Sie sind auf Seite 1von 2

TUGAS MIKROSATELIT

Nama : Suci Awaliyah

NIM : 1505003

Kelas : Biologi C 2015

>XM_019346352.1 PREDICTED: Oreochromis niloticus insulin like growth factor 1 (igf1), transcript variant X1, mRNA

TTTTGAACGCATGCATTGGTGCGGATTTATTCACATTTTTCTCCTTTTCATCCACTTATGGAACAACTCTCCCGCATGTCCTGAGTG
CGATGTGCTGTATCTCCTGTAGCCACACCCTCTCACTACTGCTGTGCGTCCTCACCCTGACTCCGACGGCAACAGGGGCGGGCCC
TGAGACCCTGTGCGGGGCGGAGCTGGTCGACACGCTGCAGTTTGTCTGTGGAGAGCGAGGCTTTTATTTCAATAAACCAACAGGC
TATGGCCCCAGTGCAAGGCGGTCACGTGGCATCGTGGACGAGTGCTGCTTCCAAAGCTGTGAGCTGCAGCGCCTTGAGATGTACT
GTGCACCTGTCAAGACTCCCAAGATTTCTCGCTCTGTGCGTTCACAGCGGCACACAGACATGCCAAGAGCACCCAAGGTTAGTAG
CAGAGCGAACAAGGGGACAGAGCGTAGGACAGCGCCTCAGCCAGACAAGACAAAAAACAAGAAGAGACCTTCACCTGGACATA
GTTCATCCTTCAAGGAAGTCCACCAGAAAAACTCAAGTCGAGGAAGTTCGGGGGGCAGGAATTACAGAATGTAGGGAAGGAGC
AAATGGACAAATGCCCAGCAACTTGGGAGGAGAGAAGGGAGTGGCCTTACCTGGTACCCCTGTGGAATGGTTCACTGTAAAACA
AAAGAAAGAAGATGCTAATAATGACCTGAAAAGCTCTTCAAAATGATTGAAAACAGAGAGCTAGGTGGTGTGTAAGGGTCTGAT
GTGGAAAATTGTGATTATTTTATACACTGCACCATTCCATACTGGGAGGAATTCTTTGTTAATGCAATGTAACAGACTAGTTTAGC
TGCTAAGACACGAACAAGAGCTTATTATACCTCCATGTTGGAGCTGCAGCCTCCCCAGGCTCCAGGAAAGATGGGAACGTATCT
GGGCCTCAGCCAATCAGAGAGCAGCATGGCTGTGGCTCGGTCACATTTAACAGTTAGTACCCCAGTTCAAAGCTGATATATTACC
TTCAGAGTTTGTTTTTATGCACCATCCATTACTGTGGATATTTTTATTATGTAAAAAAAAATAAAAAAGGTTTGCTTTAAGGACAA
AGACCAGGTGGTTCATCACAGTTTAAACATTGTTGTAGGTATTTTAACTTGAGTCTAAGTCTAAACCTTACTAAGAGGAGTCGCT
GGATCCAAACATTATAAAAGGAGCTCAAGCACTATTAGAGGGGATTTTAAAGAAAGTGGGTAGTACAGAAGGTACTACAAAAA
AAAGACTGGGATTTTTCACATTTTCCAAAACAGAAAAACAAATTAACCAGAAGCTAAAACTGAGTTCTCGTTTGGTCCTCAGAAG
TGTGTCATTCGGTGAAGTCAAAGTGCATTTGGCAAACTGAAGTGGAACAAGTCAAATAATGACAATCAGGCAAAATGTTTGTCG
TCTGCATCCTTTCACATGTCAACACCCCAGCCAAATTTGATTTTTGACAACAGTTCAGTCAACATTTCAGTTTGAGTGGAAACCTG
TGTTTAACCTTGAACACAGGTTTCCACTCACAACCCGTGTTCAAGGGTAAACACGATGTTATGAAAGTTTAGTCAAAGCAAGTGC
TCTAAAAAGAAGTACAACCGTCACACGTATGAGTTTAAGTGACTGATCTTGACCTGGATATTTTATTAGCTTAGGGAGGATGAGA
ACTTTGCAACTTTATCTGATGGCAAGAGTAGAATGAACCTCCACTGCATTCATTGCAGAGTGCACCCAAGAAACACGCATATTTG
GTGAACATTGGCAAAACCACAAGGACAAATCTTTCTGGTGATGTGATGTTCGCATATCAGAACACAAATACACATGCAAAAGCA
CTCACAAGGTAAATTAAAGTTGTGCAACTACAAGCAAAGGTCATGCACACATACACCAACTTTCATGAAAAGCCAGTTCTGAGA
AGTCCTTGCATGAGGACTAACGAAAACGGCTGTTTGTTTAAGCCTCCAAAAAAAAAAAAAAAAAAGATTAAAAAAAAACGATA
AGAAAAAAAATAATAATTGCCCAAGACGACTCATCTCTGGCTCTGTCTCCTCTGCCTGTGTATAATCAAACAGTATTCCCATTAT
GTTAACCTATGCATTACTATCATTCATTGTACATGATGGTTTCATATAACAAAACTGTATTAAGAATCCTATCCACTGTATAATGG
TGCTATTTTGTAGTTTGTTACTTGCAAGAGATGGCTAAGAGACTGATGGCAGGGCTTACATTGGAGGTCTTCCCTTTTGCACAGCC
TTGTGGCCACCATTTTAATAGTGTTTTTATTTGTAAGCTGTTTCAATAAGGTAGTAGTCTAAGCGAGTAAATGTATCTGTGTGAAA
TCTGTGAATGCACGAAGAATTTAAAAAAAAAAAAAAA