1824 Full

Circulation
ORIGINAL RESEARCH ARTICLE
miR-22 Is a Novel Mediator of Vascular

Smooth Muscle Cell Phenotypic
Modulation and Neointima Formation
Editorial, see p 1842 Feng Yang, MD*

Qishan Chen, MD, PhD*
BACKGROUND: MicroRNA-22 (miR-22) has recently been reported to play Shiping He, MD
Downloaded from http://circ.ahajournals.org/ by guest on June 17, 2018
a regulatory role during vascular smooth muscle cell (VSMC) differentiation Mei Yang, MD
from stem cells, but little is known about its target genes and related Eithne Margaret Maguire,
pathways in mature VSMC phenotypic modulation or its clinical implication in MRes
neointima formation following vascular injury. Weiwei An, PhD
Tayyab Adeel Afzal, MSc
METHODS: We applied a wire-injury mouse model, and local delivery of Le Anh Luong, PhD
AgomiR-22 or miR-22 inhibitor, as well, to explore the therapeutic potential Li Zhang, MD, PhD
of miR-22 in vascular diseases. Furthermore, normal and diseased human Qingzhong Xiao, MD, PhD
femoral arteries were harvested, and various in vivo, ex vivo, and in vitro
models of VSMC phenotype switching were conducted to examine miR-22
expression during VSMC phenotype switching.
RESULTS: Expression of miR-22 was closely regulated during VSMC
phenotypic modulation. miR-22 overexpression significantly increased
expression of VSMC marker genes and inhibited VSMC proliferation and
migration, whereas the opposite effect was observed when endogenous
miR-22 was knocked down. As expected, 2 previously reported miR-22 target
genes, MECP2 (methyl-CpG binding protein 2) and histone deacetylase 4,
exhibited a regulatory role in VSMC phenotypic modulation. A transcriptional
regulator and oncoprotein, EVI1 (ecotropic virus integration site 1 protein
homolog), has been identified as a novel miR-22 target gene in VSMC
phenotypic modulation. It is noteworthy that overexpression of miR-22 in *Drs Yang and Chen contributed
the injured vessels significantly reduced the expression of its target genes, equally.
decreased VSMC proliferation, and inhibited neointima formation in wire- Key Words: atherosclerosis ◼ cell
injured femoral arteries, whereas the opposite effect was observed with local movement ◼ cell proliferation ◼ MDS1
and EVI1 complex locus protein
application of a miR-22 inhibitor to injured arteries. We next examined the ◼ methyl-CpG-binding protein 2
clinical relevance of miR-22 expression and its target genes in human femoral ◼ microRNAs ◼ neointima
arteries. We found that miR-22 expression was significantly reduced, whereas Sources of Funding, see page 1839
MECP2 and EVI1 expression levels were dramatically increased, in diseased
© 2017 The Authors. Circulation is
in comparison with healthy femoral human arteries. This inverse relationship published on behalf of the American
between miR-22 and MECP2 and EVI1 was evident in both healthy and Heart Association, Inc., by Wolters
Kluwer Health, Inc. This is an open
diseased human femoral arteries.
access article under the terms of the
Creative Commons Attribution License,
CONCLUSIONS: Our data demonstrate that miR-22 and EVI1 are novel which permits use, distribution, and
regulators of VSMC function, specifically during neointima hyperplasia, reproduction in any medium, provided
that the original work is properly cited.
offering a novel therapeutic opportunity for treating vascular diseases.
http://circ.ahajournals.org
1824 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Yang et al miR-22 in SMC Function and Neointima Formation
miR-22, originally proposed to act as a tumor sup-

Clinical Perspective
ORIGINAL RESEARCH
pressor,27–29 has been implicated in a variety of cardiac
diseases30–33 and recently reported to play a regulato-
What Is New?
ARTICLE
ry role during VSMC differentiation from stem cells.34
• We show that microRNA-22 (miR-22) is a novel However, little is known about its downstream targets
mediator of vascular smooth muscle cell pheno- and whether there is functional involvement of miR-22
typic modulation and neointima formation. in mature VSMC phenotypic modulation and vascular
• We demonstrate that miR-22 controls vascular injury–induced neointima formation. In this study, we
smooth muscle cell phenotype and injury-induced have identified EVI1 (ecotropic virus integration site 1
arterial remodeling by modulating multiple target protein homolog) as a novel target of miR-22 and have
genes (MECP2, HDAC4, and EVI1). demonstrated that the miR-22/EVI1 signaling axis plays
• We observe that miR-22 expression is supressed an important role in VSMC phenotype switching and
in the human femoral arteries with atherosclerotic arterial remodeling in both mouse and human femo-
plaques and have uncovered an inverse relationship
ral artery disease models. Our work offers a possible
between miR-22 and its target genes in healthy
and diseased arteries.
mechanistic basis for the beneficial effect of EVI1 inhi-
bition using arsenic trioxide–eluting stent (AES) on in-
What Are the Clinical Implications? stent restenosis.
• Our findings on the miR-22–EVI1 and miR-22–

METHODS
MECP2 signaling axes in vascular smooth muscle

cell phenotypic modulation present miR-22 and its The data that support the findings of this study are available
target genes (EVI1 and MECP2) as novel biomark- from the corresponding author on reasonable request.
ers for peripheral arterial diseases.
• Local delivery of miR-22 in the injured arteries pre- miR-22 Promoter, EVI1 3ʹ–Untranslated
vents adverse arterial remodeling, suggesting that
the site-specific delivery of miR-22 mimics as a Region Reporter, and Mutation of miR-22
potential therapy for in-stent restenosis. Binding Site Within EVI1 3ʹ–Untranslated
Region Reporter
V
miR-22 promoter DNA was amplified from mouse genomic
ascular smooth muscle cell (VSMC) phenotype DNA by polymerase chain reaction using primers shown in
switching, or the phenotypic modulation of Table I in the online-only Data Supplement. Amplified DNA
VSMCs from a differentiated, contractile state fragments were cloned into the Kpn I and Mlu I sites of the
to a dedifferentiated, synthetic phenotype, has been pGL3-basic vector (Promega), designated as pGL3-miR-22.
shown to play a vital role in intima remodeling and in Reporter vectors harboring 3ʹ–untranslated region (3ʹ-UTR)
many cardiovascular diseases.1 Various environmental sequences of the murine EVI1 were created using cDNA from
stimuli, such as growth factors, reactive oxidative spe- VSMCs. The 3ʹ-flanking 3ʹ-UTR (11-1142 nucleotides of the
cies, and even mechanical injury, have been identified 3ʹ-UTR region) of murine EVI1 gene (NM_007963) was ampli-
to lead to dramatic changes in VSMC phenotype and fied by polymerase chain reaction with primers shown in
Table I in the online-only Data Supplement and cloned into
behavior.1 Both transcriptional and epigenetic mecha-
the Sac I and Mlu I sites of the pmiR-reporter-basic vector
nisms have been extensively implicated in VSMC phe- (Ambion, Applied Biosystems), designated as pmiR-Luc-EVI1-
notype switching and regulation of smooth muscle cell WT. miR-22 binding site mutation was introduced into pmiR-
(SMC)–selective marker genes such as smooth muscle Luc-EVI1 by using the QuikChange site-directed mutagenesis
α-actin (SMαA), smooth muscle 22α (SM22α), smooth kit (Agilent Technologies) according to the manufacturer’s
muscle calponin (CNN1), smooth muscle myosin heavy instructions and designated as pmiR-Luc-EVI1-mutant. All
chain (SM-myh11), and smoothelin-B (SMTN-B).1,2 Of plasmids were verified by DNA sequencing at GATC Biotech.
great interest to us is the growing evidence that sup-
ports a role for a novel class of gene regulators, microR- Mouse Femoral Artery Denudation Injury
NAs (miRs), in regulating VSMC differentiation from and Perivascular Delivery of miR-22
stem/progenitor cells and VSMC phenotype switching
in response to vascular injury.3–6 Despite the growing
AgomiRs or LNA-miR-22
Mouse femoral arterial injury models were performed as
number of identified miRs that have been implicated
described in our previous studies.35–37 To investigate the ther-
in VSMC differentiation and phenotypic modulation in
apeutic effects of miR-22 on wire injury–induced vascular
response to injury, such as miR-1,7 miR-15b/16,8 miR- remodeling, 100 μL of 30% pluronic gel containing chemi-
21,9,10 miR-34a,11,12 miR-133,13 miR-143/145 cluster,14–20 cally modified and cholesterol-conjugated miR-22 (2.5 nmol)
miR-182-3p,21 miR-214,22 miR-221/222,23,24 miR-638,25 or scrambled AgomiRs were applied perivascularly to the
and miR-663,26 the epigenetic regulation of VSMC phe- femoral artery for local delivery of AgomiRs. miR-22 loss of
notype switching has yet to be fully understood. function was conducted by local application of LNA-miR-22
Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1825

(locked nucleic acid–modified miR-22 inhibitor) in the injured test was applied for comparing 2 groups if the data did not
ORIGINAL RESEARCH
arteries. All animal experiments were conducted according display normal distribution. Spearman rank correlation analy-
to the Animals (Scientific Procedures) Act of 1986 (United ses were conducted to characterize the relationships between
Kingdom). All the animal procedures were approved by the the gene expression levels of miR-22 and its target genes,
ARTICLE
Queen Mary University of London ethics review board (Project MECP2 (methyl-CpG binding protein 2) and EVI1. The Fisher
license No. 70/7216) and conform to the guidelines from exact test was used to compare the significance for categori-
Directive 2010/63/EU of the European Parliament on the pro- cal variables (such as patient demographics, comorbidities,
tection of animals used for scientific purposes or the National hospital characteristics) between patients with healthy and
Institutes of Health guidelines (Guide for the Care and Use of diseased femoral arteries. P < 0.05 was considered as statisti-
Laboratory Animals). cally significant.
Additional detailed description of materials and methods
Human Healthy and Diseased is provided in the online-only Data Supplement.
Femoral Arteries Collection and
Immunohistochemistry Analysis RESULTS
Human healthy and diseased femoral arterial specimens were
collected from patients aged 30 to 80 years who underwent miR-22 Expression Is Modulated During
elective major lower extremity amputation of the index leg VSMC Phenotype Switching In Vivo, Ex
at the First Affiliated Hospital of Zhejiang University (China) Vivo, and In Vitro
between June 2013 and August 2017. Healthy femoral arte-
rial specimens were obtained from patients with conditions To explore the potential function of miR-22 in VSMC
unrelated to peripheral artery disease (eg, trauma). Diseased phenotype switching, we examined in vivo, ex vivo,
femoral arterial specimens were characterized by the pres- and in vitro mouse models of VSMC phenotype switch-
ence of SMC-rich atherosclerotic lesions (identified by hema- ing. Reverse transcription quantitative polymerase
toxylin and eosin staining) and obtained from patients with chain reaction (RT-qPCR) data showed that miR-22
peripheral artery disease. Individuals selected for healthy and was significantly decreased in the injured versus un-
diseased groups were age- and sex-matched. Exclusion crite-
injured femoral arteries (Figure 1A, in vivo). RT-qPCR
ria for enrollment were established ahead of time, including
the presence of liver failure, dialysis because of renal failure,
data also showed downregulation of miR-22, and the
cancer, chemotherapy, and pregnancy, and the lack of con- VSMC markers (SmαA and SM-myh11), as well, in the
sent to participate to the study, as well. Patient characteristics, explanted cultured thoracic aortic tissues (Figure 1B, ex
including demographics, comorbidities, and medical treat- vivo). As expected, we found that gene expression lev-
ments, were summarized in Table II in the online-only Data els of VSMC markers were maintained in the VSMCs in
Supplement. All patients gave their written, informed consent early passages (up to passage 8, P8) but significantly
to sample collection. All procedures had local ethical approval. downregulated later (P9 to P12) (Figure 1C, in vitro).
All studies were approved by the Research Ethics Committees Thus, VSMCs between P5 and P8 were used in the cur-
of the First Affiliated Hospital of Zhejiang University (institu- rent study. It is interesting to note that a similar de-
tional review board approval No. 2013/150), and all experi-
creased expression pattern was observed for miR-22
ments were conducted according to the principles expressed
in the Declaration of Helsinki.38 All human arterial specimens
(Figure 1C). Furthermore, miR-22 expression in cul-
(1.5 cm per specimen) were divided into 2 portions: 1 por- tured VSMCs was reduced in response to platelet-de-
tion (1.0 cm per specimen) was used to extract total RNA rived growth factor BB (PDGF-BB) and serum stimula-
with miRCURY RNA Isolation Kits (formalin-fixed paraffin- tion (Figure 1D), whereas the opposite effect was seen
embedded) (EXIQON, 300115), and the other portion (0.5 cm in the serum-starved VSMCs (Figure 1E). The induction
per specimen) underwent fixing with 4% formaldehyde for of miR-22 in VSMCs was further enhanced by trans-
hematoxylin and eosin staining, as detailed previously.39 All forming growth factor β1 (TGF-β1) treatment 24 hours
the human arterial specimens were examined by 2 indepen- and 48 hours after serum starvation (Figure 1E). Alto-
dent cardiovascular pathologists.
gether, these data confirm that expression of miR-22
is altered during phenotype switching in vivo, ex vivo,
Statistical Analysis and in vitro.
Statistical analysis was performed by using Graphpad Prism5.
Numbers (n) refer to the number of independent experi-
ments, mice, or patients. The Shapiro-Wilk normality test miR-22 Is Transcriptionally Regulated
was used for checking the normality of the data, where data During VSMC Phenotypic Modulation
with a Shapiro-Wilk test P value of >0.05 were considered
to fit a normal distribution. A two-tailed unpaired Student t
Transcriptional modulation and regulation of mi-
test and 1- (or 2-) way ANOVA with Dunnett (or Bonferroni) croRNA biogenesis are 2 main mechanisms through
post hoc test were applied for comparisons between 2 or which miR activity can be regulated. Here, we sought
multiple groups, respectively, if the data displayed a normal to determine whether either of these mechanisms
distribution. Conversely, a nonparametric Mann-Whitney U was responsible for regulating miR-22 expression dur-

ORIGINAL RESEARCH
ARTICLE
Figure 1. miR-22 expression is closely modulated during VSMC phenotype switching.

A, miR-22 was significantly downregulated after injury in the in vivo mouse model. Total RNA was collected from the uninjured
(day [D] 0) and injured femoral arteries (D3, D7, D14, and D28 postinjury). RT-qPCR analyses were conducted to obtain relative
expression levels. B, miR-22 was decreased in the ex vivo cultured thoracic aortas. RT-qPCR analysis was used to examine the
mRNA (SMαA and SM-myh11) and miR (miR-22) levels in the freshly isolated aortas and the aortas cultured (Continued )

ing VSMC phenotype switching in cultured VSMCs. found that, whereas PDGF-BB treatment reduced
ORIGINAL RESEARCH
We measured expression of miR-22, its primary (Pri- expression of SM-myh11 and SMTN-B, the addition
miR-22) transcript, and its precursor (Pre-miR-22) of miR-22 mimics significantly increased expression
ARTICLE
transcript. We found that all were significantly down- of both genes even with PDGF-BB treatment (Figure
regulated by PDGF-BB and serum (Figure 2A) but IC and ID in the online-only Data Supplement), sug-
upregulated by TGF-β1 (Figure 2B), suggesting that gesting that miR-22–induced contractile gene ex-
miR-22 was transcriptionally regulated during VSMC pression is PDGF-BB–independent. RT-qPCR analysis
phenotypic modulation. Such a notion was further verified that miR-22 was successfully overexpressed
supported by data from our luciferase activity assays and knocked down in VSMCs by miR-22 mimics and
using miR-22 gene promoter reporter (Figure 2C). A inhibitor, respectively, in control, serum, and PDGF-
recent study showed that miR-22 expression is regu- BB treatments (Figure 3A and 3B). It is important to
lated by a P53-dependent mechanism during cardiac note that VSMC proliferation, growth, and migration
aging,30 and such a mechanism may be responsible for were significantly inhibited by miR-22 overexpression
miR-22 regulation during VSMC phenotypic modula- as demonstrated in bromodeoxyuridine incorpora-
tion. Indeed, we found that the P53-specific inhibitor, tion analysis (Figure 3C), cell counting (Figure IIA in
Pifithrin-α (15 µmol/L), actively reduced miR-22 ex- the online-only Data Supplement), transwell migra-
pression in TGF-β1–treated VSMCs (Figure 2D). These tion (Figure 3D), and wound-healing assays (Figure
data demonstrate that TGF-β1 can regulate miR-22 IIB in the online-only Data Supplement). Conversely,
transcription in VSMCs, likely through a P53-depen- an increased capacity to proliferate, grow, and mi-
dent mechanism. grate was observed in VSMCs transfected with the

miR-22 inhibitor (Figure 3E and 3F, Figure IIC and IID
in the online-only Data Supplement). Similar findings
Functional Role of miR-22 in VSMC from human aortic SMCs also supported that miR-22
Phenotype Switching plays an important role during human VSMC pheno-
To test our hypothesis that miR-22 plays a role in typic modulation (Figure III in the online-only Data
VSMC phenotype switching, we transfected murine Supplement).
and human VSMCs with miR-22 mimics or miR-22
inhibitor and then subjected the transfected cells to
various analyses. RT-qPCR data showed that miR-22
VSMC Apoptosis Is Not Regulated by
expression in murine VSMCs was significantly upreg- miR-22
ulated by miR-22 mimics (Figure IA in the online-only Apart from VSMC migration and proliferation, VSMC
Data Supplement) and downregulated by the miR-22 apoptosis has been suggested to be another major
inhibitor (Figure IB in the online-only Data Supple- contributing factor to atherosclerotic lesion formation
ment). The expression of 4 VSMC genes (SMαA, and plaque phenotype.40–42 To explore any potential
SM22α, SM-myh11, and SMTN-B) was also signifi- roles of miR-22 in VSMC apoptosis, serum-starved
cantly increased in VSMCs transfected with miR-22 VSMCs were subjected to extended serum starva-
mimics (Figure IA in the online-only Data Supple- tion (96 hours) (Figure IVA and IVB in the online-only
ment) and significantly decreased in VSMCs treated Data Supplement) or incubation with 10 µmol/L H2O2
with the miR-22 inhibitor (Figure IB in the online-only (Figure IVC and IVD in the online-only Data Supple-
Data Supplement). It is important to note that we ment) to induce apoptosis. Data from flow cytometry
Figure 1 Continued. in DMEM containing 20% serum for 3 days. Data and error bars in A and B represent the mean±SEM
(n=4), where up to 5 femoral arteries were pooled as 1 experiment. *P<0.05 (versus D0 [A], or fresh aorta [B]). C, miR-22 expres-
sion was downregulated in the extended culture of murine VSMCs. Total RNA, including miR (miR-22) and mRNA (SMαA, SM-
myh11, and CNN1), was harvested from freshly cultured VSMCs (cultured until day 7 and then split, designated P0), and VSMCs
with the indicated passage number (P0, P3, P8, P9, or P12) were subjected to RT-qPCR analysis to obtain relative expression levels.
D, Serum (left) and PDGF-BB (right) downregulated miR-22 in cultured VSMCs. VSMCs were subjected to serum starvation for
48 hours, followed by incubation with 20% serum or PDGF-BB (10 ng/mL), respectively. Total RNA was harvested at each indi-
cated time point. E, Serum starvation and TGF-β1 upregulated miR-22 in cultured VSMCs. VSMCs in normal culture were used as
control (TGF-β1–, Serum+) or subjected to serum starvation for 48 hours and then harvested after the indicated stimulations and
time points: no stimulation (TGF-β1–, Serum–) at 0 hour, TGF-β1 stimulation at 24 hours (TGF-β1-24hrs, Serum–), and TGF-β1
stimulation at 48 hours (TGF-β1-48hrs, Serum–). Total RNA was extracted and subjected to RT-qPCR analysis with a specific miR-
22 forward primer and a universal miR reverse primer. Data and error bars in C through E represent mean±SEM (n=5). *P<0.05,
**P<0.01, ***P<0.001 (versus P0 [C], 0 hours [D], or normal culture [E]); #P<0.05 (versus 0 hours). DMEM indicates Dulbecco’s
modified Eagle’s medium; miR-22, microRNA-22; PDGF-BB, platelet-derived growth factor BB; RT-qPCR, reverse transcription
quantitative polymerase chain reaction; TGF-β1, transforming growth factor β1; and VSMC, vascular smooth muscle cell.

A B
ORIGINAL RESEARCH
ARTICLE
C D
Figure 2. miR-22 is transcriptionally regulated in VSMC phenotypic modulation.

A, PDGF-BB and serum significantly downregulated miR-22, and its primary (pri-miR-22) and precursor (premiR-22) tran-
scripts, as well. Serum-starved VSMCs were used as the control (PDGF-BB–, Serum–), incubated with serum (20%), or
incubated with PDGF-BB (10 ng/mL) for 3 hours. Total RNA was harvested and subjected to RT-qPCR analysis to examine
miR-22 and its transcripts. B, TGF-β1 significantly upregulated miR-22, pri-miR-22, and premiR-22. RT-qPCR analysis was
used to examine the miR levels in serum-starved VSMCs incubated with TGF-β1 (5 ng/mL) for 0, 24, and 48 hours. C, PDGF-
BB significantly decreases, whereas TGF-β1 significantly increases miR-22 gene promoter activity. VSMCs transfected with
miR-22 gene promoter (pGL3-miR-22) were subjected to serum starvation for 24 hours, followed by mock treatment (Ctrl)
or incubation with PDGF-BB (10 ng/mL) or TGF-β1 (5 ng/mL) for 6 hours. Cell lysates were harvested and analyzed using the
luciferase activity assay. D, TGF-β1 upregulated miR-22 in a P53-depedent manner. VSMCs transfected with miR-22 gene
promoter (pGL3-miR-22) were subjected to serum starvation for 24 hours, followed by incubation with vehicle (TGF-β1–,
Pifithrin-α–) or TGF-β1 (5 ng/mL) for 24 hours in the absence or presence of 15 µmol/L P53-specific inhibitor, Pifithrin-α.
Cell lysates were harvested and subjected to the luciferase activity assay. Data and error bars in A through D represent the
mean±SEM (n=3 in A, C, and D; n=4 in B). *P<0.05 (versus PDGF-BB–Serum– [A], 0 hours [B], Ctrl [C], or TGF-β1– [D]);
#
P<0.05 (versus TGF-β1+, Pifithrin-α–). miR-22 indicates microRNA-22; PDGF-BB, platelet-derived growth factor BB; RT-
qPCR, reverse transcription quantitative polymerase chain reaction; TGF-β1, transforming growth factor β1; and VSMC,
vascular smooth muscle cell.
analyses showed that the percentages of live, early proliferation, migration, apoptosis, and cell cycle)11,43–45
apoptotic, late apoptotic, and necrotic VSMCs were and vascular biology34 (Figure V in the online-only Data
not significantly changed by either miR-22 overex- Supplement). Our data showed that the expression lev-
pression (Figure IVA and IVC in the online-only Data els of TP53INP1, TGFRβ1, P21, MAP2K4, and SP1 were
Supplement) or inhibition (Figure IVB and IVD in the significantly increased in both serum-starved and TGF-
online-only Data Supplement), indicating that miR-22 β1–treated VSMCs, whereas the expression levels of
was not involved in either extended serum starvation MECP2, ARPC5, EVI1, MYST4, and histone deacetylase
or H2O2-induced VSMC apoptosis. 4 (HDAC4) were significantly inhibited by either serum
starvation or TGF-β1 stimulation (Figure V in the on-
line-only Data Supplement). It is important to note that
Potential Downstream Targets of miR-22 MECP2 and EVI1 expression in serum-starved VSMCs
During VSMC Phenotype Switching was further decreased by TGF-β1 treatment (Figure V
Conserved miR-22 binding site(s) were found within in the online-only Data Supplement). Because TGF-β1
270 genes by using Targetscan. Among them, 23 vali- treatment increased miR-22 expression (Figure 1E) and
dated/predicted targets of miR-22 were selected for decreased expression of MECP2, EVI1, and HDAC4,
further study, because they are known to play key reg- these observations indicated these genes could be po-
ulatory roles in both VSMC functions (differentiation, tential targets of miR-22.

A B C
ORIGINAL RESEARCH
ARTICLE
D E F
Figure 3. miR-22 modulates VSMC proliferation and migration.

VSMCs were transfected with miR-22 mimics, miR-22 inhibitor, or respective negative control miR (miRNA ctrl), followed by 24
hours of serum starvation. Subsequently, cells were treated with vehicle control (Ctrl), PDGF-BB (10 ng/mL), or serum (20%)
for 48 hours and analyzed. A, RT-qPCR analysis confirmed miR-22 overexpression in VSMCs transfected with miR-22 mimics
on PDGF-BB and serum treatment. B, RT-qPCR analysis confirmed that miR-22 expression was significantly inhibited in VSMCs
transfected with miR-22 inhibitor in all treatments. C, BrdU assays revealed significantly decreased absorbance of VSMCs
transfected with miR-22 mimics in all treatments, indicating decreased proliferation. D, Transwell migration assays showed
significantly decreased migration of VSMCs transfected with miR-22 mimics under both PDGF-BB and serum stimulation. E,
BrdU assays revealed significantly increased absorbance and therefore proliferation of VSMCs transfected with the miR-22
inhibitor on PDGF-BB and serum treatment. F, Transwell migration assays showed significantly increased migration of VSMCs
transfected with the miR-22 inhibitor under both PDGF-BB and serum stimulation. Note: No or very few migrated cells were
observed without cell chemoattractant in transwell migration assays; therefore, no control treatment is shown. Data and error
bars represent the mean±SEM (n=3 in A; 4 in B, C, and E; or 5 in D and F). *P<0.05 (versus miRNA ctrl). #P<0.05 (versus Ctrl).
BrdU indicates bromodeoxyuridine; miR-22, microRNA-22; PDGF-BB, platelet-derived growth factor BB; RT-qPCR, reverse tran-
scription quantitative polymerase chain reaction; and VSMC, vascular smooth muscle cell.
MECP2 and HDAC4 Are 2 Functional cantly upregulated by MECP2 inhibition (Figure VID
Target Genes of miR-22s During VSMC in the online-only Data Supplement), supporting that
MECP2 is the downstream target of miR-22. It is impor-
Phenotype Switching
tant to note that VSMC proliferation (Figure VIE in the
Our previous study showed that miR-22 targets MECP2 online-only Data Supplement) and migration (Figure VIF
during VSMC differentiation from stem cells,34 lead- in the online-only Data Supplement) were significantly
ing to our hypothesis that MECP2 may also be a decreased by MECP2 knockdown, demonstrating that
downstream target of miR-22 during VSMC pheno- MECP2 suppression can recapitulate the effects of miR-
type switching. Data from RT-qPCR and Western blot 22 overexpression in VSMC phenotypic modulation. In
analyses showed that both MECP2 mRNA and protein addition to MECP2, HDAC4 is another reported target
expression levels are decreased in VSMCs by miR-22 of miR-22.33,46 miR-22 overexpression decreased the ex-
overexpression (Figure VIA and VIB in the online-only pression level of HDAC4 (Figure VIIA in the online-only
Data Supplement). The MECP2 3ʹ-UTR reporter34 ac- Data Supplement). Inhibition of HDAC4 mimics miR-22
tivity was also significantly inhibited by miR-22 mim- overexpression during VSMC phenotype switching (Fig-
ics (Figure VIC in the online-only Data Supplement). ure VIIB through VIID in the online-only Data Supple-
Moreover, all 5 VSMC genes (SMαA, SM22α, CNN1, ment). These data suggested that miR-22 also targets
SM-myh11, SMTN-B), but not miR-22, were signifi- HDAC4 in mature VSMCs.

EVI1 Is a Novel Target Gene and proliferation (Figure VIIIB in the online-only Data Sup-
ORIGINAL RESEARCH
Responsible for miR-22–Mediated VSMC plement) and migration (Figure VIIIC in the online-only
Data Supplement). Taken together, we demonstrate
Phenotype Switching
ARTICLE
that EVI1 is a novel target gene that is at least partially
The transcriptional regulator and oncoprotein EVI1 was responsible for miR-22-mediated VSMC phenotype
predicted as one of the target genes of miR-22 by Tar- switching.
getscan (Figure 4A). Opposite from miR-22 (Figure 1C),
EVI1 gene expression was dramatically increased in the
extended passages (P8, P9, and P12) of cultured mu- EVI1 Is a Transcriptional Repressor for
rine VSMCs (Figure 4B). These observations prompted VSMC Marker Gene Expression
us to investigate whether or not EVI1 is a novel target As described above, gene expression data indicate that
gene of miR-22 during VSMC phenotype switching. EVI1 plays an inhibitory role in regulating the expression
As expected, expression levels of both the EVI1 mRNA
of 5 VSMC genes and 2 transcription factors. Lucifer-
(Figure 4C) and protein (Figure 4D) were significantly
ase activity data showed that EVI1 knockdown induced
downregulated by miR-22 mimics but upregulated
both SMαA and SM22α gene promoter activity, but
by miR-22 inhibitor in VSMCs. The luciferase activ-
this was completely lost once the SRF binding element
ity of EVI1 3ʹ-UTR reporter was significantly repressed
within the gene promoter was mutated (Figure 6A and
by miR-22 mimics but enhanced by miR-22 inhibition
6B), confirming that EVI1 regulates VSMC marker ex-
(Figure 4E). Once the miR-22 binding site within EVI1
pression through a transcriptional mechanism requiring

3ʹ-UTR was mutated, the miR-22 mimic–induced inhibi-
SRF binding. Moreover, we found that both SRF and
tion of EVI1 expression was abrogated (Figure 4F), sug-
Myocd gene promoter reporter activity was significantly
gesting that miR-22 directly downregulates EVI1 via its
increased in EVI1 knockdown VSMCs (Figure 6C and
3ʹ-UTR binding site.
6D), indicating that EVI1 also represses SRF and Myocd
To explore the functional significance of EVI1 in
gene regulation.
VSMC phenotype switching, an EVI1 small hairpin
To understand the underlying molecular mechanisms
RNA lentivirus was produced and used to generate a
stable knockdown of EVI1 in VSMCs as validated by of EVI1 regulation, chromatin immunoprecipitation as-
RT-qPCR (Figure 5A) and Western blot (Figure 5B). We says were conducted in control and EVI1 knockdown
found that expression of 5 VSMC genes and 2 SMC VSMCs using an EVI1-specific antibody. We found
transcription factor genes (SRF and Myocd) was sig- significant enrichment of EVI1 within the promoter
nificantly increased in EVI1 knockdown VSMCs (Fig- regions of SMαA, SM22α, SRF, and Myocd genes in
ure 5C). Similarly, VSMC proliferation (Figure 5D) and control VSMCs (Figure 6E). Such enrichment disap-
migration (Figure 5E) in response to both serum and peared in EVI1 knockdown VSMCs (Figure 6E), confirm-
PDGF-BB stimulation were significantly decreased. ing that EVI1 directly binds to these 4 gene promoters.
Altogether, our data suggest that, similar to overex- In our previous publication, H3K9me3 was shown to
pression of miR-22, EVI1 suppression in VSMCs simu- bind to promoter regions of VSMC marker genes and
lates the effects of miR-22 overexpression on VSMC suppress their expression.34 This led to the hypothesis
gene expression, proliferation, and migration. that H3K9me3-induced suppression is dependent on
To further understand the functional significance EVI1. A chromatin immunoprecipitation assay with a
of EVI1 in miR-22–induced VSMC phenotype switch- H3K9me3-specific antibody showed a significantly low-
ing, control VSMCs and EVI1 knockdown VSMCs were er H3K9me3 enrichment within the promoter regions
transfected with either a control inhibitor or a miR-22 of VSMC marker genes in EVI1 knockdown cells (Fig-
inhibitor. The gene expression data showed that both ure 6F), suggesting that the binding of H3K9me3 to the
miR-22 and EVI1 were successfully downregulated in promoter regions of VSMC genes is EVI1-dependent.
VSMCs by miR-22 inhibitor and EVI1 small hairpin RNA,
respectively (Figure VIIIA in the online-only Data Supple- Therapeutic Potential of miR-22 for
ment). The expression level of EVI1 was significantly in-
creased by miR-22 inhibitor in control VSMCs, whereas
Postinjury Arterial Remodeling
the same inhibitory effect was abolished in EVI1 knock- To determine the therapeutic potential of miR-22 in
down VSMCs (Figure VIIIA in the online-only Data postinjury arterial remodeling, 2.5 nmol of miR-22 or
Supplement). It is important to note that RT-qPCR data Cel-miR-67 AgomiRs (negative control) was perivas-
showed that miR-22 inhibition downregulated VSMC cularly applied to femoral arteries immediately after
gene expression, and this inhibitory effect of miR-22 wire-induced injury as described in our previous stud-
was abolished by EVI1 knockdown (Figure VIIIA in the ies.12,22 In comparison with uninjured arteries, injured
online-only Data Supplement). Similar phenomena arteries treated with control Cel-miR-67 AgomiRs dis-
were observed in serum and PDGF-BB–induced VSMC played significantly decreased expression of miR-22 and

A B
ORIGINAL RESEARCH
ARTICLE
C D
E F
Figure 4. EVI1 is the novel target of miR-22 in VSMCs.

A, The predicted miR-22 binding site within EVI1 3ʹ-UTR by Targetscan. EVI1, miR-22 sequence (mmu-miR-22), and the miR-
22 binding site mutant (EVI1 mutant) are depicted in this illustration. The mutation site in EVI1 mutant and corresponding
sequences in wild-type EVI1 and mmu-miR-22 are underlined and bold. B, EVI1 was upregulated in the extended cultured
VSMCs. Each dot represents EVI1 mRNA level in each passage (P3, P8, P9, P12) normalized to EVI1 mRNA level of P0. C and
D, EVI1 was negatively regulated by miR-22. VSMCs transfected with miR-22 mimics, inhibitor, or respective controls (Ctrl), as
indicated, were subjected to serum starvation for 48 hours. Total RNA and protein were harvested and subjected to RT-qPCR
(C) and Western blot (D) analyses, respectively. E, miR-22 repressed EVI1 3ʹ-UTR reporter activity. miR-22 mimics, inhibitor, or
respective controls (Ctrl) were cotransfected with EVI1 3ʹ-UTR reporter into VSMCs, as indicated. Transfected cells were sub-
jected to serum starvation for 48 hours, and cell lysates were subjected to luciferase activity assay. F, miR-22 binding site was
required for miR-22–mediated EVI1 gene repression. miR-22 mimics or control miR mimics (miRNA ctrl) were cotransfected
into VSMCs with wild-type reporter (pmiR-EVI1-WT) or the reporter containing mutated miR-22 binding site (pmiR-EVI1-mu-
tant). Transfected cells were subjected to serum starvation for 48 hours before luciferase activity assay. Data and error bars in B
through F are representative (D) or mean±SEM (B, C, E, and F) (n=4 in D and F). *P<0.05, **P<0.01 (versus P0 or respective
miRNA ctrl). EVI1 indicates ecotropic virus integration site 1 protein homolog; miR-22, microRNA-22; RT-qPCR, reverse tran-
scription quantitative polymerase chain reaction; 3ʹ-UTR, 3ʹ-untranslated region; and VSMC, vascular smooth muscle cell.
VSMC genes (SMαA and SM-myh11) and significantly 22 expression via perivascular transfection of miR-22
increased expression of cell proliferation marker gene, AgomiR was specific to injured arteries, yet absent in
PCNA, and the identified miR-22 target genes (MECP2, other organs/tissues (eg, heart, skeletal muscle, spleen,
HDAC4, and EVI1), whereas the opposite effects were liver, kidney, and lung) (data not shown). As expected,
observed in injured arteries treated with miR-22 AgomiR injury-induced MECP2, EVI1, HDAC4, and PCNA gene
(Figure 7A). It is important to note that increased miR- expression was blunted, whereas the expressions of

A B
ORIGINAL RESEARCH
ARTICLE
C
D E
Figure 5. EVI1 inhibition reproduces the effects of miR-22 overexpression on VSMC-specific gene expression, prolif-
eration, and migration.
A and B, EVI1 knockdown VSMC was generated and validated. Total RNA and protein of control (nontarget shRNA, sh-NT)
and EVI1 stable knockdown (EVI1 shRNA, sh-EVI1) VSMCs were harvested and subjected to RT-qPCR (A) and Western blot
(B) analyses, respectively. C, EVI1 knockdown significantly increases expression of VSMC markers (SMαA, SM22α, CNN1,
SM-myh11, SMTN-B) and transcription factors (SRF and Myocd), although the transcription factor MEF2c exhibited no
significant change in expression. Total RNA of control and EVI1 stable knockdown VSMCs were harvested and subjected to
RT-qPCR. D, Inhibition of endogenous EVI1 decreases VSMC proliferation. Control and EVI1 stable knockdown VSMCs were
subjected to serum starvation for 48 hours, followed by BrdU incorporation assays in response to no (Ctrl), serum (20%),
and PDGF-BB (10 ng/mL) stimulation. E, Inhibition of endogenous EVI1 decreases VSMC migration. Control and EVI1 stable
knockdown VSMCs were subjected to serum starvation for 48 hours, followed by transwell migration in response to serum
(20%) and PDGF-BB (30 ng/mL) stimulation. Note: No or very few migrated cells were observed without cell chemoattrac-
tant in transwell migration assays; therefore, no control treatment is shown. Data and error bars are representative (B) or
mean±SEM (A and C through E) (n=3 in C; 4 in D; or 5 in E). *P<0.05 (versus sh-NT). #P<0.05 (versus Ctrl). BrdU indicates
bromodeoxyuridine; EVI1, ecotropic virus integration site 1 protein homolog; miR-22, microRNA-22; PDGF-BB, platelet-
derived growth factor BB; RT-qPCR, reverse transcription quantitative polymerase chain reaction; shRNA, small hairpin RNA;
and VSMC, vascular smooth muscle cell.
VSMC genes (SMαA and SM-myh11) were enhanced vascular injury. Consequently, although the application
by local ectopic expression of miR-22 (Figure 7A). These of control AgomiRs (Cel-miR-67 AgomiR) in the injured
findings are consistent with the notion that miR-22 artery exhibited pronounced neointima hyperplasia af-
promoted VSMC phenotype switching from its prolif- ter 28 days, miR-22 overexpression significantly inhib-
erative, synthetic state to a contractile phenotype after ited neointima formation, as evidenced by decreased

A B C D
ORIGINAL RESEARCH
ARTICLE
E
Figure 6. EVI1 functions as a transcriptional repressor for VSMC gene expression.

A and B, SRF binding element(s) are required for EVI1-mediated SMαA and SM22α gene promoter activity. Wild-type (SMαA/
SM22α) or SRF binding site(s) mutants (SRFmut) of SMαA (A) and SM22α (B) gene promoter reporters were transfected into
control (nontarget shRNA, sh-NT) and EVI1 stable knockdown (EVI1 shRNA, sh-EVI1) VSMCs. Transfected cells were subjected
to serum starvation for 48 hours, and cell lysates were subjected to luciferase activity assay. C and D, EVI1 inhibition signifi-
cantly increases SRF and Myocd gene promoter activity. SRF (C) and Myocd (D) gene promoter reporters were transfected
into control and EVI1 stable knockdown VSMCs. Transfected cells were subjected to serum starvation for 48 hours, and
cell lysates were subjected to luciferase activity assay. E, EVI1 was significantly enriched at the promoter regions of SMαA
(far left), SM22α (middle left), SRF (middle right), and Myocd (far right) genes and was significantly decreased by EVI1
knockdown, indicating direct binding of EVI1 to these promoter regions. ChIP assays were performed to measure EVI1 en-
richment in the promoter region of its downstream targets. Control (sh-EVI1–) and EVI1 stable knockdown (sh-EVI1+) VSMCs
were lysed and incubated with antibody against EVI1 to immunoprecipitate EVI1-bound promoter DNA, followed by qPCR
to quantify DNA enrichment. For SMαA and SM22α, genomic DNA without SRF binding sites were amplified as additional
control for specific promoter DNA enrichment and designated as Promoter–. For SRF and Myocd, PCR amplification of DNA
region adjacent to their promoter was designated as Promoter–. F, H3K9me3 enrichment within the promoter regions of
SMαA (far left), SM22α (middle left), SRF (middle right), and Myocd (far right) genes was significantly decreased by
EVI1 knockdown. ChIP assays were performed by using an antibody against H3K9me3. Data and error bars are mean±SEM.
*P<0.05 (versus sh-NT). #P<0.05 (versus sh-EVI1–, Promoter+). ChIP indicates chromatin immunoprecipitation; EVI1, eco-
tropic virus integration site 1 protein homolog; qPCR, quantitative polymerase chain reaction; shRNA, small hairpin RNA; and
VSMC, vascular smooth muscle cell.
intima area and intima/media ratio in the miR-22 22 in postinjury arterial remodeling, we also conducted
AgomiR–treated injured artery, although the media miR-22 loss-of-function experiments using LNA-miR-22
area experienced no significant change (Figure 7B and and found that miR-22 inhibition produces the oppo-
7C). To better understand the functional role of miR- site effects of miR-22 overexpression on VSMC marker

A B
ORIGINAL RESEARCH
ARTICLE
C
D E
Figure 7. Modulation of miR-22 expression in the injured arteries influences neointima formation.
A through C, Local enforced expression of miR-22 reduces neointima formation in the injured femoral arteries. After wire-
induced injury, 100 µL of 30% pluronic gel containing 2.5 nmol control AgomiR (Cel-miR-67 AgomiR) or miR-22 AgomiR per
artery per mouse was immediately applied and packed around the injured femoral arteries. Three days (A) or 4 weeks (B and
C) later, injured segments of femoral arteries were harvested for analyses. A, Perivascular delivery of miR-22 AgomiRs reversed
the gene expression profiles in wire-induced femoral artery injury. Total RNA was harvested from uninjured and AgomiR-ap-
plied injured femoral arteries before undergoing RT-qPCR analyses. Data and error bars represent mean±SEM (n=3) (5 femoral
arteries were pooled for each experiment). *P<0.05 (versus uninjured arteries). #P<0.05 (miR-22 AgomiRs versus Cel-miR-67
AgomiRs in the injured arteries). B and C, Locally enforced expression of miR-22 inhibited neointima formation in wire-injured
femoral arteries. Paraffin sections from both groups (n=15 mice for Cel-miR-67 and n=13 mice for miR-22 AgomiRs) were
prepared and subjected to H&E staining. Representative images (B) and morphological characteristics (C), including media area
(left), intima area (middle), and intima/media (I/M) ratio (right) at 4 weeks after injury were presented. #P<0.05 (versus Cel-
miR-67 AgomiRs). D through F, miR-22 inhibition promotes neointima formation in the injured arteries. After wire injury, 100 µL
of 30% pluronic gel containing vehicle (mock transfection, Mock), 2.5 nmol control LNA (scrambled LNA, Scrbl-LNA), or LNA-
miR-22 per artery per mouse was immediately applied and packed around injured femoral arteries. Seven days (Continued )

expression and injury-induced neointima hyperplasia not apoptosis, were modulated by miR-22. Mechanis-
ORIGINAL RESEARCH
(Figure 7D through 7F). These findings suggest thera- tically, we have confirmed that MECP2, HDAC4, and
peutic potential for harnessing local ectopic expression EVI1 are the authentic downstream targets of miR-22
ARTICLE
of miR-22 to suppress neointima hyperplasia after arte- during VSMC phenotype switching. We have also iden-
rial injury. tified EVI1 as a novel transcriptional repressor of VSMC
contractile genes. It is important to note that we ob-
served that miR-22 expression is suppressed in the hu-
miR-22 Is Significantly Downregulated, man femoral arteries with atherosclerotic plaques and
Whereas Its Target Genes (MECP2 and have uncovered an inverse relationship between miR-
EVI1) Are Dramatically Upregulated in 22 and its target genes, MECP2 and EVI1, in healthy
the Diseased Human Arteries and diseased arteries.
To translate our findings from murine into human, we
collected 30 diseased and 30 healthy femoral arte- Role of miR-22 in Heart Disease and
rial specimens from patients who underwent leg am-
Vascular Remodeling
putation at the First Affiliated Hospital of Zhejiang
University, China. Diseased femoral artery specimens miR-22 has been primarily identified as a tumor sup-
featured SMC-rich atherosclerotic lesions with severe pressor, but later studies have identified miR-22 as a
neointima hyperplasia, whereas healthy femoral ar- prohypertrophic miR.32,33,46,47 A phenotypic screen with
teries displayed no atherosclerotic lesions (Figure 8A). primary rat cardiomyocytes has suggested that miR-
In comparison with healthy arteries, diseased femoral 22 has prohypertrophic potential,46 which was further
arteries showed a significantly decreased gene ex- confirmed by using transgenic mice: specifically, global
pression level of miR-22 and dramatically increased or cardiac-specific deletion of miR-22 blunted stress-in-
expression levels of its target genes (MECP2 and EVI1) duced cardiac hypertrophy and remodeling,32,33 where-
(Figure 8B). It is more important that significant in- as cardiac-specific overexpression of miR-22 induced
verse relationships between miR-22 and its down- a prohypertrophic gene expression profile and elicited
stream targets, MECP2 and EVI1, were observed in cardiac dilation and heart failure.47 In a more clinically
both healthy and diseased femoral arteries (Figure 8C relevant study, pharmacological inhibition of miR-22
and Figure IX in the online-only Data Supplement). It promoted cardiac functional recovery after myocardial
is interesting to note that an abnormally high expres- infarction by eliciting cardiac autophagy.30 These im-
sion level of EVI1 was observed in 3 healthy and 3 portant studies provide clear evidence to suggest that
diseased femoral arteries harvested from the patients a fine balance of miR-22 expression and regulation is
with hypertension and hyperlipidemia, indicating that critical for maintaining adequate cardiac functions. Al-
the coexistence of these 2 comorbidities could signifi- though the majority of miR-22 studies were conducted
cantly affect EVI1 expression. Thus, these data provide in cancer cells or cardiac cells, we recently reported an
critical information about the functional relevance of important role for miR-22 in VSMC differentiation from
miR-22 and its target genes in human atherosclerotic stem cells both in vitro and in vivo,34 inferring a regu-
lesions. latory role for miR-22 in VSMC biology. However, the
role for miR-22 in VSMC phenotypic modulation had
not been explored until our present study. By perform-
DISCUSSION ing miR gain- and loss-of function studies, we demon-
By using various in vivo, ex vivo, and in vitro models strated that miR-22 promotes VSMC contractile gene
of VSMC phenotypic modulation, we identified a nov- expression and inhibits VSMC proliferation and migra-
el role of miR-22 as a mediator of VSMC phenotype tion. We show that local transfer of miR-22 onto the in-
switching and neointima formation. We specifically jured arteries can restore synthetic VSMCs to a contrac-
show that miR-22 is transcriptionally regulated by se- tile phenotype, providing a basis for using site-specific
rum, PDGF-BB, and TGF-β1. Moreover, VSMC contrac- delivery of miR-22 mimics via miR-22–coated stents to
tile gene expression, proliferation, and migration, but prevent or inhibit in-stent restenosis. Our study was
Figure 7 Continued. (D) or 4 weeks (E and F) later, injured segments of femoral arteries were harvested for RT-qPCR analyses
(D), H&E staining (E), and morphological quantification (F) (n=5 mice for Mock and n=10 mice for LNA-miR-22 and Scrbl-
LNA). Note: Dotted line (D) represents the gene expression level in the uninjured arteries, which is set as 1.0. *P<0.05 (versus
uninjured arteries). #P<0.05 (LNA-miR-22 versus Mock and Scrbl-LNA). EVI1 indicates ecotropic virus integration site 1 protein
homolog; HDAC4, histone deacetylase 4; H&E, hematoxylin and eosin; LNA, locked nucleic acid; MECP2, methyl-CpG binding
protein 2; miR-22, microRNA-22; PCNA, proliferating cell nuclear antigen; and RT-qPCR, reverse transcription quantitative
polymerase chain reaction.

also the first to identify an inverse relationship between

A
ORIGINAL RESEARCH
the expression levels of miR-22 and its target genes,
MECP2 and EVI1, in both healthy and diseased human
ARTICLE
femoral arteries, suggesting that miR-22 could be a po-
tential therapeutic agent in coronary atherosclerosis.
Therefore, extending our studies to other human arter-
ies (eg, coronary/carotid arteries) would be a promising
next step for exploring the therapeutic application of
B miR-22 in various cardiovascular diseases.
Transcriptional Regulation of miR-22

The regulatory mechanisms of miR-22 expression in
VSMCs are only partially known. Our previous publi-
cation suggested that miR-22 is transcriptionally reg-
ulated by PDGF-BB and TGF-β1 during VSMC differ-
entiation from stem cells, but no direct evidence has
been obtained.34 PDGF-BB is a member of the plate-
let-derived growth factor family primarily expressed by
vascular endothelial cells and platelets at the vascular

injury sites, and it is a key stimulant of VSMC prolif-
eration and migration.48,49 In addition to upregulating
C
miR-22 during VSMC differentiation from stem cells,34
PDGF-BB signaling has also been reported to transcrip-
tionally induce miR-15b expression to mediate VSMC
dedifferentiation and inhibit miR-221 to promote
proliferation in pancreatic cancer cells.50,51 TGF-β1,
initially identified as a tumor suppressor, is known to
transcriptionally regulate genes involved in prolifera-
tion, growth, and differentiation by binding their re-
sponse elements within target promoters.52 Similar to
TGF-β1 signaling, the P53 signaling pathway can also
Figure 8 Continued. MECP2 (relative to 18S, ‰) and EVI1

(relative to 18S, ‰), are shown for each HFA and DFA speci-
men (dots). Lines represent the mean in each patient group.
*P<0.05 (DFA versus HFA, Mann-Whitney U test). The ex-
pression level of miR-22 was significantly decreased, whereas
the expression levels of MECP2 and EVI1 were dramatically
increased in DFA. C, Spearman rank correlation analyses
were performed to characterize the relationships between
the gene expression levels of MECP2/EVI1 and miR-22 in
HFA and DFA specimens. The y axis represents the expres-
sion level of miR-22 (relative to U6, %); the x axis represents
Figure 8. Expression profiles of miR-22 and target the expression level of its target genes (MECP2 and EVI1)
(relative to 18S, ‰). The solid line indicates the fitted linear
genes in the healthy and diseased human arteries.
regression line; the dotted line indicates 95% confidence
Healthy femoral artery specimens (HFA, n=30) from patients
interval level. r is the Spearman rank correlation coefficient
without peripheral arterial diseases and diseased femoral
between the expression levels of MECP2/EVI1 and miR-22.
artery specimens (DFA, n=30) from patients with peripheral A value closer to –1 indicates a stronger negative correla-
arterial diseases were collected and subjected to H&E stain- tion, and a value closer to 1 indicates a stronger positive
ing (A) and RT-qPCR (B) analyses. A, Representative H&E correlation. P is the P value indicating the significant level
images of HFA and DFA groups are shown. HFA is character- of correlation. EVI1 indicates ecotropic virus integration site
ized by the absence of atherosclerotic lesions, whereas DFA 1 protein homolog; H&E, hematoxylin and eosin; MECP2,
is characterized by the presence of atherosclerotic lesions methyl-CpG binding protein 2; miR-22, microRNA-22; and
and severe neointima hyperplasia (NI). B, Expression levels of RT-qPCR, reverse transcription quantitative polymerase chain
miR-22 (relative to U6, %) and its target genes, (Continued ) reaction.

modulate miR expression and maturation, and thereby with the previous finding that another miR-22 target,
ORIGINAL RESEARCH
cell proliferation and differentiation.53 A recent study MECP2, also modulates H3K9me3 enrichment within
showed that miR-22 expression is regulated by a P53- promoter regions of VSMC-specific genes,34 these re-
ARTICLE
dependent mechanism during cardiac aging.30 In this sults imply that epigenetic modification within VSMC
study, we have provided definitive evidence that miR- gene promoters may be one of the underlying path-
22 gene expression in VSMCs is regulated by PDGF-BB ways through which miR-22 regulates VSMC phe-
and TGF-β1 through modulation of gene promoter ac- notype switching. Whether other epigenetic mecha-
tivity (Figure 2C). Furthermore, our data also show that nisms are involved in EVI1-mediated VSMC phenotype
TGF-β1 transcriptionally regulates miR-22 in VSMCs switching remains to be seen. Further investigations
via a P53-dependent mechanism. Our observation first are warranted to identify genome-wide targets for
establishes the TGF-β1/P53/miR-22 signaling axis and EVI1 in VSMCs by conducting an unbiased EVI1 chro-
uncovers the regulatory role of PDGF-BB, TGF-β1, and matin immunoprecipitation sequencing to better un-
P53 signaling pathways in VSMC phenotypic modu- derstand the global regulatory role of EVI1 in VSMC
lation. Because these major signaling pathways may phenotype modulation and potentially in cardiovascu-
represent novel therapeutic targets, the development lar diseases.
of agents that target these signaling pathways is likely It is noteworthy that our identification of the
to have a significant therapeutic impact on vascular miR-22/EVI1 signaling axis in human atherosclerotic
disease. plaques presents potential clinical application toward
treating cardiovascular disease. Because the expres-
sion of miR-22 was significantly decreased, whereas

EVI1 as Novel Gene Target of miR-22 expression of its target genes, MECP2 and EVI, was
Previous studies have shown that EVI1 functions as dramatically increased in femoral atherosclerotic le-
a transcriptional regulator that binds DNA sequences sions in comparison with healthy femoral arteries,
in the promoter region of target genes and regulates inhibiting EVI1 may offer a therapeutic opportunity
a number of biological processes, such as hemato- to decrease neointima formation and restenosis.
poiesis, apoptosis, development, and cell differentia- Furthermore, it has been reported that EVI1 protein
tion and proliferation.54–57 However, little is known can be specifically degraded by an anticancer drug,
about its potential involvement in VSMC function arsenic trioxide.59 Several preclinical60,61 and clini-
and cardiovascular disease. In this study, we provide cal62,63 studies suggest AES is a promising alternative
compelling evidence that EVI1 is the target gene of to widely used sirolimus derivative–eluting stents. In
miR-22–mediated VSMC phenotype modulation and a rabbit iliac artery injury model, AES significantly
is a transcriptional repressor for multiple VSMC con- suppressed in-stent restenosis by reducing prolifera-
tractile genes. We specifically demonstrate that EVI1 tion and inducing apoptosis of VSMCs.61 The benefi-
transcriptionally inhibits VSMC-specific gene expres- cial effects of AES on in-stent restenosis in a porcine
sion by providing the following evidence: (1) suppres- coronary model were also attributed to an early anti-
sion of EVI1 expression and its reporter activity by inflammatory effect of arsenic trioxide in the stented
miR-22 mimics; (2) increase in gene expression of all 5 vessels.60 A 2-year follow-up clinical study also dem-
VSMC-specific contractile markers and 2 transcription onstrated that AES has a comparable efficacy and
factors by EVI1 knockdown; (3) increase in gene pro- safety to durable polymer sirolimus–eluting stent for
moter activity of SMαA, SM22α, SRF, and Myocd by the treatment of de novo coronary artery lesions.62
EVI1 inhibition; (4) requirement of SRF binding sites(s) Our finding that the miR-22/EVI1 signaling axis plays
for EVI1-mediated SMαA and SM22α gene repres- an important role in VSMC phenotypic modulation
sion; and (5) direct binding and enrichment of EVI1 and arterial remodeling may offer a possible mecha-
at the promoter regions of SMαA, SM22α, SRF, and nistic basis for the beneficial effect of AES on in-stent
Myocd confirmed by chromatin immunoprecipitation restenosis, and suggests that correcting the dysregu-
assay. lation of miR-22 and EVI1 in atherosclerotic arteries
Emerging evidence has suggested that EVI1 regu- through a site-specific delivery of miR-22 mimics to
lates transcription, in part, through epigenetic modi- the stented vessels by using a miR-22–coated balloon
fication.56 For example, the aberrant DNA hyper- or stent, or ultrasound-triggered nanodelivery tech-
methylation signature in EVI1-directed acute myeloid nology, could be a potential treatment to prevent or
leukemia is likely through interaction with DNA meth- inhibit in-stent restenosis.
yltransferases 3A and 3B.58 In this study, we observed We recognize a few limitations of our study. First,
a significant H3K9me3 enrichment within the promot- we chose the mouse wire-injury model to study the
er regions of VSMC-specific genes (SMαA, SM22α, therapeutic potential of miR-22 for treating postangio-
SRF, and Myocd), and this enrichment was significantly plasty restenosis, because it partially mimics balloon an-
inhibited by EVI1 knockdown (Figure 6F). Combined gioplasty and intraluminal stent placement, but further

investigation using a stent model would increase the REFERENCES
ORIGINAL RESEARCH
translational feasibility of our current findings. Another 1. Gomez D, Owens GK. Smooth muscle cell phenotypic switching in athero-
limitation is that this model fails to accurately emulate sclerosis. Cardiovasc Res. 2012;95:156–164. doi: 10.1093/cvr/cvs115.
2. Alexander MR, Owens GK. Epigenetic control of smooth muscle cell
ARTICLE
neointima formation attributable to native athero- differentiation and phenotypic switching in vascular development and
sclerosis, a major underlying cause of cardiovascular disease. Annu Rev Physiol. 2012;74:13–40. doi: 10.1146/annurev-physi-
disease. Hence, extending our studies to a hyperlipid- ol-012110-142315.
3. Albinsson S, Sessa WC. Can microRNAs control vascular smooth muscle
emia-induced atherogenic animal model is required to phenotypic modulation and the response to injury? Physiol Genomics.
validate the therapeutic potential of miR-22 in other 2011;43:529–533. doi: 10.1152/physiolgenomics.00146.2010.
cardiovascular diseases. 4. Condorelli G, Latronico MV, Cavarretta E. microRNAs in cardiovascu-
lar diseases: current knowledge and the road ahead. J Am Coll Cardiol.
Taken together, we present in this study compelling 2014;63:2177–2187. doi: 10.1016/j.jacc.2014.01.050.
evidence that miR-22 is a novel regulator of VSMC phe- 5. Quiat D, Olson EN. MicroRNAs in cardiovascular disease: from patho-
notype switching and vascular neointima lesion forma- genesis to prevention and treatment. J Clin Invest. 2013;123:11–18. doi:
10.1172/JCI62876.
tion, which acts via its target genes, MECP2, HDAC4, and 6. Zampetaki A, Mayr M. MicroRNAs in vascular and metabolic disease. Circ
EVI1. Our data have shown for the first time that ectopic Res. 2012;110:508–522. doi: 10.1161/CIRCRESAHA.111.247445.
expression of miR-22 in the injured arteries can reverse 7. Chen J, Yin H, Jiang Y, Radhakrishnan SK, Huang ZP, Li J, Shi Z, Kilsdonk
EP, Gui Y, Wang DZ, Zheng XL. Induction of microRNA-1 by myocardin in
the process of VSMC phenotype switching and prevent smooth muscle cells inhibits cell proliferation. Arterioscler Thromb Vasc
postangioplasty restenosis, supporting a potential role for Biol. 2011;31:368–375. doi: 10.1161/ATVBAHA.110.218149.
miR-22 and its target genes in a variety of proliferative 8. Xu F, Ahmed AS, Kang X, Hu G, Liu F, Zhang W, Zhou J. MicroRNA-
15b/16 attenuates vascular neointima formation by promoting the con-
vascular diseases. These findings may have extensive im- tractile phenotype of vascular smooth muscle through targeting YAP.
plications for the treatment of human atherosclerosis. Arterioscler Thromb Vasc Biol. 2015;35:2145–2152. doi: 10.1161/AT-
VBAHA.115.305748.
9. Ji R, Cheng Y, Yue J, Yang J, Liu X, Chen H, Dean DB, Zhang C. MicroRNA
ARTICLE INFORMATION expression signature and antisense-mediated depletion reveal an essen-
tial role of MicroRNA in vascular neointimal lesion formation. Circ Res.
Received February 8, 2017; accepted December 4, 2017. 2007;100:1579–1588. doi: 10.1161/CIRCRESAHA.106.141986.
The online-only Data Supplement is available with this article at http://circ. 10. Wang M, Li W, Chang GQ, Ye CS, Ou JS, Li XX, Liu Y, Cheang TY, Huang
ahajournals.org/lookup/suppl/doi:10.1161/CIRCULATIONAHA.117.027799/-/ XL, Wang SM. MicroRNA-21 regulates vascular smooth muscle cell func-
DC1. tion via targeting tropomyosin 1 in arteriosclerosis obliterans of lower
extremities. Arterioscler Thromb Vasc Biol. 2011;31:2044–2053. doi:
10.1161/ATVBAHA.111.229559.
Correspondence 11. Yu X, Zhang L, Wen G, Zhao H, Luong LA, Chen Q, Huang Y, Zhu J, Ye S,
Li Zhang, MD, PhD, Department of Cardiology, the First Affiliated Hospital, Xu Q, Wang W, Xiao Q. Upregulated sirtuin 1 by miRNA-34a is required
School of Medicine, Zhejiang University, 79 Qingchun Rd, Hangzhou, 310003, for smooth muscle cell differentiation from pluripotent stem cells. Cell
Zhejiang, China; or Qingzhong Xiao, MD, PhD, Centre for Clinical Pharmacolo- Death Differ. 2015;22:1170–1180. doi: 10.1038/cdd.2014.206.
gy, William Harvey Research Institute, Barts and The London School of Medicine 12. Chen Q, Yang F, Guo M, Wen G, Zhang C, Luong le A, Zhu J, Xiao Q,
and Dentistry, Queen Mary University of London, Heart Centre, Charterhouse Zhang L. miRNA-34a reduces neointima formation through inhibit-
Square, London EC1M 6BQ, United Kingdom. E-mail li_zhang@zju.edu.cn or ing smooth muscle cell proliferation and migration. J Mol Cell Cardiol.
q.xiao@qmul.ac.uk 2015;89(pt A):75–86. doi: 10.1016/j.yjmcc.2015.10.017.
13. Torella D, Iaconetti C, Catalucci D, Ellison GM, Leone A, Waring CD, Bo-
chicchio A, Vicinanza C, Aquila I, Curcio A, Condorelli G, Indolfi C. Mi-
croRNA-133 controls vascular smooth muscle cell phenotypic switch in
Affiliations
vitro and vascular remodeling in vivo. Circ Res. 2011;109:880–893. doi:
Department of Cardiology, The First Affiliated Hospital, School of Medicine, 10.1161/CIRCRESAHA.111.240150.
Zhejiang University, Hangzhou, China (F.Y., Q.C., M.Y., L.Z.). Centre for Clinical 14. Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN, Lee TH,
Pharmacology, William Harvey Research Institute, Barts and The London School Miano JM, Ivey KN, Srivastava D. miR-145 and miR-143 regulate smooth
of Medicine and Dentistry, Queen Mary University of London, United Kingdom muscle cell fate and plasticity. Nature. 2009;460:705–710. doi: 10.1038/
(F.Y., S.H., E.M.M., W.A., T.A.A., L.A.L., Q.X.). Key Laboratory of Cardiovascu- nature08195.
lar Diseases, The Second Affiliated Hospital, School of Basic Medical Sciences, 15. Rangrez AY, Massy ZA, Metzinger-Le Meuth V, Metzinger L. miR-143 and
Guangzhou Medical University, Xinzao Town, Panyu District, China (Q.X.). Key miR-145: molecular keys to switch the phenotype of vascular smooth
Laboratory of Protein Modification and Degradation, School of Basic Medical Sci- muscle cells. Circ Cardiovasc Genet. 2011;4:197–205. doi: 10.1161/CIRC-
ences, Guangzhou Medical University, Xinzao Town, Panyu District, China (Q.X.). GENETICS.110.958702.
16. Xin M, Small EM, Sutherland LB, Qi X, McAnally J, Plato CF, Richardson
JA, Bassel-Duby R, Olson EN. MicroRNAs miR-143 and miR-145 modulate
Sources of Funding cytoskeletal dynamics and responsiveness of smooth muscle cells to injury.
Genes Dev. 2009;23:2166–2178. doi: 10.1101/gad.1842409.
This work was supported by the British Heart Foundation (FS/09/044/28007,
17. Boettger T, Beetz N, Kostin S, Schneider J, Krüger M, Hein L, Braun T.
PG/11/40/28891, PG/13/45/30326, PG/15/11/31279, PG/15/86/31723,
Acquisition of the contractile phenotype by murine arterial smooth
and PG/16/1/31892 to Dr Xiao); the National Natural Science Founda-
muscle cells depends on the Mir143/145 gene cluster. J Clin Invest.
tion of China (91339102, 30900571, 81270001, 81570249, 91539103,
2009;119:2634–2647. doi: 10.1172/JCI38864.
and 81270180); and the Zhejiang Provincial Nature Science Foundation
18. Cheng Y, Liu X, Yang J, Lin Y, Xu DZ, Lu Q, Deitch EA, Huo Y, Delphin ES,
(LR14H020001 and LD18H020001). This work forms part of the research
Zhang C. MicroRNA-145, a novel smooth muscle cell phenotypic marker
portfolio for the National Institute for Health Research Biomedical Research
and modulator, controls vascular neointimal lesion formation. Circ Res.
Center at Barts.
2009;105:158–166. doi: 10.1161/CIRCRESAHA.109.197517.
19. Zhao N, Koenig SN, Trask AJ, Lin CH, Hans CP, Garg V, Lilly B. MicroRNA
miR145 regulates TGFBR2 expression and matrix synthesis in vascular
Disclosures smooth muscle cells. Circ Res. 2015;116:23–34. doi: 10.1161/CIRCRE-
None. SAHA.115.303970.

20. Elia L, Quintavalle M, Zhang J, Contu R, Cossu L, Latronico MV, Peterson etalloproteinase-8 promotes vascular smooth muscle cell proliferation
m
KL, Indolfi C, Catalucci D, Chen J, Courtneidge SA, Condorelli G. The and neointima formation. Arterioscler Thromb Vasc Biol. 2014;34:90–98.
ORIGINAL RESEARCH
knockout of miR-143 and -145 alters smooth muscle cell maintenance doi: 10.1161/ATVBAHA.113.301418.
and vascular homeostasis in mice: correlates with human disease. Cell 38. World Medical Association. World Medical Association Declaration of
ARTICLE
Death Differ. 2009;16:1590–1598. doi: 10.1038/cdd.2009.153. Helsinki: ethical principles for medical research involving human subjects.
21. Sun L, Bai Y, Zhao R, Sun T, Cao R, Wang F, He G, Zhang W, Chen Y, Ye JAMA. 2013;310:2191–2194.
P, Du G. Oncological miR-182-3p, a novel smooth muscle cell phenotype 39. Zhang L, Chen Q, An W, Yang F, Maguire EM, Chen D, Zhang C, Wen
modulator, evidences from model rats and patients. Arterioscler Thromb G, Yang M, Dai B, Luong LA, Zhu J, Xu Q, Xiao Q. Novel pathological
Vasc Biol. 2016;36:1386–1397. doi: 10.1161/ATVBAHA.115.307412. role of hnRNPA1 (heterogeneous nuclear ribonucleoprotein A1) in vas-
22. Afzal TA, Luong LA, Chen D, Zhang C, Yang F, Chen Q, An W, Wilkes E, cular smooth muscle cell function and neointima hyperplasia. Arterio-
Yashiro K, Cutillas PR, Zhang L, Xiao Q. nck associated protein 1 modulat- scler Thromb Vasc Biol. 2017;37:2182–2194. doi: 10.1161/ATVBA-
ed by miRNA-214 determines vascular smooth muscle cell migration, pro- HA.117.310020.
liferation, and neointima hyperplasia. J Am Heart Assoc. 2016;5:e004629. 40. Clarke MC, Talib S, Figg NL, Bennett MR. Vascular smooth muscle cell
23. Liu X, Cheng Y, Zhang S, Lin Y, Yang J, Zhang C. A necessary role of apoptosis induces interleukin-1-directed inflammation: effects of hyperlip-
miR-221 and miR-222 in vascular smooth muscle cell proliferation and idemia-mediated inhibition of phagocytosis. Circ Res. 2010;106:363–372.
neointimal hyperplasia. Circ Res. 2009;104:476–487. doi: 10.1161/CIR- doi: 10.1161/CIRCRESAHA.109.208389.
CRESAHA.108.185363. 41. Clarke MC, Littlewood TD, Figg N, Maguire JJ, Davenport AP, Goddard M,
24. Davis BN, Hilyard AC, Nguyen PH, Lagna G, Hata A. Induction of microR- Bennett MR. Chronic apoptosis of vascular smooth muscle cells acceler-
NA-221 by platelet-derived growth factor signaling is critical for modula- ates atherosclerosis and promotes calcification and medial degeneration.
tion of vascular smooth muscle phenotype. J Biol Chem. 2009;284:3728– Circ Res. 2008;102:1529–1538. doi: 10.1161/CIRCRESAHA.108.175976.
3738. doi: 10.1074/jbc.M808788200. 42. Clarke MC, Figg N, Maguire JJ, Davenport AP, Goddard M, Littlewood TD,
25. Li P, Liu Y, Yi B, Wang G, You X, Zhao X, Summer R, Qin Y, Sun J. MicroR- Bennett MR. Apoptosis of vascular smooth muscle cells induces features
NA-638 is highly expressed in human vascular smooth muscle cells and of plaque vulnerability in atherosclerosis. Nat Med. 2006;12:1075–1080.
inhibits PDGF-BB-induced cell proliferation and migration through target- doi: 10.1038/nm1459.
ing orphan nuclear receptor NOR1. Cardiovasc Res. 2013;99:185–193. 43. Usui T, Morita T, Okada M, Yamawaki H. Histone deacetylase 4 con-
doi: 10.1093/cvr/cvt082. trols neointimal hyperplasia via stimulating proliferation and migration
26. Li P, Zhu N, Yi B, Wang N, Chen M, You X, Zhao X, Solomides CC, of vascular smooth muscle cells. Hypertension. 2014;63:397–403. doi:
Qin Y, Sun J. MicroRNA-663 regulates human vascular smooth muscle 10.1161/HYPERTENSIONAHA.113.01843.
cell phenotypic switch and vascular neointimal formation. Circ Res. 44. Liu R, Jin Y, Tang WH, Qin L, Zhang X, Tellides G, Hwa J, Yu J, Martin KA.
2013;113:1117–1127. doi: 10.1161/CIRCRESAHA.113.301306. Ten-eleven translocation-2 (TET2) is a master regulator of smooth muscle
27. Ling B, Wang GX, Long G, Qiu JH, Hu ZL. Tumor suppressor miR-22 cell plasticity. Circulation. 2013;128:2047–2057. doi: 10.1161/CIRCULA-
suppresses lung cancer cell progression through post-transcriptional TIONAHA.113.002887.
regulation of ErbB3. J Cancer Res Clin Oncol. 2012;138:1355–1361. doi: 45. Chen HZ, Wang F, Gao P, Pei JF, Liu Y, Xu TT, Tang X, Fu WY, Lu J, Yan YF,
10.1007/s00432-012-1194-2. Wang XM, Han L, Zhang ZQ, Zhang R, Zou MH, Liu DP. Age-associated sir-
28. Zhang G, Xia S, Tian H, Liu Z, Zhou T. Clinical significance of miR-22 ex- tuin 1 reduction in vascular smooth muscle links vascular senescence and
pression in patients with colorectal cancer. Med Oncol. 2012;29:3108– inflammation to abdominal aortic aneurysm. Circ Res. 2016;119:1076–
3112. doi: 10.1007/s12032-012-0233-9. 1088. doi: 10.1161/CIRCRESAHA.116.308895.
29. Xu D, Takeshita F, Hino Y, Fukunaga S, Kudo Y, Tamaki A, Matsunaga J, 46. Jentzsch C, Leierseder S, Loyer X, Flohrschütz I, Sassi Y, Hartmann D,
Takahashi RU, Takata T, Shimamoto A, Ochiya T, Tahara H. miR-22 re- Thum T, Laggerbauer B, Engelhardt S. A phenotypic screen to identify
presses cancer progression by inducing cellular senescence. J Cell Biol. hypertrophy-modulating microRNAs in primary cardiomyocytes. J Mol Cell
2011;193:409–424. doi: 10.1083/jcb.201010100. Cardiol. 2012;52:13–20. doi: 10.1016/j.yjmcc.2011.07.010.
30. Gupta SK, Foinquinos A, Thum S, Remke J, Zimmer K, Bauters C, de 47. Gurha P, Wang T, Larimore AH, Sassi Y, Abreu-Goodger C, Ramirez MO,
Groote P, Boon RA, de Windt LJ, Preissl S, Hein L, Batkai S, Pinet F, Thum T. Reddy AK, Engelhardt S, Taffet GE, Wehrens XH, Entman ML, Rodriguez
Preclinical development of a microRNA-based therapy for elderly patients A. microRNA-22 promotes heart failure through coordinate suppres-
with myocardial infarction. J Am Coll Cardiol. 2016;68:1557–1571. doi: sion of PPAR/ERR-nuclear hormone receptor transcription. PLoS One.
10.1016/j.jacc.2016.07.739. 2013;8:e75882. doi: 10.1371/journal.pone.0075882.
31. Jazbutyte V, Fiedler J, Kneitz S, Galuppo P, Just A, Holzmann A, Bauersachs 48. Millette E, Rauch BH, Kenagy RD, Daum G, Clowes AW. Platelet-derived
J, Thum T. MicroRNA-22 increases senescence and activates cardiac fibro- growth factor-BB transactivates the fibroblast growth factor receptor to
blasts in the aging heart. Age (Dordr). 2013;35:747–762. doi: 10.1007/ induce proliferation in human smooth muscle cells. Trends Cardiovasc
s11357-012-9407-9. Med. 2006;16:25–28. doi: 10.1016/j.tcm.2005.11.003.
32. Gurha P, Abreu-Goodger C, Wang T, Ramirez MO, Drumond AL, van Don- 49. Li Y, Huang J, Jiang Z, Zhong Y, Xia M, Wang H, Jiao Y. MicroRNA-145
gen S, Chen Y, Bartonicek N, Enright AJ, Lee B, Kelm RJ Jr, Reddy AK, regulates platelet-derived growth factor-induced human aortic vascular
Taffet GE, Bradley A, Wehrens XH, Entman ML, Rodriguez A. Targeted smooth muscle cell proliferation and migration by targeting CD40. Am J
deletion of microRNA-22 promotes stress-induced cardiac dilation and Transl Res. 2016;8:1813–1825.
contractile dysfunction. Circulation. 2012;125:2751–2761. doi: 10.1161/ 50. Kim S, Kang H. miR-15b induced by platelet-derived growth factor signal-
CIRCULATIONAHA.111.044354. ing is required for vascular smooth muscle cell proliferation. BMB Rep.
33. Huang ZP, Chen J, Seok HY, Zhang Z, Kataoka M, Hu X, Wang DZ. MicroR- 2013;46:550–554.
NA-22 regulates cardiac hypertrophy and remodeling in response to stress. 51. Su A, He S, Tian B, Hu W, Zhang Z. MicroRNA-221 mediates the effects
Circ Res. 2013;112:1234–1243. doi: 10.1161/CIRCRESAHA.112.300682. of PDGF-BB on migration, proliferation, and the epithelial-mesenchymal
34. Zhao H, Wen G, Wen G, Huang Y, Yu X, Chen Q, Afzal TA, Luong le A, transition in pancreatic cancer cells. PLoS One. 2013;8:e71309. doi:
Zhu J, Ye S, Shu Y, Zhang L, Xiao Q. MicroRNA-22 regulates smooth mus- 10.1371/journal.pone.0071309.
cle cell differentiation from stem cells by targeting methyl CpG-binding 52. Elston R, Inman GJ. Crosstalk between p53 and TGF-β Signalling. J Signal
protein 2. Arterioscler Thromb Vasc Biol. 2015;35:918–929. doi: 10.1161/ Transduct. 2012;2012:294097. doi: 10.1155/2012/294097.
ATVBAHA.114.305212. 53. Loayza-Puch F, Drost J, Rooijers K, Lopes R, Elkon R, Agami R. p53 induces
35. Xiao Q, Zeng L, Zhang Z, Margariti A, Ali ZA, Channon KM, Xu Q, Hu transcriptional and translational programs to suppress cell proliferation
Y. Sca-1+ progenitors derived from embryonic stem cells differenti- and growth. Genome Biol. 2013;14:R32. doi: 10.1186/gb-2013-14-
ate into endothelial cells capable of vascular repair after arterial injury. 4-r32.
Arterioscler Thromb Vasc Biol. 2006;26:2244–2251. doi: 10.1161/01. 54. Hinai AA, Valk PJ. Review: Aberrant EVI1 expression in acute myeloid leu-
ATV.0000240251.50215.50. kaemia. Br J Haematol. 2016;172:870–878. doi: 10.1111/bjh.13898.
36. Zeng L, Xiao Q, Margariti A, Zhang Z, Zampetaki A, Patel S, Capogrossi 55. Yuan X, Wang X, Bi K, Jiang G. The role of EVI-1 in normal hematopoiesis
MC, Hu Y, Xu Q. HDAC3 is crucial in shear- and VEGF-induced stem cell and myeloid malignancies (review). Int J Oncol. 2015;47:2028–2036. doi:
differentiation toward endothelial cells. J Cell Biol. 2006;174:1059–1069. 10.3892/ijo.2015.3207.
doi: 10.1083/jcb.200605113. 56. Yoshimi A, Kurokawa M. Evi1 forms a bridge between the epigenetic
37. Xiao Q, Zhang F, Grassia G, Hu Y, Zhang Z, Xing Q, Yin X, Maddaluno machinery and signaling pathways. Oncotarget. 2011;2:575–586. doi:
M, Drung B, Schmidt B, Maffia P, Ialenti A, Mayr M, Xu Q, Ye S. Matrix 10.18632/oncotarget.304.

57. Wieser R. The oncogene and developmental regulator EVI1: expression, a porcine coronary model. Biomed Res Int. 2013;2013:937936. doi:
biochemical properties, and biological functions. Gene. 2007;396:346– 10.1155/2013/937936.
ORIGINAL RESEARCH
357. doi: 10.1016/j.gene.2007.04.012. 61. Yang W, Ge J, Liu H, Zhao K, Liu X, Qu X, Li W, Huang Y, Sun A, Zou Y.
58. Lugthart S, Figueroa ME, Bindels E, Skrabanek L, Valk PJ, Li Y, Meyer Arsenic trioxide eluting stent reduces neointima formation in a rabbit iliac
ARTICLE
S, Erpelinck-Verschueren C, Greally J, Löwenberg B, Melnick A, Del- artery injury model. Cardiovasc Res. 2006;72:483–493. doi: 10.1016/j.
wel R. Aberrant DNA hypermethylation signature in acute myeloid cardiores.2006.08.010.
leukemia directed by EVI1. Blood. 2011;117:234–241. doi: 10.1182/ 62. Shen L, Yang W, Yin JS, Liu XB, Wu YZ, Sun AJ, Qian JY, Ge JB. Nine-
blood-2010-04-281337. month angiographic and two-year clinical follow-up of novel biode-
59. Shackelford D, Kenific C, Blusztajn A, Waxman S, Ren R. Targeted gradable-polymer arsenic trioxide-eluting stent versus durable-polymer
degradation of the AML1/MDS1/EVI1 oncoprotein by arsenic trioxide. sirolimus-eluting stent for coronary artery disease. Chin Med J (Engl).
Cancer Res. 2006;66:11360–11369. doi: 10.1158/0008-5472.CAN-06- 2015;128:768–773. doi: 10.4103/0366-6999.152490.
1774. 63. Zhang S, Zhang Y, Li S, Li Z. Efficacy of arsenic trioxide drug-eluting stents
60. Shen L, Gong F, Tian W, Li W, Zhang F, Qian J, Sun A, Zou Y, Yang W, in the treatment of coronary heart disease. Exp Ther Med. 2017;13:1634–
Ge J. Anti-inflammatory effects of arsenic trioxide eluting stents in 1636. doi: 10.3892/etm.2017.4106.

miR-22 Is a Novel Mediator of Vascular Smooth Muscle Cell Phenotypic Modulation and
Neointima Formation
Feng Yang, Qishan Chen, Shiping He, Mei Yang, Eithne Margaret Maguire, Weiwei An,
Tayyab Adeel Afzal, Le Anh Luong, Li Zhang and Qingzhong Xiao
Circulation. 2018;137:1824-1841; originally published online December 15, 2017;

doi: 10.1161/CIRCULATIONAHA.117.027799
Circulation is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2017 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7322. Online ISSN: 1524-4539
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circ.ahajournals.org/content/137/17/1824
Free via Open Access
Data Supplement (unedited) at:

http://circ.ahajournals.org/content/suppl/2017/12/14/CIRCULATIONAHA.117.027799.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:

http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation is online at:

http://circ.ahajournals.org//subscriptions/
SUPPLEMENTAL MATERIAL
miRNA-22 is a novel mediator of vascular smooth muscle cell phenotypic

modulation and neointima formation
Feng Yang , Qishan Chen1#, Shiping He2, Mei Yang1, Eithne Margaret Maguire2,
1,2#
Weiwei An2, Tayyab Adeel Afzal2, Le Anh Luong2, Li Zhang1* and Qingzhong
Xiao2,3,4*
Supplemental Methods
Materials
Antibodies against MECP2 (rabbit IgG, ab2828) and EVI1 (rabbit, ab28457) were
purchased from Abcam, UK. The antibody against α-tubulin (mouse) and all
secondary antibodies were from Sigma. Other materials used in this study were
purchased from Sigma unless specifically indicated otherwise.
Isolation and culture of thoracic aorta and smooth muscle cell (VSMC)
Thoracic aorta and primary murine VSMCs were isolated from mouse aorta and
routinely maintained in DMEM supplemented with 10% serum (Fetal Bovine Serum,
FBS) as described in our previous study1. Briefly, C57BL/6 mice (25-30 grams;
Charles River Laboratories, UK) were euthanized by CO2, the thoracic aorta was
dissected to remove adhering periadventitial tissue, and the endothelium was denuded
with a catheter. The aortic tissues were either directly harvested for total RNA
extraction (fresh aorta), cultured in DMEM containing 20% serum for 3 days
(cultured aorta), or digested to obtain cultured VSMCs. Specifically, the aortic tissues
were digested with Collagenase I solution (Sigma, 1 mg/ml) for 10 min at 37 °C
followed by removing the adventitial layer, and the medial layer was minced into
small pieces for second digestion with Collagenase I solution for 2 hours at 37 °C.
After filtering with a Cell Strainer (70 µm), single cell digestion solution was
centrifuged to remove the digestion solution. Cells were re-suspended in VSMC
culture medium containing DMEM, 10% FBS, and 1% penicillin/streptomycin-
glutamine and transferred into culture dishes pre-coated with 0.04% gelatin. Every
batch of VSMCs was tested by immunofluorescence staining of smooth muscle cell
(SMC) marker using a SMαA antibody (clone 1A4, 1:400; Sigma) to ensure that the
purity of VSMCs was above 95%. Human aortic SMCs (hAoSMCs) were purchased
from PromoCell GmbH (C-12533) and cultured in SMC growth medium 2
(PromoCell GmbH, C-22062) according to the manufacturer's instructions. Both
murine and human VSMCs between passages 5 (P5) to P8 were treated with various
stimuli as described in our previous studies2, 3. Briefly, for PDGF-BB and serum
stimulation, VSMCs were grown to 80-90% confluence and serum-starved for 24~48
hours (0.5% FBS), followed by incubation with 20% FBS and 10ng/ml PDGF-BB for
3, 6, 12, 24, and 48 hours. For TGF-β1 treatments, VSMCs were serum-starved for
24~48 hours (0.5% FBS), followed by an incubation with 5ng/ml TGF-β1 for 24 or 48
hours.
Real time quantitative PCR (RT-qPCR) for mRNA and microRNAs

1
RT-qPCR was performed as previously described2-6. Briefly, total RNA containing
small RNAs was extracted from murine aortas, or VSMCs using Trizol reagent
(Sigma) according to the manufacturer’s instructions. Total RNA containing small
RNAs was extracted from human arterial specimens using miRCURY™ RNA
Isolation Kits (FFPE) (EXIQON, 300115). RNAs were subjected to DNase I (Sigma)
digestion to remove potential DNA contamination. Reverse transcription for long
RNAs was performed using an Improm-IITM RT kit (Promega, Madison, WI, USA)
with RNase inhibitor (Promega), and Random primers (Promega). The NCode™
VILO™ miRNA cDNA Synthesis Kit (Invitrogen, A11193-051) was used to
synthesise poly (A) tails of all the miRNAs, followed by cDNA synthesis from the
tailed population in a single reaction. The resultant cDNA was diluted to a working
concentration of 5 ng/μl and stored at -20 ºC. NCode™ EXPRESS SYBR®
GreenER™ qPCR SuperMix Universal was used in miRNA RT-qPCR. Relative
mRNA or miRNA expression levels were normalized to 18S or U6 snRNA expression
levels, respectively. Primers were designed using Primer Express software (Applied
Biosystems), and the sequence for each primer was listed in Supplemental Table 1.
miR-22 mimics/inhibitor or siRNA transfection

Either miR-22 mimics, inhibitors, miRNA negative controls (Ctrl), control-scramble
siRNA (si-NT), or MECP2-specific siRNA (si-MECP2) (25 nM, final concentration)
were transfected into VSMCs using TransIT-X2 Transfection Reagent (Geneflow
Limited, UK) according to the manufacturer's instructions. With Cy3™ Dye-Labeled
Pre-miR Negative Control #1 (AM17120, Thermo Fisher Scientific Inc. UK), we
detected over 70% of transfection efficiency for miRNA or siRNA transfection in
VSMCs. All miRNA inhibitors or mimics and respective negative controls were
purchased from Thermo Fisher Scientific Inc., and both control-scrambled siRNA and
gene-specific siRNAs (MECP2 and HDAC4) were purchased from Sigma.
Functional assays for VSMCs

All functional studies to examine the effects of miR-22 and its target genes on
VSMCs’ behaviours were similarly conducted as described in our previous studies1-3
and below.
VSMC proliferation assays
Cell counting
VSMCs were plated (3.5x104 per well) and cultured in 24-well plates pre-coated with
0.04% gelatin as described previously. Cells were allowed to grow to 80-90%
confluence and transfected with miR-22 mimics, miR-22 inhibitor, MECP2 siRNA, or
respective negative controls as indicated in the figures. Transfected cells were
cultured overnight and subjected to serum starvation by culturing them in DMEM
containing 0.5% serum for 24~48 hours. After starvation process, the cells were
treated with 20% serum or PDGF-BB (10 ng/ml) for 48 hours before trypsinizing and
manually counting the cells using a hematocytometer.
BrdU incorporation assay
VSMCs were transfected as described above, and were re-cultured (7.5x103 per well)
in 96-well plates overnight, followed by serum starvation for 24 hours. Starved
VSMCs were re-stimulated with 20% FBS or 10 ng/ml PDGF-BB, respectively, for
2
48 hours. Cell proliferation was evaluated using 5-Bromo-2’-deoxy-uridine (BrdU)
Labeling and Detection Kit II (Roche) according to the manufacturer's instructions.
Briefly, cells were incubated with BrdU at a final concentration of 10 μM for 12 hours
before measurement. After fixation, cellular DNA was digested by nuclease and
labelled with a peroxidase-conjugated BrdU antibody, followed by incubation with
the peroxidase substrate. The absorbance of the samples was measured by a
microplate reader at 405 nm (OD405) with reference measurement at 490 nm
(OD490). Absorbance (A405nm-A490nm) values representing cell proliferation ability
were compared between treatments.
VSMC migration assays

Wound healing (Scratch model)
Scratch wound healing assays were carried out using a previously described method7.
In brief, VSMCs were cultured in 12-well plates and transfected with miR-22 mimics,
miR-22 inhibitor, or respective miRNA negative controls (Ctrl) as described earlier.
Transfected cells were allowed to grow to ~100% confluence and subjected to serum
starvation for 24~48 hrs. After starvation process, the cells were treated with
hydroxyurea (2 mM) to inhibit cell proliferation for 2 hours before subjecting them to
20% FBS or PDGF-BB (10 ng/ml) treatment. The cells were scratched in criss-cross
manner and rinsed with PBS or DMEM three times to remove cell debris, before
cultured in DMEM supplemented with 20% FBS or PDGF-BB (10 ng/ml) in the
presence of 2 mM hydroxyurea. Denuded cell surface area of each wound at 0 hours
(A0) and 24 hours (A24) was obtained by photomicrographic images and measured
with ImageJ software by two experienced investigators who were blinded to the
treatments. The percentages of cell closures (cell closure%) were calculated as (A0-
A24)/A0*100.
Trans-well migration assay

VSMCs were cultured, transfected with miR-22 mimics, miR-22 inhibitor, MECP2
siRNA (si-MECP2), HDAC4 siRNA (si-HDAC4), or respective miRNA negative
controls (Ctrl), and serum-starved as described earlier. Transfected cells were
harvested by trypsinization. An aliquot (250,000 cells/200 µl) of the cells in serum-
free DMEM was dispensed into the trans-well inserts (8 µm pore size, Greiner Bio-
One Ltd, UK. Item number: 662638) pre-coated with 0.5% gelatin (Sigma, G1393),
and DMEM with 20% serum or 30 ng/ml PDGF-BB was placed in the lower chamber.
The trans-well plates were incubated at 37 °C in a 5% CO2 incubator for 12~18
hours. Non-migrated cells in the top insert were carefully removed by cotton swab,
and the migrated cells in the bottom side were stained with Crystal Violet dye. Images
were captured at five fixed locations (right, bottom, left, up, and centre), and migrated
cells were counted by two experienced investigators blinded to the treatments.
Flow cytometry analysis for cell apoptosis

Similar to our previous study2, VSMCs were transfected with miR-22 mimics, miR-
22 inhibitor, or respective negative miRNA controls (Ctrl), and were subjected to
various treatments as indicated. Cells were harvested and subjected to apoptosis
3
analyses using an Annexin V-FITC/PI kit (BMS306F1; Bender MedSystems)
according to the manufacturer’s instructions. After staining, cells were analysed using
a FACSCalibur sorting system (Becton Dickinson). Cells with Annexin V-/propidium
iodide (PI)-, Annexin V+/PI-, Annexin V+/PI+, or Annexin V-/PI+ were counted as live,
early apoptotic, late apoptotic, or dead/necrotic cells, respectively.
Immunoblotting
Cells were harvested and sonicated in lysis buffer containing 50 mM Tris-Cl pH 7.5,
150 mM NaCl, 1 mM EDTA pH 8.0 and supplemented with protease inhibitors and
0.5% Triton. 40 μg of protein from cell lysate was separated by SDS-PAGE with
4%~20% Tris-Glycine gel (Invitrogen, Carlsbad, CA, USA) and subjected to standard
Western blot analysis. Antibody to EVI1 (ab28457, 1:1000, Abcam); α-tubulin
(T6074, 1:4000, Sigma), and MECP2 (ab2828, 1:1000, Abcam) were used to probe
target proteins.
Transient transfection and luciferase assay

Luciferase assay for gene promoter or 3’UTR reporters were conducted as previous
studies2-6. Briefly, for gene promoter activity assays, VSMCs were co-transfected
with individual gene promoters (pGL3-miR-22, pGL3-SMαA, pGL3-SM22α, pGL3-
SMαA-SRFmut, pGL3-SM22α-SRFmut, pGL3-SRF or pGL3-Myocd, the last six gene
reporters were generated in our previous study8) (0.15 μg/2.5x104 cells) and pRenilla
(15 ng/2.5x104 cells) using TransIT-X2 Transfection Reagent (Geneflow Limited,
UK), according to the manufacturer’s instructions. Transfected cells were subjected to
various treatments as indicated in the respective figure legend. Dual-Luciferase
Reporter Assay System was used for detecting luciferase and Renilla activities
according to the protocol provided in the system. Relative luciferase unit (RLU) was
defined as the ratio of Luciferase versus Renilla activity with that of the control (set
as 1.0).
For MECP2 or EVI1 3’UTR reporter activity assays, VSMCs were co-transfected
with individual reporter genes (pmiR-Luc-MECP29, pmiR-Luc-EVI1-WT, pmiR-Luc-
EVI1-mutant, 0.15 μg/2.5x104 cells) and control or miR-22 mimics (25 nM) using
TransIT-X2 Transfection Reagent (Geneflow Limited, UK), according to the
manufacturer’s instructions. pmiR-Luc-β-gal (0.20 μg/2.5x104 cells) was included in
all transfection assays as internal control. Luciferase and β-galactosidase activities
were detected 48 hours after transfection using a standard protocol. Relative
luciferase unit (RLU) was defined as the ratio of Luciferase versus β-galactosidase
activity with that of the control (set as 1.0).
Generation of EVI1 shRNA lentivirus and EVI1 stable knockdown VSMCs

EVI1 shRNA lentiviral particles were produced using MISSION shRNA EVI1
plasmids DNA (SHCLNG-NM_007963, MISSION® shRNA Bacterial Glycerol
Stock, Sigma) according to protocol provided. The shRNA Non-Target control vector
(SHC002) was used as a negative control (sh-NT). Briefly, 293T cells were
transfected with the lentiviral vector and the packaging plasmids, pCMV-dR8.2 and
pCMV-VSV-G (both obtained from Addgene), using TransIT-X2 Transfection
Reagent (Geneflow Limited, UK) according to the manufacturer's instructions. The
4
supernatant containing the lentivirus was harvested 48 hours later, filtered, aliquoted,
and stored at –80 °C. p24 antigen ELISA (Zeptometrix) was used to determine the
viral titre. The Transducing Unit (TU) was calculated using the conversion factor
recommended by the manufacturer (104 physical particles per pg of p24 and 1
transducing unit per 103 physical particles for a VSV-G pseudotyped lentiviral
vector), with 1 pg of p24 antigen converted to 10 Transducing Units (TU). shRNA
lentiviral infection and EVI1 stable knockdown VSMCs generation were performed
as described in our previous studies with some modifications8, 10, 11. Briefly, VSMCs
were plated 24 hours prior to infection in 6-well plates at 37 °C. One TU per cell (or
2-3x105/well) of shRNA or control virus was added with 10 μg/ml of hexadimethrine
bromide (H9268; Sigma). Viral constructs were incubated for 24 hours with the cells
before the media was replaced with complete media containing 4 μg/ml of puromycin
(P9620, Sigma). For selection of transductants, fresh media containing puromycin
was added at 2- to 3-day intervals for 7~10 days. Stably infected cells were split and
frozen for future experiments.
Chromatin immunoprecipitation (ChIP) assays

The ChIP assays were performed as previously described4, 8, 9, 12, 13. Briefly, control
(sh-NT) or EVI1 stable knockdown (sh-EVI1) VSMCs were treated with 1% (v/v)
formaldehyde at room temperature for 10 minutes and then quenched with glycine.
The medium was removed and the cells were harvested and sonicated. The sheared
samples were diluted in 1 ml of immunoprecipitation buffer, and
immunoprecipitation was conducted with antibodies raised against EVI1 (rabbit,
ab28457), H3K9me3 (mouse, 05-1250), or respective IgG controls
(5µg/immunoprecipitation). Immunoprecipitation complexes were pulled down using
protein-G Dynabeads. The immunoprecipitates were eluted from the beads using 50
μl of elution buffer, and immunoprecipitaed DNA was extracted, purified, and then
used to amplify target DNA sequences by RT-qPCR using specific primers (Online
Supplemental Table 1). Promoter DNA enrichment with specific antibodies was
calculated using percent input method with that of the IgG control set as 1.0. PCR
amplification of the adjacent promoter regions (for SRF and Myocd) or regions
lacking SRF binding sites (without CArG region) (for SMαA and SM22α) were
included as an additional control for specific promoter DNA enrichment. The data
was obtained from three to four independent experiments.
Mouse femoral artery denudation injury and perivascular delivery of miR-22

agomiRs or LNA-miR-22
Anesthetized C57BL/6 mice underwent surgical procedure as described previously1, 2,
14, 15
. Wire-induced denudation injury was achieved by removing the endothelium of
the femoral arteries with 3~5 passages of a 0.25 mm angioplasty spring-wire (Tips of
cross-IT 200x guide wire, Abbott Laboratories. Illinois, USA). For perivascular
delivery of miR-22, wire-injured femoral arteries were randomly assigned miR-22 or
Cel-miR-67 agomiRs group and applied with pluronic gel as described in our previous
studies2, 3. Briefly, after wire injury, 100 μl of 30% pluronic gel containing chemically
modified and cholesterol-conjugated 2.5 nmol miR-22 or scrambled (Cel-miR-67)
agomiRs was applied perivascularly to injured femoral arteries. The micrON™
5
miRNA agomiRs were purchased from RiboBio (Guangzhou RiboBio Co., Ltd.,
China); the in vivo expression efficiency and stability of such agomiRs has been
extensively demonstrated by many research groups worldwide16-19.
For miR-22 knockdown experiment, 100 μl of 30% pluronic gel containing vehicle
(mock transfection), control LNA (Scrambled LNA), or LNA-miR-22 per vessel per
mouse was applied perivascularly to injured femoral arteries. Locked nucleic acid
(LNA) modified antisense (LNA-miR-22) and scrambled control oligonucleotide
(Scrambled LNA) were purchased from EXIQON with their corresponding sequences
-5’- CAGTTCTTCAACTGGCAGCT-3’ and -5’-ACGTCTATACGCCCA-3’.
Additional femoral arteries were harvested and dissociated at three (agomiRs) or

seven (LNA-miRNAs) days after injury. Five femoral arteries from each group were
pooled for each independent experiment and triplicate experiments were conducted.
Total RNAs (including small RNAs) were extracted for RT-qPCR of miR-22 and
mRNAs of genes of interest. All animal experiments were performed according to
protocols approved by the Institutional Committee for Use and Care of Laboratory
Animals at Queen Mary University of London, UK.
Morphometric analysis and quantification of neointima formation

The mouse femoral arteries were harvested four weeks after the operation. The
specimens were fixed in 4% formaldehyde and subjected to paraffin embedding and
sectioning processes. Sections (8µm) were collected at 100µm intervals (10 sections
per segment/interval), mounted on slides, and numbered. Six digitised sections with
the same identification number from three segments/intervals (~0.4mm, 0.5mm, and
0.6mm from injury site) of each animal (e.g. IV-1/2, V-1/2, and VI-1/2 represent the
1st and 2nd section of the 4th, 5th and 6th segment/interval, respectively) were stained
with H&E for morphometric analysis. The procedure for lesion quantification was
similar to previous descriptions1-3, 14, 15. Briefly, the area of media and intima on
cross-section of H&E-stained artery segments were automatically measured in pixel-
squared (pixel2) with a computerized image analysis system (Axiovision software) by
two experienced investigators blinded to the treatments.
6
Supplemental References
1. Xiao Q, Zhang F, Grassia G, Hu Y, Zhang Z, Xing Q, Yin X, Maddaluno M,

Drung B, Schmidt B, Maffia P, Ialenti A, Mayr M, Xu Q, Ye S. Matrix
metalloproteinase-8 promotes vascular smooth muscle cell proliferation and
neointima formation. Arteriosclerosis, thrombosis, and vascular biology.
2014;34:90-98
2. Chen Q, Yang F, Guo M, Wen G, Zhang C, Luong le A, Zhu J, Xiao Q, Zhang
L. Mirna-34a reduces neointima formation through inhibiting smooth muscle
cell proliferation and migration. Journal of molecular and cellular cardiology.
2015;89:75-86
3. Afzal TA, Luong LA, Chen D, Zhang C, Yang F, Chen Q, An W, Wilkes E,
Yashiro K, Cutillas PR, Zhang L, Xiao Q. Nck associated protein 1 modulated
by mirna-214 determines vascular smooth muscle cell migration, proliferation,
and neointima hyperplasia. Journal of the American Heart Association. 2016
Dec 7;5(12). pii: e004629.
4. Luo Z, Wen G, Wang G, Pu X, Ye S, Xu Q, Wang W, Xiao Q. Microrna-200c
and -150 play an important role in endothelial cell differentiation and
vasculogenesis by targeting transcription repressor zeb1. Stem Cells.
2013;31:1749-1762
5. Yu X, Zhang L, Wen G, Zhao H, Luong LA, Chen Q, Huang Y, Zhu J, Ye S,
Xu Q, Wang W, Xiao Q. Upregulated sirtuin 1 by mirna-34a is required for
smooth muscle cell differentiation from pluripotent stem cells. Cell Death
Differ. 2015 Jul;22(7):1170-1180.
6. Zhao H, Wen G, Huang Y, Yu X, Chen Q, Afzal TA, Luong LA, Zhu J, Shu
Y, Zhang L, Xiao Q. Microrna-22 regulates smooth muscle cell differentiation
from stem cells by targeting methyl cpg-binding protein 2. Arteriosclerosis,
thrombosis, and vascular biology. 2015 Apr;35(4):918-929.
7. Liang CC, Park AY, Guan JL. In vitro scratch assay: A convenient and
inexpensive method for analysis of cell migration in vitro. Nat Protoc.
2007;2:329-333
8. Huang Y, Lin L, Yu X, Wen G, Pu X, Zhao H, Fang C, Zhu J, Ye S, Zhang L,
Xiao Q. Functional involvements of heterogeneous nuclear ribonucleoprotein
a1 in smooth muscle differentiation from stem cells in vitro and in vivo. Stem
cells. 2013;31:906-917
9. Zhao H, Wen G, Huang Y, Yu X, Chen Q, Afzal TA, Luong le A, Zhu J, Ye S,
Zhang L, Xiao Q. Microrna-22 regulates smooth muscle cell differentiation
from stem cells by targeting methyl cpg-binding protein 2. Arteriosclerosis,
thrombosis, and vascular biology. 2015;35:918-929
10. Xiao Q, Zhang F, Lin L, Fang C, Wen G, Tsai TN, Pu X, Sims D, Zhang Z,
Yin X, Thomaszewski B, Schmidt B, Mayr M, Suzuki K, Xu Q, Ye S.
Functional role of matrix metalloproteinase-8 in stem/progenitor cell
migration and their recruitment into atherosclerotic lesions. Circulation
research. 2013;112:35-47
7
11. Fang C, Wen G, Zhang L, Lin L, Moore A, Wu S, Ye S, Xiao Q. An important
role of matrix metalloproteinase-8 in angiogenesis in vitro and in vivo.
Cardiovascular research. 2013;99:146-155
12. Xiao Q, Pepe AE, Wang G, Luo Z, Zhang L, Zeng L, Zhang Z, Hu Y, Ye S,
Xu Q. Nrf3-pla2g7 interaction plays an essential role in smooth muscle
differentiation from stem cells. Arterioscler Thromb Vasc Biol. 2012;32:730-
744
13. Wang G, Xiao Q, Luo Z, Ye S, Xu Q. Functional impact of heterogeneous
nuclear ribonucleoprotein a2/b1 in smooth muscle differentiation from stem
cells and embryonic arteriogenesis. J Biol Chem. 2012;287:2896-2906
14. Xiao Q, Zeng L, Zhang Z, Margariti A, Ali ZA, Channon KM, Xu Q, Hu Y.
Sca-1+ progenitors derived from embryonic stem cells differentiate into
endothelial cells capable of vascular repair after arterial injury.
Arteriosclerosis, thrombosis, and vascular biology. 2006;26:2244-2251
15. Zeng L, Xiao Q, Margariti A, Zhang Z, Zampetaki A, Patel S, Capogrossi MC,
Hu Y, Xu Q. Hdac3 is crucial in shear- and vegf-induced stem cell
differentiation toward endothelial cells. The Journal of cell biology.
2006;174:1059-1069
16. Cai J, Yang C, Yang Q, Ding H, Jia J, Guo J, Wang J, Wang Z. Deregulation
of let-7e in epithelial ovarian cancer promotes the development of resistance to
cisplatin. Oncogenesis. 2013;2:e75
17. Wang X, Guo B, Li Q, Peng J, Yang Z, Wang A, Li D, Hou Z, Lv K, Kan G,
Cao H, Wu H, Song J, Pan X, Sun Q, Ling S, Li Y, Zhu M, Zhang P, Peng S,
Xie X, Tang T, Hong A, Bian Z, Bai Y, Lu A, He F, Zhang G. Mir-214 targets
atf4 to inhibit bone formation. Nat Med. 2013;19:93-100
18. Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M,
Stoffel M. Silencing of micrornas in vivo with 'antagomirs'. Nature.
2005;438:685-689
19. Trajkovski M, Hausser J, Soutschek J, Bhat B, Akin A, Zavolan M, Heim MH,
Stoffel M. Micrornas 103 and 107 regulate insulin sensitivity. Nature.
2011;474:649-653
8
Supplemental Tables
Supplemental Table 1: Primer sets used in the present study
Gene Forward (5’-3’) Reverse (5’-3’) Application

names
U6 snoRNA miRNA universal reverse primer Real-time RT-PCR
(mus/hu)
gatgacacgcaaattcgtg (Invitrogen, A11193-051)
miR-22 AAGCTGCCAGTTGAAGAACTGT miRNA universal reverse primer Real-time RT-PCR
(mus/hu) (Invitrogen, A11193-051)
18s Real-time RT-PCR
(mus/hu)
aaacggctaccacatccaag cctccaatggatcctcgtta
Pri-miR-22 AAAGGGGCACAAAGCAAGTG CAGGAAAGCTGGGTGACAGG Real-time RT-PCR
(mus)
Pre-miR-22 ACCTGGCTGAGCCGCAGTAG AGGGGCAGAGGGCAACAGTTC Real-time RT-PCR
(mus)
Mus SMαA TCCTGACGCTGAAGTATCCGAT GGCCACACGAAGCTCGTTATAG Real-time RT-PCR
Mus SM22α GAT ATG GCA GCA GTG CAG AG AGT TGG CTG TCT GTG AAG TC Real-time RT-PCR
Mus CNN1 GCGTCACCTCTATGATCCCAA CCCAGACCTGGCTCAAAGAT Real-time RT-PCR
Mus SM- AAG CAG CCA GCA TCA AGG AG AGC TCT GCC ATG TCC TCC AC Real-time RT-PCR
myh11
Mus SMTN- GGGCAGTATCTTCGACCGAG GGCAGACTCTGTGCCTTCAT Real-time RT-PCR
B
Mus GGCTGTGGTAAAACCCGTCCG GGCTTGTCTCTGAGGCCCTGGA Real-time RT-PCR
MECP2
Mus EVI1 GCAGACATTGCGCCTGGGGAA CTCACAGCGGTGCTGCCGTT Real-time RT-PCR
Mus SRF CCTACCAGGTGTCGGAATCTGA TCTGGATTGTGGAGGTGGTACC Real-time RT-PCR
Mus Myocd TCAATGAGAAGATCGCTCTCCG GTCATCCTCAAAGGCGAATGC Real-time RT-PCR
Mus AAGCCAAATCTCCTCCCCCTAT TGATTCACTGATGGCATCGTGT Real-time RT-PCR
MEF2C
Mus PCNA TTGCACGTATATGCCGAGACCT ATTGCCAAGCTCTCCACTTGC Real-time RT-PCR
Mus TET2 CCATCATGTTGTGGGACGGA TCTGAGAACAGCGACGGTTG Real-time RT-PCR
Mus GGAGCCCCAGGACTGTTGA CCTGGCTGTACTTCTGCTAGT Real-time RT-PCR
RAB5B
Mus ATGCTGTGCACAACTCCTGT TCTGGGCTTCCATTCTGGGA Real-time RT-PCR
Trp53inp1
Mus AKT3 GGTGCAGAGTCCCCTAGAGA TTGGCGACAGCAGGATCATT Real-time RT-PCR
Mus SirT1 GCTCGCCTTGCGGTGGACTT GACGGCTGGAACTGTCCGGG Real-time RT-PCR
Mus GTGGGGTCCATTGTTCGAGT TGAACGGTGTCCAGTTCCAG Real-time RT-PCR
ARPC5
Mus PTEN AGCCTCTTGATGTGTGCATT CCATTGGTAGCCAAACGGAAC Real-time RT-PCR
Mus CAGCAACGAGGGGAAGTGTA ATGATGTTGGTACCGCTGGG Real-time RT-PCR
ADAM11
Mus GAGGGCACACGCTAGGAAG CGAACACCAATGTTCGGAGC Real-time RT-PCR
PPARα
Mus CCCAGATAGAGCGGGGACC ACTTCGTCACAGAGGGAAGTC Real-time RT-PCR
Arhgef12
Mus ATCGCCACCATGGATGAACA ACTCTGCCTGTTTGGGTGAC Real-time RT-PCR
MAP3K3
Mus AAGCATTGGCAAAGGTCGGT CGGAACCATGAACGCTCTTCT Real-time RT-PCR
TGFβR1
Mus P21 GGAGGCCCGAGAACGGTGGA CAGCCCTAGGCTCCGAACGC Real-time RT-PCR
Mus KAT5 AGTGGAGGGAGGGAAGATGG CTTTCGGCCACTGATGTCCT Real-time RT-PCR
Mus TTCTGTGAAAAGGCACAAAGTAAG TCTCAGTCTCTCTATGTGTGGGT Real-time RT-PCR
MAP2K4
Mus AGAAGCTCCTGGGATGTAGC TGAGGTGAAAGGTGTCGTGG Real-time RT-PCR
CDC25a
Mus Myst4 CGGGCTGGAGGCGAGGTCTT TGACTGCCAGGCAACGTGGA Real-time RT-PCR
Mus CAAAAGCGAAAAGGCGTGGA CAGATCCAGTTGCGTGACCT Real-time RT-PCR
PDAP1
Mus Sp1 ACAGGGTGCCAATGGCTGGC GCCCACCAGAGACTGTGCGG Real-time RT-PCR
Mus TGCGTCCTGCCTTGGTGCTC GCGCGCTGTCCTGTGTTCCA Real-time RT-PCR
HDAC4
Mus TGGATATTTGGTCCGTGGGC TTCTTCAGAAGCTCAGCCCC Real-time RT-PCR
9
MAPK14
hu SMαA TGAGCGTGGCTATTCCTTCGT GCAGTGGCCATCTCATTTTCAA Real-time RT-PCR
hu SM22α GGCTGAAGAATGGCGTGATT TCTGCTTGAAGACCATGGAGG Real-time RT-PCR
hu SM- GCGTCCATGCCAGATAACACA TACCACATCTCGCCCAACCTT Real-time RT-PCR
myh11
hu SMTN-B TGGAGTCCATGAACGATGTGG TCAATCTCCTGAGCCCGTACAC Real-time RT-PCR
Hu MECP2 ATGTGACATGTGACTCCCCA TTTCTTCCCTGAGCCCTAACA Real-time RT-PCR
Hu EVI1 GGCTAGATTGCTTATTCATAGGGC AATGTACTTGAGCCAGCTTCC Real-time RT-PCR
SMαA CATAACGAGCTGAGCTGCCTC CCAAACAAGGAGCAAAGACG CHIP assay
promoter
SMαA GATCAGAGCAAGGGGCTATA CTACTTACCCTGACAGCGAC CHIP assay
adjacent
SM22α GCAGGTTCCTTTGTCGGGCCA CTGCTTGGCTCACCACCCCG CHIP assay
promoter
SM22α CTTTAAACCCCTCACCCAGC ATGACTTGCACTTACAAGG CHIP assay
adjacent
SRF GGCTGGGCCCTCCCCCATTT TGGCTGGTTTGCTGGTTTGGCA CHIP assay
promoter
SRF adjacent CCCTCTTCTGCCCTGCAGTCCT CCGCGATTCCGTGGGAGGGA CHIP assay
Myocd CCCGCTCACCGCTCCTGATT AGCCGCATCCTAGGCGTTCCT CHIP assay
promoter
Myocd CGGGAGTTGCAAGCCAACCCA TCCCCAGCTTACTGCAGGGCT CHIP assay
adjacent
pmiR-Luc- GACCTG GAGCTC CAGCAG ACGCGT EVI1 3’UTR reporter
EVI1-WT GTTGACCAGAGTGGGACCAAGTCCA AACATCATCGCACAAGCTTGCAGA clone
C
pmiR-Luc- ttgcacagccaa TTTGAAG gctgacttctgg ccagaagtcagc CTTCAAA ttggctgtgcaa miR-22 binding site
EVI1-BSmu mutation
pGL3-miR- GTGGTG GGTACC GTGGTG ACGCGT miR-22 gene
22-Luc TGCCCGAGCTGACCATTTAG GGGTTAGAAATGGGAGGGGC promoter clone
10
Supplemental Table 2: Baseline Patient Characteristics
Healthy femoral Diseased

artery group femoral group
Patient Characteristic P value
(HFA) (DFA)
(n=30) (n=30)
Demographics
Female sex, no. (%) 7 (23.3) 8 (26.7) 0.776‡
Age (years) 55.83  14.05 61.97  14.65 0.103*
Clinical Parameters
Current smoker, no. (%) 5 (16.67) 9 (30) 0.361‡
Former smoker, no. (%) 1 (3.33) 8 (26.67) 0.026‡
BMI, kg/m2 23.04  3.51 21.76  3.62 0.201*
SBP, mmHg 137.9  25.53 122.23  19.11 0.009*
DBP, mmHg 75.87  12.85 74.77  13.05 0.743*
Heart rate, beats per minute 88.67  15.66 84.6  15.05 0.309*
Comorbidities
Prior stroke, no. (%) 1 (3.33) 4 (13.33) 0.353‡
Carotid artery disease, no. (%) 2 (6.67) 2 (6.67) 1‡
Coronary artery disease, no. (%) 1 (3.33) 2 (6.67) 1‡
Hypertension, no. (%) 6 (20) 21 (70) 0.0001‡
Type II diabetes mellitus, no. (%) 0 (0) 12 (40) NA
Hyperlipidaemia, no. (%) 4 (13.33) 22 (73.33) <0.0001‡
Chronic kidney disease, no. (%) 0 (0) 8 (26.67) NA
Medications
Aspirin, no. (%) 1 (3.33) 25 (83.33) <0.0001‡
Statin, no. (%) 0 (0) 21 (70) NA
ACEI/ARB, no. (%) 3 (10) 9 (30) 0.104‡
Beta blockers, no. (%) 0 (0) 6 (20) NA
Clopidogrel, no. (%) 0 (0) 6 (20) NA
Cilostazol, no. (%) 0 (0) 9 (30) NA
Other antihypertensive
3 (10) 17 (56.67) 0.0003‡
medications, no. (%)
Other antithrombotic medications,
2 (6.67) 28 (93.33) <0.0001‡
no. (%)
Laboratory Findings
eGFR, ml/minute 106.01  41.41 84.72  46.88 0.072†
hsCRP, mg/L 58.19  46.55 103.05  55.03 0.0182†
Total cholesterol, mM/L 3.10  1.03 3.715  1.127 0.034*
Triglycerides, mM/L 1.56  1.06 1.253  0.53 0.167*
HDL cholesterol, mM/L 0.79  0.38 0.88  0.36 0.366*
LDL cholesterol, mM/L 1.55  0.88 2.03  0.92 0.0486*
Fasting plasma glucose, mM/L 5.06  0.67 7.62  4.69 0.009*
11
Leukocytes, ×109/L 8.62  3.03 11.91  5.43 0.005†
Hemoglobin, g/L 95.57  27.18 112.33  33.52 0.05*
P value is calculated with t-test (*), Mann-Whitney U Test (†) or Fisher's exact test (‡)
to compare continuous variables (presented as mean  SD) or categorical variables
(presented as no. (%)), respectively.
SMC, smooth muscle cell; SD, standard deviation; BMI, body mass index; SBP,
systolic blood pressure; DBP, diastolic blood pressure; ACEI/ARB, angiotensin-
converting enzyme inhibitor/angiotensin receptor blocker; eGFR, estimated
glomerular filtration rate; hsCRP, high-sensitivity C-reactive protein; HDL, high-
density lipoprotein cholesterol; LDL, low-density lipoprotein cholesterol; NA, not
applicable.
Body mass index was computed as the weight in kilograms divided by the square of
the height in meters.
For the measurement of blood pressure, the patient first rested 5 minutes in a seated
position. Blood pressure was then measured 3 separate times and the mean of the last
2 values was used. A systolic blood pressure ≥140 mmHg, and/or a diastolic blood
pressure ≥90 mmHg was defined as hypertension; moreover, a patient had specific
prescription records of anti-hypertensive drugs or currently taking anti-hypertensive
medications was also defined as hypertension.
Diabetes was defined as a fasting glucose value ≥7.0mM/L or a history of diabetes
medication use.
Prior stroke was defined as an episode of neurological dysfunction caused by focal
cerebral, spinal, or retinal infarction.
Carotid/coronary artery disease was defined as a maximal arterial luminal stenosis
≥70% in the indexed arteries measured by digital subtraction angiography or other
non-invasive methods, such as duplex ultrasound, computed tomography
angiography, or magnetic resonance angiography.
Chronic kidney disease was defined as either kidney damage or a decreased eGFR of
less than 60 mL/min/1.73 m2 for at least 3 months.
Hyperlipidaemia was defined as an abnormally elevated level of at least one lipid or
lipoprotein in the blood (total cholesterol ≥6.2mM/L, triglycerides ≥2.3mM/L, and/or
LDL cholesterol ≥4.1mM/L); An individual with specific prescription records of
lipid-lowering agents or currently taking lipid-lowering medications is also considered
to have hyperlipidaemia.
Medications was self-reported by patients or prescribed by the surgeons.
12
Supplemental Figures and Figure Legends
Supplemental Figure 1. miR-22 controls VSMC marker gene expression.
(A-B) miR-22 over-expression increases while miR-22 inhibition decreases VSMC

marker gene expression. VSMCs were transfected with miR-22 mimics (A), a miR-22
inhibitor (B), or respective control miRNAs (miRNA ctrl), followed by 48 hours of
serum starvation. (C-D) miR-22 over-expression prevents PDGF-BB-induced VSMC
gene repression. VSMCs transfected with miR-22 mimics or control miRNAs
(miRNA ctrl) were subjected to serum starvation for 48 hours, followed by PDGF-BB
(10 ng/ml) stimulation for 6 hours. Total RNAs were harvested and subjected to RT-
qPCR analyses with indicated primers. Data presented here are averaged from three to
four independent experiments (n=3 in A, C, and D; n=4 in B). *P<0.05 (versus
miRNA ctrl), #P<0.05 (versus control treatment).
13
Supplemental Figure 2. miR-22 regulates VSMC growth and migration.
VSMCs were transfected with miR-22 mimics (A-B), a miR-22 inhibitor (C-D), or
respective control miRNAs (miRNA ctrl), followed by 24 hours of serum starvation.
Subsequently, cells were treated with PDGF-BB (10 ng/ml) or 20% serum for a
further 48 hours, followed by cell counting (A and C) and wound-healing assays (B
and D). In wound-healing assays, the percentage of cell closure (%) was calculated as
described in the method section. Data presented here are averaged from three to four
independent experiments (n=3 in A, C, and D; n=4 in B). *P<0.05 (versus miRNA
ctrl), #P<0.05 (versus Ctrl).
14
Supplemental Figure 3. miR-22 modulates VSMC marker gene expression,
proliferation, and migration in human aortic SMCs.
Human aortic SMCs (hAoSMCs) transfected with miR-22 mimics or control miRNAs
(miRNA ctrl) were subjected to serum starvation for 48 hours. Subsequently, cells
were harvested for RT-qPCR to examine gene expression levels (A). RT-qPCR (B),
BrdU incorporation (C) and wound-healing (D) assays were performed to measure the
miR-22 expression level, proliferation and migration of serum-starved hAoSMCs in
response to PDGF-BB (10 ng/mL) or 20% serum stimulation. In wound-healing
assays, the percentage of cell closure (%) was calculated as described in the method
section. Data presented here are averaged from three to five independent experiments
(n=3 in A; n=4 in B, C, and E; n=5 in D and F). *P<0.05 (versus miRNA ctrl),
#
P<0.05 (versus Ctrl).
15
Supplemental Figure 4. miR-22 plays no role in VSMC apoptosis.
VSMCs were transfected with miR-22 mimics (A and C), a miR-22 inhibitor (B and
D), or respective control miRNA (miRNA ctrl) as indicated. Cells were serum-starved
for 48 hours, followed by another 48 hours of serum starvation (A and B) or
incubation with 10µM H2O2 for 8 hours (C and D) to induce apoptosis. Cells were
harvested and subjected to flow cytometry to analyse VSMC apoptosis. Data
presented here are averaged (mean±S.E.M.) from four independent experiments.
16
Supplemental Figure 5. Validated/Predicted miR-22 target gene expression
profiles in VSMCs treated with TGFβ1.
Total RNAs were harvested from VSMCs under normal culture condition (Normal
culture), serum starvation for 48 hours (Serum starvation), or serum starvation for 48
hours followed by a further 24 hours of TGF-β1 (5 ng/ml) stimulation (TGF-β1, 24
hrs). RT-qPCR analyses were performed to examine the expression levels of
validated/predicted target genes of miR-22. Data presented here are averaged from
three independent experiments (n=3). *P<0.05 (versus normal culture), #P<0.05
(versus serum starvation).
17
Supplemental Figure 6. Role of MECP2, a target gene of miR-22, in VSMC
phenotypic modulation.
(A-B) miR-22 over-expression represses MECP2 in VSMCs. VSMCs were

transfected with miR-22 mimics or control miRNAs (miRNA ctrl), respectively. Total
RNAs and proteins were harvested and subjected to RT-qPCR (A) and Western blot
(B) analyses, respectively. (C) miR-22 over-expression inhibits MECP2 3’UTR
reporter activity. VSMCs were co-transfected with MECP2 3’UTR reporter (pmiR-
Luc-MECP2) and miR-22 mimics or control miRNAs (miRNA ctrl), respectively.
Cell lysate were harvested and subjected to luciferase activity assays. (D-F) MECP2
inhibition recapitulates the effects of miR-22 over-expression on VSMC specific gene
expression, proliferation, and migration. VSMCs transfected with control (non-target
siRNA, [si-NT]) or MECP2 specific siRNAs (si-MECP2) were subjected to serum
starvation for 48 hours. Cells were harvested for RT-qPCR to measure gene
18
expression (D). BrdU incorporation (E) and trans-well migration (F) assays were
performed to measure the proliferation and migration of transfected and serum-
starved cells in response to 20% serum or PDGF-BB stimulation. The concentration
of PDGF-BB was 10 mg/mL and 30 mg/mL for BrdU incorporation and trans-well
migration assays, respectively. Note: very few or zero migrated cells were observed
without cell chemoattractant in trans-well migration assays; thus, control is not
shown. Data presented here are averaged from three independent experiments (n=3).
*P<0.05 (versus miRNA ctrl or si-NT), #P<0.05 (versus Ctrl).
19
Supplemental Figure 7. Role of HDAC4 in VSMC phenotypic modulation.
(A) miR-22 over-expression represses HDAC4 in VSMCs. VSMCs were transfected

with miR-22 mimics or control miRNAs (miRNA ctrl), respectively. Total RNAs
were harvested and subjected to RT-qPCR analyses. (B-D) HDAC4 inhibition
recapitulates the effects of miR-22 over-expression on VSMC specific gene
expression, proliferation, and migration. VSMCs transfected with control (non-target
siRNA, [si-NT]) or HDAC4 siRNAs (si-HDAC4) were subjected to serum starvation
for 48 hours. Cells were harvested for RT-qPCR to measure gene expression (B).
BrdU incorporation (C) and trans-well migration (D) assays were performed to
measure the proliferation and migration of transfected and serum-starved cells in
response to 20% serum or PDGF-BB stimulation. The concentration of PDGF-BB
was 10 mg/mL and 30 mg/mL for BrdU incorporation and trans-well migration
assays, respectively. Note: very few or zero migrated cells were observed without cell
chemoattractant in trans-well migration assays; thus, control is not shown. Data
presented here are averaged from three independent experiments (n=3). *P<0.05
(versus miRNA ctrl or si-NT), #P<0.05 (versus Ctrl).
20
Supplemental Figure 8. EVI1 repression is required for miR-22 mediated VSMC
phenotypic modulation.
(A) Control (sh-EVI1-) and EVI1 stable knockdown (sh-EVI1+) VSMCs were
transfected with miR-22 inhibitor (miR-22 inhibitor+) or control miRNA inhibitor
(miR-22 inhibitor-) as indicated. Transfected cells were serum-starved for 48 hours
and subjected to RT-qPCR analyses for gene expression. (B&C) Control (sh-EVI1-)
and EVI1 stable knockdown (sh-EVI1+) VSMCs were transfected with miR-22
inhibitor (miR-22 inhibitor+) or control miRNA inhibitor (miR-22 inhibitor-).
Subsequently, transfected cells were subjected to serum starvation for 48 hours,
followed by BrdU incorporation assays (B) or trans-well migration (C) in response to
Ctrl (0% serum), 20% serum or PDGF-BB stimulation. The concentration of PDGF-
BB was 10 mg/mL and 30 mg/mL for BrdU incorporation and trans-well migration
assays, respectively. Note: very few or zero migrated cells were observed without cell
chemoattractant in trans-well migration assays; thus, control is not shown. Data
presented here are averaged (mean±S.E.M.) from three independent experiments.
*P<0.05 (versus miR-22 inhibitor-, sh-EVI1-); #P<0.05 (miR-22 inhibitor+, sh-
EVI1+ versus miR-22 inhibitor+, sh-EVI1-).
21
Supplemental Figure 9. Expression profiles of miR-22 and target genes in the
healthy and diseased human arteries.
Healthy femoral artery specimens (HFA, n=30) from patients without peripheral
arterial diseases and diseased femoral artery specimens (DFA, n=30) from patients
with peripheral arterial diseases were collected and subjected to RT-qPCR analyses.
Spearman's rank correlation analyses were carried out to characterize the relationships
between the gene expression levels of MECP2/ EVI1 and miR-22 in HFA and DFA
specimens. Y-axis represents expression level of miR-22 (relative to U6, %); X-axis
represents the expression level of its target genes (MECP2 and EVI1) (relative to
18S, ‰). The solid line indicates the fitted linear regression line; the dotted line
indicates 95% CI level. R is Pearson’s correlation coefficient between the expression
levels of MECP2/EVI1 and miR-22. A value closer to -1 indicates a stronger negative
correlation, and a value closer to 1 indicates a stronger positive correlation. P is the P-
value indicating the significant level of correlation.
22

1824 Full

Hochgeladen von

Dokumentinformationen

Originaltitel

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

1824 Full

Hochgeladen von

Copyright:

Verfügbare Formate

Circulation

ORIGINAL RESEARCH ARTICLE

miR-22 Is a Novel Mediator of Vascular

Editorial, see p 1842 Feng Yang, MD*

1824 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

miR-22, originally proposed to act as a tumor sup-

• Our findings on the miR-22–EVI1 and miR-22–

MECP2 signaling axes in vascular smooth muscle

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1825

1826 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Figure 1. miR-22 expression is closely modulated during VSMC phenotype switching.

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1827

dent mechanism. grate was observed in VSMCs transfected with the

1828 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Figure 2. miR-22 is transcriptionally regulated in VSMC phenotypic modulation.

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1829

Figure 3. miR-22 modulates VSMC proliferation and migration.

1830 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

pression through a transcriptional mechanism requiring

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1831

Figure 4. EVI1 is the novel target of miR-22 in VSMCs.

1832 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1833

Figure 6. EVI1 functions as a transcriptional repressor for VSMC gene expression.

1834 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1835

1836 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

also the first to identify an inverse relationship between

Transcriptional Regulation of miR-22

vascular endothelial cells and platelets at the vascular

Figure 8 Continued. MECP2 (relative to 18S, ‰) and EVI1

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1837

sion of miR-22 was significantly decreased, whereas

1838 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

investigation using a stent model would increase the REFERENCES

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1839

1840 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1841

Circulation. 2018;137:1824-1841; originally published online December 15, 2017;

Data Supplement (unedited) at:

Reprints: Information about reprints can be found online at:

Subscriptions: Information about subscribing to Circulation is online at:

miRNA-22 is a novel mediator of vascular smooth muscle cell phenotypic

Real time quantitative PCR (RT-qPCR) for mRNA and microRNAs

miR-22 mimics/inhibitor or siRNA transfection

Functional assays for VSMCs

VSMC migration assays

Trans-well migration assay

Flow cytometry analysis for cell apoptosis

Transient transfection and luciferase assay

Generation of EVI1 shRNA lentivirus and EVI1 stable knockdown VSMCs

Chromatin immunoprecipitation (ChIP) assays

Mouse femoral artery denudation injury and perivascular delivery of miR-22

Additional femoral arteries were harvested and dissociated at three (agomiRs) or

Morphometric analysis and quantification of neointima formation

1. Xiao Q, Zhang F, Grassia G, Hu Y, Zhang Z, Xing Q, Yin X, Maddaluno M,

Supplemental Table 1: Primer sets used in the present study

Gene Forward (5’-3’) Reverse (5’-3’) Application

Healthy femoral Diseased

(A-B) miR-22 over-expression increases while miR-22 inhibition decreases VSMC

(A-B) miR-22 over-expression represses MECP2 in VSMCs. VSMCs were

(A) miR-22 over-expression represses HDAC4 in VSMCs. VSMCs were transfected

Das könnte Ihnen auch gefallen

1824 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1825

1826 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1827

1828 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1829

1830 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1831

1832 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1833

1834 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1835

1836 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1837

1838 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1839

1840 April 24, 2018 Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799

Circulation. 2018;137:1824–1841. DOI: 10.1161/CIRCULATIONAHA.117.027799 April 24, 2018 1841