European Journal of Soil Biology 46 (2010) 255e263

Contents lists available at ScienceDirect

European Journal of Soil Biology

journal homepage: http://www.elsevier.com/locate/ejsobi

Original article

Detection of aluminium tolerance plasmids and microbial diversity

in the rhizosphere of plants grown in acidic volcanic soil
Milko A. Jorquera a, *, Marcela Hernández b, Oscar Martínez b, Petra Marschner c, María de la Luz Mora a
a
Center of Plant, Soil Interaction and Natural Resources Biotechnology, Scientific and Technological Bioresource Nucleus, Av. Francisco Salazar 01145,
Universidad de La Frontera, Temuco, Chile
b
Programa de Doctorado en Ciencias de Recursos Naturales, Av. Francisco Salazar 01145, Universidad de La Frontera, Temuco, Chile
c
School of Agriculture, Food & Wine, The University of Adelaide, DP363, Adelaide, SA 5005, Australia

a r t i c l e i n f o a b s t r a c t

Article history: The rhizosphere is considered as a hot-spot for gene exchange among bacteria in terrestrial ecosystems.
Received 4 August 2009 Chilean volcanic soils are characterized by low pH and high concentrations of aluminium (Al) in the soil
Received in revised form solution, thus Al tolerance could be important for the survival of microorganisms in these soils; loss of genes
18 March 2010
encoding for Al tolerance may affect competitiveness particularly in the rhizosphere where competition is
Accepted 23 March 2010
Available online 8 April 2010
strong. The occurrence of Al-tolerance plasmids was investigated in the rhizospheres of pasture and crop
Handling editor: Christoph Tebbe plants growing in acidic volcanic soils from southern Chile. Al tolerance plasmids were captured by bipa-
rental mating. Two types of Al tolerance plasmids could be distinguished, based on their endonuclease
Keywords:
restriction pattern. One plasmid of each group (denoted as pRPA21 and pOPA21) was selected for further
Acidic soils studies. The plasmids showed a high stability in presence and absence of Al. Additionally, microbial
Aluminium tolerance community composition in the rhizosphere soils was assessed by denaturing gradient gel electrophoresis
Microbial community (DGGE). Sequencing of DGGE bands revealed among others, members of the bacterial phylum Gemmati-
Plasmid monadetes and archaeal phylum Crenarchaeota. The present study shows that the rhizosphere of pasture and
Rhizosphere crop plants growing in Chilean volcanic soil harbors genetic mobile elements which could play a role in the
adaptation of bacterial populations to environmental stressors, such as Al-toxicity.
Ó 2010 Elsevier Masson SAS. All rights reserved.

1. Introduction
Acidic soils (pH
5.5) represent around 40e50% of potentially
arable soils in the world [25,50]. Aluminium (Al) toxicity is a major
factor limiting agricultural production in these soils [25] because the
concentration of Al (Al3þ) in the soil solution increases with
decreasing pH. In the rhizosphere, which is defined as the soil adja-
cent to and influenced by the root [27], external and internal mech-
anisms of Al tolerance in mircroorganisms and plants have been
proposed. External mechanisms are the release of chelating
compounds (organic acids) while internal mechanisms refer to
detoxification within the cells by proteins that bind Al or the presence
of Al-tolerant enzymes. It is known that Al-tolerant bacteria are also
resistant to acidity, however acid tolerance does not guarantee Al
tolerance [24].
In southern Chile, acidic volcanic soils (Andisols and Ultisols) are
the predominant soil types supporting the bulk of agricultural and
forestry production. These soils are characterized by pH values
* Corresponding author. Tel.: þ56 (45) 325 467; fax: þ56 (45) 325 053.
E-mail address: mjorquera@ufro.cl (M.A. Jorquera).
between 4.5 and 5.5 and high amounts of extractable and
exchangeable Al [34]. The low pH is mainly caused by heavy rainfall
during the winter months and use of acidifying N fertilizers such as
urea [31,33]. The acidification results in an increase in Al3þ
concentration in the soil solution, which can reduce plant growth
due to Al-toxicity. Despite the fact that low pH and Al toxicity are
considered as the major environmental stressors in these soils
[33,35], no information exists about the composition of microbial
communities in volcanic soils and their tolerance to low pH and Al-
toxicity. It can be hypothesized that due to the extreme conditions,
microbial communities are quite different from those found in
other, more favourable soils and that Al tolerance is important for
the survival of microorganisms in these soils.
Compared to the bulk soil, the rhizosphere is characterized by
high microbial density and activity. This is the result of compounds
exuded by roots, e.g. amino acids and sugars which are utilized by
microorganisms. The conditions in the rhizosphere have also
shown to stimulate gene exchange by plasmid conjugation among
bacteria [5,8,54]. Lateral gene transfer by plasmid-mediated
conjugation has been studied in rhizosphere of several plant
species [45]. Plasmid transfer among bacteria is affected by meta-
bolic activity of cells as well as various environmental factors, such

1164-5563/$ e see front matter Ó 2010 Elsevier Masson SAS. All rights reserved.
doi:10.1016/j.ejsobi.2010.03.005
256 M.A. Jorquera et al. / European Journal of Soil Biology 46 (2010) 255e263
as temperature, pH, density and, availability of nutrients, or selec-
tion pressure [19,20,36]. Despite numerous studies that have
focused on ecology and evolution of plasmids in the rhizosphere,
there remains a general lack of knowledge regarding diversity,
phenotypic traits and stability of plasmids in acidic soils, as well as,
which microorganism harbour those plasmids. The stability of
plasmids in the bacterial host is now being considered as a relevant
factor for transference and persistence of plasmids in bacterial
populations [1,6,11]. The presence of stable plasmids carrying Al
tolerance genes could confer a competitive advantage to their host,
especially in the rhizosphere of plants grown in soils with low pH
and high content of Al3þ.
The aims of this study were (i) to assess the occurrence of
plasmids carrying genes for Al tolerance in the rhizosphere of
plants from an agro-pastoral ecosystem on acidic soils, (ii) inves-
tigate the stability of the plasmid under different growth conditions
in vitro, and (iii) study the diversity of the most dominant micro-
organisms (bacteria, archaea and fungi) in the rhizospheres.
2. Materials and methods
2.1. Sampling
Rhizosphere samples (roots and adhering soil) were taken from
0 to 10 cm depth at the Maquehue Experimental Station of La Fron-
tera University (38 500 S; 72 410 W). The soil is classified as Andisol.
Samples were collected from pasture (perennial ryegrass and white
clover) and crop (wheat, oat and yellow lupin) plants most commonly
cultivated in southern Chile, and transported at 4  C to the laboratory
within a few hours. Rhizosphere soil from at least 4 plants per species
was carefully collected, mixed and homogenized to obtain 0.5e0.7 kg
of rhizosphere soil per plant species. Then, each sample was divided
in three subsamples and analysed. The detailed description of
management system and chemical characteristic of the rhizosphere
soils can be found in Jorquera et al. [21] and Table 1.
2.2. Exogenous isolation of Al tolerance plasmids
from the rhizosphere
Exogenous isolations were carried out according to Smalla et al.
[43] with a few modifications. Pseudomonas putida from The
Netherlands Culture Collection of Bacteria (NCCB 68020) was used
as recipient in biparental exogenous isolation of plasmid. Bacteria
were routinely grown in LuriaeBertani (LB) broth; 15 g L1 of agar
was added for solid media. LB agar plates supplemented with 50
and 100 mg mL1 of rifampicin (sterilized through 0.2 mm pore size
filter and added after autoclaving) were evaluated to determine Rif-
resistance background among soil indigenous rhizosphere micro-
organisms. LB agar supplemented with 100 mg mL1 of rifampicin
(denoted as Rif-LB) did not show indigenous bacterial growth; this
rifampicin concentration was chosen for further experimentation.
Then, P. putida resistant to rifampicin (RifR) was isolated as
a spontaneous mutant on Rif-LB and routinely grown at 30  C in
Table 1
pH and Al saturation in rhizosphere soils.
Plant species Age pHH2 O Al saturation
(%)a
Perennial ryegrass (Lolium perenne) 3 years 6.0 0.35
White clover (Trifolium repens) 3 years 5.8 0.98
Oat (Avena sativa) 3 months 5.8 3.89
Wheat (Triticum aestivum) 3 months 5.8 2.09
Yellow lupin (Lupinus luteus) 3 months 5.6 2.67
a
Ratio of Al3þ in soil water in comparison to the total cation exchange capacity of
the soil.
Rif-LB broth. To test the suitability of P. putida (RifR) as recipient of
Al tolerance plasmids, its tolerance to Al under acidic conditions
was evaluated in LB broth at different pH (from 4 to 6) and Al
concentrations (from 0.5 to 4 mM Alþ3). P. putida was unable to
grow in LB broth with 2 mM AlCl3 and pH 5.0 (pH 5.5 for solid
media). Hence, this medium (denoted as Al-LB) was used for
isolation of transconjugants carrying Al tolerance plasmids.
One gram soil of each rhizosphere subsample was added to sterile
tubes containing 25 ml of Al-LB and incubated overnight at 30  C
with vigorous shaking. After incubation, the bacterial fraction was
collected by low-speed centrifugation (2 min at 1500  g) and
repeated washing with sterile saline solution (SS) (8.5 g L1 of NaCl)
to discard debris. The pellet was re-suspended in SS and used as
donor, while P. putida (RifR) (grown overnight in Rif-LB) served as the
recipient in biparental mating. Equal volumes (0.5 mL) of donor cells
and recipient cells were mixed and 50 ml was dispensed onto cellu-
lose acetate filters (0.45 mm pore size, Advantec, Inc., Tokyo, Japan)
which were then placed on LB agar. After 24 h incubation at 30  C, the
cells on the filters were re-suspended by vortexing in 1 mL of SS and
serial dilutions were plated onto LB agar with rifampicin
(100 mg mL1) and Al (2 mM) at pH 5.5 (Rif-Al-LB). The controls,
indigenous rhizosphere microorganisms and un-mated P. putida
(RifR) on Rif-Al-LB, were used to check for chromosomal-encoded Al
tolerance and spontaneous mutation frequency, respectively. The
plates were incubated for 2 days. Putative transconjugants on Rif-Al-
LB were counted and picked for further analysis.
Between 20 and 30 putative transconjugants per plant species
were randomly isolated after biparental mating and analyzed for
plasmid content by the alkaline lysis standard protocol [3]. Plasmid
preparations were run on 1% agarose TriseacetateeEDTA (TAE) gels
and then stained with ethidium bromide (1 mg mL1). For verifi-
cation of recipients, transconjugants with plasmids were purified
by streaking onto Rif-Al-LB agar and confirmed by sequencing using
specific primer sets for bacterial 16S rRNA gene. The 16S rRNA gene
sequences were compared with the 16S rRNA gene sequence of the
recipient to verify their origin.
2.3. Characterization of Al tolerance plasmids
DNA plasmids from 20 selected transconjugants (5 per plant
species) were extracted with QiagenÒ plasmid mini kit (Qiagen, Inc.,
Valencia, CA, USA) and separated into two preliminarily groups
according to their supercoiled forms. Purified DNA plasmids were
digested with HindIII (Invitrogen, Inc., Carlsbad, CA, USA) according to
the manufacturer’s instructions. The digested DNA was separated by
electrophoresis on 1% agarose TAE gels together with l DNA-HindIII-
digest and 1 Kb plus markers (New England Biolabs, Inc., Berverly,
MA, USA) as references for size determination. The plasmids were
divided in two groups based on their restriction pattern. One trans-
conjugant per restriction group was chosen for further analysis. The
selected transconjugants with plasmids, denoted as pRPA21 and
pOPA21, were stored at 80  C in LB broth containing 30% glycerol
and used for further characterization and stability studies.
Plasmid-encoded antibiotic resistance was determined in
quadruplicate by the KirbyeBauer disc diffusion method, as rec-
ommended by the National Committee for Clinical Laboratory
Standards (NCCLS), on MuellereHinton agar (Oxoid, Inc., Hamp-
shire, UK). Appropriate dilutions of P. putida transconjugants with
plasmids were tested with the following antimicrobials: oxacillin,
ampicillin, amoxicillin, cefotaxime, streptomycin, kanamycin,
gentamicin, tetracycline, erythromycin, chloramphenicol, vanco-
mycin, trimethoprimesulphamethoxazole, ciprofloxacin and nali-
dixic acid (for concentrations see Table 2). Inhibition zones were
measured after 1e2 day incubation at 30  C and compared with
respective zones of P. putida without plasmid. Plasmid-encoded
 M.A. Jorquera et al. / European Journal of Soil Biology 46 (2010) 255e263 257

Table 2 plasmids by gel electrophoresis of plasmid DNA extracts. Controls

Antibiotic resistance and metal tolerance in Pseudomonas putida wild type and consisted of static and shaking incubation in absence of Al pressure.
transconjugants carrying the two Al-tolerance plasmids.

P. putida P. putida P. putida 2.5. Microbial community composition in rhizosphere soils

(pRPA21) (pOPA21)
1
Antibiotics (mg disk )
The microbial community composition in pasture and crop
Oxacillin (1) þ þ þ
Ampicillin (10) þ þ þ plants was evaluated by DGGE using universally conserved bacte-
Amoxycillin (10) þ þ þ rial, fungal and archaeal primer sets (Table 3). DNA was extracted
Cefotaxime (30)    from rhizosphere soils with three replicates per plant species with
Streptomycin (10)  þ  the UltraClean Soil DNA Isolation Kit (Mo-Bio Laboratories, Inc.)
Kanamycin (30)   
Gentamicin (10)  þ 
according to the manufacturer’s instructions. For bacteria, frag-
Tetracycline (30)    ments of 16S rRNA gene were amplified by touchdown PCR as
Erythromycin (15) þ þ þ described by Iwamoto et al. [16] with the primer set EUBf933-GC/
Chloramphenicol (30)  þ þ EUBr1387 which amplifies a 454 bp fragment of the 16S rRNA gene.
Vancomycin (30) þ þ þ
The PCR amplifications were carried out with reagents supplied
Trimethoprimsulphamethoxazole (25)   
Ciprofloxacin (5)    with GoTaqÒ Flexi DNA Polymerase (Promega, Co.) as follows:
Nalidixic acid (30)    a hot-start was performed at 95  C for 10 min, the annealing was
initially set at 65  C and was then decreased by 0.5  C every cycle
Metals (mM)
Nickel (0.5)    until 55  C for 1 min, followed by extension at 72  C for 3 min. Then
Cadmium (0.5)    ten additional cycles were carried out at 55  C (annealing) followed
Mercury (0.5)    by denaturation at 94  C for 1 min and primer extension at 72  C for
  
Chromium (0.5)
3 min. The final extension step was 7 min at 72  C. For analysis of
Copper (0.5) þ þ þ
Lead (0.5)a þ þ þ
fungal and archaeal communities, touchdown PCR was followed by
Lead (1.0)  þ þ nested PCR. Firstly, the touchdown PCR was performed as described
Lead (2.0)  þ þ above by using the primer sets NS1/NS8 and 21f/958r for Fungi and
Aluminium (1.0)a þ þ þ Archaea, respectively. A second PCR with the primer sets NS7-GC/
Aluminium (2.0)  þ þ
F1Ra for Fungi and ARC344-GC/517r for Archaea was performed
Aluminium (4.0)  þ þ
with 94  C for 1 min, followed by 30 cycles of 55  C for 1 min and
þ: Resistant  tolerant; : Intermediate; : Susceptible.
a 72  C for 3 min, with a final extension at 72  C for 7 min. The primer
The highest concentration at which it was observed growth with P. putida
without plasmid. set NS1/NS8 amplifies a 1700 bp fragment of 18S rRNA gene and
NS7-GC/F1Ra amplifies a 400 bp fragment nested within the NS1/
NS8 target. The primer set 21f/958r amplifies a 937 bp fragment of
metal tolerance was determined in quadruplicate on tris-buffered 16S rRNA gene and ARC344-GC/517r amplifies a 173 bp fragment
low-phosphate agar (TBLPA) [30]. Appropriate dilutions of P. putida nested within the 21f/958r target.
transconjugants with plasmids were tested with the following The DGGE analysis was performed using a DCode system (Bio-
metals: Cd2þ, Cu2þ, Cr2þ, Ni4þ, Hg2þ and Pb2þ at 0.5, 1.0, 1.5, 2.0 and Rad Laboratories, Inc.). Twenty mL of PCR product was loaded onto
4.0 mM. Transconjugant growth was measured after 2 days incu- a 6% (w/v) polyacrilamide gel with a 50e70% gradient (urea and
bation at 30  C and compared with the growth of P. putida without formamide). The electrophoresis was run for 12 h at 100 V. The gel
plasmid. Aluminium tolerance was tested at 4 mM Al as AlCl3. was then stained with SYBR Gold (Molecular Probes, Invitrogen Co.)
for 30 min and photographed on an UV transilluminator. Repre-
2.4. Plasmid stability under Al pressure sentative bands in DGGE gels were carefully excised, run again in
DGGE gel after re-amplification, to ensure that the excised bands
Plasmid stability under Al pressure was determined in two did not contain multiple bands, and then sequenced by Macrogen,
environments differing in the degree of spatial structure as Inc. (Korea). More than one clone per band was sequenced, to
described by Spiers et al. [48] and Rainey [38] to assess bacterial ensure correct taxonomic assignment. The consensus nucleotide
adaptation by natural selection in the laboratory. Loss of the Al
resistance phenotype was used as indicator of plasmid-free cells. Table 3
Briefly, the assay was carried out in triplicate using three different Primers used in this study for PCR detection of microbial domains.
colonies of each P. putida transconjugants carrying plasmids. Each
Primer name PCR Sequence (50 e30 ) Reference
colony was inoculated in Al-LB (2 mM Al, pH 5.0) and LB and
Bacteria
incubated overnight at 30  C with shaking. Then, 100 ml of each EUBf933-GCa, d
Touchdown GCA CAA GCG GTG GAG CAT GTG G [16]
strain was transferred to 5 mL of fresh Al-LB and incubated in EUBr1387 Touchdown GCC CGG GAA CGT ATT CAC CG
homogeneous and heterogeneous conditions. A spatially homoge-
Fungi
neous environment was obtained by incubation on a shaker (200 r. NS1 Touchdown GTA GTC ATA TGC TTG TCT C [57]
p.m.), whereas a heterogeneous environment was obtained by NS8 Touchdown TCC GCA GGT TCA CCT ACG GA
static culture incubation. Thirty nine ml of culture was transferred to NS7-GCb Nested GAG GCA ATA ACA GGT CTG TGA TGC [7]
5 mL of fresh media every 24 h at 30  C, thus approximately 7 F1Ra Nested CTT TTA CTT CCT CTA AAT GAC C

generations were obtained every 24 h of growth (1:27 dilution Archaea

rate). This procedure was repeated for a total of 100 generations (14 21f Touchdown TTCCGGTTGATCCYGCCGGA [2]
958r Touchdown YCCGGCGTTGAMTCCAATT
days). Samples were diluted and plated onto LB agar at 7, 49 and 98
ARC344f-GCc Nested ACGGGGCGCAGCAGGCGCGA
generations. Aliquots were plated on LB without Al and the frac- 517r Nested ATTACCGCGGCTGCTGG
tions of plasmid-free cells were estimated by replica-picking of 50 a
GC-clamp, CGC CCG CCG CGC GCG GCG GGC GGG GCG GGG GCA CGG GGG.
randomly chosen colonies per tube onto Al-LB agar. Colonies were b
GC-clamp, CGC CCG GGG CGC GCC CCG GGC GGG GCG GGG GCA CGG GGG.
counted after incubation for 2 days at 30  C and 20 randomly c
GC-clamp, CGC CCG CCG CGC CCC GCG CCC GTC CCG CCG CCC CCG CCC C.
chosen colonies were used to confirm the presence or absence of d
The GC-clamp was attached to the 50 -end of the primer.
258 M.A. Jorquera et al. / European Journal of Soil Biology 46 (2010) 255e263

sequences obtained in this study were deposited and compared
with those present in GenBank database from National Center for
Biotechnology Information (NCBI) by using BLAST tools (http://
blast.ncbi.nlm.nih.gov/Blast.cgi).
3. Results and discussion
3.1. Exogenous isolation of aluminium tolerance
plasmids from the rhizosphere
A number of investigations have been carried out on the toxic
effect of Al on growth, cell size and intracellular water content in
soil-borne bacteria [14,15]; the presence of Al tolerance genes in
bacteria isolated from acidic cultivated soils was reported by Jo
et al. [18]. Biparental mating resulted in isolation of approximately
the same number of putative transconjugants from the rhizosphere
of all plant species, except white clover for which no trans-
conjugants were detected, with transfer frequencies from 105 to
106 per recipient. Gel electrophoresis of plasmid DNA extracts
revealed that the majority (>70%) of putative transconjugants
contained plasmid bands (Fig. 1, A). The 16S rRNA gene sequence of
transconjugants had a 100% similarity with recipient used P. putida.
Capture of self-transmissible and mobilizing plasmids from rhizo-
sphere bacteria encoding metal tolerance have been previously
reported by Smit et al. [46] and van Elsas et al. [53], who isolated
numerous mercury (Hg) resistance plasmids from rhizosphere
bacteria in wheat using P. putida, P. fluorescens, Enterobacter cloacae
and Ralstonia eutropha as recipients.
In Pseudomonas fluorescens and Rhizobium Al tolerance is not
a plasmid-borne trait [58]. Thus, we may have underestimated the
frequency of Al tolerant bacteria in the rhizosphere because Al
tolerance may also be due to changes in metabolism, e.g. secreting
organic acid anions or changes in pH, genes for which may not be
located on plasmids [58,59]. To our knowledge, this is the first
report about isolation of plasmids involved in Al tolerance from
rhizosphere of plants grown in acidic soils.
Interestingly, plasmids were captured from the rhizosphere of
most plants investigated in this study, but no transconjugants were
obtained from white clover. This inability to capture plasmids could
be due to (i) these types of plasmids not being present among
microbes inhabiting the rhizosphere of white clover, and/or (ii) Al-
tolerance, if any, being associated with chromosomal traits, not
plasmids.
3.2. Characterization of Al tolerance plasmids
Electrophoresis of DNA plasmids showed that the isolated plas-
mids were about 23 Kb in size (relaxed forms), and could be separated
into two preliminarily groups according to their supercoiled forms
(Fig. 1, B). These two groups were confirmed by restriction endonu-
clease digestion. Digestion with HindIII showed fragment sizes of 3.2,
3.0, 1.0 and 0.5 Kb for pRPA21 and fragment sizes of 2.3, 1.7 and 1.0 Kb
for pOPA21 (Fig. 1, C). Plasmids of varying sizes have been reported in
the rhizosphere. In wheat, several studies have shown the presence of
plasmids with sizes between 38 and 49 Kb [13,46,53]. From alfalfa
rhizosphere, Schneiker et al. [40] exogenously isolated Hg tolerance
plasmids with sizes between 52 and 75 Kb. Smaller plasmids with
sizes between 8 and 10 Kb have also been found in bacteria from
manure slurries [44]. Hence, the plasmids isolated in the present
study are relatively small compared to other studies.
The isolated plasmids not only conferred Al tolerance but also
encoded tolerance to antibiotics and metals in P. putida (Table 2).

Fig. 1. (A) DNA electrophoresis of aluminium tolerance plasmids from putative transconjugants extracted by alkaline lysis protocol. (B) Plasmid groups based on supercoiled forms
obtained by electrophoresis of DNA aluminium tolerance plasmids extracted from Pseudomonas putida transconjugants. (C) HindIII restriction banding pattern of DNA aluminium
tolerance plasmids. LPA: yellow lupin rhizosphere, WPA: wheat rhizosphere, RPA: perennial ryegrass rhizosphere, OPA: oat rhizosphere. M: molecular marker.
 M.A. Jorquera et al. / European Journal of Soil Biology 46 (2010) 255e263 259

Fig. 2. Stability of aluminium tolerance plasmids pRPA21 (A) and pOPA21 (B) in presence (black symbols) and absence of 2 mM of aluminium (white symbols) under static
(triangles) and shaking (circles) environments. Means and standard deviation of three replicates. (C) Electrophoresis of plasmid DNA extracted from Pseudomonas putida trans-
conjugants carrying pOPA21 and cultivated for 100 generations in presence (Alþ) and absence (Al) of aluminium.

The results showed that both plasmids conferred tolerance to
concentrations up to 0.5 and 1 mM for Pb and Al, respectively. The
concentration of Al3þ in the soil solution can range from 0.02 to
0.18 cmol(þ) kg1 (0.07e0.59 mM) to 0.39e0.89 cmol(þ) kg1
(1.3e2.9 mM) in limed and non-limed Chilean volcanic soil [32].
Thus, a tolerance to up to 1 mM Al could be important for the
survival of bacteria in these soils. The isolated plasmids differed in
antibiotic resistance. Plasmid pRPA21 conferred resistance to
streptomycin (Sm) and gentamicin (Gm) whereas plasmid pOPA21
did not confer resistance to any of the antibiotics tested.

Fig. 3. DGGE banding patterns of the bacterial (A), fungal (B) and archaeal (C) communities associated with the rhizospheres of pasture (1: perennial ryegrass, 2: white clover) and
crop (3: wheat, 4: oat, 5: yellow lupin) plants. Arrowhead and number indicate the excised bands their sequence is presented in Table 3.
260 M.A. Jorquera et al. / European Journal of Soil Biology 46 (2010) 255e263

Studies have shown that genes involved in resistance to Sm and
Gm are widespread in soil and are often encoded on mobile genetic
elements [37]. Genotypic characterization of exogenously isolated
plasmids from different European terrestrial habitats (including
rhizosphere soil of white radish, cauliflower and grass) showed the
presence of diverse genes involved in Sm resistance [55]. Heuer et al.
[10] reported the acquisition of Gm resistance after mating in
transconjugants from grass rhizosphere from an area treated with
Sm. Hence, antibiotic resistance is relatively common in soil bacteria.
In Chile, as in other Latin American countries, antimicrobials such as
Sm and Gm are commonly used as a feed supplement to promote
animal growth and as prophylactic treatment for bacterial diseases of
animals and plants [39,56], resulting in a significant antibiotic input
into the environment and consequently development of resistance to
these antibiotics in natural bacterial communities.
3.3. Stability of plasmids
The ability of bacteria to adapt to the fluctuating environmental
conditions in the rhizosphere is favored by the presence of diverse
mobile genetic elements, among which conjugative plasmids play
an important role [47]. On the other hand, rapid loss of a plasmid
encoding for Al tolerance could reduce the competitiveness of
bacteria in Chilean volcanic soils, where conditions fluctuate and
stressors are transient. In this study, plasmid pRPA21 was highly
stable in absence and presence of Al pressure (Fig. 2, A) and plasmid
pOPA21 was highly stable in presence of Al pressure (Fig. 2, B
and C). In contrast, absence of Al pressure under vigorous shaking
led to loss of plasmid pOPA21 after 49 and 98 generations (Fig. 2, B).
Stability studies using P. fluorescens WCS365 as host showed that
various small plasmids (size between 7 and 15 Kb) can be highly

Table 4
Phylogenetic assignment of DGGE bands.

Banda Taxonomic groupb Closest relatives or cloned sequences (accession no.) Similarity Accession no.
(%)c
Bacteria
1 Bacteroidetes, Sphingobacteria, Chitinophagaceae Uncultured Bacteroidetes bacterium from alpine soil (DQ450749) 98 FJ805381
2 Bacteroidetes, Sphingobacteria, Chitinophagaceae Uncultured bacterium from sediment (FJ525212) 99 FJ805382
3 Proteobacteria, Alphaproteobacteria Bradyrhizobiaceae bacterium from soybean soil (EU177515) 83 FJ805383
4 Proteobacteria, Deltaproteobacteria, Myxococcales Uncultured Myxococcales bacterium from Himalayas soil (GQ329487) 99 FJ805384
5 Proteobacteria, Alphaproteobacteria Uncultured bacterium from Australian soil (FJ432897) 97 FJ805385
6 Gemmatimonadetes Uncultured Gemmatimonadetes from rhizosphere (EF018631) 88 FJ805386
7 Acidobacteria Uncultured Acidobacteria bacterium from hydrocarbon-contaminated 97 FJ805387
soil (EF141955)
8 Gemmatimonadetes Uncultured bacterium from volcanic soil (FJ592594) 77 FJ805388
9 Gemmatimonadetes,Gemmatimonas Uncultured bacterium from unvegetated soil (EF220468) 91 FJ805389
10 Gemmatimonadete, Gemmatimonas Uncultured bacterium from rice paddy soil (AB486905) 99 FJ805390
11 Proteobacteria, Alphaproteobacteria Uncultured Sphingomonas from soil (EU809803) 78 FJ805391
12 Gemmatimonadetes Uncultured Gemmatimonadetes from Antarctic soil (EF219785) 84 FJ805392
13 Proteobacteria, Alphaproteobacteria Uncultured soil bacterium (FJ433851) 78 FJ805393
14 Bacteroidetes, Sphingobacteria, Chitinophagaceae Uncultured bacterium from mine soil (EU141799) 97 FJ805394
15 Gemmatimonadetes,Gemmatimonas Uncultured bacterium from grass soil (EU133028) 79 FJ805395

Fungi
16 Zygomycota Zygomycete sp. from alpine soil (EU428774) 99 FJ805396
17 Basidiomycota, Agaricomycetes Uncultured Boletaceae from rhizosphere (EF023916) 99 FJ805397
18 Basidiomycota, Agaricomycetes, Cantharellales Rhizoctonia solani (D85632.1) 98 FJ805398
19 Glomeromycota, Glomeromycetes Uncultured Glomus from colonized root (AM942486) 94 FJ805399
20 Chytridiomycota Uncultured Chytridiomycota from lake (EU162639) 91 FJ805400
21 Glomeromycota, Glomeromycetes, Glomerales Glomus viscosum (Y17652) 96 FJ805401
22 Zygomycota Zygomycete sp. from alpine soil (EU428773) 96 FJ805402
23 Basidiomycota, Agaricomycete, Corticiales Sistotrema raduloides (AY757262) 96 FJ805403
24 Zygomycota Uncultured soil fungus (EF628748) 98 FJ805404
25 Basidiomycota, Agaricomycetes, Polyporales Antrodia albida (AY336777) 95 FJ805405
26 Zygomycota Uncultured soil fungus (EF628862) 96 FJ805406
27 Zygomycota Zygomycete sp. from alpine soil (EU428773) 99 FJ805407
28 Zygomycota Uncultured soil fungus (EF628705) 98 FJ805408
29 Zygomycota Uncultured soil fungus (EF628573) 92 FJ805409
30 Zygomycota Uncultured soil fungus (EF628521) 98 FJ805410

Archaea
31 Crenarchaeota Uncultured archaeon from rhizosphere (EF020568) 87 FJ805411
32 Crenarchaeota Uncultured archaeon from agricultural soil (GQ871387) 91 FJ805412
33 Crenarchaeota Uncultured soil archaeon (GQ127624) 88 FJ805413
34 Crenarchaeota Uncultured archaeon from agricultural soil (GQ871448) 90 FJ805414
35 Crenarchaeota Uncultured archaeon from agricultural soil (GQ871387) 93 FJ805415
36 Crenarchaeota Uncultured archaeon from agricultural soil (GQ871441) 94 FJ805416
37 Crenarchaeota Uncultured crenarchaeote from rock (FJ182213) 90 FJ805417
38 Crenarchaeota Uncultured archaeon from agricultural soil (GQ871439) 93 FJ805418
39 Crenarchaeota Uncultured archaeon from glacial cryconite (GU298289) 91 FJ805419
40 Crenarchaeota Uncultured archaeon from shale cliffs (FJ979931) 90 FJ805420
41 Crenarchaeota Uncultured archaeon from forest soil (GU366948) 86 FJ805421
42 Euryarchaeota Uncultured archaeon from rice field soil (AB380066) 92 FJ805422
43 Crenarchaeota Uncultured archaeon from agricultural soil (GQ478278) 94 FJ805423
44 Crenarchaeota Uncultured archaeon from agricultural soil (GQ871441) 89 FJ805424
a
Corresponding DGGE bands shown in Fig. 3.
b
The phylogenetic assignment is based on sequence analysis by the RDP classifier (http://rdp.cme.msu.edu/classifier/classifier.jsp) or GenBank database from NCBI (http://
www.ncbi.nlm.nih.gov). It is given the phylum as well as the lowest predictable phylogenetic rank.
c
Based on partial sequencing of 16S and 18S rRNA gene and comparison with those present in GenBank by using Blastn.
 M.A. Jorquera et al. / European Journal of Soil Biology 46 (2010) 255e263
stable in laboratory media and under rhizosphere conditions [52].
High stability (99%) of IncP  1 plasmid has also been described in
E. coli and Kluyvera sp. populations maintained in bacterial mats
and in broth without selective pressure [1]. In contrast, De Gelder
[6] observed a large variation in the stability of a promiscuous
plasmid in different hosts, even between strains within the same
genus or species. Three strains showed rapid loss of the plasmid
within 50 generations whereas four other strains lost the plasmid
very slowly over about 600 generations. In relation to the higher
instability of pOPA21 observed under shaking (homogeneous
environment) compared with static conditions (heterogeneous
environment), it has been described that agitation increases the
instability of plasmids [12]. Agitation may limit the establishment
of closer contact between bacterial cells, increasing the probability
for segregational plasmid loss by appearance and growth of
plasmid-free cells in absence of Al pressure. When comparing
plasmid stability in homogenous and heterogeonous conditions, it
should be noted that growth rates may differ between these two
conditions. It can be assumed that growth rates are higher under
heterogenous conditions because of better access to nutrients.
Higher growth rates could increase the likelyhood of plasmid loss.
Thus, the stable plasmid pRPA21 would increase the competitive-
ness of its host, even in heterogeneous environments such as the
rhizosphere; whereas plasmid pOPA21 could be important for
the spread of Al tolerance genes within bacterial rhizosphere
communities but could be rapidly lost from host cells in absence of
Fig. 4. Phylogenetic tree highlighting the groups Crenarchaeaota (Archaea) and Gemmatimonadetes (Bacteria) where the majority of sequences obtained by DGGE band sequencing,
were aligned. The neighbor-joining tree was constructed based on sequences of control strains taken from NCBI database and by using ClustalX. The bar indicates 10% sequence
divergence; a bootstrap analysis was performed with 1000 trials.
261
high Al concentrations in homogeneous environments. In this
discussion, we assume that the stability of the plasmids in P. putida
is a good representation of plasmid stability in rhizosphere
bacteria. However, plasmid stability may vary among bacterial
species.
3.4. Microbial community composition in rhizosphere soils
Several studies in the rhizosphere have showed a high diversity of
microorganisms, including Bacteria, Fungi and Archaea [9,29]. Simi-
larly, our DGGE analysis revealed the occurrence of Bacteria, Fungi
and Archaea in the rhizosphere soils (Fig. 3). Band patterns of
bacterial communities differed little among of the different pasture
and crop plants (Fig. 3, A). Some rRNA sequence obtained from
excised DGGE bands showed high similarity to members of the phyla
Proteobacteria and Bacteroidetes. However, the majority of excised
bands were classified within the Gemmatimonadetes (Table 4; Fig. 4).
Proteobacteria and Bacteroidetes are groups commonly found in the
rhizosphere of several plant species [9], and various members of
Proteobacteria (Pseudomonas, Enterobacter and Pantoea) co-occur in
the rhizosphere [21]. Other studies have reported Gemmatimona-
detes in soils, including agricultural soils [4,17,22]. However, the role
of Gemmatimonadetes in the rhizosphere is unknown. The first
cultured member of Gemmatimonadetes showed the capacity to
accumulate polyphosphates [60]. We reported earlier that in the
rhizosphere of the plants growing in Chilean volcanic soils, bacteria
262 M.A. Jorquera et al. / European Journal of Soil Biology 46 (2010) 255e263
with capacity to mobilize phosphorus can represent from 44% to 54%
of total culturable bacteria [21].
The DGGE analysis also revealed diverse fungal and archaeal
communities (Fig. 3, B and C; Fig. 4) (Table 4). Compared with profiles
from pastures, different dominant bands were detected in the
rhizosphere of crop plants, particularly bands no. 19, 20, 22, 25, 27
and 28 for fungi (Fig. 3, B) and bands no. 35, 42, 43 and 44 for archaea
(Fig. 3, C), suggesting that crop and pasture plants have differential
fungal and archaeal rhizosphere communities. However, the present
study represents only a small subfraction of dominant members of
these phyla and the difference detected may be due to natural vari-
ability. Similar to Bacteria, it is widely accepted that Fungi play
important roles in the biology and ecology of plants: acting as plant
pathogens, influencing their growth by nutrient absorption and/or
protecting them from root diseases [29]. Studies on occurrence and
role of Archaea in rhizosphere and agricultural soils have only
commenced recently. The functionally most important archaeal
group in rice paddy soil is the methanogenic Euryarchaeota [26],
while the use of culture-independent techniques has also revealed
the presence of Crenarchaeota and Halobacterium e such as Eur-
yarchaeota e in other cultivated soils [23]. In the present study, the
majority of excised bands were close to the phylum Crenarchaeota
(Fig. 4). Non-thermophilic Crenarchaeota have been described as an
important group colonizing plant roots [41]. Clearly more work is
needed to understand the role of Archaea in the soileroot interface,
particularly in aerobic soils.
The microbial community in the rhizosphere can be influenced
by a wide variety of factors. It is generally accepted that root
exudates and plant species strongly determine the bacterial
composition in the rhizosphere, producing plant genotype-specific
community structures in the same soil [23,28,42,51]. A recent study
revealed that the bacterial community was related to soil type more
than to fertilization whereas the fungal community was more
related to the fertilization than to soil type [49]. The degree of Al
saturation is greater in the rhizosphere soil of crop than in pasture
plants and fungal as well as archaeal communities differed between
crop and pasture plants. This suggests that Al saturation may also
affect microbial composition in rhizosphere soils, particularly in
microorganisms with tolerance mechanisms, as such Al tolerance
plasmids, which could become dominant within microbial
communities at low pH and high Alþ3. However, with the data
obtained in this study we can not attribute the differences in
plasmid occurrence and microbial community to Al saturation or
plant species, and clearly more studies are required. Thus, among
the diverse factors affecting the rhizosphere microbial community
(plant species, soil type, management systems, etc.), parameters
such as soil acidity and Al-toxicity, should be taken accounts in
further investigations to evaluate their influence on plasmid
stability and microbial community in the same soils with low and
high percentage of Al saturation.
4. Conclusions
This study showed the occurrence of Al tolerance plasmids in
bacterial populations in the rhizosphere, which also encode for metal
tolerance and antibiotic resistance. Further experiments focused on
characterization of the plasmids (e.g. Al tolerance genetic determi-
nants, host range, and sequencing) are required. The presence of Al
tolerance plasmids suggests that these genetic mobile elements
might play an important role in adaptation of bacterial communities
to Al-toxicity in volcanic soils. We also demonstrate the presence of
diverse microbial populations consisting of bacteria, archaea and
fungi in the rhizosphere of plants commonly cultivated in acidic
volcanic soils from southern Chile, including members of the phyla
Gemmatimonadetes and Crenarchaeote, their role in the rhizosphere
still being poorly understood. Moreover, further investigations are
required to evaluate the influence of soil acidity and Al-toxicity on
composition of microbial communities, and to identify which
microorganisms in the rhizosphere are sources of conjugative
plasmid enconding adaptation mechanisms in acidic soils of Chile.
Acknowledgements
The authors are grateful for supported by Bicentenary Program
in Science and Technology Project PSD26, FONDECYT Regular
Research Project No.1061262 and FONDECYT International Coop-
eration Project No. 7060093. The authors also wish to thank the
helpful suggestions made by the Editor and three anonymous
reviewers to improve the quality of this paper. M. Hernández and
O. Martínez acknowledge CONICYT Ph.D. scholarships.
References
[1] M.I. Bahl, L.H. Hansen, S.J. Sørensen, Impact of conjugal transfer on the
stability of IncP  1 plasmid pKJK5 in bacterial populations. FEMS Microbi-
ology Letters 266 (2007) 250e256.
[2] N. Bano, S. Ruffin, B. Ransom, J.T. Hollibaugh, Phylogenetic composition of artic
ocean archaeal assemblages and comparison with Antarctic assemblages.
Applied and Environmental Microbiology 70 (2004) 781e789.
[3] J.H. Crosa, M.E. Tolmasky, L.A. Actis, S. Falkow, Plasmids. in: P. Gerhardt,
R.G.E. Murray, W.A. Wood, N.R. Krieg (Eds.), Methods for General and
Molecular Microbiology. American Society for Microbiology Press, Wash-
ington, DC, USA, 1994, pp. 365e386.
[4] K.E.R. Davis, S.J. Joseph, P.H. Janssen, Effects of growth medium, inoculum size,
and incubation time on culturability and isolation of soil bacteria. Applied and
Environmental Microbiology 71 (2005) 826e834.
[5] J. Davison, Genetic exchange between bacteria in the environment. Plasmid 42
(1999) 73e91.
[6] L. De Gelder, J.M. Ponciano, P. Joyce, E.M. Top, Stability of a promiscuous
plasmid in different hosts: no guarantee for a long-term relationship.
Microbiology 153 (2007) 452e463.
[7] F.A. de Souza, G.A. Kowalchuk, P. Leeflang, J.A. van Veen, E. Smit, PCR-dena-
turing gradient electrophoresis profiling of inter- and intraspecies 18S rRNA
gene sequence heterogeneity is an accurate and sensitive method to asses
species diversity of arbuscular mycorrhizal fungi of the genus Gigaspora.
Applied and Environmental Microbiology 70 (2004) 1413e1424.
[8] M. Dröge, A. Pühler, W. Selbitschka, Horizontal gene transfer among bacteria
in terrestrial and aquatic habitats as assessed by microcosm and field studies.
Biology and Fertility of Soils 29 (1999) 221e245.
[9] C.V. Hawkes, K.M. DeAngelis, M.K. Firestone, Root interactions with soil
microbial communities and processes. in: Z.G. Cardon, J.L. Whitbeck (Eds.),
The Rhizosphere: an Ecological Perspective. Elsevier Academic Press, USA,
2007, pp. 1e29.
[10] H. Heuer, E. Krögerrecklenfort, E.M.H. Wellington, S. Egan, J.D. van Elsas, L. van
Overbeek, J.M. Collard, G. Guillaume, A.D. Karagouni, T.L. Nikolakopoulou,
K. Smalla, Gentamicin resistance genes in environmental bacteria: prevalence
and transfer. FEMS Microbiology Ecology 42 (2002) 289e302.
[11] H. Heuer, R.E. Fox, E.M. Top, Frequent conjugative transfer accelerates adap-
tation of a broad-host-range plasmid to an unfavorable Pseudomonas putida
host. FEMS Microbiology Ecology 59 (2007) 738e748.
[12] J. Huang, P. Dhulster, D. Thomas, J.N. Barbotin, Agitation rate effects on
plasmid stability in immobilized and free cells continuous cultures of
recombinant E. coli. Enzyme and Microbial Technology 12 (1990) 933e939.
[13] S.B. Huddedar, A.M. Shete, J.N. Tilekar, S.D. Gore, D.D. Dhavale, B.A. Chopade,
Isolation, characterization, and plasmid pUPI126-mediated indole-3-acetic
acid production in Acinetobacter strains from rhizosphere of wheat. Applied
and Biochemistry and Biotechnology 102 (2002) 21e40.
[14] P. Illmer, C. Erlebach, Influence of Al on growth, cell size and content of
intracellular water of Arthrobacter sp. PI/1-95. Antonie van Leeuwenhoek 84
(2003) 239e246.
[15] P. Illmer, W. Mutschlechner, Effect of temperature and pH on the toxicity of
aluminium towards two new, soil born species of Arthrobacter sp. Journal of
Basic Microbiology 44 (2004) 98e105.
[16] T. Iwamoto, K. Tani, K. Nakamura, Y. Suzuki, M. Kitagawa, M. Eguchi, M. Nasu,
Monitoring impact of in situ biostimulation treatment on groundwater
bacterial community by DGGE. FEMS Microbiology Ecology 32 (2000)
129e141.
[17] P.H. Janssen, Identifying the dominant soil bacteria taxa in libraries of 16S
rRNA and 16S rRNA genes. Applied Environmental Microbiology 72 (2006)
1719e1728.
[18] J. Jo, Y.S. Jang, K.Y. Kim, M.H. Kim, I.J. Kim, W.I. Chung, Isolation of ALU1-P gene
encoding a protein with aluminium tolerance activity from Arthrobacter vis-
cosus. Biochemical and Biophysical Research Communications 239 (1997)
835e839.
 M.A. Jorquera et al. / European Journal of Soil Biology 46 (2010) 255e263
[19] A.R. Johnsen, N. Kroer, Effects of stress and other environmental factors on
horizontal plasmid transfer assessed by direct quantification of discrete
transfer event. FEMS Microbiology Ecology 59 (2007) 718e728.
[20] M. Jorquera, N. Yamaguchi, K. Tani, M. Nasu, Stimulatory effect of glutamine
and pyruvate on plasmid transfer between Pseudomonas strains. Microbes and
Environments 22 (2007) 320e326.
[21] M.A. Jorquera, M.T. Hernández, Z. Rengel, P. Marschner, M.L. Mora, Isolation of
culturable phosphobacteria with both phytate-mineralization and phosphate-
solubilization activity from the rhizosphere of plants grown in a volcanic soil.
Biology and Fertility of Soils 44 (2008) 1025e1034.
[22] S.J. Joseph, P. Hugenholtz, P. Sangwan, C.A. Osborne, P.H. Janssen, Laboratory
cultivation of widespread and previously uncultured soil bacteria. Applied and
Environmental Microbiology 69 (2003) 7210e7215.
[23] A.D. Kent, E.W. Triplett, Microbial communities and their interaction in soil
and rhizosphere ecosystems. Annual Review of Microbiology 56 (2002)
211e236.
[24] H.H. Keyser, D. Munns, Tolerance to rhizobia to acidity, aluminium and
phosphate. Soil Science Society of American Journal 43 (1979) 519e523.
[25] L.V. Kochian, O.A. Hoekenga, M.A. Piñeros, How do crop plants tolerate acid
soils? Mechanisms of aluminum tolerance and phosphorus efficiency. Annual
Reviews in Plant Biology 55 (2004) 459e493.
[26] W. Liesack, S. Schnell, N.P. Revsbech, Microbiology of flooded rice paddies.
FEMS Microbiology Ecology 24 (2000) 625e645.
[27] C. Manoharachary, K.G. Mukerji, Rhizosphere biology e an overview. in:
K.G. Mukerji, C. Manoharachary, J. Singh (Eds.), Microbial Activity in the
Rhizosphere. Springer-Verlag, Berlin Heidelberg, Germany, 2006, pp. 1e15.
[28] P. Marschner, C.H. Yang, R. Lieberei, D.E. Crowley, Soil and plant specific
effects on bacterial community composition in the rhizosphere. Soil Biology
and Biochemistry 33 (2001) 1437e1445.
[29] F.M. Martin, S. Perotto, P. Bonfante, Mycorrhizal fungi: a fungal community at
the interface between soil and root. in: R. Pinton, Z. Varanini, P. Nannipieri
(Eds.), The Rhizosphere: Biochemistry and Organic Substances at the SoilePlant
Interface. Marcel Dekker, Inc., NY, USA, 2001, pp. 263e296.
[30] M. Mergeay, D. Nies, H.G. Schlegel, J. Gerits, P. Charles, F. van Gijsegem,
Alcaligenes eutrophus CH34 is a facultative chemolithotroph with plasmid-
bound resistance to heavy metals. Journal of Bacteriology 3 (1985)
691e698.
[31] M.L. Mora, R. Demanet, Uso de enmiendas calcáreas en suelos acidificados.
Frontera Agrícola 5 (1999) 43e58 (in Spanish).
[32] M.L. Mora, P. Cartes, R. Demanet, I.S. Cornforth, Effect of lime and gypsum on
pasture growth and composition on an acid andisol in Chile, South America.
Communications in Soil Science and Plant Analysis 33 (2002) 2069e2081.
[33] M.L. Mora, M. Alfaro, P.H. Williams, W. Stehr, R. Demanet, Effect of fertilizer
input on soil acidification in relation to growth and chemical composition of
a pasture and animal production. Journal of Soil Science in Plant Nutrition 4
(2004) 29e40.
[34] M.L. Mora, C. Shene, A. Violante, R. Demanet, N.S. Bolan, The effect of organic
matter and soil chemical properties on sulfate sorption in Chilean volcanic soils.
in: P.M. Huang, A. Violante, J.M. Bollag, P. Vityakon (Eds.), Soil Abiotic and Biotic
Interactions and Impact on the Ecosystem and Human Welfare. Science
Publishing, Inc., Eifield, NH, USA, 2005, pp. 223e244.
[35] M.L. Mora, M.A. Alfaro, S.C. Jarvis, R. Demanet, P. Cartes, Soil aluminium
availability in Andisol of southern Chile and its effect on forage production
and animal metabolism. Soil Use and Management 22 (2006) 95e101.
[36] L. Mølbak, S. Molin, N. Kroer, Root growth and exudate production define the
frequency of horizontal plasmid transfer in the rhizosphere. FEMS Microbi-
ology Ecology 59 (2007) 167e176.
[37] W.C. Nwosu, Antibiotic resistance with particular reference to soil microor-
ganisms. Research in Microbiology 152 (2001) 421e430.
[38] P. Rainey, Bacterial populations adapt-genetically, by natural selection-even
in the lab! Microbiology Today 31 (2004) 160e162.
[39] B. San Martín, J. Kruze, M.A. Morales, H. Agüero, D. Iragüen, S. Espinoza,
B. León, C. Borie, Antimicrobial resistance in bacteria isolated from dairy herds
in Chile. International Journal of Applied Research in Veterinary Medicine 1
(2003) 87e95.
[40] S. Schneiker, M. Keller, M. Dröge, E. Lanka, A. Pühler, W. Selbitschka, The
genetic organization and evolution of a broad host range mercury resistance
263
plasmid pSB102 isolated from a microbial population residing in the rhizo-
sphere of alfalfa. Nucleic Acids Research 29 (2001) 5169e5181.
[41] H.M. Simon, J.A. Dodsworth, R.M. Goodman, Crenarchaeota colonize terres-
trial plant roots. Environmental Microbiology (2000) 495e505.
[42] G. Singh, K.G. Mukerji, Root exudates as determinant of rhizospheric microbial
biodiversity. in: K.G. Mukerji, C. Manoharachary, J. Singh (Eds.), Microbial
Activity in the Rhizosphere. Springer-Verlag, Berlin Heidelberg, Germany,
2006, pp. 39e53.
[43] K. Smalla, M. Osborn, E.M.H. Wellington, Isolation and characterization of
plasmids from bacteria. in: C.M. Thomas (Ed.), The Horizontal Gene Pool e
Bacterial Plasmids and Gene Spread. Harwood Academic Publishers, Amster-
dam, The Netherlands, 2000, pp. 207e248.
[44] K. Smalla, H. Heuer, A. Götz, D. Niemeyer, E. Krögerrechlenfort, E. Tietze,
Exogenous isolation of antibiotic resistance plasmids from piggery manure
slurries reveals a high prevalence and diversity of IncQ-like plasmids. Applied
and Environmental Microbiology 66 (2000) 4854e4862.
[45] K. Smalla, P.A. Sobecky, The prevalence and diversity of mobile genetic
elements in bacterial communities of different environmental habitats:
insight gained from different methodological approaches. FEMS Microbiology
Ecology 42 (2002) 165e175.
[46] E. Smit, A. Wolters, J.D. van Elsas, Self-transmissible mercury resistance
plasmids with gene-mobilizing capacity in soil bacterial populations: influ-
ence of wheat roots and mercury addition. Applied and Environmental
Microbiology 64 (1998) 1210e1219.
[47] S.J. Sørensen, M. Barley, L.H. Hansen, N. Kroer, S. Wuertz, Studying plasmid
horizontal transfer in situ: a critical review. Nature Reviews Microbiology 3
(2005) 700e710.
[48] A.J. Spiers, S.G. Kahn, J. Bohannon, M. Travisano, P.B. Rainey, Adaptative
divergence in experimental populations of Pseudomonas fluorescens. I. Genetic
and phenotypic bases of wrinkly spreader fitness. Genetics 161 (2002) 33e46.
[49] C. Suzuki, K. Nagaoka, A. Shimada, M. Takenaka, Bacterial community are
more dependent on soil type than fertilizer type, but the reverse is true for
fungal communities. Soil Science and Plant Nutrition 55 (2009) 80e90.
[50] R. von Uexküll, E. Mutert, Global extent, development and economic impact of
acid soils. Plant and Soil 171 (1995) 1e15.
[51] A. Ulrich, R. Becker, Soil parental material is a key determinant of the bacterial
community structure in arable soils. FEMS Microbiology Ecology 56 (2006)
430e443.
[52] A.J. van der Bij, L.A. Weger, W.T. Tucker, B.J.J. Lugtenberg, Plasmid stability in
Pseudomonas fluorescens in the rhizosphere. Applied and Environmental
Microbiology 62 (1996) 1076e1080.
[53] J.D. van Elsas, B.B. McSpadden Gardener, A.C. Wolters, E. Smit, Isolation,
characterization, and transfer of cryptic gene-mobilizing plasmid in the wheat
rhizosphere. Applied and Environmental Microbiology 64 (1998) 880e889.
[54] J.D. van Elsas, S. Turner, M.J. Bailey, Horizontal gene transfer in the phyto-
sphere. New Phytologist 157 (2003) 525e537.
[55] L.S. van Overbeek, E.M.H. Wellington, S. Egan, K. Smalla, H. Heuer, J.M. Collard,
G. Guillaume, A.D. Karagouni, T.L. Nikolakopoulou, J.D. van Elsas, Prevalence of
streptomycin-resistance genes in bacterial populations in European habitats.
FEMS Microbiology Ecology 42 (2002) 277e288.
[56] A.M. Vidaver, Uses of antimicrobial in plant agriculture. Papers in Plant
Pathology 34 (Suppl. 23) (2002) S107eS110.
[57] T.J. White, T.D. Burns, S. Lee, J. Taylor, Analysis of phylogenetic relationships
by amplification and direct sequencing of ribosomal RNA genes. in: M.A. Innis,
D.H. Gelfand, J.J. Sninsky, T.J. White (Eds.), PCR Protocols: A Guide to Methods
and Applications. Academic Press, NY, 1990, pp. 315e322.
[58] M. Wood, A mechanism of aluminium toxicity to soil bacteria and possible
ecological implications. Plant and Soil 171 (1995) 63e69.
[59] N. Wakao, T. Yasuda, Y. Jojima, S. Yamanaka, A. Hiraishi, Enhanced growth of
Acidocella facilis and related acidophilic bacteria at high concentrations of
aluminum. Microbes and Environments 17 (2002) 98e104.
[60] H. Zhang, Y. Sekiguchi, S. Hanada, P. Hugenholtz, H. Kim, Y. Kamagata,
K. Nakamura, Gemmatimonas aurantiaca gen. nov., sp. Nov., a Gram-negative,
aerobic, polyphosphate-accumulating micro-organism, the first cultured
representative of the new bacterium phylum Gemmatimonadetes phy. nov.
International Journal of Systematic and Evolutionary Microbiology 53 (2003)
1155e1163.