American Journal of Medical Genetics (Neuropsychiatric Genetics) 81:172–178 (1998)

Scanning of the Dopamine D1 and D5 Receptor

Genes by REF in Neuropsychiatric Patients Reveals
a Novel Missense Change at a Highly Conserved
Amino Acid
Jinong Feng,1 Janet L. Sobell,1 Leonard L. Heston,2 Edwin H. Cook, Jr.,3 David Goldman,4 and
Steve S. Sommer5*
1
Division of Molecular Medicine, Beckman Research Institute, City of Hope National Medical Center,
Duarte, California
2
Department of Psychiatry, University of Washington, Seattle, Washington
3
Departments of Psychiatry and Pediatrics, University of Chicago, Chicago, Illinois
4
National Institute on Alcohol Abuse and Alcoholism, Rockville, Maryland
5
Division of Human Genetics, Department of Molecular Diagnosis, Beckman Research Institute, City of Hope
National Medical Center, Duarte, California

In previous analyses of schizophrenic pa-
tients, multiple missense changes and one
nonsense change were identified in the D5
dopamine receptor (DRD5) gene, but no se-
quence changes of likely functional signifi-
cance were identified in the D1 dopamine
receptor (DRD1) gene. In the present study,
we examined these genes in patients with
certain other neuropsychiatric disorders
that may be related to dopaminergic dys-
regulation. The coding regions of the DRD1
and DRD5 genes were examined in 25 and 25
autistic patients, 25 and 28 attention deficit
hyperactivity disorder patients, and 51 and
43 alcoholic patients, respectively. In addi-
tion, the DRD5 gene was examined in 75
schizophrenic patients to search for addi-
tional variants affecting protein structure
or expression (VAPSEs). These patients
were analyzed with REF (restriction endo-
nuclease fingerprinting), a hybrid between
SSCP and restriction endonuclease diges-
tion, which allows the entire coding se-
quence to be screened in one lane of a gel.
Approximately 800 kb of genomic sequence
were examined. No sequence changes were
identified in the DRD1 gene among the 101
patient samples analyzed. Two sequence
Contract grant sponsor: NIMH; Contract grant numbers:
MH44276, MH52223, KO MH01389.
*Correspondence to: Steve S. Sommer, Division of Human Ge-
netics, Department of Molecular Diagnosis, Beckman Research
Institute, City of Hope National Medical Center, Duarte, CA
91010.
Received 15 July 1997; Revised 13 November 1997
© 1998 Wiley-Liss, Inc.
changes were identified in the DRD5 gene
among the 171 patient samples. These in-
cluded one previously identified silent poly-
morphism at base pair 978 (P326P). The
change was identified in patients from all
disease categories and from different ethnic
backgrounds. One novel missense change,
L88F, occurred in transmembrane domain
II at a highly conserved amino acid in all
dopamine receptors as well as in a1- and b-
adrenergic receptors. The mutation was
identified in a Caucasian male patient with
autism. Further analysis is necessary to de-
termine if this missense change is associ-
ated with a particular neuropsychiatric
phenotype. Am. J. Med. Genet. (Neuropsy-
chiatr. Genet.) 81:172–178, 1998.
© 1998 Wiley-Liss, Inc.
KEY WORDS: dopamine receptor; schizo-
phrenia; autism; attention
deficit/hyperactivity disor-
der; alcoholism
INTRODUCTION
Candidate gene association studies have been devel-
oped as an adjunct to linkage analysis in the search for
genes predisposing to multifactorial diseases, such as
schizophrenia and other neuropsychiatric disorders
[Sobell et al., 1992]. In one type of candidate gene
study, termed VAPSE-based analysis, gene regions of
likely functional significance are examined directly for
variants affecting protein structure or expression
(VAPSEs). Once a VAPSE of likely functional signifi-
cance is found in a candidate gene from a subsample of
affected individuals, the prevalence of that allele is

compared in a large group of unrelated patients and
ethnically similar controls to determine if a disease as-
sociation exists. Parental controls, if available, offer
the best approach for removing ethnicity as a confound-
ing variable [Schaid and Sommer, 1994; Falk and Ru-
binstein, 1987].
The rate-limiting step in VAPSE-based candidate
gene studies is the examination of the regions of likely
functional significance in search of sequence changes.
To increase the rate at which a DNA sequence may be
examined, while retaining high sensitivity and speci-
ficity, our laboratory has developed a battery of meth-
ods for genomic screening [Liu et al., 1996; Liu and
Sommer, 1995; Sarkar et al., 1992], including restric-
tion endonuclease fingerprinting (REF) [Liu and Som-
mer, 1995; Liu et al., 1997]. REF allows the detection of
single base pair changes in a large segment of ampli-
fied DNA (1–2 kb) by the creation of overlapping re-
striction fragments that, when electrophoresed
through a nondenaturing gel, can exhibit migrational
differences due to underlying conformational changes.
Thus, a particular sequence change can be detected as
an altered electrophoretic pattern in multiple seg-
ments. Furthermore, if a sequence change alters a re-
striction site, these changes may be readily identified
as missing or added segments.
In the present study, REF was used to examine the
dopamine D1 and D5 receptor (DRD1 and DRD5) genes
as candidates for neuropsychiatric disease. DRD1 and
DRD5 belong to a subfamily of dopamine receptors
known to stimulate the production of adenylyl cyclase
via G-protein coupling, thereby activating cyclic AMP
(c-AMP)-dependent protein kinases. Most available
agonists and antagonists of DRD1 interact similarly
with DRD5. The amino-acid sequence identity of DRD1
and DRD5 in their characteristic seven transmem-
brane domains is 80%, with an overall amino-acid ho-
mology of 50% [Sunahara et al., 1991]. The protein
products are of average length, being 477 amino acids
for D5 [Sunahara et al., 1991] and 446 residues for D1
[Sunahara et al., 1990]. The coding region of both genes
is uninterrupted. The genes have been localized to
chromosomes 4p15.1–15.3 (DRD5) [Sherrington et al.,
1993] and 5q35.1 (DRD1) [Grandy et al., 1990].
Involvement of dopaminergic systems has been hy-
pothesized in a variety of psychiatric disorders. For ex-
ample, dopaminergic activity in the striatum and lim-
bic system has been suggested to underlie the develop-
ment of substance dependence in animal models of
addictive behavior (e.g., alcoholism) [Tiihonen et al.,
1995]. Imbalances in noradrenergic and dopaminergic
systems may be associated with particular symptoms
of attention deficit/hyperactivity disorder (ADHD)
[Malone et al., 1994], and DRD1 nullizygous mice are
hyperactive [Xu et al., 1994]. Selective destruction of
dopamine neurons by the injection of 6-hydroxydopa-
mine in the neonatal rat brain has been shown to result
in behavioral problems, such as hyperactivity and
learning deficit symptoms [Garfinkel and Wender,
1989]. Excesses of dopaminergic activity in the basal
ganglia have been associated with stereotyped repeti-
tive behavior in experimental animals, while repetitive
DRD1/DRD5 and Neuropsychiatric Diseases 173
behaviors have been associated with deficient activa-
tion produced by frontal lobe lesioning [Ridley, 1994].
In previous analyses in schizophrenic patients, mul-
tiple missense changes and one nonsense change were
identified in DRD5 [Sobell et al., 1995], but no se-
quence changes of likely functional significance were
identified in DRD1 [Liu et al., 1995]. The purpose of the
present study was to search for additional DRD1 or
DRD5 sequence changes in an extended sample of
schizophrenic patients, as well as in patients with
other neuropsychiatric disorders (alcoholism, attention
deficit/hyperactivity disorder, or autism), that may be
related to dopaminergic dysregulation. An additional
purpose was to demonstrate further the feasibility of
using REF as a highly sensitive and specific screening
test.
MATERIALS AND METHODS
Patient Samples
All schizophrenic patients met the criteria for dis-
ease as defined by the Diagnostic and Statistical
Manual III, Revised (DSM-III-R), as described previ-
ously [Sobell et al., 1993]. The majority of patients were
ascertained through state mental institutions in Min-
nesota, Washington, and Oregon. Unrelated alcoholic
patients of Finnish ethnicity were ascertained through
collaborative efforts involving the National Institute on
Alcohol Abuse and Alcoholism (NIAAA) and the Uni-
versity of Helsinki, Finland (supervised by D.G.). The
Finnish alcoholics were a criminal-offender population
and were diagnosed by DSM-III criteria. The alcoholic-
offender population is highly enriched for antisocial
personality disorder and intermittent explosive disor-
der. Southwestern Native American patients were as-
certained through the NIAAA (by D.G.). The South-
western American Indians were interviewed with the
Schedule for Affective Disorders and Schizophrenia
(SADS-L) and diagnosed in blind fashion using DMS-
III-R criteria. None of the Southwestern Indian alco-
holics were first-degree relatives and, although these
subjects were all members of the same very large pedi-
gree, their degree of relationship was equal to or less
than the average degree of relationship for the popula-
tion from which they were derived [Goldman et al.,
1992, 1997]. ADHD patients were ascertained at the
University of Chicago [Cook et al., 1995] using the fol-
lowing criteria: 1) child or adolescent with a DSM-III-R
diagnosis of ADHD made in a consensus diagnostic
conference in which a child psychologist, child psychia-
trist, and a developmental pediatrician presented find-
ings from each of their evaluations; and 2) consent to
participate by both parents and child. Patients with
autistic disorder were also ascertained at the Univer-
sity of Chicago if the following criteria were met: 1)
child or adolescent with a mental age of at least 18
months and intelligence quotient greater than 35; 2)
DMS-IV diagnosis of autistic disorder by a child psy-
chologist and child psychiatrist; 3) diagnosis of autistic
disorder by the Autism Diagnostic Interview-Revised
(ADI) [Lord et al., 1994]; 4) absence of specific identi-
fied etiology based on history and physical examina-
tion; and 5) consent to participate from both parents
174 Feng et al.
and child. Selected demographic characteristics of all
patients are displayed in Table I.
Patient 1242 With Autism and a
Missense Mutation
There were 2 paternal cousins (in different sibships)
with speech and language problems. The patient was
not severe, had sleep problems which resolved, and had
mild comorbid attention deficit hyperactivity disorder
for which pemoline (Cylert) and methylphenidate were
prescribed sequentially with relatively little benefit.
He did not have other comorbid features, specifically,
neither seizures nor increased irritability.
When he was 4 years old, his ADI scores were 21
(cutoff, 10), 13 (cutoff, 8), and 6 (cutoff, 3) in social,
communicative, and restricted and repetitive interests
domains, respectively. At age 6, his Differential Ability
Scales (DAS) Verbal Standard Score was 92 and his
Nonverbal Reasoning Score was 105. His receptive lan-
guage, as measured by the Peabody Picture Vocabulary
Tests-Revised, was average (standard score, 90).
Medical evaluation revealed a boy at the 61st centile
of height and 80th centile of weight. He was not dys-
morphic and his overall physical examination was nor-
mal, except for his developmental problems. Labora-
tory evaluation included normal brain-stem auditory-
evoked response, normal urinary amino-acid and
organic-acid analysis, and normal electroencephalo-
gram, with 46XY karyotype, and negative fragile X
chromosomal testing. His thryoxine level as slightly
increased (13.3, with a reference range of 6.0–12.0 mcg/
dl).
Laboratory Methods
DNA amplification. DNA was extracted as previ-
ously described [Gustafson et al., 1987]. For both the
DRD1 and DRD5 genes, an initial amplification by
PCR was performed in a total volume of 25 ml with 10
mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 200
mM of each deoxyribonucleoside triphosphate, and 0.1
mM of primers specific for DRD1, i.e., DRD1 (Hs)-
58UTR-(−29)-27D: 5 8GAGCCCCTGATGTGCTTT-
CTCTTAGGA 3 8; DRD1 (H s )-38UTR-(1413)-27U:
5
8TTAATAGCAAGCCCCAGAGCAATCTCC 3 8, or of
primers specific for DRD5, i.e., DRD5 (Hs)-58UTR-(−74)
-32D: 58CCGATGGGGCTGCCTGGGGGTCGCAGGG-
CTGA38; DRD5 (Hs)-38UTR-(1503)-32U: 58GCGTGTG-
TABLE I. Distribution of DRD5 and DRD1 Patients by Diagnosis, Race/Ethnicity, and Gender (M/F)
Diagnosis Schizophrenia, DRD5
Race/ethnicity
Caucasian
Western European 41/19
Northern European
Hispanic
African-American 13/2
Native American
Asian
Total 75
a
Finnish.
b
Southwestern American Indian.
TGTGCGTGCTTGTCAGTGTCTGTGC38. The informa-
tive primer names and number systems for the genes
have been previously described [Grandy et al., 1991;
Dearry et al., 1990; Stoflet et al., 1988]. 1 U of Ampli-
Taq (Perkin-Elmer, Norwalk, CT) and 2 ng of genomic
DNA were added (denaturation at 95°C for 15 sec, an-
nealing at 65°C for 30 sec, and elongation at 72°C for 3
min for a total of 15 cycles with the Perkin-Elmer Ge-
neAmp PCR System 9600). A second nested round of
PCR was performed using internal primers for DRD1,
i.e., DRD1 (Hs)-58UTR-(−7)-30D: 58TAGGAAGATGAG-
GACTCTGAACACCTCTGC 3 8; DRD1 (H s )-38UTR-
(1361)-28U: 58GGCAGGATTCATCTGCGAGTTCAG-
GTTG38, and internal primers for DRD5, i.e., DRD5
(H s )-58UTR-(−7)-22D: 5 8GCCCGAAATGCTGCCGC-
CAGGC38; DRD5 (Hs)-38UTR-(1450)-32U: 58GTTTCT-
TAATGCAGTTTAATGGAATCCATTC38, using 1 ml of
the first-round product. This was added to a volume of
75 ml with the same reagents as above. PCR cycles
were conducted at the same temperatures and times
for a total of 30 cycles and a final elongation for 10 min
at 72°C. The nested amplification products were puri-
fied using Microcon-100 columns (Amicon, Beverly,
MA). Product sizes were 1,426 bp for DRD1 and 1,511
bp for DRD5.
Overview of REF. REF is a hybrid between SSCP
and restriction endonculease digestion in which virtu-
ally all mutations in a 1–2-kb segment can be detected
[Liu and Sommer, 1995; Liu et al., 1997; Fujimura et
al., 1997]. If brief, the region of interest is amplified by
PCR, and divided into multiple aliquots. Each aliquot
is digested by a different set of endonucleases. The ali-
quots are combined, end-labeled, denatured, and elec-
trophoresed on a nondenaturing gel. If six different en-
donuclease digestions are performed, 12 single-
stranded segments on the REF fingerprint will contain
that variant. If only one of those segments displays an
altered mobility, the variant will be detected. In addi-
tion to the SSCP effect, approximately one quarter of
the mutations will be detected because they create or
eliminate a restriction site. Our revised protocol fol-
lows.
Restriction endonuclease digestions. The re-
striction enzyme digestions were performed as de-
scribed previously [Liu and Sommer, 1995]. Selection
of the enzyme battery was aided by computer algo-
rithms developed in our laboratory [Scaringe et al., un-
Autism ADHD Alcoholism
DRD1 DRD5 DRD1 DRD5 DRD1 DRD5
21/3 21/3 17/6 19/7
17/0a 16/0a
1/0 1/0
0/1 0/1
21/13b 13/14b
1/0 1/0
25 25 25 28 51 43
 DRD1/DRD5 and Neuropsychiatric Diseases
published findings]. In brief, 100 ng of purified DNA
were digested in separate tubes by four groups of en-
donucleases (AvaII/BbsI, BbvI, DrdI/MslI, and MboI
for DRD1, and AluI, BsaHI, MslI, and PleI/BbsI for
DRD5). When two enzymes were used, the digestions
were performed at one time in the same tube. All en-
zymes and buffers were purchased from New England
Biolabs (Beverly, MA). Digestion reactions were incu-
bated at 37°C for 6–8 hr, followed by enzyme inactiva-
tion by heating at 80°C for 30 min.
End-labeling, electrophoresis, and sequenc-
ing. The digestion reaction products were combined
and incubated with 0.5 U of calf intestinal alkaline
phosphatase (CIAP) (Life Technologies, Gaithersburg,
MD) at 37°C for 2 hr to remove the phosphate group at
the 58 end of the digested DNA fragments, and then
heated to 80°C for 30 min. Four nanograms of digested
DNA products were 58 end-labeled with [g-33P] ATP
(Amersham, Arlington Heights, IL) and 1 U of T4 poly-
nucleotide kinase (Promega, Madison, WI) in 2 ml re-
actions containing 50 mM Tris-HCl, pH 7.4, 10 mM
MgCl2, and 5 mM DTT. Incubation was at 37°C for 30
min. The end-labeled product (1.5 ml) was electropho-
resed at room temperature on a 0.5 × MDE™ gel with
2% urea (0.33 mol/l), using the Model SE 1500 Poker
Face™ sequencing apparatus (Hoefer Scientific, San
Francisco, CA) with a 50 mM Tris-borate (pH 8.3)
buffer at 15 W constant power. Autoradiographs of the
restriction endonuclease fingerprints were interpreted
as previously described [Liu and Sommer, 1995].
Samples with abnormal or suspicious banding patterns
were cycle-sequenced with the Perkin-Elmer GeneAmp
PCR System 9600, with cycle parameters of denatur-
ation at 95°C for 15 sec, annealing at 55°C for 30 sec,
and elongation at 72°C for 1 min for a total of 30 cycles.
Sequence analysis was performed with cycle sequenc-
ing or GAWTS (genomic amplification with transcript
sequencing) [Stoflet et al., 1988].
Blinded analysis. Included among the DRD5 pa-
tient samples were 8 schizophrenic individuals previ-
ously shown to have eight different sequence changes
in the coding region of the D5 dopamine receptor, rang-
ing from 66–1,358 bp [Sobell et al., 1995]. A total of 14
different sequence change events occurred in the
samples: 5 of the 8 unique changes (C806T, C989A,
C1005A, A1051G, and C1358G) occurred in only 1 in-
TABLE II. Frequency by Race of T978C Polymorphism Identified Among DRD5
Alleles in Patients With Neuropsychiatric Disease*
Disease Race/ethnicity
a
Schizophrenia Caucasian
African American
Autism Caucasiana
ADHD Caucasiana
African American
Alcoholism Caucasian (Finnish)
Native Americanb
Total Caucasian
Caucasian (Finnish)
African American
Native American
*Excludes Hispanic, Asian, and Asian Indian alleles due to small numbers.
a
Western European descent.
b
Southwestern American Indian.
175
dividual each, while one change (T978C) occurred in 5
individuals, and two (G66A and G990A) occurred in 2
individuals each. Blinded analysis was performed with
these samples, as the laboratory investigator (J.F.) did
not kown which samples were controls, how many posi-
tive controls were included, or the types of sequence
changes represented in the positive samples.
RESULTS
Sequence Changes
For the DRD1 gene, no sequence changes were iden-
tified among the 102 patient samples analyzed. Two
sequence changes in the DRD5 gene were identified by
REF. These included one previously known silent poly-
morphism at base pair 978 (P326P). The change was
identified in patients from all disease categories and
from different ethnic backgrounds (Table II). One novel
missense change, L88F, which results from a C→T
transition at base pair 262 (CTT→TTT), was identified
in patient 1242, a Caucasian male with autism. In ad-
dition, a C→A transversion at base pair 989 resulted in
a proline-to-glutamine missense change at amino acid
330 (P330Q). This previously described sequence
change was identified serendipitously as a result of di-
rect sequencing, but was not evident on the REF gel.
DISCUSSION
This study represents the first step in VAPSE-based
candidate gene association studies [Sobell et al., 1992].
This approach seeks first to delineate sequence
changes of likely functional significance in candidate
genes, and then to test aberrant alleles for disease as-
sociation. VAPSE-based strategies have been devel-
oped as an alternative approach to linkage-based
analysis and to linkage disequilibrium-based ap-
proaches in the study of multifactorial disorders [Sobell
and Sommer, 1997; Sobell et al., 1992].
The rate-limiting step in the conduct of VAPSE-
based analyses is the identification of sequence
changes of likely functional significance. Recently, hy-
brids between SSCP and other methods have been de-
veloped for efficiently scanning candidate genes [Liu
and Sommer, 1995; Grompe, 1993; Sarkar et al., 1992].
Restriction endonuclease fingerprinting is one such
method; REF was shown by blinded analysis to be
Total alleles C allele frequency
120 25.8%
30 33.3%
46 30.4%
52 26.9%
2 0.0%
32 21.9%
54 40.7%
218 27.1%
32 21.9%
32 31.2%
54 40.7%
176 Feng et al.

TABLE III. Summary of VAPSEs Identified in Selected Catecholamine System and Other Genes in Patients With Schizophrenia
or Other Mental Illnesses
Unique Total
sequence sequence Screening No. of No. of
Genea Patientsb scanned (bp) scanned (kb) methodc VAPSEs non-VAPSEs References
DRD1 156 (76) 1,400 643 ddF; REF 0 3 Liu et al., 1995; this study
DRD2 14 3,464 97 GAWTS 0 3 Sarkar et al., 1991
DRD5 153 (96) 1,573 743 ddF; REF 6 4 Sobell et al., 1995; this study
a2AAR 93 (113) 1,584 653 REF 4 2 Feng et al., 1998
b2AR 95 1,047 214 Bi-ddF 0 6 Feng et al., unpublished data
MAO-B 100 2,350 235 ddF; Bi-ddF; GAWTS 0 8 Sobell et al., 1997
COMT 100 1,800 360 ddF; GAWTS 2 6 Sobell et al., unpublished data
PENK-A 150 1,820 546 ddF; SSCP 1 6 Mikesell et al., 1996
APP 212 392 166 GAWTS 0 0 Arnholt et al., 1993
Total 1,358 15,430 3,657 13 38
a
a2AAR, a2 adrenergic receptor gene, subtype A; b2AR, b2 adrenergic receptor gene; MAO-B, monoamine oxidase B gene; COMT, catechol-o-
methyltransferase gene; PENK-A, proenkephalin A gene; APP, amyloid precusor protein gene.
b
Other mental illness patients indicated in parentheses.
c
ddF, dideoxy fingerprinting; SSCP, single-strand conformation polymorphism; Bi-ddF, bidirectional dideoxy fingerprinting.

highly sensitive for the detection of single base pair (Table I), only 94 were from non-Finnish Caucasians.
mutations of all types [Liu and Sommer, 1995]. REF The failure to observe the G1263A polymorphism when
was utilized in the present analysis to examine the D1 2.6 were expected is not significant.
and D5 dopamine receptor genes in a large group of For the DRD5 gene, 171 patients were analyzed, and
patients with neuropsychiatric disease. two previously identified sequence changes were ob-
served: a polymorphism (T978C) and a known mis-
Sensitivity of REF sense change in a nonconserved amino acid (P330Q). In
By decreasing the number of restriction endonucle- addition, a novel missense change, L88F, was identi-
ases used from six to four and including samples from fied within transmembrane domain II of the protein in
individuals with known mutations (see Materials and a Caucasian male patient with autism. A comparison of
Methods), further data on the sensitivity of REF in the DRD5 protein sequence between receptor subtypes
blinded analyses were obtained. One of 14 known mu- and species showed that this amino acid is highly con-
tations was missed when REF was performed on a served (Fig. 1).
1.5kb segment with only four groups of restriction en-
donucleases. Based on past blinded analyses in which
all mutations were detected, five enzymes are recom-
mended when REF is performed on a 1kb segment, and
six enzymes are recommended for a 1.3–2.3kb segment
[Liu and Sommer, 1995]. The recent development of
‘‘REF Select’’ software (available on request) facilitates
the selection of appropriate restriction endonuclease
groups, which are important to ensure that virtually all
mutations are detected with the above-mentioned
number of enzyme groups [Scaringe et al., unpublished
observations].
Previously Observed Sequence Changes
REF analysis of the DRD1 gene in 101 samples re-
vealed no sequence changes. Several sequence changes
previously have been reported, including G(−94)A [Chi-
con et al., 1994]; A(−48)G [Liu et al., 1995; Ohara et al.,
1993]; A90G [Ohara et al., 1993]; G198A [Liu et al.,
1995]; G1263A [Liu et al., 1995; Chicon et al., 1994],
and T1403C [Chicon et al., 1994]. As the current analy-
sis screened a PCR product from −7–1361, polymor-
phisms at basepairs −94, −48, and 1403 would not be
detectable. The G198A change, reported in our previ-
ous analysis of the DRD1 gene in schizophrenics, was
observed only in Asians, while the G1263A polymor- Fig. 1. Amino-acid alignment of DRD5 with other dopamine receptors
phism was found in 2.8% of Caucasians of Western indicates that L88 is completely conserved in this gene family. An addi-
European descent (Finns were not included). Only one tional alignment with the adrenergic receptor gene family revealed that
L88 was present in the adrenergic receptors a1A, B, and C, and a adren-
Asian patient was included in the present DRD1 analy- ergic receptors b, 1, 2, and 3, and conservatively changed to I in the ad-
sis. Although 128 Caucasian alleles were included renergic receptors a 2A, B, and C (data not shown).

Based on the high level of evolutionary conservation,
the missense change is highly likely to be of functional
significance. A multitude of data suggests that the
level of conservation is a good indicator of this likeli-
hood; for example, analyses of the relationship between
missense mutations causing hemophilia B and the ex-
tent to which residues in factor IX are conserved during
evolution indicate that almost all missense mutations
that occur at residues conserved in the factor IX gene
family (more than 2 billion years of evolutionary diver-
gence) are functionally deleterious [Bottema et al.,
1991]. This same relationship has been found for other
genes in which many mutations have been described
(e.g., p53, phenylalanine hydroxylase, and the cystic
fibrosis transmembrane conductance regulator). Fu-
ture studies with large samples are needed to deter-
mine the possible association of the L88F VAPSE with
neuropsychiatric disease.
If no association is found between this VAPSE and
neuropsychiatric disease, additional studies may be
conducted to determine if the aberrant allele is associ-
ated with other disorders or clinical traits. For these
analyses, a large number (preferably thousands) of
DNA samples may be screened to identify a subset of
individuals with the aberrant allele. Analyses of medi-
cal history between individuals with the VAPSE and
those homozygous for the wild-type allele may be con-
ducted.
Based on studies in Drosophila, recessive lethal mu-
tations reduce fitness in heterozygotes by an average of
3% [Crow, 1993]. Most deaths due to the mutation occur
in the heterozygotes (rather than the homozygotes) be-
cause heterozygotes are much more frequent in the
population. These ‘‘genetic deaths’’ in heterozygotes oc-
cur before the end of the reproductive period. However,
additional morbidity and mortality are likely to occur
after the reproductive period. If these data extrapolate
to humans, one would expect that mutations at highly
conserved residues would often predispose to diseases
or traits in heterozygotes, especially at higher ages.
Frequency of VAPSEs
Genomic sequence (3.6. megabases) has been ana-
lyzed in a total of nine genes. When an average of 151
patients was scanned within an average of 1,714 bp of
regions of likely functional significance, an average of
1.4 VAPSEs was found. Of these, 46% are very likely to
be of functional significance (e.g., a nonsense mutation
or a missense mutation at an amino acid that has been
conserved during more than 2 billion years of evolu-
tionary divergence). The remaining VAPSEs are mis-
sense changes that represent a mixture of functionally
important changes and neutral polymorphisms.
Two classes of genes emerge: those genes with no
VAPSEs despite extensive scanning for mutations (e.g.,
DRD1), and those genes with VAPSEs (sometimes with
four or more VAPSEs).
For every VAPSE found within regions of likely func-
tional significance, there were approximately three
non-VAPSE variants, mostly silent changes in the cod-
ing region. Within the coding sequence, there were two
VAPSEs for every silent change (13 VAPSEs vs. 25
silent changes).
DRD1/DRD5 and Neuropsychiatric Diseases 177
Candidate Genes Analyzed
To partially examine the dopamine hypothesis of
schizophrenia, our laboratory has examined genes in
the receptor and degradative pathways. These have in-
cluded the D1, D2, and D5 dopamine receptor genes, as
well as catechol-o-methyltransferase and monoamine
oxidase B. Other noncatecholamine genes have also
been examined, including dystrophin, proenkephalin
A, adrenergic receptors, and the amyloid precursor pro-
tein gene. Within the power of our sample size, none of
the VAPSEs correlated with disease in case-control
analyses. Our sample sizes were often adequate to de-
tect attributable risks on the order of 4%. Although the
results of association studies have been negative, the
data are still useful in ruling out certain genes as com-
mon causes of schizophrenia.
It should be noted that the strength of the VAPSE-
based association study approach does not lie in its
application by any one group of investigators, any more
than the usefulness of the linkage approach in multi-
factorial diseases can be judged by the results of any
single group. Rather, the VAPSE-based approach will
have its greatest usefulness when applied by many in-
dependent investigative groups in a variety of patient
populations. Ultimately, as technological advances
make direct gene examinations efficient, the identifi-
cation of sequence changes of likely functional signifi-
cance will be commonplace.
ACKNOWLEDGMENTS
We thank Mark Stein, Catherine Lord, Marrea Win-
ega, and Bennett Leventhal for diagnostic assistance,
and Shuya Yan for expert technical assistance. This
work was partially supported by grants MH44276,
MH52223,and KO2 MH01389 from NIMH.
REFERENCES
Arnholt JC, Sobell JL, Heston LL, Sommer SS (1993): Amyloid precursor
protein (APP) gene mutations and schizophrenia. Biol Psychiatry 34:
739–740.
Bottema CDK, Ketterling RP, Ii S, Yoon H, Phillips JA III, Sommer SS
(1991): Missense mutations and evolutionary conservation of amino
acids: Evidence that many of the amino acids in factor IX function as
‘‘spacer’’ elements. Am J Hum Genet 49:820–838.
Chicon S, Nothen MM, Erdmann J, Propping P (1994): Detection of four
polymorphic sites in the human dopamine D1 receptor gene (DRD1).
Hum Mol Genet 3:209.
Cook EH, Stein MA, Krasowski MD, Cox NJ, Olkon DM, Kieffer JE, Lev-
enthal BL (1995): Association of attention-deficit disorder and the do-
pamine transporter gene. Am J Hum Genet 56:993–998.
Crow JF (1993): How much do we know about spontaneous human muta-
tion rates? Environ Mol Mutagen 21:122–129.
Dearry A, Gingrich JA, Falardeau P, Fremeau RT, Bates MD, Caron MG
(1990): Molecular cloning and expression of the gene for a human D1
dopamine receptor. Nature 347:72–75.
Falk CT, Rubinstein P (1987): Haplotype relative risks: An easy, reliable
way to construct a proper control sample for risk calculations. Ann
Hum Genet 51:227–233.
Feng J, Sobell JL, Heston LL, Goldman D, Cook EH Jr, Gelernter J, Kran-
zler H, Sommer SS (1998): Variants in the a2A adrenergic receptor gene
in psychiatric patients.
Fujimura FK, Liu Q, Feng J, Sommer SS (199): Detection of mutation by
single-strand confirmation polymorphism (SSCP) analysis and SSCP-
hybrid methods. Current Protocols in Human Genetics 7.4.1–7.4.23.
Garfinkel BD, Wender PH (1989): Attention-deficit hyperactivity disorder.
178 Feng et al.
In Kaplan HI, Sadock BJ (eds): ‘‘Comprehensive Textbook of Psychia-
try.’’ Baltimore: Williams and Wilkins, p 1831.
Goldman D, Dean M, Brown GL, Bolos AM, Tokola R, Virkkunen M, Lin-
noila M (1992): D2 dopamine receptor genotype and cerebrospinal fluid
homovanillic acid, 5-hydroxyindoleacetic acid and 3-methoxy-
4hydroxyphenylphenylglycol in Finnish and American alcoholics. Acta
Psychiatr Scand 86:351–357.
Goldman D, Urbanek M, Guenther D, Robin R, Long JC (1997): Linkage
and association of a functional DRD2 variant [Ser311Cys] and DRD2
markers to alcoholism, substance abuse, and schizophrenia in South-
western American Indians. Am J Med Genet 74:386–394.
Grandy DK, Zhou QY, Allen L, Litt R, Magenis RE, Civelli O, Litt M (1990):
A human D1 dopamine receptor gene is located on chromosome 5 at
q35.1 and identifies an EcoRI RFLP. Am J Hum Genet 47:828–834.
Grandy DK, Zhang Y, Bouvier C, Zhou Q, Johnson RA, Allen L, Buck K,
Bunzow JR, Salon J, Civelli O (1991): Multiple human D5 dopamine
receptor genes: A functional receptor and two pseudogenes. Proc Natl
Acad Sci USA 88:9175–9179.
Grompe M (1993): The rapid detection of unknown mutations in nucleic
acids. Nat Genet 5:111–117.
Gustafson S, Proper JA, Bowie EJW, Sommer SS (1987): Parameters af-
fecting the yield of DNA from human blood. Anal Biochem 165:294–
299.
Liu Q, Sommer SS (1995): Restriction endonuclease fingerprinting (REF):
A sensitive method for screening mutations in long, contiguous seg-
ments of DNA. Biotechniques 18:470–477.
Liu Q, Sobell JL, Sommer SS (1995): Screening the dopamine D1 receptor
gene in 131 schizophrenics and eight alcoholics: Identification of poly-
morphisms but lack of functionally significant sequence changes. Am J
Med Genet 60:165–171.
Liu Q, Feng J, Sommer SS (1996): Bi-directional dideoxy fingerprinting
(Bi-ddF): A rapid method for quantitative detection of mutations in
genomic regions of 300–600 bp. Hum Mol Genet 5:107–114.
Liu Q, Feng J, Sommer SS (1997): In a blinded analysis. Restriction En-
donuclease Fingerprinting detects all the mutations in a 1.9kb seg-
ment. Biotechniques 23:836–839.
Lord C, Rutter M, LeCouteur A (1994): Autism Diagnostic Interview-
Revised: A revised version of a diagnostic interview for caregivers of
individuals with possible pervasive developmental disorders. J Autism
Dev Disord 24:659–685.
Malone MA, Kershner JR, Swanson JM (1994): Hemispheric processing
and methylphenidate effects in attention-deficit hyperactivity disorder.
J Child Neurol 9:181–189.
Mikesell MJ, Sobell JL, Sommer SS, McMurray CT (1996): Identification of
a missence change and polymorphisms in the proenkephalin A gene of
schizophrenic patients. Am J Med Genet 67:459–467.
Ohara K, Ulpian C, Seeman P, Sunahara RK, Van Tol HH, Niznik HB
(1993): Schizophrenia: Dopamine D1 receptor sequence is normal, but
has DNA polymorphisms. Neuropsychopharmacology 8:131–135.
Ridley RM (1994): The psychology of perservative and stereotyped behav-
iour. Prog Neurobiol 44:221–231.
Sarker G, Kapelner S, Grandy DK, Marchionni M, Civelli O, Sobell J,
Heston L, Sommer SS (1991): Direct sequencing of the dopamine D2
receptor (DRD2) in schizophrenics reveals three polymorphisms but no
structural change in the receptor. Genomics 11:8–14.
Sarkar G, Yoon H, Sommer SS (1992): Dideoxy fingerprinting (ddF): A
rapid and efficient screen for the presence of mutations. Genomics 13:
441–443.
Schaid DJ, Sommer SS (1994): Comparison of statistics for candidate-gene
association studies with cases and parents. Am J Hum Genet 55:402–
409.
Sherrington R, Mankoo B, Attwood J, Kalsi G, Curtis D, Buetow KH, Povey
S, Gurling H (1993): Cloning of the human dopamine D5 receptor gene
and identification of a highly polymorphic microsatellite for the DRD5
locus that shows tight linkage to the chromosome 4p reference marker
RAF1P1. Genomics 18:423–425.
Sobell JL, Sommer SS (1997) Genetics. In Tasman A, Kay J, Lieberman JA
(eds): ‘‘Psychiatry.’’ Philadelphia: W.B. Saunders, pp 182–209.
Sobell JL, Heston LL, Sommer SS (1992): Delineation of genetic predispo-
sition to multifactorial disease: A general approach on the threshold of
feasibility. Genomics 12:1–6.
Sobell JL, Heston LL, Sommer SS (1993): Novel association approach for
determining the genetic predisposition to schizophrenia: Case-control
resource and testing of the first candidate gene. Am J Med Genet 48:
28–35.
Sobell JL, Lind TJ, Sigurdson DC, Zald DH, Snitz BE, Grove WW, Heston
LL, Sommer SS (1995): The D5 dopamine receptor gene in schizophre-
nia: Identification of a nonsense change and multiple missense changes
but lack of association with disease. Hum Mol Genet 4:507–514.
Sobell JL, Lind TJ, Hebrink DD, Heston LL, Sommer SS (1997): Screening
the monoamine oxidase B gene in 100 male schizophrenics: A cluster of
polymorphisms in African-Americans but lack of functionally signifi-
cant sequence changes. Am J Med Genet (in press).
Stoflet ES, Koeberl DD, Sarkar G, Sommer SS (1988): Genomic amplifica-
tion with transcript sequencing. Science 239:491–494.
Sunahara RK, Niznik HB, Weiner DM, Stormann TM, Brann MR,
Kennedy JL, Gelernter JE, Rozmahel R, Yang YL, Israel Y, et al.
(1990): Human dopamine D1 receptor encoded by an intronless gene on
chromosome 5. Nature 347:80–83.
Sunahara RK, Guan H, O’Dowd BF, Seeman P, Laurier LG, Ng G, George
SR, Torchia J, Van Tol HHM, Niznik HB (1991): Cloning of the gene for
a human dopamine D5 receptor with higher affinity for dopamine than
D1. Nature 350:614–619.
Tiihonen J, Kuikka J, Bergstrom K, Hakola P, Karhu J, Byynanen OP,
Fohr J (1995): Altered striatal dopamine re-uptake site densities in
habitually violent and non-violent alcoholics. Nat Med 1:654–657.
Xu M, Moratalla R, Gold LH, Hiroi N, Koob GF, Graybiel AM, Tonegawa S
(1994): Dopamine D1 receptor mutant mice are deficient in striatal
expression of dynorphin and in dopamine-mediated behavioral re-
sponses. Cell 79:729–742.