Sie sind auf Seite 1von 1

>AF016978.

1 Odocoileus virginianus WHITETAILA mitochondrial D-loop, complete


sequence
TAATATACTGGTCTTGTAAACCAGAAAAGGAGAGCAACTAATCTCCCTAAGACTCAAGGAAGAAGCCATA
GCCCCACTATCAACACCCAAAGCTGAAGTTCTATTTAAACTATTCCCTGACGCATATTAATATAGCTCCA
TAAAACCCAAGAGCTTTATCAGTATTAAATTTTTAAAAATTTTAATAATTTAATACAGTTTTGTACTCAA
TAGCCATATTACATTCTTTAATACCATTACCTACACAAACTGCACAACAATGTATTTATTATATAATCTT
ATGCGGGTGTAGTACATAAAATTAATGTATCAAGACATATTATGTATAATAGTACATTACATTATATACC
CCATACTTATAAGCAAGTACATAAAATTAATGTATTAAAACATATTATGTATAATAGTACATTAAACTAT
ACACCCCATGCTTACAAGCAAGTACATACAATCACTTCAAGTACATAGTACATACTATTATTAATCGTCC
ATAGCACATTAAGTCAAATCTACCCTCGTCAACATGCGTATCCCGTCCCTTAGATCACGAGCTTAACCAC
CATGCCGCGTGAAACCATCAACCCGCTTGGCAGGGATCCCTCTTCTCGCTCCGGGCCCATATAATGTGGG
GGTAGCTATTTAATGAACTTTATCAGACATCTGGTTCTTTCTTCAGGGCCATCTCACCTAAAATCGCCCA
CTCTTTCCTCTTAAATAAGACATCTCGATGGACTAATGACTAATCAGCCCATGCTCACACATAACTGTGG
TGTCATACATTTGGTATTTTTAATTTTTGGGGGGATGCTTGGACTCAGCTATGGCCGTCTGAGGCCCCGA
CCCGGAGCATATATTGTAGCTGGACTTAACTGCATCTTGAGCATCCCCATAATGATAGGCACGGGCATGA
TAGTGAATGCTAGTAAGACATAACTGTAATAGTAAGCATGGACATATTAATTAATGGTAACAGGACATAA
CTATTATTTCATGATTCAACCCTATAACTTTTTTCCCCCCCCCCGAAATCTCCCCCTTATATGGTTACCA
CAATTTTTAACACACTTCTCCCTAGATAGTATTTTAAATTTATCGCATTTTCAATACTCAATTAGTACTC
CAGGGCAAGGTAAGTATATAAGCGCCATTTTTTCTTCTCCAAATCATAGTTAATGTAGCTTAAACAATAA
AGCAAGGCACTGAAAATGCCTAGATGAGTATAATTACTCCATAAAACACATAGGTTTGGTCCCAGCCTTC
CGACCC
>U12869.1 Odocoileus virginianus mitochondrion D-loop, complete sequence
ACGCATATTAATATAGCTCCATAAAACCCAAGAGCTTTATCAGTATTAAATTTTTAAAAATTTTTAATAA
TTTAATACAGTTTTGCACTCAACAGCCATATTACATTCTTTAATACCATTATCTACATAAACTGCACAAT
AACATACCCACTATACAATTTTATGTGGGTATAGTACATAAAATTAATGTACCAAGACATACTATGTATA
ATAGTACATTATATTACATACCCCATACTTATAAGCTAGTACATAAAATTAATGTACTAAGACATACTAT
GTATAATAATACATTACACTATTTACCCCATGCTTATAAGCAAGTACATACAACTATTCAAAGTACATAA
GACATGTTACTGTTAGTCGTCCATGGCACATTAAGTCAAATCCACCCTTGTCAACATGCGTATCCCGTCC
CTTAGATCACGAGCTTAATTACCATGCCGCGTGAAACCAACAACCCGCTTGGCAAGGATCCCTCTTCTCG
CTCCGGGCCCATATAGTGTGGGGGTAGCTATTTAATGAATTTTAACAGACATCTGGTTCTTTCTTCAGGG
CCATCTCATCTAAAATCGCCCACTCTTTCCCTTAAATAAGACATCTCGATGGACTAATGACTAATCAGCC
CATGCTCACACATAACTGTGGTGTCATGCATTTGGTATTTTTAATTTTTGGGGGGATGCTTGGACTCAGC
TATGGCCGTCTGAGGCCCGACCCGGAGCATATATTGTAGCTGGACTTAACTGCATCTTGAGCATCCCCAT
AATGATAGGCATGGGCATGACAGTGAATGCTAGTAAGACATAACTATAATGGTAAGTATGGACATAACAG
TCAATGCTAGTAGGACATAATCATTATTTCATGATTCAACCCTATAACTTTTTCCCCCCCCGGTAAATTC
TCCCCCTTATATGGTTACCACAATTTTTAACACACTTCTCCCTAGATAGTATTTTAAATTTATCGCATTT
TCAATACTCAATTAGTACTCCAGGGCGAGGTAGGTATATAAGCGCCATTTTTTCTTCTCCAAATCATA
>U12864.1 Bison bison mitochondrion D-loop, complete sequence
AACGCTATTAATATAGTTCCATAAATGCAAAGAGCCTCACCAGTATTAAATTTACTAAAAATTCCAATAA
CTCAACACAAACTTTGTACTCTAACCAAATACTGCAAACACCACTAGCTAACGTCACTCACCCCCAAAAT
GCATTACCCAAACGGGGGAAATATACATAACATTAATGTAATAAAAACATATTATGTATATAGTACATTA
AATTATATGCCCCATGCATATAAGCAAGTACTTATCCTCTATTGACAGTACATAGTACATAAAGTTATTA
ATTGTACATAGCACATTATGTCAAATCTACCCTTGGCAACATGCATACCCCTTCCATTAGATCACGAGCT
TAATTACCATGCCGCGTGAAACCAGCAACCCGCTAGGCAGAGGATCCCTCTTCTCGCTCCGGGCCCATGA
ACCGTGGGGGTCGCTATTTAATGAACTTTATCAGACATCTGGTTCTTTCTTCGGGGCCATCTCACCTAAA
ATCGCCCATTCTTTCCTCTTAAATAAGACATCTCGATGGACTAATGGCTAATCAGCCATGCTCACACATA
ACTGTGCTGTCATACATTTGGTATTTTTTTATTTTGGGGGATGCTTGGACTCAGCTATGGCCGTCAAAGG
CCTGACCCGGAGCATCTATTGTAGCTGGACTTAACTGCACCTTGAGCACCAGCATAATGGTAAGCATGCA
CATATAGTCAATGGTTACAGGACATAAACTGTATTATATATCCCCCCCCTCCATAAAAATTCCCCCTTAA
ATATTTACCACTGCTTTTAACAGATTTTTCCCTAGTTACCTATTTAAATTTTCCACACTTTCAATACTCA
AATTAGCACTCCATATAAAGTCAATATATAAACGCAGGGCCCCCCCCCCC