We So Similar?

The DNA of these species is so similar because the basic organization of life is widely
shared, with the largest differences found between plants and animals, or between tiny
single-celled organisms like yeast and large multicellular organisms like ourselves. The
similarities reflect a common ancestry that appears to be shared by all life on Earth.

Are People Really Identical?

Even though humans share 100% of the same genes, the instructions
contained within the genes are not entirely identical. Each person is unique. People have
different hair colors, facial structures, and other traits. These differences between
individuals result from very small differences in their DNA sequences. DNA also
contains many so-called "housekeeping genes" that control important metabolic
processes. As you will see, some of the differences in these genes can cause illness.

Although the DNA of any two people on Earth is, in fact, 99.9% identical, even a tiny
difference can have a big effect if this difference is located in a critical gene.

Inheritance
Two Copies of the Genome
You Inherit One Copy from Each Parent
A person has two copies of every gene sequence, one inherited from the mother, and the
other inherited from the father. A child thus inherits one copy from each parent's own
pair, and this copy is selected from the parent randomly. In order to fully understand a
person's DNA sequences, both inherited copies of a gene need to be examined.

These sequences are often not identical. Gene sequences for so-called "dominant" traits
are expressed over "recessive" traits. Do you have a cleft chin? It is an indentation at the
tip of your chin. If so, you have at least one copy of the dominant gene for cleft chin. But
if your chin has no indentation, you have two copies of the recessive gene for this trait.
 Two Copies of Each Chromosome

You inherit one copy of every chromosome from

each parent. Therefore you have two copies of
every gene sequence

complete genetic instructions for an organism.

THE DNA SEQUENCE:

The extremely long DNA molecule is actually made of a long string of

chemical building blocks called “nucleotides.” There are four different nucleotides,
which are labeled adenine (A), thymine (T), guanine (G), and cytosine (C). The human
genome is made of a sequence of roughly three billion of these nucleotides, and it is
about the same size as the genome of a chimpanzee or a mouse. In contrast, a fruit fly has
180 million, a yeast has 12 million, and the flowering weed “thele cress” has 100 million
nucleotides of DNA in its genome.

Learn more about how to read the DNA sequence and probe the sequence for matches in
the following sections:

Unzipping DNA
Probe the Sequence
Like a Library of Instructions
Reading Chapters from the Genome

Probe the Sequence

DNA sequences hold the instructions for building organisms. In this online activity, you
can explore a sequence by designing and sending short DNA "probes" through part of the
human genome.
Unzipping DNA
The Sequence On One Strand

The DNA molecule is composed of two very long strands of A’s, T’s, G’s
and C’s, which are tightly paired with each other. An A on one strand is always paired
with a T on the other strand, and a G is always paired with a C. This means that if the
sequence of nucleotides on one strand is known, the sequence of the other strand will be
automatically known as well.

One strand of DNA is like a photographic negative of the other strand. A

negative can be used to make many copies of a photograph because it contains all of the
information that is part of that photograph. Similarly, to read the sequence of A’s, T’s,
G’s, and C’s in a genome, it is only necessary to read one strand of DNA to be able to
deduce the sequence of the other strand.

One Strand of DNA Is Like a Photographic Negative to the Other

An adenine (A) on one strand is always paired with a thymine (T) on the other strand, and
a guanine (G) is always paired with a cytosine (C). If the sequence of nucleotides on one
strand is known, the sequence of the other strand will be automatically known as well.

Probe the Sequence

Reading the Sequences

The sequence of nucleotides in a gene gives it meaning by storing the instructions for
building the other molecules necessary for life. These instructions are read as a string of
A’s, T’s, G’s, and C’s, such as ACGGTAACT. In the sense that there are 26 letters in the
English alphabet, there are four letters in the alphabet of DNA.

The four letters in the DNA alphabet are actually abbreviations for the chemicals that
make up the library of instructions.

A for Adenine
T for Thymine
G for Guanine
C for Cytosine

DNA Is Like A Library Of Instructions

The genome is like a library of instructions.

A gene is a sequence of A’s, T’s, G’s, and C’s that usually provides the
instructions for a single protein component of an organism.

The letters of the genetic alphabet – A, T, G, and C – are meaningless on

their own, but they are combined into useful instructions in genes. Some genes carry
enough information for one complete characteristic of an organism, but most
characteristics result from combinations of genes. Genes are like chapters in the books
that fill the library of the genome.

DNA sequencing
The sequence of letters within a gene is like the letters in a book of
instructions. Deciphering the enormously long sequence of A’s, T’s, G’s, and C’s in an
organism’s genome reveals useful information. For example, finding a difference in a
gene sequence that governs muscle structure raises questions. Could the difference affect
health? Just as changing one letter in a word can change its meaning – for example, mice
to rice to nice – so changing one DNA letter can sometimes cause illness.

Not all of the sequences in the genes of two humans are identical. For
example, because your face is unique, the precise set of sequences in the large group of
genes that control the shape of your face are presumably unique too. Some special parts
of the DNA sequence vary from person to person with unusually high frequency. As you
will see, finding sequences in DNA samples can be used to identify individuals and help
solve crimes, even when there are no eyewitnesses.

Reading Chapters In The Genome

Every cell in the body stems from just one cell: the fertilized egg.
Every cell contains the same library of instructions, but the cells read and use
different genetic chapters.
Reading Chapters from the Genome
Every cell in the body contains all of the DNA sequence, but the
composition of each cell depends on which sections of the DNA are used. We know that
each cell reads only those chapters from the library of instructions that it needs. The
selective reading process creates many different kinds of cells, such as skin, muscle,
neural, and bone cells, all of which develop from the many cells of the embryo produced
by the growth and division of one cell: the fertilized egg. Studies of the fruit fly,
Drosophila melanogaster, have been useful in revealing how organisms develop these
cell types, with each cell knowing what Each very long DNA molecule is tightly wound
and packaged as a chromosome. Humans have two sets of 23 chromosomes in every cell,
one set inherited from each parent. A human cell therefore contains 46 of these
chromosomal DNA molecules.

Within each chromosome - in genes...

Each DNA molecule that forms a chromosome can be viewed as a set of
shorter DNA sequences. These are the units of DNA function, called genes, each of
which guides the production of one particular component of an organism. A set of human
chromosomes contains one copy of each of the roughly 30,000 genes in the human
"genome" - the term used to refer to the co
Genes a re the fundamental units of DNA function. In DNA terms, genes
are discrete sections of the DNA sequence that are part of much longer DNA molecules.
They provide the biochemical instructions for producing all of the components of
biological organisms. Some genes specify visible physical traits, while others govern
metabolic processes
The DNA of these species is so similar because the basic organization of
life is widely shared, with the largest differences found between plants and animals, or
between tiny single-celled organisms like yeast and large multicellular organisms like
ourselves. The similarities reflect a common ancestry that appears to be shared by all life
on Earth.
The genes are not entirely identical. Each person is unique. People have
different hair colors, facial structures, and other traits. These differences between
individuals result from very small differences in their DNA sequences. DNA also
contains many so-called "housekeeping genes" that control important metabolic
processes. As you will see, some of the differences in these genes can cause illness.
Although the DNA of any two people on Earth is, in fact, 99.9% identical,
even a tiny difference can have a big effect if this difference is located in a critical gene.
other inherited from the father. A child thus inherits one copy from each parent's own
pair, and this copy is selected from the parent randomly. In order to fully understand a
person's DNA sequences, both inherited copies of a gene need to be examined.
These sequences are often not identical. Gene sequences for so-called
"dominant" traits are expressed over "recessive" traits. Do you have a cleft chin? It is an
indentation at the tip of your chin. If so, you have at least one copy of the dominant gene
for cleft chin. But if your chin has no indentation, you have two copies of the recessive
gene for this trait.
blocks called “nucleotides.” There are four different nucleotides, which are labeled
adenine (A), thymine (T), guanine (G), and cytosine (C). The human genome is made of
a sequence of roughly three billion of these nucleotides, and it is about the same size as
the genome of a chimpanzee or a mouse. In contrast, a fruit fly has 180 million, a yeast
has 12 million, and the flowering weed “thale cress” has 100 million nucleotides of DNA
in its genome.
 Learn more about how to read the DNA sequence and probe the sequence
for matches in the following sections:
You Inherit One Copy From Each Parent

The DNA molecule is composed of two very long strands of A’s, T’s, G’s
and C’s, which are tightly paired with each other. An A on one strand is always paired
with a T on the other strand, and a G is always paired with a C. This means that if the
sequence of nucleotides on one strand is known, the sequence of the other strand will be
automatically known as well.

One strand of DNA is like a photographic negative of the other strand. A

negative can be used to make many copies of a photograph because it contains all of the
information that is part of that photograph. Similarly, to read the sequence of A’s, T’s,
G’s, and C’s in a genome, it is only necessary to read one strand of DNA to be able to
deduce the sequence of the other strand.

The sequence of nucleotides in a gene gives it meaning by storing the

instructions for building the other molecules necessary for life. These instructions are
read as a string of A’s, T’s, G’s, and C’s, such as ACGGTAACT. In the sense that there
are 26 letters in the English alphabet, there are four letters in the alphabet of DNA.
The four letters in the DNA alphabet are actually abbreviations for the chemicals that
make up the library of instructions.

A for Adenine
T for Thymine
G for Guanine
C for Cytosine

The letters of the genetic alphabet – A, T, G, and C – are meaningless on

their own, but they are combined into useful instructions in genes. Some genes carry
enough information for one complete characteristic of an organism, but most
characteristics result from combinations of
 The sequence of letters within a gene is like the letters in a book of
instructions. Deciphering the enormously long sequence of A’s, T’s, G’s, and C’s in an
organism’s genome reveals useful information. For example, finding a difference in a
gene sequence that governs muscle structure raises questions. Could the difference affect
health? Just as changing one letter in a word can change its meaning – for example, mice
to rice to nice – so changing one DNA letter can sometimes cause illness.

Not all of the sequences in the genes of two humans are identical. For
example, because your face is unique, the precise set of sequences in the large group of
genes that control the shape of your face are presumably unique too. Some special parts
of the DNA sequence vary from person to person with unusually high frequency. As you
will see, finding sequences in DNA samples can be used to identify individuals and help
solve crimes, even when there are no eyewitnesses.

Every cell in the body contains all of the DNA sequence, but the
composition of each cell depends on which sections of the DNA are used. We know that
each cell reads only those chapters from the library of instructions that it needs. The
selective reading process creates many different kinds of cells, such as skin, muscle,
neural, and bone cells, all of which develop from the many cells of the embryo produced
by the growth and division of one cell: the fertilized egg. Studies of the fruit fly,
Drosophila melanogaster, have been useful in revealing how organisms develop these
cell types, with each cell knowing developing embryo.

Grassroots Cooperation

The human body has between 50 and 100 trillion cells and no single cell is in charge .
Throughout a lifetime, each cell interacts with many other cells to determine which
instructions to use at a particular time and place

INHERITING DISEASE:
Can You Use DNA to Prevent Disease?
How Reading DNA Sequences Can Improve Health

“The ultimate goal of these scientific advances is the treatment, cure, and eventual
prevention of genetic disorders, but effective interventions lag behind the ability to detect
disease or increased susceptibility to disease.” – National Academies, 1994
The new ability to pinpoint the cause of human genetic disease, and to detect those
individuals who are predisposed to such diseases, does not mean that modern medicine
can prevent them.

Learn more about how DNA is being used to detect and prevent disease in the following
sections:

How Can a Child Inherit a Disease from Two Normal Parents?

What Are Mutations?
Hemochromatosis
Hemochromatosis Multimedia
Sickle Cell Anemia

Inherited Disease
The Sheahans have discovered that they are carriers of hemochromatosis. Their oldest
child has been diagnosed with the disease, and their two younger children are at risk.

This activity simulates the test to find the disease.

How Can A Child Inherit A Disease From Two Normal

Parents?
A child inherits two copies of each gene: one from the mother and one
from the father. In most cases, genetic diseases are said to be “recessive,” which means
that if just one of the two copies is defective, the other copy will keep the child healthy.

A person who inherits one defective copy and one normal copy of a gene
is a “carrier” of the mutation. Even though they are unlikely to get sick, they have a fifty-
fifty chance of passing the mutation along to each of their children. This is one reason
why some diseases seem to disappear in one generation, only to reappear in later
generations.

Inherited Disease

Just as a children may inherit their

hair or eye color from their parents,
they can also inherit genetic diseases.
If a child inherits just one mutated
copy of the gene he or she is a
"carrier" of the genetic disease. If
there are two defective copies the
child may be

What Are Mutations?

Be cause A, T, G, and C are letters in the genetic alphabet, changing one

letter for another can change the meaning of a gene. Just as “time” changes to “tame”
when one letter changes, a single nucleotide change in a gene may sometimes cause
disease.

Since many genes govern the fundamental structure and chemical

processes of life, defects in their instructions can potentially interfere with the chemical
interactions that control an organism’s growth and health. However, most mutations that
are passed on from generation to generation occur in the long stretches of DNA in
between the parts of genes that carry instructions, where they do not harm the person.

There are many different ways that a gene can be mutated. Examples are shown
below using the sentence "Time To Dream."
Hemochromatosis

Genetic Liver Disease

(Hemochromatosis)

Hemochromatosis results from inheriting two copies of a defective gene, which causes
the intestines to absorb too much iron. As a result, a person with these defective genes is
likely to develop liver disease in middle age. Hemochromatosis is often hard to identify
because the symptoms are shared with other diseases. If a fairly close relative, such as an
aunt, uncle, or first cousin has hemochromatosis, it may be prudent to test your children’s
DNA for the defect.

Hemochromatosis
Using DNA to Maintain Good Health

If a child is known to have inherited the genetic mutations for hemochromatosis, the
impact of the disease can often be reduced. Symptoms of the disease usually do not
appear until middle age. Even in such cases, health and life expectancy can be improved
through a treatment known as “phlebotomy,” in which iron-rich blood is removed from
the patient every week and replenished with normal blood by the body.

The Centers for Disease Control (CDC) recommends avoiding vitamins that contain iron
and restricting vitamin C, which increases iron absorption. The CDC also recommends
avoiding behavior that could damage the liver, such as more than mild alcohol
consumption. Although patients may eat iron-containing foods, they should avoid eating
raw seafood and shellfish, because iron-overload patients are susceptible to infections
that these foods may carry.

What Difference Do the Letters Make?

The gene defect that causes sickle cell anemia involves just one letter. And this small
change in the sequence has an enormous impact on health.

Sickle Cell Anemia

One of the genes that codes for part of hemoglobin, the molecule that
carries oxygen through the bloodstream, is mutated in individuals with sickle cell anemia.
Normal hemoglobin fits into round-shaped red blood cells, which move smoothly through
tiny capillaries to nourish muscles, organs, and other tissues. The single-letter sickle cell
mutation causes hemoglobin molecules to cluster together, forming long, rod-like
structures. These structures cause the red blood cells to become stiff and assume a
characteristic sickle shape. Sickle-shaped red blood cells stack up, causing blockages that
starve the body’s tissues of oxygen. The resulting illness is known as sickle cell anemia.

DNA/CRIMINAL JUSTICE:

How DNA Determines Guilt Or Innocence

The science of identifying individuals using DNA sequences is very clear, and the
probability of scientific error is extremely small. As a result, DNA evidence has been
used to help identify perpetrators of crimes and to exonerate innocent people before they
become suspects.

The following sections explain the science behind DNA fingerprinting in more detail.

How Can DNA Sequences Identify Individuals?

What Does a Match Mean?
Forensic DNA Evidence
DNA Identifier

Catch A Criminal
A crime has been committed. Circumstantial evidence points to three men. Two of the
men are brothers; the other man is unrelated. A trace ot the perpetrator's DNA has been
found at the scene of the crime.

How Can DNA Sequences Identify Individuals?

Most people share very similar gene sequences, but some regions of DNA
sequence have been found to vary from person to person with high frequency. Comparing
variation in these regions allows us to answer the question of whether two different DNA
samples come from the same person.
The FBI’s forensic DNA identification system probes thirteen such
regions in the genome. Sequences in these special regions involve multiple repetitions of
short combinations of letters, such as GATA. Easily detectable differences between
people lie in the number of repeats that occur in both copies of their DNA in these
regions. For example, at one of these regions a person might have inherited four repeats
(GATAGATAGATAGATA) from their father and six repeats
(GATAGATAGATAGATAGATAGATA) from their mother at the same location in the
genome. Another person might inherit eight repeats
(GATAGATAGATAGATAGATAGATAGATAGATA) from their father and five
repeats (GATAGATAGATAGATAGATA) from their mother.

When two DNA samples match completely in a large number of regions,

such as the 13 used in the FBI’s CODIS system, the probability that they could have
come from two unrelated people is virtually zero. This fact makes DNA identification
extremely reliable.

Injustice Corrected

It takes both sequences at all 13 sites to prove a DNA match, but it only takes one
sequence to prove a mismatch. DNA evidence has been used to liberate a growing numb
er of people who were falsely imprisoned for crimes they did not commit.

What Does A Match Mean?

It takes both sequences at all 13 sites to prove a DNA match, but it only
takes one sequence to prove a mismatch. DNA evidence has been used to liberate a
growing number of people who DNA identification is based on probabilities. Consider
the case of just three CODIS sites. The probability that someone would match a random
DNA sample at any one site is roughly one in ten (1/10). So the probability that someone
would match at three sites would be about one in a thousand:

1/10 x 1/10 x 1/10 = 1/1000

Applying this probability equation to all 13 CODIS sites would mean that the chances of
matching a random DNA sample are about one in ten trillion:

1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x
= 1/10,000,000,000,000

Actual probabilities vary, depending on several factors. But the probability of two
different people matching at all 13 CODIS sites is virtually zero.

Visit the Marian Koshland Science

Museum to learn more.

See how DNA fingerprints are made and hear

how the use of DNA evidence has affected the
criminal justice system.

Forensic DNA Evidence

The science of identifying individuals using DNA sequences is very clear, and the
probability of scientific error is extremely small. As a result, DNA evidence has been
used to help identify perpetrators of crimes and to exonerate innocent people before they
become suspects.

The value of the evidence depends on the quality of the DNA samples and how well law
enforcement agencies handle them. Most legal disputes over DNA evidence challenge the
handling and storage of DNA samples.

Sources of DNA Evidence

DNA can be left behind in a surprising variety of forms, including saliva,

blood, semen, skin, hair, tears, and more. As a result, crime scene evidence can often be
traced to a specific individual even if there were no eyewitnesses, and DNA tests provide
a more powerful tool than fingerprint analyses.

DNA Evidence Is Left Behind In A Variety Of Forms

A skin cell, blood, and the shaft of a hair (shown from left to right) all contain DNA
and can be collected as crime scene evidence. (Microscopic images of the skin cell and
hair shaft courtesy of Joseph A. Brzostowski)

IIIIM IMPROVING CROPS

IMPROVING CROPS:

How Does Reading Genes Improve Crop

With the dawn of agriculture, about 10,000 years ago, humans began
modifying wild plants. Planting seeds from the most desirable plants is a way of choosing
certain genetic traits over others. Although the transformations occurred over many
centuries, virtually every cultivated species has been genetically modified from its wild
form through classical plant-breeding techniques. The produce sold in markets today is
very different from its wild progenitors.
 Crop yields have risen dramatically since the advent of scientific crop
selection about a century ago. Cross-breeding techniques improved the precision with
which specific traits could be selected. Today, DNA sequencing provides new tools for
understanding crop traits and for selecting desirable traits with even greater efficiency. In
other words, the latest genetic engineering techniques often provide a better way to carry
out many of the crop selections of the past.

In the following sections we explore the development of crops, using corn as an example.

From Teosinte to Corn

Increasing Productivity in Corn
Reading Traits in the Corn Genome
Growing GMOs

Maize Mutants
The genes that govern many specific traits have been
identified in the maize (corn) genome.In this activity you
can explore some of the genes located on corn's ten
chromosomes and see the effects of those genes.

From Teosinte to Corn

Ancient Teosinte

Corn's ancestor did not have large ears. Instead, hard, nut-like kernels were distributed in
small, feathery cobs over many tertiary branches.

Modern Corn (Maize)

Corn today comes in many varieties, all of which have ears that contain many soft
kernels.

From Teosinte to Corn

The genes that control a number of specific traits have been identified.
For example, a gene on chromosome #1 causes the ears of corn to be big and to grow on
a few short branches. In contrast, the ears of teosinte are scattered over many small
branches.
A gene on the second chromosome causes more rows of kernels to grow, yielding more
food per corn plant.
A gene on the fourth chromosome causes corn kernels to have small, soft casings.
Teosinte kernels have much larger, harder kernel casings that make them hard to eat.
Ancient Teosinte (left) Corn's
ancestor did not have large ears.
Instead, hard, nut-like kernels
were distributed in small, feathery
cobs over many tertiary branches.
Modern Corn (Maize) (right)
Corn today comes in many
varieties, all of which have ears
that Contain many soft
kernels.Photos ourtesy of John
Doebley.

Increasing Productivity in Corn

The goal of plant breeding, scientific crop selection, and modern genetic research is to
increase crop yields and improve the quality of the food, feed, and fibers produced.
Modern crops are dramatically more productive than wild plants, as demonstrates.
Corn is just one example of advances in productivity for many crops.

Acreage Required to Match Today's U.S. Corn Production

Today: Total U.S. corn production in 2002, excluding feed corn, was
about 252 million tons from 69.3 million acres, which is 3.6 tons or 130 bushels per acre.
This represents around 4% of the land area of the lower 48 states.
Teosinte: Modern experiments growing teosinte produced 0.28 tons per acre, so matching
today's corn production would require 12.9 times the current acreage, or a total of 891
million acres. This represents around 47% of the land area of the lower 48 states.
Reading Traits in the Corn Genome

Chromosomes, Genes, and Traits

The genes that govern many specific traits have been identified in the genome of maize
(corn) and located along the plant's ten chromosomes. Just a few of these genes are
shown here, yet they demonstrate how broadly the gene sequences in DNA affect an
organism's appearance and health.

Maize Mutants
The genes that govern many specific traits have been
identified in the maize (corn) genome.

In this activity you can explore some of the genes located on

corn's ten chromosomes and see the effects of those genes.

Growing GMOs
Genetically modified organisms (GMOs) are created by inserting genes for specific traits
into a genome. These genes can either come from plants or other organisms. In corn, such
genes have been chosen to improve pest and pesticide resistance, and the insertions were
tested through many generations to assess the stability and safety of the new strains. The
first genetically modified corps were approved for release in 1996.

Since 1987, a series of independent committees of the National Academies have pointed
out that “both transgenic and conventional approaches to adding genetic variation to
crops can cause changes in the plant genome that result in unintended effects on crop
traits.” In this sense, all of the plants that we eat today have been “genetically modified.”
New variations of food plants should therefore be carefully examined for possible
adverse health or environmental effects. However, each of the committees has
emphasized that “the properties of a genetically modified organism should be the focus of
risk assessments, not the process by which it was produced.” – NRC 2000, 2002
 Visit the Marian Koshland Science Museum
to learn more.

See what countries are planting genetically

modified crops and explore corn chromosomes
to see how genes effect maize traits.

INFECTIOUS DISEASE
Why Are People Suddenly Ill?

What Is This New Disease?

• Is it a virus?
• Is it a bacteria?
• Is it from a natural source?
• Is it from a hostile attack?

In 2002, a growing number of people suddenly became ill with an unknown condition.
The outbreak, which seemed to begin in East Asia, came to be known as Severe Acute
Respiratory Syndrome, or SARS.

Identifying infectious agents quickly is a goal of public health response. But growing
cultures and identifying strains is a time-consuming process.

The identification of the cause of SARS provides an example of the great speed that
modern DNA sequencing has brought to the detection of infectious diseases. In this case,
a new tool that uses the wealth of available DNA sequence information was used to
identify the SARS disease agent as a strain of coronavirus in just 24 hours. This
information guided public health researchers to the source of the SARS virus in wild
animals. This DNA technique can be used to rapidly detect and identify new outbreaks,
whether they stem from natural sources or criminal activity, thereby saving many lives.

The following sections describe how DNA evidence was used to identify the source of
SARS.
Streamling the Process
Identify the Disease
Finding the Source

Identify the Disease

A new tool that uses the wealth of available DNA sequence
information was used to identify the SARS disease agent as
a strain of coronavirus in just 24 hours. See if you can
identify the disease in this activity.

Streamlining the Process

Probing Many Viruses at Once

The “virus chip” is a DNA technology that was used successfully to identify the family of
viruses to which SARS belongs in just 24 hours. Using a virus chip, SARS was compared
to DNA samples from 1,000 viruses simultaneously.

The virus chip is an ordered arrangement of 11,000 specific 70-letter DNA sequences
representing 1,000 different viral strains. They are the same DNA sequences that appear
on the screen to the left. A sample of each 70-letter sequence is prepared and arranged as
a tiny dot on a small glass slide. If samples from a sick person contain some of these
same sequences, the dots containing the matching DNA sequences appear red, as in the
enlarged photo above. Each dot in the photo, whether red or green, represents a different
70-letter DNA sequence.

From Dots to Bar Codes

Sorting the Dots for Easier Comparison
The virus chip software converts the red dots into lines on a bar code, such as this one.
Since each virus has a unique combination of DNA sequences, each has a unique bar
code.

The DNA matches that result in bar code lines are not always perfect. The brightness of
each yellow line indicates how strong the match is. This is useful information because an
unknown virus might be a new strain that is different from known strains. The SARS
coronavirus, for example, was a new strain in humans.

Identify the Disease

A new tool that uses the wealth of available DNA sequence information was used to
identify the SARS disease agent as a strain of coronavirus in just 24 hours. See if you can
identify the disease in this activity.

Finding the Source

Where Did SARS Come From?

Knowing that SARS is caused by a particular strain of coronavirus

allowed public health researchers to trace the virus back to its first appearance in humans.

SARS did not appear to stem from a hostile or criminal act. Rather, the
first cases appeared among people who handle certain wild animals, which are eaten as
delicacies in parts of China.

Tests of animals showed that the SARS strain of coronavirus is present in

masked palm civets, Chinese ferret badgers, and raccoon dogs. It is possible that one of
these animals was imported into China and used as food, allowing the virus to move into
and adapt to grow in a human. Once this happened, the virus moved from person to
person through close contact.

Masked Palm Civet

SARS may have originated in

animals. The masked palm
civet (left) is one possible
source. Chinese ferret
badgers and raccoon dogs
have also be cited as possible
sources. (National Zoological
Park ©2004 Smithsonian
Institution)

CONCLUSION

Although we have discussed some disadvantages of

DNA computing, its efficiency in today’s world is
unquestionable.