Journal of Microbiological Methods 82 (2010) 19–27

Contents lists available at ScienceDirect

Journal of Microbiological Methods

j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j m i c m e t h

A novel selective growth medium-PCR assay to isolate and detect Sphingomonas in

environmental samples
Mi-Sung Yim a,b, Yvonne C.W. Yau c, Anne Matlow d,e, Jae-Seong So b, Jitao Zou f, Cecily A. Flemming g,
Heidi Schraft a, Kam Tin Leung a,⁎
a
Depertment of Biology Lakehead University, 955 Oliver Road, Thunder Bay, Ontario, Canada P7B 5E1
b
Division of Biological and Chemical Engineering, College of Engineering, Inha University, Incheon, 402-751, South Korea
c
Division of Microbiology, Department of Pediatric Laboratory Medicine, The Hospital for Sick Children, Toronto, Ontario, Canada M5G 1X8
d
Infection Prevention & Control Programme, The Hospital for Sick Children, Toronto, Ontario, Canada M5G 1X8
e
Department of Pediatrics, and Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada M5S 1A8
f
NRC Plant Biotechnology Institute, 110 Gymnasium Place, Saskatoon, Saskatchewan, Canada S7N 0W9
g
Standards Development Branch, Ontario Ministry of the Environment, 40 St. Clair Ave. W. 7th Floor, Toronto, Ontario, Canada M4V 1M2

a r t i c l e i n f o a b s t r a c t

Article history: Sphingomonas species can be found ubiquitously in the environment and can be frequently found in surface
Received 15 February 2010 biofilms. Some Sphingomonas strains are well known for metabolizing complex organic pollutants but some are
Received in revised form 17 March 2010 opportunistic human pathogens. Despite the importance of the Sphingomonas species, a reliable system to
Accepted 17 March 2010
isolate this group of bacteria from the environment has not been developed. In this study, a combined
Available online 30 March 2010
streptomycin–piperacillin selective growth medium/polymerase chain reaction (PCR) detection approach is
Keywords:
developed to isolate and identify the Sphingomonas bacteria. A total of 72 known Sphingomonas strains
PCR detection of Sphingomonas (including 21 different Sphingomonas species type strains) and 14 non-Sphingomonas species were tested
Serine palmitoyltransferase gene using a new Sphingomonas-specific growth medium containing 100 and 50 µg/ml streptomycin and
Sphingomonas selective growth medium piperacillin, respectively. All the Sphingomonas strains showed positive growth on the selective medium
Streptomycin and no growth was shown by the non-Sphingomonas species. In addition, two sets of PCR primers targeting the
Piperacillin serine palmitoyltransferase gene (spt), a crucial sphingolipid biosynthesis gene, were developed. With the
Biofilms exception of the Sphingomonas subarctica type strain, 71 of the 72 known Sphingomonas samples were
amplified positively by either one or both of the spt-specific primers. None of the non-Sphingomonas bacteria
were amplified by the spt primers. To verify the effectiveness of this novel approach for use in environmental
screening applications the Sphingomonas selective medium was used to isolate 165 potential Sphingomonas
isolates, including 101 yellow, 4 orange and 58 unpigmented isolates, from the influent water and biofilm
samples of a pulp and paper mill in Northwestern Ontario. Screening of these isolates with the two
Sphingomonas spt–PCR primer sets showed that 98% of the yellow isolates and 100% of the orange isolates were
positive to the spt–PCR test. None of the unpigmented isolates was positive to the spt–PCR assay. The 16S rDNA
of 17% of the spt + ve and − ve isolates were sequenced and analyzed. All of the yellow and orange pigmented
isolates were Sphingomonas while none of the unpigmented isolates were Sphingomonas. REP-PCR was
performed on 79 Sphingomonas samples randomly selected from the paper mill and hospital isolates and
showed that a diverse group of Sphingomonas can be grown or isolated by our Sphingomonas selective growth
medium. Therefore, by using the streptomycin–piperacillin selective growth medium in combination with the
colour pigmentation and the positive spt–PCR reactions of the isolates, a diverse population of Sphingomonas
strains can be isolated and identified from complex microbial communities with high accuracy.
© 2010 Elsevier B.V. All rights reserved.

1. Introduction
Members of the genus Sphingomonas are widely distributed in soil,
fresh water and marine water environments (Gilewicz et al., 1997;
⁎ Corresponding author. Tel.: + 1 807 343 8265; fax: + 1 807 346 7796.
E-mail address: ktleung@lakeheadu.ca (K.T. Leung).
White et al., 1996). They have also been found in treated surface
waters, potable water distribution systems and biofilms associated with
potable water (Flemming et al., 2004; Gauthier et al., 1999; Kelley et al.,
2004; Perola et al., 2002). Sphingomonads are gram-negative aerobic
bacteria, and with the exception of a few bacterial species (such as
Zymomonas mobilis and Gluconobacter oxydans), they differ from other
gram-negative bacteria by having glycosphingolipids on their outer
membrane and do not contain lipopolysaccharides (White et al., 1996).

0167-7012/$ – see front matter © 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.mimet.2010.03.012
20 M.-S. Yim et al. / Journal of Microbiological Methods 82 (2010) 19–27

Table 1
Minimal inhibitory concentrations (MICs) of streptomycin and piperacillin on various Sphingomonas and non-Sphingomonas species.

Strains tested MIC in liquid L9 + 1% Growth on L9 + 1% glucose + 1% glutamate agar media with Source
glucose + 1% glutamate
(μg ml− 1) with

Sm Pip 200 μg ml− 1 Sm + 100 μg ml− 1 Sm + 50 μg ml− 1 Sm +

50 μg ml− 1 Pip 50 μg ml− 1 Pip 50 μg ml− 1 Pip

Sphingomonas strainsa (28 )

Sphingomonas capsulate N400b N 400 + + + LMG 2830
Sphingomonas chlorophenolica N400 N 400 + + + LMG 17544
Sphingomonas paucimobilis N400 N 400 + + + LMG 1227
Sphingomonas subterranea N400 N 400 + + + DSM 12447
Sphingomonas ursincola N100 to ≤150 N 50 to ≤ 100 − + + DSM 6383
Sphingomonas xenophaga N400 N 50 to ≤ 100 + + + LMG 17331
Sphingomonas adhaesiva N400 N 400 + + + LMG 10922
Sphingomonas sanguinis N400 N 400 + + + DSM 13885
Sphingomonas subarctica N400 N 400 + + + LMG 17731
Sphingomonas suberifaciens N400 N 400 + + + LMG 9832
Sphingomonas sp. SPH1 N100 to ≤150 N 50 to ≤ 100 − + + clinical
Sphingomonas sp. SPH2 N150 to ≤200 N 400 + + + clinical
Sphingomonas sp. SPH3 N400 N 400 + + + clinical
Sphingomonas sp. SPH4 N400 N 400 + + + clinical
Sphingomonas sp. SPH5 N400 N 400 + + + clinical
Sphingomonas sp. SPH6 N400 N 400 + + + clinical
Sphingomonas sp. SPH7 N400 N 400 + + + clinical
Sphingomonas sp. SPH9 N400 N 400 + + + clinical
Sphingomonas sp. SPH16 N100 to ≤150 N 50 to ≤ 100 − + + Hos. Env.
Sphingomonas sp. SPH18 N400 N 400 + + + clinical
Sphingomonas sp. SPH19 N100 to ≤150 N 50 to ≤ 100 − + + Hos. Env.
Sphingomonas sp. SPH28 N400 N 400 + + + Hos. Env.
Sphingomonas sp. SPH33-1 N400 N 400 + + + Hos. Env.
Sphingomonas sp. SPH33-2 N400 N 400 + + + Hos. Env.
Sphingomonas sp. SPH37 N400 N 150 to ≤200 + + + Hos. Env.
Sphingomonas sp. SPH38 N100 to ≤150 N 400 − + + clinical
Sphingomonas sp. SPH39 N400 N 150 to ≤200 + + + clinical
Sphingomonas sp. SPH40 N400 N 400 + + + clinical

Non-Sphingomonas strains (14)

Chryseobacterium sp.
Pseudomonas sp.
Enterococcus faecalis
Bacillus subtilis
Escherichia coli
Serratia marcescens
Klebsiella pneumoniae
Alcaligenes faecalis
Pseudomonas fluorescens
Streptococcus latics
Staphylococcus aureus
Salmonella typhimurium
Zymomonas mobilis
Gluconobacter oxydans 621H
N50 to ≤100 N 50 to ≤ 100 − − + Hos. Env.
N50 to ≤100 N 50 to ≤ 100 − − + Hos. Env.
N0 to ≤50 N 0 to ≤50 − − − ATCC 29212
N0 to ≤50 N 0 to ≤50 − − − ATCC 6633
N0 to ≤50 N 0 to ≤50 − − − ATCC 25922
N0 to ≤50 N 0 to ≤50 − − − ATCC 8100
N0 to ≤50 N 0 to ≤50 − − − ATCC 13883
N0 to ≤50 N 0 to ≤50 − − − ATCC 35655
N0 to ≤50 N 0 to ≤50 − − − ATCC 49838
N0 to ≤50 N 0 to ≤50 − − − ATCC 11454
N0 to ≤50 N 0 to ≤50 − − − ATCC 25923
N0 to ≤50 N 0 to ≤50 − − − ATCC 14028
N0 to ≤50 N 0 to ≤50 − − − DSM 424
N0 to ≤50 N 0 to ≤50 − − − DSM 3503

Hos. Env. = hospital environment isolate; clinical = clinical isolate.

+, growth/positive amplification.
−, no growth/negative amplification.
a
All Sphingomonas stains are yellow pigmented.
b
400 μg ml− 1 is highest concentration used for antibiotics.

Many Sphingomonas strains possess unique abilities in degrading
refractory organic pollutants, such as dibenzo-p-dioxin and dibenzo-
furan (Wittich et al., 1992), carbofuran (Feng et al., 1997), hexachlor-
ocyclohexane (Imai et al., 1991), chlorinated biphenyls (Taira et al.,
1988), polychlorophenols (Karlson et al., 1996; Leung et al., 1997;
Nohynek et al., 1996), 2,4-dichlorophenoxyacetic acid (Ka et al., 1994),
dehydroabietic acid (Mohn, 1995) and simple aromatic and polyaro-
matic hydrocarbons (Fredrickson et al., 1991; Khan et al., 1996). Be-
cause of their metabolic diversity, pollutant-degrading Sphingomonas
strains are potential microbial agents for bioremediation (White et al.,
1996).
Despite its potential as a bioremediation agent, some Sphingomonas
species (e.g., Sphingomonas paucimobilis, S. parapaucimobilis and
S. yanoikuyae) can be opportunistic pathogens causing nosocomial
infections such as bacteremia (Casadevall and Pirofski, 1992; Reina
et al., 1991), catheter-related sepsis (Salazar et al., 1995), meningitis
(Hajiroussou et al., 1979), peritonitis (Baddour et al., 1985), cutaneous
infections (Peel et al., 1979), diarrheal diseases and tracheal infections
(Lemaitre et al., 1996). Because of the bacteria's ability to survive in
low nutrient conditions, oligotrophic niches such as hospital tap water
supply systems (Perola et al., 2002), reverse osmosis systems (Oie
et al., 1998), dialysate (Oie et al., 2003), atomizer units of pediatric cool
mist tents (Dale and Williams 1986) and ventilators (Lemaitre et al.,
1996) have been implicated as sources of infection. Furthermore,
Sphingomonas strains have even been identified in the flight potable
water supply and humidity condensate samples on board of the
International Space Station (Castro et al., 2004).
Another undesirable property of Sphingomonas is that the bacteria
are capable of forming biofilms that can cause metal corrosion of
plumbing systems and biofouling of drinking water and industrial water
distribution systems (Vaisanen et al., 1998). The biofilm-forming
property of the Sphingomonas species may explain their ability to
 M.-S. Yim et al. / Journal of Microbiological Methods 82 (2010) 19–27 21

Table 2
Sphingomonas antibiotic selective growth medium and spt-PCR assays on various Sphingomonas and non-Sphingomonas bacteria.

Strain or isolate Growth on L9–glucose– PCR amplification by primers Reference/origin

(no. of strain/isolate) glutamate+100 μg ml−1
Sph-spt 295f/Sph-spt 713r Sph-spt 694f/Sph-spt 983r Either or both primer sets
Sm+50 μg ml−1 Pip

Type species (21)

Sphingomonas capsulata
Sphingomonas chlorophenolica
Sphingomonas paucimobilis
Sphingomonas terrae
Sphingomonas yanoikuyae
Sphingomonas subterranea
Sphingomonas stygia
Sphingomonas chungbukensis
Sphingomonas natatoria
Sphingomonas ursincola
Sphingomonas xenophaga
Sphingomonas asaccharolytica
Sphingomonas macrogolitabida
Sphingomonas mali
Sphingomonas adhaesiva
Sphingomonas pruni
Sphingomonas rosa
Sphingomonas sanguinis
Sphingomonas subarctica
Sphingomonas suberifaciens
Sphingomonas trueperi
Clinical isolates (27)
Hospital environmental isolates (20)
Paper mill biofilm isolates (4)
Total Sphingomonas isolates tested (72)a
Non-Sphingomonas species (14)b
+ − + + LMG 2830
+ + + + LMG 17544
+ + + + LMG 1227
+ + + + LMG 10924
+ + − + LMG 3925
+ − + + DSM 12447
+ + + + DSM 12445
+ + − + DSM 16638
+ + + + DSM 3183
+ − + + DSM 9006
+ + + + DSM 6383
+ + + + LMG 17539
+ + + + DSM 8826
+ + + + LMG 17331
+ + − + LMG 10922
+ + + + LMG 18380
+ − + + LMG 17328
+ + + + DSM 13885
+ − − − LMG 17731
+ + + + LMG 9832
+ + + + LMG 2142
100.00( 27) 100.00 (27) 96.30 (26) 100.00 (27)
100.00 (20) 70.00(14) 90.00 (18) 100.00 (20)
100.00 (4) 100.00 (4) 100.00 (4) 100.00 (4)
100.00 (72) 84.72 (61) 90.28 (65) 98.61 (71)
0.00 (14) 0.00 (14) 0.00 (14) 0.00 (14)

+, Growth/positive amplification.
−, No growth/negative amplification.
a
All Sphingomonas are yellow pigmented.
b
The 14 non-Sphingomonas species in this Table are the same as those presented in Table 1.

survive in chlorinated municipal and industrial water (such as pulp and
paper mill processing water) distribution systems (Flemming et al.,
2004; Koskinen et al., 2000). As a result, both municipal and industrial
water systems can be vulnerable to contamination by this group of
bacteria.
Antimicrobial treatments using chlorinated or brominated biocides
are often required in the pulp and paper industry to reduce the buildup
of slimes (i.e., biofilms) on the paper machines. Outbreaks of slime on
critical surface areas of the paper machine, such as the mixing tanks
and headbox, as well as the former and press sections of the paper
machine, can release large amount of clumped organic debris (flocs)
into the processing water (i.e., white water) causing blockage of wire
screens and felts. These defects and breaks in the paper web will
adversely affect sheet properties and machine operation leading to
production down time and reduced product quality (Flemming et al.,
2001). Although some Sphingomonas strains in the pulp and paper
effluents are able to breakdown resin acids (a major group of
pollutants in pulp and paper mill effluents) and other organic
pollutants (Mohn, 1995), other Sphingomonas strains can be major
biofilm formers on paper machines and in white water (Flemming
et al., 2004; Tian et al., 2007). In order to study the roles of
Sphingomonas in biofouling and to monitor the growth dynamics of
this group of bacteria, a comprehensive approach in isolating and
detecting the Sphingomonas bacteria is necessary.
The current strategies for in situ detection of Sphingomonas
are based on DNA probes or PCR assays targeting specific sequence
(s) of the 16S rDNA of Sphingomonas (Leung et al., 1999, Leys et al.,
2004; Neef et al., 1999). However, most of these 16S rDNA targeting
probes and PCR primers are not very efficient in distinguishing some
α-proteobacteria, such as Zymomonas, Porphyrobacter, Erythrobacter
and Erythrobacterium that are phylogenetically related to the genus
Sphingomonas.
Despite the important roles of Sphingomonas species in bioreme-
diation, and as a potential cause of nosocomial infections and
biofouling, selective growth medium for this group of bacteria is not
commercially available. Vanbroekhoven et al. (2004) developed a
streptomycin-based Sphingomonas growth medium, but it is only
partially selective for Sphingomonas in soil environments. In this
study, the effectiveness of a combined streptomycin and piperacillin
based growth medium for Sphingomonas was examined. In addition,
novel PCR primer sets targeting a Sphingomonas specific sphingolipid
synthesis gene (serine palmitoyltransferase gene, spt) were devel-
oped. The streptomycin–piperacillin selective medium/spt-PCR de-
tection system was tested to verify its effectiveness in isolating
Sphingomonas from pulp and paper mill biofilm and influent water
samples. The genomic diversity of Sphingomonas strains isolated by
the streptomycin–piperacillin selective medium was further exam-
ined by PCR DNA fingerprinting.
2. Materials and methods
2.1. Bacterial strains
Seventy-two known Sphingomonas isolates (21 Sphingomonas
species type strains and 27 clinical, 20 hospital environmental and
four previously isolated paper mill biofilm Sphingomonas isolates) and
14 non-Sphingomonas strains were used to test the suitability of the
combined streptomycin–piperacillin selective growth medium/spt-
PCR detection system in growing and identifying Sphingomonas
species (Tables 1 and 2). The clinical and hospital Sphingomonas
isolates were isolated at the Hospital for Sick Children, Toronto,
Ontario, Canada from patients suspected of bacterial infection or
colonization, and from hospital environments such as sinks, faucets
and ice machines, respectively. The Sphingomonas species type strains
22 M.-S. Yim et al. / Journal of Microbiological Methods 82 (2010) 19–27

were obtained from the German Collection of Microorganisms and

–3′
–3′
-3′

-3′

-3′
-3′

-3′

-3′
-3′
-3′
-3′
-3′
-3′
-3′
–
–
Cell Cultures (DSMZ) and the Belgian Coordinated Collections of

–
–
–
T
T
T
T

G
Microorganisms (BCCM/LMG). All bacterial strains were routinely

C
C
–
–
–
–

–
C

C
–
–
–
–

–
grown at 30 °C on Tryptic Soy Agar (TSA) or in Tryptic Soy Broth (TSB)

–
–
–
–
–
–
–
(Becton Dickinson Sparks, USA), and kept in 25 % glycerol at −80 °C
A

–
–
–
–
–
–
–

–
–
–
–
–
–
–
for long-term storage.
G

C
–
–
–
–

–
–

A
–
–
–

–
–
C

–
–
–

–
T

A
2.2. Antibiotic selective growth medium

C
–
–
–
–
–

–
A

–
–
–
–
–
–
–

–
–
–
–
–

–
T
The Sphingomonas basal medium was composed of the L9 minimal
G

C
–
–
–
–

C
–
–
–

–
–
T
salt medium supplemented with 1% each of glucose and sodium
G

C
–
–
–
–
–

–
–
–
–
–
–
–
T
glutamate (w/v) as organic carbon and nitrogen source, respectively.
G
G
G
C

–
–
–
–

–
–
–
–
–
–
–
The L9 minimal salt medium was composed of (per liter) 8.8 g
T
G

A
C
–
–
–

–
–

Na2HPO4·2H2O, 3.0 g KH2PO4, 1.0 g NH4Cl, 0.5 g NaCl, 0.2 g MgSO4

–
–
–
–
–
–
–
T

and 2.5 ml of a trace element solution. The trace element stock

A

–
–
–
–
–
–
–

G
G
A

–
–

–
–
solution contained (per liter) 23 mg MnCl2·2H2O, 30 mg MnCl4·H2O,
A

–
–
–
–
–
–
–

C
C
–
–
–
–
–
31 mg H 3 BO 3 , 36 mg CoCl 2 ·6H 2 O, 10 mg CuCl 2 ·2H 2 O, 20 mg
G

A
–
–
–

NiCl2·6H2O, 30 mg Na2MoO4·2H2O, and 50 mg ZnCl2. The final pH

A
C

–
–
–

–
T
T
G

–
–
–
–

–
T

of the growth medium was adjusted to 7.0 (Bastiaens et al., 2000).

C

C
–
–
–
–
–
–
C

–
–
–
–

–
T

In order to determine the optimal concentration of streptomycin

A

–
–
–
–
–
–
–

(Fisher Scientific, Nepean, Ontario, Canada) and piperacillin (Sigma

G

C
–
–
–
–

A
–
–
–

–
–
–

Life Science, St. Louis, Missouri, USA) for the Sphingomonas selective
Sph-spt 713r

–
–
–
–
–
–
–

Sph–spt 983r

–
–
–
–
–
–
–

growth medium, antibiotic susceptibility tests at 0, 50, 150, 200, 300,

–
–
–
–
–
–
–
T

400 µg ml− 1 were performed on 28 known Sphingomonas and 14

C

–
–
–
–
–
–
–
5′-

5′-
5′-
5′-
5′-
5′-
5′-
5′-

non-Sphingomonas strains using the L9–glucose–glutamate medium

5′-

5′-
5′-
5′-
5′-
5′-
5′-
5′-

(Table 1).
-3′

-3′
-3′
-3′
-3′
-3′
-3′
-3′

The bacterial strains used for the antibiotic susceptibility test were
-3′

-3′
-3′
-3′
-3′
-3′
-3′
-3′
G

cultured at 30 °C overnight and the cell cultures were diluted to an

–
–
–
–
–

–
-

optical density600 nm of 0.1 (approximately 1 × 108 CFU ml− 1). Ten-μl

G
C

–
–
–
–

–
T
–
–
–
–
–
–
–
T

aliquot samples were inoculated in the wells of a 96-well multititer plate

G

A
–
–
–
–

–
–
G

–
–
–
–
–
–
–

containing 190 μl of L9–glucose–glutamate liquid medium with

Alignments of the Sph-spt primers with spt gene fragments of some spt-positive Sphingomonas and non-Sphingomonas species.

A
C

–
–
–
–

–
–
G
G
G
G
C

–
–
–

appropriate concentration of either streptomycin or piperacillin. After

C

–
–
–

–
T

T
T
–
–
–
–
–
–
–
T

incubation at 30 °C for two days, cell growth of the sample cultures was
–
–
–
–
–
–
–
T

determined by the OD600 nm of the samples using a BMG Labtech

G
A

C
C

C
–
–
–

microplate reader (FluoStar OPTIMA, Fisher Scientific, Nepean, Ontario,

–
–
–
–
–
–
–
T
G

C
C
C
C
–
–
–

Canada). Once the minimal inhibitory concentrations (MICs) of the

C

–
–
–
–
–

–
T
A
A

A
C

–
–
–

two individual antibiotics were determined, the 28 different Sphingo-

G

C
C

C
–
–
–

–
G

A
A

A
–
–
–

monas strains and 14 non-Sphingomonas isolates from the various

G

G
A
C

–
–
–

clinical, hospital and culture collection sources were tested again for
C

–
–
–
–
–

–
T

their ability to grow on the Sphingomonas selective agar medium

–
–
–
–
–
–
–
A
–
–

–
–
–
–
T

containing three different combinations of streptomycin and piper-

G
–
–
–
–

–
–
T
–
–
–
–
–
–
–
T

acillin (in µg/ml): 50 and 50, 100 and 50, and 200 and 50, respectively
G

A
A
–
–
–

–
G
C

–
–
–
–

–
T

(Table 1). In this assay, a single colony of a Sphingomonas or non-

C

–
–
–
–
–
–
–
C

–
–
–
–
–
–
–

Sphingomonas culture was streaked on the three Sphingomonas selective

–
–
–
–
–
–
–
T

growth medium agar plates. The samples were incubated at 30 °C for

C

–
–
–
–
–
–
–

two days and the growth of the bacteria was recorded.

G
A
–
–
–
–
–
–
–
T

–
–
–
–

–
–
Primer sequences

–
–
–
–
–
–
–

A
A
A
–
–
–

2.3. Novel Sphingomonas-specific spt–PCR primers

Sph-spt 295f

Sph–spt 694f
G

–
–
–
–
–
–
–

–
–
–
–
–
–
–
C

–
–
–
–
–

–
T

Two Sphingomonas genus-specific primer sets were designed by

–
–
–
–
–
–
–

aligning the serine palmitoyltransferase gene (spt) sequences of

5′-

5′-
5′-
5′-
5′-
5′-
5′-
5′-

5′-

5′-
5′-
5′-
5′-
5′-
5′-
5′-

several Sphingomonas strains and other sphingolipid-containing α-

Zymomonas mobilis subsp. mobilis ZM4 (AE008692)

Zymomonas mobilis subsp. mobilis ZM4 (AE008692)

proteobacteria (Table 3). The spt sequences were retrieved from the
GenBank database and aligned by using the DNAMAN version 4.1
Erythrobacter litoralis HTCC2594 (CP000157)

Erythrobacter litoralis HTCC2594 (CP000157)

Sphingopyxis alaskensis RB2256 (CP000356)

Sphingopyxis alaskensis RB2256 (CP000356)

Program (Lynnon BioSoft, Pointe-Claire, Quebec, Canada) and the

Sphingomonas chungbukensis (DQ002568)

Sphingomonas chungbukensis (DQ002568)

Gluconobacter oxydans 621H (CP000009)

Gluconobacter oxydans 621H (CP000009)

Sphingomonas wittichii RW1 (CP000699)

Sphingomonas wittichii RW1 (CP000699)

Sphingomonas paucimobilis (AB055142)

Sphingomonas paucimobilis (AB055142)

ClustalW software (http://www.ebi.ac.uk/tools/ClustalW2/index.

html). Two spt primer sets were designed based on two conserved
regions identified in the Sphingomonas spt genes. The first set of the
Sphingomonas spt specific primers was Sph-spt 295f (forward, 5′-CG
Organism (accession no.)

ATCCCTTCGCGATCGTG) and Sph-spt 713r (reverse, 5′-TGGCGGAAGC

GGACGATC) and the second specific primer set contained Sph-spt 694f
(forward, 5′-GAGATCGTCCGCTTCCGC) and Sph-spt 983r (reverse 5′-
CCGACCGATTTGGAGAAG). The first and the second Sph-spt primer
sets targeted the Sphingomonas spt gene producing a 408 and 289 bp
Table 3

DNA fragments, respectively. The two sets of Sphingomonas spt specific

PCR primers were tested on 72 known Sphingomonas bacterial samples
 M.-S. Yim et al. / Journal of Microbiological Methods 82 (2010) 19–27
Fig. 1. Results of the spt-PCR assays. (A) The 408-bp spt-PCR products amplified by the
Sph-spt 295f and Sph-spt 713r primer set. (B) The 298-bp spt-PCR products amplified by
the Sph-spt 694f and Sph-spt 983r primer set. PCR amplifications were performed on
the genomic DNA extracts of: 1, Sphingomonas paucimobilis LMG1227; 2, Sphingomonas
SPH2 (clinical); 3, Sphingomonas SPH37 (hospital environment); 4, Sphingomonas
FO201 (paper machine, former section); 5, Sphingomonas PO301 (paper machine, press
section); 6, Sphingomonas 78A01 (paper mill influent); 7, blank lane; 8, Pseudomonas sp.
strain (see Table 1); 9, Alcaligenes faecalis ATCC 35655; 10, Staphylococcus aureus ATCC
25923; 11, Escherichia coli ATCC 25922; and M, 100-bp DNA ladder marker.
and 14 non-Sphingomonas species (Table 2). Prior to PCR assays,
genomic DNAs from the Sphingomonas and non-Sphingomonas
bacterial samples were extracted using the InstaGene DNA extraction
kit (Bio-Rad Laboratories, Mississauga, ON, Canada). Three ml of each
cell culture (at OD600 nm 1.0) were harvested by centrifugation at
10,000 rpm (9300 × g) for 5 min. The cell pellet was washed twice with
sterile saline, suspended in 200 μl of InstaGene matrix, incubated
sequentially at 56 °C (30 min) and 100 °C (8 min) and centrifuged at
15,000 rpm (21,000 ×g) for 2 min. One μl of the DNA extract was used
in a 25-μl spt-PCR assay. The PCR mixture contained 0.2 mM of each
dNTPs, 2.5 mM MgCl2, 1×PCR buffer, 1.0 U Taq DNA polymerase and
1.0 μM of each primer. The PCR assay was programmed with an initial
denaturation at 94 °C for 5 min, followed by 30 cycles consisting of
94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min. A final extension
was performed at 72 °C for 3 min to complete the amplification. The
PCR products were analyzed by electrophoresis in 1% agarose gels
containing TAE (40 mM Tris–HCl, 20 mM acetic acid and 1 mM EDTA)
and ethidium bromide (1 μg ml− 1).
2.4. Isolation and identification of Sphingomonas from paper mill
samples
To validate the effectiveness of the streptomycin–piperacillin selective
growth medium in isolating Sphingomonas species from environment
samples, biofilms and influent water samples were collected from the
Abitibi Bowater Pulp and Paper Mill in Thunder Bay, Ontario, Canada and
screened with the Sphingomonas selective growth medium. Biofilm
samples were collected from the surfaces of the forming table and the
press sections of a paper machine in December 2005, and January and
February 2006. The paper machine makes uncoated newsprint under acid
conditions (pH 5.5). However, the pH of the biofilm samples was
consistently at about 6.5. In addition, the temperatures of the paper
furnish at the former and the press sections of the paper machine were
about 50 and 45 °C, respectively.
23
Half a gram of each biofilm sample was suspended in 1 mL of sterile
PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 2 mM KH2PO4 pH
7.2), followed by vigorous vortexing for 1 min to disrupt the biofilms. A
10× dilution series on each biofilm sample was prepared in PBS and one
hundred μl portions of each dilution was spread-plated on the L9–
glucose–glutamate agar containing 100 µg ml− 1 of streptomycin and
50 µg ml− 1 of piperacillin. The plates were incubated at 30 °C for 2 days.
Bacterial colonies developed on the Sphingomonas selective agar
medium (both pigmented and un-pigmented) were randomly selected
and isolated. A total of 70 and 45 bacterial isolates were collected from
the former and the press sections, respectively. The water supply of
the pulp and paper mill is taken from the Kaministiquia River, Thunder
Bay, Ontario, a river that empties into the western end of Lake Superior.
The untreated influent water samples in this study were collected at
the water supply station of the pulp and paper mill in April, May and
June of 2006. The influent water samples were diluted and spread-
plated on the Sphingomonas antibiotic selective agar medium and 48
potential Sphingomonas isolates were isolated. All the potential
Sphingomonas isolates collected from the biofilm and influent samples
were stored in a sterile 25% glycerol (v/v) solution at −80 °C until
further study.
Two approaches were used to confirm the identity of the potential
Sphingomonas isolates. First, both of the pigmented and the non-
pigmented isolates were screened with the two sets of Sphingomonas
specific spt-PCR primers (i.e., Sph-spt 295f and Sph-spt 713r and Sph-spt
694f and Sph-spt 983r). The DNA extraction and PCR protocols were
described earlier in the Sphingomonas spt primers section. Second, 17%
(17/103) of those isolates which tested positive to one or both of the
Sphingomonas specific PCR primer sets and 17% (10/60) of the spt-PCR
negative isolates (including one representative out of the two yellow
pigmented isolates that were spt-PCR negative) were randomly chosen
for 16S rDNA sequencing.
For 16S rDNA sequencing, total genomic DNA was extracted using
a Wizard® SV Genomic DNA Purification System (Promega Corpora-
tion, Madison, WI, USA) as described by the manufacturer. Briefly,
cells were suspended in 600 μl of Nuclei Lysis Solution and lysed at
80 °C for 5 min. Next, 200 μl of protein precipitation solution was
added, followed by centrifugation at 15,000 rpm (21,000 ×g) for
10 min. DNA was then precipitated with isopropanol, centrifuged for
10 min at 15,000 rpm (21,000 × g), washed with cold 70% (v/v)
ethanol, and dried in the air. The dried DNA was resuspended in 50 μl
of sterile ddH2O. One μl of DNA was added in the PCR mixture
contained 0.2 mM of each dNTPs, 2.5 mM MgCl2, 1×PCR buffer, 1.0 U
Taq DNA polymerase and 1.0 μM of each primer of 16S-27f (5′-
AGAGTTTGATCCTGGCTCAG) and 16S-1492r (5′-TACGGGTACCTTGT-
TACGACTT) for 16S rDNA amplification. The PCR was programmed
with an initial denaturation at 94 °C for 5 min, followed by 30 cycles
consisting of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min 30 s.
A final extension was performed at 72 °C for 5 min to complete the
amplification. The 16S rDNA amplicons were purified and sequenced
by a DNA sequencing company, Macrogen Inc., Seoul, Korea. The 16S
rDNA sequences were aligned with published sequences from the
GenBank database using NCBI BLAST comparison software.
2.5. REP-PCR fingerprinting of Sphingomonas isolates
REP-PCR fingerprints of 80 Sphingomonas representatives were
analyzed, including 20 clinical isolates, 20 hospital environmental
isolates, 19 biofilm isolates (from both former and press sections), 20
influent isolates and 1 Sphingomonas type strain (S. paucimobilis LMG
1227). Genomic DNA for the REP-PCR reaction was extracted with the
Bio-Rad InstaGene matrix buffer (5% of Chelex resin, 0.2% SDS,
100 mM Tris-HCl, 50 mM EDTA) as described earlier in the Sphingo-
monas spt primers section. The REP-PCR reaction mixture was
prepared by mixing 3 μl (or 50 ng) of the chromosomal DNA extract,
2.0 mM of dNTPs, 2.5 mM MgCl2, 1 unit of Taq DNA polymerase, 1×
24 M.-S. Yim et al. / Journal of Microbiological Methods 82 (2010) 19–27

Table 4
Verification of the combined Sphingomonas selective growth medium and spt–PCR assay in isolating Sphingomonas from pulp and paper mill samples.

Source (number Selective media Specific PCR detection

of isolates)
%of yellow isolates/ %of orange isolates/ % of unpigmented isolates/ % of positive/yellow % of positive/orange % of positive/unpigmented
total (number of total (number of total (number of isolates (number of isolates (number of isolates (number of
isolates/total) isolates/total) isolates/total) isolates/total) isolates/total) isolates/total)

Former section (70) 75.71 (53/70) 2.86 (2/70) 21.43 (15/70) 98.11 (52/53) 100.00 (2/2) 0.00 (0/15)
Press section (45) 42.22 (19/45) 4.44 (2/45) 53.33 (24/45) 94.74 (18/19)d 100.00 (2/2) 0.00 (0/24)
Influent water (48) 60.42 (29/48) 0.00 (0/48) 39.58 (19/48) 100.00 (29/29) NR 0.00 (0/19)
total (163) 61.96 (101/163) 2.45 (4/163) 35.58 (58/163) 98.02 (99/101)a 100.00 (4/4)b 0.00 (0/58)c

NR, not relevance.

a
13 representatives out of 99 yellow pigmented spt–PCR positive isolates were sequenced and identified as Sphingomonas by analysis of 16S rDNA sequences.
b
4 representatives out of 4 orange pigmented spt–PCR positive isolates were sequenced and identified as Sphingomonas by analysis of 16S rDNA sequences.
c
9 representatives out of 58 unpigmented spt–PCR negative isolates were sequenced and identified as Agrobacterium–like bacteria by analysis of 16S rDNA sequences.
d
1 representative out of 2 yellow pigmented spt–PCR negative isolates was sequenced and identified as Sphingomonas by analysis of 16S rDNA sequences.

PCR buffer and 1.0 μM of each REP-PCR primer, REPIR-I (5′-
IIIICGICGICATCIGGC-3′) and REP2-1 (5′-ICGICTTATCIGGCCTAC-3′)
(Bruijin, 1992). The REP-PCR assay was performed with 1 cycle of
denaturation at 95 °C for 6 min, 30 cycles at 94 °C for 1 min, 40 °C for
1 min and 65 °C for 8 min; and one final cycle at 65 °C for 16 min. The
REP-PCR products were separated by agarose (2.0 %) gel electropho-
resis in a 1× TAE buffer at 100 V for 50 min.
The DNA band patterns from REP-PCR assay were analyzed by the
Fingerprinting II Informatix™ software (Bio-Rad laboratories,
Canada). DNA bands were identified by an automatic bands
assignment mode of the software. Occasionally, dirt stuck on the
agarose gel was mistakenly identified as a band by the machine and it
was corrected manually. The position of bands of each gel image was
normalized by a 1-kb DNA ladder (Fermentas Canada Inc., Burlington,
Ontario, Canada) as an external reference standard. Pearson coeffi-
cient and UPGMA were used to construct a dendrogram for
Sphingomonas isolates.
3. Results and discussion
3.1. Antibiotic selective growth medium
Two approaches have typically been used to isolate Sphingomonas
from the environment. The first approach is based on the fact that many
Sphingomonas strains are capable of metabolizing complex organic
compounds for growth, such as hexachlorocyclohexane, chlorpyrifos,
pentachlorophenol and other polycyclic aromatic hydrocarbons. Using
these complex organic compounds as sole carbon sources of enrichment
growth media, many Sphingomonas strains have been isolated from the
environment (Fredrickson et al., 1995; Leung et al., 1997, Bastiaens et al.,
2000, Vanbroekhoven et al., 2004, Xia et al., 2005, Li et al., 2007,
Manickam et al., 2008). However, this approach fails to isolate
Sphingomonas that do not possess the ability of metabolize these
complex organic compounds. An alternative isolation approach, based on
the intrinsic streptomycin resistance of Sphingomonas, was developed by
Vanbroekhoven et al (2004). However, the streptomycin selective
medium (containing 200 μg ml− 1 streptomycin) did not inhibit growth
of some α-proteobacteria (e.g. Rhizobium radiobacter VM1167 and
VM1168) and some Sphingomonas-related bacterial species such as
Erythrobacter litoralis DSM8509T and Zymomonas mobilis LMG448T
(Vanbroekhoven et al., 2004).
Recently, it has been reported that Sphingomonas isolates from
marine environments have high tolerance to piperacillin (Lai et al.,
2004). Unlike streptomycin, which targets the 30 S ribosomal RNA of
bacteria, piperacillin is a β-lactam antibiotic that inhibits bacterial cell
wall formation. In this study, the minimal inhibitory concentrations
(MICs) of streptomycin and piperacillin were determined on 28
Sphingomonas and 14 non-Sphingomonas strains (Table 1). For strep-
tomycin, MICs of 22 out of the 28 isolates were N400 µg ml− 1 and
the rest of the isolates tested had MICs between 100–200 µg ml− 1.
For piperacillin, 21 of the 28 strains had a MIC N400 µg ml− 1 and
the rest of the isolates had MICs ranged from 100–200 µg ml− 1. On
the other hand, 86% of the non-Sphingomonas strains had MICs of
streptomycin and piperacillin ≤50 µg ml− 1. The Pseudomonas and
Chryseobacterium strains had higher resistance to the two antibiotics
with MICs between 50–100 µg ml− 1 (Table 1).
Based on the MICs of streptomycin and piperacillin of the
Sphingomonas strains, selective growth agar media containing the
L9–glucose–glutamate basal medium supplemented with three
combinations of different concentrations of the two antibiotics were
tested (Table 1). All the tested Sphingomonas strains were resistant to
the selective growth agar media containing 50 µg ml− 1 of each
streptomycin and piperacillin, and they managed to grow even when
the concentration of streptomycin was increased to 100 µg ml− 1.
However, the growth of some Sphingomonas strains was inhibited
when the concentration of streptomycin was 200 µg ml− 1. Therefore,
the optimized antibiotic Sphingomonas selective medium contained
100 µg ml− 1 streptomycin and 50 µg ml− 1 piperacillin. Because
piperacillin has a synergic effect on the antimicrobial activity of
streptomycin on bacteria (Fuursted, 1988), the combined streptomycin–
piperacillin Sphingomonas selective medium was more effective than
the streptomycin selective medium alone. For instance, Zymomonas
mobilis was resistant to the streptomycin medium (Vanbroekhoven
et al., 2004) but was susceptible to the streptomycin–piperacillin
amended Sphingomonas selective medium (Table 1).
To further verify the effectiveness of the optimized Sphingomonas
selective medium, an extra 11 different Sphingomonas type strains and
as well as 15 clinical, 14 hospital and 4 known paper mill Sphingomonas
isolates were tested on the optimized selective medium. All of the
known Sphingomonas strains showed positive growth on the selective
medium and none of the 14 non-Sphingomonas species were able to
grow on the Sphingomonas selective agar medium (Table 2). In addition,
it was observed that all the Sphingomonas strains tested were pigmented
on the streptomycin–piperacillin Sphingomonas selective agar medium
after two days of growth at 30 °C.
3.2. Sphingomonas-specific spt gene primer sets
The 16S rDNA is one of the most commonly used genetic markers for
designing genus- or species-specific PCR primers to detect various

Fig. 2. UPGMA clustering of the Sphingomonas isolates (C, clinical; HE, hospital environment; BP-F, paper mill biofilm from former section; BP-P, paper mill biofilm from press
section; I, influent water; and T, Sphingomonas paucimobilis LMG 1227) based on the REP-PCR fingerprints of the samples. The Pearson similarity coefficients of the samples are used
in constructing the dendrogram.
M.-S. Yim et al. / Journal of Microbiological Methods 82 (2010) 19–27 25
26 M.-S. Yim et al. / Journal of Microbiological Methods 82 (2010) 19–27
bacterial groups including Sphingomonas species (Hastings et al., 1997;
Marchesi et al., 1998; Leung et al., 1999; Leys et al., 2004). However, one
major disadvantage of using the 16S rDNA as a genetic marker to detect
Sphingomonas is the high rate of false positive reactions. For example, Leys
et al. (2004) showed that their Sphingomonas 16S rDNA specific PCR
primers cross-reacted with some α-proteobacteria, such as Zymomonas,
Porphyrobacter, Erythrobacter and Erythrobacterium strains.
The serine palmitoyltransferase gene (spt) is a key gene in the
sphingolipid biosynthesis pathway (Ikushiro et al., 2003). Because all
Sphingomonas strains possess sphingolipids on their outer membranes
and the sphingolipd membrane structure is a unique phenotype
distinguishing Sphingomonas from other bacteria, it can serve as a specific
biomarker for Sphingomonas. In this study, two sets of Sphingomonas spt
specific PCR primers were designed to identify the Sphingomonas species.
To our knowledge, this is the first study to use the spt as a genetic marker
to detect Sphingomonas. To design the Sphingomonas specific primers,
sequences of the spt genes from Sphingomonas and other related bacterial
strains were compared. Nucleotides at positions 295–313 and 713–730 on
the spt were chosen to be the first sets of Sphingomonas-specific primers,
with Sph-spt 295f and Sph-spt 713r as forward and reverse PCR primer,
respectively. The region for second Sphingomonas-specific primer set were
located at nucleotide positions 694–711 (forward, Sph-spt 694f) and 983–
1000 (reverse, Sph-spt 983r). The spt primer sequences chosen were
either identical or with only one nucleotide difference among the available
Sphingomonas spt genes. However, they were different from the spt genes
of other non-Sphingomonas species by four to nine mismatches (Table 3).
To verify these primer sets, 72 known Sphingomonas isolates
(including 21 different Sphingomonas species type strains) and 14 non-
Sphingomonas species were screened with these primers (Tables 2).
Positive amplification by both the Sph-spt 295f/Sph-spt 713r primer set
and the Sph-spt 694f/Sph-spt 983r primer set produced amplicons of
408 bp and 289 bp, respectively (Fig. 1). The first primer set (Sph-spt 295f
and 713r) produced positive amplification with the Sphingomonas type
strains, clinical, hospital environment, and paper mill biofilm isolates in
76%, 100%, 70% and 100% of the isolates, respectively (Table 2). For the
second primer set (Sph-spt 694f and 983r), it showed 81%, 96%, 90%, and
100% positive amplification to the Sphingomonas type strain, clinical,
hospital environment and paper mill biofilm isolates, respectively
(Table 2). However, when the results of the two primer sets of were
combined, 99% of the known Sphingomonas strains showed strong
positive amplification to either one or both of the spt prime sets. Also,
none of non-Sphingomonas species was positive to the spt primer sets
(Table 2). Unlike other Sphingomonas species, the S. subarctica LMG17731
strain reacted negatively to the spt primer sets. Since this Sphingomonas
strain was isolated from a subarctic area in Finland (Nohynek et al., 1996),
it is not clear if the bacterium has evolved to modify its sphingolipid
membrane to adapt to the cold environment. Unfortunately, information
on the evolution of sphingolipids and the spt gene is limited. The
specificity of the spt primers will be improved when more information
about the Sphingomonas spt is available.
3.3. Isolation of Sphingomonas from pulp and paper mill environments
Sphingomonas is a bacterial agent that causes biofilms and
biofouling in pulp and paper mills (Vaisanen et al., 1998; Flemming
et al., 2004), and in other water systems, such as household and
hospital potable water environments (Kelley et al., 2004; Perola et al.,
2002; Gauthier et al., 1999). Biofilm and influent water samples
collected from the Abitibi Bowater pulp and paper mill (Thunder Bay,
Ontario, Canada) were spread onto the Sphingomonas selective agar
medium. After incubation for two days, 163 isolates were randomly
picked from the selective agar medium. The isolates were categorized
into three groups based on colony colour, including yellow (62%),
orange (2%) and unpigmented (36%) isolates (Table 4). The yellow
pigmented isolates were the major group of bacteria cultured from
both the influent and biofilm samples. The percentages of the yellow
pigmented strains isolated from the influent water and the former
section of the paper machine were 60.4 and 75.7%, respectively. A
lower percentage of yellow isolates (42.2%) was isolated from the
press section of the machine (Table 4). This shift in composition of the
Sphingomonas community was expected because of the differences in
temperature, pH and humidity of these sampling areas.
The pulp and paper mill isolates were then screened with the two
Sphingomonas spt primer sets. Strong positive amplifications by one
or both spt primer sets were seen on all the four orange isolates and
99 out of the 101 yellow pigmented isolates (Table 4). On the other
hand, none of the unpigmented isolates (0 out of 58) showed positive
amplification with any of the spt primer sets (Table 4).
Based on the results of the spt–PCR assay, it was only the pigmented
isolates that were Sphingomonas while the unpigmented isolates were
background bacteria that were naturally resistant to both streptomycin
and piperacillin. In order to confirm our findings, the 16S rDNA of 27
representative isolates were sequenced and analyzed, including 13
yellow isolates, four orange isolates, nine un-pigmented isolates, and
one yellow isolate from the two yellow isolates that were negative to
both the spt primer sets. The sequencing data showed that all the yellow
(including the spt negative isolates) and orange pigmented isolates
were 99–100% similar to 16S rDNA sequences of known Sphingomonas
species in the GenBank DNA sequence database. The unpigmented
isolates that showed negative amplification with spt-primers were
identified as Agrobacterium-like bacteria, with 98–99% similarity to
Agrobacterium species. The 16S rDNA sequences of the 18 pulp and
paper mill Sphingomonas isolates were deposited in the GenBank with
accession numbers GQ849282-GQ849299. The GenBank accession
numbers of the 16S rDNA of the nine Agrobacterium-like isolates are
GQ849300-GQ849308. Therefore, the streptomycin–piperacillin medi-
um is only semi-selective to Sphingomonas species. However, by
combining the production of yellow or orange pigment with the
positive PCR reactions of the two spt specific primer sets, Sphingomonas
strains can be isolated and identified with extremely high accuracy.
3.4. Diversity of Sphingomonas isolates
To ensure the Sphingomonas selective medium was suitable for
selecting a genetically diverse group of Sphingomonas, REP-PCR was
performed on 79 Sphingomonas isolates randomly selected from the
Sphingomonas collection isolated from the influent water, paper mill
biofilm (former and press sections of the paper machine), hospital
environment and clinical samples. In addition, a Sphingomonas paucimo-
bilis type strain (LMG 1227) was also included in the analysis. The REP-
PCR assay produced a total of 338 distinct REP-PCR DNA bands (ranging of
0.1 to 3.5 kb) on the 80 Sphingomonas samples (Fig. 2). A cluster analysis
on the REP-PCR fingerprints showed a huge genetic diversity between the
Sphingomonas isolates. The isolates were grouped into eight clusters (A–
H). The similarity coefficients between the clusters ranged from 12 to 42%.
Within the individual clusters, the isolates were 28 to 100% similar to each
other (Fig. 2). Both the biofilm (from former and press sections) and
influent isolates were spread among Clusters A, B, C, D, E, F and G,
indicating a high degree of diversity among these two groups of
Sphingomonas isolates. The hospital environmental isolates were also
very diverse and were distributed among Clusters A, B, D, E and F. The
clinical Sphingomonas isolates showed the highest degree of similarity.
Despite the fact that some clinical isolates fell into Clusters C and D, the
majority (80%) of the isolates were exclusively grouped under Cluster H.
4. Conclusions
The streptomycin–piperacillin selective growth medium allowed
the growth and isolation of diverse groups of Sphingomonas species from
a variety of environments. Despite the fact that about 36% of the pulp
and paper mill isolates isolated by this antibiotic selective medium were
non-pigmented, non-Sphingomonas strains, 100% of the Sphingomonas
 M.-S. Yim et al. / Journal of Microbiological Methods 82 (2010) 19–27
strains could be distinguished from the background bacteria by the
presence of either yellow or orange pigments in the bacteria, as
confirmed by PCR using the two sets of Sphingomonas-specific spt–PCR
primers and 16S rDNA sequencing. In addition, the PCR identification
assay in this study, that employed two sets of Sphingomonas-specific
spt–PCR primers, allows the (1) confirmation of pigmented Sphingomo-
nas and (2) detection of potential unpigmented Sphingomonas species in
the environment.
Acknowledgements
This research was funded by the Northern Ontario Heritage Fund
Corporation, FedNor, the NSERC Advanced Foods and Materials
Network and the NSERC Discovery Grant. In addition, this work was
also supported by the Inha University Research Grant awarded to J.S.
So. We thank the Toronto Hospital for Sick Children for providing us
the clinical and hospital environmental Sphingomonas isolates, and
the Thunder Bay Abitibi Bowater Pulp and Paper Mill for providing us
the water and biofilm samples.
References
Baddour, L., Kraus, A., Smalley, D., 1985. Peritonitis due to Pseudomonas paucimobilis
during ambulatory peritoneal dialysis. South Med. J. 78, 366.
Bastiaens, L., Springael, D., Wattiau, P., Harms, H., deWachter, R., Verachtert, H., et al.,
2000. Isolation of Adherent Polycyclic Aromatic Hydrocarbon (PAH)-degrading
bacteria using PAH-sorbing carriers. Appl. Environ. Microbiol. 66, 1834–1843.
Bruijin, F., 1992. Use of repetitive (repetitive extragenic palindromic and enterobac-
terial repetitive intergeneric consensus) sequences and the polymerase chain
reaction to fingerprint the genomes of Rhizobium meliloti isolates and other soil
bacteria. Appl. Environ. Microbiol. 58, 2180–2187.
Casadevall, A., Pirofski, L., 1992. Septic shock caused by Pseudomonas paucimobilis. Clin.
Infect. Dis. 14, 784.
Castro, V., Thrasher, A., Healy, M., Ott, C., Pierson, D., 2004. Microbial characterization during
the early habitation of the international space station. Microb. Ecol. 47, 119–126.
Dale, B., Williams, J., 1986. Pseudomonas paucimobilis contamination of cool mist tents
on a paediatric ward. J. Hosp. Infect. 7, 189.
Feng, X., Ou, L., Ogram, A., 1997. Plasmid-mediated mineralization of carbofuran by
Sphingomonas sp. strain CF06. Appl. Environ. Microbiol. 63, 1332–1337.
Flemming, C., Lewis, N., Leung, K., 2004. Freshwater treatment evaluation in an alkaline paper
mill in Thunder Bay. 90th Pulp and Paper Tech. Assoc. Can. Annu. Meeting 90, 77–80.
Flemming, C.A., Palcic, M.M., Elliott, R.B., Teodorescu, G., 2001. Novel optical fouling
monitor for deposit control. Pulp Paper Canada 102 (10), 53–55.
Fredrickson, J., Balkwill, D., Zachara, J., Li, S., Brockman, F., Simmons, M., 1991. Physiological
diversity and distributions of heterotrophic bacteria in deep cretaceous sediments of the
Atlantic coastal plain. Appl. Environ. Microbiol. 57, 402–411.
Fredrickson, J., Balkwill, D., Drake, G., Romine, M., Ringelberg, D., White, D., 1995.
Aromatic-degrading isolates from the deep subsurface. Appl. Environ. Microbiol.
61, 1917–1922.
Fuursted, K., 1988. Comparative killing activity and postantibiotic effect of streptomy-
cin combined with ampicillin, ciprofloxacin, imipenem, piperacillin or vancomycin
against strains of Streptococcus faecalis and Streptococcus faecium. Chemotherapy
(Basel) 34, 229–234.
Gauthier, V., Redercher, S., Block, J.-C., 1999. Chlorine inactivation of Sphingomonas cells
attached to goethite particles in drinking water. Appl. Environ. Microbiol. 65, 355–357.
Gilewicz, M., Ni’matuzahroh, T., Nadalig, T., Budzinski, H., Doumencq, P., Michotey, V.,
Bertrand, J.C., 1997. Isolation and characterization of a marine bacterium capable of
utilizing 2-methylphenanthrene. Appl. Microbiol. Biotechnol. 48, 528–533.
Hajiroussou, V., Holmes, B., Bullas, J., Pinning, C.A., 1979. Meningitis caused by
Pseudomonas paucimobilis. J. Clin. Pathol. 32, 953–955.
Hastings, R., Ceccherini, M., Miclaus, N., Saunders, J., Bazzicalupo, M., McCarthy, A., 1997. Direct
molecular biological analysis of ammonia oxidising bacteria populations in cultivated soil
plots treated with swine manure. FEMS Microbiol. Ecol. 23, 45–54.
Ikushiro, H., Hayashi, H., Kagamiyama, H., 2003. Bacterial serine palmitoyltransferase: a
water-soluble homodimeric prototype of the eukaryotic enzyme. Biochim. Biophys.
Acta. 1647, 116–120.
Imai, R., Nagata, Y., Fukuda, M., Takagi, M., Yano, K., 1991. Molecular cloning of a
Pseudomonas paucimobilis gene encoding a 17-kilodalton polypeptide that
eliminates HCl molecules from gamma-hexachlorocyclohexane. J. Bacteriol. 173,
6811–6819.
Ka, J., Holben, W., Tiedje, J., 1994. Genetic and phenotypic diversity of 2, 4-
dichlorophenoxyacetic acid (2, 4-D)-degrading bacteria isolated from 2, 4-D-
treated field soils. Appl. Environ. Microbiol. 60, 1106–1115.
Karlson, U., Rojo, F., Van Elsas, J., Moore, E., 1996. Genetic and serological evidence for
the recognition of four pentachlorophenol-degrading bacterial strains as a species
of the genus Sphingomonas. Appl. Syst. Microbiol. 18, 539–548.
27
Kelley, S.T., Theisen, U., Angenent, L.T., St. Amand, A., Pace, N.R., 2004. Molecular
analysis of shower curtain biofilm microbes. Appl. Environ. Microbiol. 70,
4187–4192.
Khan, A., Wang, R., Cao, W., Franklin, W., Cerniglia, C., 1996. Reclassification of a
polycyclic aromatic hydrocarbon-metabolizing bacterium, Beijerinckia sp. strain B1,
as Sphingomonas yanoikuyae by fatty acid analysis, protein pattern analysis, DNA-
DNA hybridization, and 16S ribosomal DNA sequencing. Int. J. Syst. Evol. Microbiol.
46, 466–469.
Koskinen, R., Ali-Vehmas, T., Kampfer, P., Laurikkala, M., Tsitko, I., Kostyal, E., et al.,
2000. Characterization of Sphingomonas isolates from Finnish and Swedish drinking
water distribution systems. J. Appl. Microbiol. 89, 687–696.
Lai, F., Wang, Q., Zhou, Y., Mu, C., Geng, S., Zhang, Y., et al., 2004. Investigation of the
bacteria in the seawater of Xisha in the South China Sea and their antibiotic
sensitivity profile. J. First Mil. Med. Univ. 24, 347–438.
Lemaitre, D., Elaichouni, A., Hundhausen, M., Claeys, G., Vanhaesebrouck, P.,
Vaneechoutte, M., et al., 1996. Tracheal colonization with Sphingomonas paucimo-
bilis in mechanically ventilated neonates due to contaminated ventilator
temperature probes. J. Hosp. Infect. 32, 199–206.
Leung, K.T., Cassidy, M.B., Shaw, K.W., Lee, H., Trevors, J.T., Lohmeier-Vogel, E.M., et al.,
1997. Isolation and characterization of pentachlorophenol degrading Pseudomonas
spp. UG25 and UG30. World J. Microbiol. Biotech. 13, 305–313.
Leung, K.T., Chang, Y.J., Gan, Y.D., Peacock, A., Macnaughton, S.J., Stephen, J.R., et al.,
1999. Detection of Sphingomonas spp. in soil by PCR and sphingolipid biomarker
analysis. J. Ind. Microbiol. Biotechnol. 23, 252–260.
Leys, N.M., Ryngaert, A., Bastiaens, L., Verstraete, W., Top, E.M., Springael, D., 2004.
Occurrence and phylogenetic diversity of Sphingomonas strains in soils contaminated
with polycyclic aromatic hydrocarbons. Appl. Environ. Microbiol. 70, 1944–1955.
Li, X., He, J., Li, S., 2007. Isolation of a chlorpyrifos-degrading bacterium, Sphingomonas
sp. strain Dsp-2, and cloning of the mpd gene. Res. Microbiol. 158, 143–149.
Manickam, N., Reddy, M., Saini, H., Shanker, R., 2008. Isolation of hexachlorocyclohex-
ane-degrading Sphingomonas sp. by dehalogenase assay and characterization of
genes involved in γ-HCH degradation. J. Appl. Microbiol. 104, 952–960.
Marchesi, J., Sato, T., Weightman, A., Martin, T., Fry, J., Hiom, S., et al., 1998. Design and
evaluation of useful bacterium-specific PCR primers that amplify genes coding for
bacterial 16S rRNA. Appl. Environ. Microbiol. 64, 795–799.
Mohn, W.W., 1995. Bacteria obtained from a sequencing batch reactor that are capable
of growth on dehydroabietic acid. Appl. Environ. Microbiol. 61, 2145–2150.
Neef, A., Witzenberger, R., Kampfer, P., 1999. Detection of sphingomonads and in situ
identification in activated sludge using 16S rRNA-targeted oligonucleotide probes.
J. Ind. Microbiol. Biotechnol. 23, 261–267.
Nohynek, L., Nurmiaho-Lassila, E., Suhonen, E., Busse, H., Mohammadi, M., Hantula, J., et
al., 1996. Description of chlorophenol-degrading Pseudomonas sp. strains KF1T,
KF3, and NKF1 as a new species of the genus Sphingomonas, Sphingomonas
subarctica sp. nov. Int. J. Syst. Evol. Microbiol. 46, 1042–1055.
Oie, S., Oomaki, M., Yorioka, K., Tatsumi, T., Amasaki, M., Fukuda, T., et al., 1998.
Microbial contamination of ‘sterile water’ used in Japanese hospitals. J. Hosp. Infect.
38, 61–65.
Oie, S., Kamiya, A., Yoneda, I., Uchiyama, K., Tsuchida, M., Takai, K., et al., 2003. Microbial
contamination of dialysate and its prevention in haemodialysis units. J. Hosp. Infect.
54, 115–119.
Peel, M., Davis, J., Armstrong, W., Wilson, J., Holmes, B., 1979. Pseudomonas paucimobilis
from a leg ulcer on a Japanese seaman. J. Clin. Microbiol. 9, 561–564.
Perola, O., Nousiainen, T., Suomalainen, S., Aukee, S., Käkkänen, U., Kauppinen, J., et al.,
2002. Recurrent Sphingomonas paucimobilis-bacteraemia associated with a multi-
bacterial water-borne epidemic among neutropenic patients. J. Hosp. Infect. 50,
196–201.
Reina, J., Bassa, A., Llompart, I., Portela, D., Borrell, N., 1991. Infections with Pseudomonas
paucimobilis: report of four cases and review. Rev. Infect. Dis. 13, 1072–1076.
Salazar, R., Martino, R., Sureda, A., Brunet, S., Subira, M., Domingo-Albos, A., 1995.
Catheter-related bacteremia due to Pseudomonas paucimobilis in neutropenic
cancer patients: report of two cases. Clin. Infect. Dis. 20, 1573–1574.
Taira, K., Hayase, N., Arimura, N., Yamashita, S., Miyazaki, T., Furukawa, K., 1988. Cloning
and nucleotide sequence of the 2, 3-dihydroxybiphenyl dioxygenase gene from the
PCB-degrading strain of Pseudomonas paucimobilis Q1. Biochemistry. 27,
3990–3996.
Tian, M., Kanavillil, N., Davey, L., Leung, K., Schraft, H., Chen, A., 2007. Direct growth of
biofilms on an electrode surface and its application in electrochemical biosensor-
ing. J. Electroanal. Chem. 611, 133–139.
Vaisanen, O.M., Weber, A., Bennasar, A., Rainey, F.A., Busse, H.J., Salkinoja-Salonen, M.S.,
1998. Microbial communities of printing paper machines. J. Appl. Microbiol. 84,
1069–1084.
Vanbroekhoven, K., Ryngaert, A., Bastiaens, L., Wattiau, P., Vancanneyt, M., Swings, J., et
al., 2004. Streptomycin as a selective agent to facilitate recovery and isolation of
introduced and indigenous Sphingomonas from environmental samples. Environ.
Microbiol. 6, 1123–1136.
White, D., Sutton, S., Ringelberg, D., 1996. The genus Sphingomonas: physiology and
ecology. Cur. Opin. Biotechnol. 7, 301–306.
Wittich, R., Wilkes, H., Sinnwell, V., Francke, W., Fortnagel, P., 1992. Metabolism of
dibenzo-p-dioxin by Sphingomonas sp. strain RW1. Appl. Environ. Microbiol. 58,
1005–1010.
Xia, Y., Min, H., Rao, G., Lv, Z., Liu, J., Ye, Y., et al., 2005. Isolation and characterization of
phenanthrene-degrading Sphingomonas paucimobilis strain ZX4. Biodegradation
16, 393–402.