Sie sind auf Seite 1von 13
<a href=Patogénesis Microbiana 105 (2017) 153 mi 165 Patogénesis Microbiana 105 (2017) 153 mi 165 Patogénesis Microbiana 105 (2017) 153 mi 165 listas dede contenidos ofrecidos enen Science D i r e c t listas contenidos ofrecidos Science D i r e c t Patogénesis microbiana revista Página dede inicio: www.elsevie r .com revista Página inicio: www.elsevie r .com // localizar localizar // micpath micpath La aparición de resistencia a múltiples drogas entre las bacterias del suelo que exponen a los insecticidas Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy ununununununununununununun ,,,,,,,,,,,,, Murugan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Athiappan ununununununununununununun ,,,,,,,,,,,,, ************* ,,,,,,,,,,,,, Natarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Devarajan Natarajan Devarajan segundo Natarajan Devarajan segundo segundo segundo segundo segundo segundo segundo segundo segundo segundo segundo segundo ,,,,,,,,,,,,, Javid Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. A. Parray Parray dododododododododododododo unun Departamento Departamento dede Microbiología Microbiología dede lala Universidad Universidad dede Periyar, Salem, Tamil Nadu, India Periyar, Salem, Tamil Nadu, India segundo segundo Departamento Departamento dede Biotecnología Biotecnología dede lala Universidad Universidad dede Periyar, Salem, Tamil Nadu, India Periyar, Salem, Tamil Nadu, India dodo Centro Centro dede Investigación para el Desarrollo, Universidad Investigación para el Desarrollo, Universidad dede Cachemira, Cachemira, JJ && K, India K, India información del artículo Articulo de historia: Recibido 31 de enero de 2.017 Recibido en forma 3 revisión febrero de 2.017 Aceptada 7 de febrero de 2017 Disponible en Internet el 10 de febrero de 2017 palabras clave: Las bacterias del suelo insecticidas Aparición de resistencia a múltiples fármacos resistencia cruzada abstracto Impactos dedede lalala exposición Impactos Impactos exposición aaa los pesticidas enenen el microbiana del suelo Florida Ora yyy resistencia cruzada aaa los antibióticos nonono han sido bien exposición los pesticidas los pesticidas el microbiana del suelo Florida Ora el microbiana del suelo Florida Ora resistencia cruzada resistencia cruzada los antibióticos los antibióticos han sido bien han sido bien documentados. Desarrollo de resistencia a los antibióticos es un problema común entre las bacterias del suelo que se está exponiendo a los plaguicidas de forma continua a una concentración sub-letal. El presente estudio se centró para evaluar la correlación entre la exposición a los pesticidas yyy lalala evolución pesticidas pesticidas evolución dedede lalala resistencia evolución resistencia aaa múltiples fármacos entre los aislados recogidos dedede suciedad aplicada con insecticidas. Veinte resistencia múltiples fármacos entre los aislados recogidos múltiples fármacos entre los aislados recogidos suciedad aplicada con insecticidas. Veinte suciedad aplicada con insecticidas. Veinte fififi veveve insecticida (monocrotofos) bacterias degradantes fueron aislados dedede suelo agrícola contaminada. Los aislados bacterianos Bacilo sps, insecticida (monocrotofos) bacterias degradantes fueron aislados insecticida (monocrotofos) bacterias degradantes fueron aislados suelo agrícola contaminada. Los aislados bacterianos Bacilo sps, suelo agrícola contaminada. Los aislados bacterianos Bacilo sps, Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus fifififififi UDA UDA yyyyyy bacilo turingiensico sesesesesese encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, UDA UDA UDA UDA bacilo turingiensico bacilo turingiensico bacilo turingiensico bacilo turingiensico bacilo turingiensico encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, ampicilina, cefotaxima, estreptomicina yy tetraciclina usado. Participación ampicilina, cefotaxima, estreptomicina tetraciclina usado. Participación dede plásmido plásmido enen drogas, así como resistentes aa los insecticidas fue con fifi drogas, así como resistentes los insecticidas fue con rma través rma través dedededededededede plásmido rma través rma través rma través rma través rma través rma través rma través plásmido plásmido dedededededededede curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus plásmido plásmido plásmido plásmido plásmido plásmido curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus ((((((((( MK-11), Bacilo fififififififififi UDA MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo UDA UDA UDA UDA UDA UDA UDA UDA ((((((((( MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) yyy Bacilo turingiensico ((( MK-24) perdió sususu resistente contra los insecticidas yyy antibióticos una vez después dedede lalala eliminación del plásmido Bacilo turingiensico Bacilo turingiensico MK-24) perdió MK-24) perdió resistente contra los insecticidas resistente contra los insecticidas antibióticos una vez después antibióticos una vez después eliminación del plásmido eliminación del plásmido mediante la exposición a 2% de sulfato dodecil de sodio. El plásmido se transforma de nuevo a las bacterias que producen derivados similares cuando se cultivan en medio de sal mínima (pH 7,0) suplementado con 0,4% de insecticida. modelado por homología se utiliza para demostrar que hidrolasa organofosforados y capaz de metabolizar todos los antibióticos mostró una interacción positiva con alta puntuación de acoplamiento. El presente estudio reveló que la persistencia de los insecticidas en el suelo agrícola puede conducir a aumentar el desarrollo de resistencia a múltiples fármacos entre las bacterias del suelo. ©© 2017 Elsevier Ltd. Todos los derechos reservados. 2017 Elsevier Ltd. Todos los derechos reservados. 1. Introducción El uso continuo de plaguicidas ha sistemas de agua del suelo y subterráneas muy contaminada. Estos son lo suficientemente tóxico para matar los organismos objetivo, pero al mismo tiempo afectan aaa los organismos nonono objetivo [82] afectan afectan los organismos los organismos objetivo [82] objetivo [82] ... Por desgracia, los ecosistemas acuáticos yyy terrestres están Por desgracia, los ecosistemas acuáticos Por desgracia, los ecosistemas acuáticos terrestres están terrestres están contaminados con pesticidas debido severamente para lixiviar el formulario dedede lalala agricultura contaminados con pesticidas debido severamente para lixiviar el formulario contaminados con pesticidas debido severamente para lixiviar el formulario agricultura agricultura fififi campos campos campos [59] [59] .. contaminación dede plaguicidas resultantes dede lala introducción directa oo indirecta puede causar contaminación plaguicidas resultantes introducción directa indirecta puede causar cambios enenen todos los niveles cambios cambios todos los niveles dedede organización biológica [38] todos los niveles organización biológica [38] organización biológica [38] ... Diferentes pesticidas como el glifosato, Diferentes pesticidas como el glifosato, Diferentes pesticidas como el glifosato, clorpirifós, paratión, metil paratión, diazinon, cumafos, monocrotofos, fenamifos y forato se están indígena Florida Ora yyy las poblaciones que son capaces indígena Florida Ora indígena Florida Ora las poblaciones que son capaces dedede metabolizar estas sustancias químicas. las poblaciones que son capaces metabolizar estas sustancias químicas. metabolizar estas sustancias químicas. Por lo tanto, los genes metabólicos evolucionan de manera capaz de metabolizar los plaguicidas y conseguir enriquecido debido aaa lalala persistencia conseguir enriquecido debido conseguir enriquecido debido persistencia persistencia dedede los plaguicidas [18,39] los plaguicidas [18,39] los plaguicidas [18,39] ... Tal alteración dedede las Tal alteración Tal alteración las las comunidades nativas finalmente conduce a alterar el ecosistema del suelo y la pérdida de fertilidad del suelo [66,15] .. [66,15] Diferentes microorganismos han sido conocidos para transformar plaguicidas para sus necesidades dede energía. Las bacterias del suelo como Pseudomonas, Bacillus, Arthrobacter, necesidades energía. Las bacterias del suelo como Pseudomonas, Bacillus, Arthrobacter, Pseudomonas mendocina, Bacillus megaterium, Arthrobacter atrocyaneus, Pseudomonas aeruginosa utilizando enenen lalala India desde 1952 [62] ... utilizando utilizando India desde 1952 [62] India desde 1952 [62] F10B yyy ichiganense Clavibacterm SBL11 F10B F10B ichiganense Clavibacterm SBL11 son comunes entre los suelos contaminados con ichiganense Clavibacterm SBL11 son comunes entre los suelos contaminados con son comunes entre los suelos contaminados con monocrotofos [10,53,54] monocrotofos [10,53,54] monocrotofos [10,53,54] Los microorganismos del suelo que sesese están continuamente expuestos Los microorganismos del suelo que Los microorganismos del suelo que están continuamente expuestos aaa están continuamente expuestos SeSeSe espera que los pesticidas enenen el Florida influir espera que los pesticidas espera que los pesticidas el Florida influir el Florida influir enenen lalala vía metabólica dedede vía metabólica vía metabólica * Autor correspondiente. Dirección dedede correo electr ónico: amuruganpu@gmail.com (M. Athia ppan). Dirección Dirección correo electr ónico: amuruganpu@gmail.com (M. Athia ppan). correo electr ónico: amuruganpu@gmail.com (M. Athia ppan). http://dx.doi.org/10.1016/j.micpath.2017.02.011 0882-4010 /// ©©© 2017 Elsevier Ltd. Todos los derechos reservados. 0882-4010 0882-4010 2017 2017 Elsevier Ltd. Todos los derechos reservados. Elsevier Ltd. Todos los derechos reservados. los pesticidas desarrollan resistencia al fármaco lentamente. Los pesticidas pueden inducir una resistencia cruzada cuando no destinados exposición. relación común entre la entrada y la expansión de pesticidas resistencia sigue siendo materia de debate. El desarrollo de antibióticos y la resistencia a los pesticidas a menudo se presenta como ejemplo una moderna de la evolución por mutaciones y como una clara evidencia de " id="pdf-obj-0-9" src="pdf-obj-0-9.jpg">

listas dede contenidos ofrecidos enen ScienceDirect

listas

contenidos ofrecidos

ScienceDirect

Patogénesis microbiana

revista Página dede inicio: www.elsevier .com

revista Página

inicio: www.elsevier .com // localizar

<a href=Patogénesis Microbiana 105 (2017) 153 mi 165 Patogénesis Microbiana 105 (2017) 153 mi 165 Patogénesis Microbiana 105 (2017) 153 mi 165 listas dede contenidos ofrecidos enen Science D i r e c t listas contenidos ofrecidos Science D i r e c t Patogénesis microbiana revista Página dede inicio: www.elsevie r .com revista Página inicio: www.elsevie r .com // localizar localizar // micpath micpath La aparición de resistencia a múltiples drogas entre las bacterias del suelo que exponen a los insecticidas Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy ununununununununununununun ,,,,,,,,,,,,, Murugan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Athiappan ununununununununununununun ,,,,,,,,,,,,, ************* ,,,,,,,,,,,,, Natarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Devarajan Natarajan Devarajan segundo Natarajan Devarajan segundo segundo segundo segundo segundo segundo segundo segundo segundo segundo segundo segundo ,,,,,,,,,,,,, Javid Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. A. Parray Parray dododododododododododododo unun Departamento Departamento dede Microbiología Microbiología dede lala Universidad Universidad dede Periyar, Salem, Tamil Nadu, India Periyar, Salem, Tamil Nadu, India segundo segundo Departamento Departamento dede Biotecnología Biotecnología dede lala Universidad Universidad dede Periyar, Salem, Tamil Nadu, India Periyar, Salem, Tamil Nadu, India dodo Centro Centro dede Investigación para el Desarrollo, Universidad Investigación para el Desarrollo, Universidad dede Cachemira, Cachemira, JJ && K, India K, India información del artículo Articulo de historia: Recibido 31 de enero de 2.017 Recibido en forma 3 revisión febrero de 2.017 Aceptada 7 de febrero de 2017 Disponible en Internet el 10 de febrero de 2017 palabras clave: Las bacterias del suelo insecticidas Aparición de resistencia a múltiples fármacos resistencia cruzada abstracto Impactos dedede lalala exposición Impactos Impactos exposición aaa los pesticidas enenen el microbiana del suelo Florida Ora yyy resistencia cruzada aaa los antibióticos nonono han sido bien exposición los pesticidas los pesticidas el microbiana del suelo Florida Ora el microbiana del suelo Florida Ora resistencia cruzada resistencia cruzada los antibióticos los antibióticos han sido bien han sido bien documentados. Desarrollo de resistencia a los antibióticos es un problema común entre las bacterias del suelo que se está exponiendo a los plaguicidas de forma continua a una concentración sub-letal. El presente estudio se centró para evaluar la correlación entre la exposición a los pesticidas yyy lalala evolución pesticidas pesticidas evolución dedede lalala resistencia evolución resistencia aaa múltiples fármacos entre los aislados recogidos dedede suciedad aplicada con insecticidas. Veinte resistencia múltiples fármacos entre los aislados recogidos múltiples fármacos entre los aislados recogidos suciedad aplicada con insecticidas. Veinte suciedad aplicada con insecticidas. Veinte fififi veveve insecticida (monocrotofos) bacterias degradantes fueron aislados dedede suelo agrícola contaminada. Los aislados bacterianos Bacilo sps, insecticida (monocrotofos) bacterias degradantes fueron aislados insecticida (monocrotofos) bacterias degradantes fueron aislados suelo agrícola contaminada. Los aislados bacterianos Bacilo sps, suelo agrícola contaminada. Los aislados bacterianos Bacilo sps, Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus fifififififi UDA UDA yyyyyy bacilo turingiensico sesesesesese encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, UDA UDA UDA UDA bacilo turingiensico bacilo turingiensico bacilo turingiensico bacilo turingiensico bacilo turingiensico encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, ampicilina, cefotaxima, estreptomicina yy tetraciclina usado. Participación ampicilina, cefotaxima, estreptomicina tetraciclina usado. Participación dede plásmido plásmido enen drogas, así como resistentes aa los insecticidas fue con fifi drogas, así como resistentes los insecticidas fue con rma través rma través dedededededededede plásmido rma través rma través rma través rma través rma través rma través rma través plásmido plásmido dedededededededede curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus plásmido plásmido plásmido plásmido plásmido plásmido curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus ((((((((( MK-11), Bacilo fififififififififi UDA MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo UDA UDA UDA UDA UDA UDA UDA UDA ((((((((( MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) yyy Bacilo turingiensico ((( MK-24) perdió sususu resistente contra los insecticidas yyy antibióticos una vez después dedede lalala eliminación del plásmido Bacilo turingiensico Bacilo turingiensico MK-24) perdió MK-24) perdió resistente contra los insecticidas resistente contra los insecticidas antibióticos una vez después antibióticos una vez después eliminación del plásmido eliminación del plásmido mediante la exposición a 2% de sulfato dodecil de sodio. El plásmido se transforma de nuevo a las bacterias que producen derivados similares cuando se cultivan en medio de sal mínima (pH 7,0) suplementado con 0,4% de insecticida. modelado por homología se utiliza para demostrar que hidrolasa organofosforados y capaz de metabolizar todos los antibióticos mostró una interacción positiva con alta puntuación de acoplamiento. El presente estudio reveló que la persistencia de los insecticidas en el suelo agrícola puede conducir a aumentar el desarrollo de resistencia a múltiples fármacos entre las bacterias del suelo. ©© 2017 Elsevier Ltd. Todos los derechos reservados. 2017 Elsevier Ltd. Todos los derechos reservados. 1. Introducción El uso continuo de plaguicidas ha sistemas de agua del suelo y subterráneas muy contaminada. Estos son lo suficientemente tóxico para matar los organismos objetivo, pero al mismo tiempo afectan aaa los organismos nonono objetivo [82] afectan afectan los organismos los organismos objetivo [82] objetivo [82] ... Por desgracia, los ecosistemas acuáticos yyy terrestres están Por desgracia, los ecosistemas acuáticos Por desgracia, los ecosistemas acuáticos terrestres están terrestres están contaminados con pesticidas debido severamente para lixiviar el formulario dedede lalala agricultura contaminados con pesticidas debido severamente para lixiviar el formulario contaminados con pesticidas debido severamente para lixiviar el formulario agricultura agricultura fififi campos campos campos [59] [59] .. contaminación dede plaguicidas resultantes dede lala introducción directa oo indirecta puede causar contaminación plaguicidas resultantes introducción directa indirecta puede causar cambios enenen todos los niveles cambios cambios todos los niveles dedede organización biológica [38] todos los niveles organización biológica [38] organización biológica [38] ... Diferentes pesticidas como el glifosato, Diferentes pesticidas como el glifosato, Diferentes pesticidas como el glifosato, clorpirifós, paratión, metil paratión, diazinon, cumafos, monocrotofos, fenamifos y forato se están indígena Florida Ora yyy las poblaciones que son capaces indígena Florida Ora indígena Florida Ora las poblaciones que son capaces dedede metabolizar estas sustancias químicas. las poblaciones que son capaces metabolizar estas sustancias químicas. metabolizar estas sustancias químicas. Por lo tanto, los genes metabólicos evolucionan de manera capaz de metabolizar los plaguicidas y conseguir enriquecido debido aaa lalala persistencia conseguir enriquecido debido conseguir enriquecido debido persistencia persistencia dedede los plaguicidas [18,39] los plaguicidas [18,39] los plaguicidas [18,39] ... Tal alteración dedede las Tal alteración Tal alteración las las comunidades nativas finalmente conduce a alterar el ecosistema del suelo y la pérdida de fertilidad del suelo [66,15] .. [66,15] Diferentes microorganismos han sido conocidos para transformar plaguicidas para sus necesidades dede energía. Las bacterias del suelo como Pseudomonas, Bacillus, Arthrobacter, necesidades energía. Las bacterias del suelo como Pseudomonas, Bacillus, Arthrobacter, Pseudomonas mendocina, Bacillus megaterium, Arthrobacter atrocyaneus, Pseudomonas aeruginosa utilizando enenen lalala India desde 1952 [62] ... utilizando utilizando India desde 1952 [62] India desde 1952 [62] F10B yyy ichiganense Clavibacterm SBL11 F10B F10B ichiganense Clavibacterm SBL11 son comunes entre los suelos contaminados con ichiganense Clavibacterm SBL11 son comunes entre los suelos contaminados con son comunes entre los suelos contaminados con monocrotofos [10,53,54] monocrotofos [10,53,54] monocrotofos [10,53,54] Los microorganismos del suelo que sesese están continuamente expuestos Los microorganismos del suelo que Los microorganismos del suelo que están continuamente expuestos aaa están continuamente expuestos SeSeSe espera que los pesticidas enenen el Florida influir espera que los pesticidas espera que los pesticidas el Florida influir el Florida influir enenen lalala vía metabólica dedede vía metabólica vía metabólica * Autor correspondiente. Dirección dedede correo electr ónico: amuruganpu@gmail.com (M. Athia ppan). Dirección Dirección correo electr ónico: amuruganpu@gmail.com (M. Athia ppan). correo electr ónico: amuruganpu@gmail.com (M. Athia ppan). http://dx.doi.org/10.1016/j.micpath.2017.02.011 0882-4010 /// ©©© 2017 Elsevier Ltd. Todos los derechos reservados. 0882-4010 0882-4010 2017 2017 Elsevier Ltd. Todos los derechos reservados. Elsevier Ltd. Todos los derechos reservados. los pesticidas desarrollan resistencia al fármaco lentamente. Los pesticidas pueden inducir una resistencia cruzada cuando no destinados exposición. relación común entre la entrada y la expansión de pesticidas resistencia sigue siendo materia de debate. El desarrollo de antibióticos y la resistencia a los pesticidas a menudo se presenta como ejemplo una moderna de la evolución por mutaciones y como una clara evidencia de " id="pdf-obj-0-51" src="pdf-obj-0-51.jpg">

La aparición de resistencia a múltiples drogas entre las bacterias del suelo que exponen a los insecticidas

Kirubakaran Rangasamy

Kirubakaran Rangasamy

Kirubakaran Rangasamy

Kirubakaran Rangasamy

Kirubakaran Rangasamy

Kirubakaran Rangasamy

Kirubakaran Rangasamy

Kirubakaran Rangasamy

Kirubakaran Rangasamy

Kirubakaran Rangasamy

Kirubakaran Rangasamy

Kirubakaran Rangasamy

Kirubakaran

Rangasamy ununununununununununununun ,,,,,,,,,,,,, Murugan

Murugan Athiappan

Murugan Athiappan

Murugan Athiappan

Murugan Athiappan

Murugan Athiappan

Murugan Athiappan

Murugan Athiappan

Murugan Athiappan

Murugan Athiappan

Murugan Athiappan

Murugan Athiappan

Murugan Athiappan

Athiappan ununununununununununununun ,,,,,,,,,,,,, ************* ,,,,,,,,,,,,, Natarajan

Natarajan Devarajan

Natarajan Devarajan

Natarajan Devarajan

Natarajan Devarajan

Natarajan Devarajan

Natarajan Devarajan

Natarajan Devarajan

Natarajan Devarajan

Natarajan Devarajan

Natarajan Devarajan

Devarajan

Natarajan Devarajan segundo

Natarajan Devarajan

segundo

segundo

segundo

segundo

segundo

segundo

segundo

segundo

segundo

segundo

segundo

segundo ,,,,,,,,,,,,, Javid

Javid A. Parray

Javid A. Parray

Javid A. Parray

Javid A. Parray

Javid A. Parray

Javid A. Parray

Javid A. Parray

Javid A. Parray

Javid A. Parray

Javid A. Parray

Javid A. Parray

Javid A.

A. Parray

Parray dododododododododododododo

unun Departamento Departamento dede Microbiología Microbiología dede lala Universidad Universidad dede Periyar, Salem, Tamil Nadu, India
unun Departamento
Departamento dede Microbiología
Microbiología dede lala Universidad
Universidad dede Periyar, Salem, Tamil Nadu, India
Periyar, Salem, Tamil Nadu, India
segundo
segundo Departamento
Departamento dede Biotecnología
Biotecnología dede lala Universidad
Universidad dede Periyar, Salem, Tamil Nadu, India
Periyar, Salem, Tamil Nadu, India
dodo Centro
Centro dede Investigación para el Desarrollo, Universidad
Investigación para el Desarrollo, Universidad dede Cachemira,
Cachemira, JJ && K, India
K, India
<a href=Patogénesis Microbiana 105 (2017) 153 mi 165 Patogénesis Microbiana 105 (2017) 153 mi 165 Patogénesis Microbiana 105 (2017) 153 mi 165 listas dede contenidos ofrecidos enen Science D i r e c t listas contenidos ofrecidos Science D i r e c t Patogénesis microbiana revista Página dede inicio: www.elsevie r .com revista Página inicio: www.elsevie r .com // localizar localizar // micpath micpath La aparición de resistencia a múltiples drogas entre las bacterias del suelo que exponen a los insecticidas Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy Kirubakaran Rangasamy ununununununununununununun ,,,,,,,,,,,,, Murugan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Murugan Athiappan Athiappan ununununununununununununun ,,,,,,,,,,,,, ************* ,,,,,,,,,,,,, Natarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Natarajan Devarajan Devarajan Natarajan Devarajan segundo Natarajan Devarajan segundo segundo segundo segundo segundo segundo segundo segundo segundo segundo segundo segundo ,,,,,,,,,,,,, Javid Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. Parray Javid A. A. Parray Parray dododododododododododododo unun Departamento Departamento dede Microbiología Microbiología dede lala Universidad Universidad dede Periyar, Salem, Tamil Nadu, India Periyar, Salem, Tamil Nadu, India segundo segundo Departamento Departamento dede Biotecnología Biotecnología dede lala Universidad Universidad dede Periyar, Salem, Tamil Nadu, India Periyar, Salem, Tamil Nadu, India dodo Centro Centro dede Investigación para el Desarrollo, Universidad Investigación para el Desarrollo, Universidad dede Cachemira, Cachemira, JJ && K, India K, India información del artículo Articulo de historia: Recibido 31 de enero de 2.017 Recibido en forma 3 revisión febrero de 2.017 Aceptada 7 de febrero de 2017 Disponible en Internet el 10 de febrero de 2017 palabras clave: Las bacterias del suelo insecticidas Aparición de resistencia a múltiples fármacos resistencia cruzada abstracto Impactos dedede lalala exposición Impactos Impactos exposición aaa los pesticidas enenen el microbiana del suelo Florida Ora yyy resistencia cruzada aaa los antibióticos nonono han sido bien exposición los pesticidas los pesticidas el microbiana del suelo Florida Ora el microbiana del suelo Florida Ora resistencia cruzada resistencia cruzada los antibióticos los antibióticos han sido bien han sido bien documentados. Desarrollo de resistencia a los antibióticos es un problema común entre las bacterias del suelo que se está exponiendo a los plaguicidas de forma continua a una concentración sub-letal. El presente estudio se centró para evaluar la correlación entre la exposición a los pesticidas yyy lalala evolución pesticidas pesticidas evolución dedede lalala resistencia evolución resistencia aaa múltiples fármacos entre los aislados recogidos dedede suciedad aplicada con insecticidas. Veinte resistencia múltiples fármacos entre los aislados recogidos múltiples fármacos entre los aislados recogidos suciedad aplicada con insecticidas. Veinte suciedad aplicada con insecticidas. Veinte fififi veveve insecticida (monocrotofos) bacterias degradantes fueron aislados dedede suelo agrícola contaminada. Los aislados bacterianos Bacilo sps, insecticida (monocrotofos) bacterias degradantes fueron aislados insecticida (monocrotofos) bacterias degradantes fueron aislados suelo agrícola contaminada. Los aislados bacterianos Bacilo sps, suelo agrícola contaminada. Los aislados bacterianos Bacilo sps, Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus fifififififi UDA UDA yyyyyy bacilo turingiensico sesesesesese encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, UDA UDA UDA UDA bacilo turingiensico bacilo turingiensico bacilo turingiensico bacilo turingiensico bacilo turingiensico encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos, ampicilina, cefotaxima, estreptomicina yy tetraciclina usado. Participación ampicilina, cefotaxima, estreptomicina tetraciclina usado. Participación dede plásmido plásmido enen drogas, así como resistentes aa los insecticidas fue con fifi drogas, así como resistentes los insecticidas fue con rma través rma través dedededededededede plásmido rma través rma través rma través rma través rma través rma través rma través plásmido plásmido dedededededededede curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus plásmido plásmido plásmido plásmido plásmido plásmido curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus ((((((((( MK-11), Bacilo fififififififififi UDA MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo MK-11), Bacilo UDA UDA UDA UDA UDA UDA UDA UDA ((((((((( MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) MK-13) yyy Bacilo turingiensico ((( MK-24) perdió sususu resistente contra los insecticidas yyy antibióticos una vez después dedede lalala eliminación del plásmido Bacilo turingiensico Bacilo turingiensico MK-24) perdió MK-24) perdió resistente contra los insecticidas resistente contra los insecticidas antibióticos una vez después antibióticos una vez después eliminación del plásmido eliminación del plásmido mediante la exposición a 2% de sulfato dodecil de sodio. El plásmido se transforma de nuevo a las bacterias que producen derivados similares cuando se cultivan en medio de sal mínima (pH 7,0) suplementado con 0,4% de insecticida. modelado por homología se utiliza para demostrar que hidrolasa organofosforados y capaz de metabolizar todos los antibióticos mostró una interacción positiva con alta puntuación de acoplamiento. El presente estudio reveló que la persistencia de los insecticidas en el suelo agrícola puede conducir a aumentar el desarrollo de resistencia a múltiples fármacos entre las bacterias del suelo. ©© 2017 Elsevier Ltd. Todos los derechos reservados. 2017 Elsevier Ltd. Todos los derechos reservados. 1. Introducción El uso continuo de plaguicidas ha sistemas de agua del suelo y subterráneas muy contaminada. Estos son lo suficientemente tóxico para matar los organismos objetivo, pero al mismo tiempo afectan aaa los organismos nonono objetivo [82] afectan afectan los organismos los organismos objetivo [82] objetivo [82] ... Por desgracia, los ecosistemas acuáticos yyy terrestres están Por desgracia, los ecosistemas acuáticos Por desgracia, los ecosistemas acuáticos terrestres están terrestres están contaminados con pesticidas debido severamente para lixiviar el formulario dedede lalala agricultura contaminados con pesticidas debido severamente para lixiviar el formulario contaminados con pesticidas debido severamente para lixiviar el formulario agricultura agricultura fififi campos campos campos [59] [59] .. contaminación dede plaguicidas resultantes dede lala introducción directa oo indirecta puede causar contaminación plaguicidas resultantes introducción directa indirecta puede causar cambios enenen todos los niveles cambios cambios todos los niveles dedede organización biológica [38] todos los niveles organización biológica [38] organización biológica [38] ... Diferentes pesticidas como el glifosato, Diferentes pesticidas como el glifosato, Diferentes pesticidas como el glifosato, clorpirifós, paratión, metil paratión, diazinon, cumafos, monocrotofos, fenamifos y forato se están indígena Florida Ora yyy las poblaciones que son capaces indígena Florida Ora indígena Florida Ora las poblaciones que son capaces dedede metabolizar estas sustancias químicas. las poblaciones que son capaces metabolizar estas sustancias químicas. metabolizar estas sustancias químicas. Por lo tanto, los genes metabólicos evolucionan de manera capaz de metabolizar los plaguicidas y conseguir enriquecido debido aaa lalala persistencia conseguir enriquecido debido conseguir enriquecido debido persistencia persistencia dedede los plaguicidas [18,39] los plaguicidas [18,39] los plaguicidas [18,39] ... Tal alteración dedede las Tal alteración Tal alteración las las comunidades nativas finalmente conduce a alterar el ecosistema del suelo y la pérdida de fertilidad del suelo [66,15] .. [66,15] Diferentes microorganismos han sido conocidos para transformar plaguicidas para sus necesidades dede energía. Las bacterias del suelo como Pseudomonas, Bacillus, Arthrobacter, necesidades energía. Las bacterias del suelo como Pseudomonas, Bacillus, Arthrobacter, Pseudomonas mendocina, Bacillus megaterium, Arthrobacter atrocyaneus, Pseudomonas aeruginosa utilizando enenen lalala India desde 1952 [62] ... utilizando utilizando India desde 1952 [62] India desde 1952 [62] F10B yyy ichiganense Clavibacterm SBL11 F10B F10B ichiganense Clavibacterm SBL11 son comunes entre los suelos contaminados con ichiganense Clavibacterm SBL11 son comunes entre los suelos contaminados con son comunes entre los suelos contaminados con monocrotofos [10,53,54] monocrotofos [10,53,54] monocrotofos [10,53,54] Los microorganismos del suelo que sesese están continuamente expuestos Los microorganismos del suelo que Los microorganismos del suelo que están continuamente expuestos aaa están continuamente expuestos SeSeSe espera que los pesticidas enenen el Florida influir espera que los pesticidas espera que los pesticidas el Florida influir el Florida influir enenen lalala vía metabólica dedede vía metabólica vía metabólica * Autor correspondiente. Dirección dedede correo electr ónico: amuruganpu@gmail.com (M. Athia ppan). Dirección Dirección correo electr ónico: amuruganpu@gmail.com (M. Athia ppan). correo electr ónico: amuruganpu@gmail.com (M. Athia ppan). http://dx.doi.org/10.1016/j.micpath.2017.02.011 0882-4010 /// ©©© 2017 Elsevier Ltd. Todos los derechos reservados. 0882-4010 0882-4010 2017 2017 Elsevier Ltd. Todos los derechos reservados. Elsevier Ltd. Todos los derechos reservados. los pesticidas desarrollan resistencia al fármaco lentamente. Los pesticidas pueden inducir una resistencia cruzada cuando no destinados exposición. relación común entre la entrada y la expansión de pesticidas resistencia sigue siendo materia de debate. El desarrollo de antibióticos y la resistencia a los pesticidas a menudo se presenta como ejemplo una moderna de la evolución por mutaciones y como una clara evidencia de " id="pdf-obj-0-202" src="pdf-obj-0-202.jpg">

información del artículo

Articulo de historia:

Recibido 31 de enero de 2.017 Recibido en forma 3 revisión febrero de 2.017

Aceptada 7 de febrero de 2017 Disponible en Internet el

10 de febrero de 2017

palabras clave:

Las bacterias del suelo

insecticidas

Aparición de resistencia a múltiples fármacos resistencia

cruzada

abstracto

Impactos dedede lalala exposición

Impactos

Impactos

exposición aaa los pesticidas enenen el microbiana del suelo Florida Ora yyy resistencia cruzada aaa los antibióticos nonono han sido bien

exposición

los pesticidas

los pesticidas

el microbiana del suelo Florida Ora

el microbiana del suelo Florida Ora

resistencia cruzada

resistencia cruzada

los antibióticos

los antibióticos

han sido bien

han sido bien

documentados. Desarrollo de resistencia a los antibióticos es un problema común entre las bacterias del suelo que se está exponiendo a los

plaguicidas de forma continua a una concentración sub-letal. El presente estudio se centró para evaluar la correlación entre la exposición a los

pesticidas yyy lalala evolución

pesticidas

pesticidas

evolución dedede lalala resistencia

evolución

resistencia aaa múltiples fármacos entre los aislados recogidos dedede suciedad aplicada con insecticidas. Veinte

resistencia

múltiples fármacos entre los aislados recogidos

múltiples fármacos entre los aislados recogidos

suciedad aplicada con insecticidas. Veinte

suciedad aplicada con insecticidas. Veinte fififi veveve

insecticida (monocrotofos) bacterias degradantes fueron aislados dedede suelo agrícola contaminada. Los aislados bacterianos Bacilo sps,

insecticida (monocrotofos) bacterias degradantes fueron aislados

insecticida (monocrotofos) bacterias degradantes fueron aislados

suelo agrícola contaminada. Los aislados bacterianos Bacilo sps,

suelo agrícola contaminada. Los aislados bacterianos Bacilo sps,

Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus cereus, Bacillus Bacillus
Bacillus cereus, Bacillus
Bacillus cereus, Bacillus
Bacillus cereus, Bacillus
Bacillus cereus, Bacillus
Bacillus cereus, Bacillus
Bacillus cereus, Bacillus fifififififi UDA
UDA yyyyyy bacilo turingiensico sesesesesese encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos,
UDA
UDA
UDA
UDA
bacilo turingiensico
bacilo turingiensico
bacilo turingiensico
bacilo turingiensico
bacilo turingiensico
encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos,
encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos,
encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos,
encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos,
encontró que eran resistentes contra los antibióticos cloranfenicol, monocrotofos,
ampicilina, cefotaxima, estreptomicina yy tetraciclina usado. Participación
ampicilina, cefotaxima, estreptomicina
tetraciclina usado. Participación dede plásmido
plásmido enen drogas, así como resistentes aa los insecticidas fue con fifi
drogas, así como resistentes
los insecticidas fue con
rma través
rma través dedededededededede plásmido
rma través
rma través
rma través
rma través
rma través
rma través
rma través
plásmido
plásmido dedededededededede curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus
plásmido
plásmido
plásmido
plásmido
plásmido
plásmido
curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus
curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus
curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus
curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus
curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus
curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus
curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus
curado entre las cepas bacterianas seleccionadas. Bacilo Sps (MK-07), Bacillus cereus ((((((((( MK-11), Bacilo fififififififififi UDA
MK-11), Bacilo
MK-11), Bacilo
MK-11), Bacilo
MK-11), Bacilo
MK-11), Bacilo
MK-11), Bacilo
MK-11), Bacilo
MK-11), Bacilo
UDA
UDA
UDA
UDA
UDA
UDA
UDA
UDA ((((((((( MK-13)
MK-13)
MK-13)
MK-13)
MK-13)
MK-13)
MK-13)
MK-13)
MK-13)
yyy Bacilo turingiensico ((( MK-24) perdió sususu resistente contra los insecticidas yyy antibióticos una vez después dedede lalala eliminación del plásmido
Bacilo turingiensico
Bacilo turingiensico
MK-24) perdió
MK-24) perdió
resistente contra los insecticidas
resistente contra los insecticidas
antibióticos una vez después
antibióticos una vez después
eliminación del plásmido
eliminación del plásmido

mediante la exposición a 2% de sulfato dodecil de sodio. El plásmido se transforma de nuevo a las bacterias que producen derivados similares

cuando se cultivan en medio de sal mínima (pH 7,0) suplementado con 0,4% de insecticida. modelado por homología se utiliza para demostrar

que hidrolasa organofosforados y capaz de metabolizar todos los antibióticos mostró una interacción positiva con alta puntuación de

acoplamiento. El presente estudio reveló que la persistencia de los insecticidas en el suelo agrícola puede conducir a aumentar el desarrollo de

resistencia a múltiples fármacos entre las bacterias del suelo.

©© 2017 Elsevier Ltd. Todos los derechos reservados.

2017 Elsevier Ltd. Todos los derechos reservados.

1. Introducción

El uso continuo de plaguicidas ha sistemas de agua del suelo y subterráneas muy contaminada.

Estos son lo suficientemente tóxico para matar los organismos objetivo, pero al mismo tiempo

afectan aaa los organismos nonono objetivo [82]

afectan

afectan

los organismos

los organismos

objetivo [82]

objetivo [82]

...

Por desgracia, los ecosistemas acuáticos yyy terrestres están

Por desgracia, los ecosistemas acuáticos

Por desgracia, los ecosistemas acuáticos

terrestres están

terrestres están

contaminados con pesticidas debido severamente para lixiviar el formulario dedede lalala agricultura

contaminados con pesticidas debido severamente para lixiviar el formulario

contaminados con pesticidas debido severamente para lixiviar el formulario

agricultura

agricultura fififi campos

campos

campos

[59]

[59]

..

contaminación dede plaguicidas resultantes dede lala introducción directa oo indirecta puede causar

contaminación

plaguicidas resultantes

introducción directa

indirecta puede causar

cambios enenen todos los niveles

cambios

cambios

todos los niveles dedede organización biológica [38]

todos los niveles

organización biológica [38]

organización biológica [38]

...

Diferentes pesticidas como el glifosato,

Diferentes pesticidas como el glifosato,

Diferentes pesticidas como el glifosato,

clorpirifós, paratión, metil paratión, diazinon, cumafos, monocrotofos, fenamifos y forato se están

indígena Florida Ora yyy las poblaciones que son capaces

indígena Florida Ora

indígena Florida Ora

las poblaciones que son capaces dedede metabolizar estas sustancias químicas.

las poblaciones que son capaces

metabolizar estas sustancias químicas.

metabolizar estas sustancias químicas.

Por lo tanto, los genes metabólicos evolucionan de manera capaz de metabolizar los plaguicidas y

conseguir enriquecido debido aaa lalala persistencia

conseguir enriquecido debido

conseguir enriquecido debido

persistencia

persistencia dedede los plaguicidas [18,39]

los plaguicidas [18,39]

los plaguicidas [18,39]

...

Tal alteración dedede las

Tal alteración

Tal alteración

las

las

comunidades nativas finalmente conduce a alterar el ecosistema del suelo y la pérdida de fertilidad

del suelo

[66,15] ..

[66,15]

Diferentes microorganismos han sido conocidos para transformar plaguicidas para sus

necesidades dede energía. Las bacterias del suelo como Pseudomonas, Bacillus, Arthrobacter,

necesidades

energía. Las bacterias del suelo como Pseudomonas, Bacillus, Arthrobacter,

Pseudomonas mendocina, Bacillus megaterium, Arthrobacter atrocyaneus, Pseudomonas aeruginosa

utilizando enenen lalala India desde 1952 [62] ...

utilizando

utilizando

India desde 1952 [62]

India desde 1952 [62]

F10B yyy ichiganense Clavibacterm SBL11

F10B

F10B

ichiganense Clavibacterm SBL11 son comunes entre los suelos contaminados con

ichiganense Clavibacterm SBL11

son comunes entre los suelos contaminados con

son comunes entre los suelos contaminados con

monocrotofos [10,53,54]

monocrotofos [10,53,54]

monocrotofos [10,53,54]

Los microorganismos del suelo que sesese están continuamente expuestos

Los microorganismos del suelo que

Los microorganismos del suelo que

están continuamente expuestos aaa

están continuamente expuestos

SeSeSe espera que los pesticidas enenen el Florida influir

espera que los pesticidas

espera que los pesticidas

el Florida influir

el Florida influir enenen lalala vía metabólica dedede

vía metabólica

vía metabólica

*

Autor correspondiente.

Dirección dedede correo electrónico: amuruganpu@gmail.com (M. Athiappan).

Dirección

Dirección

0882-4010 /// ©©© 2017 Elsevier Ltd. Todos los derechos reservados.

0882-4010

0882-4010

2017

2017

Elsevier Ltd. Todos los derechos reservados.

Elsevier Ltd. Todos los derechos reservados.

los pesticidas desarrollan resistencia al fármaco lentamente. Los pesticidas pueden inducir una

resistencia cruzada cuando no destinados exposición. relación común entre la entrada y la expansión

de pesticidas resistencia sigue siendo materia de debate. El desarrollo de antibióticos y la resistencia

a los pesticidas a menudo se presenta como ejemplo una moderna de la evolución por mutaciones y

como una clara evidencia de

154

K. Rangasamy et al. /// Patogénesis microbiana 105 (2017) 153 mi 165

K.

K.

Rangasamy et al.

Rangasamy et al.

Patogénesis microbiana 105 (2017) 153 mi 165

Patogénesis microbiana 105 (2017) 153 mi 165

darvinismo [5] darvinismo [5] darvinismo [5]
darvinismo [5]
darvinismo [5]
darvinismo [5]

Otro problema creado por el uso excesivo dedede antibióticos

Otro problema creado por el uso excesivo

Otro problema creado por el uso excesivo

antibióticos

antibióticos enenen lalala acuicultura

acuicultura

acuicultura eseses lalala

presencia de antibióticos residuales en los productos acuáticos comercializados.

Desarrollo de resistencia a los antibióticos considerado como riesgos más graves para la salud

humana. Se ha observado que las múltiples resistencias a antibióticos se incrementaron por la

exposición exposición dedede pesticidas [35,53,54,64] exposición pesticidas [35,53,54,64] pesticidas [35,53,54,64] Los plásmidos recuperados aaa partir Los
exposición
exposición dedede pesticidas [35,53,54,64]
exposición
pesticidas [35,53,54,64]
pesticidas [35,53,54,64]
Los plásmidos recuperados aaa partir
Los plásmidos recuperados
Los plásmidos recuperados
partir dedede diferentes aislados
partir
diferentes aislados
diferentes aislados
bacterianos de muestras clínicas encontrado que tienen fenotipos resistentes a una variedad de
antibióticos [55]
antibióticos [55]
antibióticos [55]
Por
Por lololo tanto, el uso indiscriminado dedede lalala contaminación pesticidas hahaha encontrado para
Por
tanto, el uso indiscriminado
tanto, el uso indiscriminado
contaminación pesticidas
contaminación pesticidas
encontrado para
encontrado para

crear una resistencia a múltiples fármacos entre la población bacteriana filtrada. Las bacterias y los

insectos adquieren resistencia, ya sea a través de la selección natural a través de una única

mutación. En muchos casos, el organismo pasa a más de producir una enzima que descompone los

plaguicidas y otros derivados. El presente estudio se ha enfocado al estudio de la evolución de

bacterias resistentes a múltiples fármacos aislados de tierras de cultivo contaminadas.

sus monocrotofos la utilización de la capacidad. Todas las colonias se transfirieron a medio estéril

fresco para obtener un cultivo puro. Se seleccionaron las cepas que poseían la más alta capacidad

de degradación para una mayor investigación experimental.

  • 2.3.2. prueba de tolerancia y análisis de datos Los insecticidas

tolerancia bacteriana a diversas concentraciones de los pesticidas se realizó en caldo de sal

mínimo. 5 ml de caldo se preparó en agua destilada esterilizada para alcanzar concentraciones que

van desde

se tomaron 0,1% a 1,0% de insecticidas. El crecimiento bacteriano se midió a través de los rayos UV

Spectrophometry a 600 nm para detectar el crecimiento bacteriano. Los valores anteriores son la

media dede lala 1010 réplica

media

réplica yy las desviaciones estándar

las desviaciones estándar dede acuerdo con el procedimiento descrito por Ref. [26]

acuerdo con el procedimiento descrito por Ref. [26]

.

2. Materiales y métodos

  • 2.1. materiales

    • 2.3.3. resistencia a los antibacterianos

Aislamientos (MK-01 TomK-25) se ensayaron para determinar su susceptibilidad para diferentes

antibióticos por el método dedede difusión

antibióticos por el método

antibióticos por el método

difusión

difusión enenen disco

disco enenen agar Mueller Hinton (MHA) placas [4,16,49,51,50] ...

disco

agar Mueller Hinton (MHA) placas [4,16,49,51,50]

agar Mueller Hinton (MHA) placas [4,16,49,51,50]

Las placas sese incubaron

Las placas

incubaron aa 3737 sese observaron

observaron CC durante

durante 2424 hh yy por

por susu zona

zona dede inhibición.

inhibición.

Comercialmente disponible de grado monocrotofos (36% de pureza) se adquirió de comerciante

  • 2.4. La degradación de insecticida

dede pesticidas local desde Namakkal, Tamil Nadu, India. antibióticos estándar como ampicilina (Amp 10),

pesticidas local desde Namakkal, Tamil Nadu, India. antibióticos estándar como ampicilina (Amp

10),

Estreptomicina (HLS

Estreptomicina (HLS

Estreptomicina (HLS

Estreptomicina (HLS

Estreptomicina (HLS

Estreptomicina (HLS

Estreptomicina (HLS

Estreptomicina (HLS 100), Neomicina

Estreptomicina

(HLS 100),

100),

100),

100),

100),

100),

100),

100),

30), Cephatoxime (Ce

Cephatoxime (Ce

Cephatoxime (Ce

Cephatoxime (Ce

Cephatoxime (Ce

Cephatoxime (Ce

Cephatoxime (Ce

Cephatoxime

(Ce 30),

Oxacilina (Ox), Sulfadiazina (Sz

Oxacilina (Ox), Sulfadiazina (Sz

Oxacilina (Ox), Sulfadiazina (Sz

Oxacilina (Ox), Sulfadiazina (Sz

Oxacilina (Ox), Sulfadiazina (Sz

Oxacilina (Ox), Sulfadiazina

(Sz 100),

Neomicina (N(N(N(N(N(N(N(N(N 30), Cephatoxime (Ce 30), Oxacilina (Ox), Sulfadiazina (Sz

Neomicina

Neomicina

Neomicina

Neomicina

Neomicina

Neomicina

Neomicina

30),

30),

30),

30),

30),

30),

30),

30),

30),

30),

30),

30),

30),

30),

Oxacilina (Ox), Sulfadiazina (Sz

100),

100),

100),

100),

100),

100),

100),

Oxacilina (Ox), Sulfadiazina (Sz 100), Tetraciclina

Tetraciclina

Tetraciclina

Tetraciclina

Tetraciclina

Tetraciclina

Tetraciclina

Tetraciclina

Tetraciclina

Las muestras bacterianas inoculadas con Erlenmeyer pre-esterilizado

Ni Florida oxaci (Nx

(T(T(T(T(T(T(T(T(T(T(T 30), Ni Florida oxaci (Nx 10), Cefozolin (CZ 30)

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

30), Ni

30),

30),

30),

30),

30),

30),

30),

30),

30),

Florida oxaci

(Nx 10),

10),

10),

10),

10),

10),

10),

10),

10),

10),

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

30)

30)

30)

30)

30)

30)

30)

30)

30)

Cefozolin (CZ 30) yyyyyyyyyyy cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol (C(C(C(C(C(C(C(C(C(C(C 30)

30)

30)

30)

30)

30)

30)

30)

30)

30)

30) sesesesesesesesesesese obtuvieron

obtuvieron

obtuvieron

obtuvieron

obtuvieron

obtuvieron

obtuvieron

obtuvieron

obtuvieron

obtuvieron

los Laboratorios Hola

obtuvieron dedededededededededede los Laboratorios Hola

los Laboratorios Hola

los Laboratorios Hola

los Laboratorios Hola

los Laboratorios Hola

los Laboratorios Hola

los Laboratorios Hola

los Laboratorios Hola

los Laboratorios Hola

los Laboratorios Hola

Medios Pvt. Ltd, Mumbai.

Florida pide sal containingMinimal caldo supplementedwith insecticida

Florida pide sal containingMinimal caldo supplementedwith insecticida

0,4% sese incubaron

0,4%

incubaron aa 3737 CC durante

durante 4848 h. muestras dede células libre dede caldo

h. muestras

células libre

caldo sese tomaron

tomaron

periódicamente y se ensayaron para el análisis insecticida residual usando GC-MS mediante la

extracción de los derivados utilizando dos veces acetato de etilo y se evaporaron en condiciones de

  • 2.2. Recogida de muestras y estudios de enriquecimiento

vacío hasta sequedad [28]

vacío hasta sequedad [28]

vacío hasta sequedad [28]

...

usó Agilent Cromatógrafo dedede gases (Modelo 7820A Series EE.UU.)

SeSeSe usó Agilent Cromatógrafo

usó Agilent Cromatógrafo

gases (Modelo 7820A Series EE.UU.)

gases (Modelo 7820A Series EE.UU.)

equipado con un detector de ionización de llama para el análisis de la degradación de insecticida.

Hay tres tipos dedede muestras

Hay tres tipos

Hay tres tipos

muestras dedede suelos agrícolas (control, más dedede fififi cinco años y, más dedede diez

muestras

suelos agrícolas (control, más

suelos agrícolas (control, más

cinco años y, más

cinco años y, más

diez

diez

años) se utilizaron en este estudio para el aislamiento de microorganismos de plaguicidas

degradantes. Las muestras de suelo se recogieron a partir de 5 cm de capa superior a partir de

diferentes plaguicidas contaminados sitios agrícolas de Salem y el distrito de Namakkal (11,7794

78,2034 NN EE yy 11,47

78,2034

11,47 NN 78,17 E), Tamil Nadu, India. Las muestras recogidas sese almacenaron

78,17 E), Tamil Nadu, India. Las muestras recogidas

almacenaron aa 44 CC

hasta el análisis adicional.

  • 2.3. Aislamiento de monocrotofos bacterias degradantes por cultivo de enriquecimiento

2.5.

2.5.

2.5.

identi fififi cación

identi

identi

cación dedede aislados bacterianos utilizando 16S rRNA secuenciación dedede genes

cación

aislados bacterianos utilizando 16S rRNA secuenciación

aislados bacterianos utilizando 16S rRNA secuenciación

genes

genes

DNAwas bacterianas aisladas siguiendo protocolos estándar [63]

DNAwas bacterianas aisladas siguiendo protocolos estándar [63]

ampli fififi ededed usando 16S rRNA cebadores universales: 27f (AGAGTTTGATCMTGGCTCAG),

ampli

ampli

usando 16S rRNA cebadores universales: 27f (AGAGTTTGATCMTGGCTCAG),

usando 16S rRNA cebadores universales: 27f (AGAGTTTGATCMTGGCTCAG), 1492r

1492r

1492r

(TACGGYTACCTTGTTACGACTT). Las mezclas dedededede PCR (50

(TACGGYTACCTTGTTACGACTT). Las mezclas

(TACGGYTACCTTGTTACGACTT). Las mezclas

(TACGGYTACCTTGTTACGACTT). Las mezclas

(TACGGYTACCTTGTTACGACTT). Las mezclas

PCR (50

PCR (50

PCR (50

PCR

(50 metro metro l)l)l)l)l) contenía metro metro metro contenía contenía contenía Taq polimerasa, BSA Taq polimerasa,
(50 metro
metro l)l)l)l)l) contenía
metro
metro
metro
contenía
contenía
contenía
Taq polimerasa, BSA
Taq polimerasa, BSA

contenía 1010101010 metro

metro MMMMM dedededede cada metro metro metro cada cada cada cada metro MMMM yyyy 2222 metro
metro MMMMM dedededede cada
metro
metro
metro
cada
cada
cada
cada
metro MMMM yyyy 2222 metro
metro
metro
metro
metro
metro
durante

cebador, PCR Invitrogen Master Mix (tampón PCR, 5555 UUUU dededede Taq polimerasa, BSA

cebador, PCR Invitrogen Master Mix (tampón PCR,

cebador, PCR Invitrogen Master Mix (tampón PCR,

cebador, PCR Invitrogen Master Mix (tampón PCR,

ll dede ADN). Las condiciones

Taq polimerasa, BSA 10101010 metro

ADN). Las condiciones dede termociclado incluyeron una etapa dede desnaturalización

termociclado incluyeron una etapa

desnaturalización aa 9494 CC durante

min, 3434343434 ampli

33333 min,

min,

min,

min,

ampli fififififi ciclos

ampli

ampli

ampli

ciclos dedededede cationes

ciclos

ciclos

ciclos

cationes dedededede 9494949494 CCCCC durante

cationes

cationes

cationes

durante

durante

durante

durante 11111 min,

min, 5555555555 CCCCC durante

min,

min,

min,

durante 3030303030 sssss yyyyy 72ºC durante 11111 min

durante

durante

durante

72ºC durante

72ºC durante

72ºC durante

72ºC durante

min

min

min

min yyyyy fififififi polimerización

polimerización

polimerización

polimerización

polimerización

medio mínimo que contenía (por litro) 8,8 ggggg dedededede Na

medio mínimo que contenía (por litro) 8,8

medio mínimo que contenía (por litro) 8,8

medio mínimo que contenía (por litro) 8,8

medio mínimo que contenía (por litro) 8,8

Na

Na

Na

Na 22222 HPO

HPO 44444 $$$$$ 2H2O,

HPO

HPO

HPO

2H2O,

2H2O,

2H2O,

2H2O,

nal para 8min con Eppendorf termociclador (Eppendorf AG 22331). La electroforesis se continuó

3,0 gggggggg dededededededede KHKHKHKHKHKHKHKH 22222222 correos 4, 1,0

3,0

3,0

3,0

3,0

3,0

3,0

3,0

correos 4, 1,0 gggggggg dededededededede NHNHNHNHNHNHNHNH 44444444 Cl, 0,5 gggggggg dededededededede NaCl,

correos

correos

correos

correos

correos

correos

4,

4,

4,

4,

4,

4,

1,0

1,0

1,0

1,0

1,0

1,0

Cl, 0,5

Cl, 0,5

Cl, 0,5

Cl, 0,5

Cl, 0,5

Cl, 0,5

Cl, 0,5

NaCl,

NaCl,

NaCl,

NaCl,

NaCl,

NaCl,

NaCl, 1,0 ml dededededededede 11111111 MMMMMMMM MgSO

1,0 ml

1,0 ml

1,0 ml

1,0 ml

1,0 ml

1,0 ml

1,0 ml

MgSO 44444444

MgSO

MgSO

MgSO

MgSO

MgSO

MgSO

durante 30 min a 100 V (unidad de electroforesis Tarson). El tamaño de los fragmentos se determinó

una solución

una solución

una solución

una solución

una solución

una solución

elementos traza (por litro)

elementos traza (por litro)

elementos traza (por litro)

elementos traza (por litro)

elementos traza (por litro)

yyyyyyy 2,5 ml dedededededede una solución dedededededede elementos traza (por litro) 23232323232323 mg

2,5 ml

2,5 ml

2,5 ml

2,5 ml

2,5 ml

2,5 ml

elementos traza (por litro)

mg

mg

mg

mg

mg

mg dedededededede MnCl

MnCl 2222222 $$$$$$$ 2H2H2H2H2H2H2H 2222222 O,

MnCl

MnCl

MnCl

MnCl

MnCl

O,

O,

O,

O,

O,

O, 30303030303030 mg

mg dedededededede MnCl

mg

mg

mg

mg

mg

MnCl 4444444 $$$$$$$ MARIDO

MnCl

MnCl

MnCl

MnCl

MnCl

MARIDO

MARIDO

MARIDO

MARIDO

MARIDO

MARIDO

por comparación con 1 marcador kb (Fermentas) 1500 pb. Los productos de PCR se visualizaron en

O,

O,

O,

O,

O,

O,

O,

O,

O,

O, 313131313131313131313131313131313131 mg

222222222222222222 O,

O,

O,

O,

O,

O,

O,

O,

mg dededededededededededededededededede HHHHHHHHHHHHHHHHHH 333333333333333333 BOBOBOBOBOBOBOBOBOBOBOBOBOBOBOBOBOBO 3,

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

3,

3,

3,

3,

3,

3,

3,

3,

3,

3,

3,

3,

3,

3,

3,

3,

3, 363636363636363636363636363636363636 mg

mg dededededededededededededededededede CoCl

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

CoCl

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

CoCl 222222222222222222 $$$$$$$$$$$$$$$$$$ 6H6H6H6H6H6H6H6H6H6H6H6H6H6H6H6H6H6H 222222222222222222 O,

CoCl

CoCl

CoCl

CoCl

CoCl

CoCl

CoCl

CoCl

CoCl

CoCl

CoCl

CoCl

CoCl

CoCl

CoCl

O, 101010101010101010101010101010101010 mg

mg dededededededededededededededededede CuCl

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

CuCl

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

CuCl 222222222222222222 $$$$$$$$$$$$$$$$$$ 2H2H2H2H2H2H2H2H2H2H2H2H2H2H2H2H2H2H 222222222222222222 O,

CuCl

CuCl

CuCl

CuCl

CuCl

CuCl

CuCl

CuCl

CuCl

CuCl

CuCl

CuCl

CuCl

CuCl

CuCl

O, 202020202020202020202020202020202020 mg

mg dededededededededededededededededede NiCl

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

NiCl

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

O,

NiCl 222222222222222222 $$$$$$$$$$$$$$$$$$ 6H6H6H6H6H6H6H6H6H6H6H6H6H6H6H6H6H6H 222222222222222222 O,

NiCl

NiCl

NiCl

NiCl

NiCl

NiCl

NiCl

NiCl

NiCl

NiCl

NiCl

NiCl

NiCl

NiCl

NiCl

O, 303030303030303030303030303030303030 mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

mg

Na 222222222 Mugir

dedededededededede Na

Na

Na

Na

Na

Na

Na

Na

Mugir 444444444 $$$$$$$$$ 2H2H2H2H2H2H2H2H2H 222222222 OOOOOOOOO yyyyyyyyy 505050505050505050 mg

Mugir

Mugir

Mugir

Mugir

Mugir

Mugir

Mugir

mg

mg

mg

mg

mg

mg

mg

mg dedededededededede ZnCl

ZnCl

ZnCl

ZnCl

ZnCl

ZnCl

ZnCl

ZnCl

7,0). Alrededor

7,0). Alrededor

7,0). Alrededor

7,0). Alrededor

7,0). Alrededor

7,0). Alrededor

7,0). Alrededor

7,0). Alrededor

ZnCl 222222222 ((((((((( pHpHpHpHpHpHpHpHpH 7,0). Alrededor dedededededededede 505050505050505050 ml

ml

ml

ml

ml

ml

ml

ml

ml

MSM

MSM

MSM

MSM

MSM

MSM

MSM

preparó

preparó

MSM sesesesesesesesese preparó

dedededededededede MSM

preparó

preparó

preparó

preparó

preparó

preparó

suplementando con 0,1% de insecticida y se sembró con 1 g de muestra de suelo y se incubaron a

3737 CC durante

durante 4848 h. Después dede lala incubación, los cultivos

h. Después

incubación, los cultivos sese agitaron vigorosamente con incubadora

agitaron vigorosamente con incubadora

con agitador durante 1 h para dispensar las bacterias de las partículas del suelo. Pesticidas degradar

las poblaciones bacterianas se enriquecieron durante otras 48 h con 0,4% de insecticida.

1,0% dedede gel

1,0%

1,0%

gel dedede agarosa con lalala documentación

gel

agarosa con

agarosa con

documentación dedede gel (Mediccare H6Z081). el Puri

documentación

gel (Mediccare H6Z081). el Puri

gel (Mediccare H6Z081). el Puri fififi productos

productos ededed PCR productos PCR PCR nucleótidos obtenidas nucleótidos obtenidas
productos ededed PCR
productos
PCR
PCR
nucleótidos obtenidas
nucleótidos obtenidas

fueron secuenciados enenen Euro

fueron secuenciados

fueron secuenciados

Euro fififi nsnsns Pvt Ltd, Bangalore, India. Las secuencias dedede nucleótidos obtenidas

Euro

Pvt Ltd, Bangalore, India. Las secuencias

Pvt Ltd, Bangalore, India. Las secuencias

se analizaron utilizando BLAST-n (Centro Nacional de Información de Biotecnología Bases de datos).

Un árbol filogenético fue construido con el MEGA explorador 7.0 de alineación (Molecular

Evolutionary filogenético Análisis árbol) basado en secuencias completas o casi completas de 16S

ADNr alineadas [1,34] ...

ADNr alineadas [1,34]

ADNr alineadas [1,34]

2.3.1. Enumeración de bacterias de plaguicidas degradar

0,5 ggg dedede suelo samplewas tomada

0,5

0,5

suelo samplewas tomada enenen cónica Florida pedir que contiene

suelo samplewas tomada

cónica Florida pedir que contiene

cónica Florida pedir que contiene 505050 ml

ml

ml

dedede agua destilada

agua destilada

agua destilada

estéril y se mezcla a fondo por agitación a 150 rpm durante 1 h. La suspensión se diluyó en serie

hasta 10101010 2222 aaaa 10101010 8888

hasta

hasta

hasta

dilución. Una cantidad de 0,1 ml de cada dilución se extendió sobre agar sal mínimo suplementado

con placas monocrotofos 0,4% por triplicado y se incubaron en condiciones aerobias a 37ºC durante

2.6.

2.6.

2.6.

Bacterial plásmido pro fififi análisis

Bacterial plásmido pro

Bacterial plásmido pro

análisis lelele

análisis

Todos los aislados se utilizaron para el enriquecimiento de ADN plasmídico mediante el uso de

(MSM) suplementado con 0,4% de monocrotofos durante 48 h. El ADN plásmido se aisló usando

484848 hhh yyy colonias discretas fueron recogidas para el análisis experimental [57]

colonias discretas fueron recogidas para el análisis experimental [57]

colonias discretas fueron recogidas para el análisis experimental [57]

Las colonias resultantes

Las colonias resultantes

Las colonias resultantes

fueron repetidamente sub cultivaron en el mismo medio (MSM con 0,4% de monocrotofos) para

conformar

métodos estándar dedede procedimiento bacterianas [9]

métodos estándar

métodos estándar

procedimiento bacterianas [9]

procedimiento bacterianas [9]

Después del aislamiento del ADN plásmido fue

Después del aislamiento del ADN plásmido fue

Después del aislamiento del ADN plásmido fue

con fififi rma

con

con

rma enenen lalala electroforesis

rma

electroforesis enenen gel horizontal (aparato electroforético Tarson) usando 0,8%

electroforesis

gel horizontal (aparato electroforético Tarson) usando 0,8% dedede

gel horizontal (aparato electroforético Tarson) usando 0,8%

agarosa.

K.

K.

K.

Rangasamy et al. /// Patogénesis microbiana 105 (2017) 153 mi 165

Rangasamy et al.

Rangasamy et al.

Patogénesis microbiana 105 (2017) 153 mi 165

Patogénesis microbiana 105 (2017) 153 mi 165

155

2.6.1.

2.6.1.

2.6.1.

oph parcial yyy mdr ampli gen

oph parcial

oph parcial

mdr ampli gen

mdr ampli gen fififi catión

catión

catión

ADN plásmido bacteriano se aisló siguiendo protocolos estándar métodos procedimiento

gov

pccompound )) YY estas estructuras 2D2D sese convierten

estas estructuras

convierten enen estructuras 3D. Las estructuras 3D3D

estructuras 3D. Las estructuras

obtenidos se reducen al mínimo para detectar los sitios activos. Implementación de algoritmos

bacterianas [9] secuencia génica era recuperar dedede NCBI (AY043245.2 yyy GU591496.1) basándose enenen

bacterianas [9] secuencia génica era recuperar

bacterianas [9] secuencia génica era recuperar

NCBI (AY043245.2

NCBI (AY043245.2

GU591496.1) basándose

GU591496.1) basándose

lalala especificidad del gen secuencia fififi cebadores

especificidad del gen secuencia

especificidad del gen secuencia

cebadores CCC fue diseño dedede imprimación neto (Premier Biosoft):

cebadores

fue diseño

fue diseño

imprimación neto (Premier Biosoft):

imprimación neto (Premier Biosoft):

organofosforados

hidrolasa

MK: oph-FP:

ATCGGCA-

evolutivos centra en simulaciones de acoplamiento molecular. Docking estaba realizando presentó

con todos los potenciales sitios activos detectados en enzima hidrolasa organofosforado. Durante el

acoplamiento, enenen fififi primero

acoplamiento,

acoplamiento,

primero sesese prepararon las moléculas

primero

prepararon las moléculas yyy bonos, órdenes dedede enlace, hidrógenos

prepararon las moléculas

bonos, órdenes

bonos, órdenes

enlace, hidrógenos

enlace, hidrógenos

explícitas, cargos y

CAGGCGATCGG, MK: oph-RP: CATGACGCCCGCAAGGTCGG y resistentes a múltiples fármacos

MK gen: mdr-FP: AAAACAAAGTATGGTAAAATACAGGAA, MK: mdr-RP:

Florida torsiones flexibles fueron asignados con tanto lala proteína

Florida torsiones flexibles fueron asignados con tanto

proteína yy los ligandos. El modelo fue

los ligandos. El modelo fue

ATAATTACCATATAATTGACCACAAGC. Las mezclas dedededede PCR (50 ATAATTACCATATAATTGACCACAAGC. Las mezclas ATAATTACCATATAATTGACCACAAGC. Las mezclas ATAATTACCATATAATTGACCACAAGC. Las mezclas ATAATTACCATATAATTGACCACAAGC.
ATAATTACCATATAATTGACCACAAGC. Las mezclas dedededede PCR (50
ATAATTACCATATAATTGACCACAAGC. Las mezclas
ATAATTACCATATAATTGACCACAAGC. Las mezclas
ATAATTACCATATAATTGACCACAAGC. Las mezclas
ATAATTACCATATAATTGACCACAAGC. Las mezclas
PCR
PCR (50
PCR (50
PCR (50
(50 metro
metro
metro
metro
metro l)l)l)l)l) contenía
contenía
contenía 1010101010 metro
contenía
contenía
metro
metro
metro
metro MMMMM dedededede
calibrado usando un conjunto de datos de estructuralmente diversos complejos de la base de datos
cada cebador, PCR Invitrogen Master Mix (tampón PCR, 555 UUU dedede Taq polimerasa, BSA
cada cebador, PCR Invitrogen Master Mix (tampón PCR,
cada cebador, PCR Invitrogen Master Mix (tampón PCR,
Taq polimerasa, BSA 101010 metro
Taq polimerasa, BSA
metro MMM yyy
metro
PDB se unen con conocido AF de unión
2222 metro
metro llll dededede ADN). Las condiciones
metro
metro
ADN). Las condiciones dededede termociclado incluyeron una etapa dededede desnaturalización
ADN). Las condiciones
ADN). Las condiciones
termociclado incluyeron una etapa
termociclado incluyeron una etapa
termociclado incluyeron una etapa
desnaturalización
desnaturalización
desnaturalización aaaa 94949494 CCCC
fifififi nidades expresado enenenen kJkJkJkJ //// mol [72] ....
nidades expresado
nidades expresado
nidades expresado
mol [72]
mol [72]
mol [72]
durante
durante 33333 min,
durante
durante
durante
min,
min,
min,
min, 3434343434 ampli
ampli
ampli
ampli
ampli fififififi ciclos
ciclos
ciclos
ciclos
ciclos dedededede cationes
cationes
cationes
cationes
cationes dedededede 9494949494 CCCCC durante
durante
durante
durante
durante 11111 min,
min,
min,
min, 5454545454 CCCCC durante
min,
durante
durante
durante
durante 3030303030 sssss yyyyy 7272727272 CCCCC durante
durante
durante
durante
durante
111 min
min
min yyy fififi polimerización final durante
polimerización final durante
polimerización final durante 888 min con Eppendorf termociclador (Eppendorf
min con Eppendorf termociclador (Eppendorf
min con Eppendorf termociclador (Eppendorf AGAGAG 22331).
22331).
22331). LaLaLa
2.9.3. Las proteínas y ligandos de los estudios de inhibición

electroforesis se continuó durante 30 min a 100 V (unidad de electroforesis Tarson). El tamaño de los

fragmentos se determinó por comparación con 1 marcador kb (NEB) 1400 pb. Los productos de PCR

Interacción análisis sese realizó usando el paquete dede software

Interacción análisis

realizó usando el paquete

software dede acoplamiento

acoplamiento (( http://www.schrodinger.com/

http://www.schrodinger.com/

). búsquedas de acoplamiento para las interacciones favorables entre uno o más típicamente

visualizaron enenen gel

sesese visualizaron

visualizaron

gel dedede agarosa al 1,0% con lalala documentación

gel

agarosa al 1,0% con

agarosa al 1,0% con

documentación dedede gel (Mediccare H6Z081). el Puri

documentación

gel (Mediccare H6Z081). el Puri

gel (Mediccare H6Z081). el Puri fififi productos

productos

productos

pequeña moléculas de ligando y una molécula de receptor más grande. estructuras Obtenido fueron

PCR fueron secuenciados enenen Euro

ededed PCR fueron secuenciados

PCR fueron secuenciados

Euro fififi nsnsns Pvt Ltd, Bangalore, India. Las secuencias dedede nucleótidos

Euro

Pvt Ltd, Bangalore, India. Las secuencias

Pvt Ltd, Bangalore, India. Las secuencias

nucleótidos

nucleótidos

sometidas a eliminación de agua hasta 5 distancias A, la asignación de átomo de par de electrones

obtenidas se analizaron utilizando BLAST-n (Centro Nacional de Información de Biotecnología Bases

solitario utilizando el asistente preparación de proteína. La rejilla receptor se creó y generó para

de datos).

especificar el bolsillo de unión en el que el ligando se une con el panel de receptor de generación de

rejilla. acoplamiento molecular de la proteína preparada y el ligando se lleva a cabo utilizando de

acoplamiento [43] ...

acoplamiento [43]

acoplamiento [43]

  • 2.7. resistencia cruzada

3. Resultados y discusión

El plásmido aaa partir

El plásmido

El plásmido

partir dedede bacterias insecticidas degradar fue curado por los standardmethods [23]

partir

bacterias insecticidas degradar fue curado por los standardmethods [23] ...

bacterias insecticidas degradar fue curado por los standardmethods [23]

Plasmidwas curados fromMK-07, MK-11, MK13 y MK-24 mediante la inoculación del cultivo con 2%

de agentes de curado (SDS). Además, estas cepas de plásmidos curado se ensayaron para

  • 3.1. Aislamiento de monocrotofos bacterias degradantes

Veinte fififi cinco diferentes microorganismos

Veinte

Veinte

cinco diferentes microorganismos sesese aislaron

cinco diferentes microorganismos

aislaron dedede los plaguicidas aplicados suelo yyy sesese

aislaron

los plaguicidas aplicados suelo

los plaguicidas aplicados suelo

determinar susu capacidad para degradar insecticidas. Los cultivos sese incubaron

determinar

capacidad para degradar insecticidas. Los cultivos

incubaron aa continuación

continuación aa 3737 CC

encontraron para degradar el insecticida. Las cepas como MK-07, MK-11, MK-13 y MK-24 se

en un agitador orbital a 150 rpm durante 48 h. Después de la incubación, se cambió el cultivo de

eligieron para estudios adicionales en base a las propiedades resistentes a múltiples fármacos. Se

caldo. El cultivo en placa de intercambio proyectó por su sensibilidad hacia los antibióticos estándar

supo que el desarrollo de resistente a los medicamentos es común entre las bacterias del suelo

tales asAmpicillin, (Amp

(HLS 100),

tales asAmpicillin, (Amp 10), Estreptomicina (HLS 100), Neomicina

tales asAmpicillin, (Amp

tales asAmpicillin, (Amp

tales asAmpicillin, (Amp

tales asAmpicillin, (Amp

tales asAmpicillin, (Amp

tales asAmpicillin, (Amp

tales asAmpicillin, (Amp

Estreptomicina (HLS

Estreptomicina (HLS

Estreptomicina (HLS

Estreptomicina (HLS

Estreptomicina (HLS

Estreptomicina (HLS

Estreptomicina (HLS

tales asAmpicillin, (Amp 10), Estreptomicina (HLS

10),

10),

10),

10),

10),

10),

10),

10),

Estreptomicina

100),

100),

100),

100),

100),

100),

100),

100),

Neomicina (N(N(N(N(N(N(N(N(N(N 30), Cephatoxime (Ce 30), Oxacilina (Ox 1), continuamente expuestos a los pesticidas. la teoría de la evolución darwiniana afirma que el

Neomicina

Neomicina

Neomicina

Neomicina

Neomicina

Neomicina

Neomicina

Neomicina

Cephatoxime (Ce

30), Cephatoxime (Ce

30),

30),

30),

30),

30),

30),

30),

30),

Cephatoxime (Ce

Cephatoxime (Ce

Cephatoxime (Ce

Cephatoxime (Ce

Cephatoxime (Ce

Cephatoxime (Ce

Cephatoxime

(Ce 30),

30),

30),

30),

30),

30),

30),

30),

30),

Oxacilina (Ox

Oxacilina (Ox

Oxacilina (Ox

Oxacilina (Ox

Oxacilina (Ox

Oxacilina (Ox

Oxacilina (Ox

Oxacilina (Ox

Oxacilina (Ox

1),

1),

1),

1),

1),

1),

1),

1),

1),

Sulfadiazina (SZ 100), Tetraciclina

Sulfadiazina (SZ

Sulfadiazina (SZ

Sulfadiazina

(SZ 100),

100),

100),

Tetraciclina

Tetraciclina

Tetraciclina (T(T(T(T 30),

30),

30),

30),

desarrollo de los antibióticos y resistentes a los pesticidas es una evidencia de moléculas para el

hombre teoría dedede lalala evolución [5]

hombre teoría

hombre teoría

evolución [5]

evolución [5]

...

Persistencia dedede pesticidas entre las bacterias del suelo eseses ununun

Persistencia

Persistencia

pesticidas entre las bacterias del suelo

pesticidas entre las bacterias del suelo

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

Ni Florida oxaci (Nx

(Nx 10),

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

Cefozolin (CZ

Ni Florida oxaci (Nx 10), Cefozolin (CZ 30)

Ni Florida oxaci

10),

10),

10),

10),

10),

10),

10),

30)

30)

30)

30)

30)

30)

30)

Cefozolin (CZ 30) yyyyyyyyy cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol

cloranfenicol (C(C(C(C(C(C(C(C(C 30). Los discos

antibióticos estándar

antibióticos estándar

antibióticos estándar

antibióticos estándar

antibióticos estándar

antibióticos estándar

antibióticos estándar

antibióticos estándar

Los discos dedededededededede antibióticos estándar sesesesesesesesese

Los discos

Los discos

Los discos

Los discos

Los discos

Los discos

30). Los

30).

30).

30).

30).

30).

30).

30).

discos

colocaron sobre la superficie del agar agar andMSM contenía placas de 0,4% de insecticida

(monocrotofos) con bacterias curados y no curados eran simples rayada. Las placas se incubaron a

3737 CC durante

durante 2424 hh yy sese observó para el crecimiento bacteriano. Las muestras bacterianas nono curadas

observó para el crecimiento bacteriano. Las muestras bacterianas

curadas

mostraron crecimiento en agar normal de MSM (0,4% y diferentes concentraciones de disco

antibiótico) pero las cepas bacterianas curados fracasado para crecer en agar MSM suplementado

con insecticida y antibióticos.

proceso de evolución por una selección natural, donde una contaminación de pesticidas sensibles se

hizo resistente [17]

hizo resistente [17]

hizo resistente [17]

...

poblaciones resistencia aaa los insecticidas han aumentado dedede 5,0

poblaciones resistencia

poblaciones resistencia

los insecticidas han aumentado

los insecticidas han aumentado

5,0

5,0

101010 222 aaa 7,8

7,8

7,8

101010 333 ((( CFU

CFU /// g) entre el suelo continuamente

CFU

g)

g)

entre el suelo continuamente

entre el suelo continuamente

expuestos aaa pesticidas durante ununun período

expuestos

expuestos

pesticidas durante

pesticidas durante

período

período dedede más

más dedede diez años ((( Tabla

más

diez años

diez años

Tabla

Tabla S1S1S1 ).).).

  • 3.2. tolerancia Insecticida de bacterias

  • 2.8. análisis estadístico

Los insecticidas concentraciones inhibitorias mínimas se llevaron a cabo por duplicado. Un

modelo dedede ANOVA

modelo

modelo

ANOVA dedede una sola vía [sesenta yyy cinco]

ANOVA

una sola vía [sesenta

una sola vía [sesenta

cinco]

cinco] sesese utilizó para determinar

utilizó para determinar lalala significación

utilizó para determinar

significación

significación

estadística fififi cance

estadística

estadística

cance dedede lalala biorremediación por los aislados enenen diferentes condiciones dedede entorno.

cance

biorremediación por los aislados

biorremediación por los aislados

diferentes condiciones

diferentes condiciones

entorno.

entorno.

medio de sal mínimo que contenía diferentes concentraciones de pesticidas se utilizó para

comprobar sususu resistencia

comprobar

comprobar

resistencia aaa pesticidas [8,42,80]

resistencia

pesticidas [8,42,80]

pesticidas [8,42,80]

...

Las bacterias desarrollan resistencia como ununun

Las bacterias desarrollan resistencia como

Las bacterias desarrollan resistencia como

fenómeno de la selección natural

[24]

[24]

[24]

[24]

....

Con el finfinfinfin dededede evaluar

Con el

Con el

Con el

evaluar lalalala resistencia bacteriana 0,1

evaluar

evaluar

resistencia bacteriana 0,1 mi

resistencia bacteriana 0,1

resistencia bacteriana 0,1

mi

mi

mi

sesesese utilizó 1,0% dededede insecticida

utilizó 1,0%

utilizó 1,0%

utilizó 1,0%

insecticida

insecticida

insecticida

(monocrotofos). El crecimiento máximo 0,55 ±±± 0,02,

(monocrotofos). El crecimiento máximo 0,55

(monocrotofos). El crecimiento máximo 0,55

0,02,

0,02,

0.57

0.57

0.57

0.57

0.57

0.57

0.57

0.57

0.57

±±±±±±±±± 0,02, 0,56 ±±±±±±±±± 0,02

0,02, 0,56

0,02, 0,56

0,02, 0,56

0,02, 0,56

0,02, 0,56

0,02, 0,56

0,02, 0,56

0,02, 0,56

0,02

0,02

0,02

0,02

0,02

0,02

0,02

0,02 yyyyyyyyy 0,55

0,55 ±±±±±±±±± 0.03

0,55

0,55

0,55

0,55

0,55

0,55

0,55

0.03

0.03

0.03

0.03

0.03

0.03

0.03

0.03

Tabla S2S2S2S2S2S2S2S2S2 ))))))))) SeSeSeSeSeSeSeSeSe observaron

((((((((( Tabla

Tabla

Tabla

Tabla

Tabla

Tabla

Tabla

Tabla

observaron enenenenenenenenen

observaron

observaron

observaron

observaron

observaron

observaron

observaron

0,4% de pesticidas con MK-07, MK-11, MK-13 y MK-24 cepas, respectivamente, cuando se midió

espectrofotométricamente utilizando 620 nm.

  • 2.9. Docking análisis para comprender hidrolasa organofosforado proporciona resistencia a

múltiples fármacos

  • 3.3. Resistencia antibiótica

  • 2.9.1. La recuperación de la estructura de proteínas

De los 25 aislamientos, 4 cepas como MK-07, MK-11, MK-13, MK-24 se encontró que eran

La estructura cristalina de hidrolasa de organofósforo de altamente resistencia altamente resistencia altamente resistencia aaaaa 55555
La estructura cristalina de hidrolasa de organofósforo de
altamente resistencia
altamente resistencia
altamente resistencia aaaaa 55555 diferentes antibióticos como
altamente resistencia
altamente resistencia
diferentes antibióticos como
diferentes antibióticos como
diferentes antibióticos como lalalalala ampicilina (Amp 10), Estreptomicina (HLS 100), Cephatoxim
diferentes antibióticos como
ampicilina (Amp 10), Estreptomicina (HLS
ampicilina (Amp
ampicilina (Amp
ampicilina (Amp
10),
10),
10),
Estreptomicina
Estreptomicina (HLS
Estreptomicina (HLS
(HLS 100),
100),
100),
100),
Cephatoxim
Cephatoxim
Cephatoxim
Cephatoxim
Geobacillus (((( APAPAPAP ID: 3F4C) fue recuperado dededede Protein Data Bank (PDB) (((( http://www.rcsb.org/pdb
Geobacillus
Geobacillus
Geobacillus
ID: 3F4C) fue recuperado
ID: 3F4C) fue recuperado
ID: 3F4C) fue recuperado
Protein Data Bank (PDB)
Protein Data Bank (PDB)
Protein Data Bank (PDB)
http://www.rcsb.org/pdb
http://www.rcsb.org/pdb
http://www.rcsb.org/pdb ).).).).
(Ce
(Ce 30),
30),
Tetraciclina
Tetraciclina (T(T(T 30)
Tetraciclina
30) yyy cloranfenicol
30)
cloranfenicol
cloranfenicol
(DO
(DO 30) respectivamente
(DO 30) respectivamente
30)
respectivamente
((((( Tabla
Tabla S3S3S3S3S3 ;;;;; Figura
Tabla
Tabla
Tabla
Figura 11111 ).).).).). Mientras MK-02 encuentra para ser sensible aaaaa todos los fármacos utilizados enenenenen
Figura
Figura
Figura
Mientras MK-02 encuentra para ser sensible
Mientras MK-02 encuentra para ser sensible
Mientras MK-02 encuentra para ser sensible
Mientras MK-02 encuentra para ser sensible
todos los fármacos utilizados
todos los fármacos utilizados
todos los fármacos utilizados
todos los fármacos utilizados
  • 2.9.2. Recuperación de ligandos

Estructura molecular de monocrotofos, estreptomicina, ampicilina, cefotaxima, cloranfenicol y

el experimento. Sin embargo, las cepas como MK-01, MK

03, MK-05, MK-06, MK-08, MK-09, MK-12, MK-14, MK-15, MK-16, MK-17, MK-18, MK-19, MK-20,

tetraciclina tetraciclina tetraciclina (((( Tabla tetraciclina Tabla S4S4S4S4 )))) SeSeSeSe realizaron búsquedas enenenen lalalala base Tabla
tetraciclina
tetraciclina
tetraciclina (((( Tabla
tetraciclina
Tabla S4S4S4S4 )))) SeSeSeSe realizaron búsquedas enenenen lalalala base
Tabla
Tabla
realizaron búsquedas
realizaron búsquedas
realizaron búsquedas
base
base
base dededede datos contra PubChem
datos contra PubChem
datos contra PubChem
datos contra PubChem (((( http:
http:
http:
http:
MK-21, MK-22, MK-23 y MK-25 resultó ser intermitente resistentes a varios fármacos. formaciones
//www.ncbi.nlm.nih.

156

K. Rangasamy et al. /// Patogénesis microbiana 105 (2017) 153 mi 165

K.

K.

Rangasamy et al.

Rangasamy et al.

Patogénesis microbiana 105 (2017) 153 mi 165

Patogénesis microbiana 105 (2017) 153 mi 165

156 K. Rangasamy et al. /// Patogénesis microbiana 105 (2017) 153 mi 165 K. K. Rangasamy

Fig. 1. Las placas que muestran patrón de sensibilidad de antibióticos con diferentes antibióticos.

(Plate-I a, Bacilo sp., b. Bacillus cereus, do. Bacilo fififififififififififi UDA

(Plate-I a, Bacilo sp., b. Bacillus cereus, do. Bacilo

(Plate-I a, Bacilo sp., b. Bacillus cereus, do. Bacilo

(Plate-I a, Bacilo sp., b. Bacillus cereus, do. Bacilo

(Plate-I a, Bacilo sp., b. Bacillus cereus, do. Bacilo

(Plate-I a, Bacilo sp., b. Bacillus cereus, do. Bacilo

(Plate-I a, Bacilo sp., b. Bacillus cereus, do. Bacilo

(Plate-I a, Bacilo sp., b. Bacillus cereus, do. Bacilo

(Plate-I a, Bacilo sp., b. Bacillus cereus, do. Bacilo

(Plate-I a, Bacilo sp., b. Bacillus cereus, do. Bacilo

(Plate-I a, Bacilo sp., b. Bacillus cereus, do. Bacilo

bacilo turingiensico con probado con ampicilina, estreptomicina, cephatoxime, cloranfenicol

UDA yyyyyyyyyyy d. bacilo turingiensico con probado con ampicilina, estreptomicina, cephatoxime, cloranfenicol yyyyyyyyyyy tetraciclina. Plate-II. eeeeeeeeeee FFFFFFFFFFF GGGGGGGGGGG H. bacterias curar con antibióticos respectivo ampicilina,

UDA

UDA

UDA

UDA

UDA

UDA

UDA

UDA

UDA

d.

d.

d.

d.

d.

d.

d.

d.

d.

d.

bacilo turingiensico con probado con ampicilina, estreptomicina, cephatoxime, cloranfenicol

bacilo turingiensico con probado con ampicilina, estreptomicina, cephatoxime, cloranfenicol

bacilo turingiensico con probado con ampicilina, estreptomicina, cephatoxime, cloranfenicol

bacilo turingiensico con probado con ampicilina, estreptomicina, cephatoxime, cloranfenicol

bacilo turingiensico con probado con ampicilina, estreptomicina, cephatoxime, cloranfenicol

bacilo turingiensico con probado con ampicilina, estreptomicina, cephatoxime, cloranfenicol

bacilo turingiensico con probado con ampicilina, estreptomicina, cephatoxime, cloranfenicol

bacilo turingiensico con probado con ampicilina, estreptomicina, cephatoxime, cloranfenicol

bacilo turingiensico con probado con ampicilina, estreptomicina, cephatoxime, cloranfenicol

tetraciclina. Plate-II.

tetraciclina. Plate-II.

tetraciclina. Plate-II.

tetraciclina. Plate-II.

tetraciclina. Plate-II.

tetraciclina. Plate-II.

tetraciclina. Plate-II.

tetraciclina. Plate-II.

tetraciclina. Plate-II.

tetraciclina. Plate-II.

H.

H.

H.

H.

H.

H.

H.

H.

H.

H.

bacterias curar con antibióticos respectivo ampicilina,

bacterias curar con antibióticos respectivo ampicilina,

bacterias curar con antibióticos respectivo ampicilina,

bacterias curar con antibióticos respectivo ampicilina,

bacterias curar con antibióticos respectivo ampicilina,

bacterias curar con antibióticos respectivo ampicilina,

bacterias curar con antibióticos respectivo ampicilina,

bacterias curar con antibióticos respectivo ampicilina,

bacterias curar con antibióticos respectivo ampicilina,

bacterias curar con antibióticos respectivo ampicilina,

estreptomicina, cephatoxime, cloranfenicol y tetraciclina).

de drogas mutantes resistentes son bastante comunes donde el uso indiscriminado de insecticidas o

antibióticos (Dzidic, 2007; [52]

antibióticos (Dzidic, 2007; [52]

antibióticos (Dzidic, 2007; [52]

...

incidencia dedede resistencia

LaLaLa incidencia

incidencia

resistencia aaa los medicamentos son muy comunes

resistencia

los medicamentos son muy comunes

los medicamentos son muy comunes

debido a las bacterias que residen en el entorno pueden transferir los genes de resistencia tanto

vertical como horizontalmente [18] ...

vertical como horizontalmente [18]

vertical como horizontalmente [18]

  • 3.4. La degradación de insecticida

insecticidas organofosforados son amenaza para problemas dedede salud humana [67]

insecticidas organofosforados son amenaza para problemas

insecticidas organofosforados son amenaza para problemas

salud humana [67]

salud humana [67]

...

Diferentes

Diferentes

Diferentes

tipos de bacterias presentes en el suelo son capaces de degradingmany plaguicidas persistentes y

sususu hidrolizado fácilmente aaa residuos

hidrolizado fácilmente

hidrolizado fácilmente

residuos dedede plaguicidas degradables [14] Pesticidas degradadores son

residuos

plaguicidas degradables [14] Pesticidas degradadores son

plaguicidas degradables [14] Pesticidas degradadores son

capaces de convertir metabolitos de monocrotofos como fuente de carbono como la energía también.

análisis metabólico de la degradación de pesticidas han revelado ciclohexanona, isoxazol, indol 3

piridina, fenol, 6Methyl-4-fenil-quinazolina, pro-piophenone, benzo [h] quinolina) los principales

productos. Comparativamente MK-07 encontrado para degradar la mayoría de los derivados como 11

compuestos más de 19 compuestos. Mientras MK-11, MK-13 y MK-24 fueron capaces de degradar

10, 99999 yyyyy 55555 residuos, respectivamente ((((( tabla

10,

10,

10,

10,

residuos, respectivamente

residuos, respectivamente

residuos, respectivamente

residuos, respectivamente

tabla

tabla

tabla

tabla 11111 yyyyy Figura

Figura

Figura

Figura

Figura 22222 ).).).).).

3.6.

3.6.

3.6.

pro ADN dedede plásmido

pro ADN

pro ADN

plásmido

plásmido fififi LeLeLe

bacterias dedededede Plaguicidas degradar paradoxus Alcaligenes yyyyy Alcaligenes eutrophus contiene

bacterias

bacterias

bacterias

bacterias

Plaguicidas degradar paradoxus Alcaligenes

Plaguicidas degradar paradoxus Alcaligenes

Plaguicidas degradar paradoxus Alcaligenes

Plaguicidas degradar paradoxus Alcaligenes

Alcaligenes eutrophus contiene

Alcaligenes eutrophus contiene

Alcaligenes eutrophus contiene

Alcaligenes eutrophus contiene

plásmidos como pJP3, PJP4, pJP5 yy pJP7 que tienen masa molecular

plásmidos como pJP3, PJP4, pJP5

pJP7 que tienen masa molecular dede 5151 MDa (Don yy Prmberton, [21]

MDa (Don

Prmberton, [21]

...

IncP plásmido identi fififi ededed yyy caracteriza

IncP plásmido identi

IncP plásmido identi

caracteriza lalala resistencia confiere aaa una antibióticos dedede espectro bordo yyy

caracteriza

resistencia confiere

resistencia confiere

una antibióticos

una antibióticos

espectro bordo

espectro bordo

metales pesados ​​(Popowska yyy Balska, [56]

metales pesados ​​(Popowska

metales pesados ​​(Popowska

Balska, [56]

Balska, [56]

...

agresiones químicas aumentan lalala frecuencia

agresiones químicas aumentan

agresiones químicas aumentan

frecuencia

frecuencia dedede las

las

las

respuestas de plásmido de ADN de las poblaciones de bacterias dentro de la estresado

químicamente comunidades del suelo [78]

químicamente comunidades del suelo [78]

químicamente comunidades del suelo [78]

químicamente comunidades del suelo [78]

químicamente comunidades del suelo [78]

.....

EnEnEnEnEn este estudio, el plásmido dedededede ADN pro fififififi les

este estudio, el plásmido

este estudio, el plásmido

este estudio, el plásmido

este estudio, el plásmido

ADN pro

ADN pro

ADN pro

ADN pro

les

les

les

les dedededede los

los

los

los

los

aislados pRS11, pRS12 yyy pRS13 gama lalala acogida

aislados pRS11, pRS12

aislados pRS11, pRS12

pRS13 gama

pRS13 gama

acogida

acogida dedede 888 kb,

kb, 666 kbkbkb yyy 333 kbkbkb [41]

kb,

[41]

[41]

...

Insecticida degradar

Insecticida degradar

Insecticida degradar

poblaciones expuestas a bajo nivel de pesticida han enriquecido el plásmido número de copias sobre

las poblaciones que nonono fueron expuestos aaa plaguicidas. Pro plásmido

las poblaciones que

las poblaciones que

fueron expuestos

fueron expuestos

plaguicidas. Pro plásmido

plaguicidas. Pro plásmido fififi LeLeLe análisis expositoras

análisis expositoras

análisis expositoras

aumentos en el número de copias de plásmidos están involucrados en la degradación de plaguicidas

Fig. 444 ).).).

((( Fig.

Fig.

3.7.

3.7.

3.7.

oph parcial yyy mdr ampli gen

oph parcial

oph parcial

mdr ampli gen

mdr ampli gen fififi análisis

análisis

análisis dedede cationes

cationes yyy lalala comparación

cationes

comparación

comparación

3.5.

3.5.

3.5.

identi filogenético fififi cación

identi filogenético

identi filogenético

cación

cación dedede los aislados

los aislados

los aislados

Los cultivos fueron identi fififififi ededededed basado

Los cultivos fueron identi

Los cultivos fueron identi

Los cultivos fueron identi

Los cultivos fueron identi

basado enenenenen las similitudes enenenenen lalalalala secuencia

basado

basado

basado

las similitudes

las similitudes

las similitudes

las similitudes

secuencia

secuencia

secuencia

secuencia dedededede 16S rRNA. ampli

16S rRNA. ampli

16S rRNA. ampli

16S rRNA. ampli

16S rRNA. ampli fififififi cación

cación

cación

cación

cación

de ADN bacteriano por 16S rRNA PCR fue seguido con cebadores universales (27f y 1492).

Mediante la secuenciación de los genes 16S rRNA de MK-07, MK-11, MK-13 y MK-24 y

comparándolas con las secuencias del gen 16S rRNA previamente publicados. La secuencia se

presentan identidad (>(>(>(>(> 90%) con el 16S rRNA

presentan identidad

presentan identidad

presentan identidad

presentan identidad

90%) con el 16S rRNA

90%) con el 16S rRNA

90%) con el 16S rRNA

90%) con el 16S rRNA dedededede homología

homología

homología

homología

homología dedededede secuencia

secuencia

secuencia

secuencia

secuencia ((((( Fig.

Fig. 33333 ))))) Fueron identi fififififi ededededed

Fig.

Fig.

Fig.

Fueron identi

Fueron identi

Fueron identi

Fueron identi

como miembro de la

Gen sesesesesesese identificó

Gen

Gen

Gen

Gen

Gen

Gen

identificó fififififififi ededededededed basado

identificó

identificó

identificó

identificó

identificó

basado

basado

basado

basado

basado

basado enenenenenenen ampli

ampli

ampli

ampli

ampli

ampli

ampli fififififififi cación

cación dedededededede ADN plásmido bacteriano por el gen especí

cación

cación

cación

cación

cación

ADN plásmido bacteriano por el gen especí fififififififi cebadores

ADN plásmido bacteriano por el gen especí

ADN plásmido bacteriano por el gen especí

ADN plásmido bacteriano por el gen especí

ADN plásmido bacteriano por el gen especí

ADN plásmido bacteriano por el gen especí

cebadores

cebadores

cebadores

cebadores

cebadores

cebadores

c (gen OPH era MK: oph-FP, MK: oph-RP y el gen mdr fue MK: mdr-FP, MK: mdr-RP). El tamaño de

los fragmentos sesese determinó por comparación con 111 marcador

los fragmentos

los fragmentos

determinó por comparación con

determinó por comparación con

marcador

marcador kbkbkb (NEB) 1400 pbpbpb ((( Fig.

(NEB) 1400

(NEB) 1400

Fig.

Fig. 666 ).).). métodos

métodos dedede

métodos

secuenciación dedede Sanger analizaron parcialmente (secuencia Forward). Por especí aislado fififi genes

secuenciación

secuenciación

Sanger analizaron parcialmente (secuencia Forward). Por especí aislado

Sanger analizaron parcialmente (secuencia Forward). Por especí aislado

genes ccc

genes

oph yyy mdr

dedede oph

oph

mdr dedede MK-07

mdr

MK-07 ((( Bacilo Sps) bacterias

MK-07

Bacilo Sps) bacterias yyy secuenciación

Bacilo Sps) bacterias

secuenciación enenen comparación con las secuencias

secuenciación

comparación con las secuencias

comparación con las secuencias

de genes previamente publicado (explosiva-N). La secuencia de ORF identidad se presentan (> 60%)

con el unpredicted bacilo

con el unpredicted bacilo

Bacilo Sps (KU510395). Bacillus cereus

Bacilo Sps (KU510395). Bacillus cereus

Bacilo Sps (KU510395). Bacillus cereus

Bacilo Sps (KU510395). Bacillus cereus

Bacilo Sps (KU510395). Bacillus cereus

Bacilo Sps (KU510395). Bacillus cereus

KU510396), Bacilo

KU510396), Bacilo

KU510396), Bacilo

KU510396), Bacilo

KU510396), Bacilo

KU510396), Bacilo

Bacilo Sps (KU510395). Bacillus cereus ((((((( KU510396), Bacilo fififififififi UDA

UDA

UDA

UDA

UDA

UDA

UDA

proteína dedede homología

proteína

proteína

homología dedede secuencia

homología

secuencia sesese identificaron

secuencia

identificaron fififi secuencias oph ededed yyy mdr (KY420134 KY420133

identificaron

secuencias oph

secuencias oph

mdr (KY420134 KY420133

mdr (KY420134 KY420133

y) se presentaron en GenBank. herramienta de alineamiento por pares (Clustal-w) entre estos genes

(KU510397) yyy Bacillus thuringiensis ((( KU510398)

(KU510397)

(KU510397)