Progesterone Receptor and NF2 Interaction is required for the

Development of Orbitocranial Meningioma

Agus Supartoto1, Datu Respatika1, Indra Tri Mahayana1,

Dhimas Hari Sakti1, Prima Sugesty Nurlaila1, Didik Setyo Heriyanto2, and M. Bayu Sasongko1

1
1Ophthalmology Department, Faculty of Medicine, Universitas Gadjah Mada/RSUP Dr.Sardjito
2
Pathology Department, Faculty of Medicine, Universitas Gadjah Mada/RSUP Dr.Sardjito

ABSTRACT
The high incidence of meningioma among hormonal contraception users has lead the study
to examining the involvement of progesterone receptor (PR) in meningioma tumorigenesis.
Other previous study showed that, inactivation of NF2 gene involved in the meningioma
pathogenesis. However, the association between PR and NF2 remains unclear. Our study
investigated the effect of hormonal contraception to PR and NF2 in orbitocranial
meningioma. Among 115 females subjects, 40 were in the case group, while 75 were in the
control group. The demographic data, risk factors, and history of progesterone injection
were obtained by in−depth interviews. The investigation of NF2 and PR were done by qPCR
method on serum specimens. The mean age group in case group was 46.6 ± 6.2 and the control
group was 46.5 ± 7.45 (p = 0.969). There was a significant decrease in PR and NF2 serum
levels (p <0.01) in the case group compared to those in control group. We also found that PR
expression significantly affects NF2 expression. The linear expression of NF2 with PR showed
a strong association with the incidence of meningioma. Thus, our study supports the
possibility of a relationship between the interaction of PR and NF2 with meningioma.
Keywords: Orbitocranial meningioma, progesterone, estrogen, NF2
INTRODUCTION
Meningioma is the most common primary brain tumor encountered in clinical practice. The
prevalence of meningioma ranges from 0.7%, with an incidence of 2-7 per 100,000 population
(Barnholtz-Sloan and Kruchko, 2007). It has been widely associated with the use of hormonal
contraceptives either oral or injections (Benson et al., 2010). The use of hormonal contraception
and hormone replacement therapy may increase the risk of meningioma (Wigertz et al., 2006,
Korhonen et al., 2010, Andersen et al., 2013). However, there have been few problems with this
concept. Several previous studies on the association between hormonal contraception and HRT
with the risk of meningioma development have provided conflicting conclusion (Hatch et al.,
2005, Custer et al., 2006, Lee et al., 2006, Michaud et al., 2010, Cea-Soriano et al., 2012, Claus
et al., 2013). Although there is a remarkable circumstantial evidence that supporting the role of
exogenous steroid hormones in meningioma pathogenesis, the basic molecular and
epidemiologic evidence of causality were remains inadequate.
A few hypothetical mechanisms have been proposed in the previous study. Hormonal
contraceptives were reported associated with the expression of progesterone receptors (PR) and
the incidence of meningiomas (Perry et al., 2000, Wahab and Al-Azzawi, 2003, Roser et al.,
2004, Kandemir et al., 2010). Concordantly, another study indicates that benign meningiomas
are positive for PR expression and less likely to recur (Fewings et al., 2000). Another mechanism
that has been suggested was related to genes that contributes to the pathogenesis of meningioma.
The observed results showed that Neurofibromatosis−2 (NF2) gene was a predisposing gene in
meningiomas and it is related to meningioma histotype (Rouleau et al., 1993, Buccoliero et al.,
2007, Tabernero et al., 2013). Individuals with certain mutations in the NF2 gene were also
considered to have increased risk for suffering from meningioma (Seong et al., 2010, Wiemels
et al., 2010).
Despite the fact that PR and NF2 were associated with meningioma, there was no direct
evidence showing possible relationship between meningioma, PR, and NF2. The inactivation of
NF2 gene affected the production of merlin, that plays a role in controlling cell proliferation by
inhibiting ErbB2 (Brown and Hansen, 2008). While, another study showed that methylation of
NF2 gene by IL-1β will lead to inactivation of the NF2 gene (Wang et al., 2016). On the other
hand, several studies showed that progesterone may inhibit the production of pro-inflammatory
cytokines, such as IL-1β (Butts et al., 2007, Garcia-Ruíz et al., 2015). These findings led us to
the possibility of interaction between PR and NF2 in the meningioma pathogenesis. Thus, our
study was aimed to find the relationship between the interaction of PR and NF2 with the
incidence of meningioma.

MATERIAL AND METHODS

Study Design and Population
This was a case-control study of 115 females with orbito-cranial meningioma and healthy
controls. The population consisted of all women aged 38−54 years in Indonesia. The study
period ranged from June, 2010 to October, 2014. We recruited 40 consecutive cases presenting
at Sardjito General Hospital in Yogyakarta. Those who confirmed by histopathological
examination positive for meningioma following either craniotomy or orbitotomy, were defined
as cases. A total of 75 age-matched (± 2 years old difference), healthy females were recruited
as controls. Each of control were randomly chosen with similar socio-demographic background
to cases. All controls underwent careful clinical examination by experienced doctor and head
CT-Scan to ensure the absence of intracranial tumors.

Preparation of cDNA and RT-qPCR Analysis.

A total of 5 ml of venous blood were taken from brachial vein and collected in the tubes
containing EDTA. Total RNA was extracted from whole blood using the Geneaid Blood/Cell
Total RNA Mini Kit (Geneaid Biotech, Taiwan). The total RNA was subjected to reverse
transcription followed by qPCR analysis in 48-well with the use of KAPA SYBR® FAST One-
Step Universal Kit (Sigma-Aldrich, St. Louis, MO, USA) and a DTlite Real-Time PCR System
(DNA−Technology, Russia). The amplification results were analyzed with the use of DTlite
Real-Time PCR System Software (DNA−Technology) and were normalized by the
corresponding amount of GAPDH mRNA. Primer sequences for qPCR (forward and reverse,
respectively) were as follows: GAPDH, 5’−GCATCCTGGGCTACACTGAG−3’ and
5’TCCACCACCCTGT TGCTGTA−3’; PR, 5’−AGCTCATCAAGGCAATTGGTTT−3’ and
5’−ACAAGATCAT GCAAGTTATCAAGAAGTT-3; and NF2, 5’−CCCCCAACTCCCC
TTTCC−3’ and 5’-AGCCCTTTAGCCCCCCTG-3’.
Statistical Analysis.
Data were analyzed by computer statistic program STATA version 12.1. A p value of <0.05
was considered statistically significant. Mean serum PR and NF2 expression in cases and
controls was analyzed by unpaired t-test. Other results are reported as odds ratios (OR) with
95% confidence intervals (CI) was performed by logistic regression by introducing confounding
variables into the multivariate model. The PR expression was then grouped into 4 quartiles, and
sought to correlate with serum and tissue NF2 expression with logistic regression analysis.
Stratification in terms of use of progesterone injection in NF2 analysis of the incidence of
meningioma was performed to look for the interaction of expression of PR and NF2 with
exposure to the environment.

RESULTS
Characteristic of the Study Participants, Reproductive Factor, and History of Contraception
Use
The baseline characteristics of 115 subjects who participated in this study have been
presented elsewhere (Supartoto et al., 2016). There were no significant differences in
characteristics in case group (40 females) compared to those control group (75 females). The
mean ages (±SD) for women with meningioma and for controls were 46,6 ± 6,2 and 46,5 ± 7,45
years, respectively. We found that case group exhibit a longer exposure to hormonal
contraception, when compared to control (P=0.005). A greater proportion of regular menstrual
cycle (28 days) was found in the case group, compared to proportion in control group that only
57.3%.

Figure 1. Expression of PR in serum

Lower Expression of PR in the serum of Meningioma Patients
The use of progesterone−only contraception was associated with increased risk of
orbitocranial meningioma in females (Supartoto et al., 2016). Concordantly, progesterone-only
contraception was also associated with an increased risk of recurrence of meningioma (Harland
et al., 2017). Another study described that PR status related to the clinical and biological
features, and biological behavior of meningiomas. This shows that PR could predict the
meningioma recurrence, and help to select more effective follow up plan (Roser et al., 2004).
Based on above studies, we want to compare the expression of PR in the case and control groups.
The blood examination result shows that the case group exhibit lower serum PR expression
when compared to control group (Figure 1).

Reduced Expression of NF2 in the serum of Meningioma Patients

NF2 protein was known as tumor suppressor gene that affect cell cycle progression and
involved in a broad range of nervous system tumors (Beltrami et al., 2013). The aberrant NF2
hyper−methylation was found to be involved in the development of sporadic meningiomas,
primarily those of grade I (Lomas et al., 2005). The other study was also reported that sporadic
meningioma was associated with inactivation of NF2 which causes loss of merlin tumors
suppressor (James et al., 2008). In this study, we found that NF2 expression in serum were
decreased in the meningioma group compared to the control group (Figure 2). The loss of NF2
expression here might occured due to inactivation or mutation of NF2 gene.

Figure 2. Expression of NF2 in serum

Lower PR Expression Associated with Lower NF2 Expression
The involvement of PR and NF2 in meningioma was reported in several studies (Perry et al.,
2000, Roser et al., 2004, Lomas et al., 2005, Pravdenkova et al., 2006, James et al., 2008,
Beltrami et al., 2013, Baxter et al., 2014). However, none of those studies have discussed in-
depth relationship between PR and NF2 expression. In this study, we intend to find the
relationship between PR and NF2 expression in meningioma tissue. The result showed a positive
association between PR and NF2 expression shows (Table 2). This result might have led us to
the possibility that PR and NF2 were involved in the same pathway.

Table 1. Expression of PR and NF2 (n=114)

NF2
Variable
N Mean (95% CI) P−value^
Expression PR
Quartile 1 (0.54 – 2.64) 28 9.54 (6.57 – 12.5)
Quartile 2 (3.03 – 5.27) 31 11.3 (9.36 – 13.2)
0.03
Quartile 3 (5.65 – 10.6) 27 13.1 (11.1 – 15.1)
Quartile 4 (11.3 – 22.6) 26 14.8 (11.7 – 17.9)
^P−value linear

The association of NF2 expression and hormonal contraception with the incidence of
meningioma has been partly discussed in previous studies (James et al., 2008, Beltrami et al.,
2013, Supartoto et al., 2016, Harland et al., 2017). However, the relationship between NF2 with
hormonal contraceptives in meningioma has not received special attention. Here, we focused to
find a relationship between NF2 with hormonal contraceptives to the incidence of meningioma.
In Table 3 we showed a relationship between NF2 expression history and duration of hormonal
contraception, regression analysis was performed with 2 models. The multivariate analysis
includes other confounding factors such as age of menarche, number of children, length of
menstrual cycle, duration of contraception use, and history of breast cancer. The length of the
menstrual cycle has the weakest association with NF2 expression, followed by hormonal
contraceptive type, hormonal contraceptive use, and menarche age. A strong association was
found between the duration of hormonal contraception and NF2 expression in both univariate
and multivariate analysis. Our result showed a trend of reduced NF2 expression with the
increased of duration of hormonal contraceptive use.
 Table 2. Expression of serum NF2 and History of the Use of Hormonal Contraception (n=114)

Model 1 Model 2*
Variable
N Mean (95% CI) P−value^ Mean (95% CI) P−value^
Menarche (y.o.)
< 12 4 8.98 (4.11 – 13.9) 0.11 7.42 (2.42 – 12.4) 0.08
12 – 15 62 11.3 (9.06 – 13.5) 11.0 (9.14 – 12.9)
>15 48 13.5 (10.8 – 16.3) 13.2 (10.7 – 15.7)
Menstrual Periods (days)
< 28 8 11.1 (7.47 – 14.8) 0.54 11.4 (7.79 – 15.0) 0.89
28 77 11.9 (9.95 – 13.9) 11.6 (9.70 – 13.5)
> 28 16 12.7 (10.1 – 15.3) 11.8 (9.23 – 13.4)
Irregular 11 13.4 (8.73 – 18.1) 11.9 (7.29 – 16.6)
Hormonal Contraception
No 18 14.7 (10.4 – 19.2) 0.16 14.5 (10.1 – 18.9) 0.12
Yes 79 11.2 (9.13 – 13.4) 10.5 (8.49 – 12.5)
The Type of Hormonal Contraception
Injection 70 13.9 (10.2 – 17.5) 0.22 13.3 (9.55 – 16.9) 0.21
Implant / Pill 9 11.2 (8.94 – 13.4) 10.5 (8.36 – 12.7)
Duration of Hormonal Contraception (years)
0 – 10 80 13.1 (10.9 – 15.2) 12.6 (10.4 – 14.7)
10 – 20 23 10.7 (8.25 – 13.1) 0.046 10.5 (8.21 – 12.8) 0.055
> 20 11 8.31 (3.57 – 13.0) 8.50 (3.94 – 13.1)
5 years increases −1.03 (−2.20 – 0.15) 0.08 −0.99 (−2.17 – 0.18) 0.09
*the age of menarche, number of children, length of the menstrual cycle, duration of contraception, and
history of breast cancer in the family were included in the analysis

Several studies have simultaneously concluded that approximately 60% of sporadic

meningioma were associated with inactivation of the NF2 gene (Lomas et al., 2005, van Tilborg
et al., 2006). In this study, we found a relationship between low NF2 expression with increased
incidence of meningioma. Figure 2 shows a significant decrease in NF2 levels (p <0.01) in
serum cases when compared with controls and Table 3 shows the relationship between NF2
expression and duration of hormonal contraceptive use. The above findings have been shown to
be independent from other confounding factors such as age of menarche, number of children,
length of menstrual cycle, duration of contraceptive use, family history of breast cancer, after
multivariate regression analysis with 2 models. In line with previous results, it was found that
low NF2 expression was strongly associated with the incidence of orbitocranial meningioma,
both in univariate and multivariate analysis. This supports a strong association between
inactivation of the NF2 gene and the incidence of meningioma that is also strongly associated
with the duration of the use of hormonal contraception.
 Table 3. Interaction of NF2 and PR with the Incidence of Meningioma (n=114)

Model 1 Model 2*
Variable N OR (95% CI) P−value OR (95% CI) P−value
NF2*PG receptor
NF2 >4.28 &
69 Reference Reference
PR >2.63
NF2 <4.28 &
17 4.14 (1.32 – 12.9) 0.014 4.08 (1.30 – 12.8) 0.016
PR >2.63
NF2 >4.28 &
17 15.2 (4.20 – 54.7) <0.001 15.4 (4.16 – 56.8) <0.001
PR <2.63
NF2 <4.28 &
11 21.0 (4.01 – 109) <0.001 21.1 (4.00 – 111) <0.001
PR <2.63
*the age of menarche, number of children, length of the menstrual cycle, duration of contraception,
and history of breast cancer in the family were included in the analysis

Next, we sought that the interaction of PR and NF2 expression might be associated with
meningioma. Table 4 showed the relationship between expression of NF2 and PR with the
incidence of orbitocranial meningioma using regression analysis with 2 models. In this study,
high NF2 (>4.28) and PR (>2.63) expression were used as a reference. The results showed an
increased risk of meningioma incidence with decreased of NF2 or PR expression. Interestingly,
the incidence of meningioma is found to increased significantly in cases with reduced both, NF2
and PR expression. Thus, the result suggests that the risk of meningioma significantly higher in
the patients that exhibited low NF2 and PR expression.

DISCUSSIONS
The study of meningioma epidemiology and etiology has fall behind that for more threatening
intracranial neoplasms because of the benign nature of meningioma. Consequently, the study of
risk factors for meningioma remains challenging (Wiemels et al., 2010). Another study reported
a strong evidence that suggest the role of sex steroids, including hormonal contraception, in the
pathogenesis of meningioma (Elder and Chiocca, 2011). Therefore, we conducted a case–
control study to find the association between the use of hormonal contraception and
meningioma. Previously we found a that the use of progesterone only contraception was
significantly associated with increased risk of meningioma (Supartoto et al., 2016). In this study,
we focused more in the expression of progesterone receptor, and we found that PR expression
were significantly reduced in the case group when compared to control group (Figure 1). This
finding was similar to other studies, in which oral contraception use was associated with low
PR expression and increased risk of meningioma. The PR expression was also reported
contrarily proportional to histologic grade and a higher meningioma recurrence (Fewings et al.,
2000, Perry et al., 2000, Roser et al., 2004, Custer et al., 2006). One study shows that expression
of PR was not associated with meningioma recurrence (Guevara et al., 2010). However, our
study in concordant with other studies that utilized a mRNA, shows a preferable result. It is
because a mRNA examination was thought to be more reliable and less subjective than the
assessment of cells in immunohistochemical preparations (Fewings et al., 2000). Thus, the
reduction of PR expressions taking part in the pathogenesis of meningioma.
Several studies have emphasized that tumors suppressor gene NF2 was associated with the
incidence of meningioma (Evans et al., 2000, Houshmandi et al., 2009, Beltrami et al., 2013,
Petrilli and Fernández-Valle, 2016). In agreement with those studies, our findings in this study
shows that NF2 expression was significantly reduced in the case group when compared to
control group. The reduction of NF2 production could be direct consequence NF2 inactivation
or mutation (Seong et al., 2010, Petrilli and Fernández-Valle, 2016). It is known that, a high rate
of NF2 gene inactivation occurred in 70% of meningiomas (Hilton et al., 2016). These findings,
suggested that the inactivation or mutation of NF2 gene was attributable to lower NF2
expression and increased risk of meningioma development.
There was no evidence shows the interaction between PR and NF2. Interestingly, our findings
suggested that PR expression significantly affects NF2 expression. The linear expression of NF2
with the expression of PR showed that lower PR expression was associated with reduced NF2
expression. These finding might be important to understand the pathogenesis of meningioma
that associated with hormonal contraception. The reproductive factors, including onset of
menarche, menstrual periods, and hormonal contraception, were also reported involve in the
development of meningioma (Lee, 2009, Qi et al., 2013). Our findings in this study showed
interaction between NF2 and the reproductive factor with meningioma. Thus, there is strong
possibility that the reproductive factor and the PR interferes the NF2 function that plays an
important role in meningioma development.
Although NF2 and PR were known to be involved in the pathogenesis of meningioma, the
previous studied only mentioned the association of NF2 and PR with meningioma independently
(Roser et al., 2004, Custer et al., 2006, Hilton et al., 2016, Petrilli and Fernández-Valle, 2016).
We here try to find the interaction of NF2 and PR in association with meningioma development.
The risk of meningioma development increased accordingly to low expression of NF2 or PR,
with an OR 4.14 (95% CI = 1.32 – 12.9) and 15.2 (95% CI = 4.20 – 54.7) respectively.
Interestingly, univariate analysis shows that, low expression of both NF2 and PR, significantly
increased the risk of meningioma development (OR 21.0; 95% CI = 4.01 – 109). These findings
suggested that, both NF2 and PR, involved in the same pathway in the meningioma
development. The NF2 was known to be an important factor in the development of tumors,
including meningioma (Petrilli and Fernández-Valle, 2016). One study mentioned that IL-1β
involvement in NF2 gene methylation will lead to inactivation of the NF2 gene (Wang et al.,
2016). On the other hand, other researchers have shown that progesterone administration might
inhibit the production of pro−inflammatory cytokines, such as IL-1β (Butts et al., 2007, Garcia-
Ruíz et al., 2015). The reduction of PR expression we found in our study, might be responsible
for the higher production of IL-1β. The increased production of IL-1β would results in NF2
inactivation that increased the risk of meningioma development. Thus, the results of our and
previous studies support the possibility of a relationship between PR and NF2 in meningioma.
In conclusion, the long-term use of progesterone as a hormonal contraceptive is thought to
play a role in development of meningioma. We found that progesterone injection increased the
risk of meningioma, while birth control pills (containing estrogen and progesterone) did not
show a strong association. Our new findings suggest that, both NF2 and PR, indeed involved in
the pathogenesis of meningioma. More importantly, decreased expression of PR (<2.63) and
NF2 (<4.28) in serum was significantly associated with an increased risk of meningioma. These
suggest that both NF2 and PR might act in the same pathway in the development of meningioma.
A better understanding of the role of NF2 and PR in tumorigenesis and meningioma progression
is still required. The fact that reduction of NF2 or PR in humans mostly leads to meningioma
formation, suggests specific molecular pathway was involved and requires further elucidation.
In addition, the significance of NF2 and PR reduction in meningioma deserves more
investigation for its potential contribution to progression, prognosis and therapeutics of
meningioma.

FINANCIAL SUPPORT AND SPONSORSHIP

CONFLICTS OF INTEREST

REFERENCES
Andersen, L., Friis, S., Hallas, J., Ravn, P., Schroder, H. D. & Gaist, D. 2013. Hormone
replacement therapy increases the risk of cranial meningioma. Eur J Cancer, 49, 3303-
10.
Barnholtz-Sloan, J. S. & Kruchko, C. 2007. Meningiomas: causes and risk factors.
Baxter, D. S., Orrego, A., Rosenfeld, J. V. & Mathiesen, T. 2014. An audit of
immunohistochemical marker patterns in meningioma. Journal of Clinical
Neuroscience, 21, 421-426.
Beltrami, S., Kim, R. & Gordon, J. 2013. Neurofibromatosis type 2 protein, NF2: an
uncoventional cell cycle regulator. Anticancer research, 33, 1-11.
Benson, V. S., Pirie, K., Green, J., Bull, D., Casabonne, D., Reeves, G. K. & Beral, V. 2010.
Hormone replacement therapy and incidence of central nervous system tumours in the
Million Women Study. International journal of cancer, 127, 1692-1698.
Brown, K. D. & Hansen, M. R. 2008. Lipid raft localization of erbB2 in vestibular schwannoma
and Schwann cells. Otology & neurotology, 29, 79-85.
Buccoliero, A. M., Gheri, C. F., Castiglione, F., Ammannati, F., Gallina, P., Taddei, A., Garbini,
F., Degl'innocenti, D. R., Arganini, L. & Di Lorenzo, N. 2007. Merlin Expression in
Secretory Meningiomas: Evidence of an NF2-independent Pathogenesis?:
Immunohistochemical study. Applied Immunohistochemistry & Molecular Morphology,
15, 353-357.
Butts, C. L., Shukair, S. A., Duncan, K. M., Bowers, E., Horn, C., Belyavskaya, E., Tonelli, L.
& Sternberg, E. M. 2007. Progesterone inhibits mature rat dendritic cells in a receptor-
mediated fashion. International immunology, 19, 287-296.
Cea-Soriano, L., Blenk, T., Wallander, M.-A. & Rodríguez, L. a. G. 2012. Hormonal therapies
and meningioma: is there a link? Cancer epidemiology, 36, 198-205.
Claus, E. B., Calvocoressi, L., Bondy, M. L., Wrensch, M., Wiemels, J. L. & Schildkraut, J. M.
2013. Exogenous hormone use, reproductive factors, and risk of intracranial
meningioma in females. Journal of neurosurgery, 118, 649-656.
Custer, B., Longstreth, W., Phillips, L. E., Koepsell, T. D. & Van Belle, G. 2006. Hormonal
exposures and the risk of intracranial meningioma in women: a population-based case-
control study. BMC cancer, 6, 152.
Elder, J. B. & Chiocca, E. A. 2011. Meningioma—Toward an Improved Understanding of the
Role of Sex Steroids in Tumor Development and Progression. World neurosurgery, 76,
409-411.
Evans, D. G. R., Sainio, M. & Baser, M. E. 2000. Neurofibromatosis type 2. Journal of medical
genetics, 37, 897-904.
Fewings, P. E., Battersby, R. D. & Timperley, W. R. 2000. Long-term follow up of progesterone
receptor status in benign meningioma: a prognostic indicator of recurrence? Journal of
neurosurgery, 92, 401-405.
Garcia-Ruíz, G., Flores-Espinosa, P., Preciado-Martínez, E., Bermejo-Martínez, L., Espejel-
Nuñez, A., Estrada-Gutierrez, G., Maida-Claros, R., Flores-Pliego, A. & Zaga-
Clavellina, V. 2015. In vitro progesterone modulation on bacterial endotoxin-induced
 production of IL-1β, TNFα, IL-6, IL-8, IL-10, MIP-1α, and MMP-9 in pre-labor human
term placenta. Reproductive Biology and Endocrinology, 13, 115.
Guevara, P., Escobar-Arriaga, E., Saavedra-Perez, D., Martinez-Rumayor, A., Flores-Estrada,
D., Rembao, D., Calderon, A., Sotelo, J. & Arrieta, O. 2010. Angiogenesis and
expression of estrogen and progesterone receptors as predictive factors for recurrence of
meningioma. Journal of Neuro-oncology, 98, 379-384.
Harland, T. A., Freeman, J. L., Davern, M., Mccracken, D. J., Celano, E. C., Lillehei, K., Olson,
J. J. & Ormond, D. R. 2017. Progesterone-only contraception is associated with a shorter
progression-free survival in premenopausal women with WHO Grade I meningioma.
Journal of neuro-oncology, 1-7.
Hatch, E. E., Linet, M. S., Zhang, J., Fine, H. A., Shapiro, W. R., Selker, R. G., Black, P. M. &
Inskip, P. D. 2005. Reproductive and hormonal factors and risk of brain tumors in adult
females. International journal of cancer, 114, 797-805.
Hilton, D. A., Shivane, A., Kirk, L., Bassiri, K., Enki, D. G. & Hanemann, C. O. 2016.
Activation of multiple growth factor signalling pathways is frequent in meningiomas.
Neuropathology, 36, 250-261.
Houshmandi, S. S., Emnett, R. J., Giovannini, M. & Gutmann, D. H. 2009. The
neurofibromatosis 2 protein, merlin, regulates glial cell growth in an ErbB2-and Src-
dependent manner. Molecular and cellular biology, 29, 1472-1486.
James, M. F., Lelke, J. M., Maccollin, M., Plotkin, S. R., Stemmer-Rachamimov, A. O.,
Ramesh, V. & Gusella, J. F. 2008. Modeling NF2 with human arachnoidal and
meningioma cell culture systems: NF2 silencing reflects the benign character of tumor
growth. Neurobiology of disease, 29, 278-292.
Kandemir, N. O., Aylin, E., Gun, B. D., Karadayi, N., Yurdakan, G. & Ozdamar, S. O. 2010.
Her-2/neu, estrogen and progesterone receptor expression in WHO grade I
meningiomas. Balkan Medical Journal, 2010.
Korhonen, K., Raitanen, J., Isola, J., Haapasalo, H., Salminen, T. & Auvinen, A. 2010.
Exogenous sex hormone use and risk of meningioma: a population-based case–control
study in Finland. Cancer Causes & Control, 21, 2149-2156.
Lee, E., Grutsch, J., Persky, V., Glick, R., Mendes, J. & Davis, F. 2006. Association of
meningioma with reproductive factors. International journal of cancer, 119, 1152-1157.
Lee, J. H. 2009. Meningiomas: diagnosis, treatment, and outcome. Am Soc Neuroradiology.
Lomas, J., Bello, M. J., Arjona, D., Alonso, M. E., Martinez‐Glez, V., Lopez‐Marin, I.,
Aminoso, C., De Campos, J. M., Isla, A. & Vaquero, J. 2005. Genetic and epigenetic
alteration of the NF2 gene in sporadic meningiomas. Genes, Chromosomes and Cancer,
42, 314-319.
Michaud, D. S., Gallo, V., Schlehofer, B., Tjonneland, A. M., Olsen, A., Overvad, K., Dahm,
C. C., Kaaks, R., Lukanova, A. & Boeing, H. 2010. Reproductive factors and exogenous
hormone use in relation to risk of glioma and meningioma in a large European cohort
study. Cancer Epidemiology and Prevention Biomarkers, cebp. 0447.2010.
Perry, A., Cai, D. X., Scheithauer, B. W., Swanson, P. E., Lohse, C. M., Newsham, I. F.,
Weaver, A. & Gutmann, D. H. 2000. Merlin, DAL-1, and progesterone receptor
expression in clinicopathologic subsets of meningioma: a correlative
immunohistochemical study of 175 cases. Journal of Neuropathology & Experimental
Neurology, 59, 872-879.
Petrilli, A. M. & Fernández-Valle, C. 2016. Role of Merlin/NF2 inactivation in tumor biology.
Oncogene, 35, 537-548.
Pravdenkova, S., Al-Mefty, O., Sawyer, J. & Husain, M. 2006. Progesterone and estrogen
receptors: opposing prognostic indicators in meningiomas. Journal of neurosurgery,
105, 163-173.
Qi, Z.-Y., Shao, C., Huang, Y.-L., Hui, G.-Z., Zhou, Y.-X. & Wang, Z. 2013. Reproductive and
exogenous hormone factors in relation to risk of meningioma in women: a meta-analysis.
PloS one, 8, e83261.
Roser, F., Nakamura, M., Bellinzona, M., Rosahl, S., Ostertag, H. & Samii, M. 2004. The
prognostic value of progesterone receptor status in meningiomas. Journal of clinical
pathology, 57, 1033-1037.
Rouleau, G. A., Merel, P., Lutchman, M., Sanson, M., Zucman, J., Marineau, C., Hoang-Xuan,
K., Demczuk, S., Desmaze, C. & Plougastel, B. 1993. Alteration in a new gene encoding
a putative membrane-organizing protein causes neuro-fibromatosis type 2. Nature, 363,
515-521.
Seong, M.-W., Yeo, I. K., Cho, S. I., Park, C.-K., Kim, S.-K., Paek, S. H., Kim, D. G., Jung, H.-
W., Park, H. & Kim, S. Y. 2010. Molecular Characterization of the NF2 Gene in Korean
Patients with Neurofibromatosis Type 2: A Report of Four Novel Mutations. The Korean
journal of laboratory medicine, 30, 190-194.
Supartoto, A., Mahayana, I., Christine, R. & Suhardjo, A. A. 2016. Exposure to Exogenous
Female Sex Hormones is Associated with Increased Risk Oforbito-Cranial Meningioma
in Females: A Case-Control Study. Int J Ophthalmic Pathol 5, 3, 2.
Tabernero, M., Jara-Acevedo, M., Nieto, A. B., Caballero, A. R., Otero, Á., Sousa, P.,
Gonçalves, J., Domingues, P. H. & Orfao, A. 2013. Association between mutation of the
NF2 gene and monosomy 22 in menopausal women with sporadic meningiomas. BMC
medical genetics, 14, 114.
Van Tilborg, A. A., Morolli, B., Giphart‐Gassler, M., De Vries, A., Van Geenen, D. A., Lurkin,
I., Kros, J. M. & Zwarthoff, E. C. 2006. Lack of genetic and epigenetic changes in
meningiomas without NF2 loss. The Journal of pathology, 208, 564-573.
Wahab, M. & Al-Azzawi, F. 2003. Meningioma and hormonal influences. Climacteric, 6, 285-
292.
Wang, B., Cui, Z., Zhong, Z., Sun, Y., Yang, G. Y., Sun, Q. & Bian, L. 2016. The role and
regulatory mechanism of IL‐1β on the methylation of the NF2 gene in benign
meningiomas and leptomeninges. Molecular carcinogenesis.
Wiemels, J., Wrensch, M. & Claus, E. B. 2010. Epidemiology and etiology of meningioma.
Journal of neuro-oncology, 99, 307-314.
Wigertz, A., Lönn, S., Mathiesen, T., Ahlbom, A., Hall, P. & Feychting, M. 2006. Risk of brain
tumors associated with exposure to exogenous female sex hormones. American journal
of epidemiology, 164, 629-636.