Biologycal

Synthetic Biology
Final Report
Team
Österreichische Agentur für Gesundheit und
Ernährungssicherheit GmbH (kurz AGES)
1220 Wien, Spargelfeldstraße 191
Impressum
Herausgeber, Medieninhaber und Hersteller:
Bundesministerium für Gesundheit, Sektion II
Radetzkystraße 2, 1030 Wien
Für den Inhalt verantwortlich:

Dr. Ulrich Herzog
Projektleitung und interne Projektkoordination:

Alexandra Ribarits
Autorinnen und Autoren (in alphabetischer Reihenfolge):

Brüller Werner
Gansberger Markus
Hochegger Rupert
Kuffner Melanie
Peterseil Verena
Ribarits Alexandra
Stepanek Walter
Toptischnig Christina
Widhalm Ingomar
Wögerbauer Markus
ISBN 978-3-902611-84-0
Erscheinungstermin:
November 2014
Zitiervorschlag/Please cite this report as follows:
Ribarits A., Stepanek W., Wögerbauer M., Peterseil V., Kuffner M., Topitschnig C.,
Brüller W., Hochegger R., Gansberger M., Widhalm I. und Leonhardt C. (2014)
Synthetic Biology. Bundesministerium für Gesundheit, Wien.
Ribarits A., Stepanek W., Wögerbauer M., Peterseil V., Kuffner M., Topitschnig C.,
Brüller W., Hochegger R., Gansberger M., Widhalm I. und Leonhardt C. (2014)
Synthetic Biology. Federal Ministry of Health, Vienna.
Synthetic Biology | Content
Content
Content ................................................................................................................................................................... 3
Executive Summary................................................................................................................................................. 5
Zusammenfassung .................................................................................................................................................. 6
Background and aims .............................................................................................................................................. 8
1 Introduction ............................................................................................................................................... 9
1.1 What is synthetic biology? ......................................................................................................................... 9
1.1.1 The scientific landscape of synthetic biology........................................................................................... 10
2 Definition and delimitation of synthetic biology ..................................................................................... 12
2.1 “Synthetic biology” and “Synthetic genomics” ........................................................................................ 12
2.2 Synthetic biology, systems biology, metabolic engineering and the need to differentiate between the
fields ......................................................................................................................................................... 13
2.2.1 Systems biology........................................................................................................................................ 14
2.2.2 Metabolic engineering ............................................................................................................................. 14
2.2.3 Synthetic metabolic pathways ................................................................................................................. 15
2.2.4 Is it synthetic biology or still conventional biotechnology? ..................................................................... 16
2.3 Some limits to “bio-part engineering” ..................................................................................................... 16
3 State of the Art ......................................................................................................................................... 18
3.1 Overview of paths to synthetic life .......................................................................................................... 18
3.1.1 Top-down or bottom-up .......................................................................................................................... 18
3.1.2 Prerequisites ............................................................................................................................................ 18
3.1.3 Platform cell factories .............................................................................................................................. 19
3.1.4 Cell-free synthetic biology ....................................................................................................................... 20
3.2 Construction of a novel cell...................................................................................................................... 20
3.2.1 Minimal genomes – top-down approach ................................................................................................. 20
3.2.2 De novo construction of a cell – bottom-up approach ............................................................................ 22
3.2.3 Modification on other level than DNA ..................................................................................................... 30
3.3 Building biological systems from parts .................................................................................................... 31
3.3.1 Regulation of gene expression: parts and devices................................................................................... 31
3.3.2 Genetic devices ........................................................................................................................................ 32
3.3.3 Design and optimisation of synthetic biological systems ........................................................................ 35
3.3.4 Standardisation of genetic parts and modules ........................................................................................ 39
4 Applications of synthetic biology ............................................................................................................. 42
4.1 Synthetic biology in microorganisms ....................................................................................................... 42
4.2 Synthetic biology in other species ........................................................................................................... 43
4.3 Synthetic biology in plants ....................................................................................................................... 43
4.3.1 Assembly of plant pathways in heterologous hosts ................................................................................ 44
4.3.2 Review of existing applications in plant-like systems and higher plants ................................................. 47
4.3.3 Emerging applications .............................................................................................................................. 50
5 Risk assessment and risk management ................................................................................................... 53
5.1 Current risk assessment approaches ....................................................................................................... 53
5.2 Applicability of current approaches on plants created by synthetic genomics ....................................... 54
5.3 Additional aspects in the risk assessment of plants created by synthetic genomics .............................. 55
5.4 Assessment of the practical consequences and risks of a release into the environment of plants created
by synthetic genomics.............................................................................................................................. 57
5.5 Biosafety considerations on BioBricks™ used for Synthetic Biology ....................................................... 58
5.6 Potential impacts of synthetic biology in relation to biosafety ............................................................... 61
5.6.1 Impact on the ecosystem ......................................................................................................................... 61
5.6.2 Transfer of novel genetic material/DNA to native host organisms ......................................................... 63
5.6.3 Emergence of novel properties ................................................................................................................ 63
6 Discussion................................................................................................................................................. 65
7 Recommendations ................................................................................................................................... 69
8 References................................................................................................................................................ 72
3
Synthetic Biology | Content
9 List of Figures ........................................................................................................................................... 80

10 List of Tables............................................................................................................................................. 81
11 Annex ....................................................................................................................................................... 82
4
Synthetic Biology | Executive Summary
Executive Summary
Synthetic biology and synthetic genomics are emerging research fields that attract much attention due to their
vast potential in diverse applications. To date there is neither a commonly accepted formal definition of the
terms nor systematic coordination of the individual research and development efforts. This report aims at
providing an overview of the current status concerning definitions and the conceptual framework, showing the
diversity of potential actors characterised by diverse backgrounds and approaches. Based on the state of
science and knowledge and the assessment of potential applications, approaches to risk assessment and risk
management practices are discussed. Finally, recommendations for action are outlined.
The most widely used definition of synthetic biology describes it as the design and construction of new
biological parts, devices and systems or, alternatively, as the re-design of existing, natural biological systems
for useful purposes. A key feature in synthetic biology is the application of engineering principles that aim at
designing and constructing organisms with novel properties previously not inherent. This is done by two
different approaches, which are either from scratch (“bottom-up”), or based on the minimal genome concept
(“top-down”). The first approach involves basic building units (parts) that are assembled from pieces of
synthesised DNA, and used to design and construct devices (multiple parts with defined functions), pathways
and ultimately whole designer genomes. A number of approaches to assemble synthetic genomes have been
developed that are based on standardisation of parts to facilitate assembly. The reverse, top-down approach
aims at reducing the genome to the minimal set of genes to sustain life under defined conditions. These
minimal cells, also termed “chassis”, serve as platform cell factories into which synthetic elements can be
added. The preferred platforms are well-studied model organisms like Escherichia coli or yeast, which may also
be used as hosts for the expression of plant pathways. Advanced applications using microbes aim at the
production of desired compounds like biofuels or pharmaceuticals that are produced in contained systems.
Given the uncertainty concerning the effects of unintentional release, a scenario which is moreover prone to
sustain, reliable containment measures are of utmost importance.
Synthetic biology endeavours in plants clearly lag behind those in microbes. The most advanced developments
encompass the production of biofuels, for which possible strategies in various stages of development were
identified. In the long term, synthetic biology will likely involve the environmental release of higher plants,
mostly intended for use in the bioenergy sector.
Organisms developed by synthetic biology are expected to differ significantly from their presently existing
counterparts concerning their properties but also fitness, including potential invasiveness and persistence.
There is still considerable uncertainty concerning future developments, consequently the analysis risk
assessment and risk management procedures has to remain general at this stage. One major requirement will
be to enhance the predictability of synthetic organisms to fill knowledge gaps due to limited information from
practical experiences and to identify the best experimental set-ups. It is also of pivotal importance to establish
data requirements and appropriate safety levels, an effort to be aided by adequate risk research. Another
important aspect is to intensify efforts concerning international coordination to reach a consensus as to which
developments fall under the scope of synthetic biology. In this context, there is the urgent need to define clear
and legally binding rules and control measures for actors in the field.
5
Synthetic Biology | Zusammenfassung
Zusammenfassung
Synthetische Biologie und synthetische Genomik sind neu entstehende Forschungsfelder, die aufgrund ihres
enormen Potenzials in den unterschiedlichsten Anwendungen viel Aufmerksamkeit auf sich ziehen. Bis heute
gibt es weder eine allgemein akzeptierte formale Definition der Begriffe noch eine systematische Koordination
der einzelnen Forschungs-und Entwicklungsanstrengungen. Dieser Bericht gibt einen Überblick über den
aktuellen Status betreffend Definitionen und den konzeptionellen Rahmen und zeigt die Vielfalt der
potenziellen Akteure und ihre unterschiedlichen Hintergründe und Ansätze. Basierend auf dem Stand von
Wissenschaft und Wissen und die Abschätzung der möglichen Anwendungen werden Ansätze zur
Risikobewertung und Risikomanagement diskutiert. Der Bericht schließt mit Empfehlungen zum
Handlungsbedarf.
Die am häufigsten verwendete Definition der synthetischen Biologie beschreibt sie als die Planung und
Konstruktion von neuen biologischen Teilen, Baugruppen und Systemen oder alternativ als Re-Design
bestehender natürlicher biologischer Systeme für nützliche Zwecke. Ein wesentliches Merkmal in der
synthetischen Biologie ist die Anwendung von ingenieurwissenschaftlichen Prinzipien, die auf die Entwicklung
und Realisierung von Organismen mit bisher nicht bestehenden neuen Eigenschaften abzielen. Das kann durch
zwei Ansätze erreicht werden, entweder im Aufbau "bottom-up" oder auf der Grundlage des Minimalgenom-
Konzeptes ("top-down"). Der erste Ansatz beinhaltet Grundbausteine (Teile), die aus Stücken synthetisierter
DNA zusammengesetzt sind, und die für die Gestaltung und die Konstruktion von Baugruppen (mehrere Teile
mit definierten Funktionen), biologischer Wege und letztlich ganzer Designer-Genome verwendet werden.
Eine Reihe von Ansätzen zur Herstellung synthetischer Genome wurde entwickelt, die auf der Standardisierung
von Teilen basieren, um den Aufbau zu erleichtern. Der entgegengesetzte Top-Down-Ansatz beruht auf der
Verkleinerung des Genoms bis zum minimalen Satz von Genen, die das Leben unter definierten Bedingungen
aufrechterhalten. Diese Minimalzellen, auch als "Chassis" bezeichnet, dienen als Plattform/Zellfabriken, in die
synthetische Elemente hinzugefügt werden können. Die bevorzugten Plattformen sind gut untersuchte
Modellorganismen wie Escherichia coli oder Hefe, die als Wirtsorganismus für die Expression von pflanzlichen
Stoffwechselwegen verwendet werden können. Bestehende Anwendungen von Mikroben zielen auf die
Erzeugung von gewünschten Verbindungen wie Biokraftstoffen oder Pharmazeutika ab, die in geschlossenen
Systemen produziert werden. Angesichts der Unsicherheit über die Auswirkungen unbeabsichtigter
Freisetzung, ein Szenario, das zudem nicht rückgängig gemacht werden kann, sind zuverlässige
Sicherheitsmaßnahmen von größter Bedeutung.
Die Verwendung von synthetischer Biologie in Pflanzen liegt deutlich hinter jener in Mikroben zurück. Die
fortschrittlichsten Entwicklungen umfassen die Produktion von Biokraftstoffen, für die mögliche Strategien in
verschiedenen Stadien der Entwicklung identifiziert wurden. Auf lange Sicht wird die synthetische Biologie
wahrscheinlich die Freisetzung in die Umwelt von höheren Pflanzen vor allem für den Einsatz im Bioenergie-
Sektor mit sich bringen.
Für Organismen, die durch synthetische Biologie entwickelt werden, wird erwartet, dass sie sich von den
gegenwärtig existierenden Gegenstücken nicht nur durch ihre Eigenschaften, sondern auch in ihrer Fitness
wesentlich unterscheiden, einschließlich potenzieller Invasivität und Beständigkeit. Es gibt immer noch
erhebliche Unsicherheit über künftige Entwicklungen, damit muss die Analyse der aktuellen Risikobewertung
und Risikomanagement-Verfahren in diesem Stadium allgemein bleiben. Eine wichtige Voraussetzung wird
sein, die Berechenbarkeit von synthetischen Organismen zu verbessern, damit Wissenslücken aufgrund der
begrenzten Informationen aus der Praxis zu füllen und die besten experimentellen Anordnungen zu
identifizieren. Es ist auch von zentraler Bedeutung, Datenanforderungen und entsprechende Sicherheitsstufen
festzulegen, ein Bestreben, das mit einer angemessenen Risikoforschung zu unterstützen ist. Ein weiterer
6
Synthetic Biology | Zusammenfassung
wichtiger Aspekt ist, die Bemühungen um die internationale Koordinierung zu intensivieren und einen Konsens
über die in den Bereich der synthetischen Biologie fallenden Entwicklungen zu erreichen. In diesem
Zusammenhang besteht die dringende Notwendigkeit, klare und rechtsverbindliche Vorschriften und
Kontrollmaßnahmen für Akteure im Bereich zu definieren.
7
Synthetic Biology | Background and Aims
Background and aims

In this study, we present an overview of the intensively discussed field of synthetic biology/synthetic
genomics. It has been included into the catalogue of emerging techniques that are currently being evaluated
by regulatory bodies in a number of countries, including the European Union (Lusser et al. 2011). Using
synthetic biology/synthetic genomics, existing organisms may be reproduced in vitro, natural ones be modified
or completely artificial organisms be created.
To date there is no conclusive decision as to a formal definition of synthetic biology or synthetic genomics.
Based on a comprehensive literature research current definitions of “synthetic biology” and “synthetic
genomics” are presented; a clear bias towards the use of the term “synthetic biology” was identified. The
literature research provided the conceptual framework of this report. Following this general assessment,
state-of-the-art methods applied to assemble synthetic genomes are reviewed, and the relevant approaches,
methods and techniques to build a synthetic genome are discussed. Particular attention is paid to the major
elements of synthetic genomic approaches, i.e. parts, genes, devices pathways and genomes. Parts are
generated from synthesised DNA and are assembled to larger units following a clear design.
The next part of this report focuses on existing and emerging applications of synthetic biology. Whereas there
have been major advances in microbial systems, the technique is still in its infancy in the plant field. In most
cases these organisms are grown in contained systems, which is also the case for heterologous hosts that are
used to express plant pathways created by synthetic biology approaches. The latter may also be seen as
developments that aid future applications in higher plants. Even though developed for closed systems it
cannot be excluded that these microorganisms are released unintentionally. Potential deliberate
environmental release scenarios are related to the microbial field and to “plant-like” systems like microalgae,
and implications for risk management are discussed.
Despite the currently prevailing preference for contained use of microbes and microalgae, some applications
might also involve deliberate release of higher plants. Considerable potential of the technique related to
industrial applications is forecast. The most important are the production of valuable compounds and uses in
the bioenergy sector, which will potentially lead to environmental release. In view of this, the major
differences between current risk assessment procedures for genetically modified plants and those relevant for
synthetic biology approaches are highlighted.
The report concludes with recommendations. We raise aspects that should be considered when evaluating the
challenges related to possible applications of synthetic biology. Due to the fast development of the field these
recommendations are indicative as contemporary uncertainties concerning future uses have to be taken into
account.
8
Synthetic Biology | Introduction
1 Introduction
1.1 What is synthetic biology?
Synthetic biology is an emerging field that potentially offers an indefinite number of possibilities and potential
applications. To this end, it integrates a number of different disciplines from engineering to basic science that
join in a common effort to achieve a previously determined aim. The ongoing discussions concerning the
definition of synthetic biology point towards the lack of global coordination of the developments in the field.
As a consequence, also no widely accepted definition of synthetic biology has emerged to date. Briefly, it may
be summarised as the application of engineering principles to the fundamental components of biology (see
also http://www.synbioproject.org/), an explanation elaborated by the NEST (New and Emerging Science and
Technology) High-Level Expert Group (EC 2005):
Synthetic biology is the engineering of biology: the synthesis of complex, biologically based (or inspired) systems
which display functions that do not exist in nature. This engineering perspective may be applied at all levels of the
hierarchy of biological structures – from individual molecules to whole cells, tissues and organisms. In essence,
synthetic biology will enable the design of ‘biological systems’ in a rational and systematic way.
Following this depiction, the aims of synthetic biology are to systematically improve existing biological systems
and create new ones (Arpino et al. 2013). With this in mind, synthetic biology is characterised by a dual
definition, aiming on the one hand to construct new biological parts (e.g. promoters, terminators, open
reading frames), devices (combinations of parts) and systems (biological entities, from biological structures to
organisms), and on the other hand to re-design existing parts (Porcar and Pereto 2012). To achieve these aims,
a specific objective is designed a priori and the functionality for defined inputs and outputs is specified.
Synthetic biology pursues to make the engineering of biological systems easier and more predictable (Kitney
and Freemont 2012). Emerging from basic science, well-characterised biological components are provided,
from which standard modular parts are constructed (Haseloff and Ajioka 2009). These modular/molecular
parts are nucleic acids and proteins, and the aim is to assemble them in a way to predict their behaviour
(Haynes and Silver 2009). They are used to design proteins with novel functions, to build genetic circuits
(biological parts designed to perform specific logical functions), or synthetic genomes (Polka and Silver 2013).
(Re-)designing of a system includes transcriptional, translational and post-translational parameters, and
standard optimisation and control engineering approaches to find the best parameter choice to achieve a
desired objective. Like in other fields of engineering, standard systems can be produced from standard
devices, i.e. functional combinations of parts, which, in turn, are produced from standard parts (or
components) (Kitney and Freemont 2012). It becomes clear that standardisation is a key prerequisite to
engineering efforts, the results of which are verified by combining simulations and analytical methods (Arpino
et al. 2013).
The design and generation of new biological parts for the modular construction of biological genetic systems
(Zurbriggen et al. 2012) is a key aspect of synthetic biology. Basic prerequisites for a synthetic biology
approach are sufficient data on genes, proteins and metabolites, the decline of costs and increase in efficiency
of oligonucleotide synthesis, and the development of precise techniques for studying cellular metabolism
(Yadav et al. 2012). Breakthrough technologies to enable efficient and successful use of synthetic biology are,
inter alia, improved DNA synthesis, advances in high-throughput DNA sequencing and large-scale
biomolecular modelling of metabolic and signalling networks (Esvelt and Wang 2013). Furthermore, detailed
knowledge of the host cell (referred to as “chassis”), thorough characterisation of parts, their functional
9
behaviour and compatibility, and the possibility to assemble multiple DNA sequences is necessary (Kitney and
Freemont 2012).
1.1.1 The scientific landscape of synthetic biology

Oldham et al. (2012) published an overview to aid understanding of synthetic biology by analysing
publications, key terms, local distribution of researchers and organisations, and mapping the subjects and
citing landscapes. The study provided a baseline for related research, and concluded that – at the time of the
publication – almost 700 organisations in 40 countries worked on genetic components, parts and organisms
with potential for a wide range of applications. Their work also impressively demonstrated that one of the
major characteristics of synthetic biology is its trans-/interdisciplinarity at the intersection between biology,
chemical engineering, chemistry, electrical engineering, physics, and computer science (Peccoud and Isalan
2012; Schmidt 2008).
Figure 1: Trans-/interdisciplinarity of synthetic biology; from Polizzi (2013)
Synthetic biology uses the engineering principles of modularity, characterisation (in vitro, in vivo, reference
parts under different conditions), and standardisation (Kitney and Freemont 2012). Many of the methods and
techniques which are used in this context are derived from other fields (Kitney and Freemont 2012). Synthetic
biology applies knowledge from a variety of disciplines like molecular biology, chemistry, biotechnology,
information technology and engineering (Haynes and Silver 2009). Foundational science for synthetic biology
includes genomics, structural biology, biochemistry, systems biology, molecular and cell biology, chemical
biology, protein engineering and design, and tissue engineering and biomaterials. Platform technology is a
suite of tools and methods which can be applied across a range of fields (Kitney and Freemont 2012). Standard
systems are produced from standard devices that are produced from standard parts (or components, in this
case a sequence of DNA with certain characteristics).
10
Synthesising new genomes is in the real sense comparable to a construction project (Wang 2010). Errors must
be minimised, and synthetic genomes may fail in design, in synthesis or in boot-up (i.e. transplantation to a
new host). Design errors are the most crucial, as new designs may fail due the presence of toxic genes, the
absence of essential genes, or improper genetic regulation (Wang 2010). Such errors, however, will show
themselves only after synthesis.
Early synthetic biologists created simple gene regulatory circuits whose dynamics were described using simple
mathematical models. An “engineering workflow” was established that incorporated quantitative design,
physical construction, experimental measurement and hypothesis-driven debugging (Cameron et al. 2014).
A major challenge of synthetic biology is that the focus of biological engineering shifts from individual genes to
entire genomes. Despite major advances, designing and building a genome to produce the desired phenotype
has proven exceedingly difficult, as phenotypes need to be accurately predicted from genotype. Genome
engineering aims at constructing a genotype that gives rise to a desired phenotype, an approach that requires
identifying the number of changes that have to be made to an existing genome. According to Esvelt and Wang
(2013) a genome-scale approach involves sequence modifications to at least two distinct regions of a genome.
Such approach requires sophisticated genome design tools, and genomic designs need powerful predictive
models.
Whole genome engineering included the synthesis of the Mycoplasma mycoides genome (Gibson et al. 2010),
the design of synthetic chromosome arms that lacked unstable elements in yeast (Dymond et al. 2011), or the
redesign of a fully functional chromosome III, again removing all elements potentially causing instabilities
(Annaluru et al. 2014).
Currently large-scale de novo synthesis of a genome is more demanding than editing an existing genome, and
may fail even due to small errors in essential genes (Esvelt and Wang 2013). However, it is the method of
choice for larger-scale alterations. In any case the approach currently involves step-wise construction and
testing of intermediates (high-throughput sequencing, phenotypic and functional tests) to check whether the
design goals have been met.
Successful designing aims at a dedicated objective under various constraints (i.e. the context), which should be
reached by defining a set of specifications (Esvelt and Wang 2013). Despite recent successes in prediction of
genotype-to-phenotype behaviour (Karr et al. 2012), biological complexity, combinatorial variations, and
computational limitations restrict predictive modelling. Biological complexity is believed to be one of the most
significant barriers to rational genome design. As an alternative to in silico prediction empirical analysis and
next generation sequencing approaches may contribute to genomic designs (Esvelt and Wang 2013). One
approach to collect suitable data is genome-scale mutagenesis. Various mutagenesis techniques, including
recombinases, zinc-finger nucleases, transcription activator-like (TAL) effector nucleases, clustered regularly
interspaced short palindromic repeat (CRISPR) nucleases, etc., are available, but suitable techniques for
multiplexed genome engineering are still under development. Esvelt and Wang (2013) suggested Multiplex
Automated Genome Engineering (MAGE) that makes use of an oligo to precisely engineer sites in the genome.
11
Synthetic Biology | Definition and delimitation
2 Definition and delimitation of synthetic biology

2.1 “Synthetic biology” and “Synthetic genomics”
The origin and, as a consequence, the definition of synthetic biology are not well established (Stephanopoulos
2012). A consensus has yet to be reached on a precise definition of synthetic biology (Cameron et al. 2014).
Although there is general assent to differentiate synthetic biology from biotechnology, metabolic engineering
and systems biology, it is still difficult to distinguish it from more traditional engineering goals, and implies,
e.g., a higher rate of sophistication as compared to metabolic engineering (Porcar and Pereto 2012). One
characteristic, however, is the use of molecular biology tools and techniques to forward-engineer cellular
behaviour; to reach this, a set of common engineering approaches and laboratory practices have developed.
The principal idea was to follow a bottom-up approach based on molecular “parts” that should be used to
forward-engineer regulatory networks. The first genetic circuits were created using Escherichia coli, and were
described using simple mathematical models (model-based design approach). The desired behaviour,
however, was only reached after replacing parts.
Porcar and Pereto (2012) proposed to restrict the term “synthetic biology” to four research fields:
 Model-inspired research following strict engineering principles applied to biotechnology

 Top-down approaches significantly simplifying cell complexity and aiming to implement semi-synthetic
cells that are easier to manipulate further (in a broad sense, a chassis)
 Bottom-up, empirical explorations aiming at de novo construction of increasingly complex proto-cells,
displaying a link between genotype (informational substance) and phenotype/behaviour
 Xenobiology research
They also suggest “exclusion criteria”, like lack of design, use of assay/error tuning strategies, lack of
orthogonality and/or modularity, and in addition propose that ad-hoc strategies and standard-free approaches
are incompatible with the concept.
According to Stephanopoulos (2012) it is important to distinguish synthetic biology from other areas to avoid
the replication of existing fields under a different name.
There is no official or formal definition of “synthetic biology” or “synthetic genomics”.

One frequently cited (and modified) definition of “synthetic biology” is that on http://syntheticbiology.org/:
Synthetic biology is
A) the design and construction of new biological parts, devices, and systems, and
B) the re-design of existing, natural biological systems for useful purposes.
More papers include a definition of “synthetic biology” compared to “synthetic genomics”. Following analysis
of the two terms, they appear to be interchangeable; no clear difference between them could be found in
various publications.
König et al. (2013) tried to differentiate between “synthetic biology” and “synthetic genomics”:
Synthetic biology is the design and construction of biological components, functions and organisms (that do
not exist in nature) and the redesign of existing biological systems (to perform new functions)
Synthetic genomics encompasses technologies for the generation of chemically synthesised genomes to allow
for simultaneous multiple changes to the genetic material of organisms.
The following main elements of synthetic biology (genomics) are identified in the definitions:
12
 Engineering principles are applied and include metabolic engineering as the simplest form of synthetic
biology up to the engineering of complex biological entities (regulatory networks, systems, organisms,
ecosystems). In this context the term “construction” is frequently used to describe the construction of
biological parts but also systems.
 Synthetic biology is clearly defined as inter- or transdisciplinary field. It includes the use of state-of-
the-art molecular technologies (“omics”-approaches).
 Novelty: concepts and design, and the used elements like biological parts, devices, and systems are
novel. New functions and unique functionality are created.
 The basis encompasses naturally existing elements from biological blueprints that are engineered to
improve their function. By this, a toolbox of biological building blocks (“BioBricks™”) is created.
Systems are designed from simple, predictable and powerful modules. The ultimate aim is to be
independent from standard biological “bricks”.
 Minimal genomes are constituted in order to render the outcome predictable and efficient. These
genomes contain only the essential parts.
 Self-replication is an important feature of the resulting living organisms.
 Knowledge on the behaviour of biological systems is the basic prerequisite for the concept.
In conclusion and based on the published definitions, for the purpose of this project we propose to define
synthetic biology/genomics as
 The design and construction of novel organisms with the capability to self-replicate, based on the
concept of minimal genomes and by using well-defined biological building blocks.
Note: In September 2014 an “Opinion on Synthetic Biology I Definition” was published addressing a mandate
on synthetic biology from Directorates Health and Consumers (SANCO), Research and Innovation (RTD),
Enterprise and Environment to the three Scientific Committees Health and Environmental Risks (SCHER),
Emerging and Newly Identified Health Risks (SCENIHR), and Consumer Safety (SCCS). The Opinion includes an
operational definition for synthetic biology (SCENIHR et al. 2014):
SynBio is the application of science, technology and engineering to facilitate and accelerate the design, manufacture
and/or modification of genetic materials in living organisms.
2.2 Synthetic biology, systems biology, metabolic engineering and the need to
differentiate between the fields
There is general assent that synthetic biology is a well-defined field different from systems biology, metabolic
engineering and biotechnology (Porcar and Pereto 2012). On the other hand, there is a close coupling between
synthetic biology, systems biology and metabolic engineering (Nielsen and Keasling 2011). The techniques and
methodology developed in synthetic biology are also important to promote the development of systems
biology (Kitney and Freemont 2012).
In the course of our literature research we identified the need to distinguish between synthetic biology and
metabolic engineering. However, it has also been found to be difficult if not impossible to distinguish some
aims of synthetic biology from more traditional engineering goals (Porcar and Pereto 2012), and that to date
there is no consent concerning the boundaries between synthetic biology and metabolic engineering (CBD
2014).
13
2.2.1 Systems biology

Systems biology is a discipline that models processes (e.g. regulatory networks), and iteratively tests and
improves these models (Ehrhardt and Frommer 2012). It emerged from molecular biology, when the progress
in automated DNA sequencing and improved computational tools allowed scientists to combine
experimentation and computation to reverse-engineer cellular networks (Cameron et al. 2014). It is an
“interdisciplinary approach that attempts to develop and test holistic models of living systems.” Systems
biology lays the basis for engineering organisms, i.e. synthetic biology, and includes, inter alia, novel
approaches like nanoreactors, attempts to redesign networks and pathways, and includes the synthesis of
complete chromosomes (Ehrhardt and Frommer 2012). It is based on either a “top-down” systems approach
that “uses quantitative modelling to identify and describe the underlying biosynthetic and regulatory networks
of a system” or a “bottom-up” approach that “attempts to model the systems-wide phenotypes that emerge
from component interactions”.
2.2.2 Metabolic engineering

Metabolic engineering may be defined as the optimisation of genomic and regulatory processes within cells
and tissues with the aim of increased production of desired substances and/or the reduction of unwanted
substances; it can lead to more energy efficient biochemical processes and reduce large-scale production costs
(Ellis and Goodacre 2012).
It is about the design, engineering and optimisation of pathways for the production of a variety of products,
including fuels, materials and chemicals (Stephanopoulos 2012). As maximising the production of a desired
metabolite generally involves quantitative evaluation and adjustment of cellular metabolism (Boyle and Silver
2012), synthetic biology approaches may contribute tremendously to the possible outcomes. Concomitantly,
however, it is difficult to draw clear borders between the two disciplines.
Like synthetic biology, metabolic engineering focusses on the improvement and/or design of cells, following
different strategies like the enhancement of substrate range, production of novel products, increased yield
and productivity, and augmentation of cellular robustness (Nielsen and Keasling 2011). In most cases, the
design and construction of platform cell factories requires both synthetic biology and metabolic engineering;
due to advancements in systems biology it is expected that continuously more efficient cell factories will be
developed.
The design of organisms to produce important metabolites is frequently mentioned as one of the main
applications of synthetic biology (Boyle and Silver 2009). Although the reconfiguration of metabolism is a
challenge due to the complex regulation of the metabolome, synthetic biology advanced in the context of
metabolic pathway optimisation and metabolic engineering (Stephanopoulos 2012). The basic elements of
metabolic engineering within the context of synthetic biology are pathway design, construction, and
optimisation. However, while it may be relatively easy to build a pathway, its improvement to support a
commercial process can be a tedious process.
The major prerequisite to successfully engineer cellular metabolism is to understand metabolic reactions and
regulatory elements that affect metabolic throughput (Boyle and Silver 2012). Two stages may be identified: a
proof of concept stage – novel enzyme combinations to produce a desired product – and an optimisation stage
– regulatory adjustments to improve product yields. The necessary elements include approaches for
transcriptional and translational pathway control, spatial pathway control (through for example scaffolds,
subcellular compartmentalisation, and synthetic (microbial) consortia), and modelling and measuring the
metabolic network. The emerging engineering design cycle includes both in silico modelling and prediction as
well as directed evolution and screening. Metabolomics (including metabolic profiling, metabolite flux analysis,
14
metabolic fingerprinting, and metabolic footprinting) contributes to the understanding of metabolic networks,
which will greatly assist synthetic biology (Ellis and Goodacre 2012).
Porcar and Pereto (2012) suggested that implementing a complex pathway into a heterologous host that in
addition is constantly adjusted and optimised (the “sophistication of a genetic modification”) renders an
approach “synthetic biology”.
Systems metabolic engineering has developed from metabolic engineering (Yadav et al. 2012). Instead of
deleting or over-expressing endogenous genes and introducing heterologous genes, gene expression and
regulatory networks are manipulated throughout the cell. Thus, metabolic engineering by now involves
knowledge far beyond the control of pathway gene expression (Stephanopoulos 2012). It furthermore includes
approaches beyond genetic engineering and molecular biology by making use of synthetic genetic constructs
like networks or circuits.
While contemporary metabolic engineering focuses on altering existing pathways, future engineering will
design metabolisms and minimal organisms de novo (Bilgin and Wagner 2012). Metabolic engineering
applications are expected to increase dramatically, also fostered by market forces, concern about
sustainability and the associated increasing interest in the production of products from renewable resources
(Stephanopoulos 2012). Arpino et al. (2013) and Yadav et al. (2012) conclude that “instead of becoming a state
of the art discipline, metabolic engineering has remained a collection of elegant demonstrations” – not
surprisingly, synthetic biology has the potential to aid future developments in this field significantly. Synthetic
biology opens the possibility to synthesise and control non-natural pathways, whereas metabolic engineering
provides the basic methods to design analyse and optimise them.
2.2.3 Synthetic metabolic pathways

A driving force for advances in synthetic biology is the idea to streamline pathways in industrial biotechnology,
for improved production of biopharmaceuticals, fine chemicals or biofuels and biodegradation of wastes.
Research endeavours applying the principles of synthetic biology to the improvement of metabolic pathways
are summarised under the keyword of “metabolic engineering” (Comba et al. 2012).
Biotechnology, i.e. synthesis or energy conversion in living microbial cells is centuries old, and the employment
of genetically engineered strains has become a routine since decades. Therefore it is difficult to distinguish
between classical genetic engineering and synthetic biology in this context.
Current scientific reviews on metabolic engineering typically refer to pathway modularisation, multiplex-
automated genome modification, metabolic flux analysis and dynamic control using regulatory devices. These
approaches have mostly been exemplified in the construction of heterologous terpenoid biosynthesis
pathways. Terpenoid biosynthesis is of particular interest, since potent plant-pharmaceuticals, such as the
anti-malaria agent artemisinin and the anti-tumour component taxol are derived from terpenoid moieties.
Terpenoids are also building blocks for carotenoid pigments which are suitable for colorimetric high
throughput analysis of experimental success. In metabolic engineering, terpenoid biosynthesis genes from
bacteria, yeasts and various plants are combined for optimised cost-effective production in Escherichia coli
(Yadav et al. 2012; Xu et al. 2012; Comba et al. 2012). However, the same principles may be applied to any
biotechnological pathway. The project list of the iGEM competition website may provide an idea of the
application potential of metabolic engineering (http://2013.igem.org/Jamboree/Team_Abstracts). Genome-
scale metabolic engineering may be attempted by in vivo editing or de novo synthesis (Esvelt and Wang 2013).
15
2.2.4 Is it synthetic biology or still conventional biotechnology?

Many approaches are in the interphase between conventional biotechnology practice and synthetic biology.
According to Nielsen and Keasling (2011) the difference may be described as a “platform cell factory” that
would not naturally produce any of the chemicals, and into which a synthetic (rationally designed or synthetic)
pathway is transferred (synthetic biology). Montague et al. (2012) define and distinct synthetic genomics from
genetic engineering based on “engineering and manipulation of genetic material of an organism on the scale
of the whole genome either in terms of number of base-pairs, or number of loci engineered” as the major
feature. In addition, even if the scope is engineering an individual biosynthetic pathway, the “pathway must
function in a biochemical and regulatory context with many inputs and outputs” (Montague et al. 2012).
Key components for the construction of non-natural pathways are synthetic DNA, advanced molecular
switches for controlling the state of the metabolism, and protein and pathway engineering provided by
synthetic biology (Stephanopoulos 2012). By applying these components enzyme activity and specificity is
improved, cofactors and currency metabolites are balanced, yields are increased and effective direct product
synthesis is achieved. Although a pathway might be coded for by only a few genes, changes to the genome,
e.g. by increasing the yield, highlights the difference between synthetic biology and genetic engineering
(Montague et al. 2012).
2.3 Some limits to “bio-part engineering”

The understanding of biology will continue to be for a long time the limiting component in any attempt to
reconstruct or emulate biological systems, in whole or in part (Stephanopoulos 2012). Understanding the
context of metabolic networks and its correlation with metabolite concentrations is one of the major
challenges to which meta-omics studies contribute significantly (Boyle and Silver 2012). However, the
complexity of living cells to date surpasses the complexity of human-made devices. Due to limited background
knowledge complete forward engineering of entire cells is not yet possible (Nielsen and Keasling 2011). In the
long term plant metabolism could be engineered based on synthetic strategies to produce compounds with
novel chemical properties (Zurbriggen et al. 2012). However, to date the engineering of biosynthesis pathways
is tedious due to its complexity and consequently limited knowledge, in particular on plant genes. Successfully
assembled biological systems are still of low actual complexity and typically contain less than ten promoters
(Purnick and Weiss 2009) or have limited capacity concerning assembly of genes and their maximum size (Xu
et al. 2012). Furthermore, important synthetic biology tools are currently only demonstrated within
Escherichia coli and Saccharomyces cerevisiae, limiting these tools to a narrow set of organisms (Montague et
al. 2012). Most projects are being realised in laboratory cultures of microorganisms.
The result of the engineering process when aiming at the production of desirable compounds has to be high
yield and high titres (Nielsen and Keasling 2011). This is not an easy task, as inserting a new synthetic path may
lead to a sudden drain of a precursor metabolite, from which a number of metabolites is produced. Thus, it
may be expected that the initial yield and productivity after reconstruction is low, and the flux has to be
redirected toward the desired product.
The production of plant-derived natural products is challenging due to the complexity of the compounds but
also to the complexity of their native production hosts (Li and Pfeifer 2014). Synthetic biology offers the
possibility to overcome these hurdles by designing biosynthesis pathways in heterologous host. The main
challenges if a pathway is adapted to be expressed in a heterologous host (e.g. a plant biosynthetic pathway in
microbes) are the necessity to have genetic sequence information, proper design of sequence information for
active gene expression, biosynthesis and improved production metrics (Li and Pfeifer 2014). These limitations
are due to the fact that the majority of tools and techniques cannot be transferred between hosts and that the
functioning of parts and modules depends on the cellular context. For example the abundance of RNA
16
polymerase and ribosomes and even promoter repression/activation depend on cellular growth rates.
Therefore genetic systems do not work predictably across strains despite standardisation efforts (Arpino et al.
2013).
Synthetic biologists generally have to deal with intricate biological phenomena, such as cross-talk, cell death,
epigenetics, mutations, evolution and noise (Purnick and Weiss 2009). Altogether, our ability to construct
genetic systems from basic DNA parts is limited by our incomplete understanding of regulatory mechanisms in
the cell (Yadav et al. 2012).
The major challenges to be solved are robustness and noise suppression (Arkin and Fletcher 2006). There
might be different exogenous noise sources under different environmental conditions. Thus, the cell has to be
designed in a way to minimise or even exploit these effects.
17
Synthetic Biology | State of the Art
3 State of the Art

3.1 Overview of paths to synthetic life
3.1.1 Top-down or bottom-up

The behaviour of synthetic biology parts within a particular host has to be defined to render it repeatable
(Kitney and Freemont 2012). Numerous genes are involved in cellular communication while others have been
shown to be non-essential to cell functioning. It was early suggested that it would be possible to reduce
genome complexity to a minimal set of genes able to sustain (under given external conditions) cell life and
reproduction. This idea is exploited in the so-called top-down approach. The bottom-up approach starts
constructing a synthetic cell from scratch: a life-like entity is built by assembling of molecular components.
These can be of biological nature or instead completely ad hoc chemical components. Between these two
approaches is the concept of xenobiology, which aims at the construction of functional alternative nucleic
acids (Porcar and Pereto 2012).
The top-down approach aims at simplifying already reduced cells to get a “chassis” for synthetic biology
devices to be mounted on and has been tried in bacteria and yeast. Non-essential genes – commonly
responsible for adaptation to stress or altered environmental conditions – are removed, as are intergenic
regions. Prerequisite is a thorough analysis of suitable regions, usually by employing mutants.
For the bottom-up-approach the whole minimal sequence is compiled from scratch, synthesised and
transferred into a suitable cellular casing. After pioneering work in 2007, the approach has been successfully
used in Mycoplasma genitalium and Mycoplasma mycoides/Mycoplasma capricolum (Lartigue et al. 2007;
Gibson et al. 2008; Gibson et al. 2010). Three major research endeavours may be identified: the large scale
synthesis of microbial genomes, the redesign of metabolic pathways (production of desirable compounds), and
the rational design of genetic logic devices from modular DNA parts (Agapakis et al. 2012).
3.1.2 Prerequisites
Techniques to assemble synthetic genomes
DNA synthesis technologies allow creating entire genomes. In synthetic biology, custom-made DNA is used to
build larger DNA segments, and groups of these fragments are pieced together into larger fragments that are
assembled until the desired DNA product is obtained (Montague et al. 2012). There are ligation dependent
methods, like BioBrick™ and Golden Gate, and overlap dependent methods to assemble overlapping
fragments (see Patron (2014) for a review). Two of the most commonly used methods are BioBricks™ (or
standard assembly) and Gibson Assembly®, complemented by other systems like GoldenBraid, which makes
use of GBparts (fragments of DNA with four-nucleotide overhangs) as minimal standard building blocks
(Gibson et al. 2009; Kitney and Freemont 2012; Sarrion-Perdigones et al. 2013). GoldenBraid has been shown
to serve as a modular assembly system in plant synthetic biology (Sarrion-Perdigones et al. 2014). Depending
on the size, a range of methods is available, including inter alia BglBricks, CPEC (Circular Polymerase Extension
Cloning), Golden Gate, and for larger assemblies sequence-independent overlap methods such as SLIC
(Sequence- and Ligation-Independent Cloning), InFusion™, Clontech™, Gibson Assembly®, SLiCE (Seamless
Ligation Cloning Extract), and CPEC USER (Uracil-specific excision reagent cloning). So far, in particular TAR
(Transformation-Associated Recombination in Saccharomyces cerevisiae) and Gibson Assembly® have proved
successful. In contrast to the building of new genomes by DNA synthesis and assembly, alternatively
distributed recombineering methods such as MAGE/CAGE and TRMR in Escherichia coli or Green Monster in
18
Saccharomyces cerevisiae are used. To date, these methods are limited to a narrow set of organisms so that a
number of metabolic and biological tools may therefore not be worked on (Montague et al. 2012).
Standardisation
Standardisation is necessary to accurately reproduce synthetic biology devices and systems. However,
concomitantly the full characterisation of parts is necessary, which has currently not yet been reached to a
sufficient extent. Parts usually need to be characterised in a specific genetic or environmental context and do
not function in a predictable manner when taken out of this context. Thus, it will be necessary to solve the
issues of parts characterisation and interoperability by increasing the scope and diversity of tested designs
(Cameron et al. 2014).
Registry of parts
To make use of parts efficiently, the need for a professional registry of parts was identified (Kitney and
Freemont 2012). The registry comprises a database and should include the full characterisation of parts in the
context of suitable hosts. To tackle the storage and assembly of genetic parts, the Registry of Standard
Biological Parts (RSBP) was established, which facilitates the methodological assembly of parts into larger
circuits by storing them in the standardised “BioBrick™” format. A standard computational language (Synthetic
Biology Open Language, SBOL) was subsequently developed to describe parts and designs, and to facilitate
their exchange.
Chassis and minimal genomes

A core undertaking in synthetic biology is the “minimal genome” concept, i.e. the minimal set of genes
required to allow cellular life, onto which genes can be added and then transplanted into a chassis (Acevedo-
Rocha et al. 2013). The minimal genome contains the simplest possible components to sustain reproduction,
self-maintenance and evolution (Sole et al. 2007; CBD 2014). To develop a core or minimal chassis the genome
is reduced to a functionally useful set of genes. The result should be a simple, predictable and programmable
chassis that is able to propagate in a safe and controllable manner, including mechanisms preventing
unintended release into the environment and ensuring isolation from other organisms. The minimal genome
allows avoiding potential risks by, e.g., minimising the potential of cells to propagate under natural
environmental conditions and excluding pathogenicity. The aim is to generate simple cellular systems, which
may be used to answer scientific questions concerning the systematic interplay of cellular modules (Esvelt and
Wang 2013).
A chassis derives from a well-known, safe platform cell factory, involving the reconstruction of a completely
synthetic pathway and the alteration of metabolic fluxes (Nielsen and Keasling 2011). In industrial production a
few fungal and bacterial cell factories are used, e.g. Saccharomyces cerevisiae for the production of fuels,
Escherichia coli for producing pharmaceuticals, or Corynebacterium glutamicum for the production of amino
acids. Escherichia coli, for example, is an ideal test bed for synthetic biology endeavours because of the already
established deep mechanistic understanding of its biology, its ease of genetic manipulation and the relatively
large number of well-studied gene regulatory systems (Cameron et al. 2014).
3.1.3 Platform cell factories

Synthetic biology and metabolic engineering interact to turn living cells into microbial factories used in
industrial biology (“self-regenerating machines”) (Nielsen and Keasling 2011; Agapakis et al. 2012). The aim is
to have a limited number of “platform cell factories” available to produce a wide range of fuels and chemicals.
A major advantage of such platform is that it may be used to insert many different synthetic pathways. For
example, a platform cell factory may be created such that it produces an important precursor metabolite for
many products, e.g. acetyl Co-A for the production of polyketides (antibiotics, anticancer drugs and
19
immunosuppressors), lipids (dietary supplements, pharmaceuticals and biodiesels) and isoprenoids (perfumes,
biodiesels, antimalarial drugs, antibiotics, rubber, dietary supplements, food ingredients and vitamins).
3.1.4 Cell-free synthetic biology

An alternative and emerging field is cell-free biology, which is defined as the “activation of complex biological
processes without using intact living cells” (Harris and Jewett 2012). It features the ability to focus on
production of a single compound without physical barriers, facilitates substrate addition, product removal and
rapid sampling, provides direct access to reaction conditions, and utilises the entire reactor volume. Another
advantage is that there is no conflict between microbial growth and engineering design objectives. The most
prominent example is cell-free protein synthesis (CFPS), which allows for the synthesis of proteins containing
non-natural amino acids (NNAA, see also 3.2.3.). Major application-oriented advantages of cell-free systems
are that gene expression of multiple products may be tuned to facilitate proper product interactions, reaction
and product stability may be optimised by adjusting DNA template concentrations and controlling the redox
potential for optimal disulphide bond formation, the possibility for recombinant expression of toxic proteins,
and the production of complex biocatalysts (Smith et al. 2014). They overcome inherent limitations of living
cells, enable control of gene expression, chassis optimisation, in situ monitoring, and automation. Cell-free
systems are used to develop new reaction pathways that significantly increase productivity, e.g. to microbe-
based systems. It also allows for the faster and more predictable development of modular gene circuits, as
control of reaction environment and components, and access to the reaction is greatly facilitated –
applications are the engineering of minimalistic artificial cells and cell-like microdevices.
3.2 Construction of a novel cell

Designed and synthesised DNA segments that encode novel functions need to be implemented into a suitable
organism by one of the many available genome engineering techniques or by novel mega-size cloning
strategies (Heinemann and Panke 2006). Complexity, the major problem, is desirable to be reduced. One
option is to reduce the genome of the host into which the new sequence is implemented, which would
eliminate many possibilities for interference. Since numerous genes are involved in cell-cell communication
while others have been shown to be non-essential to cell function it was early suggested that it would be
possible to reduce genome complexity to a minimal set of genes able to sustain cell life and reproduction (Sole
et al. 2007). No matter how small, cell genomes must contain all the information necessary for the cells to
perform essential functions allowing them to maintain metabolic homeostasis (self-maintenance), reproduce
(self-reproduction) and evolve (evolvability) – the three main properties of living cells.
It is important that the synthetic device or system is either decoupled from the metabolic processes inherent
to the viability of the cell or does not adversely affect these processes.
“Microbial synthesis of any plant natural product can be achieved by „precursor-mediated product synthesis“,
in which an existing host pathway is altered to incorporate a heterologous pathway, or by „de novo synthesis“,
in which new-to-host biosynthetic routes are imported. Global approaches have been applied to improve for
example the terpenoid pathway flux in microbial host” (Moses et al. 2013).
3.2.1 Minimal genomes – top-down approach

A minimal genome is the minimum set of genes that is necessary for a cell to propagate under specific
environmental conditions (Heinemann and Panke 2006).
According to theoretical considerations, growth in the presence of a rich but synthetic and defined medium
requires as few as 206 genes, basically comprising the DNA replication, transcriptional and translational
machinery, rudimentary DNA repair functions, protein processing and degradation, cell division and
20
rudimentary metabolic and energy functions (Heinemann and Panke 2006). Relatively large genomes of
established models can, on the one hand, be substantially reduced to reach this goal or, on the other hand,
one can work on the already very small genome of other organisms in exchange for the requirement to
develop novel molecular biology tools (Heinemann and Panke 2006). The smallest genome sizes have been
detected in prokaryotic cells living in symbiosis with other organisms. Notable examples are the human
parasite Mycoplasma genitalium, the archaeal exosymbiont Nanoarchaeum equitans, the insect
endosymbionts Buchnera aphidicola BCc, Candidatus Carsonella ruddii and Candidatus Sulia muelleri. All of
these microorganisms are heterothroph host-dependent bacteria. They are dependent on the chemically
complex environment represented by their respective host cells. As an adaptation to the symbiotic lifestyle,
their genomes underwent a reductive process in which genes that were unnecessary in the new protected
environment or redundant because their functions were provided by the host tended to be lost (Moya et al.
2009).
Which are the essential genes?

The first step of making a minimal cell is to answer the question about how many genes are necessary to
support cellular life. Whether a gene is essential depends on the environmental conditions. Esvelt and Wang
(2013) define a set of useful traits for a biological chassis as:
- Fast growing in minimal media with glucose

- Capable of fermentation
- Amenable to genetic manipulation
- Minimally sufficient such that removal of any additional gene negatively affects the other three stated
considerations
One way to approach the gene composition of a minimal genome is by comparative genomics. The underlying
hypothesis is that genes shared between distantly related species are likely to be essential. It has to be
mentioned that there is an intrinsic limitation of this method: Many essential cellular functions can be
performed by several alternative and unrelated proteins, and will be misled by comparative approaches. The
comparative minimal core (common set of genes) only retrieves those genes involved in functions for which
there is no alternative in nature. The task of determining if there is a minimal deletion core is difficult because
of three critical issues:
1. Redundancy might only be apparent: Inactivation of single genes does not detect essential functions
encoded by redundant genes, and some individually dispensable genes may not be simultaneously
dispensable, a phenomenon called synthetic lethality (Moya et al. 2009).
2. The mechanism of cell division is not yet completely understood: Theoretical considerations of self-
reproduction (transcription/translation machinery, replication machinery and regulation) apply well to
automatic schemes, but it is not guaranteed that this also works in an artificial cell (Noireaux et al. 2011).
Life is not only a program; it relies also on other fundamental nongenetic properties, for example molecular
self-organisation and molecular crowding.
3. Each part of the genome is loosely connected with the rest: when designing novel constructs or cells one
should also bear in mind that there are also fundamental questions on nongenetic processes which are not
defined in a DNA program. A living organism is an open system made of hundreds of chemical reactions
whose properties go beyond the DNA program. The assembly of a synthetic cell unfolds the importance of
physical aspects that are, in vivo, regulated by already evolved gene networks (Noireaux et al. 2011).
Another way is performing large-scale inactivation studies in order to define which genes are essential for cell
survival in several well-characterised bacterial models (Escherichia coli, Bacillus subtilis,…) (Moya et al. 2009),
21
e.g. the systematic inactivation of each individual gene present in a genome. Still, all these methods have
limitations because they uncover several possibilities of misclassification of genes (Moya et al. 2009).
The simplification of modern cells has also been approached in a third way, by searching for the biochemical
description of well-defined pathways that are needed to perform essential functions. Forster and Church
(2006) described a minimal genome that contains just genes needed for informational processes but does not
include genes for intermediate metabolism (e.g. lipid metabolism and glycolysis), representing the main
component needed to synthesise a minimal self-replicative system. Self-reproductive vesicles that are defined
in the minimal genome allow transmembranous small molecule transport. Such a system is entirely composed
of genes with well-defined functions, which are designed by modules and allow a system-by-system debugging
to attain self-replication. Moya et al. (2009) propose that this approach could be a good start to synthesise a
useful, near-minimal, self-replicating system dependent on added energised substrates.
Bacteria with small genome sizes (Moya et al. 2009):
- Mycoplasma genitalium: the 580kb genome is the smallest among organisms that can be grown as pure
cultures, nevertheless it carries all essential genes for informational processes (replication, transcription,
translation, and protein folding and processing) plus a severely limited metabolism. It still represents the
smallest known genome of a bacterium that can be grown in the laboratory and therefore must be close to a
minimal autonomous genome.
- Nanoarchaeum equitans is the only known archaeon exhibiting a symbiotic lifestyle. Its genome size is of 490
kb presents a complete information-processing system and a highly simplified metabolic apparatus.
- Gammaproteobacteria, Buchnera aphidicola BCc and Candidatus Carsonella ruddii are three bacterial
endosymbionts of insects with a very small microbial genome. Their role in their respective symbiosis is to
supply the nutrients that lack in the insect host diet, mainly essential amino acids and vitamins.
- The smallest genome with 1.308 Mb of any cell known to replicate independently in nature corresponds to
the photoheterotrophic marine bacterium Pelagibacter ubique.
3.2.2 De novo construction of a cell – bottom-up approach

Synthetic cells
Contrary to top-down applications, the bottom-up approach starts from scratch: an entity is built by self-
assembling of molecular components (Sole et al. 2007). These can be of biological nature or instead
completely ad hoc chemical components. Another approach is the synthesis of a cell from its basic elements.
Within this approach the comprehensive understanding of three essential components of cellular life – the
DNA information, the compartment and the metabolism – is a prerequisite.
The synthetic cell, built from scratch, is a unique compartment with a structure and an organisation similar to
a bacterium. ATP and GTP are used as energy sources in the first stages of the development. For the
information part, the synthetic DNA programmes would be expressed with the transcription and translation
machineries extracted from an organism. The physical boundary of the artificial cell would be a phospholipid
bilayer. Lipid bilayers are also the natural template for membrane proteins.
The cell wall, anchored to the lipid membrane, provides the structural strength to the bacterium. The
fabrication of a stable compartment with an active interface is one of the most challenging steps in the
synthesis of a DNA-programmed artificial cell. The efficient insertion of membrane proteins into the bilayer is
the real current limitation to the development of an active interface. Membrane proteins can be also
expressed and integrated into phospholipid bilayers (Noireaux et al. 2011).
22
A living organism is an open system made of hundreds of chemical reactions whose properties go beyond the
DNA programme. A continuous uptake of energy and a continuous elimination of reaction by-products are
critical for any living systems as well as for a synthetic cell. The construction of an artificial cell requires the
development of an artificial environment. The external medium has to be an isotonic non-dissipative feeding
solution that maintains physiological conditions by exchanges of low molecular mass nutrients, nucleotides
and amino acids through the phospholipid membrane (Noireaux et al. 2011). Selective exchanges, osmotic
pressure problems, and efficient transcription/translation are among the issues that must be solved to obtain
an initial workable microscopic vesicle.
Chassis
By far the most common chassis in use is Escherichia coli. However, also other hosts as listed below are used.
- Escherichia coli:
1. Is a prominent example whose genome has been reduced up to 15% in various projects without any
noticeable effect on the investigated physiological properties (Heinemann and Panke 2006).
2. Has the advantage of the availability of numerous vectors (plasmids, cosmids, BACs) and promoters for
heterologous expression, and can express genes with G + C codon usage as high as 73%, but does not
recognise promoters from Streptomyces (Zotchev et al. 2012).
3. Escherichia coli is one of the most common chassis used in synthetic biology because it can be grown easily
and has relatively simple genetics which can be easily manipulated. Furthermore non-infective lab-strains
can be constructed.
4. To date Escherichia coli is the best understood cellular life form; its genome has over four million base pairs
of DNA and encodes about 5.000 genes (Glass 2012).
Mycoplasma species:
Mycoplasma genitalium has only 525 genes, about the tenth the number of genes encoded by Escherichia coli
(Glass 2012). It has a very slow growth rate compared to e.g. Mycoplasma capricolum. Mycoplasma capricolum
was used as a chassis by Gibson et al. (2010) for the transplantation of a digitised genome sequence of
Mycoplasma mycoides.
- Bacillus subtilis:
Bacillus subtilis can easily be manipulated in relation to genetic changes. It is sometimes used in the place of
Escherichia coli because it has certain properties that are more amenable to some specific forms of genetic
manipulation related to synthetic biology, as for example DNA circuits can be easily integrated into the
Bacillus subtilis genome (Zotchev et al. 2012).
Minimum genome engineering substantially facilitated the optimisation of Bacillus subtilis as a production
host. Bacillus species are mainly used to produce important enzymes (e.g. alpha-amylase) and biochemicals
(e.g. biosurfactants) used in industry (Liu et al. 2013).
Several Bacillus species have evolved as an important platform for the production of various enzymes and
chemicals. A vast range of cellular phenotypes can be obtained in Bacillus species by regulation and
modification of the corresponding metabolic pathway at the global and gene-specific level. The genome
sequence data of Bacillus species is available in specified databases (Liu et al. 2013).
“Bacteria have the functional equivalent of an immune system that evolved to protect them from
bacteriophages, the viruses that infect bacteria. The bacterial immune system is a complex of enzymes called
restriction-modification systems that enable bacteria to recognise and destroy foreign DNA, which would
usually come from an infecting bacteriophage. One of the enzymes is a methylase that chemically modifies
23
DNA bases at specific sequences. Another restriction enzyme labels the bacterium’s DNA as self, and so it
distinguishes self from foreign DNA that would enter the cell during a bacteriophage infection” (Glass 2012).
Yeast does not have this system. The bacterial restriction-modification genes are not expressed while the
genome is cloned in yeast. Any bacterial genome that is isolated from a yeast cell will not have the specific
methylation needed to keep the recipient cell restriction modification system from recognizing it as foreign
DNA and cutting it to pieces. Glass and coworkers managed to mutate the Mycoplasma capricolum
restriction enzyme so that it could no longer cut donor genomes lacking the appropriate methylation.
Obviously there were no differences, other than the restriction-modification systems issues, between
eukaryotic and prokaryotic DNA that would interfere with the genome transplantation process (Glass 2012).
- Yeast
The yeast species which is mainly used as a chassis in synthetic biology is Saccharomyces cerevisiae. It is largely
used in molecular biology, particularly in relation to research on the eukaryotic cell, which links directly into
human biology. They appear to be able to accommodate larger sequences of modified DNA than Escherichia
coli. The eukaryotic microbe has remarkable capacity to combine homologous pieces of DNA, allowing for up
to 200 base pair overlaps between synthetic fragments (Glass 2012).
Cell engineering
This approach pursues the synthesis of minimal but complete genomes and their insertion in cells to redesign
and control metabolic processes (Moya et al. 2009).
According to the kind of modification and the genetic level where the modification takes place Ellis et al.
(2011) categorised three issues:
1. Parts to genes
2. Genes to pathways
3. Pathways to genomes
Roughly, these steps comprise combining parts to produce genes, linking genes to make pathways and devices,
and finally arranging these together to create synthetic chromosomes and genomes.
Table 1: Possibilities for DNA assembly in synthetic biology (Ellis et al. 2011)
The DNA assembly process is still a limiting factor for most laboratories. The methods differ in mechanism and
scale, offering the self-assembly of many parts in a single reaction (parallel assembly), giving constructs with a
24
pre-defined physical arrangement (ordered assembly), or allowing multiple versions of parts to be used
simultaneously (combinatorial assembly). The challenge for synthetic biology is to develop standardised
assembly methods allowing work at all levels of abstraction – genes, pathways and genomes – and to clearly
understand the context dependencies when parts are physically placed next to other parts (Ellis et al. 2011).
Assembly of a gene from its individual parts functionally requires ordered assembly. Scar-sequences – bases
without function left behind by some assembly methods – are undesirable as they often affect how parts
function together, and individual parts possibly cannot be replaced in another way once assembled (Ellis et al.
2011).
An idealised assembly method should be suitable for combinatorial construction from standardised part
libraries, have no forbidden site requirements, and allow for pre-determined order in the final product. It
should also allow rapid assembly in a parallel reaction, working at any scale and only leave scars between parts
that can tolerate them. As currently no single technique is capable to fulfil all these requirements the most
appropriate strategy involves using several techniques in tandem (Ellis et al. 2011).
Genome synthesis
Genome synthesis, i.e. DNA synthesis of entire genomes, entails chemically synthesising DNA molecules from
the four different DNA nucleotides or bases: Adenine, Guanine, Thymine and Cytidine. These four bases are
chemically synthesised from glucose and are linearly assembled in specific sequences using an instrument
called an oligonucleotide synthesiser (Glass 2012).
Figure 2: Strategy for synthesising the genome of Mycoplasma genitalium (Glass 2012)
25
Genome transplantation
Is the process of installing a naked bacterial chromosome into a suitable recipient cell in such a way that the
installed genome commands and reprograms the machinery of the recipient cell. The resulting cell has only
the attributes encoded by the new genome (Glass 2012).
Figure 3: Strategy for making a synthetic bacterial cell (from Glass (2012))
Parts to genes
Current techniques employ standardised restriction enzyme assembly protocols such as BioBricks™, BglBricks
and Golden Gate methods. Alternatively, sequence independent overlap techniques, such as InFusion™, SLIC
and Gibson assembly® (an isothermal assembly) are becoming popular for larger assemblies, and in vivo DNA
assembly in yeast and bacillus appears adept for chromosome fabrication (Ellis et al. 2011).
BioBrick™: a DNA unit with standardised flanking sequences that enables assembly to be achieved by a cheap,
simple and standardised restriction/ligation method. The major downside of the BioBrick™ approach is that
the same eight bp scar sequence is found at every junction. The presence of this scar sequence is unacceptable
at certain positions, notably the RBS (Ribosome Binding Site). The scar is also problematic when assembling
fusion proteins as it encodes an in-frame stop codon.
Another standard, BglBricks has been described that uses different sequences for assembly and leaves a
smaller six bp scar. BglBrick has the advantage of using highly efficient and commonly-used restriction
enzymes whose recognition sequences are not blocked by the most common DNA methylases, Dam and Dcm.
Scarless assembly is possible using other methods, as described in OE-PCR (overlap extension polymerase
chain reaction). This method uses chimeric PCR primers of more than 40 bases in length to create homologous
ends between different DNA molecules. The homology is then used to prime extension in a second round of
PCR between the initial products, and is the basis of most routine gene fusion techniques. The sequences of
the homologous primers direct which parts follow each other, allowing ordered assembly which can be done
sequentially, or even as a parallel reaction. OE-PCR has the power to assemble not just a gene, but the whole
plasmid (CPEC – circular polymerase extension cloning). Like all PCR methods, assembly is problematic when
sequences contain many repeats or are GC-rich. These methods are also limited in their ability to scale up,
plasmids becoming less efficient at larger sizes and by the error rate of PCR.
26
Figure 4: Overview of exemplar DNA assembly techniques (from Ellis et al. (2011))
Genes to pathways (linking genes to construct pathways and devices)

The challenge of assembly at larger scales has led to methods utilising Type II restriction enzymes like the
Golden Gate assembly method: a parallel one-pot, one-step five min technique to assemble seamless
constructs. DNA is inserted into an entry clone shuttle vector which provides the Type II recognition sequences
immediately at both ends of the DNA pieces. Digestion then produces all the fragments for assembly which
ligate in parallel where overhangs are complementary. This method is also suitable to shuffle multiple
fragments.
Forbidden site requirement may occur – this problem can be solved with the oligo-based technology RARE
(RecA-assisted restriction endonuclease), whereby sequence-specific blocking oligos prevent CpG methylation
of tag digest sites, via RecA-mediated binding to homologous sequences (Ferrin and Camerini-Otero 1991).
27
Overlap assembly methods: These methods require DNA fragments for assembly to share at least 20 bp of
common sequence at ends that will be joined. This sequence is processed in vitro by enzymes that perform the
assembly. Several kits are available on the market, such as Gateway® (Life Technologies) and InFusion®
(Clontech). Suited particularly for parallel reactions with several DNA fragments, these techniques are also
often called “chew back and anneal”. They work by digesting back one strand of DNA from each exposed end
of a fragment, leaving a single-stranded overhang that anneals with the complementary overhang of a
fragment sharing the same overlap sequence. The order of the fragments is pre-determined by the sequence
overlap between them.
USER cloning and USER fusion (uracil-specific excision reagent) is a cloning technique which requires a PCR
amplification of fragments using primers that incorporate at least one uracil. No assembly scars are left
behind, seamless assembly is possible. The drawback of this method is that at least one thymidine is required
near the end of the sequence (replaced with uracil), so it is not truly sequence-independent.
Several other ligation-independent cloning methods also exist and a sequence-independent variation SLIC
(sequence- and ligation-independent cloning) has recently been described (Ellis et al. 2011). The Craig Venter
Institute published several overlap methods where whole genomes were assembled in vitro from directly
synthesised five kb fragments designed to have a more than 100 bp overlapping sequence. The Gibson
isothermal assembly method requires a high fidelity DNA polymerase, T5 exonuclease and Taq DNA ligase and
foresees a single 30 min-incubation at one temperature.
Zhang et al. (2012) describe how to assemble multiple DNA fragments into recombinant DNA molecules in a
single in vitro recombination reaction (SLiCE – Seamless Ligation Cloning Extract). This method is based on
bacterial extracts from common RecA- Escherichia coli laboratory strains, which can also be further optimised
by simple genetic modifications, and does not leave any unwanted sequences at the junction sites. SLiCE is also
capable of facilitating recombination between DNA fragments that contain flanking heterologous sequences
and of deleting the extra flanking sequences to generate precise junctions at the recombination sites.
Pathways to genomes
At this level parallel assembly reactions are essential; the order of assembly has to be defined.
TAR (Transformation Assisted Recombination cloning) is a common protocol for manipulation of DNA in yeast.
It undergoes homologous recombination during yeast spheroplast transformation and is predominantly used
to incorporate gene- and pathway-sized DNA assemblies into specific sites in the yeast genome. By including a
yeast artificial chromosome (YAC) replication sequence and a selective marker in one assembly fragment,
assembly of a circular self-propagations construct is achieved. The native recombination enzymes of yeast are
working, so the assembly in yeast is very accurate and it tolerates very large constructs.
For genome sized assembly, yeast is not the only cellular chassis; also Bacillus was used by Itaya et al. (2008).
Gibson et al. (2010) reported the design, synthesis and assembly of the 1.08-mega-base pair Mycoplasma
mycoides JCVI-syn1.0 genome starting from digitised genome sequence information and its transplantation
into a Mycoplasma capricolum recipient cell to create new Mycoplasma mycoides cells that are controlled only
by the synthetic chromosome.
With a combination of in vitro enzymatic methods and in vivo recombination in Saccharomyces cerevisiae the
synthetic genome from Mycoplasma genitalium was assembled in four stages out of an initial DNA cassette of
about 6 kb in size.
28
Bacterial genomes grown in yeast (eukaryotes) are unmethylated and thus are not protected from the single
restriction system of the recipient cell (prokaryotes dispose of a restriction system). This restriction barrier can
be overcome by methylating the donor DNA with purified methylases or crude Mycoplasma mycoides or
Mycoplasma capricolum extracts, or by simply disrupting the recipient cell’s restriction system.
Design of the Mycoplasma mycoides JCVI-syn1.0 genomes was based on the highly accurate finished genome
sequences of the laboratory strains of Mycoplasma mycoides subspecies capri GM12. 4. Watermark sequences
were designed to further differentiate between the synthetic genome and the natural one. These watermark
sequences encode unique identifiers while limiting their translation into peptides. The oligonucleotides used in
the cassettes were synthesised by Blue Horn (Bothell, Washington). The genome assembly was performed in
three stages: In the first step, 1080 bp cassettes (orange arrows) were recombined in sets of 10 to produce 109
~10 kb assemblies (blue arrows). These were then recombined in sets of 10 to produce 11 ~100 kb assemblies
(green arrows). In the final stage of assembly, these 11 fragments were recombined into the complete genome
(red circle). With the exception of two constructs that were enzymatically pieced together in vitro (white
arrows), assemblies were carried out by in vivo homologous recombination in yeast.
Figure 5: The assembly of a Mycoplasma mycoides genome in yeast (Gibson et al. 2010)
29
Intact synthetic Mycoplasma mycoides genomes from the sMmYCp235 yeast clone were transplanted into
restriction-minus Mycoplasma capricolum recipient cells.
To aid in testing the functionality of each 100 kb synthetic segment, semisynthetic genomes were constructed
and transplanted. By mixing natural pieces with synthetic ones, the successful construction of each synthetic
100 kb assembly could be verified without having to sequence these intermediates (Gibson et al. 2010).
It was also demonstrated that the progeny of this cell will not contain any protein molecules that were present
in the original recipient cell.
3.2.3 Modification on other level than DNA

Non-Natural Amino Acids (NNAA):
DNA is a chemically and mechanically robust biopolymer that serves as a code and a memory but has almost
no enzymatic or catalytic activity (Noireaux et al. 2011). However, all necessary transcription and translation
components are encoded in genes, i.e. DNA, which is also the basis for proteins that upon translation perform
the desired tasks within an organism.
Artificial cells would be ideal containers for inserting new genetic modules or modifying existing ones. With the
ability to generate a synthetic specific genome, a modified genetic code could be defined thus affording
additional codons for the incorporation of non-natural amino acids (NNAA) in cellular proteins. Such an
incorporation of a variety of NNAA would allow the fabrication of novel proteins with novel functions (Moya et
al. 2009).
Non-natural amino acids have already been successfully incorporated into proteins using several strategies
involving orthogonally evolved tRNA and rRNA synthases (Hendrickson et al. 2004), but this approach has been
hampered by low efficiencies of incorporation due to competition with already existing codon recognition
factors. Expanding the repertoire of possible amino acids that the cell can use to build proteins is a powerful
capability that will be readily available to any recoded chassis (Esvelt and Wang 2013).
In all living cells the genetic code is limited to the common 20 amino acids (AA), with the rare exceptions of
selenocysteine and pyrolysine. The genetic code is expressed by aminoacyl-tRNA synthetases, the enzymes
that load specific AAs onto tRNAs. It was demonstrated (Liu and Schultz 2010) that mutating the active site of
the Methanococcus jannaschii tyrosyl-tRNA synthetase enabled it to load a variety of non-natural AA onto
target tRNA that were subsequently assembled into proteins in Escherichia coli. Using these methods,
numerous NNAA have been incorporated into proteins, enabling the site-specific labelling of proteins with
biophysical probes, photo-crosslinking reagents, fluorescent groups, heavy atoms, and orthogonal reactive
groups (Filipovska and Rackham 2013).
Despite the many advances in expanding the genetic code, with over 70 NNAA successfully added to date,
these approaches have been almost entirely relied on recoding of the rare UAG stop codon. Because all 61
sense codons are actively used by existing tRNAs carrying the 20 canonical AA it has been challenging to add
multiple different NNAA to proteins within the same cells. One remedy would be to move beyond the existing
set of triplet codons and use tRNAs with extended anticodons that recognise quadruplet codons. However, the
efficiency of incorporation was very low, most likely due to the ribosome’s reduced ability to accommodate
the larger anticodon. To solve this problem, mutant-ribosomes were constructed which were able to use
quadruplet codons as efficiently as triplet codons (Filipovska and Rackham 2013).
30
NNAAs can be synthesised with a great variety of side chains. These techniques were expanded to yeast,
mammalian cells, and multicellular organisms. One disadvantage is that incorporation of NNAA by replacing
natural codons necessarily competes with natural processes (Marcheschi et al. 2013).
Generally, NNAA introduce new chemical functionality to directly participate in the enzymatic mechanism.
Examples include metal-ion binding, photoreactive AA, and photocaged AA. Also relevant are AA that
represent a post-translationally modified version of a natural AA. Examples include sulfated, methylated,
nitrosylated, and recently phosphorylated AA (Marcheschi et al. 2013)
RNA modifications
Also RNA could be used to program synthetic cells, which seems far more complicated to build than a DNA
cell (Noireaux et al. 2011).
3.3 Building biological systems from parts

In line with the principles of classical engineering synthetic biology aims at building biological systems from
basic components. On DNA level, basic components are promoters, operators, upstream activation sequences
(UAS), ribosome binding sites (RBS), open reading frames (ORF), terminators etc. These “parts” are combined
to create genetic circuits of increasing complexity following a systematic design framework. Current synthetic
biology mainly focuses on the construction and optimisation of regulatory devices and metabolic pathways.
The creation of novel genomes from parts is an ultimate goal for the future (Arpino et al. 2013; Ellis et al.
2011).
3.3.1 Regulation of gene expression: parts and devices

A part is a distinct DNA sequence which performs a defined function in a genetic circuit and is compatible with
an assembly technique. A gene is an open reading frame (ORF) along with all regulatory elements required for
successful expression. A functional gene or “composite part” usually consists of a promoter, a translation start
site (the RBS in prokaryotes), the protein coding ORF and a terminator. Assembly of a gene from its individual
parts functionally requires ordered assembly. One of the foundational advances of synthetic biology was the
BioBrick™, a DNA unit with standardised flanking sequences that enables assembly to be achieved by a cheap,
simple and standardised restriction/ligation method. With BioBricks™ it became possible to store pots of
modular biological parts that could be shared and easily assembled in different combinations by a vibrant
community.
A pathway is a group of genes or operons (multi-ORF genes) which may perform related functions. Such
pathways, devices and regulatory networks could be used for integrated assembling to build synthetic
designer genomes or chromosomes for custom organisms. Research in this area is already active and
beginning to bear fruit (Ellis et al. 2011).
Regulatory elements are of pivotal importance for designing predictable systems (Boyle and Silver 2009).
Regulation is achieved at several levels in biological systems: transcription, RNA processing, translation,
protein-protein interactions, and protein-substrate interactions. Spatial and temporal organisation of these
control systems ensures their proper function. In particular proteins may interact with any suitable binding
partners, regardless of the cellular compartment. Synthetic proteins may be rearranged and thereby yield new
behaviour. In synthetic systems, the metabolism may be optimised at many scales (compartmentalisation,
proteins – substrate channelling, scaffolding of complexes, enzymes – electron transfer in mitochondria and
chloroplasts (Agapakis et al. 2012).
Many new biological parts, like organelle-targeting sequences, transmembrane transporters and bacterial
microcompartment (BMC) pores, need to be characterised for efficient intracellular engineering (Agapakis et
31
al. 2012). Metabolic networks function through different strategies that bring together appropriate cells,
enzymes and substrates in time and space.
Control of gene expression is achieved on the levels of transcription (regulated promoters, transcriptional
riboswitches) or translation/post-translation, which fosters faster dynamics. Components (i.e. genetic parts,
devices and systems) and tools to regulate these components in a predictable and quantitatively controllable
manner have to be designed (Seo et al. 2013).
3.3.2 Genetic devices

Genetic devices are combinations of parts that implement a defined function. Hallmarks in this field are
several designs inspired by electronic circuitry, such as genetic toggle-switches, timers, oscillators and logic
evaluators (Purnick and Weiss 2009; Arpino et al. 2013). Their functioning is based on the control of
transcription, translation or post-translational processing. Complex “devices” are assembled from well-defined
modular parts but it is challenging to fully predict their function (Boyle and Silver 2009). They may also be less
robust than natural systems, and endogenous regulatory systems may interfere with the function of synthetic
biology devices. It is difficult to predict what the assembled parts will do, even when much is known about
them individually (Arkin and Fletcher 2006). Engineering new proteins or gene circuits may lead to direct
interaction among new components or to indirect interactions via their effects on the organism (“chassis”) into
which they are introduced. Due to lacking co-evolution unforeseen cross-reactions may occur. It may be
expected that engineered organisms survive poorly in real-world environments (Arkin and Fletcher 2006).
Figure 5 and 6 show several types of genetic devices.
Transcriptional control devices

Transcriptional control of gene expression is used to optimise biological systems (modification of the spacer
region between DNA sequences of native promoters and utilisation of polymerase chain reaction (PCR) to
introduce mutations into the entire promoter region. Also, synthetic hybrid promoter approaches that
combine core promoters with enhancer elements consisting of combinations or tandem repeats of upstream
activating sequences. Promoter strength can differ depending on flanking sequences upstream and
downstream of the consensus boxes and promoter copy number. A recent study demonstrated the
importance of precisely balancing metabolic fluxes by controlling transcription efficiency for the optimal
production of a target molecule. In addition, rapid prototyping services like BIOFAB (International Open Facility
Advancing Biotechnology, http://biofab.synberc.org/) are developed that provide libraries of characterised
regulatory elements and facilitate prototyping of synthetic devices via high-throughput cloning and testing
(Boyle and Silver 2012).
A prototype of transcriptional control is the bistable toggle switch (Gardner et al. 2000). It is composed of two
promoters that transcribe mutually inhibitory repressor proteins and can be inactivated by different inducers
(Figure 6). One promoter also transcribes a reporter gene, such as the green fluorescent protein (GFP). The
expression of the reporter can be switched on by transient addition of the first inducer and switched off by
transient addition of the second inducer.
32
Figure 6: Bistable genetic toggle switch. Figure from Gardner et al. (2000)
More complex arrangements of promoters and repressors are for example transcriptional oscillators and
timers. Oscillators (Figure 7a) increase and decrease the expression of a reporter gene in a rhythm that
depends on the concentrations of two inducer compounds present in the medium (Purnick and Weiss 2009).
With a genetic timer, the expression of a reporter gene can be switched on or off by transient addition of an
inducer and is reset to the initial state after a given time span (Ellis et al. 2009).
Translational control devices

Typical elements of translational control are synthetic ribozymes (Arpino et al. 2013; Purnick and Weiss 2009).
In these RNA devices the transcript of a gene of interest carries an autocatalytic region and aptamers to sense
specific ligands. Binding of a ligand to the RNA aptamer leads to a structural change in the autocatalytic region.
The activated autocatalytic region inhibits translation of the transcript. RNA devices that respond to various
low molecular metabolites are called riboswitches. RNA devices that respond to small interfering RNAs
(siRNAs) are called riboregulators.
Riboswitches have been used to create logic evaluators that report the presence or absence of several ligands
simultaneously using AND/OR/NOT/NOR Boolean logic (Figure 7b). Such devices are also referred to as logical
gates (Purnick and Weiss 2009).
Post-translational control devices

An example of a post-translational control device is the scaffold protein phosphorylation system shown in
Figure 7c scaffold proteins recruit proteins required for specific cellular processes and tether them together. In
the presented device, the scaffold is activated by phosphorylation in presence of specific inducers, and scaffold
activation initiates expression of the reporter gene GFP (Purnick and Weiss 2009).
33
Figure 7: Regulatory devices: a) oscillator, b) riboswitch, c) artificial scaffold protein. Figure from Purnick and Weiss
(2009)
Applications of regulatory devices

The devices shown in Figure 6 and Figure 7 and many other basic devices have been conceived in Escherichia
coli and yeast. These examples use standard inducers, such as IPTG, arabinose and anhydro-tetracycline and
control standard reporter genes like GFP. However, the same principles can be used to build genetic systems
that respond to all kinds of chemical or physical stimuli and control various cellular processes.
In numerous studies microorganisms have been equipped with devices that express reporter genes in
presence of environmental contaminants. Bacteria have also been programmed to recognise several tumour
characteristics over logical AND-gates and to invade correctly identified cancer cells. Artificial communication
between cell populations has been established via conditional expression of essential metabolites, toxins and
quorum sensing compounds such acyl homoserine lactone (Purnick and Weiss 2009). One of the rare examples
of a genetic device implemented in a plant is an artificial receptor for the environmental pollutant TNT in
Arabidopsis thaliana that signalises environmental pollution by chlorophyll loss (Bowen et al. 2008).
Importantly, genetic devices can also be integrated into biosynthetic pathways for dynamic process control in
biotechnology (see below). The experimental application possibilities of regulatory genetic devices are virtually
infinite. Table 2 lists selected projects that were presented at the international genetically engineered machine
(iGEM) competition to provide an idea of the application potential of regulatory genetic devices.
Global transcription machinery engineering (gTME), i.e. creating libraries of mutant transcription factors, is an
approach that has been implemented in both prokaryotes and eukaryotes (Seo et al. 2013). The connection
between mutant transcription factor sequences and function is difficult to predict de novo. Phenotypes are
selected and screened to identify and characterise the desired one.
Comprehensive lists of projects and references are available on the iGEM website (footnotes in Table 2).
34
Year Function Reference

Environment – sensing and remediation
2007 E. coli expressing ß-galactosidase in presence of arsenate in water samples A
leading to a pH drop
2007 A yeast sensor for real extra virgin olive oil A
2007 A cellular lead sensor A
2007 A biological radiation sensor A
2013 E. coli and B. subtilis acting as microbial “mops” that detect algal toxins and B
detoxify them by ligand release
Health and Medicine
2007 A biological system to sense environmental glucose concentration and decrease A
it by insulin release
2007 An AHL sensor combined with a GFP reporter to detect biofilm formation in A
catheters.
2013 E. coli cells that recognise and kill S. aureus by linking quorum sensing to the B
release of antimicrobial peptides
Information processing and biocomputing
2007 Tri-stable toggle switch A
2009 A “bio screen” of voltage activated yeast cells A
2007 A divide-by-two circuit A
2013 A system of two E. coli strains demonstrating the “Prisoners’ Dilemma” from B
game theory
A http://openwetware.org/wiki/IGEM:Projects_categorized
B http://2013.igem.org/Jamboree/Team_Abstracts
Table 2: Genetic device projects presented at international genetically engineered machine (iGEM) competition
3.3.3 Design and optimisation of synthetic biological systems

Construction of synthetic devices and pathways involves a quantitative characterisation of the individual parts,
mathematical modelling, physical assembly, genetic modification, and systematic improvement of the system
based on experimental data and modelling.
Mathematical modelling
Mathematical models guiding the design of genetic modules, devices and pathways usually take the form of
differential equations describing the chemical reactions in the system. Figure 8 shows a simple genetic system
consisting of a constitutively expressed repressor, which can be inactivated by addition of an inducer molecule
and regulates the expression of a reporter protein. The reactions that have to be described are: promoter
binding of RNA polymerase, repressor-promoter interaction, inducer-repressor interaction, ribosome binding
to mRNA and degradation of mRNA and protein. The corresponding equations are shown next to the figure
and have to be filled with quantitative information (Arpino et al. 2013). Numerous software tools for design
and analysis of genetic networks are available (Purnick and Weiss 2009).
35
Figure 8: A simple genetic system with model equations. Figure from Arpino et al. (2013)
Assembly of parts
A very common approach to assemble DNA parts is classical cloning based on restriction and ligation.
Restriction/ligation is implemented in the BioBrick™ standard (see below) and allows for stepwise and
combinatorial assembly. The major downside is that short scar sequences are left at every junction and that
the recognition sites of the involved restriction enzymes are forbidden within the parts. A set of alternative
methods are based on sequence overlaps between neighbouring parts, that can be connected by overlap
extension PCR, 'chew back and anneal' techniques such as sequence and ligation independent cloning (SLIC) or
the 'Gibson' isothermal assembly method. For a detailed review on current DNA assembly techniques see Ellis
et al. (2011).
Characterisation and “tuning” of parts

As the basic “parts” used in synthetic biology are derived from disparate sources, it is of central importance to
obtain quantitative information characterising their reaction rates and input-output thresholds (Arpino et al.
2013). In order to work synergistically in a synthetic system, parts and modules have to be adapted to each
other. Such system optimisation or “tuning” is typically carried out through iterative steps of mathematical
modelling, genetic manipulation, experimental testing and model refinement (Purnick and Weiss 2009).
State of the art molecular biology enables multifaceted modifications. At transcriptional level, promoter
strength can be influenced by modifying the sequence of the RNA-polymerase binding sites and thus binding
affinity. Regulated promoters can also be modified by variation of the operator sequence, which changes the
strength of the interaction between repressor and DNA. Mutations in the DNA sequences between important
binding motifs have also been shown to produce variation in promoter strength, presumably by altering local
DNA conformation (Arpino et al. 2013; Ellis et al. 2009).
At translational level, the efficiency of ribosome recruitment can be controlled by modifying the sequence of
the ribosome binding sites (RBS). Moreover, translation rates of protein coding genes can be improved by
36
codon optimisation - that is the creation of a sequence encoding the same protein, but avoiding rare codons.
The longevity of mRNA transcripts can be controlled by modifying its secondary structure in untranslated
regions that make it more or less vulnerable to RNases (Arpino et al. 2013).
Similarly, protein degradation can be tuned by addition of degradation tags. For enzymatic activities, mutants
with altered substrate specificity or thermostability can be created (Arpino et al. 2013).
Random sequence variation in DNA units can be achieved by various techniques such as directed evolution via
error-prone PCR (Arpino et al. 2013) or by synthesis with degenerate sequence (Ellis et al. 2009). The resulting
libraries of diversified parts can be characterised in test systems and versions with optimal input-output
characteristics and reaction rates can be selected for further applications. Mathematical modelling can greatly
assist this process. For example, Ellis et al. (2009) created a library of promoters and a model describing their
varying expression and inhibition thresholds. Based on this model the authors were able to produce devices
with quantitatively predictable behaviour. For RBS-optimisation a universal and popular software tool is
available: The RBS-calculator (Salis et al. 2009) reliably predicts ribosome binding strength of prokaryotic
Shine-Dalgarno sequences.
Copy number
The gene copy number can increase or decrease the expression of a protein over a partially linear range
(Arpino et al. 2013). Similarly, multiplication of repressor or activator binding sites has been shown to
influence gene expression in a predictable way (Xu et al. 2012).
The copy number of plasmid-borne genes and constructs can be modified easily by changing the origin of
replication to modify the plasmid copy number. However maintenance of increasing numbers of plasmids
adds to the metabolic burden of the host cell. Alternatively repetitive tandem copies of genes or control
elements can be inserted into the same plasmid or chromosome (Arpino et al. 2013; Xu et al. 2012).
Modularisation of genetic systems (MMME)

Multigene pathways can be systematically improved by multivariate modular metabolic engineering (MMME).
MMME groups genes with similar turnover into modules, i.e. into synthetic operons. Such groups of genes can
be tuned in their expression as a single unit, using the toolbox of promoter and RBS strength, copy number
etc. This simplifies the adjustment of multiple genes to each other in order to eliminate bottlenecks and
maximise pathway turnover. An excellent example of MMME is the study of Ajikumar et al. (2010), who
optimised a synthetic terpenoid pathway for the synthesis of the taxol-precursor taxadiene in Escherichia coli
(Figure 9). Ten genes of bacterial and plant origin were arranged in two modules that could be harmonised in
their expression levels. Using this approach, the authors needed to construct only 32 strains to identify a
variant with 15000-fold increased taxadiene production, whereas varying and combinatorial screening of the
ten individual genes would have required construction of 10 000 strains. Modular plasmid backbones that
enable parallel generation of differently configured pathway variants within a few cycles of cloning facilitate
MMME (Xu et al. 2012).
37
Figure 9: Modularisation of a taxadiene biosynthesis pathway. Detail from a figure of Ajikumar et al. (2010)
Simultaneous modification and combinatorial screening of multiple genes (MAGE)

More frequently than not, several genes need to be modified simultaneously to obtain a superior phenotype.
The recently developed multiplex-automated genomic engineering (MAGE) protocol produces genomic
diversity by simultaneously modifying several genomic locations on the chromosome of a single cell or across a
cells population (Yadav et al. 2012). The capabilities of MAGE have been demonstrated in a study of Wang et
al. (2009) who targeted all 20 genes involved in the terpenoid pathway of Escherichia coli to modify
biosynthesis of the tetraterpene pigment lycopene. Significant improvements were made within short time.
However, combinatorial screening of 20 genes required testing of 100000 mutants. MAGE is therefore
restricted to end-products with colorimetric properties or other properties that can be assessed in high
throughput screenings (Yadav et al. 2012).
Metabolic flux analysis

Empowered by the volume of gene, protein and metabolite data accumulated in biotechnology databases the
focus of metabolic engineering has shifted from perturbing individual pathways towards manipulating the
entire cell for optimised product formation. The target pathway is considered in the context of the entire
metabolic network of the host cell. This enables handling competition with native pathways, accumulation of
inhibitory side products and other interaction phenomena (Yadav et al. 2012).
Flux balance analysis (FBA) is a popular simulation tool for integrative metabolic engineering of well described
organisms, such as Escherichia coli. FBA describes the network of a cell's metabolic reactions in a
stoichiometric matrix. Stoichiometric information is retrieved from experimental biochemical data and from
comparative analysis of enzyme coding genes of different completely sequenced organisms. Based on this
matrix, FBA predicts metabolic fluxes, i.e. turnover rates of metabolites, and helps to maximise desired
functions (Comba et al. 2012; Bilgin and Wagner 2012). For example Xu et al. (2011) used FBA to identify a
minimum set of genetic interventions required to redirect the carbon flux in Escherichia coli towards malonyl-
CoA building blocks for flavonoid synthesis.
For dynamic regulation of metabolic fluxes, regulatory devices can be employed to sense accumulation of
metabolites and subsequently up-regulate reactions that redirect fluxes towards the intended output (Zhang
et al. 2012).
Metabolic network analysis can also be used to predict the minimum metabolic requirements for a cell under
given conditions. Applying FBA to sets of random networks that were automatically generated from
biochemical reaction databases, Bilgin and Wagner (2012) calculated that a cell synthesizing 20 biomass
molecules from 20 alternative carbon sources requires a minimum of 260 reactions. Every additional carbon
source requires two extra reactions; every additional product requires three extra reactions, on average.
38
3.3.4 Standardisation of genetic parts and modules

Engineering relies on the standardisation. Standards for genetic parts and methods are required for synthetic
biologists to build upon each other’s accomplishments and to make synthetic biology a state of-the-art
discipline (Purnick and Weiss 2009).
A seminal approach towards standardisation in synthetic biology is the BioBrick™ concept. BioBrick™ provides
an open source collection of characterised biological parts and modules. Assembly of BioBricks™ is carried out
by restriction-ligation and all BioBrick™ parts are equipped with compatible restriction sites at their ends.
Moreover metrics for quantitative characterisation of bioparts are being developed, e.g. PoPs (polymerase
operations per second) for transcriptional regulators or RiPS (ribosomal initiations per second) for translational
regulators. Finally the BioBrick™ foundation is fostering innovation in synthetic biology by organizing the
international genetically engineered machines competition (iGEM) for students (Purnick and Weiss, 2009).
BioBricks™: The basic building blocks for synthetic biology

In synthetic biology the standardisation of genetic elements used for creating novel genetic regulation units is
a key issue. The crucial goal is to simplify the process of biological engineering (Shetty et al. 2008). To enhance
the dissemination of practical expertise gained in the field of synthetic biology, accelerate the development
process of new biological regulation circuits, improve the reproducibility of the obtained results, increase
transparency in the emerging field the iGEM (internationally Genetically Engineered Machine) organisation is
vigorously promoting open access to such a kind of standardised biological parts. iGEM serves as an
educational and introductory platform trying to comprehensively cover most aspects of synthetic biology. It
organises international competitions for high school and university students in this highly competitive area to
proliferate the technology. As a first step towards streamlining the design process and standardisation in
synthetic biology iGEM is vigorously propagating the concept of BioBricks™-standardised biological parts which
can be easily used and distributed to construct novel genetic functional complexes (for details see section
below). Only recently iGEM has started to raise the awareness of the participants for biosafety aspects by
requesting a detailed description of biosafety issue relevant for the synthetic constructs submitted for the
competition (Guan et al. 2013).
The BioBricks™ inventory

A DNA sequence which encodes a biological function i.e. for a promoter, terminator, ribosomal binding site,
protein domain, protein coding sequences etc. is called a “basic part” (Figure 10).
A basic part is a functional unit of DNA which cannot be subdivided

into smaller components. A representative example for a basic part is
Figure 10: Schematic
the T7 promoter (5’taatacgactcactatagggaga3’; order code
representation for basic part BBa_I719005) or a phage lambda cI regulated promoter
“promoter“ in the BioBricks™ (5’taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc3’; BBa_R0051).
assembly (iGEM 2014)
39
A composite part is a functional unit of DNA which consists of two

or more several basic parts stacked together (Figure 11). An
example for a composite part is the combination of a ribosomal
binding site, a protein coding region and a terminator spliced
representation of a composite
part (ribosomal binding site –
together on a contiguous stretch of DNA forming a functionally
protein coding region – active complex (example: BBa_I13507).
terminator) (iGEM 2014)
A device is a variant of a composite part which is capable to

mediate a function in a cellular context. An example of such a
kind of device is the combination of the basic part BBa_R0051
representation of a device with the composite part BBa_I13507 (Figure 12).
consisting of a basic (=promoter)
and a composite part (ribosomal
binding site – protein coding region
– terminator) (iGEM 2014)
The BioBricks™ standard

“BioBricks™” are standardised biological parts (basic and composite), which conform to the BioBrick™
assembly standard. Adhering to this standard guarantees compatibility between parts and/or to BioBrick™
plasmid carriers and allows that any newly composed part will be ready for recombination with other parts
adhering to the BioBrick™ assembly standard without the need for further genetic manipulation. The
BioBrick™ assembly standard in general takes care for appropriate restriction enzyme target sequences,
compatible multiple cloning sites in carrier vectors and appropriate backbone sequences. This approach allows
the scientist to focus on design of new functions instead of dealing with technical problems concerning cloning
and genetic manipulations.
BioBricks™ are available to the scientific community and may be freely recombined to produce new genetic
entities (Table 3). Information on BioBricks™ is collected and shared via the internet platform Registry of
Standard biological Parts. Physical samples of basic and composite parts may be retrieved from the Registry of
Standard Biological Parts (=Registry Repository) (Shetty et al. 2008).
40
BioBrick™ parts Description

Promoters Recruitment sites for transcription machinery RNA Polymerase
binding sites
Ribosome binding sites Region on mRNA for ribosomal binding translation initiation
Protein domains Encodes functional compartments of protein sequence
Protein coding sequences Encodes the amino acid sequence of a protein
Translational units Translational units are composed of a ribosome binding site and
a protein coding sequence. They begin at the site of translational
initiation, the RBS, and end at the site of translational
termination, the stop codon.
Terminators Transcription stop signal at the end of a gene or operon
DNA DNA parts provide functionality to the DNA itself. DNA parts
include cloning sites, scars, primer binding sites, spacers,
recombination sites, conjugative transfer elements, transposons,
origami, and aptamers.
Plasmid backbones A plasmid is a circular, double-stranded DNA molecule typically
containing a few thousand base pairs that replicate within the
cell independently of the chromosomal DNA. A plasmid backbone
is defined as the plasmid sequence beginning with the BioBrick™
suffix, including the replication origin and antibiotic resistance
marker, and ending with the BioBrick™ prefix.
Plasmids A plasmid is a circular, double-stranded DNA molecule typically
containing a few thousand base pairs that replicate within the
cell independently of the chromosomal DNA. If you're looking for
a plasmid or vector to propagate or assemble plasmid backbones,
please see the set of plasmid backbones. There are a few parts in
the Registry that are only available as circular plasmids, not as
parts in a plasmid backbone. Note that these plasmids largely do
not conform to the BioBrick™ standard.
Primers A primer is a short single-stranded DNA sequence used as a
starting point for PCR amplification or sequencing. Although
primers are not actually available via the Registry distribution,
commonly used primer sequences are included.
Composite parts Composite parts are combinations of two or more BioBrick™
parts.
Table 3: Types of parts available from the BioBrick™ Registry Repository (modified from iGEM (2014)).
41
Synthetic Biology | Applications of Synthetic Biology
4 Applications of synthetic biology

Synthetic biology has a vast range of potential practical applications (Porcar and Pereto 2012). It is perceived
as a way to tackle problems, among others, in cell and tissue engineering, gene therapy, biologically derived
materials, biocatalysis and natural product synthesis (Arkin and Fletcher 2006). In addition, it is believed to
facilitate mass production of useful compounds and a variety of chemicals (drugs, biofuels, etc.), to be key in
the development of bioremediation, to increase crop yield, lead to the production of novel food ingredients,
and improve human health (Porcar and Pereto 2012). Upon careful design, it offers the possibility to minimise
unwanted (side) effects (like production of any undesirable substances that might reduce yield or inhibit
metabolic pathways), to reduce energy costs to the cells, and to establish good conversion from substrate(s) to
desired product (Ellis and Goodacre 2012).
Major efforts toward potential application of synthetic biology include the production of biofuels like ethanol,
algae-based fuels, bio-hydrogen and microbial fuel cells; bioremediation like wastewater treatment, water
desalination, solid waste decomposition and CO2 recapturing; the production of biomaterials like bioplastics,
bulk chemicals, pharmaceuticals, flavourings, fragrances, and compounds for cosmetics; and finally the
production of novel cells and organisms, which includes the generation of protocells and xenobiology (see CBD
(2014) and OECD (2014) for excellent recent overviews).
4.1 Synthetic biology in microorganisms

Device or system design is done in context of a particular host cell (Kitney and Freemont 2012). The major
model microbial species in which the foundational work in synthetic biology (i.e. metabolic engineering and
minimal genome construction) was carried out have been Escherichia coli and Saccharomyces cerevisiae
(Cameron et al. 2014). Fabrication facilities (biofabs) are developed to construct, characterise and standardise
biological components for widely used platform organisms (Nielsen and Keasling 2011). The big advantage of
concentrating on a few organisms is obviously that much knowledge is accumulated, allowing for better
prediction of the results of engineering strategies.
Microbes, in particular Escherichia coli or yeast, may also be used as experimentally convenient heterologous
hosts to reconstitute biosynthesis (Li and Pfeifer 2014). Such an approach offers considerable advantages as
compared to production in, e.g., the native plant host or chemical synthesis strategies, which may be
hampered by slow growth kinetics and low native titres. Companies design strains (e.g. Escherichia coli Clean
Genome®, Scarab Genomics) with “enhanced genetic stability, improved metabolic efficiency and improved
production yields” with the aim of creating efficient production platforms. The desired properties are achieved
by deleting nonessential gene, insertion sequence (IS) elements, recombinogenic/mobile DNA, cryptic viruses
and virulence genes, and the strains are being offered as a platform to optimise processes for the production
of, e.g., therapeutic proteins, plasmid DNA and vaccines. Also Saccharomyces cerevisiae is already well
adapted to industrial conditions and thus its use for industrial production is easy and straight-forward (“plug-
and-play solution”) (Nielsen and Keasling 2011).
Remarkably both Escherichia coli and Saccharomyces cerevisiae are in addition important model organisms,
ensuring the availability of an impressing amount of data originating from basic research. Not least,
mathematical models for systems biology have been developed for them, potentially allowing for the
modelling of the interaction between all the components in the system. Finally, powerful synthetic biology
tools have been demonstrated within these two species (Montague et al. 2012). The major limitation is that
important metabolic and biological tools are absent – e.g. traits of photosynthesis or the capacity to express
large mammalian genes exhibiting splicing and post-translational modifications that both involve many genes
42
and lead to broad systemic alterations to the biology of the organisms. Due to this complexity they cannot be
easily engineered into either Saccharomyces cerevisiae or Escherichia coli (Montague et al. 2012).
Another important species that may serve as platform cell factory is Corynebacterium glutamicum (Becker et
al. 2013). It has been suggested as a model organism for synthetic biology as it is capable of producing a
variety of valuable chemicals and materials, and is already applied in the industrial production of amino acids
(Woo and Park 2014). A number of approaches to optimise Corynebacterium glutamicum, including the
development of standard DNA parts, DNA/RNA parts, and devices (e.g. to sense metabolites) are discussed by
Woo and Park (2014). In general, strain development is an important application for synthetic biology in
microbes (as for example the generation of optimised Corynebacterium glutamicum strains for the production
of amino acids or even the establishment of multi-use platform strains) (Wendisch 2014).
The following potential environmental applications of designed microorganisms have been identified in CBD
(2014); the expected benefits are that they could provide less toxic and more effective tools for
bioremediation, which would positively impact local biodiversity (CBD 2014):
 enhance mining metal recovery and to aid in acid mine drainage bioremediation (Brune and Bayer
2012).
 design whole-cell biosensors that will indicate the presence of a target, such as arsenic in drinking
water.
 design an arsenic biosensor that would be suitable for field use in developing countries, using freeze-
dried transformed Escherichia coli that changed colour in the presence of arsenic (French et al. 2011).
 engineering Escherichia coli to secrete auxin, a plant hormone intended to promote root growth (French
et al. 2011; WWICS 2013b).
 pre-coating seeds with the bacteria, to be planted in areas at risk from desertification (French et al.
2011; WWICS 2013b).
 Degradation of herbicides by “reprogrammed” Escherichia coli.
4.2 Synthetic biology in other species

There are also attempts to use hosts beyond bacteria and yeast, e.g. to produce spider silk (dragline silk
protein) in the milk of transgenic mice (Xu et al. 2007). The animal host was more efficient as compared to
microbial ones in expression and homogeneity.
Recently, synthetic biology has also been suggested as providing new strategies for therapeutic applications
(Ye and Fussenegger 2014). For this, for example gene circuits are assembled into biosensing devices. The
designed circuits monitor, quantify, and treat diseases by sensing disease signals, and producing and releasing
tailor-made therapeutic molecules. Another recent development aims at regulating gene drives that influence
reproductive capacity (Oye et al. 2014). Potential applications are the elimination of mosquito-borne diseases
like malaria and dengue, reversing the development of pesticide and herbicide resistance, and the local
eradication of invasive species. However, it has been acknowledged that this development has substantial
implications concerning environmental and security aspects, and risk management (Oye et al. 2014).
4.3 Synthetic biology in plants

Synthetic metabolic pathways may be designed for the expression in heterologous hosts, in particular
microorganisms. However, for a range of applications plants will be better suited, e.g. for the large scale
production of compounds or evidently when targeting cell walls for more efficient production of biomass.
Concomitant with recent advances in plant biotechnology, the field benefits from methods for synthetic
biology that have already been successfully applied by the microbial biotechnology community. In particular
43
DNA assembly techniques are also adopted by plant biologists (Patron 2014). However, the progress in
synthetic biology in plants is slower compared to that in microbial systems (O'Connor and Brutnell 2014).
In the plant field, Arabidopsis thaliana is the model organism, and a plethora of information on gene function
or metabolic and regulatory pathways has been created by basic research (Kliebenstein 2014). Thus, it may be
seen as the plant equivalent to Escherichia coli or yeast, offering the possibility to use it as a platform organism
(Nielsen and Keasling 2011).
To date, there is scarce knowledge on plant genes in general (Rhee and Mutwil 2014), and consequently also
on those involved in plant biosynthetic pathways. Thus, their manipulation is largely limited to selected, well
characterised target genes. In addition, stable overexpression of multiple transgenes limits reconstruction of
complex biochemical pathways (Giuliano 2014). It is therefore important to understand the enzymes that
determine chemical features, and factors influencing functional properties (Zhang et al. 2014). Steps towards
successful synthetic biology approaches include transcript profiling of selected plants to select candidate genes
(i.e. parts) that will be used to assemble synthetic metabolic pathways (Facchini et al. 2012). Only upon
deciphering the regulatory complexity the ultimate of synthetic biology, i.e. engineering of changes beyond
the limits of natural variation, may be reached. Reports of synthetic biology approaches in plants are currently
limited to synthetic regulatory elements and switches for the spatiotemporal manipulation of gene expression
and engineering of signalling networks (Cabello et al. 2014). Despite some success, multi-gene transfer is still
difficult (Jirschitzka et al. 2013).
Important challenges that in particular apply to the plant field include the predictability of chosen approaches
by establishing the number of genes to be manipulated; also potential interactions and modes of interaction
remain to be determined (Kliebenstein 2014). Decomposition of systems by using reverse engineering is a way
to investigate these questions. The genetic background plays a determinant role by controlling the outcome of
genetic manipulation, e.g. by influencing epigenetic stability, but also the effect the introduced sequences
have on the host organism. To date, these effects become obvious whenever a transgene is introduced into an
organism, and have to be considered when attempting synthetic biology approaches. Questions to be
answered also include which parts of the genomic background (nuclear and organellar genomes) have to be
manipulated to optimise the expression of a pathway, but also the fate and effects of the engineered
metabolite. In some cases there is the potential for toxicity, or the metabolite may cause disruption of the
metabolic network. In any case, transcriptional and post-transcriptional regulatory changes have to be
monitored. Designing a pathway may also include the necessity to remove the plants perception of the
introduced metabolite or its precursors. The challenge in synthetic biology in plants thus includes to create
integrative models to facilitate predictive engineering. For this, a key component is to identify how the plant
regulatory networks react to changes.
Cabello et al. (2014) highlighted advances in plant synthetic biology that include the development of synthetic
regulatory elements, switches for the spatiotemporal manipulation of gene expression and engineering of
signalling networks, the successful introduction of a synthetic pathway for the production of halogenated
alkaloids in Catharanthus roseus, and the relocation of an entire cytochrome P450 monooxygenase pathway
from the endoplasmatic reticulum to the chloroplast. Further reports describe the development of an auxin
biosensor, or the design of a synthetic signal transduction pathway, allowing linking the detection of a
metabolite to the expression of target genes.
4.3.1 Assembly of plant pathways in heterologous hosts

Heterologous production should facilitate rapid and robust access to the desired compound. Adjusting
expression parameters for the new host and further codon optimisation are the prerequisites to achieve this
44
aim (Li and Pfeifer 2014). Despite many advances, the choice of the proper host is a matter of balancing
advantages and challenges. As an alternative, a new host may be built – “bottom-up” – to optimise cellular
function and heterologous production. Microbial engineering of plant pathways, however, will also facilitate
the discovery of biosynthetic genes and the analysis of plant metabolite synthesis, and thus be an essential
step towards using the potential of synthetic biology (Facchini et al. 2012). Pathway assembly in yeast may, for
instance, contribute to the discovery of gene function, in particular when in vitro enzyme characterisation is
not possible, to optimise pathway efficiency, and also as a combinatorial biochemistry platform to produce
novel molecules in plants.
Interest in plant metabolism is growing as plants represent an enormous repository of bioactive natural
products of pharmaceutical and biotechnological importance (Xu et al. 2013). These products are currently
mostly extracted from their native plant sources or semi-synthesised from extracted intermediates, both
processes that potentially suffer from low yield and complicated downstream purification processes. Synthesis
may involve toxic catalysts or require extreme reaction conditions. Microbial metabolic engineering is a way to
overcome these limitations, and offers the possibility to use a genetically tractable organism. As more and
more genetic parts and devices are characterised (e.g. synthetic promoter libraries or synthetic ribosome
binding sites are available) and the cost of DNA synthesis declines, tailor-made cell factories may be designed
and created for high-throughput, efficient production of natural products and fuels.
It is thus not surprising that one of the major potential application of synthetic biology using plant resources is
the reconstruction of plant biosynthetic pathways in heterologous hosts (Li and Pfeifer 2014). In parallel, for
example codons can be optimised or unnecessary sequences removed. This approach shows one of the most
important advantages of synthetic biology as compared to “simple” metabolic engineering, namely rendering
production more efficient. Alternative to already existing pathways that are optimised there is also the
possibility to build a pathway from genes/enzymes with known functionality. The ultimate aim is to provide
rapid and robust access to the desired compound. In this context, synthetic biology plays a crucial role in
improving expression and thus productivity.
Yeast (Saccharomyces cerevisiae) is the organism of choice for the reconstruction of complex plant pathways
(Facchini et al. 2012). One reason for this is that genome-wide metabolic models and genetic resources are
available, and, more importantly, that optimal expression and activity of plant enzymes require a eukaryotic
cell environment. Microbial hosts may be engineered to produce sufficient levels of metabolic precursors and
are the starting point for the stepwise introduction of plant genes for the production of central intermediates
in the targeted pathway up to the creation of novel metabolic pathways. Challenges include finding the
optimal selection of regulatory elements for optimised pathway flux but also to overcome the limitations due
to the dynamic behaviour of complex biological systems, e.g. the maintenance of a constant level of essential
precursor metabolite flux that causes only limited performance improvement (Xu et al. 2013; Facchini et al.
2012). Despite such challenges, both Escherichia coli and Saccharomyces cerevisiae have been successfully
used to produce fatty acids, terpenoids, flavonoids, polyketides and alkaloids (Xu et al. 2013).
Besides Saccharomyces cerevisiae and Escherichia coli, Candida utilis, Streptomyces avermitilis, and Bacillus
subtilis have been used as heterologous hosts for the production of plant-derived isoprenoid products, like
lycopene from tomato, artemisin against malaria from Artemisia annua, and paclitaxel (taxadiene) with anti-
cancer properties from Taxus brevifolia (reviewed in Li and Pfeifer (2014)). Another example is the production
of isoprenoids in Escherichia coli (Ajikumar et al. 2010).
Advanced applications of microorganisms in the biofuel sector

Yeast metabolism is converted such that the specific hydrocarbon or the target molecule farnesene is
produced. Yeast uses sugar as a nutrient and as a feedstock (Amyris 2014). It may be designed in a way that it
45
directly converts sugar into the targeted end product bio-isobutane and consequently in high-octane gasoline
(PCSBI 2010; Bioenergies 2014).
LS9 has developed a platform technology that leverages the natural efficiency of microbial fatty acid
biosynthesis to produce a diversity of drop‐in fuels and chemicals. Microorganisms modified by synthetic
biology may perform a one‐step conversion of renewable carbohydrates (sugars) to two diesel alternatives, a
fatty acid methyl ester and an alkane (BIO 2013).To achieve this, alkane biosynthetic genes were engineered
into Escherichia coli.
“Synthetic biology has been essential in engineering the LS9 microbial catalysts. The biosynthetic pathways to
produce finished fuel products do not exist in the native Escherichia coli host, and prior to our efforts alkane
biosynthetic genes were unknown. LS9 designed the pathways, synthesised the genes encoding each enzyme in
the pathway, and constructed multigene biosynthetic operons enabling production. To improve yield,
productivity, and titer – the drivers of process economic efficiency – the biosynthetic pathways and host
metabolism have required significant genetic optimization. LS9 developed capabilities for the computational
design and automated parallel construction of gene, operon, and recombinant cell libraries that have enabled
the rapid construction and evaluation of thousands of rationally engineered microorganisms. This capability in
combination with state of the art screening, process development, and analytical methodologies has enabled
LS9 in only a few years to advance from concept to a process slated for commercial‐scale demonstration” (BIO
2013).
Figure 13: Producing biofuels and renewable chemicals by means of synthetic biology; adapted from BIO (2013);
TM….trade mark
Global Bioenergies (BIO 2013; Bioenergies 2014) modified several enzymes in a way so that enzymatic catalysis
within artificial metabolic pathways was achieved. Subsequently, these enzymes were integrated into a
bacterium which converts sugar into bio-isobutane.
Some bacteria have the built-in enzymes to manufacture butanol, but the natural process is not very fast or
high-yield. Synthetic biologists have engineered the easy-to-manipulate bacterium Escherichia coli to improve
this bacterial biochemical reaction to make butanol more industrially useful (PCSBI 2010).
Certain microorganisms have evolved to be proficient in converting lignocellulosic material to ethanol,

biobutanol and other biofuels. A longstanding challenge in metabolic and genetic engineering is determining
whether to improve the isolate host’s production capacity or whether to transplant the desired genes or
pathways into an industrial model host, such as Escherichia coli or Saccharomyces cerevisiae (Khalil and Collins
2010). For example, Calysta engineered, by means of synthetic biology, the metabolic pathways of
46
methanotrophs (methane-using bacteria), which convert methane and other components of natural gas into
liquid hydrocarbons that can be used to make fuels and chemicals (CBD 2014). Another approach for the
application of synthetic biology is the production of consolidated bioprocessing platforms for further use in
biofuel production. The process works via engineering microorganisms to generate properties that allowed
them to digest plant biomass and to convert it to hydrocarbons that have the characteristics of advanced
biofuels. The requirements for such an organism are multiple pathways for hydrocarbon production and the
capacity to sufficient enzymes to efficiently hydrolyse cellulose and hemicellulose. An example in this research
field is the biofuel production from ionic liquid-pretreated switchgrass (Panicum viragtum L.) using engineered
Escherichia coli, without the addition of enzymes (Bokinsky et al. 2011).
Another, though long-term example are cyanobacteria that convert carbon dioxide, untreated water and
sunlight into liquid hydrocarbons that are the functional equivalent of diesel and ethanol (U.S. Patents
#7,981,647 and #7,968,321).
4.3.2 Review of existing applications in plant-like systems and higher plants

Many efforts aim at the manipulation of algae and higher plants physiology and metabolic pathways for the
production of desired products and compounds, of which biofuels (bioethanol, biodiesel and H2) and
pharmaceuticals currently attract most interest (Zurbriggen et al. 2012; Lee 2013). In this context, synthetic
biology approaches also allow for the production of compounds with novel chemical properties. Prokaryotic
(cyanobacteria) but also eukaryotic algae may be a target organism to produce advanced biofuels (e.g. butanol
through photosynthesis); they have the additional advantage that they may be used in a (photo)bioreactor (no
need for arable land), and may be programmed in a way not to require freshwater. Apart from biofuels, algae
may also be used to produce pharmaceuticals-related products like omega-3 fatty acids, e.g. DHA
(docosahexaenoic acid) and EPA (eicosapentaenoic acid), ARA (arachidonic acid, an omega-6 fatty acid),
chlorophylls, carotenoids, phycocyanins, allophycocyanin, phycoerythrin, etc. (Lee 2013).
Algae for the production of desired compounds

As molecular genetic manipulation of eukaryotic algae and/or prokaryotic blue-green algae (cyanobacteria) is
easier than that of higher plants this field is emerging much faster than the latter (Lee 2013). Potential
applications include biofuel-production, ultimately by direct conversion of sunlight to fuel. It may also be used
to replace biomass production on arable land and the use of freshwater by employing other sources like sea-,
ground- or even waste water.
Biofuels and byproducts can be synthesised from a large variety of algae (Menetrez 2012). Using algae and
microalgae for the production of biofuels is an attractive application due to their potential to accumulate high
amounts of lipids and due to high starch content providing a good source for bioethanol production (Safi et al.
2014). In addition, they can be cultured with an inexpensive nutrient regime, have faster growth rate
compared to terrestrial plants and high biomass production. As they provide an alternative to current biofuel
crops (e.g. soybean, corn, rapeseed and lignocellulosic feedstock) also less favoured environments (land that is
unsuitable for agriculture, brackish coastal water and seawater) may be used, adding to the potential to
provide remediation for waste (Safi et al. 2014; Menetrez 2012).
Microalgal growth may be autotrophic (photosynthesis under appropriate light conditions), heterotrophic
(without light, requiring an organic carbon source), and mixotrophic (combination of photosynthesis and an
external carbon source). Finally, co-cultivation and co-immobilisation with bacteria is possible. Microalgae are
harvested by centrifugation, flocculation, flotation, or filtration (reviewed in Safi et al. (2014)).
Growth techniques for algae and microalgae include open pond systems that may be natural (lakes, lagoons,
ponds) or wastewater, artificial ponds, or containers and tanks (Safi et al. 2014; Menetrez 2012). Open ponds
47
are the most common and cheapest way of large-scale biomass production and are in particular used for
strains with high oil content. However, open systems also require strict control systems to avoid pollution,
water evaporation, contaminants, invading bacteria and the risk of growth of other algae species. Stirring is
necessary, at least near the end of the exponential growth phase, due to potential low surface to volume ratio
and poor diffusion of CO2 to the atmosphere. Alternatively, closed photo-bioreactors (flat-plate, tubular or
column) are used, which provide a managed environment that allows for higher cell concentration and the
production of pure pharmaceuticals, nutraceuticals and cosmetics. Major disadvantages of closed systems are
higher costs (construction, sterilisation) and small illumination area. Balancing the advantages and constraints
in both systems hybrid culture systems may be chosen.
Algae are among the most potentially significant sources of sustainable biofuels in the future of renewable
energy (Menetrez 2012). There are several areas of researches for the production of biofuels based on algae
and microalgae, classified as lower plants, and cyanobacteria, which have as bacteria the ability for oxygenic
photosynthesis. Lipids, such as triacylglyceride (TAGs), and carbohydrates, both derived by extraction from
algae, can be used as sources for the processing into biodiesel and ethanol (Menetrez 2012; Georgianna and
Mayfield 2012). Algae are commonly genetically engineered to allow modification for agricultural and
industrial biofuel production (Menetrez 2012). Therefore also synthetic biology tools get included in the algae
biomass and lipid production and further in optimisation strategies for these tools. Challenges are the finding
of the ideal algal strain for effective production of biomass and photosynthetic activity and the adaptation to
variations in temperature, light, salinity and pathogen load in agricultural systems. Strains of the algae classes
Chlorophyceae, Eustigmatophyceae (f.i. Nannochloropsis sp.) and Haptophyceae are used to produce biofuels
and other industrial organic chemicals but many other types of algae and photosynthetic active cyanobacteria
get tested as further biofuel candidates. In agricultural production the cultivation of the algae is done in open
ponds and for industrial production bioreactors or photobioreactors are use (Georgianna and Mayfield 2012).
For efficient, large-scale and sustainable algal biofuel production further engineering strategies and
improvements are needed. In regard to applications of synthetic biology methods combined with algal
“farming” in open pond systems or bioreactors, also crop and environmental protection measures/strategies
will be required.
Biofuel production from biomass

Attempts to improve the energy-conversion efficiency and the production of biofuels from non-food
agricultural residues use the techniques of synthetic biology, and involve corn stalks, straws, grass clippings,
prairie grasses, wood chips, and dedicated biomass crops, like sugar cane, corn, grain and switchgrass (Agrivida
2012b; Fesenko and Edwards 2014; PCSBI 2010). The goal is to produce fuels and other valuable chemical
products from simple, inexpensive and renewable starting materials in a sustainable manner (JBEI 2014). The
various synthetic biology alternatives to current biofuel production methods include producing cellulosic
ethanol (derived from cell walls rather than corn) and manufacturing other bioalcohols with synthetically
manipulated biomass. A potentially more promising bioalcohol made by synthetic biology and used for energy
production is butanol. Like ethanol, butanol is produced by the fermentation of sugars and starches or through
the breakdown of cellulose (PCSBI 2010). Companies and organisations, like Agrivida, Amyris, JBEI, British
Petroleum, DuPont, Gevo, Global Bioenergies, LS 9, Inc., try or already use synthetic biology to produce
biofuels (Lipp 2008; PCSBI 2010). However, the current market status varies and is difficult to assess (Table 4).
The efficiency in bioenergy production may be increased by modifying plant cell walls to enhance the
digestibility of lignocellulosic biomass (Lee 2013). Agrivida has created a proprietary INzymeTM molecular
engineering technology. The modified enzymes allow a significantly more efficient conversion of plant cell
walls into sugars through the production of embedded "dormant" enzymes, which are then activated under
specific post-harvest conditions (Agrivida 2012b; BIO 2013). The modified enzymes can break down a wider
48
range of biomass more effectively, making it possible to utilise agricultural waste such as corn stalks and straw,
and woody biomass (PCSBI 2010).
Some Biofuels are currently available as product (near-term), in pilot development (medium-term), or are
expected in the long term, when companies have demonstrated intent to develop the application (Table 4).
Table 4: Product Matrix for biofuels (SBP 2012) “Inventory of synthetic biology products – existing and possible”
(Synthetic Biology Project – Draft, July 2012)
The classification concerning the readiness for marketing reads as follows (SBP 2012):
- Near-term: currently available as product, demonstrations have been running and may be scaled up, seeking
out markets and customers
- Medium-term: pilot plant built, in clinical trials, joint venture established, holds patents
- Long-term: companies have demonstrated intent to develop this application, but has not progressed beyond
small scale or experimental work, applied for patents
- On the horizon: no commercial development, but some laboratory experimentation
The expected benefit of technologies that make use of biomass feedstock with dormant biodegrading
enzymes, like the INzymeTM technology (Agrivida 2012b), is to reduce the cost and energy of breaking down
feedstock for the fermentation process to produce ethanol or to create high-performance feedstocks or
chemicals (Agrivida 2012a, b). In June 2012, Agrivida announced at the National Corn Growers Association’s
Corn Utilization and Technology Conference that it had launched its “first significant field production” of
modified corn in US Department of Agriculture-permitted field trials (Agrivida 2012b).
49
TM
Figure 14: INzyme Plant Expression (Agrivida 2012b)
“Glowing plants”
A further research for using synthetic biology techniques is demonstrated in the design/ the creation of
glowing plant. In the so called “Glowing Plant project”, synthetic biology techniques and software from
Genome Compiler, for the design and „print“ DNA, are used for transformation processes of Arabidopsis
thaliana. These processes will lead to the production of luciferase and luciferin, which appears in an emission
of weak, green-blue light by endowing it with genetic circuitry from fireflies. Finally the creation of a so called
“Glowing Plant” is completed/finished (Callaway 2013). Pollack (2013) tinkers with this idea one stage further
for the development of glowing trees that can replace electric streetlamps and potted flowers luminous
enough to read by.
But there are fears for an unsupervised and uncontrolled release of such synthetic engineered organism/plants
due to the assumption that no regulatory system would interfere in this case. Critics speak of gaps and holes in
the regulatory structure and say that this might strengthen a negative public perception of synthetic biology,
because there is no real “useful” task behind this research/development. It could be seen only as a synthetic
gimmick/gadget and therein should not be the main focus on such kind of research development of synthetic
biology or the use of synthetic biology techniques (Pollack 2013; Callaway 2013).
4.3.3 Emerging applications

Cell-free synthetic biology to replace plant cell cultures
Plant cell culture allows for sustainable production of secondary metabolites, which, at the same time, is
challenged by low product yields (Wilson and Roberts 2012). Cell culture variability, i.e. dedifferentiated versus
differentiated cells, is an important factor governing metabolite and protein production.
Cell-free biology, on the other hand, is a possibility to produce desirable compounds and to incorporate non-
natural encoded amino acids (NNAA) without the limitations and necessities of intact living cells (Harris and
Jewett 2012). Recent applications of cell-free synthetic biology (Smith et al. 2014) include antibody production
(in prokaryote- and eukaryote-based systems), pharmaceuticals (vaccines, e.g. against Lymphoma and
Malaria), or biocatalysts like hydrogenase and lipase. Finally, the incorporation of unnatural amino acids has a
number of applications such as ligand-protein interaction, biotherapeutics, and biocatalysis.
Transient expression of synthetic biology in plants

Transient expression systems and their controlled modulation are important tools in plant-based synthetic
biology (Sainsbury and Lomonossoff 2014). Transient transformation of plant tissues is rapid and the
50
production of recombinant proteins or products of their activity is fast, and expression yields allow for
commercially relevant production. Attractive targets are the production of triterpenes that have a wide range
of potential commercial applications (pharmaceutical, food, and cosmetic industries, etc.) but are recalcitrant
to synthetic chemistry and occur in low abundances in plants. Another example is the production of
intermediates in the biosynthesis of the antimalarial drug artemisinin. Recently the relocation of a metabolic
pathway was shown, concretely the light-dependent production of the aromatic defence compound dhurrin in
the chloroplast, providing an example of exploiting photosynthesis in synthetic biology (Nielsen et al. (2013)
cited in Sainsbury and Lomonossoff (2014)).
Engineered minichromosomes in plants

Like in yeast and mammals, artificial chromosomes may be generated by using either bottom-up or top-down
approaches to be reintroduced into plants (Birchler 2014; Patron 2014). Suggested future applications include
designing chromosomes to desired specifications and engineering them in a way that there is enhanced
transmission to next generations, ensuring efficient transfer to virtually all progeny. By transferring
minichromosomes from a haploid inducer to target lines linkage drag could be eliminated. The
minichromosomes could be placed into a number of different varieties, carrying a wide range of beneficial
properties like whole biochemical pathway leading to adaptation and improvement of field crops (e.g.
resistances, nutritional qualities, yield, etc.). Besides Arabidopsis, successful engineering of minichromosomes
in plant species focussed on maize, in which supernumerary or B chromosomes are the primary target as their
modification does not directly link to phenotypic alterations. Future research will focus on the modification of
chromosomes in vivo and on avoiding potential problems during meiotic transmission.
“Artificial leaf” – the use for solar energy as bioenergy for the production of solar fuels
One division of synthetic biology is the approach of artificial photosynthesis, or to create plants that more
efficiently collect sun energy and directly convert it into fuels (Lee 2013).In this context, the design of an
artificial “leaf” was suggested, with the central concept of using sunlight to produce hydrogen and other fuels
much more efficiently than real leaves ever made biomass (Marshall 2014). UK researchers focus on the direct
conversion of sunlight to “solar fuels”, by trying to use chemical reactions similar to photosynthesis but in an
artificial system and the production of such carbon-based liquid fuels via synthetic biology tools (UKSBRCG
2012).
The Joint Center for Artificial Photosynthesis in California concentrates on the design of an artificial leaf
through construction of two electrodes immersed in an aqueous solution. Each electrode is composed of a
semiconductor material chosen to capture light energy from a particular part of the solar spectrum. This
process uses photons from sunlight to split water molecules into oxygen and hydrogen, which can be used to
make fuel (Marshall 2014). There are also further similar researches for using the solar energy for the
production of alternative fuels, including developments in the field of Solar Fuels, HyperSolar photoabsorbers
or Artificial Photosynthetic Chemical Process (Marshall 2014).
The concept of artificial photosynthesis remains the same in every approach: The use of the biggest energy
source, the sun, and the combination with energy storage in chemical fuels. The challenge would be the
optimizing of all production steps in-between and the use of the light in a most efficient way.
“Ferrari plants and crops” – outlook on synthetic biology in agriculture

Another though less advanced application is to increase plant productivity, which may be achieved in manifold
ways. One possibility is the thorough redesign of the photosynthetic apparatus as optimised photosynthetic
efficiency may lead to an increase in biomass and energy production (Zurbriggen et al. 2012). There are also
attempts to improve crop yields by manipulating key processes such as the developmental and environmental
51
control of flowering time, or the hacking of the circadian clock. This may be achieved, for instance, by
designing a synthetic plant signal transduction pathway, which is the starting point to assemble fully synthetic
signalling networks.
Synthetic approaches aiming at engineering C4 photosynthesis (as found in for example maize and sorghum)
into the more diffused C3 background have been suggested by Denton et al. (2013). The obvious advantage of
C4 plants as compared to C3 is higher productivity at elevated temperatures, and higher nitrogen and water
use efficiencies (i.e. more biomass with less input). Systems and synthetic approaches are used to understand
the trait, aided by the completion of several genome sequences of C4 grasses.
McFadden (2012) describes synthetic biology as “our best hope for a healthy future” – bringing up hopes to
create plants that are able to perform photosynthesis more efficiently by harvesting light from wider regions
of the spectrum or capture nitrogen directly from the air so they will not need nitrogen fertiliser. In addition,
the design of new microbes that digest and degrade toxic pollutants or turn agricultural waste into electricity
are mentioned as applications that will tackle food security and at the same time reduce the negative
environmental impacts of agriculture (McFadden 2012).
52
Synthetic Biology | Risk assessment and risk management
5 Risk assessment and risk management

5.1 Current risk assessment approaches
The current approach for the risk assessment of GM plants in the European Union is set out by different EU
regulations and EFSA guidance documents and dealing with the marketing of food and feed, the use for non-
food and non-feed purposes, and the deliberate release into the environment (EFSA 2011, 2010a, 2009; EC
2001, 2003, 2013). The risk assessment is characterised by the four different steps: hazard identification,
hazard characterisation, exposure assessment and risk characterisation.
In addition, the following elements are part of the current risk assessment procedure:
i) Risk assessment of GM plants and derived food and feed (EFSA 2011):
- Characteristics of the donor organisms and recipient plant
- Genetic modification and its functional consequences
- Agronomic and phenotypic characteristics of the GM plant
- Compositional characteristics of GM plants and derived food and feed
- Potential toxicity and allergenicity of gene products (proteins, metabolites) and the whole GM plant
and its derived products
- Dietary intake and potential for nutritional impact
- Influence of processing and storage on the characteristics of the derived products
ii) Environmental risk assessment of GM plants (EFSA 2010a):

- Persistence and invasiveness including plant-to-plant gene flow
- Plant to micro-organisms gene transfer
- Interactions of the GM plant with target organisms
- Interactions of the GM plant with non-target organisms
- Impacts of the specific cultivation, management and harvesting techniques
- Effects on biogeochemical processes
- Effects on human and animal health
- Post-market environmental monitoring
The risk assessment of GM plants not intended for food or feed uses contains similar elements to those
abovementioned (EFSA 2009): molecular characterisation, safety for humans and animals (e.g. compositional
characterisation, toxicology), safety for the environment, monitoring.
With all three EFSA guidance documents, the comparative approach is considered a crucial part of the risk
assessment. Besides the molecular characterisation, it forms the basis for the evaluation of the intended
alterations of the plant phenotype and, in particular, for the detection of any unintended effect:
 "Unintended effects may be detected through the comparison of the agronomic, phenotypic and
compositional characteristics" (EFSA 2011),
 "The comparative safety assessment is being followed in order to identify differences caused by either
intended or unintended effects" (EFSA 2010a),
 "Compositional analyses have to be carried out […] to identify and quantify possible unintended changes in
the composition of the whole GM plant” (EFSA 2009)
Comparative approaches were introduced as key element of the GMO risk assessment (OECD 1993). They
intend to provide significant information on the substantial equivalence between GM plants and comparators,
which – in case of sexually propagating crops – are defined to be non-GM genotypes with genetic backgrounds
as close as possible to the GM plant (EFSA 2011). The EFSA guidance for GM plants used for non-food and non-
53
feed purposes gives detailed comments on "substantially modified" transgenic plants. It is said that
substantially modified transgenic plants cannot be statistically compared with conventional plants making the
risk assessment much more laborious and complex. The reason is that extensive genetic modifications (e.g. the
insertion of multiple genes) can lead to substantial changes in the original metabolism and composition of the
GM plant (EFSA 2009).
For GM plants used for non-food and non-feed purposes, the EFSA GMO Panel still considers that the vast
majority of the basic biology of the GM plant and the non-GM comparator will remain the same. Therefore a
certain level of comparison with a non-GM comparator will always be appropriate.
5.2 Applicability of current approaches on plants created by synthetic

genomics
Per definition, metabolism and also physiology of a synthetic organism will be largely different to any
conventional plant. In addition, plants produced by synthetic genomics are different as regards composition,
and any process of synthetic engineering of a plant can result in unknown physiological and biological
processes. For this reason the application of the concept of substantial equivalence is not possible and not
feasible.
The risk assessment and evaluation of synthetic plants has to be done in a case specific manner and with
respect to potential impact on human and animal health and the environment addressing:
 the level of differences with respect to the main biological characteristics of conventionally bred crops in
general,
 the technology and concept behind the design of the synthetic plant,
 the biogenetic principles and the construction process of the synthetic material and the underlying
biological functions and characteristics of the synthetic organism at the genome and metabolic level,
 the intended function and behaviour of a synthetic plant,
 the design of field trials required to account for situations where the receiving environment of the
synthetic plant is substantially different to the appropriate comparator,
 the different environments that are associated with the intended function and the intended use of the
synthetic plant,
 specific biological and genomic properties, e.g. expression of artificial proteins, newly introduced
regulatory mechanisms,
 the selection of the endpoints that need to be tested, possibly based on the new variety studies for crop
plants (DUS), that could provide the basis for establishing a minimum requirement for plants created by
synthetic genomic (UPOV 2011),
 the variation in the endpoints tested depending on the biology of the synthetic organism,
 the assessment of the comparative data in relation to the outcome of the molecular characterisation,
 the verification of any unanticipated effect by additional experimental data (e.g. field testing, food
safety studies),
 the problem that the products of synthetic plants (e.g. a different nucleic acid) released into the
environment could be highly hazardous, and
 the necessity of extensive laboratory testing prior to any release experiment.
It is noteworthy that synthetic genes and, in general, new life forms have no evolutionary history and cannot
be traced back to wild ancestors (Norton 2010). A comparative approach usually will not be applicable due to
the missing evolutionary history and relationship of a synthetic higher plant (a non-existing biological system)
and a conventional crop plant. A comprehensive toxicological and allergological risk assessment can provide
the missing data. Internationally accepted approaches applied for testing chemicals in foods (Renwick et al.
2003; EFSA 2011) form the basis for the testing and quantification of adverse effects caused by artificial
54
molecules (DNA, proteins, metabolites, etc.). Long term effects are to be tested by appropriate repeated-dose
studies.
90-day rodent feeding study is being widely regarded as the single most appropriate test for the detection of a
wide range of toxicological endpoints, when suitably conducted (EFSA 2008). In case of synthetic plants, the
realisation of long-term oral toxicity studies can characterise the dose-response relationship, predict chronic
toxicity effects at human exposure levels, and test hypotheses regarding the mode of action of synthetic plants
and derived material. Long-term toxicity studies in animals can reliably identify no-observed-adverse-effect
levels (NOAEL) used for establishing safety criteria for life-long human exposure (OECD 2009). Additional
toxicological data can provide information for studying the potential of the artificial genomic material or newly
expressed proteins derived from synthetic plants to cause carcinogenic, developmental, reproductive,
hormonal, or neural dysfunctions in humans, and also on the toxicokinetics of the synthetic organic material.
5.3 Additional aspects in the risk assessment of plants created by synthetic

genomics
Four different subfields/techniques in the area of synthetic genomic are mentioned in scientific literature
(Schmidt 2010a):
 DNA based bio-circuits (design of genetic circuits and inserting them into living cells)
 Minimal genome (synthesis of genomes and transplanting them into cells)
 Protocells (production of cellular containers and insertion of metabolic components)
 Chemical synthetic biology (alternative chemical systems with similar biological functions)
Not all areas are equally important for the development of synthetic higher plants. Bio-circuits, minimal
genome and protocells are only relevant for single cell approaches. However, it is likely that knowledge and
expertise gained from these technologies may also be useful for the designing of synthetic plants.
For the risk assessment of DNA based bio-circuits it is not sufficient to study how the genetic element behaves
in a new environment, but to assess any interactions of the numerous genetic parts that were inserted. A
comparable counterpart for assessing a full behavioural range will not be available. Also, with minimal
genomes and protocells conventional comparators are not available, although the limited viability of minimal
genomes in the environment adds to the safety of such organisms.
Chemical synthetic biology approaches could be used for the production of synthetic higher plants. This
approach includes the chemical modification of DNA, polymerases, amino acids and proteins, but also the
identification of amino acid sequences that have a stable architecture but do not occur in nature. There are
also so-called "never-born-proteins" that could provide a lot of useful novel functions for molecular biology.
Other areas of work are the changing of translation mechanisms or the use of synthetic nucleic acids (e.g.
replacing of base pairs, modifying sugar molecules) not occurring in nature.
The main problems in relation to synthetic plants produced by chemical synthetic biology approaches are the
high levels of uncertainties with respect to unnatural (chemically synthesised) DNA sequences, especially
synthetic nuclein base analogs. Unexplainable effects were reported with respect to a synthetic poliovirus
genome by Cello et al. (2002) mentioning that the silent mutations introduced into the virus genome had an
influence on pathogenesis by hitherto unknown mechanisms. Similar and additional unknown mechanisms are
to be expected in synthetic plants, especially when synthetic base analogs are utilised.
In the light of recent developments in synthetic biology community a framework for risk research that
addresses four public safety issues has been proposed by the Woodrow Wilson Synthetic Biology Project:
55
 How might synthetic organisms interact with natural ones?

 How well will they survive in receiving environments?
 How might they evolve and adapt to fill new ecological niches?
 What is the potential for gene transfer into unmodified organisms?
The synthetic biology community was invited to address these questions through designing, building, and
testing new synthetic systems. The knowledge gained from the tests will help to close the existing knowledge
gaps and contribute to the understanding of the biology behind synthetic higher plants and strengthen risk
assessment processes.
Adverse effects can result from unintended exposure to toxins or pathogens originating from synthetic plants.
Infectious diseases can be considered resulting from accidental transmission of disease agents manipulated for
the development of synthetic organisms. If the reproduction of such synthetic organisms is not limited, risks of
transmission can increase and may spread to wider human community or the environment (Colussi 2013). A
proper evaluation of the reproduction system of a synthetic plant therefore is a very important issue for the
risk assessment.
Additionally, the careless use and implementation of pathogenic DNA sequences has to be avoided.
Requirements need to be established for the performance of routine screenings for pathogenicity before
development and assembling of synthetic DNA constructs (Hatch 2010).
The commercialisation of a synthetic higher plant poses certain risks, one of which is the risk of increasing the
probability of development of exotic plant species. In this context, it is pointed out that the accidental release
of synthetic organisms is difficult to control, and also that hazards occur when these organisms replicate in the
environment (Colussi 2013).
Another risk is that a genetic exchange between synthetic organisms (biological entities) and natural
organisms may occur. Such an exchange, called "genome contamination", could affect human health, and also
biological ecosystems influencing mutation and evolution.
It is further important to note that the consumption of synthetic proteins in food can lead to allergies or
negative changes in nutritional values. Such synthetic proteins may even consist of non-canonical amino acids
altering the physical and chemical properties as compared to natural proteins (Johnson et al. 2010). It is also
unclear how to adequately test for the allergenic potential of synthetic proteins, as the current allergological
assessment considers animal tests in most of the cases not relevant because of the lack of validated tools (e.g.
animal models). Especially, animal models cannot fully reproduce the diversity and variability of the IgE
response in heterogeneous populations of atopic humans or the conditions of sensitisation that occur in the
real life. Also, current animal models have not enough sensitivity and specificity in order to guarantee the
absence of false negative and false positive results (EFSA 2010b).
Issues pertaining to biosecurity (the protection, control of, and accountability for high-consequence biological
agents and toxins; NSABB (2010)) also need to be addressed. The dilemma arises when scientific knowledge
could be used in both directions, beneficial and harmful (e.g. the misuse of a synthetic organisms); and when
the risk of harmful use is that high that it is no longer clear whether that knowledge is to be pursued or
disseminated (Douglas and Savulescu 2010; Jain et al. 2012) or not. Such bioethical issues need also be
considered in the context of synthetic biology based applications.
In conclusion, it is difficult to assess the risk and impact associated with the use and application of synthetic
biology technology, as research is still in an early phase. However, there are many points that must be
considered before making appropriate risk and safety analyses. For instance, risk assessment methods have to
56
be adequate to assess the risk of gene transfer. Gene transfer of synthetic plants depends on the likelihood of
plant pollination, but also the release of high-copy plasmids from dead cells might result in gene transfer.
Interactions between plants with synthetic modifications and natural organisms have to be considered as well.
Such modifications may enable synthetic cells to adhere with natural cells or invade cell membranes.
Experiments need to be carried out in order to measure any synergistic or toxic effect on cells caused by the
synthetic plant (Moe-Behrens et al. 2013).
Currently, it is highly unclear how all risks that may occur with synthetic higher plants can be fully assessed.
This applies in particular for organisms which are based potentially on a different nucleic acid or on an
enlarged genetic alphabet. In this context it has to be noted that organisms based on an enlarged genetic
alphabet might avoid natural predators at all, possibly enabling unrestricted spread. Moreover, the use of an
extended genetic code is mentioned in scientific literature, but only in connection with bacteria and not with
higher plants. So it is speculated that the use of an extended genetic code and a corresponding novel
polymerase could lead to a synthetic Escherichia coli organism. However, it is extremely unlikely that anything
like that or even more that a synthetic higher plant will soon occur (Schmidt 2010a).
5.4 Assessment of the practical consequences and risks of a release into the
environment of plants created by synthetic genomics
From the data available, it is extremely unlikely that release experiments of synthetic higher plants in the strict
sense will be performed in the near and mid future. What is more realistic are synthetic biology approaches
implemented for the development of photosynthetic microorganisms, cyanobacteria and microalgae
(unicellular algae). Different approaches for redesign of the photosynthetic apparatus of microalgae or novel
pathway for the production of compounds with novel chemical properties were reported (Zurbriggen et al.
2012).
Microalgae modified by genetic engineering are currently used for different industrial processes, of which the
most prominent is the production of biofuels (Wageningen UR 2014). The most important risk assessment
strategies for these release scenarios have been described which provide fundamental aspects that are
essential to be mentioned also with respect to microalgae produced by new technologies including synthetic
biology.
Microalgae can be cultivated in different aqueous systems, from open air ponds to closed bioreactors with
closely controlled environments. Potential hazards may be identified in connection with the amplification of
microbial populations, microalgae (including synthetic organisms), toxins, and enzymes in such cultivation
systems that may be potentially hazardous to the environment and individuals. Each process could produce
potentially pathogenic, toxic, infective, or allergenic compounds. Any impacts of a release scenario, therefore,
can be risk assessed only by the complete understanding of the process employed and the specific algal
organism used. Specifications of the synthetic organisms and their behaviour under different conditions need
to be fully understood and characterised.
Therefore, the most important points in relation to the risk assessment of the production of industrial
compounds including biofuels by synthetic microalgae are (modified from EFSA (2011); Wozniak et al. (2012)):
 submission of all available data on the microorganism(s) (e.g. the synthetic biology approach) and the
planned activities,
 a priori evaluation of the release into the environment,
 information and discussion concerning actual or potential effects on health or the environment of the
microalgae along with their phenotypic and ecological characteristics,
57
 utilisation of experimental data proving the absence of pathogenicity (e.g. toxicity studies) taking
account of:
 the presence and levels of synthetic material or other new constituents (synthetic DNA/proteins,
unnatural molecules, etc.)
 the differences between the synthetic organism and natural systems regarding e.g. gene regulation,
metabolic functions, chemistry, cellular components, responses to different environments
 the impact of other changes in anatomical, nutritional and physiological characteristics due to the
synthetic design process
 information about the proposed field testing activity including the objectives and significance of the
activity with a rationale for the release in the environment,
 the numbers and frequency of microorganisms released by the proposed application,
 full characterisation of the location including the geographical, physical, chemical, and biological
features, and proximity to human habitation or activity, and
 description of the proposed confinement procedures, potential mitigation and emergency procedures,
and the procedures for routine termination of the activity.
5.5 Biosafety considerations on BioBricks™ used for Synthetic Biology

The backbone of biosafety assessment is the classification of host (micro-) organisms into four risk groups as
set out in Table 5 (WHO 2004).
Risk Definition Explanation

Classification
Risk Group 1 no or low A microorganism that is unlikely to cause human or animal disease.
individual and
community risk
Risk Group 2 moderate A pathogen that can cause human or animal disease but is unlikely
individual risk, to be a serious hazard to laboratory workers, the community,
low community livestock or the environment. Laboratory exposures may cause
risk serious infection, but effective treatment and preventive measures
are available and the risk of spread of infection is limited.
Risk Group 3 high individual A pathogen that usually causes serious human or animal disease but
risk, low does not ordinarily spread from one infected individual to another.
community risk Effective treatment and preventive measures are available.
Risk Group 4 high individual A pathogen that usually causes serious human or animal disease and
and community that can be readily transmitted from one individual to another,
risk directly or indirectly. Effective treatment and preventive measures
are not usually available.
Table 5: Classification of host (micro-) organisms by risk groups (NIH 2013)
As any new technique may represent a risk to human, animal or environmental health Synthetic Biology is
subject to specific regulations in order to perform research in a responsible and safe way (Check 2005). This
circumstance is of special relevance for projects intended to be released into the environment or for
commercial use.
The focus of risk assessment of constructs designed with BioBricks™ has usually been put on laboratory safety
based upon biosafety guidelines as published by the NIH (NIH guidelines for research involving recombinant or
synthetic nucleic acid molecules) (NIH 2013) and WHO (Laboratory biosafety manual) (WHO 2004).
However, a biosafety level designation is not exclusively based upon the classification of the host organism but
is a composite of design features, construction, containment facilities, equipment, practices and operational
procedures required for working with agents from the various risk groups as displayed in Table 6.
58
Risk Biosafety Level Laboratory Type Laboratory Practices Safety Equipment

Group
1 basic basic teaching, GMT none;
Biosafety research open bench work
Level 1
2 basic primary health GMT plus protective open bench plus BSC
Biosafety services, clothing, biohazard for potential aerosols
Level 2 diagnostic sign
services,
research
3 containment Special as Level 2 plus BSC and/or other
Biosafety diagnostic special clothing, primary devices for all
Level 3 services, controlled access, activities
research directional airflow
4 maximum dangerous as Level 3 plus airlock class III BSC, or

containment pathogen units entry, shower exit, positive pressure suits
Biosafety special waste in conjunction with
Level 4 disposal class II BSCs, double-
ended autoclave
(through the wall),
filtered air
Table 6: Relation of risk groups to biosafety levels, practices and equipment (NIH 2013)
GMT….good microbiological techniques

BSC….biosafety cabinet
It is important to realise that the risk group classification scheme is to be used only for laboratory work.
However, this classification provides a convenient basis and starting point for a comprehensive risk assessment
of BioBrick™ devices and viable constructs.
The assignment of an agent to a risk group is based upon a thorough risk assessment process considering the
following issues (WHO 2004):
1) Pathogenicity of the agent and infectious dose

2) Potential outcome of exposure
3) Natural route of infection
4) Other routes of infection, resulting from laboratory manipulations (parenteral, airborne, ingestion)
5) Stability of the agent in the environment
6) Concentration of the agent and volume of concentrated material to be manipulated
7) Presence of a suitable host (human or animal)
8) Information available from animal studies and reports of laboratory-acquired infections or clinical
reports
9) Laboratory activity planned (sonication, aerosolisation, centrifugation, etc.)
10) Any genetic manipulation of the organism that may extend the host range of the agent or alter the
agent’s sensitivity to known, effective treatment regimens
11) Local availability of effective prophylaxis or therapeutic interventions
The assignment of biosafety levels takes the following issues into account:
 Organism (pathogenicity of the potential host/agent)

 Facilities available
 Equipment
59
 Practices and procedures to conduct work safely in the laboratory
Beginning in 2008, iGEM acknowledged these issues and started to request mandatorily the answering of a
questionnaire relating to the biosafety aspects of the submitted projects from the competitors (Guan et al.
2013). Risk assessment of BioBrick™ constructs under the auspices of iGEM is predominantly based upon self-
evaluation by the involved researchers in combination with incentives to involve local biosafety committees
and open to scrutiny by the public.
On the level of BioBrick™ basic and composite parts risk assessment is quite straight forward: A combination of
a strong constitutive viral promoter with a known pathogenicity determinant (e.g. adhesion-, invasion factors,
toxins, insufficiently characterised proteins etc…) intended to be applied in a human or animal environment
has to be treated in a different way compared to a system relying on an inducible promoter assembled to a
well-known housekeeping gene (e.g. glycerinaldehyd-3-phosphat-dehydrogenase, ribosomal proteins etc.).
All items deposited in the Registry Repository maintained by iGEM are accompanied by a detailed description
of their function and origin. This information is open for public and scientific scrutiny. The potential risk
mediated by a single part may, therefore, be readily assessed before the constructs are actually synthesised,
because usually sufficient information concerning biosafety aspects is available. This open source/open access
strategy followed by the iGEM consortium allows streamlining of the risk assessment process and facilitates a
first estimation of the potential risk mediated by the designed construct. On the level of BioBrick™ devices risk
assessment relevant information obtained for basic and composite parts provide a valuable basis and starting
point for a full scale risk assessment procedure for a product which is intended for deliberate release or for
commercial purposes as the cellular context comes into play.
A “self-evaluation” of iGEM projects in the years 2008 - 2011 by the executing researchers revealed four major
categories of risk they conceived concerning their application of principles for Synthetic Biology (Guan et al.
2013):
 No risk: The project posed no risk at all

 Minor biosafety problems: There were minor problems to be expected which the researchers were
confident to solve
 Major biosafety problems: Difficult problems were to be expected during the course of the project
which were assumed to be difficult to solve
 Major biosafety problems: no solution provided
The most common observed safety issues were related to:
 Known toxicity of chemicals used during the execution of the project (e.g. ethidium bromide, IPTG,
phenol, etc.)
 Hazardous physical agents (e.g. ultraviolet light)
 Biological waste disposal
 Environmental pollution
As insurmountable safety related problems i) horizontal gene transfer, ii) unpredictable mutations in the
designed construct in the living cell, iii) unknown and/or pleiotropic effects of the bacterial modification, iv)
misuse of the product and v) antibiotic resistance were identified.
In order to mitigate the risk of biosynthetic products appropriate biosafety laboratory trainings and
cooperation with local/institutional biosafety committees who oversaw the biosafety laboratory rules were
proposed.
Biosafety questions in the area of BioBricks™ which have to be primarily considered are:
60
1. How does the project using BioBricks™ affect the safety of the researcher?
2. How does the project using BioBricks™ affect public safety?
3. Which effects has the project on environmental safety?
4. Is a local biosafety group, committee, or review board involved in the risk assessment of the project?
5. Is the project using BioBricks™ following special/official, national or international biosafety guidelines/rules?
6. Do any new BioBrick™ parts or devices made in the context of the project raise any safety issues?
An obvious advantage of the iGEM risk assessment approach is its open access feature and the reliance on
standardised, exactly defined and characterised genetic elements which facilitates risk evaluation
substantially.
A certain drawback of the iGEM concept is its inclination on laboratory biosafety. BioBrick™ devices and viable
constructs intended for deliberate release into the environment will have to be assessed thoroughly according
to Directive 2001/18/ EC (EC 2001).
The engagement of the scientific community in implementing biosafety measures is essential (NRC 2009).
Without this commitment governments will run into difficulties to prevent accidents that could have possible
adverse effects on public health (De Lorenzo 2010). Actually, the optimal time point to prevent potential harm
is interfering during the developmental stage of a project.
The BioBrick™ concept is supporting this approach substantially and the involved scientific community is
raising awareness in this respect in a commendable way.
5.6 Potential impacts of synthetic biology in relation to biosafety

Biosafety in the context of synthetic biology is an issue of major concern. Accidental or deliberate release of
organisms resulting from synthetic biology techniques (= SB organisms) may have significant adverse effects
on human or animal health or the environment. In the following chapter possible unintended effects caused
by the intentional or unintentional release of SB organisms on the ecosystem, the accidental transfer of novel
genes and hereditary material and the emergence of unpredictable properties of SB organisms are discussed.
Measures for mitigation of these undesirable effects, i.e. the application appropriate layers of containment,
are presented in the following chapter.
5.6.1 Impact on the ecosystem

Intentional and unintentional releases
Intentional and unintentional releases of SB organisms (outside from contained use in research laboratories
and production facilities) may result in adverse effects on biodiversity. Due to a change in biological fitness SB
organisms may either become more invasive, show an increased persistence or an improved survival pattern
and, thus, may reduce the viability of native inhabitants of the exposed habitat (Redford et al. 2013; Wright et
al. 2013). In this sense SB organisms would represent a new class of environmental pollutants.(International
Civil Society Working Group on Synthetic Biology (ICSWGSB) 2011) Even if their lifespan was intended to be
limited substantial short term interruptions in biodiversity may occur (compare with intermitting algal blooms)
(Snow and Smith 2012).
SB organisms intended for contained use

SB organisms originally intended only for contained use may accidentally be released into the environment by
spillage or bioreactor leakage. Usually these kinds of organisms are thought to suffer from reduced fitness and
are believed to bear a selective disadvantage compared to wild type populations (Garfinkel and Friedman
2010; De Lorenzo 2010; Bassler 2010). However, microbes are characterised by a high potential for rapid
61
evolutionary change and innocuous or weak SB organisms may acquire fitness rapidly by beneficial mutations
(Snow and Smith 2012). It should be clear that SB organisms – once released into the environment – cannot be
retrieved anymore (Dana et al. 2012).
The first step in mitigation potential risks by SB organisms is to impose physical barriers which should help to
prevent accidental release into the environment (Schmidt and de Lorenzo 2012). As physical containment
might not suffice, biological containment is proposed as a solution to its drawbacks (Wright et al. 2013;
Marliere 2009). For biological containment the following lines of research are proposed and pursued:
a) induced lethality: “kill switches”, “suicide genes”
This approach is prone to mutations reverting the targeted phenotype by deactivation of the lethal gene
(Schmidt and de Lorenzo 2012). Due to the high rate of evolution of microorganisms this strategy is expected
to be unreliable (Wright et al. 2013).
b) prevention of horizontal gene transfer
The application of phage-resistant strains or of plasmids lacking proper transfer sequences is proposed
(Skerker et al. 2009). However, the prevention of uptake of free DNA by natural transformation of competent
microorganisms will be challenging (Wright et al. 2013).
c) trophic containment:
Auxotrophic SB microorganisms relying on nutrients only present in in vitro settings may be designed (Marliere
2009). Accidental release into the environment would lead to cell death due to starvation. This approach
suffers from several drawbacks as the necessary nutrients might well be present in the environment or the
auxotrophic mutant may use metabolites from neighbouring organisms or horizontal gene transfer might
compensate for the auxotrophic mutations (Moe-Behrens et al. 2013; Wright et al. 2013).
d) Semantic containment: Xenobiology
The application of altered nucleotides and/or alternate backbones other than phospho-ribose and deoxyribose
which would lead to incompatibilities with naturally occurring polymerases, and a confinement of the SB
organism from the living environment appears to be promising (Schmidt 2010b; Marliere 2009). However,
unnatural nucleotides and alternative backbones in nucleic acids may be toxic to conventional cells (Moe-
Behrens et al. 2013).
SB organisms intended for environmental release

Contrary to the experience obtained with genetically modified microorganisms to date, which had been
deliberately released and usually did not perform sufficiently well in their respective habitats, SB organisms
intended for environmental release are especially designed to survive harsh environmental conditions
(Anderson et al. 2012). They may inherently express traits which provide a selective advantage in the
respective habitat reducing inherently the survival capabilities of indigenous inhabitants of the exposed
ecosystem. In this context it is important to clarify that risk assessors and regulators to date have only
insufficient experience in considering potential risks of intentional SB releases and that they have no
experience in considering potential risks arising from the evolution of SB microorganisms and their interactions
with the native populations in their new habitat (Pauwels et al. 2013; Rodemeyer 2009).
62
5.6.2 Transfer of novel genetic material/DNA to native host organisms

Transfer of genetic material from SB organisms to native hosts may be facilitated either by vertical/sexual gene
flow or by horizontal gene transfer (HGT).
Vertical gene transfer

Modified genes may be passed on to native populations of the same or closely related species via pollen or via
imprudent seed exchange as happened with the dispersal of transgenes among non-GM maize variants in
Mexico which has been facilitated by sloppy seed dispersal systems and grain markets (Rhodes 2010; Dyer et
al. 2009).
Horizontal gene transfer

Horizontal gene transfer between microorganisms is mediated by transformation (uptake of free DNA),
conjugation (transfer of DNA between bacteria via cell-cell contacts) and transduction (transfer of DNA via viral
shuttles) (Lorenz and Wackernagel 1994). A major problem for assessing the risk arising from horizontal gene
transfer is the fact that comprehensive knowledge on gene transfer frequencies in natural habitats and the
involved mechanisms is still lacking (Rocha 2013). Although it is well known that horizontal gene transfer is a
hallmark in bacterial evolution bacterial gene transfer is also involved in the shaping of the evolution of
eukaryotic genomes (Rocha 2013). Concerning transformation the exchange of modified genetic material is
also possible even if the initial carrier has died (Wright et al. 2013).
Impact on biodiversity on the genetic level

Horizontal gene transfer from SB organisms to native populations may lead to a change in biodiversity at the
genetic level. A vivid example for adverse effects of HGT is the unrestricted spread of antibiotic resistance
genes in clinical and natural environments leading to a “genome pollution” of native bacterial strains with
genetic elements previously not prevalent in the exposed communities (Wright et al. 2013; International Civil
Society Working Group on Synthetic Biology (ICSWGSB) 2011). The dissemination of resistance determinants
has a profound negative impact on morbidity and mortality of patients suffering from infectious diseases and
puts a severe financial burden on public health. There is no consensus if gene transfer itself is an adverse
effect which needs to be prevented (NGOs) or only a potential mechanism by which adverse effects could
occur (EU regulatory system) (Marris and Jefferson 2013).
5.6.3 Emergence of novel properties

The application of synthetic biology techniques for the construction of new metabolic pathways and regulatory
circuits will lead to radically different forms of life in the long run (Garfinkel and Friedman 2010; Mukunda et
al. 2009). These novel organisms may develop unpredictable new properties. It is disconcerting that the
interaction of novel circuits with endogenous pathways and the interaction with changing environmental
conditions is only rudimentary understood (Pauwels et al. 2013). There is only limited knowledge available
which allows the forward engineering of genetic devices containing a maximum of 20 genes or biological parts
at best (Schmidt and de Lorenzo 2012). Trial and error will be a long-term companion of synthetic biology and
unexpected traits will almost certainly arise (Schmidt and de Lorenzo 2012). That unforeseen results may pose
a serious health hazard is exemplified by the production of a new mouse pox virus which intentionally should
induce infertility but killed not only all of the exposed native mice but also 50% of a vaccinated - and hence
supposedly immune - control group (Schmidt and de Lorenzo 2012; Jackson et al. 2001). This observation
implies that there are clear limits of predictive knowledge (Garrett 2011). The situation will deteriorate
considering the combination of more and more elements from multiple and diverse sources of DNA (Fleming
2006).
63
It is important to note that at present no one comprehensively understands which risks completely synthetic
organisms will pose to humans, animals and the environment, what information is needed to assess these
kinds of risks and who should be responsible for collecting the necessary data (Dana et al. 2012).
64
Synthetic Biology | Discussion
6 Discussion
This report discusses the state of the art of synthetic biology (SB), risk assessment issues, and aspects of
potential knowledge and regulatory gaps. Currently, there is still no satisfactory definition and delimitation of
the field, which results in a number of uncertainties as to which control measures need to be taken. The
recently published definition (SCENIHR et al. 2014) has deliberately been formulated in a very open way. It is
questionable whether it is adequate to allow for the clear classification of relevant activities. This is important
in particular concerning offers from companies as in this context the practice not to use the term SB was
identified.
Both genetic modification and SB are very closely interconnected, a fact that has also been acknowledged by
SCENIHR et al. (2014). Consequently, their opinion explicitly states that SB activities would currently fall under
the relevant legislation for genetically modified organisms (i.e. Directives 2001/18/EC and 2009/41/EC, and
other relevant documents, e.g. EFSA guidance). SB organisms derived from well understood hosts and natural
sequences intended for contained use are likely to be comparable to conventional GMOs (Rodemeyer 2009).
Therefore, the current regulatory regimes on GMOs appear to sufficiently apply to near-term results of SB
techniques. On the other hand and beyond doubt there is huge potential emerging from SB. Measurability is
one of the major factors accountable for the difficulties in delimitation, as is the speed at which new concepts
emerge (SCENIHR et al. 2014). Future considerations have to take into account that in SB not all risks are
identifiable or measurable (Zhang et al. 2011). Thus, care should be taken to observe potential gaps that are
not covered by the current regulatory framework. To achieve this, monitoring of developments in the field will
be necessary, preferably on an international level. Adaption of the regulations is indicated if the complexity of
SB organisms is increasing, novel gene sequences are more profoundly modified and a greater gene pool
and/or sequence variety is used for the construction of SB microorganisms (Pauwels et al. 2013; Rodemeyer
2009).
A coordinated review of any new developments in the field of SB has to be carried out accounting for
consistency of regulatory requirements (WWICS 2014). Further, a gap analysis for the risk assessment and data
collection of synthetic organisms may identify areas for further research. The aim of such an analysis is to
address and to compare up-to-date and outdated practices and strategies in GMO risk assessment to make
them consistent with current and future developments in SB. The purpose of the risk assessment process is to
enable to select the most suitable controls or combination of controls that are proportionate to the risk. It is
reasonable to assume that concomitant with future developments in SB many gaps are to be identified and
tackled concerning food and feed, and environmental risk assessment of synthetic organisms. These are
mainly related to limited information from practical experiences and knowledge gaps in relation to the best
experimental set-ups, and, in general, the low data availability. It will also be necessary to determine statistical
approaches to satisfy the established requirements and safety levels. Areas of continuous refinement and
improvement are to be identified. One example is to clearly define fundamental specifications on the
requirements needed to test for any potential pathogenicity of synthetic living materials concerning tests for
carcinogenic, developmental, reproductive, hormonal, neural dysfunctions, etc. As a possible consequence,
the need to adapt current risk assessment methodologies accordingly might emerge.
Considering the capacity and potential of SB techniques it is important to be prepared for demands on new
risk assessment procedures and regulatory responses (International Civil Society Working Group on Synthetic
Biology (ICSWGSB) 2011). In particular, a debate on suitable and adequate comparators may be expected.
Current GMO risk assessment relies on the assessment of the parental organism and/or suitable conventional
comparators. This approach is inadequate for SB organisms which have no analogue in the natural world
(International Civil Society Working Group on Synthetic Biology (ICSWGSB) 2011). To be prepared for such
65
scenarios and adequate regulatory requirements is of utmost relevance concerning release experiments
involving synthetic organisms with the above-mentioned characteristics.
An important point in relation to additional experimental data on the risk analysis of biomolecular systems and
SB is the need to provide practical examples for mimicking natural biological systems and bridge the gaps
between theoretical concepts and experiments carried out (Zhou et al. 2011). An important component for the
mitigation of potential risks imposed by SB is the focus on risk research. By increasing the efforts in this area,
the relevance of potential or conceived risks versus real hazards may be facilitated and streamlined. Dana et al.
(2012) identified the following areas of risk research to be most urgent and promising:
a) characterisation of the differences in physiology between conventional and SB organisms
b) establishment of the capabilities of SB microorganisms to alter their habitat, the food webs and biodiversity
c) characterisation of the rate of evolution of SB microorganisms in artificial and natural environments
d) understanding of processes relevant for gene transfer
The risk of SB discussed broadly in chapter 5 may be mitigated by the application of appropriate layers of
containment to avoid adverse effects of deliberate or accidental release of SB organisms. With respect to the
European Union, the regulatory requirements applying to GMOs are to be observed also when working with
synthetic organisms. By adhering to the safety levels and related appropriate provisions laid down in the
relevant and national legislation, particularly on contained use, a high level of workplace and environmental
safety is ensured. On the international level, the NIH guidelines for research involving recombinant or
synthetic nucleic acid molecules (National Institutes of Health (NIH) 2013) are a good general basis for
establishing physical containment in SB. They rely on biosafety level standards as established by the World
Health Organization (World Health Organization (WHO) 2004). Biosafety levels correspond to certain codes of
practices, presence of laboratory design, equipment and facilities (World Health Organization (WHO) 2004). An
international agreement concerning adherence to high standards seems to be of particular importance
concerning current SB activities as most of their results are intended for contained use (see chapter 4).
Although effective provisions are in place it should be kept in mind that physical containment is not fail-proof
(Wright et al. 2013). Consequently, some synthetic biologists propose biological containment to overcome the
limitations of physical containment (Wright et al. 2013; Marliere 2009) – however, also single biological
containment measures suffer from certain drawbacks. A solution would be to apply multiple biosafety
mechanisms. On the other hand, the higher the complexity the more prone to failure the system will be
(Wright et al. 2013). Given the expected increase in SB endeavours the effectiveness of different containment
strategies is to be subject to continuous evaluation and development. Aspects concerning containment
strategies have been extensively discussed by the International Civil Society Working Group on Synthetic
Biology (ICSWGSB) (2011). Accordingly, it may be anticipated that effective containment may require updating
and upgrading of the containment facilities.
A major element of mitigating potential risks from SB is to provide proper training (Marris and Jefferson 2013).
Newcomers to SB frequently lack formal biosafety training and sensitisation to ethical, social and legal norms
usually established in the traditional life science research communities (NSABB 2010; Schmidt 2010a). Even
under optimal educational and training conditions understanding of the complexities and non-linearities of
biological systems diminishes over time because proportionally lesser and lesser biologists are involved in SB
(Murray 2010). This issue also reflects one of the major characteristics of SB, i.e. its trans-/interdisciplinarity
(discussed in chapter 1). SB relies on well-educated and comprehensively trained staff capable of
understanding interactions, networks and the complexity of biological systems. A high sensibility of the
66
involved scientists for potential adverse effects of their undertakings on animal, human and environmental
health should be prerequisite.
Another aspect frequently mentioned in the context of SB is the “do-it-yourself” DIYbio community that much
engages in related activities (WWICS 2013a). SB seems to be an attractive field of activity for “amateur
biologists”, possible because, as Seyfried et al. (2014) argue, it is simpler and easier to use than traditional
genetic engineering. Such protagonists enter an area that has been reserved for highly trained professionals in
the past. Not least triggered by the “glowing plant” Kickstarter project as one example emerging from DIY
endeavours requirements for oversight are also heavily debated (Callaway 2013). The “glowing plant” is not
subject to regulatory oversight according to the current system regulating GM plants in the US. Similar to the
earlier case of GM Kentucky bluegrass (Ledford 2011) awareness was raised for weaknesses in the US
regulations governing GM crops. For SB this current lack of authority for oversight will gain more importance
concerning riskier projects that may be pursued (Callaway 2013).
In the European Union, work with GMOs is restricted by the relevant legislative measures; concretely,
European groups have to obtain a license to conduct their research, which is conceived as the primary
challenge for DIYBio Europe, the European amateur biology movement network (Seyfried et al. 2014). Despite
appropriate regulatory provisions, it seems advisable to investigate the consequences of deskilling
biotechnology, not least because not all of the players have undergone formal biosafety training as already
mentioned.
Adequate and effective SB oversight requires an immediate emphasis on preventing known and potential
human exposures to synthetic organisms that have not been proven safe. Workers in SB laboratories will likely
be the first to be exposed to any potential hazards. The current provisions for worker safety in laboratories
dealing with GMOs seem to be adequate to also cover SB experiments in the foreseeable future. Nonetheless
new developments are to be observed as they might require timely reaction taking into account the unique
risks and challenges to human health posed by organisms created through SB. For example, many of the
organisms engineered through SB (e.g., algae) may be aerosolised, in practice are potentially inadequately
confined (described and discussed in chapter 4 and 5), or potentially prone to easily escape confinement. For
such scenarios it will be challenging to apply adequate safety levels.
Exposure to GMOs must be prevented or adequately controlled to reduce the risk to an acceptable level,
which is achieved by defined systems and actions. To minimise potential risks of work with GMOs control
measures are in force to protect people, animals, plants and other aspects of the environment from exposure
to these organisms, and in similar way apply to synthetic organisms. Protective measures include engineering
controls such as containment laboratories and microbiological safety cabinets, management controls such as
safe operating procedures, training, supervision, and personal protective equipment like lab coats, gloves and
spectacles (Glasgow 2014). Based on the current state of knowledge it is unlikely that existing workplace safety
procedures are to be augmented in the foreseeable future. The established standards are appropriate but
must be strictly adhered to in order to ensure that synthetic organisms and their products are adequately
contained.
Conclusion
SB represents an area of science and engineering that raises a couple of issues concerning, e.g., technical,
regulatory, security, biosafety, ethical standards. Monitoring the relevant developments would be greatly
facilitated by the establishment of a clear, unambiguous definition commonly agreed-upon for SB and its
products. The current regulatory regime is to date adequate for SB endeavours. However, care should be
taken to assess possible additional risks whenever new SB projects emerge. Concomitantly, the current
regulatory framework is to be analysed for its applicability and to be adapted if necessary.
67
SB is already considered as new research field in Europe and the research community is supported by the
European Commission through their framework programme. However, for a better understanding of the
global SB landscape international coordination is indispensable, not least concerning a commonly agreed
delimitation of the field and the observation of emerging developments.
Recognising that science tends to move forward much faster than policy formation, early attention to issues
associated with the governance and regulation of SB seem to be particularly appropriate. Consequently
governments should act to ensure ongoing dialogue about emerging technologies such as SB, and
acknowledge international coordination as essential for safety and security considerations.
68
Synthetic Biology | Recommendations
7 Recommendations
The authors identified the following needs for action based on the findings discussed in this report:
Clear definition and delimitation of terms
Currently there is still imprecise assignment of the term “synthetic biology” (SB), and research disclosed
attempts to omit the term by, e.g., using more general terms like “engineering”. To characterise the field by a
clear technical definition helps to identify these grey areas; on the other hand, the difficulties to
unambiguously delimitate the field, in particular concerning the differentiation from genetic modification of
organisms, have been acknowledged (SCENIHR et al. 2014). Despite a recent consensus on the definition for SB
(SCENIHR et al. 2014) the classification of SB and its products remains vague, and decision makers have to step
up efforts to establish a concrete definition for SB and its products to avoid misclassification.
Public information
Periodical information of the public – in particular on biosafety and biosecurity issues – should be provided to
avoid misinterpretation and uncertainty. Open conversation and transparent decision-making processes are
critical to retain public confidence in authorities and institutions like government agencies by preventing that
the public perceives the risks associated with SB to be greater than they actually are.
Coordinated exchange of information and central collection of data
As the field develops at a fast pace the initiation and establishment of appropriate platforms for information
exchange is urgent. Besides monitoring relevant developments, the dialogue should include the analysis of
benefits and risks of applying SB. International coordination of information exchange concerning synthetic
biology endeavours has to be envisaged to ensure that regulators are ready to adequately cover and react to
the developments in the sector. The creation of a database including a detailed description of the projects
(scientific aims, sources/material used, intended purpose, etc.) would greatly support these intentions; ideally,
central recording is foreseen. An added value is the improved predictive ability for SB organisms.
Establishment of standards
It is advisable to establish a mechanism or body to develop a clear, defined, and coordinated approach to
synthetic biology research, development and application (“code of conduct”). New mandates should be
initiated working on general terms and definitions down to unambiguous protocols for specific applications
(e.g. rules for the physical composition of biological expression devices). The European Commission is
suggested to consider inviting the European standardisation bodies to start work in this area. The
establishment of international standards brings technological, economic and societal benefits. Conformity to
these standards also helps reassure consumers that products are safe, and supports regulators in developing
adequate regulatory measures.
High standards for the regulatory framework
Regulatory requirements conforming to high standards should be widely unified, consistent and
complementary rather than contradictory (see f.e. the “glowing plant” that is currently not regulated in the
US). In the European Union uniformity and consistency is achieved by setting high standards in the European
regulatory frameworks. However, keeping these standards implies also a coordinated review of trends to react
to new developments timely and in a harmonised manner. Efforts should be strengthened to setting
internationally agreed high standards for regulations covering SB as core principle to avoid inadequately
regulated SB activities.
69
International coordination
As seen in other fields, upcoming issues of technical, regulatory, security, biosafety, ethical, etc. relevance are
likely evaluated differently in different countries. These diverse approaches may potentially lead to highly
deviating regulatory requirements and even regulatory gaps. Thus, efforts should be made towards high
standards that are ideally widely agreed upon on an international level, as this is understood to be essential for
safety and security considerations. Also, care should be taken to balance the regulatory regime – minimising
risks while avoiding overregulation to allow for research and development.
Evaluation of risk assessment activities
SB techniques have huge capacity and potential. New risks may arise as new organisms with novel properties
are developed. To ensure that risk assessment procedures reflect the state of the art, technological
developments, including the use of hosts and sequences, have to be monitored continuously. Risk assessment
should be based on appropriate standards that conform to at least the current European regulatory
framework for genetically modified organisms. In view of this, the European Food Safety Authority (EFSA) is
advised to launch the systematic evaluation of the current requirements, in particular concerning relevant
safety aspects, for their suitability by the Scientific Committee and Scientific Panel.
Requirements for risk assessment
The requirements needed to test for any possible pathogenicity of synthetic materials (including, inter alia, the
potential to cause carcinogenic, developmental, reproductive, hormonal and neural dysfunctions) have to be
defined. To ensure that the requirements are met, suitable statistical approaches and safety levels need to be
established. Also concerning a thorough assessment of these issues an EFSA mandate is proposed.
Risk research
Several projects have already dealt with potential risks arising from SB activities. Efforts should focus on the
aggregation of available data on an international level. This course of action helps identifying knowledge gaps
(e.g. concerning the best experimental set-ups) and improves the current status in relation to low data
availability and limited information from practical experience. Of particular importance is the promotion of
research to determine the potential risks and hazards originating from the use of synthetic organisms (e.g. the
behaviour in natural or artificial environments or the potential for gene transfer).
Restriction of SB activities without surveillance
In the European Union work with recombinant DNA is clearly regulated and thus the regulative framework also
covers SB activities. Requirements for people and premises are specified and legally binding, and premises
(laboratories) have to be officially approved and regulated. These measures seem to be appropriate to avoid
unrestricted backyard activities in the SB field within the European Union. However, it is advised to develop an
international consensus concerning access to technology and material relevant for SB, taking advantage of
ongoing discussions and awareness in a number of countries (see f.e. OECD (2014)).
Commercial provision of SB material
In view of potential misuse of synthesised DNA sequences, a number of commercial DNA synthesis companies
(under the umbrella of the International Gene Synthesis Consortium (IGSC)) have committed themselves to
screen ordered DNA sequences for their potential to code for pathogenic or toxic products, and to check
customers for legitimacy. Appropriate record keeping is also foreseen
(http://www.genesynthesisconsortium.org/). In the US there have also been attempts to define control criteria
70
(OECD 2014). The measures established by the IGSC seem appropriate to minimise potential risks and should
be mandatory for all companies providing SB material.
Safety and security
Control measures to protect people and the environment from exposure to SB organisms must be specified.
Given the state-of-the-art, the current focus should be on the protection of staff working in SB laboratories
and in measures to ensure confinement of the organisms under investigation. All regulatory measures for
working with genetically modified organisms fully apply to SB organisms.
Establishment of containment strategies
To prevent the unintended release of SB organisms into the environment, and to avoid adverse effects of
deliberate or accidental release of SB organisms, adequate containment strategies, including the proper
disposal of waste, have to be put in place, strictly fulfilling the EU regulatory framework and relevant
national legal requirements. On the international level, if no appropriate measures are yet foreseen, it is
recommended to adhere to the relevant National Institutes of Health NIH Guidelines for Research Involving
Recombinant or Synthetic Nucleic Acid Molecules (NIH Guidelines) for physical containment. Generally,
biological containment strategies are not recommended, as single strategies may be too weak and not
reliable and the use of multiple strategies may lead to failure of the containment due to its complexity.
Worker safety
The baseline governing worker safety is the relevant EU or national standards. However, care should be
taken whether unique risks and challenges posed by SB organisms to human health (e.g., unintended
exposure due to aerolisation) potentially trigger the need to augment existing workplace safety procedures
and standards.
Training needs
An important aspect of risk mitigation is to ensure proper training of staff and fitting to the individual tasks.
The multidisciplinarity of the field brings along that not all persons involved have had biological training.
Therefore, the establishment of appropriate training standards is of pivotal importance. Staff dealing with
SB material has to undergo comprehensive biosafety instruction that should follow the relevant EU and/or
national standards.
Possibility to track SB organisms
Traceability of SB organisms could be ensured by obligatory integration of “watermark” sequences into

synthetic genomes, which can then be targeted by a specific PCR reaction. SB organisms can thus be labelled,
and potential unintentional releases could be tracked by standard molecular detection methods.
71
Synthetic Biology | References
8 References
Acevedo-Rocha CG, Fang G, Schmidt M, Ussery DW, Danchin A (2013) From essential to persistent genes: a functional
approach to constructing synthetic life. Trends in genetics : TIG 29 (5):273-279. doi:10.1016/j.tig.2012.11.001
Agapakis CM, Boyle PM, Silver PA (2012) Natural strategies for the spatial optimization of metabolism in synthetic
biology. Nature chemical biology 8 (6):527-535. doi:10.1038/nchembio.975
Agrivida (2012a) INzymeTM Plant Expression. http://www.agrivida.com/technology/inzymeplant.html. Accessed
20.07.2014
Agrivida (2012b) Press Release: Agrivida Launches Significant Field Production of Early Stage INzymeTM Crops.
http://www.agrivida.com/news/releases/2012jun5.html. Accessed 20.07.2014
Ajikumar PK, Xiao WH, Tyo KE, Wang Y, Simeon F, Leonard E, Mucha O, Phon TH, Pfeifer B, Stephanopoulos G (2010)
Isoprenoid pathway optimization for Taxol precursor overproduction in Escherichia coli. Science 330
(6000):70-74. doi:10.1126/science.1191652
Amyris (2014) Fuels.
Anderson J, Strelkowa N, Stan GB, Douglas T, Savulescu J, Barahona M, Papachristodoulou A (2012) Engineering and
ethical perspectives in synthetic biology. Rigorous, robust and predictable designs, public engagement and a
modern ethical framework are vital to the continued success of synthetic biology. EMBO reports 13 (7):584-
590. doi:10.1038/embor.2012.81
Annaluru N, Muller H, Mitchell LA, Ramalingam S, Stracquadanio G, Richardson SM, Dymond JS, Kuang Z, Scheifele
LZ, Cooper EM, Cai Y, Zeller K, Agmon N, Han JS, Hadjithomas M, Tullman J, Caravelli K, Cirelli K, Guo Z,
London V, Yeluru A, Murugan S, Kandavelou K, Agier N, Fischer G, Yang K, Martin JA, Bilgel M, Bohutski P,
Boulier KM, Capaldo BJ, Chang J, Charoen K, Choi WJ, Deng P, DiCarlo JE, Doong J, Dunn J, Feinberg JI,
Fernandez C, Floria CE, Gladowski D, Hadidi P, Ishizuka I, Jabbari J, Lau CY, Lee PA, Li S, Lin D, Linder ME, Ling
J, Liu J, Liu J, London M, Ma H, Mao J, McDade JE, McMillan A, Moore AM, Oh WC, Ouyang Y, Patel R, Paul M,
Paulsen LC, Qiu J, Rhee A, Rubashkin MG, Soh IY, Sotuyo NE, Srinivas V, Suarez A, Wong A, Wong R, Xie WR,
Xu Y, Yu AT, Koszul R, Bader JS, Boeke JD, Chandrasegaran S (2014) Total synthesis of a functional designer
eukaryotic chromosome. Science 344 (6179):55-58. doi:10.1126/science.1249252
Arkin AP, Fletcher DA (2006) Fast, cheap and somewhat in control. Genome biology 7 (8):114. doi:10.1186/gb-2006-
7-8-114
Arpino JA, Hancock EJ, Anderson J, Barahona M, Stan GB, Papachristodoulou A, Polizzi K (2013) Tuning the dials of
Synthetic Biology. Microbiology 159 (Pt 7):1236-1253. doi:10.1099/mic.0.067975-0
Bassler B (2010) Transcript from Meeting 1, Session 1 of the US Presidential Commission on Bioethics. Available at:
http://bioethics.gov/node/164, .
Becker J, Schafer R, Kohlstedt M, Harder BJ, Borchert NS, Stoveken N, Bremer E, Wittmann C (2013) Systems
metabolic engineering of Corynebacterium glutamicum for production of the chemical chaperone ectoine.
Microbial cell factories 12:110. doi:10.1186/1475-2859-12-110
Bilgin T, Wagner A (2012) Design constraints on a synthetic metabolism. PloS one 7 (6):e39903.
doi:10.1371/journal.pone.0039903
BIO (2013) Current Uses of Synthetic Biology for Renewable Chemicals, Pharmaceuticals, and Biofuels. Biotechnology
Industry Organization. http://www.bio.org/sites/default/files/Synthetic-Biology-and-Everyday-Products-
2012.pdf. Accessed 17.07.2014
Bioenergies (2014) Global Bioenergies. Science. http://www.global-
bioenergies.com/index.php?option=com_content&view=article&id=66&Itemid=164&lang=en. Accessed
22.07.2014
Birchler JA (2014) Engineered minichromosomes in plants. Current opinion in plant biology 19C:76-80.
doi:10.1016/j.pbi.2014.05.009
Bokinsky G, Peralta-Yahya PP, George A, Holmes BM, Steen EJ, Dietrich J, Lee TS, Tullman-Ercek D, Voigt CA, Simmons
BA, Keasling JD (2011) Synthesis of three advanced biofuels from ionic liquid-pretreated switchgrass using
engineered Escherichia coli. Proceedings of the National Academy of Sciences of the United States of
America 108 (50):19949-19954. doi:10.1073/pnas.1106958108
Bowen TA, Zdunek JK, Medford JI (2008) Cultivating plant synthetic biology from systems biology. The New
phytologist 179 (3):583-587. doi:10.1111/j.1469-8137.2008.02433.x
Boyle PM, Silver PA (2009) Harnessing nature's toolbox: regulatory elements for synthetic biology. Journal of the
Royal Society, Interface / the Royal Society 6 Suppl 4:S535-546. doi:10.1098/rsif.2008.0521.focus
72
Boyle PM, Silver PA (2012) Parts plus pipes: synthetic biology approaches to metabolic engineering. Metabolic
engineering 14 (3):223-232. doi:10.1016/j.ymben.2011.10.003
Brune KD, Bayer TS (2012) Engineering microbial consortia to enhance biomining and bioremediation. Frontiers in
microbiology 3:203. doi:10.3389/fmicb.2012.00203
Cabello JV, Lodeyro AF, Zurbriggen MD (2014) Novel perspectives for the engineering of abiotic stress tolerance in
plants. Current opinion in biotechnology 26:62-70. doi:10.1016/j.copbio.2013.09.011
Callaway E (2013) Glowing plants spark debate. Nature 498 (7452):15-16. doi:10.1038/498015a
Cameron DE, Bashor CJ, Collins JJ (2014) A brief history of synthetic biology. Nature reviews Microbiology 12 (5):381-
390. doi:10.1038/nrmicro3239
CBD (2014) New and emerging issues relating to the conservation and sustainable use of biodiversity - potential
positive and negative impacts of components, organisms and products resulting from synthetic biology
techniques on the conservation and sustainable use of biodiversity. Convention on Biological Diversity.
Subsidiary body on scientific, technical and technological advice.
http://www.cbd.int/doc/meetings/sbstta/sbstta-18/information/sbstta-18-inf-03-en.pdf. Accessed
14.07.2014
Cello J, Paul AV, Wimmer E (2002) Chemical synthesis of poliovirus cDNA: generation of infectious virus in the
absence of natural template. Science 297 (5583):1016-1018. doi:10.1126/science.1072266
Check E (2005) Synthetic biology: designs on life. Nature 438 (7067):417-418. doi:10.1038/438417a
Colussi IA (2013) Synthetic biology, concerns and risks: looking for a (constitutionally oriented) regulatory framework
and a system of governance for a new emerging technology. Universtity of Trento,
Comba S, Arabolaza A, Gramajo H (2012) Emerging engineering principles for yield improvement in microbial cell
design. Computational and structural biotechnology journal 3:e201210016. doi:10.5936/csbj.201210016
Dana GV, Kuiken T, Rejeski D, Snow AA (2012) Synthetic biology: Four steps to avoid a synthetic-biology disaster.
Nature 483 (7387):29. doi:10.1038/483029a
De Lorenzo V (2010) Environmental biosafety in the age of synthetic biology: Do we really need a radical new
approach? Bioessays 32:926-931
Denton AK, Simon R, Weber AP (2013) C(4) photosynthesis: from evolutionary analyses to strategies for synthetic
reconstruction of the trait. Current opinion in plant biology 16 (3):315-321. doi:10.1016/j.pbi.2013.02.013
Douglas T, Savulescu J (2010) Synthetic biology and the ethics of knowledge. Journal of medical ethics 36 (11):687-
693. doi:10.1136/jme.2010.038232
Dyer GA, Serratos-Hernandez JA, Perales HR, Gepts P, Pineyro-Nelson A, Chavez A, Salinas-Arreortua N, Yunez-Naude
A, Taylor JE, Alvarez-Buylla ER (2009) Dispersal of transgenes through maize seed systems in Mexico. PloS
one 4 (5):e5734. doi:10.1371/journal.pone.0005734
Dymond JS, Richardson SM, Coombes CE, Babatz T, Muller H, Annaluru N, Blake WJ, Schwerzmann JW, Dai J,
Lindstrom DL, Boeke AC, Gottschling DE, Chandrasegaran S, Bader JS, Boeke JD (2011) Synthetic chromosome
arms function in yeast and generate phenotypic diversity by design. Nature 477 (7365):471-476.
doi:10.1038/nature10403
EC (2001) Directive 2001/18/EC of the European Parliament and of the Council of 12 March 2001 on the deliberate
release into the environment of genetically modified organisms and repealing Council Directive 90/220/EEC.
Official Journal of the European Communities, vol L 106.
EC (2003) Regulation (EC) No 1829/2003 of the European Parliament and of the Council of 22 September 2003 on
genetically modified food and feed. Official Journal of the European Communities, vol L 268.
EC (2005) Synthetic Biology. Applying Engineering to Biology. Report of a NEST High-Level Expert Group.
http://www.synbiosafe.eu/uploads///pdf/EU-highlevel-syntheticbiology.pdf. Accessed 31.07.2014
EC (2013) Commission Implementing Regulation (EU) No 503/2013 of 3 April 2013 on applications for authorisation
of genetically modified food and feed in accordance with Regulation (EC) No 1829/2003 of the European
Parliament and of the Council and amending Commission Regulations (EC) No 641/2004 and (EC) No
1981/2006. Official Journal of the European Union, vol L 157/1.
EFSA (2008) Safety and nutritional assessment of GM plants and derived food and feed: the role of animal feeding
trials. Food and Chemical Toxicology 46 Suppl 1:S2-70
EFSA (2009) Scientific Opinion on Guidance for the risk assessment of genetically modified plants used for non-food
or non-feed purposes. The EFSA Journal 1164:1-42
EFSA (2010a) Guidance of the GMO Panel on the environmental risk assessment of genetically modified plants. The
EFSA Journal 8(11):1879:1-111
73
EFSA (2010b) Scientific opinion of the GMO Panel on the assessment of allergenicity of GM plants and
microorganisms and derived food and feed. The EFSA Journal 8(7):1700:1-168
EFSA (2011) Guidance of the GMO Panel for risk assessment of food and feed from genetically modified plants. The
EFSA Journal 9(5):2150:1-37. doi:10.2903/j.efsa.2011.2150
Ehrhardt DW, Frommer WB (2012) New technologies for 21st century plant science. The Plant cell 24 (2):374-394.
doi:10.1105/tpc.111.093302
Ellis DI, Goodacre R (2012) Metabolomics-assisted synthetic biology. Current opinion in biotechnology 23 (1):22-28.
doi:10.1016/j.copbio.2011.10.014
Ellis T, Adie T, Baldwin GS (2011) DNA assembly for synthetic biology: from parts to pathways and beyond.
Integrative biology : quantitative biosciences from nano to macro 3 (2):109-118. doi:10.1039/c0ib00070a
Ellis T, Wang X, Collins JJ (2009) Diversity-based, model-guided construction of synthetic gene networks with
predicted functions. Nature biotechnology 27 (5):465-471. doi:10.1038/nbt.1536
Esvelt KM, Wang HH (2013) Genome-scale engineering for systems and synthetic biology. Molecular systems biology
9:641. doi:10.1038/msb.2012.66
Facchini PJ, Bohlmann J, Covello PS, De Luca V, Mahadevan R, Page JE, Ro DK, Sensen CW, Storms R, Martin VJ (2012)
Synthetic biosystems for the production of high-value plant metabolites. Trends in biotechnology 30 (3):127-
131. doi:10.1016/j.tibtech.2011.10.001
Ferrin LJ, Camerini-Otero RD (1991) Selective cleavage of human DNA: RecA-assisted restriction endonuclease (RARE)
cleavage. Science 254 (5037):1494-1497
Fesenko E, Edwards R (2014) Plant synthetic biology: a new platform for industrial biotechnology. Journal of
experimental botany 65 (8):1927-1937. doi:10.1093/jxb/eru070
Filipovska A, Rackham O (2013) Specialization from synthesis: how ribosome diversity can customize protein
function. FEBS letters 587 (8):1189-1197. doi:10.1016/j.febslet.2013.02.032
Fleming DO (2006) Risk Assessment of Synthetic Genomics: A Biosafety and Biosecurity Perspective. In Working
Papers for Synthetic Genomics: Risks and Benefits for Science and Society. 105-164. Available at:
http://www.jcvi.org/cms/fileadmin/site/research/projects/synthetic-genomics-report/Commissioned-
Papers-Synthetic-Genomics-Governance.pdf.
Forster AC, Church GM (2006) Towards synthesis of a minimal cell. Molecular systems biology 2:45.
doi:10.1038/msb4100090
French C, Mora K, Joshi N, Elfick A, Haseloff J, Ajioka J (2011) Synthetic biology and the art of biosensor design. In:
Threats IoMUFoM (ed) The Science and Applications of Synthetic and Systems Biology: Workshop Summary. .
National Academics Press, Washington DC,
Gardner TS, Cantor CR, Collins JJ (2000) Construction of a genetic toggle switch in Escherichia coli. Nature 403
(6767):339-342. doi:10.1038/35002131
Garfinkel MS, Friedman RM (2010) Synthetic biology and synthetic genomics. In Future of International
Environmental Law, edited by David Leary and Balakrishna Pisupati, New York: UNU Press, 269-291.
Garrett L (2011) The Bioterrorist Next Door: Man-made killer bird fle is here. Can – should – governments try to stop
it? Foreign Policy. Available at
http://www.foreignpolicy.com/articles/2011/12/14/the_bioterrorist_next_door, .
Georgianna DR, Mayfield SP (2012) Exploiting diversity and synthetic biology for the production of algal biofuels.
Nature 488 (7411):329-335. doi:10.1038/nature11479
Gibson DG, Benders GA, Andrews-Pfannkoch C, Denisova EA, Baden-Tillson H, Zaveri J, Stockwell TB, Brownley A,
Thomas DW, Algire MA, Merryman C, Young L, Noskov VN, Glass JI, Venter JC, Hutchison CA, 3rd, Smith HO
(2008) Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome. Science
319 (5867):1215-1220. doi:10.1126/science.1151721
Gibson DG, Glass JI, Lartigue C, Noskov VN, Chuang RY, Algire MA, Benders GA, Montague MG, Ma L, Moodie MM,
Merryman C, Vashee S, Krishnakumar R, Assad-Garcia N, Andrews-Pfannkoch C, Denisova EA, Young L, Qi ZQ,
Segall-Shapiro TH, Calvey CH, Parmar PP, Hutchison CA, 3rd, Smith HO, Venter JC (2010) Creation of a
bacterial cell controlled by a chemically synthesized genome. Science 329 (5987):52-56.
doi:10.1126/science.1190719
Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO (2009) Enzymatic assembly of DNA
molecules up to several hundred kilobases. Nature methods 6 (5):343-345. doi:10.1038/nmeth.1318
Giuliano G (2014) Plant carotenoids: genomics meets multi-gene engineering. Current opinion in plant biology
19C:111-117. doi:10.1016/j.pbi.2014.05.006
74
Glasgow (2014) University of Glasgow. Safety & Environmental Protection Services. Controlling risks of work with
genetically modified organisms. http://www.gla.ac.uk/services/seps/a-
z%20index/biological%20safety/gmriskassessment/controlling%20risks%20of%20work%20with%20geneticall
y%20modifie/. Accessed 25.07.2014
Glass JI (2012) Synthetic genomics and the construction of a synthetic bacterial cell. Perspectives in biology and
medicine 55 (4):473-489. doi:10.1353/pbm.2012.0040
Guan Z, Schmidt M, Pei L, Wei W, Ma K (2013) Biosafety Considerations of Synthetic Biology in the International
Genetically Engineered Machine (iGEM) Competition. Bioscience 63 (1):25-34
Harris DC, Jewett MC (2012) Cell-free biology: exploiting the interface between synthetic biology and synthetic
chemistry. Current opinion in biotechnology 23 (5):672-678. doi:10.1016/j.copbio.2012.02.002
Haseloff J, Ajioka J (2009) Synthetic biology: history, challenges and prospects. Journal of the Royal Society, Interface
/ the Royal Society 6 Suppl 4:S389-391. doi:10.1098/rsif.2009.0176.focus
Haslam RP, Ruiz-Lopez N, Eastmond P, Moloney M, Sayanova O, Napier JA (2013) The modification of plant oil
composition via metabolic engineering--better nutrition by design. Plant biotechnology journal 11 (2):157-
168. doi:10.1111/pbi.12012
Hatch AD (2010) Four suggestions for addressing public concern regarding synthetic biology. Journal of biological
engineering 4:7. doi:10.1186/1754-1611-4-7
Haynes KA, Silver PA (2009) Eukaryotic systems broaden the scope of synthetic biology. The Journal of cell biology
187 (5):589-596. doi:10.1083/jcb.200908138
Heinemann M, Panke S (2006) Synthetic biology--putting engineering into biology. Bioinformatics 22 (22):2790-2799.
doi:10.1093/bioinformatics/btl469
Hendrickson TL, de Crecy-Lagard V, Schimmel P (2004) Incorporation of nonnatural amino acids into proteins. Annual
review of biochemistry 73:147-176. doi:10.1146/annurev.biochem.73.012803.092429
iGEM (2014) Registry of Standard Biological Parts: Assembly standard 23.
http://parts.igem.org/Assembly_standard_23. Accessed 16.06.2014
International Civil Society Working Group on Synthetic Biology (ICSWGSB) (2011) A Submission to the Convention on
Biological Diversity's Subsidiary Body on Scientific, Technical and Technological Advice (SBSTTA) on the
Potential Impacts of Synthetic Biology on the Conservation and Use of Synthetic Biology. Available at:
https://www.cbd.int/doc/emerging-issues/Int-Civil-Soc-WG-Synthetic-Biology-2011-013-en.pdf, .
Itaya M, Fujita K, Kuroki A, Tsuge K (2008) Bottom-up genome assembly using the Bacillus subtilis genome vector.
Nature methods 5 (1):41-43. doi:10.1038/nmeth1143
Jackson RJ, Ramsay AJ, Christensen CD, Beaton S, Hall DF, Ramshaw IA (2001) Expression of mouse interleukin-4 by a
recombinant ectromelia virus suppresses cytolytic lymphocyte responses and overcomes genetic resistance
to mousepox. Journal of virology 75 (3):1205-1210. doi:10.1128/JVI.75.3.1205-1210.2001
Jain A, Bhatia P, Chugh A (2012) Microbial synthetic biology for human therapeutics. Systems and synthetic biology 6
(1-2):9-22. doi:10.1007/s11693-012-9092-0
JBEI (2014) Fuels Synthesis. Joint BioEnergy Institute. http://www.jbei.org/research/divisions/fuels-synthesis/.
Accessed 22.07.2014
Jirschitzka J, Mattern DJ, Gershenzon J, D'Auria JC (2013) Learning from nature: new approaches to the metabolic
engineering of plant defense pathways. Current opinion in biotechnology 24 (2):320-328.
doi:10.1016/j.copbio.2012.10.014
Johnson JA, Lu YY, Van Deventer JA, Tirrell DA (2010) Residue-specific incorporation of non-canonical amino acids
into proteins: recent developments and applications. Current opinion in chemical biology 14 (6):774-780.
doi:10.1016/j.cbpa.2010.09.013
Karr JR, Sanghvi JC, Macklin DN, Gutschow MV, Jacobs JM, Bolival B, Jr., Assad-Garcia N, Glass JI, Covert MW (2012) A
whole-cell computational model predicts phenotype from genotype. Cell 150 (2):389-401.
doi:10.1016/j.cell.2012.05.044
Kitney R, Freemont P (2012) Synthetic biology - the state of play. FEBS letters 586 (15):2029-2036.
doi:10.1016/j.febslet.2012.06.002
Kliebenstein DJ (2014) Synthetic biology of metabolism: using natural variation to reverse engineer systems. Current
opinion in plant biology 19C:20-26. doi:10.1016/j.pbi.2014.03.008
König H, Frank D, Heil R, Coenen C (2013) Synthetic genomics and synthetic biology applications between hopes and
concerns. Current genomics 14 (1):11-24. doi:10.2174/1389202911314010003
75
Lartigue C, Glass JI, Alperovich N, Pieper R, Parmar PP, Hutchison CA, 3rd, Smith HO, Venter JC (2007) Genome
transplantation in bacteria: changing one species to another. Science 317 (5838):632-638.
doi:10.1126/science.1144622
Ledford H (2011) Transgenic grass skirts regulators. Nature 475 (7356):274-275. doi:10.1038/475274a
Lee J (2013) Synthetic biology: A new opportunity in the field of plant biochemistry and physiology. J Plan Biochem
Physiol 1 (1). doi:http://dx.doi.org/10.4172/jpbp.10000e101
Li Y, Pfeifer BA (2014) Heterologous production of plant-derived isoprenoid products in microbes and the application
of metabolic engineering and synthetic biology. Current opinion in plant biology 19C:8-13.
doi:10.1016/j.pbi.2014.02.005
Lipp E (2008) Synthetic Biology Finds a Niche in Fuel Alternatives.
http://www.synbiosafe.eu/uploads/pdf/08_11_GEN_Synthetic_Biology_Finds_Niche_in_Fuel_Alternatives.p
df. Accessed 22.07.2014
Liu CC, Schultz PG (2010) Adding new chemistries to the genetic code. Annual review of biochemistry 79:413-444.
doi:10.1146/annurev.biochem.052308.105824
Liu L, Liu Y, Shin HD, Chen RR, Wang NS, Li J, Du G, Chen J (2013) Developing Bacillus spp. as a cell factory for
production of microbial enzymes and industrially important biochemicals in the context of systems and
synthetic biology. Applied microbiology and biotechnology 97 (14):6113-6127. doi:10.1007/s00253-013-
4960-4
Lorenz MG, Wackernagel W (1994) Bacterial gene transfer by natural transformation in the environment.
Microbiology and Molecular Biology Reviews 58:5563-5602
Lusser M, Parisi C, Plan D, Rodriguez-Cerezo E (2011) New plant breeding techniques. State-of-the-art and prospects
for commercial development. European Commission: Joint Research Center - Institute for Prospective
Technological Studies, Seville
Marcheschi RJ, Gronenberg LS, Liao JC (2013) Protein engineering for metabolic engineering: current and next-
generation tools. Biotechnology journal 8 (5):545-555. doi:10.1002/biot.201200371
Marliere P (2009) The farther, the safer: a manifesto for securely navigating synthetic species away from the old
living world. Systems and synthetic biology 3 (1-4):77-84. doi:10.1007/s11693-009-9040-9
Marris C, Jefferson C (2013) Scoping report for workshop: Synthetic Biology: Containment and release of engineered
micro-organisms. .
Marshall J (2014) Solar energy: Springtime for the artificial leaf. Nature 510 (7503):22-24. doi:10.1038/510022a
McFadden J (2012) Synthetic biology: the best hope for mankind’s future?
http://wwwtheguardiancom/commentisfree/2012/mar/29/synthetic-biology-best-hope-mankind
Menetrez MY (2012) An overview of algae biofuel production and potential environmental impact. Environmental
science & technology 46 (13):7073-7085. doi:10.1021/es300917r
Moe-Behrens GH, Davis R, Haynes KA (2013) Preparing synthetic biology for the world. Frontiers in microbiology 4:5.
doi:10.3389/fmicb.2013.00005
Montague MG, Lartigue C, Vashee S (2012) Synthetic genomics: potential and limitations. Current opinion in
biotechnology 23 (5):659-665. doi:10.1016/j.copbio.2012.01.014
Moses T, Pollier J, Thevelein JM, Goossens A (2013) Bioengineering of plant (tri)terpenoids: from metabolic
engineering of plants to synthetic biology in vivo and in vitro. The New phytologist 200 (1):27-43.
doi:10.1111/nph.12325
Moya A, Gil R, Latorre A, Pereto J, Pilar Garcillan-Barcia M, de la Cruz F (2009) Toward minimal bacterial cells:
evolution vs. design. FEMS microbiology reviews 33 (1):225-235. doi:10.1111/j.1574-6976.2008.00151.x
Mukunda G, Oye KA, Mohr SC (2009) What rough beast? Synthetic biology, uncertainty, and the future of
biosecurity. Politics and the Life Sciences 28 (2):2-26
Murray T (2010) Transcript from Meeting 3, Session 3 of the US Presidential Commission on Bioethics. Available at
http://bioethics.gov/node/181.
National Institutes of Health (NIH) (2013) Guidelines for Research Involving Recombinant or Synthetic Nucleic Acid
Molecules Available at: http://oba.od.nih.gov/oba/rac/Guidelines/NIH_Guidelines.pdf, .
Nielsen AZ, Ziersen B, Jensen K, Lassen LM, Olsen CE, Moller BL, Jensen PE (2013) Redirecting photosynthetic
reducing power toward bioactive natural product synthesis. ACS synthetic biology 2 (6):308-315.
doi:10.1021/sb300128r
Nielsen J, Keasling JD (2011) Synergies between synthetic biology and metabolic engineering. Nature biotechnology
29 (8):693-695. doi:10.1038/nbt.1937
76
NIH (2013) NIH Guidelines for Research Involving Recombinant or Synthetic Nucleic Acid Molecules (NIH guidelines)
Noireaux V, Maeda YT, Libchaber A (2011) Development of an artificial cell, from self-organization to computation
and self-reproduction. Proceedings of the National Academy of Sciences of the United States of America 108
(9):3473-3480. doi:10.1073/pnas.1017075108
Norton BG (2010) Synthetic biology: Some concerns of a biodiversity advocate remarks on synthetic biology to the
Presidential Commission on Bioethics.1-8
NRC (2009) Understanding Biosecurity: Protecting against the misuse of science in today's world. National Research
Council of the National Academies
NSABB (2010) National Science Advisory Board for Biosecurity, Addressing Biosecurity concerns related to synthetic
biology. Washington, DC
O'Connor SE, Brutnell TP (2014) Editorial overview: Growing the future: synthetic biology in plants. Current opinion in
plant biology 19:iv-v. doi:10.1016/j.pbi.2014.05.005
OECD (1993) Safety evaluation of foods derived by modern biotechnology: Concepts and principles. Organisation for
Economic Co-operation and Development (OECD), Paris
OECD (2009) Guideline for the testing of chemicals - Test No. 452: Chronic toxicity studies. OECD,
OECD (2014) Emerging Policy Issues in Synthetic Biology. OECD Publishing.
doi:http://dx.doi.org/10.1787/9789264208421-en
Oldham P, Hall S, Burton G (2012) Synthetic biology: mapping the scientific landscape. PloS one 7 (4):e34368.
Oye KA, Esvelt K, Appleton E, Catteruccia F, Church G, Kuiken T, Lightfoot SB, McNamara J, Smidler A, Collins JP
(2014) Regulating gene drives. Science. doi:10.1126/science.1254287
Patron NJ (2014) DNA assembly for plant biology: techniques and tools. Current opinion in plant biology 19C:14-19.
doi:10.1016/j.pbi.2014.02.004
Pauwels K, Mampuys R, Golstein C, Breyer D, Herman P, Kaspari M, Pagès J-C, Pfister H, van der Wilk F, Schönig B
(2013) Event report: SynBio Workshop (Paris 2012) – Risk assessment challenges of Synthetic Biology. Journal
für Verbraucherschutz und Lebensmittelsicherheit 8 (3): 215-226
PCSBI (2010) New Directions: The Ethics of Synthetic Biology and Emerging Technologies. Presidential Commission
for the Study of Bioethical Issues. http://bioethics.gov/sites/default/files/PCSBI-Synthetic-Biology-Report-
12.16.10.pdf. Accessed 20.07.2014
Peccoud J, Isalan M (2012) The PLOS ONE synthetic biology collection: six years and counting. PloS one 7 (8):e43231.
Polizzi KM (2013) What is synthetic biology? Methods in molecular biology 1073:3-6. doi:10.1007/978-1-62703-625-
2_1
Polka JK, Silver PA (2013) Building synthetic cellular organization. Molecular biology of the cell 24 (23):3585-3587.
doi:10.1091/mbc.E13-03-0155
Pollack A (2013) A Dream of Trees Aglow at Night. http://www.nytimes.com/2013/05/08/business/energy-
environment/a-dream-of-glowing-trees-is-assailed-for-gene-tinkering.html?pagewanted=all&_r=0. Accessed
17.07.2014
Porcar M, Pereto J (2012) Are we doing synthetic biology? Systems and synthetic biology 6 (3-4):79-83.
doi:10.1007/s11693-012-9101-3
Purnick PE, Weiss R (2009) The second wave of synthetic biology: from modules to systems. Nature reviews
Molecular cell biology 10 (6):410-422. doi:10.1038/nrm2698
Redford KH, Adams W, Mace GM (2013) Synthetic biology and conservation of nature: wicked problems and wicked
solutions. PLoS biology 11 (4):e1001530. doi:10.1371/journal.pbio.1001530
Renwick AG, Barlow SM, Hertz-Picciotto I, Boobis AR, Dybing E, Edler L, Eisenbrand G, Greig JB, Kleiner J, Lambe J,
Muller DJ, Smith MR, Tritscher A, Tuijtelaars S, van den Brandt PA, Walker R, Kroes R (2003) Risk
characterisation of chemicals in food and diet. Food Chem Toxicol 41 (9):1211-1271
Rhee SY, Mutwil M (2014) Towards revealing the functions of all genes in plants. Trends in plant science 19 (4):212-
221. doi:10.1016/j.tplants.2013.10.006
Rhodes C (2010) International Governance of Biotechnology. London: Bloomsbury Publishing PLC. .
Rocha EP (2013) Evolution. With a little help from prokaryotes. Science 339 (6124):1154-1155.
doi:10.1126/science.1234938
Rodemeyer M (2009) New Life, Old Bottles: Regulating First-Generation Products of Synthetic Biology. WWICS
Synthetic Biology Project
77
Safi C, Zebib B, Merah O, Pontalier P-Y, Vaca-Garcia C (2014) Morphology, composition, production, processing and
applications of Chlorella vulgaris: A review. Renew Sust Energ Rev 35:265-278
Sainsbury F, Lomonossoff GP (2014) Transient expressions of synthetic biology in plants. Current opinion in plant
biology 19C:1-7. doi:10.1016/j.pbi.2014.02.003
Salis HM, Mirsky EA, Voigt CA (2009) Automated design of synthetic ribosome binding sites to control protein
expression. Nature biotechnology 27 (10):946-950. doi:10.1038/nbt.1568
Sarrion-Perdigones A, Palaci J, Granell A, Orzaez D (2014) Design and construction of multigenic constructs for plant
biotechnology using the GoldenBraid cloning strategy. Methods in molecular biology 1116:133-151.
doi:10.1007/978-1-62703-764-8_10
Sarrion-Perdigones A, Vazquez-Vilar M, Palaci J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D
(2013) GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant
physiology 162 (3):1618-1631. doi:10.1104/pp.113.217661
SBP (2012) Inventory of synthetic biology products - existing and possible. Draft. Synthetic biology project.
http://www.synbioproject.org/process/assets/files/6631/_draft/synbio_applications_wwics.pdf. Accessed
18.07.2014
SCENIHR, SCCS, SCHER (2014) SCENIHR (Scientific Committee on Emerging and Newly Identified Health Risks), SCCS
(Scientific Committee on Consumer Safety), SCHER (Scientific Committee on Health and Environmental
Risks), Synthetic Biology I Definition, Opinion, 25 September, 2014.
http://ec.europa.eu/health/scientific_committees/emerging/docs/scenihr_o_044.pdf. Accessed 30.09.2014
Schmidt M (2008) Diffusion of synthetic biology: a challenge to biosafety. Systems and synthetic biology 2 (1-2):1-6.
doi:10.1007/s11693-008-9018-z
Schmidt M (2010a) Do I understand what I can create? In: Schmidt M, Kelle A, Ganguli-Mitra A, Vriend H (eds)
Synthetic Biology. Springer Netherlands, pp 81-100. doi:10.1007/978-90-481-2678-1_6
Schmidt M (2010b) Xenobiology: A new form of life as the ultimate biosafety tool. BioEssays 32 (4):322-331.
doi:10.1002/bies.200900147
Schmidt M, de Lorenzo V (2012) Synthetic constructs in/for the environment: Managing the interplay between
natural and engineered biology. FEBS letters 586:2199-2206
Seo SW, Yang J, Min BE, Jang S, Lim JH, Lim HG, Kim SC, Kim SY, Jeong JH, Jung GY (2013) Synthetic biology: tools to
design microbes for the production of chemicals and fuels. Biotechnology advances 31 (6):811-817.
doi:10.1016/j.biotechadv.2013.03.012
Seyfried G, Pei L, Schmidt M (2014) European do-it-yourself (DIY) biology: beyond the hope, hype and horror.
Bioessays 36 (6):548-551. doi:10.1002/bies.201300149
Shetty R, Endy D, Knight T (2008) Engineering BioBrick vectors from BioBrick parts. Journal of biological engineering 2
(1):5
Skerker JM, Lucks JB, Arkin AP (2009) Evolution, ecology and the engineered organism: lessons for synthetic biology.
Genome biology 10 (11):114. doi:10.1186/gb-2009-10-11-114
Smith MT, Wilding KM, Hunt JM, Bennett AM, Bundy BC (2014) The emerging age of cell-free synthetic biology. FEBS
letters. doi:10.1016/j.febslet.2014.05.062
Snow AA, Smith VH (2012) Genetically Engineered Algae for Biofuels: A Key Role for Ecologists. BioScience 62 (8):765-
768
Sole RV, Munteanu A, Rodriguez-Caso C, Macia J (2007) Synthetic protocell biology: from reproduction to
computation. Philosophical transactions of the Royal Society of London Series B, Biological sciences 362
(1486):1727-1739. doi:10.1098/rstb.2007.2065
Stephanopoulos G (2012) Synthetic biology and metabolic engineering. ACS synthetic biology 1 (11):514-525.
doi:10.1021/sb300094q
UKSBRCG (2012) A Synthetic Biology Roadmap for the UK. http://www.rcuk.ac.uk/RCUK-
prod/assets/documents/publications/SyntheticBiologyRoadmap.pdf. Accessed 18.07.2014
UPOV (2011) International Union for the Protection of New Varieties of Plants. Test Guidelines;
http://www.upov.int/test_guidelines/en/; (last accessed: 23/06/2014).
Wageningen UR (2014) Microalgae products. Application of algae components in different commercial sectors;
http://www.wageningenur.nl/en/Expertise-Services/Facilities/AlgaePARC/Themes/Microalgae-
products.htm; (last accessed 28/07/2014).
Wang HH (2010) Synthetic genomes for synthetic biology. Journal of molecular cell biology 2 (4):178-179.
doi:10.1093/jmcb/mjq015
78
Wang HH, Isaacs FJ, Carr PA, Sun ZZ, Xu G, Forest CR, Church GM (2009) Programming cells by multiplex genome
engineering and accelerated evolution. Nature 460 (7257):894-898. doi:10.1038/nature08187
Wendisch VF (2014) Microbial production of amino acids and derived chemicals: Synthetic biology approaches to
strain development. Current opinion in biotechnology 30C:51-58. doi:10.1016/j.copbio.2014.05.004
WHO (2004) Laboratory biosafety manual - Third edition
Wilson SA, Roberts SC (2012) Recent advances towards development and commercialization of plant cell culture
processes for the synthesis of biomolecules. Plant biotechnology journal 10 (3):249-268. doi:10.1111/j.1467-
7652.2011.00664.x
Woo HM, Park JB (2014) Recent progress in development of synthetic biology platforms and metabolic engineering
of Corynebacterium glutamicum. Journal of biotechnology 180:43-51. doi:10.1016/j.jbiotec.2014.03.003
World Health Organization (WHO) (2004) Laboratory Biosafety Manual, 3rd Edition. Available at:
http://www.who.int/csr/resources/publications/biosafety/Biosafety7.pdf.
Wozniak CA, McClung G, Gagliardi J, Segal M, Matthews K (2012) Chapter 4. Regulation of genetically engineered
microorganisms under FIFRA, FFDCA and TSCA. In: Wozniak CA, McHughen A (eds) Regulation of Agricultural
Biotechnology: 57 The United States and Canada. Springer, Washington, DC, USA, pp 57-94
Wright O, Stan GB, Ellis T (2013) Building-in biosafety for synthetic biology. Microbiology 159 (Pt 7):1221-1235.
doi:10.1099/mic.0.066308-0
WWICS (2013a) Seven myths & realities about Do-It-Yourself Biology.
http://www.synbioproject.org/publications/6676/. Accessed 30.09.2014
WWICS (2013b) Workshop Summary Reports. http://www.cbd.int/doc/emerging-issues/emergingissues-2013-07-
WilsonCenter-WorkshopSummaryReports-en.pdf. Accessed 25.07.2014
WWICS (2014) Synthetic Biology Project. http://www.synbioproject.org. Accessed 28.07.2014
Xu HT, Fan BL, Yu SY, Huang YH, Zhao ZH, Lian ZX, Dai YP, Wang LL, Liu ZL, Fei J, Li N (2007) Construct synthetic gene
encoding artificial spider dragline silk protein and its expression in milk of transgenic mice. Animal
biotechnology 18 (1):1-12. doi:10.1080/10495390601091024
Xu P, Bhan N, Koffas MA (2013) Engineering plant metabolism into microbes: from systems biology to synthetic
biology. Current opinion in biotechnology 24 (2):291-299. doi:10.1016/j.copbio.2012.08.010
Xu P, Ranganathan S, Fowler ZL, Maranas CD, Koffas MA (2011) Genome-scale metabolic network modeling results in
minimal interventions that cooperatively force carbon flux towards malonyl-CoA. Metabolic engineering 13
(5):578-587. doi:10.1016/j.ymben.2011.06.008
Xu P, Vansiri A, Bhan N, Koffas MA (2012) ePathBrick: a synthetic biology platform for engineering metabolic
pathways in E. coli. ACS synthetic biology 1 (7):256-266. doi:10.1021/sb300016b
Yadav VG, De Mey M, Lim CG, Ajikumar PK, Stephanopoulos G (2012) The future of metabolic engineering and
synthetic biology: towards a systematic practice. Metabolic engineering 14 (3):233-241
Ye H, Fussenegger M (2014) Synthetic therapeutic gene circuits in mammalian cells. FEBS letters 588 (15):2537-2544.
doi:10.1016/j.febslet.2014.05.003
Zhang F, Carothers JM, Keasling JD (2012) Design of a dynamic sensor-regulator system for production of chemicals
and fuels derived from fatty acids. Nature biotechnology 30 (4):354-359. doi:10.1038/nbt.2149
Zhang JY, Marris C, Rose N (2011) The Transnational Governance of Synthetic Biology: Scientific uncertainty, cross-
borderness and the ‘art’ of governance. BIOS Working Papers. Available at:
http://royalsociety.org/uploadedFiles/Royal_Society_Content/policy/publications/2011/4294977685.pdf.
Zhang Y, Butelli E, Martin C (2014) Engineering anthocyanin biosynthesis in plants. Current opinion in plant biology
19C:81-90. doi:10.1016/j.pbi.2014.05.011
Zhou M, Zheng X, Wang J, Dong S (2011) 'Non-destructive' biocomputing security system based on gas-controlled
biofuel cell and potentially used for intelligent medical diagnostics. Bioinformatics 27 (3):399-404.
doi:10.1093/bioinformatics/btq678
Zotchev SB, Sekurova ON, Katz L (2012) Genome-based bioprospecting of microbes for new therapeutics. Current
opinion in biotechnology 23 (6):941-947. doi:10.1016/j.copbio.2012.04.002
Zurbriggen MD, Moor A, Weber W (2012) Plant and bacterial systems biology as platform for plant synthetic
bio(techno)logy. Journal of biotechnology 160 (1-2):80-90. doi:10.1016/j.jbiotec.2012.01.014
79
Synthetic Biology | List of Figures
9 List of Figures
Figure 1: Trans-/interdisciplinarity of synthetic biology; from Polizzi (2013) ................................................................. 10
Figure 2: Strategy for synthesising the genome of Mycoplasma genitalium (Glass 2012) ............................................. 25
Figure 3: Strategy for making a synthetic bacterial cell (from Glass (2012)) .................................................................. 26
Figure 4: Overview of exemplar DNA assembly techniques (from Ellis et al. (2011)) .................................................... 27
Figure 5: The assembly of a Mycoplasma mycoides genome in yeast (Gibson et al. 2010) ........................................... 29
Figure 6: Bistable genetic toggle switch. Figure from Gardner et al. (2000) .................................................................. 33
Figure 7: Regulatory devices: a) oscillator, b) riboswitch, c) artificial scaffold protein. Figure from Purnick and Weiss
(2009) .............................................................................................................................................................................. 34
Figure 8: A simple genetic system with model equations. Figure from Arpino et al. (2013).......................................... 36
Figure 9: Modularisation of a taxadiene biosynthesis pathway. Detail from a figure of Ajikumar et al. (2010) ............ 38
Figure 10: Schematic representation for basic part “promoter“ in the BioBricks™ assembly (iGEM 2014) .................. 39
Figure 11: Schematic representation of a composite part (ribosomal binding site – protein coding region –
terminator) (iGEM 2014) ................................................................................................................................................. 40
Figure 12: Schematic representation of a device consisting of a basic (=promoter) and a composite part (ribosomal
binding site – protein coding region – terminator) (iGEM 2014).................................................................................... 40
Figure 13: Producing biofuels and renewable chemicals by means of synthetic biology; adapted from BIO (2013);
TM….trade mark .............................................................................................................................................................. 46
Figure 14: INzymeTM Plant Expression (Agrivida 2012b) ................................................................................................. 50
Figure 15: Dynamics in the biological engineering application space. ........................................................................... 94
Figure 16: Evolution of innovation .................................................................................................................................. 95
80
Synthetic Biology | List of Tables
10 List of Tables
Table 1: Possibilities for DNA assembly in synthetic biology (Ellis et al. 2011)............................................................... 24
Table 2: Genetic device projects presented at international genetically engineered machine (iGEM) competition..... 35
Table 3: Types of parts available from the BioBrick™ Registry Repository (modified from iGEM (2014)). .................... 41
Table 4: Product Matrix for biofuels (SBP 2012) “Inventory of synthetic biology products – existing and possible”
(Synthetic Biology Project – Draft, July 2012) ................................................................................................................. 49
Table 5: Classification of host (micro-) organisms by risk groups (NIH 2013)................................................................. 58
Table 6: Relation of risk groups to biosafety levels, practices and equipment (NIH 2013) ............................................ 59
81
Synthetic Biology | Annex
11 Annex
11.1Literature search - Methodology
For literature search the bibliographic database Scopus, officially named SciVerse Scopus, and the public
access database PubMed were used.
Scopus is described as the largest abstract and citation database of peer-reviewed literature, features smart
tools to track, analyse and visualise research and delivers a comprehensive overview of global scientific output
(online: http://www.elsevier.com/online-tools/scopus).
PubMed, a database developed and maintained by the National Center for Biotechnology Information (NCBI),
provides access to peer-reviewed literature of the fields of biomedicine and health, covering portions of the
life sciences, behavioural sciences, chemical sciences, and bioengineering, and additional relevant web sites
and links to the other NCBI molecular biology resources (online: http://www.ncbi.nlm.nih.gov/pubmed/).
Literature search was performed in October 2013 and terms were searched in the field “Article Title, Abstracts
and Keywords” and reviews from the years 2010 until 2013 were included. In the first step for this interim
report documents were screened in order to select definitions for synthetic genomic and synthetic biology.
Keywords for screening definitions in both databases:
“synthetic genomics”
“synthetic biology”
Search results and selection of documents

“synthetic genomics” (Scopus):
year hits available full-texts number of definitions
2010 4 4 2
2011 0 0 0
2012 1 1 0
2013 1 1 1
82
“synthetic genomics” (PubMed):
2010 3 3 0
2011 0 0 0
2012 2 2 2
2013 2 1 1
“synthetic biology” (Scopus):
2010 77 63 17
2011 93 65 19
2012 180 136 36
2013 119 79 13
“synthetic biology” (PubMed):
2010 223 126 26
2011 294 122 22
2012 134 48 46
2013 349 94 9
In summary, for the keyword “synthetic genomics” 12 documents (available full-texts) were screened for
definitions and 6 definitions are cited. For “synthetic biology” 733 articles (of 1469 hits) were screened, 188
definitions were found. The list of selected definitions may be found in the Annex.
Major elements identified in definitions published 2010-2013

The definitions listed in the Annex contain several common elements (e.g. “design of novelty”, “design novel
and redesign natural biological entities”, “to apply the principles of engineering”, “modularisation of biology”,
“bottom-up design”, “understanding by synthesis”, “understanding by manipulation” and “development of
tools for bio-design”). With reference to the relevant publications the most frequently found are:
Engineering principles/Interface of engineering and biology

• Improve the process of genetic engineering
• Most have the scope of engineering an individual biosynthetic pathway
• Metabolic engineering as simplest form of synthetic biology
• Engineering of whole metabolisms, regulatory networks, and even ecosystems
83
• Reengineering cellular components and machineries

• Engineering new biological processes for specific industrial applications
• Engineering a novel organism from existing and newly designed parts
• Engineering of biological systems with structures and functions not found in nature
• Application of engineering principles to biology, redesigning biological materials and using them as new
substrates
• Application of engineering principles
• Engineer novel biological systems with useful and predictable functions by combining modular, well-
characterised genetic parts in a rational and systematic manner
• Design and engineer biologically based parts, novel devices and systems; redesigning existing, natural
biological systems
• Application of systematic design – using engineering principles
• Engineering biological systems or modules
• Apply engineering principles to biological studies
• Engineering of biological entities not found in nature
• Reverse engineer and redesign pre-existing biological parts and devices
• Engineer predicted outputs
• Combine knowledge and techniques of biology, chemistry, computer science, and engineering.
• De novo engineering of regulatory systems
• Engineering-driven building of increasingly complicated biological entities (parts, devices and systems)
from simple and basic building blocks
• Engineering artificial biological systems with the ultimate goal of programming novel cell and organism
behaviour
• Engineering DNA based biological circuits by using standardised biological parts; identifying the minimal
genome; constructing protocells; creating orthogonal biological systems through chemical synthetic
biology
• Systematic construction of biological systems with cells being build module by module (bottom up
engineering strategy)
• Application of engineering principles toward the construction of novel biological systems
• Central goal is to transform biology into a system that can be engineered
• Application of the principles of engineering to the construction of life with desired properties in a
rational and systematic way
• Engineering novel cell activities
• Engineer and create complex biological systems for practical applications from lesser understood and
unreliable basic components
• Engineering challenge with interchangeable parts joined to yield novel pathways
• Modular, well-characterised biological parts to predictably construct novel genetic devices and complex
cell-based systems following engineering principle
• Engineering of biology (bottom up and top down approaches)
• Design and construction of biological systems guided by engineering principles
• De novo engineering of regulatory systems with desired behaviour
• Reverse-engineering the design rules governing the machinery of cells and cell circuits
• Synthetic biology is at the interface of engineering and biology
• Integration of computational analysis, biological data and the systems engineering paradigm
• Reverse-engineer naturally evolved systems and to build new systems
• Engineering of genetic molecular machines with a specific predefined function
84
• Routine engineering of complex biological systems

• Newly engineered organism functions as a machine
Construction
• Construct new parts, modify existing biological systems
• Reconstruct the decision-making networks
• Design and construction of new biological components such as enzymes, genetic circuits, and cells,
redesign of existing biological systems
• The design and construction of new biological parts, devices and systems and redesign of existing,
natural biological systems for useful purposes
• Redesign and fabrication of existing biological systems, construction of new biological parts, devices and
systems that do not occur in nature
• New tools that support pathway construction and optimisation.
• Piece together biological components from several different origins, re-design a natural or construct a
novel pathway that the host uses to synthesise a valuable chemical
• Design and construction of new biological functions that are not found in nature
• Functional stand-alone elements, reconstructed in novel configurations
• Reconstruction of entire cellular genomes from virtual sequence information and using chemical
components
• Engineering DNA based biological circuits by using standardised biological parts; identifying the minimal
genome; constructing protocells; creating orthogonal biological systems through chemical synthetic
biology
• Systematic construction of biological systems with cells being build module by module (bottom up
engineering strategy)
• Application of engineering principles toward the construction of novel biological systems
• Application of the principles of engineering to the construction of life with desired properties in a
rational and systematic way
• Modular, well-characterised biological parts to predictably construct novel genetic devices and complex
cell-based systems following engineering principle
• Design and construction of biological systems guided by engineering principles
• Novel synthetic networks

• Improve biological systems
• Modify existing cells and organisms so that they work as cell factories
Trans- and inter-disciplinarity

• Emerging transdisciplinary field
• Interdisciplinary attempts
• Mixing and matching genetic parts
Chemistry
• Chemical synthetic biology – chemical and biochemical technology
• Bio-engineering, chemical synthetic biology
• Extension of synthetic chemistry – development of novel molecules
Aims
• To generate industrially scalable systems with a defined purpose
• Exploit the potential further by generating novel pathways, novel products, by combining different
biosynthetic steps originating from different bacteria
85
• Tweak natural regulatory mechanisms or switches in order to achieve the desired function
• Reducing unwanted (side-) products
• Create functional devices, systems and organisms with novel and useful functions
• Biochemical reconstitution approach
• Improve understanding of and ability to control living organisms
• New function more efficient, safe, understandable and predictable
• Combined use of genome-wide genomics, transcriptomics, proteomics, metabolomics
• Reduce research and development time and to increase speed to market
• Provide useful drugs, green fuels, other high value biomaterials
• Synthesis – validation of a scientific hypothesis
BioBricks™/building blocks/modules/basic components/biological parts

• Development of “BioBricks™”, search for a minimal cell, delivery of customised genes
• De novo design of new or the redesign of existing biological systems (single enzymes, whole biosynthetic
pathways)
• The key elements of these modular parts are molecular switches that are based on protein-protein,
protein-DNA or protein-RNA interactions
• Genetic components
• Create novel organisms containing designed genetic circuits from standard biological parts
(“BioBricks™”) that in most cases are provided by nature
• Individual parts are synthesised and combined in different biological arrangements to make useful
products such as biopharmaceuticals and biofuels
• Design and generation of new biological parts from natural existing components (including genetic
circuits, synthetic metabolic pathways and signalling systems)
• Use, modify, and improve natural systems to design useful devices
• Aim is to program cells to perform desirable functions in a predictable manner
• Predict the behaviour of biological systems
• Key “parts” are nucleic acids, metabolites and proteins
• Conception of parts, devices and systems
• Toolbox of biological building blocks
• Use of biological or biologically inspired modules for the directed self-assembly of functional synthetic
systems
• Small DNA pieces are assembled in a series of steps into whole genomes
• Combination of synthetic with nature-derived materials and architectural concepts
• Synthetic biology is concerned with the design and synthesis of chemical structures (enzymes, proteins,
genetic circuits and cells), which do not exist in nature as such
• Metabolite biosynthetic pathway from its organism of origin into more amenable heterologous hosts
• Hierarchy of biological structures – from individual molecules to whole cells, tissues and organisms
• Unnatural molecules to reproduce emergent behaviours in natural biology (goal of creating artificial life)
or interchangeable parts from natural biology to assemble systems that function unnaturally
Novelty
• Build novel biochemical systems to emulate useful, well-known natural biological systems
• Novel synthetic networks in living systems
• Biological assemblies with novel functions
86
• Design and fabrication of novel biologically-based components as well as the redesign of existing
biological systems
• Create novel functional devices and systems
• Produce novel devices, networks and pathways
• Creating novel functional parts, modules, systems, ultimately novel organism
• Novel biological circuits for desired applications, implemented through the assembly of biological parts
(natural components of cells and artificial molecules)
Design
• Standardisation, modularisation, characterisation, coupled to systematic design
• Large-scale gene networks to control and manipulate cells
• Design unique biological circuits (synthetic networks)
• System-wide manipulation of host genomes
• Biosynthetic pathways and enzyme scaffolds
• Synthesis of complex, biologically based systems
• Rational-design approach, redesign existing biological systems or create artificial life
• Design and synthesise biological networks or devices that perform a desired function in a predictable
manner
• Redesign metabolic pathways from scratch to create entirely new biosynthetic pathways de novo
• Principles and tools to design and assemble precisely controllable elements and modules for
reprogramming cellular metabolism and its control circuits
• Tools and methods to increase control over interactions, resulting in an integrative synthetic biology
that will allow ground-up cellular optimisation
• Manipulate existing systems and create entirely new systems with unique functionality
• Biological transformation of one organic compound to another (enzymatic reaction), sophisticated
logical systems; design of sophisticated cellular programs for beneficial applications spanning health,
energy, agriculture and the environment. Technological and scientific barriers limit the complexity of the
programs that can be reliably designed, be stable and safe.
• Disassembly, redesign and standardisation of existing biological components; creating novel genetic
circuits, biosynthetic pathways and living system from abiotic components
• Endeavour to design new or modify existing organisms to produce biological systems with new or
enhanced functionality according to quantifiable design criteria
• Biological blueprints but ideally independent of standard biological building blocks and constraints
• Design, synthesise and characterise new biological elements
• Design of new biological machines and systems
• Uncover the design principles of natural biologic systems and to explore novel biologic functions and
systems not found in nature
Knowledge/behaviour of systems
• Understand and harness the emergent properties of complex biological systems
• Prediction of the behaviour of the system
• Controlling complexity, using biological processes like directed evolution to optimise the function of new
designed circuits
• Redesign of complex natural living systems in a rational and systematic way
• Behaviour of new combinations
• Accumulated knowledge on biological systems
• Optimising biological systems including refactoring existing genomes
• Synthetic biology could be used to create novel “customised” pathways.
87
• Repurposing and redesign of biological systems for novel purposes or applications

• Design and synthesise novel functions
• Modelling, simulation, and comparison to experiment
• Quantitative models describing molecular interactions able to predict of the behaviour of the systems
• Understand or modify existing biological systems and create new biological systems
• Design and assembly of predictable and robust biological parts/systems and systems biology, which aims
at system-level understanding of biological systems
Self-replication
• Development of biological components and systems that can be combined to produce a pre-
programmed outcome in a biological system, and to build a complete, self-replicating biological system
Minimal genome
• Smallest autonomous self-replicating entity
• Minimal genome, constraints
• Minimal sets of essential genes are strongly context-dependent, conservation of genes
• Semicontained use, e.g. algal culture
• Minimise the genome of natural bacteria
• Minimal set of essential genes
• Program: conceptual extension of the genetic program, chassis: conceptual extension of the living cell
• Minimalise approach to designing biochemical systems from simple, predictable, powerful modules
• Design and fabrication of artificial minimal “modules” that enable bottom-up development of biological
complexity
• Research in minimal cells
• Basic parts are assembled to form biological devices that can be further integrated into complex systems
• Minimal “chassis” organism would be created to provide a blank canvas upon which to build
• Build biological systems based solely on the essential parts that constitute a living system
Self-replication
• Spontaneous chemical self-assembly process, ability to reproduce is an essential feature of the living
system
88
Synthetic Genomics | Annex
11.2Definitions published 2010-2013

Definitions – Scopus
2010
Synthetic Genomics
Goltermann and Bentin (2010)
One novel branch of recombinant DNA, referred to as synthetic genomics, is occupied with (re)- construction
of entire cellular genomes from virtual sequence information and using chemical components.
Klasson and Andersson (2010)
Synthetic genomics is a new field of research in which small DNA pieces are assembled in a series of steps into
whole genomes.
Synthetic biology
Blank and Kuepfer (2010)
Synthetic Biology, i.e., green field design and synthesis of highly active whole-cell biocatalysts.
Gao et al. (2010)
Synthetic biology can be defined as the “re-purposing and re-design of biological systems for novel purposes or
applications” (Marner, 2009).
Ninfa AJ (2010)
Synthetic biology is a relatively new discipline focused on engineering novel cell activities .
Schmidt M (2010)
Synthetic biologists try to engineer useful biological systems that do not exist in nature.
Atsumi and Connor (2010)
Synthetic biology aims to design, synthesize, and characterize new biological elements, or redesign natural
systems that can be lumped together in a “toolbox.”
Jarboe et al. (2010)
For the purpose of this review, we will apply the Synthetic Biology definition of “the design and construction of
new biological components, such as enzymes, genetic circuits, and cells, or the redesign of existing biological
systems”.
Kämpf and Weber (2010)
Synthetic biology as the discipline of reconstructing natural and designing novel biological systems is gaining
increasing impact in signaling science.
Schmidt and Pei (2010)
89
The probably least contested definition is that found at the SB community webpage
(http://syntheticbiology.org/): Synthetic Biology is: A) the design and construction of new biological parts,
devices, and systems, and; B) the re-design of existing, natural biological systems for useful purposes.
Wang et al. (2010)
Beginning from the first outline drawn by Szybalksi and Skalka in 1978, synthetic biology has undergone a
history from the initial chemical synthesis, to enzyme and PCR-based constructions (Kodumal et al., 2004), as
well as the recent systematic fabrication relying on the conception of parts, devices and systems (Ellis et al.,
2009; Peccoud et al., 2008). While not being confined to the creation of unnatural molecules, synthetic biology
also concentrates on reconstituting the functions of a cell or entire colony.
Weber and Fussenegger (2010)
Synthetic biology, which aims to design and construct complex biologic systems, is a field that is growing
exponentially.
Zhang et al. (2010)
Now, as described by Synthetic Biology Community (http://syntheticbiology.org/), synthetic biology is the

design and construction of new biological parts, devices and systems, and the re-design of existing, natural
biological systems for useful purposes. This is the simplest and perhaps the most widely accepted definition.
Alterovitz et al. (2010)
The field of synthetic biology holds an inspiring vision for the future; it integrates computational analysis,
biological data and the systems engineering paradigm in the design of new biological machines and systems.
Aubel and Fussenegger (2010)
Synthetic biology, the science of designing biological assemblies with novel functions in a rational and
systematic manner, is a promising new field with great potential for novel therapeutic strategies.(1,2,3,4
Bashor et al. (2010)
The application of engineering principles toward the construction of novel biological systems — a discipline
that has become known as synthetic biology — has received a great deal of attention in recent years based on
its potential to deliver a wide array of technological benefits….In practice, synthetic biology consists of co-
opting molecular “parts” from natural systems and using them to construct new networks that fulfill specific
design goals.
Fritz et al. (2010)
Synthetic biology is a nascent technical discipline that seeks to enable the design and construction of novel
biological systems to meet pressing societal needs. … In recognition of such challenges, the central goal of
synthetic biology is to transform biology into a system that can be engineered just as we engineer bridges and
mechanical systems today (reviewed in [3–8]).
Ghim et al. (2010)
Synthetic biology is an emerging field with the aim of designing and constructing complex artificial biological
systems using standard biological parts in a fashion similar to that of an engineer designing an electronic or
mechanical system.
90
Neumann et al. (2010)
In its most stringent definition, synthetic biology is the application of the principles of engineering to the
construction of life with desired properties in a rational and systematic way (Serrano 2007).
Wintermute and Silver (2010)
In particular, synthetic biology, in which organisms are rationally engineered to elicit designed behavior, plays
an integral role in these studies.
Foley and Shuler (2010)
Engineers interested in synthetic biology generally fall into two categories: (1) those working to develop
biological components and systems that can be combined to produce a pre-programmed outcome in a
biological system, and (2) those working to build a complete, selfreplicating biological system capable of
performing some useful task.
McArthur IV and Fong (2010)
As with its sister field of systems biology, synthetic biology is perhaps best described not by what you do, but
how you do it. From this perspective, one way of summarizing synthetic biology is by its intended goal of
making biological systems explicitly tractable through careful modularization of biology [1]
Rothschild LJ (2010)
Synthetic biology, the design and construction of artificial biological systems, substitutes bio-engineering for
evolution, which is seen as an obstacle. …. Synthetic biology has acquired several meanings. Knight) and Endy
see synthetic biology as an engineering challenge with interchangeable parts joined to yield novel pathways.
By stripping away the ‘‘baggage’’ of its heritage, a minimal ‘‘chassis’’ organism would be created to provide a
blank canvas upon which to build. Church and Venter aim to build completely artificial cells.
Silva-Rocha and De Lorenzo (2010)
The basic notion behind synthetic biology is that any biological system can be seen as a combination of
functional stand-alone elements that can be disclosed as a limited number of components and reconstructed
in novel configurations .
Yadav and Stephanopoulos (2010)
The two cornerstones of synthetic biology are the introduction of the new technology of chemical DNA
synthesis and its subsequent emphasis on the use of standardized biological parts in the construction of
genetic systems aimed at eliciting of desired cellular behavior.
Na et al. (2010)
Although there are many definitions of synthetic biology [8], it aims at creating novel functional parts,
modules, systems, and ultimately novel organisms through the integrated use of biological techniques and
mathematical methodologies employed in engineering designs.
Percival Zhang Y-H (2010)
Synthetic biology applies engineering principles (e.g., design, extraction, and standardization) and combines
sciences (biology and chemistry) in order to design and build novel biological functions and systems that
91
function unnaturally or function much better than natural counterparts (Benner and Sismour, 2005; Endy,
2005). Synthetic biology is also interpreted as the engineering-driven building of increasingly complicated
biological entities (parts, devices, and systems) from simple and basic building blocks.
Voloshchuk and Montclare (2010)
Synthetic biology aims to engineer artificial biological systems with the ultimate goal of programming novel
cell and organism behaviour. This is being achieved via a bottom-up approach in which the key ‘‘parts’’ are
nucleic acids, metabolites and proteins.
Young and Alper (2010)
Synthetic biology is developing the tools and methods that will increase control over these interactions,
eventually resulting in an integrative synthetic biology that will allow ground-up cellular optimization.
Zheng and Sriram (2010)
Synthetic biology aims to design novel biological circuits for desired applications, implemented through the
assembly of biological parts including natural components of cells and artificial molecules that emulate
biological behavior [1, 2]. Because of its parts-to-whole approach, synthetic biology has a significant
engineering component. Engineering endeavors typically involve the three classical engineering strategies:
standardization (ensuring that components of a system are compatible and exchangeable), decoupling
(dissecting a system into less complicated subsystems), and abstraction (streamlining a problem to focus only
on the pertinent facets) [3–5].
De Lorenzo V (2010)
There is, therefore, a first brand of Synthetic Biology with an altogether scientific agenda that takes aboard the
celebrated remark by the 1965 Nobel Prize winner in Physics Richard Feynman ‘‘. . . what I cannot create, I do
not understand ’’. Synthesis is understood here as the ultimate validation of a scientific hypothesis, and
therefore as a tool that belongs to the realm of fundamental science.
Robson Marsden and Kros (2010)
Synthetic biology aims to understand and harness the emergent properties of complex biological systems. As
discussed here, one approach towards this is the use of biological, or biologically inspired modules, for the
directed self-assembly of functional synthetic systems.
Khalil and Collins (2010)
As a result, synthetic biology was born with the broad goal of engineering or “wiring” biological circuitry—be it
genetic, protein, viral, pathway, or genomic—for manifesting logical forms of cellular control.
Purcell et al. (2010)
The aim of synthetic biology is to design and synthesize biological networks or devices that perform a desired
function in a predictable manner (Endy 2005; Andrianantoandro et al. 2006; Serrano 2007; Haseloff & Ajioka
2009)
Zhang and Jiang (2010)
92
“What I cannot create, I do not understand,” as said by the physicist Richard Feynman, synthetic biology has
become an important tool not only to uncover the design principles of natural biologic systems, but also to
explore novel biologic functions and systems not found in nature.
Bayer TS (2010)
Synthetic biology is the design and construction of biological systems guided by engineering principles, with
the aim of understanding biology or producing useful biological technologies. While a precise definition and
scope has been discussed elsewhere [14,15], in broad terms synthetic biology encompasses a wide range of
focus areas, including alternative chemistries, artificial cells, self-replicating macromolecules, and in silico life
forms.
Chen et al. (2010)
Second, synthetic biology is developing principles and tools to design and assemble precisely controllable
elements and modules for re-programming cellular metabolism and its control circuits [10–16]. Synthetic
biology aims to design and fabricate biological components and systems that exist or do not exist in nature for
various engineering applications.
Grünberg and Serrano (2010)
Synthetic Biology aims to prepare the ground for the routine engineering of complex biological systems
(13,15).
2011
Synthetic biology
Achbergerová and Nahálka (2011)
“Synthetic biology” is a scientific area that includes two intentions. One area uses unnatural molecules to
reproduce emergent behaviours in natural biology with the goal of creating artificial life. The other area seeks
interchangeable parts from natural biology to assemble systems that function unnaturally [117]. In both cases,
the intentions are focused on a better understanding of life and on the use of knowledge for a commercial
benefit. For example, the design and construction of minimal cells, one main goal of synthetic biology [118],
would be beneficial for the biotechnology industry. / This is very interesting for design of minimal cells, a main
goal of synthetic biology.
Cambray et al. (2011)
The term ‘pipe’ refers to the biological transformation of one organic compound to another through an
enzymatic reaction, whereas ‘program’ refers to sophisticated logical systems, such as those that underlie
microbial homeostasis in complex environments. Synthetic Biology seeks to enable the design of sophisticated
cellular programs for beneficial applications spanning health, energy, agriculture and the environment. Current
technological and scientific barriers limit the complexity of the programs that can be reliably designed and
proven to be stable and safe after deployment. The systematic development of standard genetic components
coupled with emerging methods of multiplexed directed evolution should provide the knowledge and tools
necessary to bootstrap a virtuous cycle of genome refactoring and functional expansions. A sustained
endeavor will be necessary to cross the uncanny valley of imperfect designs, till the community gathers
enough tools and knowledge to enable efficient, robust and verifiable engineering of desired phenotypic
behaviors
93
Figure 15: Dynamics in the biological engineering application space.
Colin et al. (2011)
Synthetic biology emerged around the year 2000 as a new biological discipline, and many different definitions
have been applied to this field. However, one commonly used way to describe synthetic biology is as the
design and construction of new biological functions that are not found in nature [37]. Synthetic biology is a
discipline encompassing contributions from many fields [38–40]:
Collier and Simpson (2011)
Synthetic biology involves reverse-engineering the design rules governing the machinery of cells and cell
circuits, and then using this knowledge to manipulate existing systems and create entirely new systems with
unique functionality. A key concept is the design and fabrication of artificial minimal ‘modules’ that enable
bottom-up development of biological complexity [1,2]. In this sense, synthetic biology is related, but not
exactly equivalent to ‘systems biology’, which employs highthroughput measurements involving an extensive
parameter set to obtain complete knowledge of large systems [3]
Erb (2011)
Synthetic biology could be used to create novel “customized” CO2 fixation pathways that overcome any
historical and evolutionary burden of the six natural autotrophic pathways. Such synthetic CO2 fixation
pathways could find applications in biotechnology and “green” chemistry (e.g., the production of biomass,
biopharmaceuticals, or fine chemicals from CO2 and an appropriate energy source) or in environmental
protection (e.g., customized control of CO2 emissions)
Erickson (2011)
In our view, synthetic biology is an extension of the continuum of genetic science that has been used safely for
more than 40 years by the biotechnology industry in the development of commercial products (Figure 16).
Examples of synthetic biology use by biotechnology companies illustrate the potential to substantially reduce
research and development time and to increase speed to market. Improvements in the speed and cost of DNA
synthesis are enabling scientists to designmodified bacterial chromosomes that can be used in the production
of renewable chemicals, biofuels, bioproducts, renewable specialty chemicals, pharmaceutical intermediates,
fine chemicals, food ingredients, and health care products. Regulatory options should support innovation and
commercial development of new products while protecting the public from potential harms.
94
For instance, gains in the speed and efficiency ofDNAsynthesis, sequencing, and recombinant DNA technology
combined with cataloging of genomic data permit advanced methods for predictable biological production of
commercial proteins and chemicals. Gene shuffling and directed evolution, based on the rapid iteration and
sequencing of recombinant proteins, are other outgrowths of the increased efficiency of standard
biotechnology techniques and have been safely used for many years.Metabolic engineering—the optimization
of microbial fermentation pathways, cellular processes and enzymatic activity for biochemical production—is
an outgrowth of the increased knowledge of genomics.
Synthetic biology encompasses a set of emerging tools, including applied protein and genome design, the
standardization of genomic “parts” or oligonucleotides, and synthesis of full genomes, that are important to
the continued evolution of biotechnology. The continued refinement and capability of metabolic engineering
techniques, combined with digitized proteomic and genomic data, are expected to enable increasingly
complex, multistep fermentation of organic chemicals and longer gene synthesis.
Figure 16: Evolution of innovation
Kircher (2011)
Synthetic biology: The vision of synthetic biology is to engineer a specific biocatalytic reaction chain in a so-
called cell chassis. This chassis is able to propagate under laboratory an production conditions, but is stripped
of all genetic information and in addition, it needs to be prepared for the various environments in nature. It is
expected that such systems are genetically more stable, thus allowing continuous fermentation; produce with
higher yield since they do not waste precursors in competing metabolic pathways; and give access to man-
designed bioproducts, which are otherwise not provided by nature.
Krivoruchko (2011)
Synthetic biology involves the design and construction of biological parts and components that do not exist in
nature and operates at several levels of biological organization.This includes the DNA level, through advances
in gene synthesis and the use of codon optimization for optimal gene expression [9, 10], the creation of
unnatural base pairs [11] and the use of quadruplet codons [12].At the protein level, synthetic biology
attempts to design new functions/specificities into proteins and create new UAAs (unnatural amino acids) that
expand the catalytic possibilities further [13–14]. At the pathway level, synthetic biology attempts to redesign
biological pathways, assemble completely new pathways from biological components or design novel
regulatory systems [15, 16]. Even on the whole-organism level synthetic biology is making strides, with the first
successful transfer of a synthetic genome reported recently [17]. In addition to creating new cellular molecules
and functions, synthetic biology also attempts to standardize biological components, which could reduce the
complexity associated with biological systems and make it easier to design, assemble and regulate metabolic
95
pathways. Therefore, in many respects, synthetic biology complements metabolic engineering and advances in
this field can create new and exciting tools for the engineering of microorganisms.
Lee JW (2011)
Synthetic biology aims at creating novel biologically functional parts, modules and systems by employing
various molecular biology and synthetic DNA tools together with mathematical methodologies, and has been
successfully applied in various metabolic engineering experiments (Box 2) [11–13].
Marchisio (2011)
Synthetic biology is a rather new discipline—commonly referred to as “life engineering”—that aims to design
and construct new, biological systems characterized by specific and fully predictable outputs. Synthetically
reengineered cells might target several important tasks from disease treatment (Ro et al., 2006) to biofuel
production (Savage et al., 2008) and hazardous waste recognition and removal (de las Heras et al., 2008).
Initial attempts to build synthetic circuits were mainly proof of principle studies based on the mechanisms that
regulate DNA transcription.
Mitchell (2011)
Synthetic Biology (SB) is the repurposing of living systems for useful ends. SB, philosophically rooted in the
engineering paradigm, aims to reduce complex ‘natural’ (i.e. evolved) systems to simplified, reliable, quality-
controlled modules, or ‘parts’, that can be mathematically modeled, manipulated by computer aided design
(CAD), ‘abstracted’ (passed between loosely coupled design and production layers), bolted together to achieve
predictable results, and fabricated on an industrial scale [10].
Pleiss (2011)
herefore, the term ‘synthetic biology’ has been coined recently to describe a strategy to systematically use,
modify, and improve natural systems to design useful devices [75,76].
Synthetic Biology is: A) the design and construction of new biological parts, devices, and systems, and; B) the
re-design of existing, natural biological systems for useful purposes.
Synthetic biologists are currently working to:
96
By and large, however, the following activities are usually subsumed under SB (Bedau and Parke, 2009; Benner
and Sismour, 2005; Deplazes, 2009; Luisi, 2007; O’Malley et al., 2008; Schmidt et al., 2009; Torgersen et al.,
2010):
DNA synthesis (or synthetic genomics),

Engineering DNA-based biological circuits (based on genetic engineering but using real engineering principles),
Defining the minimal genome (or minimal cell),
Building protocells (or synthetic cells),
Xenobiology (aka chemical SB).
Shankar (2011)
Synthetic biology is a naturally evolved discipline that aims to build biological systems from scratch using
molecular design principles from nature with expanded, enhanced and controllable properties. It is about
engineering biological systems to produce predictable and robust systems with novel functionalities that do
not exist in nature.
Song (2011)
A major goal of synthetic biology, being at the interface of engineering and biology, is to program cells to
perform desirable functions in a predictable manner [1, 2]. These programmed functions could have potential
applications in biomedicine [3], biofuel [4], bioremediation [5], and cellular computation [6].
97
Stano (2011)
Research on minimal cells is one of the pillars of synthetic biology [16]. It can comprise a bottom-up or top-
down design, followed by construction, leading to the sought understanding. Research on minimal synthetic
cells has at least three fundamental facets: (i) it allows a deep comprehension of physical- biochemical facts at
the basis of cellular life; (ii) it has potential applications in medicine, biotechnology and life sciences [6, 7]; (iii)
it allows insights into origin of life because minimal cells are models of primitive cells.
Vinuselvi (2011)
The development of bioinformatics and functional genomics has enabled not only the ability to understand or
modify existing biological systems but also to create new biological systems for special purposes. The natural
outcome of such an advance is synthetic biology, which deals with the design and assembly of predictable and
robust biological parts/systems and systems biology, which aims at system-level understanding of biological
systems. These well-characterized and novel biological parts/systems would in turn provide useful drugs,
green fuels, or other high value biomaterials [1,2]. Synthetic biologists differ from genetic engineers in that
they try to engineer and create complex biological systems for practical applications from lesser understood
and unreliable basic components [3]. Systems biologists develop tools of modeling, simulation, and
comparison to experiment in order to understand complex biological systems. The systems biology approach
will be especially useful in synthetic biology.
Weber (2011)
Synthetic biology is a highly dynamic discipline at the cross-section of life sciences and engineering aimed at
the design and construction of biological systems with useful properties. The paradigm of synthetic biology is a
modular design hierarchy where basic parts are assembled to form biological devices that can be further
integrated into complex systems [1]. This bottom-up concept was successfully established in bacterial, yeast,
plant and mammalian cells and resulted in a comprehensive insight into the optimal design principles for
complex biological systems and also in first applications providing novel solutions in the medical [2,3], energy
[4] and nutritional [4] sectors.
Zhang LY (2011)
The definition of synthetic biology keeps evolving with a decade of development. So far there is no official or
formal definition. According to the definition from the Synthetic Biology Community
(http://syntheticbiology.org/), which is the most widely accepted concept, synthetic biology is the design and
construction of new biological parts, devices and systems and the re-design of existing natural biological
systems for useful purposes. Synthetic biology on the one hand is important to explore the origin and
evolution of life, on the other hand, it has a broad range of applications ranging from health care (diagnostics
and therapeutics), environment (biosensors, bioremediation), energy (biofuel) to agriculture (optimized food),
through engineering the biological systems or modules [2–5]. One of the key features of synthetic biology is to
apply the engineering principles to biological studies.
2012
Synthetic Biology
Blount et al (2012)
“Synthetic biology is the application of engineering principles to the process of constructing and implementing
human-designed biological systems. [3,4]. Synthetic biologists essentially aim to predictably produce a wide
98
variety of novel devices, networks and pathways through rational recombination of modular DNA-encoded
biological parts”
Cardinale and Arkin (2012)
“One of the common goals of synthetic biology is to make the design of new function vastly more efficient,
safe, understandable, and predictable. This field is likely to have a profound impact on chemical,
pharmaceutical and material manufacturing, environmental and agricultural engineering, and health.
Chen et al (2012)
“Synthetic biology is an emerging field of interdisciplinary research that seeks to transform our ability to
probe, manipulate, and interface with living systems by combining the knowledge and techniques of biology,
chemistry, computer science, and engineering. Its main aim is to increase the ease and efficiency with which
biological systems can be designed, constructed, and characterized”
Chiarabelli et al (2012)
Synthetic biology is first represented in terms of two complementary aspects, the bio-engineering one, based
on the genetic manipulation of extant microbial forms in order to obtain forms of life which do not exist in
nature; and the chemical synthetic biology, an approach mostly based on chemical manipulation for the
laboratory synthesis of biological structures that do not exist in nature. (…)
The notion of synthetic biology (SB) is by now well accredited in the experimental life sciences, and is generally
seen as the modern and most ambitious development of bioengineering and biotechnology in general. The
term ambitious is appropriate, as one of the declared aims of SB is the laboratory construction of alternative
forms of life, namely forms of life that do not exist in nature. The term life is till now still restricted to
microorganisms, and various aspects of this design have been described in the literature about microbes
capable of eventually producing fuels and energy for mankind, to the various genomic modifications of extant
microorganisms to enrich their functionality.
Danchin (2012)
The present avatar of «Synthetic Biology» (SB) assumes that we know enough of what life is to allow us to
construct life from scratch, or, at least, to modify existing cells and organisms so that they work as cell
factories. With this view SB puts together two separate entities, a program (the conceptual extension of the
genetic program) and a chassis (the conceptual extension of the living cell).
Firman et al. (2012)
One definition of Synthetic Biology is ‘‘the application of engineering principles to the study of the
fundamental components of biology’’, but there are major problems associated with this basic premise –
biological systems are very different from electronic systems, or chemical systems, and new combinations do
not always behave as expected
Giessen and Marahiel (2012)
It is in this light that synthetic biology, usually defined as the de novo design of new or the redesign of existing
biological systems, ranging from single enzymes (protein engineering) to whole biosynthetic pathways
(metabolic engineering), offers new approaches and methodologies that may help to tackle this urgent
problem.
Hörner and Weber (2012)

99
Synthetic biology is a relatively new discipline which aims to engineer novel biological systems with useful and
predictable functions by combining modular, well-characterized genetic parts in a rational and systematic
manner [1–8]. The key elements of these modular parts are molecular switches that are based on protein–
protein, protein–DNA or protein–RNA interactions.
Jäschke (2012)
One of the most important goals in chemical and synthetic biology is controlling the expression of defined sets
of genes by external stimuli. Such systems allow switching on or off at will the production of proteins of
interest, exogenously controlling cell function, or constructing increasingly complex gene networks with
unprecedented control
Kitney and Freemont (2012)
The accepted definition is ‘‘synthetic biology aims to design and engineer biologically based parts, novel
devices and systems – as well as redesigning existing, natural biological systems’’. Synthetic Biology is the
application of systematic design – using engineering principles”. … “an important objective of synthetic
biology is to constrain biological systems by controlling complexity through either the design of orthogonal
genetic circuits that do not interact with the host system or by using biological processes like directed
evolution to optimise the function of new designed circuits”. … “One aim of synthetic biology is define these
genetic modules as functional devices, which can be used in a design process to create more complex
responses or functions”. … “Even though there is a clear definition of synthetic biology which most people in
the field accept, there is still quite a high degree of misunderstanding about the true nature of the field. A
clear distinction must be made between various fields in life science (which, in the context of synthetic
biology, can be considered to be foundational science) and synthetic biology itself.
• Synthetic biology is a new field which is based on the engineering principles of standardisation,
modularisation and characterisation, coupled to systematic design (it is not a direct extension of genetic
engineering).
• An important driver of synthetic biology, and indeed probably the key to its genesis, has been the
development of increasingly low cost and reliable gene sequencing and synthesis methods which are
becoming widely commercially available.
• Industrialisation is an important endpoint of synthetic biology (i.e. it is primarily a field of engineering).
• Whatever the relative economic growth figures for synthetic biology, from a variety of sources might be, its
economic impact is generally predicted to be highly significant.
Lam et al. (2012)
The field of synthetic biology has combined knowledge from different science and engineering disciplines and
facilitated the advancement of novel biological components which has inspired the design of targeted
biosynthesis.
Nguyen et al. (2012)
One of the most challenging aims of synthetic biology is the de novo engineering of regulatory systems with
desired behavior by taking advantage of quantitative models describing molecular interactions able to predict
of the behavior of the systems.
Rodrigo et al. (2012)

100
Synthetic biology, which aims to redesign biological systems for novel purposes and applications, enables the
transfer of a secondary metabolite biosynthetic pathway from its organism of origin into more amenable
heterologous hosts, where the compounds of interest or their precursors can be produced with desired titers
[2–7].
Peccoud and Isalan (2012)
Synthetic biology is an emerging transdisciplinary field at the intersection between many engineering and
scientific disciplines such as biology, chemical engineering, chemistry, electrical engineering, or computer
science. The scientific milestone that inspired the development of synthetic biology is often regarded as the
description of two artificial gene networks in the same issue of Nature in 2000.
Wohlleben et al. (2012)
Synthetic Biology now offers a new perspective to exploit this potential further by generating novel pathways,
and thereby novel products, by combining different biosynthetic steps originating from different bacteria.
Benenson (2012)
One of the long-term goals in synthetic biology is the construction of large-scale gene networks to control and
manipulate cells. Such networks often tweak natural regulatory mechanisms, or ‘switches’, in order to achieve
the desired function”. … “Synthetic biology [1] is generally viewed as the successor of the venerable discipline
of genetic engineering. While genetic engineering has traditionally focused on manipulating and modifying
single genes or small numbers of genes to achieve a specific goal, synthetic biology practitioners attempt to
apply engineering concepts to medium and large-scale gene sets, resulting in engineered pathways and even
entire synthetic genomes.
Bubela et al. (2012)
The emerging interdisciplinary field of synthetic biology brings an engineering approach to biology. Individual
parts can be readily synthesized and combined in different biological arrangements to make useful products
such as biopharmaceuticals and biofuels. Synthetic biology spans from advanced genetic engineering, which
redesigns and fabricates existing biological systems, to the construction of new biological parts, devices and
systems that do not occur in nature Thus, framing synthetic biology is a combination of the old and the new,
with a change in mindset towards engineered systems.
Bugaj and Schaffer (2012)
Synthetic biology can potentially augment traditional gene therapy strategies by enhancing control of the
therapeutic gene to be expressed, for example through circuit architecture involving environmental sensing or
feedback, or through the use of inducible promoters responsive to orally administered small molecule pills.
Checa et al. (2012)
Synthetic biology is a new area of biological research and technology applying basic engineering principles like
modularization, rational design and modeling to the construction of complex biological networks with desired
properties and functionalities. The approach involves the design and generation of new biological parts from
natural existing components, that is, the building blocks necessary for the construction of such higher order
systems, including genetic circuits, synthetic metabolic pathways and signaling systems.
Cobb et al. (2012)
101
In its broadest terms, synthetic biology can be described as the engineering of biological entities not found in
nature. The applications for such entities are numerous, including bioremediation, biosensing, and synthesis of
value-added chemicals.
Ducat and Silver (2012)
Synthetic biology is well-situated to provide original approaches for compartmentalizing and enhancing
photosynthetic reactions in a species independent manner.
Ellis and Goodacre (2012)
One of the main goals of synthetic biology is to generate the desired material with a good conversion from
substrate(s) to product whilst reducing unwanted (side-) products(…)Synthetic biology is here to stay and
rational metabolic engineering of bacteria, yeast, fungi and mammalian-based systems will become an
important growth area, urgently needed to sustain the planet’s needs as the population continues to expand
at alarming rates whilst consuming valuable non-renewable resources.
Forster (2012)
Synthetic biology is a powerful experimental approach, not only for developing new biotechnology
applications, but also for testing hypotheses in basic biological science”. … “It should be noted that some of
the work on purified translation systems covered in this review doesn’t really fit our previously published
definition of synthetic biology as “the complex engineering of replicating systems” [5], even though the work
was a spin-off of putting together the biomolecular parts towards in vitro replication of peptidomimetics. Thus
it may be viewed more accurately as the “synthesis” described by Benner or perhaps “synthetic biochemistry.”
Nevertheless, the work presented does fit within some common definitions of synthetic biology, such as “the
design and construction of new biological parts, devices and systems” (http://syntheticbiology.org).
Hoesl and Budisa (2012)
One of the main goals of Synthetic Biology is to generate new and emergent biological functions in streamlined
cells which are equipped with ‘tailor-made biochemical production lines.
Juhas (2012)
One of the main aims of synthetic biology is to create a cell whose genome harbors the minimal set of
essential genes.
Karlsson and Weber (2012)
The field of synthetic biology is rapidly expanding and has over the past years evolved from the development
of simple gene networks to complex treatment-oriented circuits. The reprogramming of cell fate with open-
loop or closed-loop synthetic control circuits along with biologically implemented logical functions have
fostered applications spanning over a wide range of disciplines, including artificial insemination, personalized
medicine and the treatment of cancer and metabolic disorders,
Kittleson et al. (2012)
Synthetic biology relies on engineering concepts such as abstraction, standardization, and decoupling to
develop systems that address environmental, clinical, and industrial needs. Recent advances in applying
modular design to system development have enabled creation of increasingly complex systems.
102
Lin and Levchenko (2012)
A large facet of synthetic biology involves placing rationally designed genetic circuits in living cells to engineer
predicted outputs
Lux et al. (2012)
The aim of synthetic biology is to make genetic systems more amenable to engineering, which has naturally
led to the development of computer-aided design (CAD) tools.
Macia et al. (2012)
Synthetic biology (SB) offers a unique opportunity for designing complex molecular circuits able to perform
predefined functions.
Malinova et al. (2012)
The topic synthetic biology appears still as an ‘empty basket to be filled’. However, there is already plenty of
claims and visions, as well as convincing research strategies about the theme of synthetic biology. First of all,
synthetic biology seems to be about the engineering of biology – about bottomup and top-down approaches,
compromising complexity versus stability of artificial architectures, relevant in biology. Synthetic biology
accounts for heterogeneous approaches towards minimal and even artificial life, the engineering of
biochemical pathways on the organismic level, the modeling of molecular processes and finally, the
combination of synthetic with nature-derived materials and architectural concepts, such as a cellular
membrane. Still, synthetic biology is a discipline, which embraces interdisciplinary attempts in order to have a
profound, scientific base to enable the re-design of nature and to compose architectures and processes with
man-made matter.
Morey et al. (2012)
A goal of synthetic biology is to apply the same engineering principles to the rational design of biological
systems, including regulatory genetic circuits, metabolic systems, and signal transduction.
Olson and Tabor (2012)
Synthetic biology is improving our understanding of and ability to control living organisms.
Planson et al. (2012)
Synthetic biology aims at creating novel functional devices and systems that together with new ideas coming
from the field of systems biology are enriching the toolbox of metabolic engineering for therapeutic
development.
Slusarczyk et al (2012)
One goal in synthetic biology is to design parts and modules in such a fashion as to make systems-level fitness
landscapes smoother: for example, by orthogonalization.
Yuzawa (2012)
One definition of synthetic biology is “the deliberate design and fabrication of novel biologically-based
components as well as the redesign of existing biological systems.
Zhu et al. (2012)

103
Synthetic biology is defined as the application of engineering principles to biology. It disassembles, redesigns
and standardizes existing biological components (parts, devices and genetic circuits) with the aim of creating
novel genetic circuits, biosynthetic pathways and living system from abiotic components.
2013
Synthetic Genomics
Acevedo-Rocha et al. (2013)
A central undertaking in synthetic biology (SB) is the quest for the ‘minimal genome’. However, ‘minimal sets’
of essential genes are strongly context-dependent and, in all prokaryotic genomes sequenced to date, not a
single protein-coding gene is entirely conserved.
Synthetic Biology
Arpino (2013)
Synthetic Biology is the ‘Engineering of Biology’ – it aims to use a forward-engineering design cycle based on
specifications, modelling, analysis, experimental implementation, testing and validation to modify natural or
design new, synthetic biology systems so that they behave in a predictable fashion.
The primary goal of Synthetic Biology is to create new or add additional functionality to biological systems by
constructing new parts, or modifying existing biological systems (Purnick & Weiss, 2009).
Ausländer (2013)
104
Synthetic biology aims to standardize and expand the natural toolbox of biological building blocks to engineer
novel synthetic networks in living systems.
Cobb (2013)
Synthetic biology aims to improve and design biological systems through construction of new biological
components, such as enzymes, biosynthetic pathways, genetic circuits, and cells (recently reviewed by [1–8]).
Synthetic biology has a wide variety of industrial and therapeutic applications, such as creating biosensors [9],
generating biofuels [10–12], producing high-quality, inexpensive drugs [13,14], and remediating polluted sites
[15].
Garvey (2013)
Synthetic biology: the use of recombinant DNA technologies for the combination of genes and the production
of novel proteins.
Gübeli (2013)
Synthetic biology aims to advance life sciences by the application of engineering approaches in order to
construct novel biological systems exerting complex functions. Following a bottom-up strategy, singlewell-
characterized modules are assembled into complex biological systems guided by mathematical modeling
leading to predictable and robust functionalities. Initially, such designed systems were tested in prokaryotes
(Basu et al., 2005; Elowitz and Leibler, 2000) mainly due to simple genetic background and manipulation. As a
next step, the focus was laid on establishing these circuits in higher-order organisms from yeast (Ajo-Franklin
et al., 2007) to plants (Antunes et al., 2006) up to mammalian cells as they better represent the complexity in
humans.
Jain (2013)
Synthetic biology, application of synthetic chemistry to biology, is a broad term that covers the engineering of
biological systems with structures and functions not found in nature to process information, manipulate
chemicals, produce energy, maintain cell environment and enhance human health [1] . Synthetic biology
includes technologies for DNA synthesis and assembly of fragments of DNA for gene synthesis, sometimes
referred to as synthetic genomics. Craig Venter, a pioneer in this area, has described synthetic biology in a
video (http://www.youtube.com/watch?v=dvBV2qnSZwo).
Synthetic biology devices contribute not only to improve our understanding of disease mechanisms, but also
provide novel diagnostic tools. Methods based on synthetic biology enable the design of novel strategies for
the treatment of cancer, immune diseases metabolic disorders and infectious diseases as well as the
production of cheap drugs [2].
Lee and Na (2013)
Synthetic biology is changing the paradigm of biology and biotechnology. It allows the design and construction
of new biological parts, modules, devices, chassis, and systems, in addition to reengineering cellular
components and machineries that nature has provided. 3,4 For example, two seminal papers presenting the
first synthetic gene networks appeared in 2000: an artificial toggle switch developed using a feedback system
made of two crossrepressing genes 5 and a synthetic oscillatory network using three transcriptional
repressors.
105
Mapmel (2013)
Maurino (2013)
However, the concepts of synthetic biology could be used to bridge the gap between evolutionary theory and
functional biology by engineering a novel organism from existing and newly designed parts. Symbiotic
relationships have recently begun to be exploited in synthetic biological networks of increasing complexity
(Agapakis et al., 2011). While most of these studies are aimed at engineering synthetic dual-organism systems
of free-living microorganisms for biotechnology (Waks and Silver, 2009), several were designed to analyse the
process of the establishment of symbiosis itself (Harcombe, 2010; Hosoda et al., 2011).
Miyamoto (2013)
One of the long-term goals of synthetic biology is the ability to reconstruct the decision-making networks in
order to implement them as logic gates in living cells.
Moses (2013)
This can be achieved through synthetic biology, which can be defined as ‘the design and construction of new
biological components, such as enzymes, genetic circuits, and cells, or the redesign of existing biological
systems’ (Keasling, 2008). More elaborately, synthetic biology refers to the redesign of complex natural living
systems in a rational and systematic way to simplified, predictable and controllable modules that can be
modeled and manipulated to generate industrially scalable systems with a defined purpose. For many years,
the term ‘synthetic biology’ was used to describe concepts that would be classified today as metabolic
engineering. However, the definitions are not sharpedged, and hence metabolic engineering might still be
considered as the simplest form of synthetic biology (Channon et al., 2008).
106
Nour Eldin (2013)
Synthetic biology aims at engineering new biological processes for specific industrial applications such as, for
example, microbial production of valuable plant specialized metabolites.
Stano (2013)
Synthetic biology probably represents today the most ambitious and fascinating branch in biology, and the
construction of synthetic cells is one of its most challenging goals. In this regard, it is necessary to make a
preliminary clarification. The term synthetic biology generally is taken to signify operations with the genome of
a microorganism — either for a genetic engineering project, see for example [1] — or for analyzing theor-
etically the constraints of the minimal genome [2].
Definitions – PubMed
2010
Synthetic Biology
Included in “Definitions Scopus 2010” – see above
2011
Synthetic Biology
Newson AJ (2011)
Although no single definition of SynBio prevails, the field broadly encompasses the application of engineering
principles to biology, redesigning biological materials and using them as new substrates to create products and
entities not otherwise found in nature.
107
The probably least contested definition is that found at the SB community webpage
(http://syntheticbiology.org/):"Synthetic Biology is: A) the design and construction of new biological parts,
devices, and systems, and; B) the re-design of existing, natural biological systems for useful purposes.
"Synthetic biologists are currently working to"
• specify and populate a set of standard parts that have well-defined performance characteristics and can be
used (and re-used) to build biological systems,
• develop and incorporate design methods and tools into an integrated engineering environment,
• reverse engineer and re-design preexisting biological parts and devices in order to expand the set of
functions that we can access and program,
• reverse engineer and re-design a ‘simple’ natural bacterium,
• minimize the genome of natural bacteria and build so-called protocells in the lab, to define the minimal
requirements of living entities, and
• construct orthogonal biological systems, such as a genetic code with an enlarged alphabet of base pairs.
Weber W and Fussenegger M
Synthetic biology aims to create functional devices, systems and organisms with novel and useful functions on
the basis of catalogued and standardized biological building blocks.
Zhang et al. (2011)
Synthetic biology is more ambitious than conventional genetic engineering, and aims to design and reconstruct
biological systems or even entire bacterial genomes.
Prindle et al. (2011)
Synthetic biology can be broadly parsed into the “top-down” synthesis of genomes and the “bottom-up”
engineering of relatively small genetic circuits.
Bhomkar et al. (2011)
Synthetic biology or “synbio” is an emerging field of biotechnology that combines molecular biology with
genetic engineering and protein engineering.
Chen and Smolke (2011)
Furthermore, a central aim of synthetic biology is to facilitate the engineering of biology so that systems need
not be constructed from scratch for each new application. Synthetic biologists have begun to construct
integrated systems for translational applications by piecing together an increasingly sophisticated collection of
biological “parts” with diverse functions.
Colin at al. (2011)
However, one commonly used way to describe synthetic biology is as the design and construction of new
biological functions that are not found in nature.
108
Svensen et al. (2011)
The ability to efficiently and economically generate libraries of defined pieces of DNA would have a myriad of
applications, not least in the area of defined or directed sequencing and synthetic biology but also in
applications associated with encoding and tagging.
Amidi et al. (2011)
Synthetic biology is a rapidly emerging interdisciplinary research field that aims to construct new biological
parts and systems with new functionalities through a process of engineering and standardization.
Porcar et al. (2011)
The achievement of a simplified synthetic chassis with only a fraction of the functions of a natural cell but
keeping the very essence of life (the ability to perpetuate in time) is at the core of the research agenda of
Synthetic Biology.
Lee et al. (2011)
Synthetic biology provides a powerful tool that can be applied to a variety of goals: engineering metabolic
pathways, overproducing a specific protein, examining fundamental biology.
Saeidi et al. (2011)
Synthetic biology aims to engineer genetically modified biological systems that perform novel functions that
do not exist in nature, with reusable, standard interchangeable biological parts. The use of these standard
biological parts enables the exploitation of common engineering principles such as standardization,
decoupling, and abstraction for synthetic biology.
Achbergerová and Nahálka (2011)
"Synthetic biology" is a scientific area that includes two intentions. One area uses unnatural molecules to
reproduce emergent behaviours in natural biology with the goal of creating artificial life. The other area seeks
interchangeable parts from natural biology to assemble systems that function unnaturally [117]. In both cases,
the intentions are focused on a better understanding of life and on the use of knowledge for a commercial
benefit.
Sicilioano et al. (2011)
Synthetic Biology aims at designing and building new biological functions in living organisms. At the same time,
Synthetic Biology approaches can be used to uncover the design principles of natural biological systems
through the rational construction of simplified regulatory networks. Mathematical models of the networks are
then derived from physical considerations and can be used to explain the observed dynamical behaviours.
Sarrion-Perdigones et al. (2011)
Synthetic Biology adapts the general engineering principle of assembling standard components, dating back to
he Industrial Revolution, to biological components. This discipline aims at the design of artificial living forms
displaying new traits not existing in nature [1], [2]. This objective can be pursued following a bottom-up
strategy, by creating new living forms from its basic components; however, a more straightforward option
consists of integrating new genetic circuits within the genome of a current living organism or “chassis”.
Song et al. (2011)

109
At the interface of engineering and biology, a major aim of synthetic biology is to program cells to perform
desirable functions in a predictable manner. These programmed functions could have potential applications in
biomedicine, biofuel, bioremediation, and cellular computation.
Hansen LH et al. (2011)
The term “synthetic biology,” in its present context, covers the creation of specific self-replicating DNA
sequences that encode novel functional biological components, or replicas of existing natural systems, based
on extensive preexisting knowledge about gene conservation, function and synteny.
Kindsmüller K et al. (2011)
Furthermore, synthetic biology enables economic and rapid chemical synthesis of DNA encoding the
immunogens designed in silico, and their efficient assembly with delivery systems to obtain vectored vaccines.
Altogether, synthetic biology can help to develop improved vaccine candidates in considerably less time
compared to conventional approaches.
Misirli et al. (2011)
Synthetic biology involves the design and implementation of genetic circuits to enable organisms to perform
novel, desirable functions for biotechnology applications. Such applications include the production of
medically relevant biomolecules (Anderson et al. 2006; Ro et al. 2006), environmental bioremediation (Sinha
et al. 2010) and biofuel production (Lee et al. 2008).
Liang et al. (2011)
The scope of synthetic biology is as complicated as life itself – encompassing many branches of science, and
across many scales of application. New DNA synthesis and assembly techniques have made routine the
customization of very large DNA molecules. This in turn has allowed the incorporation of multiple genes and
pathways. By coupling these with techniques that allow for the modeling and design of protein functions,
scientists have now gained the tools to create completely novel biological machineries. Even the ultimate
biological machinery – a self-replicating organism – is being pursued at this moment. It is the purpose of this
review to dissect and organize these various components of synthetic biology into a coherent picture. (…) The
field of synthetic biology lies at the interface of many different biological research areas, such as functional
genomics, protein engineering, chemical biology, metabolic engineering, systems biology, and bioinformatics.
Not surprisingly, synthetic biology means different things to different people, even to leading practitioners in
the field.1 To avoid possible confusion for the reader, here we would define it as “deliberate design of
improved or novel biological systems that draws on principles elucidated by biologists, chemists, physicists,
and engineers.”
Kim et al. (2011)

One approach to synthetic biology is to genetically engineer microbes, so that all the desired functions are
carried out by a single strain.
2012
Synthetic Genomics
Montague et al. (2012)
1. Technologies to synthetically assemble chromosome sized fragments of DNA as well as to enable making
thousands of simultaneous changes to existing genomes are now available. These capacities are collectively
110
termed synthetic genomics. The implications of synthetic genomics extend beyond the limited pathway and
gene engineering of the past to include the engineering or whole metabolisms, regulatory networks, and even
ecosystems.
2. Synthetic genomics is defined and distinct from genetic engineering as the engineering and manipulation of
the genetic material of an organism on the scale of the whole genome either in terms of number of base-pairs,
or number of loci engineered. Most synthetic biology efforts might only have the scope of engineering an
individual biosynthetic pathway.
Synthetic Biology
Anderson et al. (2012)
Synthetic biology is a truly interdisciplinary field that engages biologists, mathematicians, physicists and
engineers; its research focus is applied; and it has enormous potential to harness the power of biology to
provide scientific and engineering solutions to a wide range of problems and challenges that plague humanity.
For the purposes of this paper, we define synthetic biology as ‘the endeavour to design new, or modify
existing, organisms to produce biological systems with new or enhanced functionality according to quantifiable
design criteria’, because it explicitly requires that the synthetic system can be evaluated against a quantifiable
design objective as is done in traditional engineering.
Blount et al. (2012)
Synthetic biology aims to use modular, well-characterised biological parts to predictably construct novel
genetic devices and complex cell-based systems following engineering principles.
Callura et al. (2012)
Synthetic biology has a history of providing components for metabolic engineering, such as biosynthetic
pathways and enzyme scaffolds. Adding to this toolbox, the genetic switchboard is a well-defined, biological
module that possesses the flexibility to aid different metabolic engineering strategies.
Cardinale and Arkin (2012)
One of the common goals of synthetic biology is to make the design of new function vastly more efficient, safe,
understandable, and predictable. This field is likely to have a profound impact on chemical, pharmaceutical
and material manufacturing, environmental and agricultural engineering, and health.
Chandran et al. (2012)
From a synthetic biology perspective, we are building novel biochemical systems to emulate useful, well-
known natural biological systems and providing alternatives to enzymes. From an engineering perspective, our
work is a minimalise approach to designing biochemical systems from simple, predictable yet powerful
modules.
A major goal of synthetic biology is the construction of evolving replicating systems.
Chang et al. (2012)
Recently, synthetic biology has been recognized as a powerful approach for the design and construction of
new biological systems.
Chen et al. (2012)
111
Synthetic biology is an emerging field of interdisciplinary research that seeks to transform our ability to probe,
manipulate, and interface with living systems by combining the knowledge and techniques of biology,
chemistry, computer science, and engineering. Its main aim is to increase the ease and efficiency with which
biological systems can be designed, constructed, and characterized.
A central aim of synthetic biology is to increase the ease and efficiency with which biological systems can be
designed, constructed, and characterized. Synthetic biology is transforming biosynthesis capabilities by
providing new tools that support pathway construction and optimization.
Chiarabelli et al. (2012)
Synthetic biology is first represented in terms of two complementary aspects, the bio-engineering one, based
on the genetic manipulation of extant microbial forms in order to obtain forms of life which do not exist in
nature; and the chemical synthetic biology, an approach mostly based on chemical manipulation for the
laboratory synthesis of biological structures that do not exist in nature.
The notion of synthetic biology (SB) is by now well accredited in the experimental life sciences, and is generally
seen as the modern and most ambitious development of bioengineering and biotechnology in general. The
term ambitious is appropriate, as one of the declared aims of SB is the laboratory construction of alternative
forms of life, namely forms of life that do not exist in nature.
Our work on Never Born Biopolymers lays within the framework of the novel and unconventional approach
dubbed ‘‘chemical synthetic biology’’ [8–10], which, as already mentioned, is concerned with the synthesis of
chemical structures such as proteins, nucleic acids, vesicular forms and other which do not exist in nature.
The common notion of synthetic biology refers to new forms of microbial life obtained through genetic
manipulation of the extant life forms – a classic bioengineering approach. The few pages of the present review
make however clear that synthetic biology has an additional dimension, that related to the term ‘‘chemical
synthetic biology’’. Here, the production of biological structures alternative to the natural ones is carried out
by using chemical and biochemical technology: we have seen in this review application of the physico-
chemistry of vesicles, the ribosomal protein synthetic apparatus, peptide catalysis, enzymatic assays, etc.
Danchin A (2012)
The present avatar of «Synthetic Biology» (SB) assumes that we know enough of what life is to allow us to
construct life from scratch, or, at least, to modify existing cells and organisms so that they work as cell
factories. With this view SB puts together two separate entities, a program (the conceptual extension of the
genetic program) and a chassis (the conceptual extension of the living cell).
Firman et al. (2012)
One definition of Synthetic Biology is ‘‘the application of engineering principles to the study of the
fundamental components of biology’’, but there are major problems associated with this basic premise –
biological systems are very different from electronic systems, or chemical systems, and new combinations do
not always behave as expected.
Giessen and Marahiel (2012)
It is in this light that synthetic biology, usually defined as the de novo design of new or the redesign of existing
biological systems, ranging from single enzymes (protein engineering) to whole biosynthetic pathways
(metabolic engineering), offers new approaches and methodologies that may help to tackle this urgent
problem.
Gorochowski et al. (2012)
112
Systems and synthetic biology rely on mathematical modeling and computational simulation to predict the
behavior of biological systems and facilitate the design of novel systems.
Gregorczyk et al. (2012)
While systems biology aims to develop a formal understanding of biological processes via the development of
quantitative mathematical models, synthetic biology aims to use such models to design unique biological
circuits (synthetic networks) in the cell able to perform specific tasks.
Jain KK (2012)
Synthetic biology, application of synthetic chemistry to biology, is a broad term that covers the engineering of
biological systems with structures and functions not found in nature to process information, manipulate
chemicals, produce energy, maintain cell environment and enhance human health. Synthetic biology includes
technologies for DNA synthesis and assembly of fragments of DNA for gene synthesis, sometimes referred to
as synthetic genomics.
Kelle A (2012)
Over recent years the label ‘synthetic biology’ has been attached to a number of diverse research and
development activities, ranging from the development of ‘BioBricks’ to the search for a minimal cell to the
delivery of customized genes by DNA synthesis companies.
Whereas standard biology treats the structure and chemistry of living things as natural phenomena to be
understood and explained, synthetic biology treats biochemical processes, molecules and structures as raw
materials and tools to be used in novel and potentially useful ways, often quite independent of their natural
roles.
Not surprisingly for a scientific discipline in its formative phase, several competing definitions exist for
synthetic biology. One that has received much attention describes synthetic biology as ‘the design and
construction of new biological parts, devices, and systems, and the re-design of existing, natural biological
systems for useful purposes’.
Four different sub-strands of synthetic biology are distinguished here: • Engineering DNA based biological
circuits, by using standardized biological parts; • Identifying the minimal genome; • Constructing protocells, in
other words living cells from base chemicals; and • Creating orthogonal biological systems in the laboratory
through chemical synthetic biology.
Khalil et al. (2012)
Synthetic biology is helping us to understand how organisms behave and develop through the forward
engineering of molecular circuitry with well-understood genetic components.
Kitney and Freemont (2012)
The accepted definition is ‘‘synthetic biology aims to design and engineer biologically based parts, novel
devices and systems – as well as redesigning existing, natural biological systems’’. Synthetic Biology is the
application of systematic design – using engineering principles
In simple terms synthetic biology aims to make the engineering of biological systems easier and more
predictable. It also aims to allow accumulated knowledge on biological systems to be standardised to enable
its utility in the synthetic biology design process.
Lamsen and Atsumi (2012)
113
Synthetic biology provides the ability to piece together biological components from several different origins in
order to redesign a natural or construct a novel pathway that the host uses to synthesize a valuable chemical.
Malinova et al. (2012)
Synthetic biology seems to be about the engineering of biology – about bottom up and top-down approaches,
compromising complexity versus stability of artificial architectures, relevant in biology. Synthetic biology
accounts for heterogeneous approaches towards minimal and even artificial life, the engineering of
biochemical pathways on the organismic level, the modelling of molecular processes and finally, the
combination of synthetic with nature-derived materials and architectural concepts, such as a cellular
membrane. Still, synthetic biology is a discipline, which embraces interdisciplinary attempts in order to have a
profound, scientific base to enable the re-design of nature and to compose architectures and processes with
man-made matter. Generally speaking synthetic biology is concerned with the design and synthesis of
chemical structures such as enzymes, proteins, genetics circuits and cells, which do not exist in nature as such.
One of the novel aims of synthetic biology is the redesign of well-known biological systems. In other words,
the hybrid discipline of synthetic biology aims at understanding, re-composition as well as constructing
architectures of life.
Nguyen et al. (2012)
Synthetic biology, which aims to redesign biological systems for novel purposes and applications, enables the
transfer of a secondary metabolite biosynthetic pathway from its organism of origin into more amenable
heterologous hosts, where the compounds of interest or their precursors can be produced with desired titers.
Oldham et al. (2012)
Synthetic biology is a self-defining community of researchers from a variety of disciplines who are articulating
themselves around the term synthetic biology and related terms such as synthetic genomics.
For biologists, synthetic biology provides a means to understand natural biological systems. For chemists it is
an extension of synthetic chemistry leading to the development of novel molecules and advancing research on
the origin of life. For ‘re-writers’ synthetic biology offers the promise of optimising biological systems including
‘refactoring’ existing genomes. Finally, for engineers biology is classified as a ‘technology’ that requires ‘‘the
development of foundational technologies that make the design and construction of engineered biological
systems easier’’. Synthetic biology is as an ‘‘inclusive theoretical and technical framework in which to approach
biological systems with the conceptual tools and language imported from electrical circuitry and mechanical
manufacturing’’ to pursue ‘‘the rational combination of standardised biological parts that are decoupled from
their natural context’’.
Osbourn et al. (2012)
Synthetic biology has been variously defined as: Synthetic biology aims to use modular, well-characterised
biological parts to predictably construct novel genetic devices and complex cell-based systems following
engineering principles. Synthetic biology is the design and engineering of biologically based parts, novel
devices and systems as well as the redesign of existing, natural biological systems. It has the potential to
deliver important new applications and improve existing industrial processes – resulting in economic growth
and job creation.
Synthetic biology is the engineering of biology: the synthesis of complex, biologically based (or inspired)
systems, which display functions that do not exist in nature. This engineering perspective may be applied at all
levels of the hierarchy of biological structures – from individual molecules to whole cells, tissues and
114
organisms. In essence, synthetic biology will enable the design of ‘biological systems’ in a rational and
systematic way.
There is no agreed definition of synthetic biology, but it is best understood as the rational design of biological
systems and living organisms using engineering principles. The concept of ‘synthetic biology space’ (Channon
et al., 2008) provides a useful tool that enables the sometimes seemingly disparate components, hierarchies
and approaches encompassed by synthetic biology to be placed into a common framework.
Peccoud and Isalan (2012)
Synthetic biology is an emerging transdisciplinary field at the intersection between many engineering and
scientific disciplines such as biology, chemical engineering, chemistry, electrical engineering, or computer
science.
Ravasi et al. (2012)
Synthetic biology is an emerging discipline that aims to create novel organisms containing designed genetic
circuits. These circuits are built from standard biological parts, known as BioBrick™s, that in most of the cases
are provided by nature.
Reiss T (2012)
Since then the idea of synthetic biology has evolved mainly as an approach of analysing, understanding, and
improving biological processes for the production of desirable goods and functions.
What seems to make synthetic biology different from other current lines of biological research is the rigorous
application of engineering principles (standardization, abstraction and decoupling) to biological research,
which indeed offers a new way of doing research in life sciences.
Rodrigo et al. (2012)
One of the most challenging aims of synthetic biology is the de novo engineering of regulatory systems with
desired behavior by taking advantage of quantitative models describing molecular interactions able to predict
of the behavior of the systems.
Roukos DH (2012)
Synthetic biology investigates the systematic construction of biological systems with cells being built module
by module based on a bottom-up engineering strategy.
Voigt CA (2012)
Synthetic biology aims to improve the process of genetic engineering. It looks to a future where the design of
genetic systems and the idiosyncrasies of DNA are decoupled, and one can compose living systems by mixing-
and-matching genetic parts. At its core, this will require a multidisciplinary approach and significant
communities have sprouted in nearly all engineering disciplines, including biological, chemical, and electrical
engineering as well as fields in basic science such as chemistry, biology, mathematics, and biophysics. The
objective of this journal is to provide a home for the research that, while spread across these fields, shares a
common goal.
Wang et al. (2012)
115
As an emerging discipline that tackles biotechnology from a rational-design approach, synthetic biology aims
to redesign existing biological systems or create artificial life.
2013
Synthetic Genomics
König et al. (2013)
Synthetic genomics, on the other hand [as compared to synthetic biology, expl. note], encompasses
technologies for the generation of chemically-synthesized whole genomes or larger parts of genomes, allowing
to simultaneously engineer a myriad of changes to the genetic material of organisms.
Synthetic Biology
König et al. (2013)
Synthetic biology seeks to model and construct biological components, functions and organisms that do not
exist in nature or to redesign existing biological systems to perform new functions.
Kondo et al. (2013)
Synthetic bioengineering is a strategy for developing useful microbial strains with innovative biological
functions. Novel functions are designed and synthesized in host microbes with the aid of advanced
technologies for computer simulations of cellular processes and the system-wide manipulation of host
genomes.
Murtas (2013)
Synthetic biology approaches are proposing model systems and providing experimental evidences that life can
arise as spontaneous chemical self-assembly process where the ability to reproduce itself is an essential
feature of the living system.
Sagt (2013)
Industrial systems metabolic engineering can be defined as the combined use of genome-wide genomics,
transcriptomics, proteomics, and metabolomics to modify strains or processes.
Ausländer and Fussenegger (2013)
Synthetic biology aims to standardize and expand the natural toolbox of biological building blocks to engineer
novel synthetic networks in living systems.
Esvelt and Wang (2013)
Synthetic biology aims to reverse-engineer naturally evolved systems and to build new systems.
Haslam et al. (2013)
The emerging science of synthetic biology […] seeks to build a bespoke system by re-designing metabolic
pathways from scratch to create entirely new biosynthetic pathways de novo within cells, thereby enabling
production of valuable molecules.
Keret (2013)
116
Synthetic biology […] focuses on the engineering of genetic molecular machines with a specific predefined
function. Plainly put, the newly engineered organism functions as a machine. It can process information,
manufacture, heal and even diagnose. We just have to engineer it to do so.
Lim et al. (2013)
In this sense, a synthetic biology approach is in many ways a philosophical extension of the much older
biochemical reconstitution approach - _ENREF_6the goal is to minimize and simplify the system to
systematically explore the key requirements for function.
Mampel et al. (2013)
Synthetic biologists strive to build biological systems based solely on the essential parts that constitute a living
system
117
www.bmg.gv.at

Biologycal

Hochgeladen von

Dokumentinformationen

Originaltitel

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

Biologycal

Hochgeladen von

Copyright:

Verfügbare Formate

Synthetic Biology

Für den Inhalt verantwortlich:

Projektleitung und interne Projektkoordination:

Autorinnen und Autoren (in alphabetischer Reihenfolge):

Zitiervorschlag/Please cite this report as follows:

9 List of Figures ........................................................................................................................................... 80

Background and aims

1.1.1 The scientific landscape of synthetic biology

Figure 1: Trans-/interdisciplinarity of synthetic biology; from Polizzi (2013)

2 Definition and delimitation of synthetic biology

 Model-inspired research following strict engineering principles applied to biotechnology

There is no official or formal definition of “synthetic biology” or “synthetic genomics”.

2.2.1 Systems biology

2.2.2 Metabolic engineering

2.2.3 Synthetic metabolic pathways

2.2.4 Is it synthetic biology or still conventional biotechnology?

2.3 Some limits to “bio-part engineering”

3 State of the Art

3.1.1 Top-down or bottom-up

Chassis and minimal genomes

3.1.3 Platform cell factories

3.1.4 Cell-free synthetic biology

3.2 Construction of a novel cell

3.2.1 Minimal genomes – top-down approach

Which are the essential genes?

- Fast growing in minimal media with glucose

Bacteria with small genome sizes (Moya et al. 2009):

3.2.2 De novo construction of a cell – bottom-up approach

Genes to pathways (linking genes to construct pathways and devices)

3.2.3 Modification on other level than DNA

3.3 Building biological systems from parts

3.3.1 Regulation of gene expression: parts and devices

3.3.2 Genetic devices

Figure 5 and 6 show several types of genetic devices.

Transcriptional control devices

Translational control devices

Post-translational control devices

Applications of regulatory devices

Year Function Reference

3.3.3 Design and optimisation of synthetic biological systems

Characterisation and “tuning” of parts

Modularisation of genetic systems (MMME)

Simultaneous modification and combinatorial screening of multiple genes (MAGE)

Metabolic flux analysis

3.3.4 Standardisation of genetic parts and modules

BioBricks™: The basic building blocks for synthetic biology

The BioBricks™ inventory

A basic part is a functional unit of DNA which cannot be subdivided

A composite part is a functional unit of DNA which consists of two

A device is a variant of a composite part which is capable to

The BioBricks™ standard

BioBrick™ parts Description

4 Applications of synthetic biology

4.1 Synthetic biology in microorganisms

4.2 Synthetic biology in other species

4.3 Synthetic biology in plants

4.3.1 Assembly of plant pathways in heterologous hosts

Advanced applications of microorganisms in the biofuel sector

Certain microorganisms have evolved to be proficient in converting lignocellulosic material to ethanol,

4.3.2 Review of existing applications in plant-like systems and higher plants

Algae for the production of desired compounds

Biofuel production from biomass

4.3.3 Emerging applications