Sie sind auf Seite 1von 27

Accepted Manuscript

Title: Design of a fermentation process for agave


fructooligosaccharides production using endo-inulinases
produced in situ by Saccharomyces paradoxus

Authors: S.R. Sandoval-González, H. Jiménez-Islas, J.L.


Navarrete-Bolaños

PII: S0144-8617(18)30729-X
DOI: https://doi.org/10.1016/j.carbpol.2018.06.075
Reference: CARP 13749

To appear in:

Received date: 9-3-2018


Revised date: 11-6-2018
Accepted date: 15-6-2018

Please cite this article as: Sandoval-González SR, Jiménez-Islas H, Navarrete-Bolaños


JL, Design of a fermentation process for agave fructooligosaccharides production using
endo-inulinases produced in situ by Saccharomyces paradoxus, Carbohydrate Polymers
(2018), https://doi.org/10.1016/j.carbpol.2018.06.075

This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.
Design of a fermentation process for agave fructooligosaccharides production using

endo-inulinases produced in situ by Saccharomyces paradoxus

Saccharomyces paradoxus: A novel strain that synthesize endo-inulinases to produce

agave fructooligosaccharides

PT
Sandoval-González S.R., Jiménez-Islas, H., Navarrete-Bolaños, J.L.†

RI
Departamento de Ingeniería Bioquímica-Ciencias de la Ingeniería. Instituto Tecnológico de

SC
Celaya. Av. Tecnológico s/n. CP 38010. Celaya Gto. México. †Corresponding author: e-

mail: luis.navarrete@itcelaya.edu.mx.

U
N
A
Highlights:
M

 A methodology to evolve from spontaneous to directed fermentation is shown.


 A stepwise methodology to designing feasible fermentation processes is proposed.
 The importance of using native strains in the design of directed fermentation
D

processes is confirmed.

TE

Saccharomyces paradoxus as promising strain for producing endo-inulinases is


proposed.
EP

Abstract
CC

Saccharomyces paradoxus, a native microorganism of the aguamiel, was used successfully


A

for endoinulinase synthesis for agave fructooligasaccharide (FOS) production. We

optimized the fermentation parameters to maximize the enzyme synthesis, and we

performed enzyme kinetics studies to achieve agave fructans hydrolysis. The results

showed that under constant operating conditions (pH 7.7, 40 °C, 175 rpm of agitation, and

1
0.005 VVM of aeration) results in the production of an enzymatic extract with 49.57 mg/L.

This enzymatic extract, when mixed with an agave fructans solution containing 37.8 g/L,

allowed us to obtain products with 18% more FOS content the original concentration. The

mass spectrum plot shows that the hydrolyzed product contains FOS with a degree of

PT
polymerization from 5 to 9 hexose units. These results are promising because they show

FOS production from agave and confirm that importance of using native strains in the

RI
design of directed fermentation processes.

SC
KEYWORDS: agave fructans, fructooligosaccharides production, endoinulinases,

Saccharomyces paradoxus.

U
1. Introduction N
A
Fructans are a heterogeneous mixture of fructose polymers linked by β-(2→1) bonds, in
M

which fructosyl units are bound to a D-glucose residue at the terminal reducing end by an

α-(1→2) bond (Sánchez et al., 2008; de Oliveira et al., 2011; Singh et al., 2016). According
D

to the type of linkage and structure, the fructans are classified into several categories,
TE

including inulins (lineal (2→1) link), levans (lineal (2→6) link), graminans (branched, with
EP

both β-(2→1) and β-(2→6) links), neo-inulin and neo-levan, formed from neo-kestose

(slightly branched, with both β-(2→1) and β-(2→6) links), and neo-fructans (highly
CC

branched, formed from neo-kestose with both β-(2→1) and β-(2→6) links) (Vijn &

Smeekens, 1999; van den Ende et al., 2004; Livingston et al. 2009; Santiago-García and
A

López, 2009). Other fructans, with lineal structure and a (2→1) link, are known as

fructooligosaccharides (FOSs), the difference in the inulin being the length of the polymer

chain, which is shorter for FOSs, with a degree of polymerization from three to 10 fructose

2
molecules, which apparently confers better technical applications and nutritional properties

than any other fructans on it, including inulin (Sanchez et al. 2008; Chen & Liu, 1996;

Santiago-García & López, 2009; Ávila-Fernández et al. 2011; Mutanda et al., 2014). Based

on the above, three different methods for FOS production have been developed: (1)

PT
extraction from certain foods or plant materials where FOSs are naturally present; (2)

enzymatic synthesis from sucrose; and (3) enzymatic hydrolysis of inulin. Of these, the

RI
extraction process from natural sources is not viable, due to low concentrations (Sangeetha

SC
et al., 2005; Sánchez et al., 2008; Dominguez et al., 2012; Mutanda et al., 2014; Zeng et al.,

2016; Singh et al., 2016; Xu et al., 2016). Enzymatic synthesis from sucrose, using

U
enzymes with transfructosylation activity (i.e., β-fructosyltransferase (EC 2.4.1.9) and β-

N
fructofuranosidase (EC 3.2.1.26), it is not viable either because the yields achieved are low,
A
seemingly due to the presence of glucose, which inhibits the fructosyl-transfer reaction, and
M

the high enzyme cost (Sangeetha et al., 2005; Mutanda et al., 2008; Dominguez et al., 2012;

Vega-Paulino & Zúniga-Hansen, 2012; Lorenzoni et al., 2014; Zeng et al., 2016). The
D

enzymatic hydrolysis of inulin, using commercial enzymatic solutions with endo-inulinase


TE

(EC 3.2.1.7) activity (which randomly breaks down the internal β-D-(2→1) glycosidic
EP

linkages, producing a mixture of FOSs, containing β-D-Fru(1→2)-[β-D-Fru(1→2)-]n,

where n=1-9, and α-D-Glu(1→2)-[β-D-Fru(1→2)-]n, where n=2-9) is seemingly the best


CC

option. This produces higher yields, which suggests that such enzyme preparations can be

used as viable alternatives for industrial FOS production (Singh et al., 2010, Singh et al.,
A

2016; Nguyen et al., 2011). The commercial exploitation of industrial biotransformations

using enzymes is heavily dependent on their cost, however, and often this process is

hampered by the lack of prolonged operational stability, and difficulties in recovering and

reusing the enzymes (Lorenzoni et al., 2015). Alternatives commonly used to overcome
3
such technical drawbacks are enzyme immobilization (which is only justified if the enzyme

is expensive, or is inactivated under reaction conditions), or in situ enzyme production by

selected microorganisms because of their easy cultivation and high yields, which is the best

way to obtain low-cost enzymatic preparations (Cadena et al., 2010; Vega-Paulino &

PT
Zúniga-Hansen, 2012; Xu et al., 2016).

In the last decade, interest in studying the functional properties of agave fructans has

RI
increased due the high content present in agave plants, which compares favorably with the

SC
fructans content present in chicory and Jerusalem artichoke (major natural sources of

fructans) (Silver, 2006), and studies that have indicated that agave fructans have a potential

U
prebiotic effect, similar to the one observed in established inulin-type prebiotics derived
N
from chicory root (Santiago-García and López, 2009; Gomez et al., 2010; Márquez-Aguirre
A
et al. 2013; Moreno-Vilet et al., 2014). These characteristics suggest that agave plants could
M

also be an abundant raw material for FOS production. Based on the above, the enzymatic
D

hydrolysis of agave fructans, using commercial endo-inulinase, has been performed, but
TE

due the complex structure of agave fructans, no hydrolysis products have been observed, or

they were not significant (Ávila-Fernández et al. 2011; Michel-Cuello et al., 2012;
EP

Huazano-García & López, 2017). Therefore, the production of FOSs from agave fructans

has been a technical challenge for the last few years. Nowadays, agave plants are exploited
CC

for the production of Mexican indigenous nonalcoholic (aguamiel), alcoholic nondistilled


A

(pulque), and distilled (tequila and mezcal) beverages, with national and international

recognition (Lappe-Oliveras et al., 2008). Aguamiel is the sugary sap obtained by

spontaneous fermentation in the previously prepared heart cavity of the agave plant

(Garcia-Aguirre et al., 2009). Studies have demonstrated that aguamiel contains some

4
native strains that have capacity for inulinase synthesis with exo-inulinase activity, and that

in their chemical composition are found presents the FOS. Therefore it is probably that in

the aguamiel is found native strains with capacity to synthesize endoinulinases (Cruz et al.,

2006; Ortiz-Basurto et al., 2008; Lappe-Oliveras et al., 2008; Garcia-Aguirre et al., 2009).

PT
On the other hand, previous studies have shown that the use of native strains from

spontaneous fermentations can produce high yields in directed fermentation with the best

RI
quality features of the final products and carry out conversions with more efficiency

SC
because the strains are naturally adapted to those ecological niches (Navarrete-Bolaños et

al., 2012).

U
On the basis of these observations, herein, a candidate native Saccharomyces isolate,
N
obtained from aguamiel samples and identified by molecular detection, was used in the
A
analysis of process variable parameters to maximize both the endo-inulinase synthesis and
M

the enzymatic hydrolysis of agave fructans. Such knowledge is needed in order to optimize
D

FOS production from agave fructans in a 3-L stirred-tank fermenter, so as to realize the
TE

ultimate goal of an efficient FOS production process, which can be scaled up to an

industrial level.
EP

2. Materials and Methods


CC

2.1 Agave juice


A

Mature 'hearts' or 'piñas' (plants without leaves) from six-year-old (on average) Agave

angustifolia, harvested from the Jalpilla locality of Comonfort Gto, Mexico, were cooked in

an autoclave at 90°C for 15 min, and pressed to obtain the agave juice containing the

5
fructans. This was stored at -79°C until it was needed. Other pines were milled and the pulp

fraction was also stored at -79°C until used.

2.2 Aguamiel

Samples of aguamiel obtained from traditional rural producers of Jalpilla locality of

PT
Comonfort Gto, Mexico were used for microbial ecology studies.

RI
2.3 Strain isolation

SC
Samples of aguamiel were taken and inoculated on Petri dishes containing nutritive agar

(Difco, Detroit, MI) for bacteria, potato dextrose agar (Difco, Detroit, MI) and malt extract

U
agar (MEA, Difco, Detroit, MI) for yeast and selective media formulated from aguamiel or
N
agave extract, plus bacteriological agar at 1.5% (v/w). The inoculations were performed by
A
taking 1 mL of aguamiel and spreading this amount onto the surface of each medium in the
M

Petri dishes. These were then incubated at 28, 32, and 37°C for 24, 48, and 72 h. The
D

colonies with different morphologies that developed were transferred to fresh agar media
TE

(nutritive, potato dextrose, and selective), and incubated again. The procedure was repeated

until pure cultures were obtained. To ensure the purity of the isolated colonies, during the
EP

whole isolation strategy, and at the end of every incubation period, the colonies developed
CC

were analyzed by microscopic (model DMRAX2, Leica Microsystems GmbH, Wetzlar,

Germany) methods, using staining techniques, and biochemical tests, using an API
A

Biochemical card (API CAUX, API 20E, and 20NE).

2.4 Enzymatic extract production

6
The pure bacteria and yeast strains that were isolated were cultured in potato dextrose (for

yeast) and nutritive (for bacteria) agar slants at 28°C for 48 h (representing the best

conditions for growth). Biomass samples were taken from each slant and transferred to 250

mL Erlenmeyer flasks containing 100 mL of nutritive broth (Difco, Detroit, MI) for

PT
bacteria, and potato dextrose broth (Difco, Detroit, MI) for yeast. These were mixed and

incubated at 28°C and 100 rpm for 48 h on a rotary shaker (model 4520, Forma Scientific,

RI
Marietta, OH) for culture propagation. The final product obtained from each Erlenmeyer

SC
flask propagation was centrifuged at 10,000 g (Hermle, model Z383). The supernatant

obtained was used as a source of extracellular enzyme, or crude enzymatic extract. All

U
crude enzymatic extracts obtained were analyzed, according to the Bradford method

N
(1976), to quantify the amount of synthesized enzyme. The endo-inulinase activity was
A
measure by mixing 50 mL of each enzymatic extract with 100 mL of a fructans solution of
M

80 g/L, and incubated on a rotary shaker at 28°C and 100 rpm for 24 h, followed by both

high-performance liquid chromatography (HPLC) and liquid chromatography–mass


D

spectrometry (LC-MS) analyses to quantify changes in the degree of polymerization


TE

profile.
EP

2.5 Strain identification


CC

Once the strain had been selected, molecular identification was performed, which included

ribosomal sequence analysis of the 5.8S rRNA gene and two ribosomal internal transcribed
A

spacers ITS1 (5`–TCCGTAGGTGAACCTGCGG–3`) and ITS4 (5`–

TCCTCCGCTTATTGATATGC–3`), which were amplified by polymerase chain reaction

(PCR), followed by restriction analysis using endonucleases. The method is based on

genomic DNA extraction from selected strains, according to the protocol proposed by

7
Ausubel et al. (1999), using an InvitrogenTM column from the PureLinkTM Genomic DNA

set. For rRNA gene amplification, the DNA extracted was mixed with PCR supermix

(Invitrogen, Carlsbad, CA) containing high-fidelity DNA polymerase (Invitrogen). The

PCR was performed under the following conditions: initial denaturalization at 95°C, for 5

PT
min, 35 cycles, with 1 min of denaturation at 95°C, 2 min of annealing at 50, 52, 54, 56,

and 58°C, 2 min of extension at 72°C, and a final extension for 10 min at 72°C. The PCR

RI
products were purified with the QIAquick® Gel Extraction Kit (QIAGEN® Group). Once

SC
purified, the products were sending to the Laboratorio Nacional de Genómica para la

Biodiversidad (LANGEBIO) of the Cinvestav Irapuato, Gto. México, for nucleotide

U
sequencing which was occurred using the Sanger technique on an Applied Biosystems

N
Automated 3730xl DNA Analyzer (Applied Biosystems by Life Technologies, Carlsbad,
A
CA, USA) and a BigDye® Terminator v3.1 Cycle Sequencing Kit (Invitrogen). The
M

sequence was compared with those reported on the National Center for Biotechnology

Information (NCBI) database using the 'Blasrx' algorithm for strain identification.
D
TE

2.6 Experimental design for endo-inulinase synthesis maximization at bioreactor level

Using the selected strain, an experimental strategy for maximization of endo-inulinase


EP

synthesis, in a stirred-vessel bioreactor, was developed. The following variables were


CC

considered: V1, acidity (expressed as pH) (temperature); V2, temperature (acidity); V3,

agitation; V4, aeration. These variables were singled out on the basis of their relationships
A

with the biomass growth and metabolic activities (temperature and pH), and their

relationships with the heat and mass transfer limitations in the batch reactor (agitation and

aeration). Agitation and aeration are essentially collinear variables affecting the oxygen

transfer rate, which implicitly affects microbial growth, substrate transformation, and

8
synthesis of the product. The feasible ranges for these variables were defined, on the basis

of a preliminary screening design (not shown), as being 3-7 for pH (V1), 25-35°C for

temperature (V2), 100-200 rpm for agitation (V3), and 0.5-1.5 vvm for aeration (V4), which

were used as boundaries of the search region to construct a central composite experimental

PT
design (Table 1). For this study, a 3-L stirred-tank bioreactor (AZ control bioreactor,

Applikon Dependable Instruments, Schiedam, Netherlands) was used. In all experimental

RI
fermentations, the starter inoculum concentration (1.0×106 cells/mL), volume medium (1.5

SC
L), and composition medium (Difco, PDB broth) were kept constant. The output functions

were both the enzyme quantity synthesized (measured as protein) (Y1), and biomass yield

U
(Y2).

2.7 Enzyme kinetics studies


N
A
M

To define the ratio among the quantity of enzymatic extract to substrate to maximize the

FOS yield, an enzyme kinetics study was performed. The study began with exploratory
D

assays of mixtures among an enzymatic extract (e.g., 50 mL) that had an enzyme
TE

concentration of 15.88 mg/L of total protein (on average), and substrate solutions (e.g., 25

mL) with different concentrations (from 60 to 200 g/L) at a ratio of 2:1 (enzyme
EP

volume:substrate volume). Once homogenized, the mixtures were incubated at 30°C and
CC

150 rpm for 192 h on a rotary shaker (Model 4520, Forma Scientific, Marietta, OH, USA),

taking samples each 24 h for FOS analysis. When a good approximation of the
A

enzyme:substrate ratio had been reached, the initial reaction rate (V0) was measured to

determine the reaction time. With this information, the effects of varying the conditions of

the reaction were investigated, first for substrate solutions with different concentrations

mixed with an enzymatic extract containing a constant content of enzyme in a ratio of 2:1,

9
followed for mixtures of different enzymatic extracts volume with protein constant

concentration (15.88 mg/L) and different volume substrate solutions of constant

concentration (80 g/L) to obtain different (enzyme volume:substrate volume) ratios (from

4:1 [e.g., 60 mL of enzymatic extract with 15 mL of substrate solution] to 1:4 [e.g., 15 mL

PT
of enzymatic extract with 60 mL of substrate solution]). All final reaction samples were

evaluated for HPLC and LC-MS to measure de reaction advance

RI
2.8 High performance liquid chromatography (HPLC) analysis

SC
To ensure that the enzymatic extracts had endo-inulinase activity, mixtures of enzymatic

U
extracts with fructans solutions were filtered through Millipore membranes of 45-μm pore-

N
diameter. Samples consisting of 20 μL of hydrolyzed extract were injected to the HPLC.
A
The equipment used for the HPLC assays was modular equipment (Agilent Technologies
M

1200 Series) that included a G1322 vacuum degasser, G1311 quaternary pump, G1329

autosampler (ALS), G1316 thermostatted column compartment, G1315 diode array


D

detector, and the OpenLAB chromatography management system for computer control
TE

(Agilent Technologies Hewlett-Packard-Strasse, 876337 Waldbronn, Germany). The

polymer profiles were obtained using a column of Prevail Carbohydrate ES 5µm, 250×4.6
EP

mm (Alltech, Grace Davison Discovery Sciences, Chicago IL, USA). The solvent elution
CC

was operated at 1.0 mL/min of a mixture containing acetonitrile (A) and water-ammonium

hydroxide (B) (in proportions of 99.96-0.04 v/v, respectively) in gradient concentrations of


A

83%-A and 17%-B from 0 to 25 min, 73%-A and 27%-B from 25 to 40 min, 55%-A and

45%-B from 40 to 80 min, and 45%-A and 55%-B from 80 to 120 min. The separation was

performed at 40˚C, and the sugars were monitored using a refractive index detector

(G1362). A comparison of retention time with external standards, followed by estimates of

10
concentration, using the relative percentage area covered in the chromatogram, was used to

calculate sugar concentrations. To establish the reference for the hydrolysis products, the

following carbohydrates were used as standards: D-fructose, D-glucose, sucrose, 1-kestose,

1-nystose, and 1-fructofuranosylnystose produced by Merk (Sigma-Aldrich, St. Louis MO,

PT
USA).

2.9 Liquid chromatography–mass spectrometry (LC-MS) analysis

RI
To determine the degree of polymerization for both the external standards and the samples

SC
enzymatically treated, a LC-MS coupled system (model LTQ XL, Thermo Scientific,

U
Waltham MA, USA) was used and developed a method to quantify the carbohydrate

N
distribution. This system offers a high capacity linear trap with two detectors, electrospray
A
ionization, atmospheric pressure chemical ionization, and multiple molecular dissociation
M

techniques, including pulsed Q collision-induced dissociation, electron transfer

dissociation, and collision-induced dissociation. The samples were analyzed by direct


D

infusion at 180 μL per hour, with substrate concentrations from 0.6% (w/v), and recording
TE

the mass spectra in positive mode in a range of 100-2000 m/z. Data were acquired, and

analyses were performed, using Xcalibur software.


EP

Statistical analysis. The results from the experimental designs were analyzed using a
CC

statistical framework, on the basis of analysis of variance procedures with normal

probability distribution values for a confidence interval of 95% (α=0.05), and variable
A

optimization, based on response surface methodology, which included data analysis using

least squares to construct mathematical models that described the relationship between the

factors (process parameters) and the output function (FOS yield).

11
3. Results and discussion

3.1 Microbial ecology studies

Twenty (X1+X2+X3+.....+X20) pure cultures were isolated from the aguamiel. Seven (X2,

X6, X10, X11, X13, X15, and X17) presented characteristics of bacteria, and 13 (X1, X3, X4, X5,

PT
X7, X8, X9, X12 X14, X16, X18, X19, X20) of yeast. The enzymatic extract obtained from each

RI
one showed that nine (eight yeast: X1, X3, X4, X5, X7, X8, X12, X14, one bacterium: X15)

synthesized mainly enzymes with exo-inulinase activity, four (three yeast: X16, X19, X20,

SC
one bacterium: X6) synthesized mainly enzymes with endo-inulinase activity, two yeast (X9

U
and X18) synthesized both exo- and endo-inulinase enzymes, and the others (X2, X10, X11,

N
X13, X15, and X17) did not exhibit enzyme inulinase activity. Seemingly, the strains that
A
synthesized either exo- and/or endo-inulinase activity acted synergistically with each other,
M

and the degree of synergy must affect the level of fructose formation, and the sweetness of

the aguamiel. Probably, the endo-inulinase is the first enzyme to act in the agave fructans
D

hydrolysis, to produce a wide range of fructo- and/or oligosaccharides, which are converted
TE

to fructose afterwards by exo-inulinase enzyme activity, in order to produce high yields in a

short processing time. The strains that did not show enzyme inulinase activity are probably
EP

found in ecological partnerships, as commensals or parasites, that do not alter the stability
CC

of the fructanolitic microorganisms, but they must have a specific objective or contribution

to the aguamiel, such as quality features, or acting in the fermentation process that converts
A

sugars into ethanol to produce pulque, a traditional Mexican alcoholic beverage, produced

from the fermentation of the fresh sap (aguamiel) extracted from several species of Agave

(maguey) plants that grow on the central Mexico plateau. Evaluation of the enzymatic

extract that contained the endo-inulinase activity showed that the enzymatic extract from

12
the X16 strain presented the highest enzyme content, achieved the most agave fructans

hydrolysis, and the best FOS content.

3.2 Strain identification

Once the strain X16 was identified as the best culture for endo-inulinase synthesis and

PT
maximum FOS yield from agave fructans hydrolysis, we proceeded with the strain

RI
identification. The results of the nucleotide sequencing analysis, which was deposited in

GenBank under accession MH032820, showed that X16 is Saccharomyces paradoxus by a

SC
99.8% identity score (0% expectancy), a strain that is the closest known relative of the

U
well-known S. cerevisiae, which has also been shown to be a strain with possibilities for

N
application in the wine industry, but has never been shown as a endo-inulinase-producer
A
strain (Orlic et al., 2007).
M

3.3 Optimization variables for inulinase synthesis maximization


D

Once S. paradoxus was selected as the best native strain for endo-inulinase production, an
TE

experimental strategy for bioreactor process variable optimization was developed.

Table 1. Central composite design (24+2c+8α) performed to optimize the fermentation


EP

parameters and maximizing the endoinulinase synthesis by S. paradoxus.


X1 X2 X3 X4 YP
Assay
(pH) (Temperature) (agitation) (aeration) (mg/L)
CC

1 5 30 150 1.0 25,42


2 5 30 150 1.0 26,88
3 3 25 200 1,5 1.00
A

4 5 30 250 1.0 13,18


5 3 25 100 1,5 2,52
6 7 35 100 0,5 49,30
7 7 35 100 1,5 35,98
8 7 25 100 1,5 23.00
9 7 25 200 1,5 15,39
10 7 25 100 0,5 37,69

13
11 3 35 100 1,5 5,36
12 5 20 150 1.0 17,60
13 9 30 150 1.0 2.00
14 7 35 200 1,5 32,90
15 7 25 200 0,5 28,81
16 5 30 150 2.0 15,47
17 5 30 50 1.0 19,52
18 3 35 200 0,5 22,59

PT
19 3 35 100 0,5 1.50
20 3 25 100 0,5 10,92
21 7 35 200 0,5 41,79

RI
22 5 30 150 0.0 21,49
23 1 30 150 1.0 1.20

SC
24 3 25 200 0,5 1.80
25 5 40 150 1.0 27,25
26 3 35 200 1,5 13,82

U
N
The results (last column of Table 1) revealed that, based on the analysis of variance, only
A
the pH variable exhibited a significant effect within their defined limits (p<0.05) for both
M

output functions. The other variables that were not significant suggested the presence of an

inflection point, which could be a maximum or a minimum. Therefore, the results were
D

used to construct a second-order polinomial model, using the least squares method, to
TE

describe the relationship that exists among the independent variables (temperature,
EP

agitation and aeration) and dependent variables (endo-inulinase synthesis: YP), by obtaining

the following expression:


CC

𝑌1 = −7.18 + 19.92 𝑉1 − 2.18 𝑉2 − 0.077 𝑉3 + 5.45 𝑉4 + 1.4 𝑉12 + 0.17 𝑉1 𝑉2


A

− 0.028 𝑉1 𝑉3 − 2.41𝑉1 𝑉4 + 0.001𝑉22 + 0.013𝑉2 𝑉3 + 0.27𝑉2 𝑉4 − 0.0006𝑉32

− 0.00007𝑉3 𝑉4 − 3.88𝑉42

The model was also analyzed based on the analysis of variance, which did not show a

statistically significant relationship (p<0.05) between the output function and the process

14
parameters among the defined limits; however, when the models were used to construct

response plots, these showed the presence of a maximum, which suggests the presence of a

global optimum (Figure 1). Therefore, on the basis of this model, the location of the

optimum that maximizes the in situ endoinulinase production was accurately computed via

PT
derivation of the second-order model, and the solution of the resulting set of linear

equations:

RI
𝜕𝑌1
= 19.92 – 2(1.4)𝑉1 + 0.17𝑉2 – 0.028𝑉3 − 2.41𝑉4
𝜕𝑉1

SC
𝜕𝑌1
= −2.18 + 0.17𝑉1 + (2)(0.001)𝑉2 + 0.031𝑉3 + 0.027𝑉4

U
𝜕𝑉2

𝜕𝑌1
N
= −0.077 – 0.028𝑉1 + 0.013𝑉2 – (2)(0.0006)𝑉3 − 0.00007𝑉4
A
𝜕𝑉3
M

𝜕𝑌1
= 5.45 – 2.41𝑉1 + 0.27𝑉2 – 0.00007𝑉3 − (2)(3.88)𝑉4
𝜕𝑉4
D
TE

Figure 1. Graphical representations of the second-order polynomial model that show the
variable values that maximizes the endoinulinase synthesis.
EP
CC
A

15
PT
RI
SC
U
N
A
The solution of the model, based on solving the sets of linear equations, are V1 = 7.7, V2 =
M

40, V3 = 175, and V4=0.005, which are the optimum values (pH=7.7, temperature=40°C,

agitation=175 rpm, aeration=0.005 VVM) for endo-inulinase production. This procedure


D

indicated that the optimum conditions for endo-inulinase synthesis maximization are pH
TE

7.7, 40°C temperature, 175 rpm of agitation, and 0.005 VVM of aeration level. The
EP

optimum value of pH found inside among average values present in the aguamiel, from

which the S. paradoxus was isolated, the temperature value is consistent with the semi-
CC

desert areas of Mexico, where a great diversity of agave plants grow, and the optimum

values for agitation and aeration are low because they are only required to maintain a
A

constant dissolved oxygen concentration because S. paradoxus is an obligate aerobic yeast.

Confirmation assays, using the optimal culture medium under optimal process conditions,

were performed, the results yielded 49.57 mg of total protein/L (average), which compares

16
favorably against the predicted model value (47.4 mg of total protein/L), and represent

three times more synthesized enzyme compared to those obtained at level shake flask using

the same culture medium (15.88 mg of total protein/L mg of total protein/L). These yield

results confirm the suitability of the optimization process parameters for the design of

PT
efficient processes, one of the larger obstacles associated with the enzymatic hydrolysis in

all fermentation processes.

RI
3.4 Studies of enzymatic kinetics

SC
Once the enzymatic extracts with endo-inulinase activity had been obtained, a strategy

U
experiment for agave fructans hydrolysis was performed. The exploratory assays to find an

N
adequate enzyme-substrate reaction mixture showed, in general, an increased FOS yield
A
directly proportional to the substrate concentration among the defined limits for both
M

substrate and enzyme concentration, but the solution of agave fructans with a concentration

of 80 g/L, mixed with an enzymatic extract containing 15.88 mg of total protein/L showed
D

the best FOS yield. For this initial ratio, the experimental assays to evaluate both the
TE

enzyme concentration effect, and the substrate concentration, revealed that the best ratio

enzyme-substrate that maximized FOS yield from agave fructans is 75 mL of enzymatic


EP

extract, with a content of 10.5 mg of total protein/L and 100 mL of agave fructans solution
CC

at 8% (w/v).

3.5 LC-MS analysis


A

The analysis of the hydrolyzed products, via LC-MS, showed that they contained 18% (on

average) more FOS compared to the control (natural samples), with a degree of

polymerization (DP) of preferably five to nine hexose units, and a low, and not significant,

17
content of free hexoses (Figure 2). These results confirm that the native strain S. paradoxus

preferably synthesizes inulinase with endo-inulinase activity, and an insignificant quantity

of exo-inulinase and invertase, which is another quality advantage of the enzymatic extract

because it limits the presence of free hexoses and sucrose, which is a quality requisite of the

PT
final product.

Figure 2. Mass spectrum plot that show the mass-to-charge ratio for samples without

RI
enzyme treatment (upper) and the hydrolyzed product by the enzymatic extract of S.
paraduxus (lower).

SC
U
N
A
M
D
TE
EP
CC
A

18
PT
RI
SC
U
N
A
M

4. Conclusions

The importance of this study is that it shows an alternative method of FOS production,
D

based on enzymatic hydrolysis. Steps were described for designing an overall A. fructans
TE

enzymatic hydrolysis process for FOS production. This new product may have a huge
EP

prebiotic potential as new branched FOSs, and give rise to a many new application studies

in the alimentary and pharmaceutical industries. In addition, because agaves represent an


CC

inexpensive, renewable, and abundant raw material, and the enzyme can be produced in

situ, the FOS production process developed in this study is inexpensive, and simple to scale
A

up to industrial production. The efficiency achieved up to now is low, however, and this is

a drawback/technical challenge that must be resolved. To help in this, process parameter

optimization studies, to maximize the enzymatic hydrolysis on a bioreactor level, are

needed, and to complement the global process design, which would probably increase the
19
FOS production. In this manner, the first integral approach to the design of a

biotechnological process to obtain FOS by enzymatic hydrolysis of A. fructans can be

achieved. Finally, the results confirm that native strains are the best for use in evolving

from spontaneous to directed fermentation because they are naturally adapted to realize a

PT
specific function in a specific ecosystem, so as to maintain the equilibrium. Specifically, the

results show S. paradoxus, a native strain of the fermented agave plant, to be a new

RI
producer strain of endo-inulinase, which can be used for production of agave FOSs, and

SC
probably for FOS production from inulin because it has a simpler structure.

Acknowledgements

U
The authors acknowledge the Tecnológico Nacional de México for financing the research

(5713.16-P).
N
A
Conflict of interest
M

There is no known actual or potential conflict of interest including any financial, personal
D

or other relationships with other people or organizations associated with this work.
TE

References
EP

Ávila-Fernández, A., Galicia-Lagunas, N., Rodríguez-Alegría, M.E., Olvera, C., & López-

Munguía, A. (2011). Production of functional oligosaccharides through limited acid


CC

hydrolysis of agave fructans. Food Chemistry, 129, 380-386.


A

Ausubel, F. M., Brent, R., Kingston, R.E., Moore, D. D., Seidman, J. G., Smith, J. A., &

Struhl, K. (1999). Preparation of yeast DNA. In Short Protocols in Molecular

Biology, 4th ed. Wiley, New York, 13-51.

20
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of proteindye binding. Analytical

Biochemistry, 72, 248-254.

Braz de Oliveira, A. J. B., Gonçalves, R. A. C., Chierrito, T. P. C., dosSantos, M. M., de

PT
Souza, L. M., Gorin, P. A. J., Sassaki, G. L., & Iacomini, M. (2011). Structure and

degree of polymerisation of fructooligosaccharides present in roots and leaves of

RI
Stevia rebaudiana (Bert.) Bertoni. Food Chemistry, 129, 305-311.

SC
Cadena, P. G., Jeronimo, R. A. S., Melo, J. M., Silva, R. A., Lima Filho, J. L., & Pimentel,

U
M. C. B. (2010). Covalent immobilization of invertase on polyurethane, plastfilm and

N
ferromagnetic Dacron. Bioresource Technology, 101, 1595-1602.
A
Chen, W. C., & Liu, C. H. (1996). Production of b- fructofuranosidase by Aspergillus
M

japonicus. Enzyme and Microbial Techology, 18, 153-160.


D

Cruz-Guerrero, A., Olvera, J. L., García-Garibay, M., & Gómez-Ruiz, L. (2006). Inulinase-
TE

hyperproducing strains of Kluyveromyces sp. isolated from aguamiel (Agave sap) and

pulque. World Journal of Microbiology and Biotechnology, 22, 115-117.


EP

Dominguez, A., Nobre, C., Rodrigues, L.R., Peres, A.M., Torres, D., Rocha, I., Lima, N., &
CC

Teixeira, J. (2012). New improved method for fructooligosaccharides production by

Aureobasidium pullulans. Carbohydrate Polymers, 89, 1174-1179.


A

García-Aguirre, M., Sáenz-Álvaro, V.A., Rodríguez-Soto, M.A., Vicente-Magueyal, F.J.,

Botello-Álvarez, E., Jimenez-Islas, H., Cárdenas-Manríquez, M., Rico-Martínez, R.,

& Navarrete-Bolaños, J.L. (2009). A strategy for biotechnological process design

21
applied to the enzymatic hydrolysis of agave fructo-oligosaccharides to obtain

fructose-rich syrups. Journal Agricultural and Food Chemistry, 57, 10205-10210.

Gomez, E., Tuohy, K. M., Gibson, G. R., Klinder, A., & Costabile, A. (2010). In vitro

evaluation of the fermentation properties and potential prebiotic activity of Agave

PT
fructans. Journal of Applied Microbiology, 108, 2114-2121.

RI
Huazano-García, A., & López, M. G. (2015). Agavins reverse the metabolic disorders in

overweight mice through the increment of short chain fatty acids and hormones. Food

SC
& Function, 6, 3720-3727.

U
Lappe-Oliveras, P., Moreno-Terrazas, R., Arrizón-Gaviño, J., Herrera-Suárez, T., García-
N
Mendoza, A., & Gschaedler-Mathis, A. (2008). Yeasts associated with the production
A
of Mexican alcoholic nondistilled and distilled Agave beverages. FEMS Yeast
M

Research, 8, 1037-1052.
D

Livingston, D . P. III., Hincha, D. K., & Heyer, A. G. (2009). Fructan and its relationship to
TE

abiotic stress tolerance in plants. Cellular and Molecular Life Sciences, 66, 2007-

2023.
EP

Lorenzoni, A.S., Aydos, L.F., Klein, M.P., Rodrigues, R.C., & Hertz P.F. (2014).
CC

Fructooligosaccharides synthesis by highly stable immobilized ß-fructofuranosidase

from Aspergillus aculeatus. Carbohydrate Polymers, 103, 193-197.


A

Lorenzoni, A.S.G., Aydos, L.F.., Klein, M.P., Ayub, M.A.Z., Rodrigues, R.C., & Hertz,

P.F. (2015). Continuous production of fructooligosaccharides and invert sugar

22
bychitosan immobilized enzymes: Comparison between in fluidized andpacked bed

reactors. Journal of Molecular Catalysis B: Enzymatic, 111, 51-55.

Márquez-Aguirre, A. L., Camacho-Ruiz, R. M., Arriaga-Alba, M., Padilla-Camberos, E.,

Kirchmayr, M. R., Blasco, J. L., & González-Avila, M. (2013). Effects of Agave

PT
tequilana fructans with different degree of polymerization profiles on the body

weight, blood lipids and count of fecal Lactobacilli/Bifidobacteria in obese mice.

RI
Food & Function, 4, 1237-1244.

SC
Michel-Cuello, C., Ortiz-Cerda, I., Moreno-Vilet, L., Grajales-Lagunes, G., Moscosa-

U
Santillán, M., Bonnin, J., González-Chávez, M. M., & Ruiz-Cabrera, M. (2012).

N
Study of enzymatic hydrolysis of fructans from agave salmiana characterization and
A
kinetic assessment. The Scientific World Journal, 1, 1-10.
M

Moreno-Vilet, L., Garcia-Hernandez, M. H., Delgado-Portales R. E., Corral-Fernandez,

N.E., Cortez-Espinosa, N., Ruiz-Cabrera, M.A., & Portales-Perez, D.P. (2014). In


D

vitro assessment of agave fructans (Agave salmiana) as prebioticsand immune system


TE

activators. International Journal of Biological Macromolecules, 63, 181-187.


EP

Mutanda, T., Wilhelmi, B.S., & Whiteley, C.G. (2008). Response surface methodology:
CC

Synthesis of inulooligosaccharides with an endoinulinase from Aspergillus niger.

Enzyme and Microbial Technology, 43, 362-368.


A

Mutanda, T., Mokoena, M.P., Olaniran, A.O, Wilhelmi, B.S., & Whiteley, C.G. (2014).

Microbial enzymatic production and applications of short-chain

fructooligosaccharides and inulooligosaccharides: recent advances and current

perspectives, Journal Industrial Microbiollogy and Biotechnology, 41, 893-906.

23
Navarrete-Bolaños, J.L. (2012). Improving traditional fermented beverages: How to evolve

from spontaneous to directed fermentation. Engineering in Life Sciences, 12, 410-418

Nguyen, Q. D., Rezessy-Szabó, J. M., Czukor, B., & Hoschke, A. (2011). Continuous

production of oligofructose syrup from Jerusalem artichoke juice by immobilized

PT
endo-inulinase. Process Biochemistry, 46, 298-303.

RI
Orlic, S., Redzepovic, S., Jeromel, A., Herjavec, S., & Iacumin, L. (2007). Influence of

indigenous Saccharomyces paradoxus strains on Chardonnay wine fermentation

SC
aroma. International Journal Food Science and Technology, 42, 95-101.

U
Ortiz-Basurto, R.I., Pourcelly, G., Doco, T., Williams, P., Dornier, M., & Belleville, M.P.
N
(2008). Analysis of the main components of the aguamiel produced by the maguey-
A
pulquero (Agave mapisaga) throughout the harvest period. Journal Of Agricultural
M

and Food Chemistry, 56, 3682-3687.


D

Sáchez, O., Guio, F., Garcia,G., Silva E., & Caicedo L. (2008). Fructooligosaccharides
TE

production by Aspergillus sp. N74 in a mechanically agitated airlift reactor. Food and

Bioproducts Processing. 86, 109-115.


EP

Sangeetha, P. T., Ramesh, M. N., & Prapulla, S. G. (2005). Recent trends in the production,
CC

analysis and application of Fructooligosaccharides. Trends Food Science and

Technology, 16, 442-457.


A

Santiago-García, P.A., & Lopez, M.G. (2009). Probiotic effect of agave fructans and

mixture of different degrees of polymerization from Agave angustifolia haw.

Dynamic Biochemistry, Process Biotechnology and Molecular Biology, 1, 52-58.

24
Silver, B.S. Inventor. (2006). Sweetener compositions containing fractions of inulin. U.S.

Patent 7,045,166.

Singh, R. S., & Singh, R. P. (2010). Production of fructooligosaccharides from inulin by

endoinulinases and their prebiotic potential. Food Technolology & Biotechnology, 48,

PT
435-450.

RI
Singh, R. S., Singh, R. P., & Kennedy, J. F. (2016). Recent insights in enzymatic synthesis

of fructooligasaccharides from inulin. International Journal of Biological

SC
Macromolecules, 85, 565-572.

U
Van-den-Ende, W., De Coninck, B., & Van-Laere A. (2004). Plant fructan exohydrolases: a
N
role in signaling and defense?. Trends Plant Science, 9, 523-528.
A
Vega-Paulinoa, R.J., & Zúniga-Hansena, M.E. (2012). Potential application of commercial
M

enzyme preparations for industrial production of short-chain fructooligosaccharides.


D

Journal of Molecular Catalysis B: Enzymatic, 76, 44-51.


TE

Vijn, I., & Smeekens, S. (1999). Fructan: more than a reserve carbohydrate?. Plant

physiology, 120, 351-359.


EP

Xu, Y., Zheng, Z., Xu, Q., Yong, Q., & Ouyang, J. (2016). Efficient Conversion of Inulin
CC

to Inulooligosaccharides through Endoinulinase from Aspergillus niger. Journal of

Agricultural and Food Chemistry. 64, 2612-2618.


A

Zeng, X.A., Zho, K., Liu, D.M., Brennan, CH.S., Brennan, M., Zhou, J.S., & Yu, S.J.

(2016). Preparation of fructooligosaccharides using Aspergillus niger 6640 whole-

25
cell as catalyst for bio-transformation. LWT-Food Science and Technology, 65, 1072-

1079.

PT
RI
SC
U
N
A
M
D
TE
EP
CC
A

26